Note: Descriptions are shown in the official language in which they were submitted.
1 3 3 4 1 7 5 CGNE-55
NOVEL ENHANCED PLANT PROMOTER
AND METHOD FOR USING SAME
INTRODUCTION
Field of the Invention
This invention relates to improvements in a plant promoter to
increase the level of transcription of a coding sequence regulated
thereby.
Backaround
Eukaryotic genes consist of a transcription/translation
initiation region, a coding region and a termination region. The
transcription/translation initiation region is typically located
upstream of the coding region, or in other words, entirely to the
5' terminal end of the coding region. This initiation region
includes a "promoter" region, the element responsible for inducing
transcription and "untranslated sequences" responsible for binding
to ribosomes and translation initiation. The translation-related
regions of these "upstream" regulatory sequences are sometimes
referred to as the "mRNA untranslated leader." They vary in
length and base composition from gene to gene.
The characteristics of the promoter will determine the level
and timing of transcription. A promoter typically consists of a
"TATA box" and an "upstream activating region" (sometimes referred
to herein as "UAR"). The TATA box is responsible for marking the
- t 334 1 75
initiation of transcription approximately -25 or 25 base pairs in
the 3' direction toward the start of the coding region. Through
recombinant techniques, a plant transcription/translation
initiation region can be designed to activate a nucleic acid
sequence of interest, such as a DNA sequence encoding a
heterologous or non-naturally occurring gene, in a plant host
cell. And by modifying the promoter region of a construct capable
of expression in a plant host cell, timing and the level of
expression of transcription can be controlled.
As noted above, recombinant DNA technology is now being
applied to plants. Researchers are able to modify plant genetic
material and achieve expression of proteins of interest in a plant
host cell, for example. However, it is often desired to increase
the expression of the nucleic acid sequence of interest. Higher
levels of expression may be desired to increase the level of the
desired protein in the consumer product, to have a desired
enzymatic or other effect on a plant cell biochemical pathway, to
create more anti-sense copies of an endogenous gene thereby
reducing the amount of mRNA transcript which could then be
processed by the cell, or the like. Methods to achieve increased
plant cell expression include the search for stronger promoters,
gene amplification, and use of enhancer regions to boost the
expression level of weaker promoters.
Relevant Literature
Khoury & Gruss, Cell (1983) 33:313-314, is a background
article on enhancer elements generally.
-- 1 334 1 75
Kay, ~ ~1, Science (1987) 236:1299-1302 reports the use of a
duplicated homologous promoter system (a "double" CaMV 35S
promoter) as an enhancer. Another group of researchers, Odell,
al, Plant Mol. Bio. (1988) lQ:263-272, have reported the use of a
CaMV 35S promoter fragment as an enhancer to the nopaline synthase
promoter (NOS) and reported an increase in the level of expression
of a chloramphenicol acetyltransferase (CAT) under the control of
the weak NOS promoter to the level observed in the inact CaMV 35S
promoter. Ellis, ~ ~1, E~Q (1987) 6:11-16, reports the use of
an octopine synthase (ocs) promoter fragment and also
alternatively, a CaMV 35S promoter fragment, to enhance the
promoter activity of the maize alcohol dehydrogenase gene (Adh-1)
in tobacco over the weak activity of the Adh-1 promoter alone.
The complete nucleotide sequence of the octopine Ti T-DNA,
including sequences corresponding to the mannopine synthase gene
(Open Reading Frame 24), is reported in Barker, et ~l, Plant Mol.
Bio. (1983) 2:335-350.
Other references of interest include: Odell, et ~1, Nature
(1985) 313:810-812;; DiRita & Gelvin, Mol Gen Genet (1987)
~Ql:233-241; Gelvin, et al, Mol Gen Genet (1985) 199:240-248;
Velten, et ~1, EMBO (1984) 3:2723-2730; Comai, ~ ~l, Nature
(1985) 317:741.
SU~G~RY OF THE INVENTION
Unexpectedly high levels of expression of coding sequences
can be obtained by the use of a CaMv 35S enhanced mannopine
synthase promoter in plant host cells.
3a 1 3341 75
This invention provides a DNA sequence comprising, in the
5' to 3' direction, a first element linked to a second
element, said first element comprising an upstream activating
region of CaMV 35S and said second element comprising a
mannopine synthase promoter.
This invention also provides a chimeric promoter
comprising a CaMV 35S enhanced mannopine synthase promoter,
wherein upon expression of a DNA sequence of interest in a
plant cell under the regulatory control of said promoter, said
DNA sequence of interest is expressible at a level of at least
5-fold higher than expression of said gene of interest in a
plant cell under the regulatory control of a CaMV 35S enhanced
CaMV 35 S promoter. This invention also provides the
aforementioned Chimeric promoter wherein the DNA sequence is
expressed in an in vivo plant cell.
This invention also provides a method to increase the
expression of an expressible gene of interest under the
regulatory control of a mannopine synthase promoter comprising
the steps of:
providing a CaMV 35S upstream activating region to the 5'
end of a DNA sequence comprising the mannopine synthase
promoter;
allowing said gene to be expressed. This invention also
provides the preceding method wherein the gene of interest is
expressed in a plant cell or where the gene of interest is
expressed in vivo.
- 1 334 1 75
A DNA sequence of this invention will comprise in the 5' to
3' direction, a first element linked to a second element, said
first element comprising an upstream activating region of CaMV 35S
and said second element comprising a mannopine synthase promoter.
More specifically, the first element may correspond to
approximately about a 200 bp to about 800 bp fragment of the
preferably from about nucelotide -360 to about -90 of the CaMV 35S
gene, and the second element may correspond to approximately about
325 bp to about 800 bp, for example, from about nucleotide -700 to
about +60 of the mannopine synthase gene. A shorter mannopine
synthase transcription/translation element may also be used, such
as from about nucleotide -300 to about +60 of the upstream
regulatory region of the mannopine synthase gene.
In a different embodiment, the invention is directed to a
chimeric promoter comprising a CaMV 35S enhanced manopine synthase
promoter, wherein upon expression of a DNA sequence of interest in
a plant cell under the regulatory control of the enhanced
promoter, said DNA sequence of interest is expressible at a level
of at least 5-fold higher than expression of the gene of interest
in a plant cell under the regulatory control of a CaMV35S enhanced
CaMV 35S promoter.
In yet a different embodiment, this invention relates to a
process of increasing the expression of an expressible gene of
interest under the regulatory control of a mannopine synthase
promoter by linking a CaMV 35S upstream activating region to the
5' end of a mannopine synthase promoter and allowing the gene to
be expressed.
1 334 1 75
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 is a graph showing a comparison of gus activity of
several transformants under the control of a transcription/
translation initiation region having a mas promoter, a CaMV 35S
promoter, or a double CaMV 35S promoter.
FIG. 2 represents the final construction steps of and a
plasmid map of pCGN1156.
FIG. 3 is a schematic representation of the steps used to
create pCGN7342.
FIG. 4 is a graph showing a comparison of gus activity of
several transformants under the control of transcription/
translation initiation region having a double CaMV 35S promoter, a
CaMV 35S enhanced mas promoter ("MAC"), or a double CaMV 35S
enhanced mas promoter ("Double MAC").
DETAILED DESCRIPTION OF THE INVENTION
AND PREFERRED EMBODIMENTS
By this invention, the activity of a mas transcription/
translation initiation region, and in particular, the promoter
functions of the mas transcription/translation initiation region
are synergistically enhanced by providing a CaMV 35S upstream
activating region ("UAR") to the 5' end of a mannopine synthase
("mas") transcription/translation initiation region. Because the
UAR of the CaMV 35S enhances the promoter functions of the mas
transcript/translation initiation region, the resulting DNA
sequences are considered to result in an "enhanced mas promoter."
1 334 1 75
The enhanced mas promoter of this invention may also be referred
to as a "MAC" promoter herein, for convenience.
The term "transcription/translation initiation region of
mannopine synthase" as used herein refers to sequences comparable
to the DNA sequences responsible for initiating transcription and
effecting translation of the mannopine synthase structural gene
derived from the TR-DNA of the octopine Ti plasmid. A DNA
sequence comprising the complete transcription/translation
initiation region of the mannopine synthase (also sometimes
referred herein as "mas") gene corresponds to those DNA sequences
found approximately from about -700 base-pairs upstream of the
start codon of the mannopine synthase structural gene to about +60
base-pairs downstream of the start codon of the mannopine synthase
structural gene, approximately about 760 base pairs. Fragments of
the mas transcription/translation initiation region may also be
used as long as the sequence is capable of effecting efficient
transcription and translation of a coding sequence under its
regulatory control. For example, a sequence from about -300 to
about +60 of this initiation region is acceptable.
The term "mannopine synthase promoter" as used herein refers
to DNA sequences, or elements, comparable to the sequences
responsible for inducing transcription of mannopine synthase.
Thus, by definition, the mas promoter region is included within
the transcript/translation initiation regions of the mas gene.
The term "upstream activating region of CaMV 35S" herein
refers to DNA sequences comparable to the CaMV 35S promoter
region, absent the TATA box, i.e., the upstream activating region
1 334 1 75
("UAR") of CaMV 35S. Preferably, the 3' end of the UAR is no
greater than from about nucleotide -25. More preferred is a 3'
end of no greater than from about nucleotide -45, and most
preferred is a 3' end of no greater than about nucleotide -90.
Extending in the 5' direction, a terminus at about nucleotide -168
is preferred. A more preferred embodiment includes up to about
nucleotide -360 at the 5' terminus.
Without the enhancing element of the CaMV 35S UAR as provided
by this invention, the mas promoter is a weak promoter. The mas
promoter is reported to initiate transcription of heterologous
genes in plants at levels below those obtained with a CaMV 35S
promoter. Data comparing the activity of the mas promoter to a
gus/mas3' construct having a CaMV 35S promoter or a double 35S
promoter is shown in Fig. 1. The mas promoter has been found to
show expression in all plant tissues but at different levels. It
is most highly expressed in apical shoots and roots and precambium
tissue. In addition, there is evidence which suggests that the
mas promoter is wound-inducible, causing increased expression in
leaves wounded by insect chewing, for example.
Surprisingly, it has been discovered that the MAC promoter
can induce the expression of a gene to levels of about 5-fold, and
up to approximately ten-fold, higher than the relating strong
double CaMV 35S promoter. This finding was unexpected and novel.
It indicates that the elements from the CaMV 35S and mas promoters
have a synergistic effect which could not be predicted. The MAC
promoter will thus be useful in a number of applications where
1 3 3 4 1 7 5
high levels of expression are desired. It may find particular
application in rapidly dividing tissues or wounded-tissues.
The upstream activating region of CaMV 35S and the mannopine
synthase promoter may be linked together according to conventional
means to provide the MAC promoter herein. It is preferred that the
UAR CaMV 35S element and the mannopine synthase promoter element
are located in close proximity to one another. Most preferred is
a ligation joining the two elements as directly as possible i.e.,
with as few intervening DNA sequences as possible. It is
preferred that the mannopine synthase promoter element is provided
within the translation/transcription initiation region of
mannopine synthase, i.e., it is preferred that the CaMV35S UAR is
linked to the transcription/translation initiation region of
mannopine synthase. When the mannopine synthase promoter is
provided with the translation/transcription initiation region of
mannopine synthase the mannopine synthase mRNA untranslated region
will be provided.
An expression cassette of this invention, will comprise, in
the 5' to 3' direction, the MAC promoter, in reading frame, one or
more nucleic acid sequences of interest followed by a transcript
termination region. The expression cassette may be used in a
variety of ways, including for example, insertion into a plant
cell for the expression of the nucleic acid sequence of interest.
The particular methods used to transform such plant cells is not
critical to this invention, nor are subsequence steps, such as
regeneration of such plant cells, as necessary. Any method or
combination of methods resulting in the expression of the desired
1 3 3 4 1 75
sequence or sequences under the control of the MAC promoter is
acceptable.
At the 3' terminus of the structural gene will be provided a
termination region which is function in plants. A wide variety of
termination regions are available that may be obtained from genes
capable of expression in plant hosts, e.g., bacterial, opine,
viral, and plant genes. Suitable transcript termination regions
include termination regions known to those skilled in the art,
such as the nos 3', tml 3', or acp 3', for example. It is
preferred that a mannopine synthase gene transcript termination
region (mas 3') be used in conjunction with the MAC promoter.
In preparing the constructs of this invention, the various
DNA fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed for joining the DNA fragments or other manipulations may
be involved to provide for convenient restriction sites, removal
of superfluous DNA, removal of restriction sites, or the like.
For this purpose, Ln vitro mutagenesis, primer repair,
restriction, annealing, resection, ligation, or the like may be
employed, where insertions, deletions or substitutions, e.g.,
transitions and transversions, may be involved.
By appropriate manipulations, such as restriction, chewing
back or filling in overhangs to provide blunt ends, ligation of
linkers, or the like, complementary ends of the fragments can be
provided for joining and ligation.
1 334 1 75
It is contemplated that sequences corresponding to the above
noted sequences may contain one or more modifications in the
sequences from the wild-type but will still render the respective
elements comparable with respect to the teachings of this
invention. For example, as noted above, fragments may be used,
different codons or groups of codons may be modified, added or
deleted in keeping with the instant invention. The sequences
themselves may be a composite of segments derived from a plurality
of sources, naturally occurring or synthetic.
In carrying out the various steps, cloning is employed, so as
to amplify the amount of DNA and to allow for analyzing the DNA to
ensure that the operations have occurred in a proper manner. A
wide variety of cloning vectors are available, where the cloning
vector includes a replication system functional in F. coli and a
marker which allows for selection of the transformed cells.
Illustrative vectors include pBR332, pUC series, M13mp series,
pACYC184, etc. Thus, the sequence may be inserted into the vector
at an appropriate restriction site (s), the resulting plasmid used
to transform the E. coli host, the E. Ç~li grown in an appropriate
nutrient medium and the cells harvested and lysed and the plasmid
recovered. Analysis may involve sequence analysis, restriction
analysis, electrophoresis, or the like. After each manipulation
the DNA sequence to be used in the final construct may bé
restricted and joined to the next sequence, where each of the
partial constructs may be cloned in the same or different
plasmids.
1 3 3 4 1 75
In additlon to the transcrlptlon construct, dependlng upon
the manner of lntroductlon of the transcription construct lnto the
plant, other DNA sequences may be requlred. For example, when
uslng the Tl- or Ri-plasmid for tran~formation of plant cells, as
described below, at lea~t the right border and frequently both the
right and left borders of the T-DNA of the Tl- and Rl-plasmids
will be ~oined as flanking region~ to the tran~cription construct.
The use of T-DNA for transformatlon of plant cells has recelved
extensive study and $s amply described in EPA Serial No. 120,516,*
Hoekema, In: The Blnary Plant Vector System Off~et-drukkeri~
Kanters B.V., Alblasserdam, 1985, Chapter V, Fraley, ~ ~l., rit
~ev. Plant Sci., ~:1-46, and An ~ ~l., Ft~BO J (1985) 4:277-284.
Alternatively, to enhance lntegratlon lnto the plant genome,
terminal repeats of transposons may be used as borders ln
con~unctlon with a transpoase. In this situatlon, expresslon of
the transposase -~hould be lnduclble, or the transposase
lnactivated, ~o that once the tran~crlption construct is
integrated into the genome, it should be relatively stably
integrated and avoid hopping. -
The transcription con~truct will normally be ~oined to amarker for selection in plant cells. Convenlently, the marker may
be resi-~tance to a biocide, particularly an antibiotic, such as
kanamycin, G418, bleomycin, hygromycin, chloramphenicol, or the
llke. The partlcùlar marker employed will be one which wlll allow
for selection of transformed cells a~ compared to cells lacking
the DNA whlc~ as been lntroduced.
* Published October 3, 1984 11
1 3341 75
Examples of some methods known in the art for transformation
of plant cells include transformation via Agrobacterium
tumefaciens, electroporation, microinjection, and bombardment with
DNA coated particles. Examples of DNA sequences of which high
level expression may be desired include mutated aroA genes which
provide glyphosate herbicide resistance, nitrilase genes which
provide bromoxynil resistance, heat shock proteins, anti-sense DNA
sequences to reduce the level of an endogenous protein and the
like.
Various plants or plant cell cultures may be used. Plant
cell cultures may be desirable as model test systems or for the
efficient production of various products. Examples of plants and
plant cells which may be used include tobacco, tomato, cotton,
rapeseed, soybean, maize, wheat, rice, alfalfa, potato, as
representative examples.
By this invention, it is also anticipated that a "double"
CaMV 35S UAR may be used to enhance the mas promoter. Thus, in
the 5' to 3' direction would be found a first CaMV 35S UAR element
linked to a second CaMV 35S UAR element, linked to a DNA sequence
comprising the mas promoter. A mas promoter enhanced by a "double
CaMV 35S UAR" may be used in the same manner as described with
respect to the MAC promoter. Tests indicate that the double CaMV
35S UAR enhanced mas ("Double MAC") also provides up to about ten-
fold increases in expression over a double CaMV 35S promoter.
The following examples are offered by way of illustration and
not by way of limitation.
1 334 t 75
EXPERIMENTAL
Construction of Plasmids
1. UAR CaMV 35S/Mas Promoter
A ~lII digested 1178 bp fragment containing the 5' promoter
region of the CaMV 35S genome (nucleotides 6492 to 7670 as
published by Gardner, et al., Nuclic Acids Res. (1981) 9: 2871-
2888) is cloned into the ~mHl site of pUC19 (Norrander, et ~l,
Gene (1983) 26: 101-106), resulting in pCGN1154A. pCGN1154A is
digested with E~QRV and ~I, deleting the TATA box containing
region of the CaMV 35S, and in its place, a fragment containing
the TATA box and about 300 bp of the 5' upstream region of the mas
transcript/translation regulatory region (specifically,
nucleotides 20495 to 20128 as published by Gelvin, supra) is
inserted. FIG. 2. The resulting plasmid, pCGN1156, contains
the hybrid UAR of CaMV 35S/mas promoter (the "MAC"). This plasmid
is digested with SmaI for insertion of an ~hQI linker, resulting
in pCGN1156~
pCGN7000 is digested with ~I and ~I and the resulting
fragment containing the gus gene and the mas 3' is inserted into
I digested pCGN1156-~hQI.
Ex~ression Construct
pCGN7000 is prepared from ~mHI, SacI digested pCGN1052 and
pBI221.1 (Jefferson, R.A., Plant Mol.Bio.Rep (1987)5:387-405.
The BamHI, SacI fragment containing the beta glucuronidase gene is
excised from pBI221.1 and inserted into pCGN1052, resulting in
1 334 1 75
pCGN7000. pCGN1052 is an expression plasmid containing the 5'
and the 3' region of the mas gene, separated by a polylinker. 5'
TCTAGAGGATCCCGGGTACCGAGCTCGAATTC 3'. pCGN7000 is then digested
with ~I and ~I, and fragment containing the gus gene and the
mas 3' inserted into ~I and ~I digested pCGN1156-Xho
resulting in p"code 7-004". This plasmid contains a MAC 5'-gus-
mas 3' chimeric gene flanked by Xhol sites.
The next steps are designed to add PstI and ~lII sites to an
~hQI fragment. pCGN566 contains the E~QRI-~in~III linker of
pUC18 (Yanish-Perron, ~ al., Gene (1985) 53: 103-119) inserted
into the EcoRI-~in~III sites of pUC13-cm (K. Buckley, Ph.D.
Thesis, UC San Deigo 1985) is digested with HindIII and E~QRl and
thereafter inserting a synthetic oligonucleotide having the region
5' AAGCTTAGATCTCTGCAGCTCGAGCTGCAGAGATCTGAATTC 3' making a
polylinker (having the following sites: ~in~III, ~51II,
~hQI, ~I, BglII and EcoRI) to create pCGN7329.
The MAC-gus-mas gene of ~hQI digested p7-004 is inserted
into ~hQI digested pCGN7329 creating pCGN7334. This construct
is digested with ~I and the MAC-gus-mas gene inserted into the
~I site of the binary vector pCGN1540 (described below)
resulting in pCGN7342. FIG. 3.
Binary Vector pCGN1540
pCGN1540 is a binary plant transformation vector containing
the left and right T-DNA borders of Agrobacterium tumefaciens
octopine Ti-plasmid pTiA6 (Currier and Nester, J. Bact. (1976)
126:157-165), the gentamycin resistance gene of pHiJI (Hirsch and
Beringer, Plasmid (1984) 12:139-141), an agrobacterium rhizogenes
14
1 334 1 75
Ri plasmid origin of replication from pLJB11 (Jouanin et al., ~
Gen. Genet. (1985) 201:370-374), the mas promoter region a mas 3'
region of pTiA6 with the kanamycin resistance gene of Tn5
(Jorgensen et al., Mol. Gen. Genet. (1979) 177:65) a ColE1 origin
of replication from pBR322 (Bolivar et al., Gene (1977) 2:95-133),
and a lacZ' screenable marker gene from pUC18 (Norrander et al.,
Gene (1983) 26:101-106). The backbone of pCGN1540, containing the
gentamycin resistance gene and the Ri and ColE1 origins, is
derived from pCGN 1532 (see below). The Ti borders and plant
selectable marker gene (mas 5'-kan-mas3'), are from pCGN1537; the
plant selectable marker cassette is in turn taken from pCGN1536,
while the right border and the lacZ' fragments are derived from
pCGN565RBx2X, and the left border derived from pCGN65.
A. pCGN1532 construction.
The 3.5kb E~QRI-~I fragment containing the gentamycin
resistance gene is removed from pPhlJI (Hirsch and Beringer,
Plasmid (1984) 12:139-141) by EcoRI-PstI digestion and cloned into
EcoRI-PstI digested pUC9 (Vieira and Messing, Gene (1982) 19:259-
268) to generate pCGN549. ~in~ pstI digestion of pCGN549
yields a 3.1 kb fragment bearing the gentamycin resistance gene,
which is made blunt ended by the Klenow fragment of DNA polymerase
I and cloned into ~y~II digested pBR322 (Bolivar et al., Gene
(1977) 2:95-113) to create pBR322GM. pBR322Gm was digested is
DraI and SphI, treated with Klenow enzyme to create blunt ends,
and the 2.8 kb fragment cloned into the Ri origin containing
plasmid pLJbB11 (Jouanin et al., Mol. Gen. Genet. (1985) 201:370-
374) which has been digested with ~I and made blunt ended with
1 3 3 4 1 75
Klenow enzyme, creating pLHbBllGm. The extra ColE1 origin and the
kanamycin resistance gene are deleted from pLJvBllGM by digestion
with ~mHI followed by self closure to create pGMB11. The ~in~II
site of pGmB11 is deleted by ~in~II digestion followed by
treatment with Klenow enzyme and self closure, creating pGmB11-H.
The PstI site of pGmB11-H is deleted by ~I digestion followed by
treatment with Klenow enzyme and self closure, creating pCGN1532.
B. pCGN1536 construction.
The 5.4 kb E~QRI fragment is removed from pVK232 (Knauf
and Nester, Plasmid (1982)8:45), by EcoRI digestion and cloned
into E~QRI digested pACYC184 (Chang and Cohen, J. Bacteriol.
(1978) 134:1141-1156) to create pCGN14. The 1434 bp ClaI-SphI
fragment of pCGN14, containing the mas 5' region (bp20128-21562
according to numbering of (Barker et al., Plant Mo. Biol. (1983)
2:335-350) is cloned into ~ hI digested pUC19 (Yanisch-Perron
et al., Gene (1985) 53:103-119) to generate pCGN50. A 746 bp
RV-~I fragment of the mas 5' region is replaced by an ~hQI
site by digesting pCGN40 with E~QRV and ~I followed by ligation
in the presence of a synthetic ~hQI linker DNA to create pCGN1036.
The 765 bp SstI-HindIII fragment (bp 18474-19239) of pCGN14,
containing the mas 3' region, is cloned into ~ in~III digested
pUC18 (Norrander et al., Gene (1983) 26:101-106) to yield pCGN43.
The HindIII site of pCGN43 is replaced with an EcoRI site by
digestion with ~in~III, blunt ending with Klenow enzyme, and
ligation of synthetic E~QRI linker DNA to create pCGN1034. The
767 bp EcoRI fragment of pCGN1034 is cloned into EçQRI-digested
pCGN1036 in the orientation that places bp 19239 of the mas 3'
16
- 1 334 1 75
region proximal to the mas 5' region to create pCGN1040. pCGN1040
is subjected to partial digestion with SstI, treated with T4 DNA
polymerase to create blunt ends, and ligated in the presence of
synthetic XhoI linker DNA; a clone is selected in which only the
~I site at the junction of bp 18474 and vector DNA (constructed
in pCGN43 and carried into pCGN1040) is replaced by an ~hQI site
to generate pCGN1047.
pCGN565 (a cloning vector containing vector based upon pUC8-
cm but containing pUC18 linkers) is digested with EcoRI and
Ein~III, treated with Klenow enzyme to create blunt ends, and
ligated in the presence of synthetic ~hQI linker DNA to create
pCGN1003; this recreates the E~QRI site adjacent to the ~hQI
linker. pCGN1003 is digested with EcoRI, treated with Klenow
enzyme to create blunt ends, and ligated in the presence of
synthetic PstI linker DNA to create pCGN1007. The 1.5kb ~hQI
fragment of pCGN1047, containing the mas 5' region and the mas 3'
region with a multiple cloning site between, is cloned into ~hQI
digested pCGN1007 to construct pCGN1052. A portion of the
multiple cloning site of pCGN1052 is deleted by digestion with
~I and ~I, treated with Klenow enzyme to make blunt ends, and
ligated to generate pCGN1052~XS.
The 1 kb EcoRI-SmaI fragment of pCGN550 (pCGN783 is a binary
plasmid containing the left and right T-DNA borders of A.
tumefaciens (Barker et al., Plant Mol. Biol. (1983) 2:335-350);
the gentamicin resistance gene of pPHlJI (Hirsch et al., Plasmid
(1984), 9:2871-2890), the kanamycin resistance gene of Tn5
(Jorgenson et al, infra and Wolff et al., ibid (1985) 13:355-367)
1 334 1 75
-
and the 3' region from transcript 7 of pTiA6 (Barker et al., supra
(1983)), containing the 1 ATG-kanamycin resistance gene, is cloned
into E~QRI-~m~I digested Bluescript M13-KS (Strategene, Inc., CA)
to create pBSKm; this plasmid contained an M13 region allowing
generation of single stranded DNA. Single stranded DNA id
generated according to the supplier's recommendations, and in
vitro mutagenesis 9d performed (Adelman et al., DNA (1983) 2:183-
193) using a synthetic oligonucleotide with the sequence
5'GAACTCCAGGACGAGGC3' to alter a PstI site with the kanamycin
resistance gene and make it undigestable, creating pCGN1534.
pCGN1534 is digested with ~m~I and ligated in the presence of
synthetic EcoRI linker DNA to generate pCGN1535.
The 1 kb EcoRI fragment of pCGN1536 is cloned into E~RI
digested pCGN1052~aXS to create the mas5'-kan mas3' plant
selectable marker cassette pCGN1536.
C. pCGN565RAx2X construction.
pCGN451 (pCGN451 includes an octopine cassette which
contains about 1556 bp of the 5' non-coding region fused via an
E~RI linker to the 3' non-coding region of the octopine synthase
gene of pTiA6. The pTi coordinates are 11,207 to 12,823 for the
3' region and 13,643 to 15.208 for the 5' region as defined by
Barker et al., Plant Mol. Biol. (1983) 2:325) is digested with
~I and ligated in the presence of synthetic ~hI linker DNA to
generate pCGN55. The ~hQI-~hI fragment of pCGN55 (bpl3800-15208,
including the right border, of Agrobacterium tumefaciens T-DNA;
(Barker et al., ~n~ (1977) 2:95-113) is cloned into ~lI-~PhI
digested pUC19 (Yanisch-Perron et al., Gene (1985) 53:103-119) to
18
1 334 1 75
,
create pCGN60. The 1.4 kb ~in~ HI fragment of pCGN60 is
cloned into ~in~III-~_HI digested pSP64 (Promega, Inc.) to
generate pCGN1039. pCGN1039 was digested with ~m~I and ~L~I
(deleting bpl4273-15208; (Barker et al., Gene (1977) 2:95-113) and
ligated in the presence of synthetic BglII linker DNA creating
pCGN1039~NS. The 0.47 kb EcoRI-~in~III fragment of pCGN1039~NS is
cloned into EcoRI-~ln~III digested pCGN565 to create pCGN565RB.
The ~in~III site of pCGN565RB is replaced with an ~hQI site by
~in~III digestion, treated with Klenow enzyme, and ligated in the
presence of synthetic ~hQI linker DNA to create pCGN565RB-H+X.
pUC18 (Norrander et al., Gene (1983) 26:101-106) is digested
with ~II to release the lacZ' fragment, treated with Klenow
enzyme to create blunt ends, and the lacZ'-containing fragment
ligated into pCGN565RB-H+X, which had been digested with ~I and
~hI and treated with Klenow enzyme in such a orientation that the
lacZ' promoter is proximal to the right border fragment; this
construct, pCGN565RBx2x is positive for lacZ' expression when
plated on an appropriate host and contained bp 13990-14273 of the
right border fragment (Barker et al., Pl~nt Mo. Biol. (1983)
2:335-350) having deleted the a~I-~hI fragment (bp 13800-13990).
D. pCGN65 construction.
pCGN501 is constructed by cloning a 1.85 kb E~QRI-~hQI
fragment of pTiA6 (Currier and Nester, J. Bact. (1976) 126:157-
165) containing bases 13362-15208 (Barker et al., Plant Mo. Biol.
(1983) 2:335-350) of the T-DNA (right border), into EÇQRI-
~digested M13mp9 (Vieira and Messing, Gene (1982) 19:259-268).
pCGN502 was constructed by cloning a 1.6 kb ~in~III-SmaI fragment
19
- 1 3341 75
of pTiA6, containing bases 602-2212 of the T-DNA (left border),
into HindIII-~m~I digested M13mp9. pCGN501 and pCGN502 are both
digested with E~QRI and ~ln~III and both T-DNA-containing
fragments cloned together into ~in~III digested pUC9 (Vieira and
Messing, Gene (1982) 19:259-268) to yield pCGN503, containing both
T-DNA border fragments. pCGN503 is digested with ~in~III and
E~QRI and the two resulting HindIII-EcoRI fragments (containing
the T-DNA borders) are cloned into EcoRI digested pHC79 (Hohn and
Collins, Gene (1980) 11:291-298) to generate pCGN518. The KpnI-
EcoRI fragment from pCGN518, containing the left T-DNA border, is
cloned into ~nI-~QRI digested pCGN565 to generate pCGN580. The
~mHII-~lII fragment of pCGN580 is cloned into the ~mHI site of
pACYC184 (Chang and Cohen, J. Bacteriol. (1978) 134:1141-1156) to
create pCGN51. The 1.4 kb ~mHI-~hI fragment of pCGN60 (Plasmid
pCGN451 (Comai et al., supra) contains the T-DNA right border.
The ~I site between the ocs gene and the right border is cut and
a ~hI linker is inserted resulting in pCGN55. The right border
is excised as an ~hQI to ~hI fragment and cloned into SphI and
~lI digested pUC19, giving pCGN60) containing the T-DNA right
border fragment, is cloned into ~_HI-~hI digested pCGN51 to
create pCGN65.
E. pCGN1537 construction.
pCGN65 is digested with ~nI and XbaI, treated with
Klenow enzyme to create blunt ends, and ligated in the presence of
synthetic ~lII linker DNA to create pCGN65~KX. pCGN65~KX is
digested with ~lI, treated with Klenow enzyme to create blunt
ends, and ligated in the presence of synthetic ~hQI linker DNA to
1 334 1 75
-
create pCGN65~KX-S+X. The 728 bp ~51II-~hQI fragment of
pCGNRBx2X, containing the T-DNA right border piece and the lacZ'
gene, was cloned into ~lII-~hQI digested pCGN65~KX-S+X, replacing
pCGN65x2X. The ClaI fragment pCGN65x2X is deleted and replaced
with an ~hQI linker by digesting with Çl~I, treating with Klenow
enzyme to create blunt ends, and ligating the presence of
synthetic ~hQI linker DNA to create pCGN65~2XX.
pCGN65~2XX is digested with_~lII and fused with ~lII
digested pCGN549 the gentamicin resistance gene is isolated from a
3.lkb EcoRI-~I fragment of pPHIJI, Hirsch et al., Plasmid (1984)
12:139-141 and cloned into pUC9, Vieira et al., Gene (1982)
19:259-268, yielding pCGN549) to create pCGN1530 which contains
both plasmid backbones. pCGN1530 is digested with ~hQI and
religated, then a gentamycin-resistant cholramphenicol-sensitive
clone is chosen which has deleted the pACYC184-derived backbone,
creating pCGN1530A. The 2.43 kb ~hQI fragment of pCGN1536,
containing the mas5'-kan-mas3' cassette, is cloned into ~hQI
digested pCGN1530A to create pCGN1537.
F. Final assembly of pCGN1540.
The BglII fragment of pCGN1537, containing the plant
selectable marker gene and the lacZ' screenable marker gene (with
multiple cloning site), all between the T-DNA borders, is cloned
into ~mHI digested pCGN1532. A clone of the orientation bearing
the T-DNA right border adjacent to the Ri plasmid origin of
replication is designated pCGN1540. This binary vector has
several advantageous features, including a minimal amount of DNA
between the T-DNA borders, high stability in Agrobacterium hosts,
-- 1 3 3 4 1 7 5
high copy number in E. coli hosts, and a blue/white screen with
multiple restriction enzyme sites for ease of cloning target DNA.
The plasmid pCGN1540 has been deposited with ATCC (Rockville,
MD), accession number 40586, dated March 21, 1989.
2. Double UAR CaMV 35S/Ma~ Promoter
pCGN2113 (see below) is digested with ~in~III and SalI. The
cohesive ends are blunted by mung bean nuclease and ~hQI linkers
5' CCTCGAGG 3' are inserted into the blunt ends to create an ~hQI
site The resulting construct, pCGN7300, is digested and
religated with ~I after removal of a EcoRV restriction site
situated between flanking ~I sites creating pCGN7300~E~QRV.
pCGN7000, described above, is digested with E~I and PstI to
provide a fragment containing a trucated mas region (300 bp with
TATA box), a gene encoding ~-glucornidase (GUS) and a termination
region (mas 3'). pCGN7300~EcoRV is digested with EcoRV and
~I. to provide a fragment containing approx. 800-850 bp of the
upstream region with the double enhancer of CaMV 35S promoter and
approx. 150 bp of the tml' region. The E~I-~I fragment of
pCGN7000 and the EÇQRV-Pst fragment of pCGN7300~EcoRV are ligated
to create pO04B-1 having approximately 300 bp of the mas
transcript/translation regulatory region and an upstream region
having a double enhancer region from 35 CaMV (the "Double Mac").
pO04B-1 is digested with ~hQI and ligated to ~hQI site of
pCGN7329, described above, to create pCGN7336. After digestion
with EstI, the fragment having the Double MAC-gus-mas3' sequences
1 3 3 4 1 7 5
is inserted into the ~I site of the binary vector pCGN1540,
described above.
Construction of pCGN2113
pCGN2113 contains a double-35S promoter and the tml-3'
region with multiple cloning sites between them, contained in a
pUC-derived plasmid backbone bearing a ampecillin resistance gene;
the promoter/a tml cassette is bordered by multiple restriction
sites for easy removal. pCGN2113 is derived from pCGN986,
pCGN164, and pCGN638.
1. Construction of pCGN986. pCGN986 contains a cauliflower
mosaic virus 35S (CaMV35) promoter and a T-DNA tml 3'-region with
multiple restriction sites between them. pCGN986 is derived from
another cassette, pCGN206, containing a CaMV35S promoter and a
different 3' region, the CaMV region VI 3'-end. The CaMV 35S
promoter is cloned as an AluI fragment (bp 7114-7734) (Gardner
et.al., Nucl. Acids Res. (1981) 9:2871-2888) into the HincII site
of M13mp7 (Messing et. al., Nucl. Acids Res. (1981) 9:309-321) to
create C614. An EcoRI digest of C614 produces the ~QRI fragment
from C614 containing the 35S promoter which is cloned into the
EcoRI site of pUC8 (Viera and Messing, Gene (1982) 19:259) to
produce pCGN147.
pCGN148a containing a promoter region, selectable marker (KAN
with 2 ATG's) and 3' region, is prepared by digesting pCGN528 with
BalII and inserting the BamHI-BglII promoter fragment from
pCGN147. This fragment is cloned into the BglII site of pCGN528
so that the ~LII site is proximal to the kanamycin gene of
pCGN528.
- 1 334 1 75
The shuttle vector used for this construct, pCGN528, is made
as follows: pCGN525 is made by digesting a plasmid containing Tn5
which harbors a kanamycin gene (Jorgenson et. al., Mol. Gen.
Genet. (1979) 177:65) with ~in~ BamHI and inserting the
~in~ HI fragment containing the kanamycin gene into the
~in~ BamHI sites in the tetracycline gene of pACYC184 (Chang
and Cohen, J. Bacteriol. (1978) 134:1141-1156). pCGN526 is made
by inserting the ~mHI fragment 19 of pTiA6 (Thomashow et. al.,
Cell (1980) 19:729-739), modified with ~hQI linkers inserted into
the SmaI site, into the BamHI site of pCGN525. pCGN528 is
obtained by deleting the small ~hQI fragment from pCGN526 by
digesting with ~hQI and religating.
pCGN149a is made by cloning the BamHI-kanamycin gene fragment
from pMB9KanXXI into the ~mHI site of pCGN148a. pMBG9KanXXI is a
pUC4K variant (Vieira and Messing, Gene (1982) 19:259-268) which
has the XhoI site missing, but contains a functional kanamycin
gene from Tn903 to allow for efficient selection in Agrobacterium.
pCGN149a is digested with ~in~III and BamHI and ligated to
pUC8 digested with ~in~III and BamHI to produce pCGN169. This
removed the Tn903 kanamycin marker. pCGN565 (see above) and
pCGN169 are both digested with ~ln~III and Pstl and ligated to
form pCGN203, a plasmid containing the CaMV 35S promoter and part
of the 5'-end of the TN5 kanamycin gene (up to the ~l site,
Jorgenson et al., (1979), supra). A 3'-regulatory region is added
to pCGN203 from pCGN204 (an EcoRI fragment of CaMV (bp 408-6105)
containing the region VI 3' cloned into pUC18 (Gardner et. al.,
(1981) supra) by digestion with ~in~III and ~1 and ligation.
24
~ 334 t 75
-
The resulting cassette, pCGN206, is the basis for the construction
of pCGN986.
The pTiA6 T-DNA tml 3'-sequences are subcloned from the ~ml9
T-DNA fragment (Thomashow et al., (1980), supra) as a ~_HI-EcoRI
fragment (nucleotides 9062 to 12,823, numbering as in Barker et.
al., Plant Mol. Biol. (1982) 2:335-350) and combined with the
pACYC184 (Chang and Cohen (1978), supra) origin of replication as
an E~QRI-~in~III fragment and a gentamycin resistance maker (from
plasmid pLB41,obtained from D. Figurski) as a ~mHI-~in~III
fragment to produce pCGN417.
The unique ~m~I site of pCGN417 (nucleotide 11,207 of the
Baml9 fragment) is changed to a ~I site using linkers and the
~_HI-~I fragment is subcloned into pCGN565 to give pCGN971.
The ~mHI site of pCGN971 is changed to an EcoRI site using
linkers and created pCGN971E. The resulting E~QRI-~I fragment
containing the tml 3' regulatory sequences is joined to pCGN206 by
digestion with E~RI and ~I to give pCGN975. The small part of
the Tn5 kanamycin resistance gene is deleted from the 3'-end of
the CaMV 35S promoter by digestion with ~lI and ~51II, blunting
the ends and ligation with SalI linkers. The final expression
cassette, pCGN986, contains the CaMV 35S promoter followed by two
SalI sites, and ~I site, ~mHI, ~m~I, KpnI and the tml 3' region
(nucletodies 11207-9023 of the T-DNA).
2. Construction of pCGN164. The ~l~I fragment of CaMV (bp
7144-7735) (Gardner et al., Nucl. Acids Res. (1981) 9:2871-2888)
is obtained by digestion with AluI and cloned in to the HincII
site of M13mp7 (Vieira et al., Gene (1982) 19:259) to create C614.
- I 334 1 75
An E~QRI digest of C614 produced the E~QRI fragment from C614
containing the 35S promoter which is cloned into the E~QRI site of
pUC8 (Vieira et al., (1982) ibid) to produce pCGN146. To trim the
promoter region, the ~lII site (bp7670) is treated with BglII and
~131 and subsequently a ~lII linker was attached to the ~131
treated DNA to produce pCGN147. pCGN147 is digested with EcoRI
and ~hI and the resultant EcoRI-~hI fragment containing the 35S
promoter is ligated into E~RI-~m~I digested M13mp8 to create
pCGN164.
3. Construction of pCGN638. Digestion of CaMV10 (Gardner
et al., (1981) supra) with ~lII produces a ~lII fragment
containing a 35S promoter region (bp 6493-7670) which is ligated
into the ~mHI site of pUCl9 (Norrander et al., Gene (1983)
26:101-106) to create pCGN638.
4. Construction of pCGN2113. pCGN164 is digested with
EcoRV and ~mHI to release a E~QRV-E~mHI fragment which contains a
portion of the 35S promoter (bp 7340-7433); pCGN638 is digested
with ~indIII and E~QRV to release a HindIII-EcoRV fragment
containing a different portion of the 35S promoter (bp 6493-7340).
These two fragments are ligated into pCGN986 which has been
digested with Ein~III and BamHI to remove the Ein~III-BamHI
fragment containing the 35S-promoter; this ligation produced
pCGN639, which contains the backbone and tml-3' region from
pCGN986 and the two 35S promoter fragments from pCGN164 and
pCGN638. pCGN638 is digested with EcoRV and DdeI to release a
fragment of the 35S promoter (bp 7070-7340); the fragment is
treated with the Klenow fragment of DNA polymerase I to create
26
~ 1 334 1 75
blunt ends, and is ligated into the E~QRV site of pCGN639 to
produce pCGN2113 having the fragment in the proper orientation.
The plasmid pCGN2113 has been deposited with the ATCC
(Rockville, MD) accession number 40587, dated March 2, 1989.
3 Com~arative Study/Double 35S CaMV
.
For comparison, a double CaMV 35S promoter is prepared having
the gus reporter gene with the mas 3' end which is spliced into
the binary vector pCGN1540. The double 35S promoter is a 1.2 kb
fragment obtained from pCGN2113 having nucleotide sequences -941
to -90, joined to a sequences -363 to -90 and -90 to -2 of the
CaMV 35S promoter region.
Generation of Transgenic Plants
1. Tomato
Sterile tomato cotyledon tissue is obtained from 7-8 day old
seedlings which are grown at 24 C, with a 16hr/ 8hr day/ night
cycle in 100 x 25mm petri dishes containing MSSV medium:
Murashige-Skoog~MS) salts (#1117 Gibco Laboratories, New York),
sucrose 30 g/l, Nitsch vitamins (Thomas, B.R., and Pratt, D.
Appl. Genet. (1981) 59:215-219), 0.8% agar (pH 6.0). Any tomato
species may be used, however, the inbred breeding line UC82B
(Department of Vegetable Crops, University of California, Davis)
is preferred. The tips and bases of the cotelydons are removed
and the center section placed onto a feeder plate for a 24-hour
preincubation period in low light at 24 C.
27
1 334 1 75
-
The feeder plates are prepared by pipetting 0.5 ml of an
eight day old suspension of Nicotiana tabacum cv xanthi cell
suspension culture (~106 cells/ml) onto 0.8% agar medium,
containing MS salts, myo-inositol (100 mg/l), thiamine-HCL (1.3
mg/l), sucrose (30 g/l), potassium acid phosphate (200 mg/l)
2,4-D (0.2 mg/l), and kinetin (0.1 mg/l) (pH 5.5). The feeder
plates are prepared one day prior to use. A #1 Whatman sterile
filter paper(Whatman Ltd Maidstone, England) is placed on top of
the tobacco cells after the suspension cells have grown for at
least one day.
The Agrobacterium containing the binary construct are grown
on AB medium (AB salts K2HPO4 3 gm/l, NaH2PO4-H2O 1.15 g/l, NH4CL
1 g/l, glucose 5 g/l, FeSO4 0.25mg/l, MgSO4 0.246 mg/l, 0.14mg/l,
15g/l agar 100 ug/l gentamycin sulfate and 100 ug/l streptomycin
sulfate) for 4-5 days. Single colonies are then inoculated into 5
mls of MG/L broth and are incubated overnight in a shaker at 30 C
and 180 R.P.M. Following the preincubation period, the cotyledon
explants are dipped into the bacterial suspension of 5 X 108
bacteria/ml for approximately 5 minutes, blotted on sterile paper
towels and returned to the original tobacco feeder plates. The
explants are then cocultivated with the bacteria for 48 hours on
the tobacco feeders plates in low light at 24 C. The explants are
then transferred to regeneration medium containing 500 mg/l of
carbenicillin disodium salts and at least 100 mg/l of kanamycin
sulfate. The regeneration medium is MS salts medium with zeatin
(2 mg/l), myo-inositol (100 mg/l), sucrose (20 g/l), Nitsch
vitamins and 0.8% agar (pH 6.0). The explants are then
28
1 334 1 75
transferred to fresh regeneration medium containing 500 mg/l of
carbenicillin disodium salts and at least 100 mg/l of kanamycin
sulfate at 10 days and subsequently every three weeks. Shoots are
harvested from 8 weeks onwards and placed on MSSV medium
containing carbenicillin (50 mg/l) , kanamycin (50 mg/l) and
indole-3-butyric acid (1 mg/l). Roots develop in 7-14 days.
Plants are then transplanted into soil.
2. Tobacco
Tobacco leaf explants, roughly 5-lOmm by 5-lOmm, are cut from
young leaves, approximately 3-5cm long and third to sixth from the
apex of Nicotiniana tbabcum cv xanthi which have been grown under
axenic conditions in solid medium: Murashige Minimal Organics
(#1118 Gibco Laboratories, New York), 7% phytagar, lmg/l indole-3-
acetic acid, 0.15mg/l kinetin. The explants are plated on solid
medium containing Murashige Minimal Organics, 6% phytagar, 40mg/l
adenine sulfate, 2mg/l indoe-3-acetic acid, 2mg/l kinetin. A
sterile #1 Whatman filter paper (Whatman Ltd., Maidstone, England)
is placed on the top of the explants and they are incubated for 24
hours in the dark at 24C.
The Agrobacteriuam containing the binary construct are grown
on AB medium (AB salts K2HPO4 3gm/l, NaH2PO4-H2O 1.15g/l, NH4Cl
lg/l, glucose 5g/l, FeSO4 0.25mg/l, MgSO4 0.246mg/l, 0.14mg/l,
15g/l agar, 100 ug/l gentamycin sulfate and 100 ug/l streptomycin
sulfate) for 4-5 days. Single colonies are inoculated into 5mls
of MG/L broth (50% Luria broth and 50% mannitol-glutamate salts
medium (Garfinkel and Nester, ~.Bacteriol. (1980)144:732-743)) and
29
1 3~4 1 75
are incubated overnight in a shaker at 30C and 180 R.P.M. before
co-cultivation.
Following the preincubation period, the explants are dipped
into the bacterial suspension of 3.3 x 108 cells/ml for
approximately 5 minutes, blotted on sterile paper towels and
replated on the same plates. After 48 hours, the explants are
placed on selection medium containing the same plate medium as
above plus 350mg/l cefotaxime and 100mg/l kanamycin. The explants
are transferred to fresh media every 2 weeks. At the 6 week
transfer or thereafter, shoot and green callus are trimmed from
explants and placed on solid media: Murashige Minimal Organics,
.5mg/l indole-3-acetic acid, 2 mg/l kinetin, 40mg/l adenine
sulfate, 350mg/l cefotaxime, 100mg/l kanamycin. Shoots may be
harvested beginning about 4 weeks after co-cultivation and placed
in 50ml culture tubes with 25ml of solid medium (7% bactagar lmg/l
indole-3-butyric acid, 350mg/l cefotaxime, 100mg/l kanamycin) and
grown at 24-28C, 12 hours light, 12 hours dark, light intensity
80-100uEm~2s~l. Shoots root in 1-2 weeks and are then transplated
into soil and placed in growth chambers.
3. Results
Plants are maintained in growth chambers and young leaves 2
to 3 cm in length are harvested from plants at the 6 to 10 leaf
stage. Gus activity was measured in leaf extracts and expressed
as units of activity for mg of protein according to the methods of
Jefferson, R.A., Plant Mol.Biol.Rep. (1987)5:387-405. FlG. 3
shows a comparison of the activity of several tomato and tobacco
1 334 1 75
transformantsi screened for gu~ activlty. As expected the level of
expression varles several folds. However, the average expre-~sion
level ls 5 to 10 fold higher in plants transformed with the marker
under the regulatory control of the MAC promoter or the Double MAC
promoter than with the double CaMV 35s promoter.
The above results demonstrate that the MAC, and the Double
MAC, promoters are expressed at higher levels in plants than the
same construct under the control of the Double 35S CaMV promoter.
The results show significant and synergistic improvements to the
mas promoter when enhanced by the upstream activating region of
the CaMV 35S gene.
Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
and understanding, it will be readily apparent to those of
ordinary skill in the art in light of the teachings of this
invention that certain changes and modifications may be made
thereto without departing from the spirit or scope of the appended
claims.
. .
