Note: Descriptions are shown in the official language in which they were submitted.
- 1 1 33508 1 21489-7358D
This application is a divisional application of Canadian
Patent Application No. 558,001 filed on February 2nd, 1988.
Field of the invention
The invention relates to the field of genetic
engineering and provides novel DNA molecules comprising DNA
sequences coding for the pectin lyase I IPLI) of Asperqillus niqer
and/or the promoter, signal sequence or terminator thereof. The
novel DNA molecules are useful for the overproduction of PLI in
Aspergillus and/or the construction of hybrid vectors expressing
foreign genes in filamentous fungi.
Background of the invention
Although in genetic engineering techniques numerous
polypeptide expression systems for prokaryotic and eukaryotic
hosts are already known, there is a continuous need for novel
systems which may have advantages over the known systems.
Very widely used are the prokaryotic Escherichia coli
host and the eukaryotic yeast host, e.g. Saccharomyces cerevisiae,
for which a high number of different expression hybrid vectors,
mostly plasmids, have been developed. The drawbacks of E. coli
hosts are that they cannot glycosylate the formed polypeptide and
that for lack of secretion the foreign peptide may accumulate
within the host cell and prevent further growth. The yeast hosts
do glycosylate. However, like _. coli, they do not secrete the
polypeptides, except very small ones, into the nutrient medium.
Yeasts secrete only into the periplasmic space. Higher eukaryotic
hosts are mammalian cancer cells which are able to glycosylate and
secrete into the nutrient meclium~ however, cultivation thereof is
very slow and expensive and the danger exists that oncogenic
~ 335~8 1
la 21489-7358D
nucleic acids are isolated together with the desired peptide of
which the latter may not be freed.
- 2 - 1 335081
In the need for other hosts also filamentous fungi, such as Neuro-
spora crassa, Aspergillus nidulans and Aspergillus niger, have been
investigated. Such fungi are already widely used for industrial
purposes, however, the application thereof in genetic engineering
techniques has lagged behind, mainly for lack of an appropriate
transformation system. In contrast to Saccharomyces cerevisiae,
filamentous fungi do not contain plasmids which could be used for
the introduction of foreign genes and phenotype selection. It is,
however, possible to transform filamentous fungi with foreign
plasmids containing a selectable marker gene. All vectors described
so far for filamentous fungi do not autonomously replicate, as those
of yeasts do, but are integrated into the fungal chromosome. This
event occurs only at a very low frequency. Advantageously, on the
other hand, integrative transformation renders the transformants
mitotically very stable, even under non-selective conditions. Stable
integration of more than one hundred copies has been reported.
The first vector for filamentous fungi described contained the qa-2
gene of Neurospora crassa as selectable marker. This gene encodes
the enzyme catabolic dehydroquinase and can be used for functional
complementation of aro mutants of N. crassa ¦Case, M.E.,
Schweizer, M., Kushner, S.R. and Giles, N.H. (1979) Proc. Natl.
Acad. Sci. USA 76, 5259-5263~. Aro mutants are unable to grow on
minimal medium without an aromatic amino acid supplement. Trans-
formation of N. crassa by the qa-2 vector occurred by integration of
a single copy of the plasmid into the chromosome. 30 % of stable
aro integrants retained the integrated qa-2 gene still linked to
the bacterial plasmid sequences ~Case, M.E. (1982) in Genetic
Engineering of Microorganisms for Chemicals (Hollander, A.,
DeMoss, D., Raplan, S., Konisky, J., Savage, D. and
Wolfe, R.S., eds), pp. 87-100, Plenum]. This observation made
cotransformation of non-selective DNA-sequences together with
selective ones a feasible task.
~ - 3 - 1 3 3 5 0 8 1
In Aspergillus nidulans, which has a sexual cycle and ls therefore
amenable to classical genetic manipulations, both negative and
positive selection systems have been identified. Either using
heterologous DNA from N. crassa or homologous DNA, functional com-
plementation of A. nidulans pyrG-mutants by transformation with
plasmids containlng the pyrG gene was obtalned (Ballance et al.
BB~C 112, 284 1983; Tilburn et al. Gene 26, 20S, 1983). In other
systems mutations at the trpC or argB locus were functlonally
complemented by transformatlon with the appropriate plasmids LYelton
et al. PNAS 81, 1470, 1984; Yelton et Timberlake J. Cell. Bio-
chem. Suppl. 9C 173, 1985; Johnstone et al. EMB0 J. 4, 1307, 1983].
A dominant positive selection system has also been developed making
use of the amdS gene isolated from A. nidulans which enables
A. niger transformed therewith to grow on acetamide as sole nitrogen
source (Tilburn et al., Gene 26, 205, 1983); Wernars et al.,
Curr.Genet. 9, 361, 1985, Relly, J.M. et al., EMB0 J. 4,
475,1985).
Compared to N. crassa or A. nidulans, A. niger ls by far the more
important organism. It is used wldely in the industrlal production
of enzymes, e.g. for use in the food industry. A. niger differs from
A. nidulans by its secretory capacity, in that lt secretes a varlety
of hydrolytic enzymes, e.g. glucoamylase, ~-amylase, pectinase,
cellulase, B-glucanase, ~-galactosidase, narlnglnase, pentosanase,
acld protease and lignase, the glucoamylase and pectinase complex
being the most important ones.
A. niger has no known sexual cycle. Mutations csn therefore not be
introduced via meiotic recombinations. By classical mutation and
selectlon procedures, extensive straln improvements in the secretion
of hydrolytic enzymes have however been achleved.
- 4 - 1 335081
Of the genes of A. niger enzymes only those of glucoamylase (Boel
et al. EMB0 J. 3, 1581, 1984) and alcohol and aldehyde dehydrogenase
(W0 86l06097) together with their promoter and signal sequences have
been characterised and used in transformation experiments with
A. nidulans and A. niger, respectively.
As selection markers for A. niger have been used the heterologous
amds gene (Kelly and Hynes, EMB0 3. 4, 475, 1985), and the argB gene
(Buxton et al., Gene 37, 207, 1985; EP 184 438; W0 86/06097), both
obtained from A. nidulans.
A. niger is the most important organism for the industrial produc-
tion of pectin degrading enzymes. Pectins are polygalacturonides of
high molecular weight (20000-40000 D) consisting of -1,4-glycosidic
bounded D-galacturonic acid polymers and occur in nature as consti-
tuents of higher plant cells, where they are attached to cellulose
molecules mainly found in the primary cell wall and the middle
lamella. Amongst the richest sources of pectin are lemon and orange
rind, which contain about 30 % of this polysaccharide. Pectic
enzymes are degrading the carbohydrate polymer substrate either by
hydrolysis of the -1,4-glycosidic bond (polygalacturonase) or by
transelemination of the -4,5 unsaturated galacturonic residue from
the pectin molecule (different pectin lyases). The systematic name
of pectin lyase is pectin transeliminase (EC 4.2.2.10).
In A. niger the proteins of the pectic complex are not expressed
constitutively. Under inducing conditions using pectin or brea~down
products thereof A. niger expresses the above mentioned enzymes,
including PLI, when other carbon sources, such as glucose or
sucrose, are limiting. In surface cultures the pectic enzymes tend
to remain associated with the outer cell wall. Increasing pectin and
Ca2 concentration ln the medium leads to complete secretion.
Pectinases, such as PLI, are used by the food stuff industry mainly
for fruit juice clarification.
~ 1 3 3 ~ ~ 8 ~ 21489-7358D
From A. niger two different pectin lyases, PLI and PLII,
have been purified and partially characterized by F.E.A. Van
Houdenhoven (1). PLI contains four residues of mannose, whereas
PLII has two residues of mannose and glucose each. The enzymes
have different molecular weights (PLI: 37.5 kD, PLII: 36 kD).
Before the present invention no total or partial amino acid
sequences have been published.
The present invention is based on a partial structure
determination of pectin lyase I (PLI) which allowed the synthesis
of DNA probes coding for relevant parts of the protein. By means
of the DNA probes it was possible to screen for and isolate DNA
coding for PLI, eventually together with pre- and post-sequences
thereof, from a gene library of A. niqer.
Aims of the invention
The invention aims to provide recombinant DNA molecules
coding for a pectin lyase expression system and derivatives
thereof, such as the structural gene of PLI and corresponding
regulatory sequences, e.g. promoter, signal and terminator
sequences, and hybrid vectors comprising corresponding DNAs,
including hybrid vectors with DNA coding for homologous or
heterologous polypeptides, hosts, especially filamentous fungi,
e.g. Asperqillus hosts, transformed by said vectors, methods for
the preparation of said recombinant DNA molecules and said hosts
and the use of the recombinant DNA molecules for the preparation
of new expression systems. A further aim is the preparation of
polypeptides by means of said DNAs and said hosts.
The pectin lyase expression system comprises DNA
sequences coding for the promoter, the signal sequence, the
_ 5a 1 33S08 ~ 21489-7358D
structural gene and the terminator of a pectin lyase qene.
More particularly, the present invention seeks the
construction of hybrid expression vectors comprising DNA sequences
coding for the promotor of PLI~ optionally for the signal sequence
~ 33S08 1
6 21489-7358
of this protein, and optionally for a suitable terminator of the
same gene. These hybrid expression vectors are used for the
incorporation of genes coding for particular proteins and for the
transformation of filamentous fungi, such as AsPeruillus,
Penicillium and CePhalosPorium. Cotransformation of A. niser with
2 different plasmids can be carried out, whereby one of the
plasmids i8 selected from the group of the expression vectors of
the invention, and the other one i8 a specially con~tructed
selection plasmid, which works in connection wlth a mutated strain
of a filamentous fungus.
The present invention also concerns the overproduction
of PLI in AsPerqillus species.
In drawings which illustrate embodiments of the
invention,
Figure 1 shows a re~triction map of plasmid pCG3B11
Figure 2 shows a restriction map of plasmid pPL29-5
Figure 3 show~ a restriction map of pla~mid pPL35-5
Figure 4 ~hows a SPe I-Nhe I fragment which comprise~
the entire sequence of the PLI gene.
Figure 5 shows a schematic protocol for the construction
of a pUBE 5 plasmid.
Figure 6 shows a schematic protocol for isolation of a
DNA fragment coding for mature desulfatohirudin.
Figure 7 shows a schematic protocol $or the construction
of a pLHK 3 plasmid.
Figure 8 shows a schematic protocol for the construction
of a pLHL 5 plasmid.
1 33508 1
6a 21489-7358D
Figure 9 shows a schematic protocol for the construction
of a pLHLT 7 plasmid.
The various subjects of the invention will become more
evident from the following detailed description of the invention.
Detailed description of the invention
The invention of this divisional application relates to
the selection marker plasmid pCG59D7 and hosts and host cells
containing the plasmid. Of particular interest is Escherichia
coli BJ5183/pCG59D7 (DSM 3968). Also of particular interest is
Asperqillus niqer An8 (DSM 3917) containing such a selection
marker plasmid.
The Recombinant DNA Molecules
The invention of the parent application concerns a
recombinant DNA molecule comprising the DNA sequence of the
formula I (Figure 4) or a derivative thereof.
The term "derivative" when used in connection with the
DNA sequence of the formula I is intended to include large
derivatives with flanking sequences, fragments of said DNA
sequence, mutants, especially naturally occurring mutants, and DNA
sequences which are degenerated.
Larger derivatives of the DNA molecules of the formula I
are those excisable from the A. niqer genome and comprising the
DNA sequence of the formula I, such as can be found in a genomic
library of A. niger obtained by fragmentation of the nucleic
acids, treatment of the fragments with a suitable restriction
enzyme, e.g. Sau 3A,
- _ 7 _ 1 335081
ligating into a suitable plasmid, e.g. pUN121, cloning, e.g. in
E. coli, and excising again, with the same restriction enzyme. Such
derivative is e.g. the insert of plasmid pCG3Bll shown in Figure 1.
Fragments of the DNA sequence of the formula I are those extending
between two restriction sites selected from those of Pst I, EcoRI,
HindIII, Sau3AI, KpnI, ClaI, NcoI, AccI, SalII, PvuI, SalI, SpeI,
B~lI, EcoRV, B~lII, AvaI, XhoI, NheI, BssHI, XmnI, BamHI, BssHII,
and the like, as shown in the accompanying Figures.
Preferred fragments are those containing the promoter sequence, the
signal sequence, the structural gene of PLI, and/or the terminator
sequence.
The fragments of the DNA sequence of the formula I may contain
linkers which provide for successful linkage to other DNA molecules.
The PLI promoter sequence is contained in the DNA region between
nucleotide positions -1 to -688, whereby the sequence between
nucleotides about -100 and -146 is essential. For the promoter
sequence the TATAA box at nucleotides -120 to -146 is important as
the RNA-polymerase recognition site. Suitable linkers may be
attached to these fragments.
The promoter of PLI of A. ni~er is inducible, i.e., the expression
of the structural gene attached thereto, e.g. the structural gene
coding for PLI or any other foreign gene, is induced by addition of
pectin or pectin degradation products to the medium.
The signal sequence extends between nucleotites 1 to 57. The signal
sequence is a preferred sequence and DNA molecules comprising it,
e.g. such containing said sequence and optional suitable linkers,
are preferred DNA molecules.
- 8 - 1 ~ 3~8~
The structural gene of PLI starts at nucleotide 58 and extends to
nucleotide 1366. As is evident from formula I the structural gene
contains several introns. Also the structural gene may contain
suitable linkers.
The terminator starts with the stop codon TAA at nucleotide 1367 and
may extend up to nucleotide 1570 or up to 2029, especially up to one
of the restriction sites within said sequence. The terminator
fragment may contain suitable linker~.
Suitable linkers to above fragments have a DNA sequence which fits
into the restriction site of the DNA to which the fragment is to be
linked, or which contain a re~triction site.
Fragments of the DNA sequence of the formula I are al~o such which
are composed of smaller fragments, e.g. those composed of the
promoter and the signal or structural sequence, or of the signal and
the structural sequence, the structural gene without the introns,
and the like.
Mutants of the DNA sequence of the formula I are e.g. naturally
occurring mutants, such a~ the mutant whose nucleotide Tgo i~
replaced by Ago, whereby the codon GTG coding for valine i9 altered
to GAG coding for glutamic acid. The latter amino acid is present in
the PLI isolated from a mixture of pectinolytic enzymes (Ultrazym~,
Novo Indu~tries, Copenhagen) obtained from an A. niger
strain. The invention comprises also natural or synthetic mutants of
the signal sequence with a similar or identical hydrophobicity
profile, e.g. wherein the codons for the polar amino acids
lysine (R~ ), tyrosine (Y ) and arginine (R ) are exchanged by
codons for other amino acids having ~imilar charges, and the hydro-
phobic amino acids ~l~n~ne (A), leucine (L) and threonine ~T), are
replaced by codons for other hydrophobic amino acids. For example,
the codon for the positively charged lysine may be replaced by a
codon for arginine and vice versa, the codon for the negatively
charged tyrosine by a codon for glutamate or aspartate, andlor the
1 335081
- 9 21489-7358D
codon for the non-polar, hydrophobic alanine by any one of the
codons for threonine, proline, valine, isoleucine, leucine,
methionine or phenylalanine, and the like. Other mutations are
"silent mutations" wherein one or a few other nucleotides, e.g. up
to about 30, are replaced by one or more other nucleotides,
whereby the new codons code for the same amino acid(s).
DNA sequences of the formula I which are degenerated
are, like silent mutations, such which are degenerated within the
meaning of the genetic code in that an unlimited number of
nucleotides are replaced by other nucleotides without changing the
amino acid sequence for which they code. Such degenerate DNA
sequences may be useful for their different restriction sites.
Recombinant DNA molecules comprising a DNA sequence of
the formula I or a derivative thereof are especially recombinant
vectors, alternatively called hybrid vectors, containing such DNA
sequences as inserts. They are usable for cloning in hosts, such
as bacteria, fungi or animal cells. Such hybrid vectors are
derived from any vector useful in the art of genetic engineering,
such as from phages, cosmids, plasmids or chromosomal DNA, such as
derivatives of phage ~, e.g. NM 989, M13mp8 phage DNA(15)
linearized by BamHI digestion, bacterial plasmids, e.g. pBR 322,
pUN121, pUC18, or yeast plasmids, e.g. yeast 2~ plasmid, or also
chromosomal DNA, derived e.g. from Aspergillus, e.g. A. niqer, for
example those provided by EP 184 438.
A hybrid vector of the invention of the parent
application, in addition to the DNA sequence of the formula I or a
derivative thereof, contains a replication site and optional,
depending on the type of the DNA derivative, an expression control
9a 1 3 3 S 0 8 1 21489-7358D
sequence, such as an enhancer sequence, upstream activation site,
promoter and signal sequences, and/or structural genes different
from corresponding present A. niqer derived sequences. Such
enhancer sequences may be derived from the extrachromosomal
ribosomal DNA of Physarum polycephalum (PCT/EP 8500278), or are
the upstream activation sites from the acid phosphatase PH05
1 3 3 5 0 8 1
8ene (EP-A-0,213,593 published on March 11th, 19~7), or the
PH05, trp, PH05-GAPDH hybrid (EP-A-0,213,593), or the like
promoters. Such expression control sequences may be linked
to the PLI structural gene.
Structural gene~ llgsted to the pre~ent promoter, nignnl andlor
termlnstor sequence~ are, besldes tho~e codlng for PLI wlth or
wltllout introns, al~o homologou~ other pectln lya~e genes, and
heterologou~ structural gene~ codlng for a wlde vsrlety of poly-
peptldes ~ lncludlng glycosylote~l polypeptlde~, in portlcular oE
hlgher eukaryotlc, e~peclslly mnmmallsn, such as snlmsl or espe-
clslly humsn orlgln, such as enzymes wl~lch cnn be u~led, for example,
for the productlon of nutrlents snd for performlng enzymstlc
re.sctions ln cheml~try, or non-enzymatlc polypeptldes, w1-icll are
useful snd valuable or l:he trentment of humsn and snlmsl dl~easeo
or for the preventlon thereof, for exsmple hormones, polypeptldes
wlth immunomodulatory, antl-vlrsl snd antl-tumor propertles,
sntlbodles, vlral antlgens, vacclnes, clottlng factor~, foodstuffs
and tlle llke.
Example~ of ~luch lleterologou~ ~tructural genes are e.g. tllone codingfor ln~ulln, growth fsctors, ~uch OR epldermal, ln~ulln-llke, m~st
cell, nerve or tran~formlng growth factor, growth hormones, ~uch as
humsn or bovlne growth hormone~, lnterleukln, ~ucll a8 lnterleukln-l
or -2, huDIan mscrophage mlgrstlon lnhlbitory factor (MIr), lnter-
ferons, such 8- huolan -lnterferon, for exslople interferon-aA, lS,
aD or aF, B-lnterferon, r-lnterferon or a hybrld lnterferon, Eor
exampl- An aA-aD- or an aD-aD-hybrid interEeron, hepatitls virus
sntlgen~, such a8 hepatltlJ D vlrus surface or core antlgen or
llepAtltla A vlrurJ antlgen, pla~mlnoeen activstor~, ~uch a~ tlsnue
plasmlnogen sctlvstor or urokln~e, tumour necrosl~ fActor, ~omato-
ststln, renln, B-endorPIlln, lmmunoglobulln~, such a~ the llght
snd/or heAvy chalns of lmmunoglobulln D, E or G, lmmunoglobulln
blndlng fsctors, ~uch a~ lmmunoelobullll E blndlll~ Eoctor, colcl-
tonln, human calcltonln-related peptlde, blood clotting factors,
such as factor IX or VIIIc, eglin~ such as eglln C, de~ulfato-
- 11 1 33508 1 21489-7358D
hirudin, such as desulfatohirudin variant HV1, HV2 or PA, or human
superoxide dismutase. Preferred genes are those coding for a
human a-interferon or hybrid interferon, human tissue plasminogen
activator (t-PA), hepatitus B virus surface antigen (HBVsAg~,
insulin-like growth factor I, eglin C and desulfatohirudin, e.g.
variant HV1. In the hybrid vectors of the present invention, the
present promoter and/or signal sequence is operably linked to the
polypeptide coding region so as to ensure effective expression of
the polypeptide.
The DNA molecules of the invention of the parent
application may contain selective markers depending on the host
which is to be transformed, selected and cloned. Any marker gene
can be used which facilitates the selection of transformants due
to the phenotypic expression of the marker. Suitable markers are
particularly those expressing antibiotic resistance, e.g. against
tetracycline or ampicillin, or, in the case of auxotrophic yeast
mutants, genes which complement host lesions. Corresponding genes
confer, for example, resistance to the antibiotic cycloheximide,
or provide for prototrophy in an auxotrophic yeast mutant, for
example the ura3, leu2, his3 or trPl gene. It is also possible to
employ as markers structural genes which are associated with an
autonomously replicating segment providing that the host to be
transformed is auxotrophic for the product expressed by the
marker.
Of particular importance are marker genes which
complement A. niger host lesions, such as the arqB gene coding for
the ornithine carbamoyl transferase, e.g. derived from A. niger or
A. nidulans ~EP 184 438~, or A. nidulans DNA fragments homologous
- lla l 3 3 5 0 81 21489-7358D
to the N. crassa Pvr4 gene (26).
Preferred embodiments of the invention of the parent
application are hybrid vectors wherein the structural gene,
especially the foreign structural gene is operatively linked to
the promotor and signal se~uences of the present invention. Such
preferred hybrid vectors are e.g. pCG3B11,
1 33508 1 21489-7358D
- 12 -
M13 mp8-PL (SalI-EcoRI) BssHII/BES, pUBE5, pLHK3, pLHL5 and pLHLT7.
Further useful hybrid vectors are pPL29-5 and pPL35-5 (see Examples
and-Figures).
The DNA of the formula I and the derivatives thereof, including
fragments can be used for screening DNA gene banks or mRNA for
similar DNAs or mR~As.
Process for the Preparation of the Recombinant DNA Molecules
The invention concerns also a process for the preparation of a
recombinant DNA molecule coding for a pectin lyase expression system
or a derivative thereof, comprising culturing a host transformet
with a DNA molecule contA~ning a DNA sequence coding for the pectin
lyase expression system or a derivative thereof and isolating the
desired recombinant DNA molecule or the derivative thereof, or
preparing it by an in vitro synthesis.
The culturing of the hosts is carried out in a conventional
nutrient medium which may be supplemented with or deprived of
chemical compounds allowing negative or positive selection of the
transformants, i.e. such hosts containing the desired DNA molecule
together with a selection marker, from the non-transformants,
i.e. such hosts lac~lng the desired DNA molecule.
Any transformable hosts useful in the art may be used, e.g. bac-
teria, such as E. coli, fungi, such as Saccharomyces cerevisiae, or
in particular filamentous fungi, ~uch as Aspergillus, e.g. A. nidu-
lans, A. oryzae, A. carbonarius, A. awamori and especially A. niger.
A preferred host is A. niger An8, a novel mutant lacking the p~rA
gene, as described further below. Transformation of the hosts is
carried out by conventional methotJ.
The DNA sequence coding for the PL expression system is obtained
from a filamentous fungi cont~n~ng such system, in particular from
a genomic library thereof or also via the mRNA.
1 33508 1
- 13 -
In the following the preparation of the PLI expression ~ystem i8
described in more detail.
A genomic library can be prepared e.g. by partial digestion of
genomic DNA of an A. niger strain, e.g. N756, wlth Sau3AI and
cloning the high molecular weight DNA fragments into the E. coli
plasmid pUN121. Any other A. niger strain producing PLI may serve as
source for the genomic library and likewise other suitable vectors
may be used as recipient for the fragments.
In order to successfully ~creen the genomic library for DNA sequen-
ces coding for PLI, sequence determination of this enzyme or parts
thereof was necessary. PLI was purified from a commercially avail-
able mixture of pectinolytic enzymes of A. niger (UltrazymX, Novo
Industrie~3) and sequenced. The N-terminus of mature PLI revealed the
sequence
Vl-G-V-X4-G-T6-P-E-G-F-A,
and a fragment of PLI, obtained by splittlng of PLI with cyanogen
bromlde, revealed the N-terminal ~equence
V~2g-S-G-V-S-N-I-I-I-Q-N-I-A-V-X143-D-I-N-X147-E,
whereln the amino acids X at that time had not been identified.
Baset OQ those amino acid sequences a number of DNA probes,
i.e. mixtures of DNA sequences coding for parts of the smino acid
sequences snd the corresponding degenerate DNA sequences, were
chemically synthesized and used for screening. Such DNA probes are
for esample the mixtures of the formulas
3' TGR1 GGR1 CTR2 CCR3 AAR3 CG5' (2014) (Ia) or
3' TGR~ GGR~ CTR2 CCR2 AAR3 CG5' (2015) (Ib)
- 14 - 1 3 3 5 0 8 1
wherein R1 is A,C, G or T, Rz is C or T and R3 is A or G, or DNA
mixture 2060 of the formula
5' AAR1 ATR2 ATRz ATR2 CAR3 A 3' (2060) (Ic)
wherein R1 is A or T, R2 is A, T or C and R3 is A or G.
Since the total DNA sequence of the PLI gene became known during the
course of this work, any part thereof having at least about 14 bp
can now be used for screening, which includes also the screening for
mRNA coding for the PL system.
For screening purpose~ the DNA probes are 5' radioactively labelled
by methods known in the art using r~ 2P-ATP and T4 kinase. Host
microorganisms carrying nucleic acids of the present invention as an
insert, are identified by hybridisation with the labelled DNA probe
on filter replicas of the gene library.
For establishing a sublibrary, clones of the library, showing a
radioactive response to the radioactive labelled DNA probe coding
for the N-terminal part of PLI can be isolated, cultivated and
hybridized with the second DNA probe coding for the N-terminal amino
acids of the CNBr fragment, as described before.
Clones showing a hybridisation response to one or both DNA probes
are isolated and amplified.
For example, screening with DNA probes 2014 and 2015 revealed 33
and 39 positive clones, respectively. The 72 clones were amplified
and the obtained sublibraries rescreened with DNA probe 2060 whereby
3 positive clones could be identified. One clone was selected and
named E. coli BJ 5183/pCG3B11. It contains plasmid pCG3B11 of which
a partial restriction map is shown in Figure 1. The Sau3AI fragment
of pCG3B11 comprises the SpeI-NheI fragment shown in Figure 4 and
formula I.
- 1 335081
- 15 - _
Plasmid pCG3B11 can be used for constructing other DNA molecules of
the invention by applying conventional genetic engineering tech-
niquès.
For example, restriction of pCG3Bll with EcoRI and cloning the two
fragments into plasmid pUN121 leads to plasmid pPL 29-5 (Fig. 2)
containing the promoter, the signal sequence and the part of the
structural PLI gene up to the central EcoRI restriction site at
position 649/650, and to plasmid pPL35-5 (Fig. 3) containing part of
the PLI structural gene starting at position 650 and the terminator.
pPL 29-5 contains further the flanking N-terminal sequences and
pPL35-5 the flanking C-terminal sequences of pCG3Bll.
Fragments of the inserts of plasmids pPL29-5 and pPL35-5 can be
obtained for sequencing by restriction with suitable enzymes, such
as AhaIII, PstI, AvaI, HindIII, EcoRI, KpnI, ClaI, NcoI, AccI,
SalI, PvuI, SalII, NheI, BglI, EcoRI and EcoRV. The fragments can be
subcloned, e.g. into different M13 phages, preferably M13mp8
and M13mpl8, and sequenced, e.g. using the M13 Cloning and Sequen-
cing Kit (M13 Sequencing Kit N.4502, Amersham) under the conditions
given by the supplier (16). The entire sequence of the 2.7 kb
SpeI-NheI fragment, comprising the complete sequence of PLI gene, is
shown in Figure 4. It comprises 688 nucleotides of the promoter
region, 1369 nucleotides of the structural part of the PLI gene and
661 nucleotides of the terminator region. The sequence of pPL29-5,
corresponding to amino acid sequence of the N-terminus of PLI as
determined by amino acid sequence analysis (Example 1), is preceded
by 57 nucleotideq coding for the signal peptide of the formula
M1-K-Y-A-A-A-L-T-A-I-A-A-L-A-A-R-A-A-As7
The amino acid sequence of the N-terminus of the C-terminal CNBr
fragment of PLI (Example 3) is not continuously encoded by the
cloned DNA fragment of pPL35-5 (nucleotide 1257-1379). A computer
aided search for consensus sequences of exon/intron splice junctions
I 33508 1
- 16 -
as well as for intron lnternal sequences (Boel E. et al. (18) and
Mount S.M. (19)) leads up to postulate the presence of four introns
with length of 65 bp, 62 bp, 63 bp and 57 bp respectively (Fig. 4).
One phage, obtained from phages M13mp8 and the 0.8 kb SalI-EcoRI
fragment of plasmid pPL29-5, containing 130 nucleotides of the
promoter and the N-terminal part of the PLI gene, is designated
Ml3mp8(salI-EcoRI)~ and is used in further steps for the preparation
of other DNA molecules of the invention.
Such other DNA molecules of the invention comprising fragments of
the DNA sequence of the formula I can be constructed as described in
Figures 5 to 9, whereby, when desired, novel restriction sites can
be introduced, e.g. an BssHII restriction site within the signal
sequence of the PLI gene. Such DNA molecules are the plasmids or
phages, respectively, pUBE5, MBmp8-PL(SalI-EcoRI)BssHII/BE5
(Fig. 5), pLHK3 (Fig. 7), pLHL5, M13mpl8-PL(SpeI-EcoRI)BssHII/AC5
pLHLT7 (Fig. 9), of which the latter three plasmids contain the
structural gene coding for desulfatohirudin.
Mutants containing new restriction sites can be prepared, for
example in vitro by site-directed mutagenesis, according to con-
ventional methods lsee review article of M.J. Zoller and M. Smith,
Methods Enzymol. 100, 468 (1983), D. Botstein and D. Shortle,
Science 229, 1193 (1985) or R. Norris et al., Nucl. Acids Res. 11,
5103 (1983)J.
~or example, a mutant of the present DNA sequences is derived from
the M13mp8PL(Sal-EcoRI) phage which comprises the promoter and the
secretional signal gene of PLI. Introduction o~ a new BssHII site
into the signal sequence region of M13mp8PL(Sal-EcoRI) gene i8
performed by using a chemically synthesized primer oligonucleotide,
which i8 complementary to the DNA sequence at positions 36 - 54
situated near the C-terminal part of the PLI signal sequence, with
the exception that at position 4S a C/G transversion (mutagenic
primer) is introduced.
~ - 17 - 1 335081
The mutated phage, carrying the new BssHII site is designated as
M13mp8PL (Sal-EcoRI) BssHII and can be used for the construction of
expression vectors for homologous or heterologous genes.
In a corresponding example the desulfatohirudin gene of pML310
(EP 168 342) is recloned into phage M13mpl8-PL(SpeI-EcoRI)BssHII/AC5
(Fig. 6 to 9). A HgaI/BssHII linker is constructed, to make the
HgaI restriction site of the desulfatohirudin gene of pML301L
compatible to the BssHII site of M13mpl8-PL(SpeI-EcoRI)BssHII/AC5.
The linker DNA is ligated to the cleaved phage DNA. The phage DNA
carrying the linker fragment is cleaved with HindIII, which gives
two fragments. The 0.7 kb fragment, comprising the signal structure
of PLI and the lin~er fragment is isolated. A suitable replication
plasmid, carrying a BamHI restriction site, such as pBR322, i8
cleaved with BamHI. The gene to be cloned is cleaved out of
genomic ~NA, plasmid or phage DNA with suitable restriction enzymes
and, if neces~ary, is provided with the required compatible restric-
tion sites.
Another method to make the restriction sites compatible is in vitro
mutagenesi~, as for example carried out by the construction
of pML301L (Fig. 6). A linker containing an HgaI restriction site is
constructed and attached to the 5'-terminsl of the desulfatohirudin
gene.
For higher expres~ion rates, any eukaryotic terminator sequence can
be llgated to the end of the structural gene. In a preferred
embodiment of the invention, the terminator region of the PLI gene
is used. For example an expression vector comprising the terminator
site of PLI can be obtained by modification of the above described
procedure in the following way. The promoter and secretional signal
sequence~ are obtained from plasmid
M13mpl8-PL(SpeI-EcoRI)BssHII/AC5. The terminator region is obtained
from pPL35-5. M13mpl8-PL(SpeI-EcoRI)Bs~HII/AC5 is cleaved with
~ - 18 - 1 335081
BssHII and a BssHII-HgaI linker is ligated. In modification,
plasmid pPL35-5 is cleaved with PstI, which gives two resulting
fragments to which again a suitable linker, compatible with the 3'
end of the cloned gene is ligated. The sticky ends of PstI restric-
tion sites are filled up by the enzyme T4-Polymerase and 8
BamHI linker is added, for example available from Biolabs, New
England. The pPL35-5 plasmid is cleaved with NheI and the resulting
0.7 kb fragment, comprising the terminator region of PLI, is
isolated. For amplification any plasmid having compatible restric-
tion sites can be used, e.g. pUC18. In the case of pVC18, the
plasmid is cleaved with HindIII and XbaI. Four DNA fragments, the
M13mpl8-PL(SpeI-EcoRI)BssHIItAC5 fragment, carrying the Bss HII-HgaI
linker, the 0.7 kB fragment of pPL35-5, carrying the BamHI linker,
HindIII/X I cleaved pUC18 and the HgaI-BamHI fragment of the desul-
fatohirudin gene, are ligated to form pLHL7 (Fig. 9).
Bacteria are transformed by a conventional method and the trans-
formants identified by their resistance, e.g. against tetracycline.
In particular the described expression vectors are amplified in
suitable E. coli host strains" such as HB101, transformed (10) and
selected by methods conventional in the art. The amplified plas-
mid DNA is isolated from the bacteria by conventional methods, in
particular as described by Birnboim ~ Doly (17).
In a similar manner other plasmids with other homologous or hetero-
logous genes can be constructed.
The DNA molecule~ of the pre~ent invention can also be prepared by
an in vitro synthesis according to conventional methods. The
in vitro synthesis is especially applicable for the preparation of
smaller fragments of the PL expression system, e.g. of the DNA
sequences coding for the promoter or especially the signal sequence
of PLI, or mutants thereof.
- 19 - 1 3 3 5 0 8 1
DNA molecules of the invention comprising the PLI promoter and
optionally the PLI signal sequence, the PLI structural gene, any
other heterologous structural gene and/or the PLI terminator can
also be used to transform filamentous fungi, such as Aspergillus,
Penicillium or Cephalosporium, e.g. A. nidulans, A. oryzae, A. car-
bonarius and especially A. niger.
In order to allow selection of the transformed from the non-trans-
formed fungi, the DNA molecules of the invention carry a selection
marker or, alternatively, the fungi are cotransformed with a second
vector containing such marker. As in other systems such selection
marker is an expressible, structural gene, the expressed polypeptide
of which (an enzyme) provldes resistance against compounds toxic to
the transformant or which completes the enzyme system of a mutant
lacking such essential polypeptide. Such marker genes are for
example the known qa-2, ~y~, pyr4, trpC, amdS or argB genes.
Within the frame of the invention a novel marker gene, named pyrA,
was isolated from the genomic library of A. niger, which is related
to and has similar function as Ey~G of A. nidulans and pyr4 of
N. crassa, namely producing the enzyme orotidine 5'-phosphate
decarboxylase. This enzyme catalyses the decarboxylation of oroti-
dine 5'-phosphate to uridylic acid (uridine 5'-phosphate) and also
of fluoro-orotic acid to the toxic fluoro-uridine. An E. coli clone
contain~ng the pyrA gene was identlfied by hybridization with the
1.1 kb Hind III fragment of pDJB2 (26) containing part of the
pyr4 gene, however, DNA of any other pyr gene coding for oro-
tidine-5'-phosphate decarboxylase may be used. From a positive clone
named E. coli B75183/pCG59D7, the plasmid pCG59D7, comprising the
pyrA gene, was isolated and used for cotransformation of an
A. niger pyrA mutant. Such pyrA mutant ls defective in the
orotidine 5'-phosphate decarboxyla~e gene and therefore is unable to
produce the corresponding enzyme. Such mutant was prepared by
treating conidiospores of A. nlger N756 under mutating W-irra-
diation and colonies surviving in the presence of fluoro-orotic acid
and uridine are selected. Colonies surviving in the presence of
~ 20 1 33508 l 21489-7358D
fluoroorotic acid and absence of uridine are eliminated. The
remaining uridine-requiring mutants, according to their ability of
being transformable, belong to two complementation groups pvrA and
pYrB, represented by mutants An8 and AnlO, respectively. They are
treated in the form of protoplasts thereof under transforming
condition with the pvrA containing plasmid pCG59D7. Only the An8
colonies were found to be transformed and to contain the PYrA gene
as evidenced by the hybridizing ability of digested DNA thereof
with DNA of pUN 121.
The invention concerns also the selection marker plasmid
pCG59D7, a host containing it and the pYrA mutant A. niqer An8 and
processes for their preparation.
The invention concerns further hosts transformed with
the hybrid vectors of the invention and methods for their
preparation. Such transformants are for example bacteria, such as
E. coli, or filamentous fun~i, such as AsPergillus~ Penicillium or
Cephalosporium, and in particular A. nidulans, A. oryzae, A.
carbonarius or preferably A. niqer, e.g. A. niqer An8. The
invention concerns also a method for the preparation of such
transformants comprising treatment of a host under transforming
conditions with a recombinant DNA molecule, especially a hybrid
vector, of the invention, optionally together with a selection
marker gene and selecting the transformants.
The invention of the parent application concerns also
the use of the recombinant DNAs or a derivative thereof for the
preparation of hybrid vectors which express useful polypeptides,
e.g. PLI, desulfatohirudin and the like.
The invention of the parent application concerns further
_ 20a 1 3 3 5 0 81 21489-7358D
a method for the preparation of polypeptides, characterized in
that a hybrid vector of the invention is expressed in a suitable
host and the polypeptide is isolated by conventional methods.
This method comprises the overproduction of
- 21 - I 3 3 5 0 8 1
PLI in Aspergillus species by cultivating an Aspergillus host
transformed with an expression hybrid vector for the expression and
secretion of PLI and collecting the PLI from the nutrient medium.
Short Description of the Figures
Figure 1 shows the restriction map of plasmid pCG3Bll containing a
Sau3AI fragment of the A. niger strain N756
Figure 2 shows the restriction map of plasmid pPL29-5 containing the
N-terminal EcoRI fragment of the DNA of formula I
Figure 3 shows the restriction map of plasmid pPL35-5 containing the
C-terminal EcoRI fragment of the DNA of formula I
Figure 4 shows the DNA of the formula (I~, with indications of some
restriction sites, and the signal and structural amino acid
sequences of PLI
Figure 5 shows the construction of pUBE5 from M13mp8-PL(SalI-
EcoRI)BssHII/BE5 and pUN121. pUBE5 contains part of the PLI
promoter, the signal sequence with BssHII restriction site,
-and part of the PLI structural gene
Figure 6 shows the construction of pML310L containing the desulfato-
hirudin gene
Figure 7 shows the construction of pLHK3 containing part of the
PLI promoter, the signal sequence with the BssHII restric-
tion site, the linker BssHII-HgaI,and the desulfstohirudin
gene
Figure 8 shows the construction of pLHL5 containing the PLI promo-
ter, the signal sequence with the BssHII refitriction site
and the desulfatohirudin gene
Figure 9 show~ the construction of pLHLT7 containing the PLI
promoter, the signal sequence with the BssHII restriction
site, the desulfstohirudin gene and the PLI terminator.
- 22 ~ 1 33508 1
The following examples serve to illustrate the invention, however
are in no way intended to restrict it.
The abbreviations have the following meanings:
bp base pairs
BSA Bovine serum albumin
cpm counts per minute (radioactive decay)
dATP 2'-deoxyadenosine triphosphate
dCTP 2'-deoxycytidine triphosphate
dGTP 2'-deoxyguanosine triphosphate
dTTP 2'-deoxythymidine triphosphate
dNTP mixture of dATP, dCTP, dGTP and dTTP
CIAP alkaline phosphatase from calf intestine
DNA deoxyribonucleic acid
DTT 1,4-dithiothreitol
EDTA ethylene~ir inetetraacetic acid disodium salt
hrs hours
IPTG isopropyl-~-D-thio-galactopyranoside
kb kilobases
min minutes
PL pectin lyase I
PTH phenylthiohydantion
RF-DNA double-stranded replicative form DNA
RNA ribonucleic acid
rpm revolutions per minute
SDS sodium dodecyl sulfate
s~ single-stranded
RT room temperature
Tris tri~(hydroxymethyl)-aminomethane
tRNA transfer RNA
U unit~
~g microgram
vol volume
X-GAL 5-bromo-4-chloro-3-indonyl-~-galactoside
_ - 23 - I 3 3 5 0 8 1
Buffers, media, reagents:
ss-Denhardt 0.02 % ficoll (Slgma), 0.02 %
polyvinylpyrrolidone (Sigma), 0.02 % BSA
~Sigma), 100 ~g/ml denaturated salmon sperm DNA
(Sigma)
Eco~I buffer 0.01 M Tris HCl pH 7.5 0.1M NaCl 0.01 M MgClz.
1 mM 2-mercaptoethanol
HgaI buffer 50 mM NaCl, 10 mM MgClz, 1 mM DTT, 100 ~g/ml BSA,
6 mM Tris-HCl pH 7.4
IPTG 100 mM Isopropyl-~-D-thio-galactopyrano side
(23.8 mg/ml in H2O)
prepare just before use
LB medium 1 % Bacto-tryptone (Difco), 0.5 % Bacto yeast
extract (Difco), 170 mM NaCl, adjusted to pH 7.5
with NaOH
ligation buffer 20 mM Tris-HCl, 10 mM MgClz, 10 mM dithioerythritol,
0.6 mM ATP, pH 7.6
TBE-buffer 1 litre contains 10.8 g Tris, 5,5 g boric acid,
4 ml 0.5 M EDTA (pH 8.0)
TE buffer 10 mM Tris-HCl (pH 7.5), 1 mM EDTA
low TE buffer 10 mM Tris-HCl (pH 7.5), 0.1 mM EDTA
top agar per litre 10 g bacto tryptone, 8 g NaCl, 8 g agar
2xTY medium per litre 16 g bacto tryptone,
10 g yeast extract, 5 g NaCl
X-GAL 2 % (5-bromo-4-chloro-3-indonyl-~-galactoside)
in dimethylformamide prepare just before use
SOC medium 2 % Bacto Tryptone (Gibco), 0.5 7 Yeast-Extract
~Gibco), 10 mM NaCl, 2.5 mM KCl, 10 mM MgClz,
5 mM MgS04, 20 mM Glucose
kinase buffer 50 mM Tris-HCL, 10 mM MgClz 5 mM DDT (pH 7.5)
X-gal plates 0.002 % X-Gal, 0.07 mM IPTG
NET 0.15 M NaCl, 0.015 M Tris-HCl (pH 7.5) lmM EDTA
~n~ ~1 medium 0.6 % NazHPO~, 0.1 % NH4Cl, 0.05 % NaCl,
for E. coli 1 mM MgSO4, 0.01 mM CaClz,
lmM th~r 'ne-Hcl~ 0.2 % glucose
-- - 24 - -- 1 335081
minimal medium 1 liter contains 6 g NaNO3, 0.52 g KCl, 0.52 g
for A. niger MgS04 x 7 HzO, 1.52 g R~2PO4, traces of 2n, Fe,
10 g glucose, adjusted to pH 6.5 with NaOH
complete medium Mycophil-Agar (BBL)
for A. niger
PCT 25 % polyethylene glycol 6000 (Merck, Darmstadt)
in 10 mM Tris-HCl (pH 7.5), 50 mM CaCl2
sporulation medium 10 g/l phytone peptone, 10 g/l glucose, 10 g/l
agar
SSC 0.15 M NaCl, 0.015 M sodium citrate
For plates all media are solidified by addition of 1.5 % Bacto agar
(Difco).
The following strains are used:
E. coli strain HB101: FR,hsdS20(r Bm-B), recA13, aral4, proA2,
lacY1, ~K2, rpsL20(str ), ~-5, mtl-l, supE44, A (Maniatis
et al. (8))
E. coli strain BJ5183: ~, endA, sbcB, recBC, galK, met, strR,
thi-1, b T, hsdR(rK, mK ~ n~h~n (10))-
E. coli strain JM101: supE, thi, ~(lac-proAB), (F',traD36,
E~AB,lacl9Z~M15) (Yanish-Perron et al. (25))
Aspergillus niger strain N756: The A. niger strain N756 has been
selected for high production of pectinolytic complex enzymes.
The following vectors are used:
M13mp phage
The M13mp8,9,i8,19 vectors (28) are derivatives of the single-stran-
ded DNA bacteriophage Ml 3 and are designated to facilitate
DNA sequencing by allowing cloning of DNA fragments at a versatile
polylinker site and the cloning of the same restriction fragment in
both possible orientations. Sequences cloned into these vectors can
readily be used as templates for sequencing reactions or the
production of single-stranded probes using a standard oligodeoxy-
ribonucleotide primer and the Klenow fragment of the E. coli DNA
polymerase I. The vector DNA is carrying the E. coli lac-operon
- 25 - 1 3 3 5 0 8 1
promoter and the genetic information of the first 145 amino acid~ of
B-galactosidase. The polylinker sequences containing multiple
restriction sites are inserted into the lacZ sequence. The poly-
linker retains the lacZ reading frame and the vector gives allelic
complementation of a LacZa host strain, yielding blue plaques on
plates containing IPTG and X-gal. Recombinant phages containing
inserts that destroy the reading frame or otherwise interfere with
expression of the lacZ~ peptide are revealed as colorless plaques.
pUC18 plasmid
The pUC18 plasmid (28) can be used for cloning DNA sequences in the
lacZ~ region providing a detection for transformants containing
recombinant plasmids on the basi~ of their Lac phenotype. Bacteria
harboring plasmids without inserts make blue colonies on indicator
plates (plates with X-gal) whilst those harboring recombinant
plasmids make white colonies. Plasmid pUC18 contains unlque cloning
sites in the lacZ~ region fitting to those of M13mpl8 phage. The
plasmid carries a gene for ampR.
pML 310 plasmid
pML 310 is described in the European Patent Application No. 0168342,
pML310 is characterized through ampR, the trp promoter and a gene
coding for desulfatohirudin, a thrombin inhibitor which naturally
occurs in leeches.
pUN121 plasmid
Plasmid pUN121 I(Nilsson et al. (9)] can be used as a cloning vector
that allows positive selection of transformants harboring plasmids
with DNA inserts. The plasmid contains the cI gene of bacteriophage
lambda, and the tet gene. Bacteria harboring pUN121 are sensitive
for tetracycline since the tet gene is transcribed from the right
promoter of bacteriophage lambda and this promoter can be repressed
by the cI-encoded repressor. Insertion of DNA fragments in one of
the sites in the cI gene inactivates the repressor gene, yielding
1 335081
26 21489-7358
tetracycllne-reslstant transformants. In addltion plasmld pUN121
has a functlonal amP gene so that ampllflcation of plasmld DNA can
be performed under selectlve condltions.
pBR322 Plasmld
Plasmid pBR322 carrles genes for reslstance to the antl-
blotlcs amplclllln (ampR) and tetracycllne (tetR). The plasmld
carrles several unlque clonlng sltes, of whlch some are located ln
elther the amP or tet gene so that lnsertlon of cloned DNA leads
to antlblotlc-sensltlve bacterla.
10 PDJB2 Plasmld
Thls plasmld has been descrlbed by Ballance and Turner
(26)
ExamPle 1: Isolatlon and characterlsatlon of Pectlne lYase I
ExamPle 1.1: Amlno acld sequence determlnatlon of the N-termlnal
part of pectln lYase I
Pectln lyase I ls purlfled from Ultrazym~ (a mlxture of pectlno-
lytlc enzymes obtalned from A. nlqer, Nova Industrles, Copenhagen)ln~analogy to the method descrlbed by F.E.A. van Houdenhoven (1).
Two mg of pectln lyase I are dlalyzed agalnst several llters of
dlstllled water and subsequently lyophlllzed. The proteln ls
dlssolved ln 1.5 ml 100 mM NaHCO3, pH 10.0 and kept at room tem-
perature for 3 hours. Thls treatment turns out to lncrease the
number of steps, whlch can be rellably sequenced by the automatlc
Edman degradatlon method (2). After the alkallne treatment the
proteln ls dlalyzed agalnst 1 llter of dlstllled water, 1 % formlc
acld and dlstllled water subsequently. Automatlc Edman degrada-
tion ls performed ln a Beckman splnnlng-cup sequenator, model 890
C. The lntact reduced and carboxymethylated proteln ls degraded
26a 1 3 3 5 0 8 1 21489-7358
uslng a quadrol slngle-cleavage program (modlflcatlon of Beckman
program 072172 C). The degradatlon of the peptlde ls carrled out
uslng a dlmethylbenzylamlne slngle-cleavage program (Beckman pro-
gram 082773) or the program of Hunkaplller and Hood. To prevent
wash-out of the peptlde, 2.5 mg of cod pa~valbumln ls used as a
carrler (3).
- 27 - 1 33~8~
Phenylthiohydantoin derivatives of amino acids are identified by
high-performance liquid chromatography according to the method of
Frank and Strubert (4). The following N-terminal amino acid sequence
is determined for pectin lyase I:
V-G-V-X4-G-T-P-E-G-F-A
Amino acid X4 is very likely to be ser but its presence has not been
established unambiguously.
xample 1.2: Preparation of cyanogen bromide fragments of pectin
lyase I
~eduction and S-carboxymethylation of pectin lyase I is performed
according to Crestfield et'al. (5). 3 g urea (ultra pure) are
dissolved in S ml of distilled water and stirred with 0.5 g of a
mixed-bed ion-exchanger (Biorad*Ag 50 1-X8) for 1 h. After removal
of the ion-exchange beads, 10 mg EDTA and 200 mg Tris are added to
4 ml of the uréa solution and the pH is adjusted to 8.5 with HCl.
The solution is filled up to a flnal volume of 5 ml in a vlal with
distilled water. Then 5-20 mg of pectin lyase I purified as des-
cribed by F.E.A. van Houdenhoven (1) are added and the vial is
maintained under a nitrogen barrier.
Finally 33 ~1 of B-mercaptoethanol are added and the reduction i9
continued for 4 hr~ at room temperature under a nitrogen barrier.
0.33 ml of a freshly prepared solution (0.268 g iodoacetic acid in
1 ml lN ~aOH) are added under nitrogen to the reaction mixture and
the mixture is kept in the dark for 15 min at room temperature.
The reaction 1~ stopped by addition of B-mercaptoethanol. Subse-
quently the carboxy~ethylated protein is applied to a Sepha-
de ~ -25 gel filtration column (100 ml bed volume~ which is wrapped
in aluminum foil and eluted with 0.5 % formic acid. The protein
fractions are pooled and lyophilized.
- 28 - 1 3 3 5 0 8 1
The carboxymethylated pectin lyase I (2-10 mg) i9 dissolved in 70 %
formic acid and solid cyanogen bromide is added in approx. hundred
fold molar exce~s to methionine of which 1 residue occurs per pectin
lyase I. The reaction mixture is stirred continuously for 24 hrs at
room temperature in a closed reaction vial. Samples of 5 ~1 are
taken at regular time intervals and analyzed on 15 % SDS-PAGE to
check the extent to which the protein is split. After 24 hr~ water
is added and the preparation is partially evaporated by flushing
with nitrogen. This step i8 repeated to remove the formic acid.
The SDS-PAGE analysis identifies, besides some residual pectin
lyase I, two cyanogen bromide peptides, CBI and CBII with apparent
molecular weight of 16.5 kD and 30 kD. Purification of these
fragments is performed by gel permeation chromatography using a
Sephacryl~S200 column (length 190 cm, 0 1 cm) equilibrated in 20 mM
sodium phosphate buffer pH 6.0, 100 mM NaCl, 4 M urea and 1 % (v/v)
~-mercaptoethanol. The CB II fragment appears in two peaks, one peak
eluting even before the residual intact protein which therefore mu~t
represent an aggregate and another peak in between the intact
protein and the small CBI fragment.
xample 1.3: Amino acid sequence determination of the N-terminal
part of CB II of pectin lyase I
200 ~g of ths purified non-aggregated CB II fragment of Example 1.2.
are uRed for the automatic Edman degradations (2) using a Bec~man
spinning-cup sequenator. Conver-qion to the PTH amino acids i8
realized after evaporation of the fraction~ and the addition of
200 ~1 2N HCl in methanol to the residue for 15 min at 65C. The
solution i8 then evaporated again and the reqidue is taken up in
50 ~1 THF/CN3CN (1:1). The PTH-amino acids are identified by NPLC
using a Zorbax CN column (Du Pont) according to
R. Rnecht et al. (6).
The N-terminal amino acid sequence of CB II i8 the following:
V-S-G-V-S-N-I-I-I-Q-N-I-A-V-XIs-D-I-N-Xlg-E
X1s and X1g are amino acid residues which have not been identified.
~ ~~
- 29 - 1 3 3 5 0 8 1
Example 2: Construction of a genomic library of Aspergillus niger
xample 2.1: Isolation of high molecular weight DNA from Aspergillus
niger
The lsolation of high molecular weight A. niger DNA is done
according to Yelton et al. (7). Conidiospores of A. niger strain
N 756 are inoculated in 200 ml lni ~I medium containing 0.1 %
arginine and shaken in 500 ml flasks with one well at 28C on a
rotary shaker for 2-3 days. The mycelium is harvested by filtra-
tion, washed wlth cold 6terile water, frozen and powdered in liquid
nitrogen. The cells are rapidly suspended in 20 ml 50 mM EDTA
pH 8.5, 0.2 % SDS and 20 ~1 diethylpyrocarbonate and lysated by
vigorously shaking for 1 min at room temperature. The lysate is
heated to 68C for 15 min, cooled to room temperature and centri-
fuged for 15 min at 12000 g at RT. 16 ml of the supernatant are
transferred to a new tube and after addition of 1 ml 8 M potassium
acetate pH 4.2 left on ice for 1 hr. The precipitate is centrifuged
at 25000 g for 15 min at 4 C. 12 ml of the supernatant are reco-
vered and the nucleic acids precipitated with 12 ml of isopropanol.
The precipitate i6 pelleted by centrifugation for 1.5 min at 12000 g
and the pellet resuspended in 2 ml TE containing 10 ~g/ml RNAseA
(Boehringer, Mannheim). The DNA fragments are extracted with
chloroform/phenol and precipitated with ethanol as described by
Maniatis et al. (8) at pages 458-459 and 461-462.
xample 2.2: Cloning of high molecular weight DNA fragments from
Aspergillus niger into pUN121
The high molecular weight DNA of Example 2.1. (100 ~g) is pre-
cipitated by centrifugation and the pellet is resuspended in 750 ~1
buffer consisting of Tris-HCl 6 mmol/l, NaCl 50 mmol/l, MgC12
6 mmol/l, pH 7.5. Partial digestions are carried out with Sau3AI,
the concentrations being in the range of 0.25-0.01 U/~g for 60 min
at 37~C. The reactions are terminated by addition of EDTA to final
concentrations of 20 mM.
1 335081
21489-7358
The partlally dlgested DNA fragments are separated on a
0.45 % agarose gel. Lambda DNA dlgested wlth HlndIII ls used as
marker to determlne the slze of the partlally dlgested DNA frag-
ments. The gel reglon contalnlng the deslred fragments ln the
range of 15 kb to 20 kb ls cut out and transferred to the sample
well of an ISCO electrophoretlc concentrator (ISCO GmbH)~ covered
wlth 0.1 TBE and electroeluted at 1 Watt for 90 mln. The DNA
fragments are extracted wlth chloroform/phenol and preclpltated
wlth ethanol.
4 yg of the partlally dlgested DNA fragments are re-
suspended ln H2O and llgated for 15 hrs at 15C to 1 ~g of pUN121
plasmld DNA (Nllsson et al. (9)), llnearlzed wlth BclI, ln a total
volume of 106 ~l llgatlon buffer wlth 6U T4 DNA llgase (Boeh-
rlnger, Mannhelm). 10 ~l allquots of thls anneallng mlxture are
added to 210 ~l of competent E. coll BJ5183 cells, whlch have been
prepared for transformatlon as descrlbed by Hanahan (10). The
cells are kept on lce for 30 mlnutes and heated to 42C for 90
sec, replaced on lce for 2 mln, 800 ~l SOC-medlum are added and
the cells are lncubated at 37C for 1 hr. The cells are spread on
10 cm agar plate contalnlng LB-medlum supplemented wlth 8 mgtl
tetracycllne (SIGMA). The plates are lncubated at 37C for 16
hrs. About 6000 transformed colonles are obtalned characterlzed
by thelr tetracycllne resistance. The efflclency ls about 12000
to 20000 tetracycllne-reslstant colonles per ~g of pUN121 DNA.
The plasmld analysls of 11 randomly chosen recomblnant
clones lndlcates an average DNA lnsert of 10 kb. To represent the
genome of A. nlqer (4.5 x 107 bp) ln the llbrary almost 4 tlmes,
15360 tetracycllne reslstant colonles are plcked and grown
1 335~8~
31 21489-7358
lndlvldually over nlght ln the wells of mlcrotlter dlshes ln LB-
medlum supplemented wlth 8 mg/l tetracycllne. After lncubatlon
glycerol ls added to 50 % v/v and the mlcrotlter dlshes are stored
at -70C.
Example 3: Screenlnq the genomlc llbrarY of A. nlger for nuclelc
aclds related to PLI
Example 3.1: Preparatlon of fllter repllcas of the llbrarY
For the lsolatlon of the pectln lyase I gene from the
DNA llbrary obtalned as descrlbed ln Example 2.2., fllter repllcas
-from the 15360 chosen transformed E. coll BJ5183 cells are made
followlng the method descrlbed by Gergen et al. (11). The cells
are transferred from the mlcrotlter dlshes to agar plates supple-
mented wlth 8 mg/l tetracycllne by uslng a stamp and grown over
nlght at 37C. Convenlently cut Whatman 541 fllter papers (114 x
175 mm per 192 clones) are placed on top of the colonles. After 2
hrs at 37C the fllters are transferred to LB plates contalnlng
250 mg/ml chloramphenlcol (Slgma, St. Louls, USA) and lncubated
over nlght at 37C. The fllters are washed twlce ln 0.5 M NaOH,
twlce ln 0.5 M Trls HCl, pH 7.4, washed twlce ln SSC and are alr
drled. The fllter repllcas can be used for several hybrldlzatlon
experlments, each preceded by the above mentloned washlng steps.
ExamPle 3.2s SYnthesls of ollqonucleotlde mlxtures
The ollgonucleotldes for screenlng the DNA llbrary of
A.nlqer, obtalned as descrlbed in Example 2.2., are syntheslzed
correspondlng to the amlno acld sequence determlned ln Examples
1.1. and 1.3. by uslng the phosphoramldlte method (M.H. Caruthers
(12)), wlth an Applled Blosystem (Model 380B) ollgonucleotlde
syntheslzer.
1 33508 1
31a 21489-7358
3.2.1: Synthesls of an ollqonucleotlde codlnq for the N-termlnus
part of pectln lyase I of AsPerqlllus nlqer
The ollgonucleotlde codlng for the N-termlnus of the
pectln lyase I proteln ls syntheslzed wlth respect to lts amlno-
acld composltlon as determlned ln Example 1.1. Because of genetlc
degeneratlon 256 ollgonucleotldes are requlred to comprlse all
posslbllltles.
Two separate mlxtures of ollgonucleotldes are chemlcally
syntheslzed, because for technlcal reason lt ls necessary to re-
duce the number of nucleotldes ln the mlxture. 90th contaln 128
dlfferent
- 32 - 1 3 3 5 0 8 1
oligonucleotides, each being a complementary strand of the strands
coding for the amino acid sequence T6-P-E-G-F-A11. In the following
they are named mixture 2014 and 2015, and are composed of oligo-
nucleotides as follows:
mixture 2014 3'TGR1 GGRl CTR2 CCR3 AAR3 CG5'
mixture 2015 3'TGR1 GGR1 CTR2 CCR2 AAR3 CG5'
wherein R1 is A, C, G or T, R2 is C or T and R3 is A or G.
xample 3.2.2: Synthesis of an oligonucleotide coding for the
N-terminus part of the C-terminal fragment of the
CNBr decomposed pectin lyase I protein
The oligonucleotide coding for the N-terminuq part of the C-terminal
fragment of the CNBr decomposed pectin lyase I protein is synthe-
sized with respect to its amino acid compoqition as determined in
Example 1.3. A mixture of 108 oligonucleotides is synthesized being
a complementary strand of the strands coding for the amino acid
sequence N134-I-I-I-Q13g, and are composed of oligonucleotides as
follows.
mixture 2060 5'AAR1 ATRz ATR2 ATR2 CAR3 A 3'
herein R1 is C or T, R2 is A, T or C and R3 is A or G.
Example 3.2.3: 32P-labelling of the oligonucleotide mixtures
67 pmoles of each oligonucleotide mixture 2014, 2015 and 2060 of
Example 3.2.1 and 3.2.2 are 5'1abelled using 50 pmoles of [~32PlATP
(Amersham, Buc~ngh- -hire, England, 5000 Ci/mmol). The incubation
is carried out at 37C with 150 units T4 polynucleotide kinaqe (New
England, Nuclear) in 500 ~1 kinase buffer. The ligation reaction of
radioactive labelled ATP to the oligonucleotides is detected by
running an aliquot of the reaction mixtures on a 20 % polyacrylamide
gel followed by autoradiography.
33 1 3 3 5 0 8 1 21489-735BD
Example 3.3 Screenlng of the gene llbrary wlth radloactlve
labelled ollqonucleotlde mlxtures 2014 and 2015
The screenlng of the gene llbrary ls carrled out by
hybrldizatlon wlth the radloactlvely labelled ollgonucleotlde
mlxtures 2014 and 2015 of Example 3.2.1 Batches of 20 fllter
repllcas of the gene llbrary (Example 3.1.) are wetted ln 6 x
NET and are prehybrldlzed ln 200 ml 6 x NET, lxss-Denhardt,
0.1 % SDS at 49.3C for 4 hrs. Then 67 pmoles of the radlo-
actlvely labelled ollgonucleotide mlxture 2014 are added and the
hybrldlzatlons carrled out over nlght at 49.3C. The same
procedure ls carrled out uslng radloactlvely labelled ollgo-
nucleotlde mlxture 2015. The fllters are washed two tlmes for
5 mlnutes ln 2 x SSC, 0.1 % SDS at room temperature, two tlmes
for 1 hr ln 2 x SSC, 0.1 % SDS at 49.3C and one tlme for two
hrs ln 0.2 x SSC, 0.5 % SDS at 49.3C. The fllters are alr
drled and autoradlographed for 3 days uslng KODAK X-omat S0282
fllms.
Wlth the ollgonucleotlde mlxture 2014 33 clones and
wlth the ollgonucleotide mlxture 2015 39 clones are found, whlch
glve a rather strong hybrldlzatlon response. To establlsh a
subllbrary the 72 clones are grown up ln a new mlcrotlter dlsh
and transferred to Whatman 541 fllter as descrlbed ln Example
3.1. Two fllter repllcas of the sublibrary are hybridized wlth
both probes lndlvldually, washed and autoradlographed. Wlth the
ollgonucleotlde 2014 mlxture only the clones obtalned by
hybrldlzatlon wlth the ollgonucleotlde 2014 mlxture hybrldlze.
Llkewlse wlth the ollgonucleotlde 2015 mlxture only the clones
Trade-mark
33a 1 3 3 5 0 8 1 21489-7358D
obtalned by hybrldlzatlon wlth the ollgonucleotlde mlxture 2015
hybrldlze.
Example 3.4s Screenlnq the subllbrarY wlth the ollgonucleotlde
mlxture 2060
The fllter replicas of the sublibrary (72 clones),
obtained ln Example 3.3, are wetted ln 6 x NET and prehybrldlzed
for 4 hrs ln 15 ml 6 x NET, l x ss-Denhardt, 0.1 % SDS at 32C.
8 pmoles of ollgonucleotlde mlxture 2060, radloactlve labelled
as descrlbed ln Example 3.2.3, are added and the hybrldlzatlon
carrled out over nlght at 32C. The fllters are washed two
tlmes for 5 minutes each
.; ,~
~ 33508 1
34 21489-7358
in 2 x SSC, 0.1 % SDS at room temperature, two tlmes for 1 hour
each ln 2 x SSC, 0.1 % SDS at 32C and one tlme for two hours ln
0.2 x SSC, 0.5 % SDS at 32C. The fllters are alr drled and auto-
radlographed for 3 days uslng KODAK X-omat S0282 fllms. 3 posi-
tlve clones are found, all belonglng to the group that hybrldlze
wlth the 2014-probe as descrlbed ln Example 9; one clone ls named
E. coll BJ5183/pCG3Bll ~short 3Bll).
Example 4: Isolatlon of plasmld pCG3Bll and restrlctlon analYsls
thereof
Large plasmld preparatlons (14) are made of the clone
3Bll, obtalned as descrlbed ln Example 3.4. The correspondlng
plasmld, named pCG3Bll, ls analysed by complete restrlctlon dlges-
tlon wlth HlndIII, EcoRI and PstI (all Boehrlnger, Mannhelm) and
electrophoretlc separatlon over a 1 % agarose gel (Flgure 1).
ExamPle 5: Subclonlnq of the EcoRI fraqments of pCG3Bll
contalnlnq the N-termlnal and the C-termlnal fractlons
of the Pectln lYase I qene
ExamPle 5.1: Isolatlon of Sau3AI fraqments of PcG3Bll and
llqatlon lnto M13DNA
1 ~g of plasmld pCG3Bll (Example 4) ls dlgested to
completlon wlth 18 unlts of restrlctlon endonuclease Sau3AI
(Boehrlnger~ Mannhelm) ln 20 ~1 10 mmol/l Trls-HCl, 75 mmol/l
NaCl, 10 mmol/l MgC12, pH 7.2 for 1 hour at 37C. The reactlon ls
termlnated by addltlon of EDTA to a flnal concentratlon of 20 mM.
The DNA fragments are extracted wlth phenol/chloroform preclpl-
tated by ethanol and resolved ln 20 ~1 TE buffer. 100 ng of the
Sau3AI dlgested DNA ls llgated to 20 ng of M13mp8 phage DNA (15)
Trade-mark
1 33508 1
34a 21489-7358
llnearlzed by BamHI dlgestlon (Boehrlnger, Mannhelm). The
llgatlon ls carrled out for 4 hrs., at 15C wlth 1 unlt of T4 DNA
llgase (Boehrlnger~ Mannhelm) ln a total volume of 10 ~l llgatlon
buffer. Competent E. coll JM101 cells are made ln 50 mM CaC12 ln
accordance to the Amersham handbook (16) p. 25. 0.3 ml allquots
of the competent JM101 cells are transferred to
_ 35 _ 1 3 3 ~ 0 8 ~
15 ml sterile culture tubes on ice. S ~l of ligated phage DNA are
added to each tube. The mixtures are kept on ice for 40 min. The
celis are heat shocked to 42C for 3 min and the tubes returned to
the ice bath. For each tube the following mixtures are prepared:
40 ~1 IPTG 100 mM, 40 ~1 X-gal 2 % in dimethylformamide and 200 ~1
E. coll JM101 cells from a fresh exponentially growing culture.
270 ~1 of this mixture are added to each tube containing heat
shocked E. coli JM101 cells. 3 ml of molten top agar (kept at 42C)
sre added to each tube and the tubes are poured onto agar plates.
The plates are incubated inverted at 37C overnight.
xample 5.2: Screening of recombinant phages with the oligonucleo-
tide probe 2060
E. coli JM101 transformed with the recombinant phage DNA show white
plaques on the X-gal containing agar plates of Example 5.1~, 384 of
which are picked and grown individually at 37C in 1.5 ml 2 x TY
medium inoculated with 15 ~1 exponentially growing E. coli JM101
cells. After 6 hrs the 384 cultures are centrifuged for 5 min in an
Eppendorf centrifuge and the phage supernatants stored at 4C.
100 ~1 from each of the 384 supernatants are transferred to four
Gene Screen membranes (New England Nuclear) by using a BioDot
apparatus with 96 slots (BioRad). The membranes are soaked 5 min in
0.5 M NaOH, 1.5 M NaCl and 5 min in 3 M NaCl, 1 M Tris-HCl, pH 5.6,
dried in air and baked in vacuo at 80C for 2 hrs. Finally the four
membranes are prehybridized, hybridized with the oligonucleotide
mixture 2060 radioactively labelled as described in Example 8,
washed ant autoradiographed as described in Example 3.4. From the
ligation experiment of Example 5.1. one positive, recombinant phage
is chosen for further analysis, designated as mp8-3A.
Example 5.3: Sequence analysis of recombinant mp8-3A phage
The supernatant containing phage mp8-3A obtained as described in
Example 5.2., is used to prepare single-stranded and replicative
form DNA (RF-DNA) as described in the Amersham handboo~ (16) at
p. 18-27. The single-stranded templates are sequenced using the
chain terminator method described in the Amersham handbook at
- 36 - 1 3~
p. 30-35. The phage proves to contain the 574 bp Sau3AI fragment
with the predicted nucleotide sequence of oligonucleotide probe 2060
at position 584 to 599.
xample 5.4: Identlfication of the N-terminal and the C-terminal
EcoRI fragments of pectin lyase I gene
The ~equenced EcoRI restriction site of phage mp8-3A (Example 5.3.),
is used to identify and subclone two EcoRI fragments, one con-
taining the C-terminal part of PLI gene, comprising the terminator
region, and one containing the N-terminal part of the gene com-
prising the promotor region. The following two oligonucleotides are
synthesized as described in Example 3.2.
Oligonucleotide 5052: 5'TGGATGATGATGTTGGAGAC3'
starts at position 597, 5' to the central EcoRI-site at posi-
tion 649/650, and extends to position 577 (complementary strand).
Oligonucleotide 5066: 5'AGGTCCAGGACAACACCTAC3'
starts at position 1020, 3' to the central EcoRI-site, and extends
to position 1039.
The oligonucleotide mixtures 5052 and 5066 are radioactive labelled
as described in Example 3.3.
1 ~g of plasmid pCG3Bll (Example 11) DNA is digested to completion
with EcoRI (Boehringer, Mannheim) and the fragments separated on a
1 % agarose gel. The DNA frag~ents are blotted to Gene Screen
membrane (New England Nuclear) as described by the supplier
p. 383-386 and the membranes hybridized with radioactively labelled
probes of oligonucleotides 5052 and 5066 as described by Maniatis
et al. (8) p. 387-389. Probe 5066 hybridizes with a 3.5 kb EcoRI
fragment which contains the C-terminal part and the terminator
region of the PLI gene. Probe 5052 hybridizes with a 2.9 kb EcoRI
fragment containing the N-terminus and the promoter region of the
gene.
~- 1 335081
- 37 -
Example 5.5: Constructlon of pPL29-5 ~d pPL35-5 by recloning of
EcoRI fragments of pCG3B11 into pU~121
4.5 ~g of plasmid pCG3B11 DNA obtained as described in Example 4 are
incubated with 50 units EcoRI (Boehringer, Mannheim) in 50 ~1 0.01 M
Tris-HCl pH 7.5, 0.1 M NaCl, 0.01 M MgCl2, 1 mM mercaptoethanol for
2 hrs at 37C. The DNA fragments are separated on a 1 % agarose gel,
the gel slice containing the 2.9 kb fragment and the 3.5 kb fragment
are eluted as described in Example 5 and the DNA extracted with
phenolJchloroform and precipitated by ethanol. The precipitates are
resuspended in 40 ~1 low TE buffer and 10 ~1 of this solution are
ligated to 100 ng pUN121 (9) linearized by EcoRI digestion. The
ligation is carried out at 15C for 4 hrs with S units T4 DNA ligase
(Boehringer, Mannheim) in 35.5 ~1 20 mmol Tris-HCl, 1 mmol EDTA,
dithioerythritol 5 mmol, 60 mmol KCl, 50 % glycerol, pH 7.6.
17.5 ~1 aliquots of this annealing mixture are added separately to
200 ~1 of competent E. coli HB101 cells, which have been prepared
for transformation by treatment with calcium chloride as described
by Maniatis et al. (8), p. 250. The mixtures are kept on ice for
30 min and heated to 42C for 2 min, then diluted with 1 ml of
SOC-medium and incubated at 3~C for 1 h. The cells are collected by
centrifugation at 2000 g for 5 min. Each cell pellet is resuspended
in 600 ~1 of SOC-medium and spread on three agar plate containing
LB-medium supplemented with 8 mg/l tetracyclin. The plates are
incubated at 37C for 16 h.
The pl~ {~ of 6 recombinant tetR clones are isolated from each
transformation by the method of Birnboim & Doly (17) and analysed by
restriction analysis. One clone cont~ning the 2.9 kb EcoRI fragment
of pCG3Bll is chosen for further analysis and named pPL29-5 (Fig 3).
Another clone cont~n~ng the 3.5 kB EcoRI fragment of pCG3Bll i9
chosen and named pPL35-5 (Fig. 3).
- 38 - 1 3 ~ 5 ~ 8 1
Example 6: Sequence determination of the pectin lyase I gene
Th~ DNA of pPL29-5 (Example 5.5.) containing the N-terminal part of
the PLI gene and the DNA of pPL35-5 (Example 5.5.) containing the
C-terminal part of the PLI gene are isolated as described by
Humphreys et al. (14). Parts of the inserts of plasmids pPL29-5 and
pPL35-5 are obtained by restriction with suitable enzymes. The
fragments are subcloned into M13mp8 and M13mpl8 and sequenced using
the M13 Cloning and Sequencing Kit (M15 Sequencing Kit N.4502,
Amersham) under the conditions given by the supplier (16).
The entire sequence of the 2.7 kb SpeI-NheI fragment, comprising the
complete sequence of PLI gene, is shown in Figure 4. It comprises
688 nucleotides of the promoter region, 1369 residues of the
structural part of the PLI gene and 660 nucleotides of the termina-
tor region.
The sequence of PLI, corresponding to amino acid sequence of the
N-terminus of PLI as determined by amino acid sequence analysis
(Example 1), is preceded by 57 nucleotides coding for the signal
sequence:
M1-K-Y-A-A-A-L-T-A-I-A-A-L-A-A-R-A-A-As7
A computer aided search for consensus sequences of exonlintron
splice ~unction~ aY well as for intron internal sequences (Boel E.
et al. (18) and Hount S.M. (19)) leads up to postulate the presence
of four introns with length of 65 bp, 62 bp, 63 bp and 57 bp
respectively (Fig. 4, underlined).
The sequence of the PLI gene is determined by combination of the
sequences of the EcoRI-SpeI fragment of plasmid pPL29-5 and the
EcoRI-NheI fragment of pPL35-5 (both determined by subcloning
in M13).
__ _ 39 _ 1 3 3 5 0 8 1
Example 7: Construction of expression vectors
Example 7.1: Introduction of a new restriction site in the signal
sequence of the PLI gene
The introduction of a new B~HII site in the signal sequence region
of the PLI gene (sequenced in Example 6) by in vitro mutagenesi~ is
done according to Zoller and Smith (20). An oligonucleotide con-
sisting of 19 residues is synthesized by the method described in
Example 3.2. which is complementary to the DNA sequence (pos. 36-54)
coding for the C-terminal part of the PLI signal sequeDce, with the
exception of nucleotide 10 (45) leading to a C/G transversion (muta-
genic primer). The exchanged nucleotide 45 of the mutagenic primer
is marked by *.
part of PLI signal sequence 5'CCTCGCTGCCCGCGCCGCT3'
36 40 50 54
*
mutagenic primer 5156: 5'CCTCGCTGCGCGCGCCGCT3'
For the in vitro mutagenesis 200 pmols of oligonucleotide 5156 is 5'
phosphorylated with 20 nmols rATP. The reaction is carried out for
1 h at 37C with 10 units T4 Polynucleotide kinase (Boehringer,
Mannheim) in 20 ~1 kinase buffer. The reaction i9 terminated by
heating to 65C for 10 min.
xample 7.2: In vitro muta~enesis of template M13mp8-PL
(Sal-EcoRI) DNA
The first in vitro mutagenesis experiment concerns single stran-
ded DNA from phage M13mp8-PL (SalI-EcoRI), obtained in Example 6,
which contains the 0.8 kB SalI-EcoRI fragment of plasmid pPL29-5,
cont~n~ng 117 nucleotites of the promotor and the N-terminal part
of the PLI gene. 1 pmol single-stranded M13mp8-PL(SalI-EcoRI) DNA is
mixet with 20 pmoles mutagenic primer 5156 (Example 7.1.) snd
10 pmoles universal M13 sequencing primer (N.4511, Amersham) in
10.5 ~1 0.02 M Tris-BCl pH 7.5, 0.01 M MgCl2, 0.05 M NaCl,
0.001 M DDT. The mixture is quickly heated to 56~C and slowly cooled
-- 1 33508 1
21489-7358
to room temperature. 1 ~l 0.2 M Trls HCl pH 7.5, 0.1 MgCl2, 0.01
M DDT, 4 ~1 2 mM dNTP, 1 ~1 10 mM ATP are added to the mlxture, 3
unlts of T4 DNA llgase (Boehrlnger, Mannhelm) and 2 unlts of DNA
polymerase I (Klenow fragment, Amersham) are added and the poly-
merlzatlon reactlon ls carrled out for 15 hrs at 15C. Three
dllutlons of the polymerlzatlon mlxture are made (1:20, 1:100 and
1:500) ln low TE buffer. From each dllutlon 1 ~l and 5 ~l are
added to 300 ~l competent E. coll JM101 cells separately, whlch
have been prepared for transformatlon by the method descrlbed ln
Example 5.1. The cells are poured on X-gal plates and colonles
formlng whlte plaques are obtalned. 100 of the whlte plaques are
toothplcked and transferred to LB plates. The bacterla transform-
ed wlth phage DNA are grown overnlght at 37C and are subsequently
transferred to Whatman 541 fllters as descrlbed ln Example 3.1.
The fllters are washed (Example 3.1.), then prehybrldlzed ln 6 x
NET, 1 x ss-Denhardt, 0.1 % SDS for 30 mln at 67C. The hybrldl-
zatlon ls carrled out at R~ (Example 3.4) for 30 mln wlth 15
pmoles radloactlve labelled (Example 3.3.) ollgonucleotlde 5156
per fllter ln 6 x SSC. After hybrldlzatlon the fllters are washed
for 4 x 40 sec ln 6 x SSC at room temperature and after drylng ln
alr exposed 1 hr to Kodak XAR-5 fllms uslng ln Ilford Screen.
The fllters are washed a second tlme for 5 mln ln 6 x SSC at 72C
(Tm of the mutagenlc prlmer 5156 ls 70C), drled and exposed over
nlght to a Kodak XAR-5 fllm.
Colonles glvlng rlse to posltlve slgnals after the
second washlng step are plcked from the orlglnal LB plate, sus-
pended ln 1 ml LB medlum and heated to 70C for 20 mln. Thls
Trade-mark
1 33508 1
40a 21489-7358
bacterlophage solutlon ls dlluted 1 10, 1 1,000 and 1:100,000 and
10 ~l of each dilutlon ls used to transfect 300 ~l of exponen-
tlally growlng E. coli JM101 cells and poured on X-gal plates. 6
plaques of the 1 100,000 dllutlon are toothplcked lndlvldually
lnto 1.5 ml 2 x TY contalnlng 15 ~1 of exponentlally growlng E.
coll
JM101 cells and grown at 37C for
- 41 - 1 3 3 5 0 8 1
6 hrs. The cultures are centrifuged 5 min in an Eppendorf centri-
fuge, the supernatants stored at 4C (phage stock) and the cell
pellets are used to do RF preparations according to the method of
Birnboim h Doly (17). After restriction analysis with BssHII one
mutant phage bearing a new BssHII site in the PLI SalI-EcoRI
fragment i8 chosen for further experiments and designated as
(M13mpl8-PL(SalI-EcoRI)BssHII/BE5).
xample 7.3: In-vitro mutagenesis of template M13mpl8-PL(SpeI-
EcoRI)
The second in-vitro mutagenesis experiment is carried out with
single-stranded DNA from phage M13mpl8-PL(SpeI-EcoRI), obtained in
Example 6. This recombinant phage contains the 1.4 kb SpeI-EcoRI
fragment of plasmid pPL29-5 and thus 688 nucleotides of the promoter
plus the N-terminal part of the PLI gene. Mutagenesis of this
template is carried out exactly as described in Example 7.2. One
phage bearing the new BssHII site in the PLI SpeI-EcoRI insert is
chosen for four experiments and named respectively M13mpl8-PL(SpeI-
EcoRI)BssHII/AC5.
Example 7.4: The con~truction of plasmid pUBE5
For easier handling the B HI-EcoRI fragment of phage M13mp8-PL
(SalI-EcoRI)BssHII/BE5 obtained as described ln Example 7.2, includ-
ing 130 bp of the promoter region and the N-terminal part of the
PLI gene including the newly introduced BssHII site in the signal
sequence region, i8 subcloned into plasmid vector pVN121 (9) as
illustrated in Fig. 5 and described in the following.
4 llg RF DNA of phage M13mp8-PL (SalI-EcoRI)BssHII/BE5 is isolated
according to Example 5.3. ant is digested to completion with
restriction endonuc-leases BamHI and EcoRI (Boehringer, Mannheim).
The fragments are separated on a 1 % agarose gel and the gel slice
containing the 0.8 kb BamHI-EcoRI fragment, consisting of 117 bp of
the promoter and the N-terminal part of the PLI gene is electro-
- 42 - 13350~
eluted as described in Example 2.2. The DNA is extracted with
phenol/chloroform and precipitated with ethanol. The DNA pellet i8
res~spended in 10 ~1 water (50 ng/~l).
2 ~g of pUN121 are digested to completion with BclI and EcoRI
(Boehringer, Mannheim). The fragments are separated on a 1 % agarose
gel and the 4.0 kb fragment is electroeluted as described in
Example 2.2. After phenol/chloroform extraction and ethanol precipi-
tation the DNA is dissolved in 18 ~1 water (100 ng/~l).
300 ng of the BamHI-EcoRI fragment, comprising the BssHII site, are
ligated to 500 ng of BcII/EcoRI cut pUN121 DNA. The ligation is
carried out for 4 hrs at 15UC with 400 units T4 DNA ligase (Biolabs)
in 20 ~1 of 50 mM Tris-HCl(pH 7,8) 10 mM MgCl2, 20 mM dithiothrei-
tol, 1.0 mM ATP. 10 ~1 of the ligation mix are used to transform
100 ~1 competent E. coli HB 101 cells (8). The cells are plated on
LB plates containing 8 mg/l tetracycline (SIGMA) and incubated
overnight at 37UC.
Plasmid preparations are made from 12 tetR colonies according to the
method of Birnboim & Doly (17) and one plasmid with the desired
restriction pattern shown in Fig. 5 is named pUBE5 and used for
further analysis .
xample 7.5: Introduction of a HgaI restriction ~ite in front of the
desulfatohirudin gene of pML310 and the isolation of
the 0.22 kB HgaI-BamHI gene fragment
For the introduction of a HgaI restriction site in front of the
desulfatohirudin gene (Fig. 6) 8 ~g of plasmid pML310 DNA are
digested to completion with restriction endonuclease EcoRI. The
cleaved DNA is extracted with phenol/ chloroform and precipitated
with ethanol. To remove 5' overhanging ends, 4 ~g of pML310/EcoRI
DNA are digested in 100 ~1 of 150 mM NaCl, 1 mM ZnS04, 30 mM sodium
acetate pH 4.6 and 20 U/ml of nuclease S1 (Sigma) for 45 min
at 37UC.
~ - 43 ~ 1 3 3 5 0 8 1
The DNA is extracted with phenollchloroform and precipitated by
ethanol. The DNA (pML310/EcoRI/S~ resuspended in 100 ~l of 50 mM
Tri~-HCl pH 8.0 and incubated with 2 units of ~lk~l~ne phosphatase
from calf intestine (CIAP, orthophosphoric-monoesterphosphorylase,
EC 3.1.3.1, Boehringer) for one hour at 37C. The enzyme is inacti-
vated at 65C for 1.5 hours. The NaCl concentration i8 adjusted to
150 mM. The dephosphorylated DNA (pML310/EcoRI/Sl/CIAP) is purified
by adsorption to a DE52 (Whatman) ionexchange column in a low salt
buffer (150 mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA). Elution is
done with a high salt buffer solution (1.5 M NaCl, 10 mM Tris-HCl
pH 8.0, 1 mM EDTA). The DNA is precipitated with ethanol and
resuspended in HzO at a concentration of 0.8 mg/ml.
For the introduction of an HgaI site an oligonucleotide of the
formula
5'-AGCGTCGACGCT -3'
is syntheslzed by the phosphotriester method (21). The sequence of
the oligonucleotide is self-complementary contAin~ng the recognition
site -GACGC- for restriction endonuclesse HgaI. Annealing of two
single strands leads to a double-stranded DNA linker~
1.2 ~g of the synthetic single-stranded oligodeoxynucleotide are
phosphorylated in 10 ~l of 60 mM Tris-HCl pH 7.5, 10 mM MgCl2,
S mM DTT, 30 ~Ci of [r-32P] ATP (3000 Ci-mmol , Amersham) and
6 units of T4 polynucleotide kinase (Boehringer) for 30 min at 37C,
followed by a 15 min chase at 37C in the presence of 0.5 mM ATP.
The mixture is further incubated for 10 min at 75C to inactivate
the enzyme. The mixture is cooled to room temperature for annealing.
0.6 ~g (170 pmoles) of the 3ZP-labelled linker DNA are mixed with
2.4 ~g (1.75 pmol ends) of pML310/EcoRI/S1/CIAP and ligated in 20 ~l
of 60 mM Tri~-HCl pH 7.5, 10 mM MgClz, 5 mM DTT, 3.5 mM ATP,
8Q0 units of T4 DNA ligase (Biolabs) for 20 hrs at 15C. The ligase
is inactivated at 85C for 10 min and the excess of linker molecules
is removed by precipitation of the DNA in the presence of 10 mM EDTA
pH 7.5, 300 mM sodium acetate pH 6.0 and 0.54 volumes of isopropan-
1 33508 1
ol. After 30 min at room temperature the DNA is pelleted resuspendedin 45 ~1 of ligation mixture (specified above) and ligated for 6 hrs
at ~5C to form circular DNA.
Aliquots of 1 ~1 and 3 ~1 of the ligation mixture are added to
100 ~1 of calcium-treated, transformation competent E. coli HB101
cells (prepared according to the method of D. H~n~han (10)). The
cells are left on ice for 30 min, then incubated for 3 min st 42C,
cooled on ice for 2 min and then incubated for one hour at 37C in
400 ~1 of SOC medium. The cells are concentratet in 100 ~1 of SOC
medium each plated on LB agar plates containing 50 ~g/ml of ampicil-
lin and are grown overnight at 37C.
12 transformed amp colonie~ are isolated and grown individually in
LB medium containing 100 ~g/ml of ampicillin. Plasmid DNA is
prepared according to the method of D.S. Holmes et al. (22). The
presence of the synthetic oligonucleotide linker is confirmed by
DNA sequencing using a single stranded DNA fragment as primer which
hybridizes to the coding strand of hirudin. One clone which contains
the linker DNA at the correct position in front of the hirudin gene
is referred to as pML310L.
For the isolation of the 0.22 kb HgaI-BamHI desulfatohirudin gene
fragment, 40 ~g of plasmid pML310L are digested to completion with
restriction endonucleases PvuI and BamHI (Boehringer) in 150 ~1
0.01 M Tris-HCl pH 7,5, 0.1 M NaCl, 0.01 M MgCl2, 1 mM 2-mercapto-
ethanol for 2 hrs at 37C. The fragments are separated on a 1 %
agarose gel and the gel slice containing the 0.84 kb PvuI-BamHI
fragment is electroeluted as described in Example 5. After phenoll
chloroform extraction and ethanol precipitation the DNA is resus-
pended in 20 ~1 HgaI-buffer and digested to completion with restric-
tion endonuclease HgaI (Biolabs). The fragments are separated on a
2 % agarose gel and the gel slice containing the 0.22 kb HgaI- BamHI
fragment is eluted as before. After phenol/chloroform extraction and
ethanol precipitation the fragment is recuspended in 55 ~1 sterile
water (0.1 pmol/~l).
- 45 - 1 3 3 5 0 8 1
xample 7.6: Fusion of the PLI signal sequence and the desulfato-
hirudin structural gene
To provide a linker in order to ligate the BssHII site of the signal
sequence (Example 7.2.) coding region of the PLI gene and the HgaI
site of the desulfatohirudin gene (Example 7.5), two oligonucleo-
tide~ are synthesized as described in Example 3.2.
PLI signal sequence I N-terminal amino acids
I of Desulfatohirudin
A~A ALA LEU ALA ALA ARG ALA ALA ALAI VAL VAL
5' 3'l
GCC GCC CTC GCT Gcg cgc gcc gct gctlGTT GTT oligonucleotide 5172
CGG CGG GAG CGA CGC GCg cgg cga cgalcaa caA oligonucleotide 5173
BssHII
(small letters: linker)
300 pmoles of each oligonucleotide are kinased separately with
400 pmoles rATP and 10 units T4 polynucleotide kinase (New England
Nuclear) in 15 ~ll of 50 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 20 mM
dithiothreitol 1.0 mM ATP, 50 ~g/ml BSA. Both kinased oligonucleo-
tides are mixed in a 1:1 ratio, heated to 95C and are slowly cooled
down to room temperature for annealing. The annealed linkers are
stored at -20C.
Example 7.7: The construction of pLHR3
For the construction of a desulfatohirudin expression vector
(Fig. 7) comprising the diminished promotor of PLI, 7 llg of pUBE5
DNA (Example 7.4.) are digestet to completion with restriction endo-
nuclease BssHII (Boehringer), extracted by phenol/chloroform and
precipitated by ethanol. The DNA (1.9 pmol) is resuspended in 10 lll
sterile water. 300 pmole~ of annealed linker 5172/5173
(Example 7.6.) are ligated to 1.9 pmoles of BssHII-cut pUBE5 with
- 1 335081
- 46 -
400 units T4 DNA ligase (Biolabs) in 60 ~1 of 50 mM Tris-HCl
(pH 7.8), 10 mM MgCl2, 20 mM dithiothreitol 1.0 mM ATP,
50 ~g/ml BSA. The ligation is carried out for 15 hrs at l5~C. The
ligase is inactivated by heating to 85C for 10 min. The buffer is
adjusted to 0.01 M Tris-HCl pH 8.0, 0,1 M NaCl, 0.005 M MgCl2, 1 mM
2-mercaptoethanol. 36 units of BamHI (Boehringer) are added and
digestion carried out for 2 hrs at 37C. The fragments are separated
on a 1 % agarose gel and the 3.4 kB BamHI-[BssHII]HgaI-linker
fragment isolated by electroelution of the gel slice followed by
phenol/chloroform extraction and ethanol precipitation. The DNA is
resuspended in 14 ~1 sterile water to a concentration of
0.1 pmoll~l. 0.2 pmols of the 0.22 kb desulphatohirudin HgaI-BamHI
fragment are ligated to 0.1 pmol of the digested pUBE5 DNA. Ligation
is carried out for 15 hrs at 15C with 400 units T4 DNA ligase
(Biolabs) in 10 ~1 of 50 mM Tris-HCl (pH 7.8), 10 mM MgClz, 20 mM
dithiothreitol, 1.0 mM ATP, 50 ~g/ml BSA.
2 ~1 of the ligation mix are used to transform 100 ~1 of competent
E. coli HB101 cells (8), which are subsequently plated on LB dishes
containing 50 mg/l ampicilline,(SIGMA). The DNA of 12 amp colonies
i8 prepared by the method of Birnboim & Doly (17) and analysed by
restriction analysis. 1 clone i9 chosen for sequence analysis by the
dideoxy chain terminator method of Sanger et al. (23). A clone
showing the desired restriction pattern and the correct sequence
within the PLI-signal sequence-desulfatohirudin junction is isolated
and named pLHK3.
Example 7.8: The construction of pLHL5
For the construction of the desulfatohirudin expression vector,
comprising the complete promoter sequence of PLI gene,
10.3 ~g RF DNA of phage M13mpl8-PL(SpeI-EcoRI)BssHII/AC5
(Example 3.3.) are digested to completion with restriction endo-
nuclease BssHII (Boehringer), extracted by phenol/chloroform,
precipitated by ethanol and resuspended in 10 ~1 sterile water to a
concentration of 1.9 pmoles. 300 pmoles of annealed linker 5172/5176
(see above) are ligated to 1.9 pmoles of the BssHII-cut phage DNA as
- 47 ~ 1 33~
deAcribed in Example 7.7. After inactivation of the T4 DNA ligase
the buffer is adjusted to 0.01 M Tris-HCl, pH 7.6, 0.05 M NaCl,
0.01 M MgCl2, 0,014 M DTT. 36 unitA of restriction endonuclease
HindIII (Boehringer) are added and digestion carried out for 2 hrs
at 37~C. The fragments are separated on a 1 % agarose gel and the
1.4 kb HindIlI-lBssHII]HgaI-linker fragment is isolated by electro-
elution as described in Example 2.2. The fragment is resuspended in
15 ~1 sterile water leading to a concentration of 0.1 pmol/~l.
3 ~g of plasmid pBR322 (24) are digested to completion with restric-
tion endonucleases B HI snd HindIII (Boehringer, Mannheim) in 20 ~1
0.01 M Tris-HCL pH 7.5, 0.1 M NaCl, 0.01 M MgClz, 1 mM 2-mercapto-
ethanol and the fragments are separated on a 1 % agarose gel. The
large 4.15 kb HindIII-BamHI fragment is eluted as described in
Example 2.2. and resuspended in 8 ~1 sterile water (0.1 pmol/~l).
0.2 pmoles of the 0.2 kb HgaI-BamHI fragment of desulphatohirudin
and 0.2 pmoles of the 1.4 kb PLI promoter-signal sequence HindIII-
[BssHII]~I-linker fragment are ligated to 0.1 pmol of HindIII/-
BamHI-cut pBR322 for 15 hrs at 15~C. The ligation is carried out
with 400 units T4 DNA ligase (Biolabs) in 10 ~1 of 50 mM Tris-HCl
(pH 7.8), 10 mM MgCl2, 20 mM dithiothreitol, 1.0 mM ATP,
50 ~g/ml BSA. 1 ~1 of the ligation mix is used to transform 100 ~1
competent E. coli HB101 cells (8). 12 ampR colonies are isolated and
the DNA analyzet as described in Example 7.7. One clone is chosen
for further experiments and named pLHL5 (Fig 8).
.
Example 7.9: The construction of pLHLT7
To provide a terminator region to the PLI-deAulfatohirudin expres-
sion system, the 0.7 kb PstI-NheI fragment of plasmid pPL35-5 is
fuAed 3' to the desulphatohirudin gene as illustrated in Fig. 9.
10 ~g of pPL35-5 are digested to completion with PstI (Boehringer).
The DNA is phenol/chloroform extracted and precipitated by ethanol.
The fragments are resuspended in 0.033 M tris-acetate pH 7.9,
0.066 M potassium-acetate, 0.01 M magnesium-acetate, 0.5 mM DTT and
1 33508 1
48 21489-7358
100 ng/ml BSA. 10 unlts T4 DNA polymerase (Boehrlnger) are added
and the reactlon carrled out for 180 seconds at 37C. The
reactlon mlx ls put on lce, 20 nmoles of dATP, dCTP, dGTP, dTTP
each are added, the buffer ad~usted to the above condltlons and
the reactlon carrled on for 35 mln at 37C. After phenol/-
chloroform extractlon and ethanol precipltatlon the DNA ls re-
suspended ln 10 yl sterlle water (1.9 pmoles - 11.4 pmoles blunt
ends). 900 pmoles of klnased and annealed (Example 7.6.) BamHI-
llnkers (Blolabs) are added and the llgatlon ls carrled out for 15
hrs at 15C wlth 400 unlts T4 DNA llgase (Blolabs) ln 60 ~1 50 mM
Trls-HCl (pH 7.8), 10 mM MgC12, 20 mM dlthlothreltol 1.0 mM ATP,
50 yg/ml BSA. After lnactlvatlon of the llgase by heatlng to 85C
for 10 mln, the buffer ls ad~usted to 0.01 M Trls-HCl pH 8.0, 0.1
M NaCl, 5 mM MgC12, 1 mM 2-mercaptoethanol. 20 unlts restrlctlon
endonuclease NheI (Blolabs) are added and dlgestlon ls done for 2
hrs at 37C. The fragments are separated on a 1.2 % agarose gel
and the 0.7 kb NheI-[PstI]BamHI fragment ls lsolated by
electroelutlon as descrlbed ln Example 2.2. The fragment ls
resuspended ln 15 yl sterlle water to glve a concentratlon of 0.1
pmol/yl.
A llgation ls set up wlth 0.2 pmoles 0.7 kb NheI-
~PstI]BamHI termlnator fragment, 0.2 pmoles 1.4 kb HlndIII-
[BssHII]HaaI promoter fragment (Example 7.4.), 0.2 pmoles 0.2 kb
HaaI-BamHI desulfatohlrudln fragment (Example 7.5.) and 0.1 pmoles
pUC18 vector (25) llnearlzed by HlndIII and XbaI. The reactlon ls
carrled out wlth 400 unlts T4 DNA llgase (Blolabs) for 15 hrs at
15C ln 10 yl of 50 mM Trls-HCl (pH 7.8), 10 mM MgC12, 20 mM
dlthlothreltol 1.0 mM ATP, 50 yg/ml BSA. 2 yl of the llgatlon are
1 335081
48a 21489-7358
used to transform E. coll HB101 cells. 12 ampR transformants are
analyzed as descrlbed ln Example 7.6. and the plasmld showlng the
correct fuslon sequences referred to as pLHLT7.
1 335081
49 21489-7358D
ExamPle 8: Construction of a cotransformation sYstem for
A. niger
ExamPle 8.1: Preparation of PCG59D7 containing the pyrA qene of
Asperqillus nlger
300 ng of a 1.1 kb HlndIII fragment of pDJB2 (26)
bearlng part of the N. crassa EY~ gene are radloactlvely label-
led by nlcktranslatlon according to Maniatis et al., (8). The
filter replicas of the gene library (Example 3.1.) are wetted in
6 x NET and prehybridized in 6 x NBT, 1 x ss-Denhardt, 0.1 % SDS
for 4 hrs at 50C. Nick-translated HlndIII fragment ls added
(300 ng/80 fllters) and hybrldlzatlon carrled out for 15 hrs at
50C. After hybridization the fllters are washed 1 x for 5 mln
ln 4 x SSC, 0.1 % SDS at 50C. After drylng ln air the filters
are exposed to KODAK X-Omat S0282 fllms for 3 days. One
strongly hybrldlzing colony, named Escherichia coll BJ5183/-
pCG59D7 (short 59D7) ls lsolated and a large plasmld preparatlon
made thereof (14). The plasmld ls referred to as pCG59D7 and is
used for the transformation in Example 9.2.
Example 8.2: Mutation of A. niqer strain N 756 and isolatlon
of mutants auxotroPhic for urldlne
Selectlon for mutants of A. nlqer strain N 756
speclflcally lacking orotldlne-5'-phosphate decarboxylase
actlvity, can be achieved by positive selection against the
toxic analogue fluoro-orotlc acld (27) ln the presence of
urldlne. 3 x 106 conldlal spores of A. nlger straln N 756 are
~. *
- ~ Trade-mark
-- 1 335081
21489-7358D
plated onto 10 ml of mlnimal medium plates supplemented with 1
g/l arginine and 50 mg/l uridine. The spores are submitted to
short-wave UV-irradiatlon (2600 ~), at a dosage whlch results ln
0.5 % survlvlng colonles. After 2 days of incubatlon at 28C,
when the outgrowing mycelia ls sllghtly vlslble, 10 mg of
fluoro-orotlc acld are added to each plate and lncubatlon
contlnued for another 2-3 days. Fluoro-orotlc acld reslstant
colonies appear as heavily growlng and sporulatlng colonies on a
background growth of whitlsh sensltive mycelia. From about
40'000 survlvors of mutagenic treatment 8 mutants are isolated.
2 of them which are reslstant to fluoro-orotlc acld wlthout
urldlne requlrement are not followed further. 6 of them have a
urldlne auxotrophy.
Heterocaryons are made by growlng a mlxture of
conldial spores of two fluoro-acid resistant mutants each on
complete medium overnlght. Blocks of mycella are transferred to
mlnlmal medlum. Mutants complementary to each other ln thelr
mutatlon show outgrowth of prototrophlc heterocaryotlc mycella
at the edges, stralns wlth a mutatlon ln the same allele do not.
The 6 urldlne-requlrlng mutants from straln N 756 fall, as in S.
cerevlslae (27), lnto 2 complementatlon groups, One of each - An
8 and An 10 - ls used for transformatlon.
Example 8.3: Preparation of protoplasts and transformatlon of
uridlne-mutants An 8 and An 10 of A. nlger N 756
Conldlal spores of mutants An 8 and An 10 are grown
separately on slants for 4 - 5 days at 28C ln complete medlum.
2 x 108 conldiospores of An 8 and An 10 are used to inoculate
i- ',~
-- ~ 335081
50a 21489-7358D
separately 200 ml mlnimal medlum supplemented wlth 1 g/l
arginlne and urldlne (Example 8.2). After 20 hrs growth at 28C
and 180 rpm. the mycellum ls harvested by flltratlon through
Mlracloth , washed twlce wlth 10 ml 0.8M KCl 50 mM CaC12 and
resuspended ln 20 ~1 0.8M KCl, 50 mM CaC12, 0.5 mg/ml Novozym
234 (Novo Industrles). The mlxture ls lncubated ln a shaklng
waterbath (30C, 50 rpm.) untll maxlmum protoplast release can
be detected mlcroscoplcally (90 - 120 mln). The protoplast
suspenslon ls flltrated through a glass wool plug ln a funnel to
remove mycellal debrls. The protoplasts are pelleted by mlld
centrlfugatlon (10 mln, 2000 r.p.m.) at room temperature and
washed twlce wlth 10 ml 0.8M KCl 50 mM CaC12. The protoplasts
are flnally resuspended ln 200-500 ~1 0.8M KCl, 50 mM CaC12 to
glve a concentratlon of 1 x 108/ml.
For transformatlon 200 ~1 allquots of protoplast
suspenslons (An 8 and An 10) are lncubated separately together
wlth solutlons conslstlng of 10 ~g/20 ~1 pCG59D7 DNA, 50 ~1 PCT,
(10 mM Trls-HCl pH 7.5, 50 mM CaC12, 25 % PEG 6000). The
lncubatlon mlxtures are kept on lce for 20 mln, another 2.0 ml
of PCT are added and the mlxtures lncubated for further 5 mln at
room temperature. 4 ml 0.8M KCl, 50 mM CaC12 are added and 1 ml
allquots of these flnal
Trade-mark
- 51 - 1 3 3 5 0 8 1
transformation solutions are mixed with liq~efied ini ~1 agar
medium (MM + 1 gll arginine + 10 g/1 Bacto-Agar (Difco)) stabilized
with 0.8M KCl. The mixtures are immediately poured on agar plates of
the same medium and incubated at 28C.
After 3 days of growth at Z8C, stable transformants appear as vigo-
rously growing and sporulating colonies on a background growth of
many hundred small presumably abortive transformants.
Transformation with pCG59D7 is only successful in mutant An 8, not
in An 10. An 8 is therefore considered to lack the ornithine-5l-
phospate decarboxylase activity, which is complemented by the
full-length gene-product of selection plasmid pCG59D7. In An 8 about
20-30 transformants are obtained per ~g pCG59D7.
Ten transformants of An 8 are picked, subcultured on inl -I medium
and the DNA is isolated and analysed for the presence of pCG59D7
sequences. DNA of the transformants is isolated after powdering of
the frozen mycelia in liquid nitrogen according to a published
procedure (7). 1 ~g DNA of each transformant is digested to comple-
tion with Xho I, fractionated by electrophoresis over 1 % agarose
gels and blotted to nitrocellulose filters according to Mania-
tis (8), p. 382-386. The blots are hybridized with [~-32p~-labelled
pUN 121 DNA following standard procedure~ as described by Maniati~
et al. (8), p. 387-389. The various hybridization patterns obtained
indicate chromosomal integration of the transforming plasmid pCG59D7
at various location~ into the host genome.
- 52 - 1 3 3 5 0 8 1
xample 9: Expression of the desulfato-hirudin gene under the
control of PLI promoter in A. niger
xample 9.1: Cotransformation of mutant An 8 with pCG59D7, pLHR3,
pLHL5 or pLHLT7
Protoplasts of mutant An 8 are prepared according to Example 8.2 and
are cotransformed with 5 ~g of selection plasmid pCG59D7 and either
10 ~g of plasmid pLHK3 (Example 7.7.), 10 ~g of plasmid pLHLS
(Example 7.8.) or 10 ~g of pla6mid pLHLT7 (Example 7.9.), following
the procedure as described in Example 8.2.
Transformed An 8 cells are selected on ~n1 ol medium for uridine
prototrophy as described in Example 8.2. 50 transformants of each
cotran~formation experiment are randomly picked and analysed for
desulfato-hirudin expression. Desulfato-hirudin activity is tested
in a thrombin inhibition assay acording to the chromogenic peptide
substrate manufacturer's instructions (Boehringer, Mannheim, FRG).
xample 9.2: Expression of desulfato-hirudin under control of the
PLI promoter in transformants of mutant An 8
Conidial spores from transformants obtained according to
Example 8.3. are individually precultured into 50 ml of a pre-
culture medium (Pectin Slow Set L (Unipectin, SA, Redon, France)
3 gll, NH4Cl 2 gll, RH2P04 0.5 gll, NaCl 0.5 gll, MgzS04 x 7 HzO
0.5 gll, Ca2S04 x 2 HzO 0.5 g/l, pH 7.0). The preculture is lncuba-
ted for 72 hrs at 250 rpm and 28C. 10 % of the preculture is used
to inoculate 50 ml of main culture medium (Soybean flour 20 g/l,
pectin Slow Set 5 g/l). The culture is grown up for 72-96 h (highest
rate of pectin lyase production) at 250 rpm and 28C (referred to as
inducing condition~). Transformants of mutant An 8 are also grown
under non-inducing conditions in Phytone peptone 10 g/l, glu-
cose 10 gll instead of main culture medium.
At various time~ (every 20 hr~) samples are taken, the cells are
pelleted by centrifugation and broken by ultrasonic desintegration.
Supernatant and cell extracts are both tested for desulfato-hirudin
~ 53 ~ 21489-7358
1 33508 ~
actlvlty as de-crlbed ln ExsmplQ 9.1. No de~ulfato-ll~rudln nctlvlty
1~ d-t-ct-d follo~lng cotran~format1On wltll pl~mld pLIIK3. pLllL5 and
pLHLT7 contalnlng the full-lQngth PLI promoter Hr~ both ~bl~ to
drlvQ expre~slon of de~ul~nto-hlrudln ln A. nl~er mutsnt An 8. Of
the 50 tr~nsformsnts taken from the cotran~Eorm0tlotl experlmento
(Exampla 9.1.) 10 esch ~ho~ de~ulfAto-hirudln actlvlty ln the
medlum.
Expres-lon of desulfstohlrudin in mutsnt An 8 under control of the
full-length PLI promoter and maklng uRe of the PLI slgnnl peptlde 18
therQfore regulated by the lnducing ~ub~trate pectln and lends to
secretlon of desulfatohlrudln into the medlum.
DepoRltlon of Mlcroorganlsmr
The follovlng mlcroorganlsms were depoRited under the Dudape~t
Treaty wlth Deut~che SammlunR von Mlkroorganl~men, Cri~bnch~tr. 8,
D-3400 Cottlngen:
Hlcroorganlsma Dep. Nr. Date of Dep.
Escherlchla coll DJ51831pCC3D11 DSM 3916 December 11, 1986
Asperglllus nlger An8 DSM 3917 December 11, 1986
Escherlcllia coll ~J5183/pCC59D7 DSM 3968 February 2, 1987
~ 54 ~ 133~1
Ref erences
1) F.E.A. van Houdenhoven. Ph.D. Thesius Agricultural University,
~ageningen in Communications Agricultural University Wageningen,
The Netherlands 75-13 ~1975).
2) Edman P., and Begg G. (1967) Eur. J. Biochem. 1, 80-91.
3) J.M. Vereijken, J. Hof~teenge, H.J. Bak and J.J. Beintema.
Eur. J. Biochem. 113, 151 (1980).
4) G. Frank and W. Strubert. Chromatographia 6, 522 (1973).
5) A.M. Crestfield, S. Moore and W.H. Stein. J. Biol. Chem. 238,
622 ~1963).
6) Rnecht et al., Anal. Biochem. 130, 65 (1983).
7) Yelton M.M., Hamer J.E., Timberlake W.E. (1984), Proc. Natl.
Acad. Sci. USA 81, 1470-1474.
8) Maniatis T., Fritsch E.F., Sambrook J., Molecular cloning, a
laboratory manual, Cold Spring Harbor Laboratory (1982).
9) Nilsson B., Uhlen M., Josephson S., Gatenbeck S. and Philip-
son L. (1983). Nucleic Acids Research 11, 8019-8030.
10) ~n~hAn D., (1983). J. Mol. Biol. 166, 557-580.
11) Gergen J.P., Stern R.H., Wensin~ P.C. (1979). Nucleic Acids
Research 7, 2115-2136.
12) M.H. Caruther, Chemical and Enzymatic Synthesis of Gene Frag-
ments: 8 laboratory manual, Verlag Chemie (1982)
14) Humphreys GØ, Willshaw G.A., Anderson E.S. (1975). Biochimica
et Biophysica Acta, 383, 457-463.
15) ~b~ J. (1983), Methods in Enzymology 101, 21-78.
16) M13 c~ ng ant sequencing handbook, Amersham International plc.
B~ ngh -h~re~ ~ngl~n~
17) Birnboim H.C. & Doly J. (1979). Nucleic Acids Res 7, 1513-1523.
18) Boel E., Han~en M.T., H~ort I., Hoegh I., Fiil N.P. (1984). EMB0
J. 3, 1581-lS85.
19) Mount S.M. (1982). Nucleic Acid~ Res.10, 459-472.
20) Zoller M.J. ~ Smith M. (1984). DNA 3, 479-488.
21) Ita~ura et al., J. Am. Chem. Soc. 103, 706 (1981).
1 33508 1 21489 7358
22) llolm-~ D.S., Qul~ley M. (1981). Anal Dloche~ 114, 193-197.
23) SAnger T., Nlckler S., Coul~on ~.R. (1977). Proc. N~tl. Acad.
Scl. USA 24, 5463-5467.
24) ~olivar F., Rodrlgue~ R.L., Greene P.J., ~etl~ch M.C., lleln-
eker IJ.L., ~oyer H., Crora J.ll., Falkow S. (1977). Cene 2,
9S-113.
25) Yani~l~-Perron C., Vlelra J., Hesnlng J. (1985).
Gene 33, 103-119
26) ~sllance D.J. and Turner C. (1985), Cene 36, 321-331
27) ~oeke J.D., Lacroute F., Flnk C.R.
Hol. Gen. Ce~et. 1984, 197, 345-346
26) Norr~nder, J. et ol., Cene 26, 101-106 (1933)
