Note: Descriptions are shown in the official language in which they were submitted.
39~3~
5-1703811-3/=
Bacillus thurin~iensis transformation
The present invention describes a process that for the first time renders
possible a direct and targeted genetic manipulation of Bacillus
thuringiensis and the closely related B. cereus using recombinant DNA
technology, based on an efficient transformation process for the said
Bacillus species.
The present invention furthermore relates to the construction of plasmids
and "shuttle" vectors and to the B. thuringiensis and/or B. cereus
strains that have been transformed therewith.
The present invention also relates to a process for inserting and, if
desired, expressing genes or other useful DNA sequences in Bacillus
thuringiensis and/or Bacillus cereus, but especially to a process for
inserting and expressing protoxin genes.
The present invention also includes a process for the direct cloning and,
if desired, expression and identification of novel genes or other useful
DNA sequences in Bacillus thuringiensis and/or Bacillus cereus, as a
result of which it is possible for the first time to establish gene banks
directly in Bacillus thuringiensis and/or Bacillus cereus and to express
them therein.
Bacillus thuringiensis belongs to the large group of gram-positive,
aerobic, endospore-forming bacteria. Unlike the very closely related
species of Bacillus, B. cereus and B. anthracis, the majority of the
hitherto known B. thuringiensis species produce in the course of their
sporulation a parasporal inclusion body which, on account of its
crystalline structure, is generally referred to also as a crystalline
body. This crystalline body is composed of insecticidally active
crystalline protoxin proteins, the so-called ~-endotoxin.
- 2 - ~33~73~
These protein crystals are responsible for the toxicity to insects of
B. thuringiensis. The ~-endotoxin does not exhibit its insecticidal
activity until after oral intake of the crystalline body, when the latter
is dissolved in the alkaline intestinal juice of the target insects and
the actual toxic component is released from the protoxin as a result of
limited proteolysis caused by the action of proteases from the digestive
tract of the insects.
The ~-endotoxins of the various B. thuringiensis strains are distinguished
by high specificity with respect to certain target insects, especially
with respect to various Lepidoptera, Coleoptera and Diptera larvae, and
by their high degree of activity. Further advantages in using ~-endotoxins
of B. thuringiensis reside in the obvious difficulty that the target
insects have in developing resistance to the crystalline protein and in
the fact that the toxins are harmless to humans, other mammals, birds,
fish and insects, with the exception of the above-mentioned target
insects.
The insecticidal potential of B. thuringiensis protoxins was recognisedvery early on. Since the end of the twenties B. thuringiensis prepara-
tions have been used as bioinsecticides for controlling various diseases
caused by insects in cultivated plants. With the discovery of
B. thuringiensis var. israelensis by )Goldberg and Margalit (1977) and
B. thuringiensis var. tenebrionis by )Krieg et al. (1983) it was
possible for the range of use of B. thuringiensis to be extended even to
mosquito and beetle larvae.
With the introduction of genetic engineering and the new possibilities
resulting from it, the field of B. thuringiensis toxins has received a
fresh impetus.
For example, the cloning of ~-endotoxin genes in foreign host organisms,
such as, for example, in E. coli, is already routine. The result of this,
meanwhile, has been that the DNA sequences of a whole series of
~33~73~
-- 3 --
~-endotoxin genes are now known (for example )Schnepf H.E. and
Whiteley H.R., 1981; 4)Klier A. et al., 1982; 5)Geiser M. et al., 1986;
)Haider M.Z. et al., 1987).
Most of the B. thuringiensis species contain several genes that code for
an insecticidally active protein. These genes, which are expressed only
during the sporulation phase, are in the majority of cases located on
large transferable plasmids (30 - 150 Md) and can therefore very easily
be interchanged between the various B. thuringiensis strains and between
B. thuringiensis and B. cereus, provided these are compatible
( )Gonzalez J.M. et al., 1982).
The protoxin genes of B. thuringiensis var. kurstaki belong to a familyof related genes, various of which have already been cloned and
sequenced. This work has been carried out especially in an E. coli
cloning system.
The cloning of B. thuringiensis genes has thus so far essentially been
limited to some few and exclusively heterologous host systems, of which
the E. coli system is the best researched and understood.
In the meantime, however, reports have also been published on the
successful cloning and expression of protoxin genes in other host
systems, such as, for example, in B. subtilis ( )Klier et al., 1982),
Pseudomonas fluorescens ( )Obukowicz M.G. et al., 1986), and
Saccharomyces cerevisiae (EP 0 238 441). The insertion and expression of
the ~-endotoxin gene in plant host cells has also been successful
(EP 0292 435).
In cloning in E. coli, advantage is taken of the fact that some protoxin
genes happen to contain, in addition to gram-positive promoters, also an
E. coli-like promoter. These promoter-like DNA sequences make it possible
for the B. thuringiensis protoxin genes to be expressed also in
heterologous host systems, provided these are capable of recognising the
above-mentioned control sequences.
- 4 - ~' 33~731
After breaking open the host cells, the expressed protoxin proteins canthen be isolated and identified using known methods.
It has since been demonstrated, however, that E. coli-like promoters are
not present in all protoxin genes (9)Donovan et al., 1988), and
consequently so far only very specific protoxin genes that meet the
above-mentioned prerequisites can be expressed and thus identified in
heterologous host systems.
The cloning of genes outside the natural host organism and the use of
these strains as bioinsecticides in practice is thus associated with a
number of disadvantages, some of which are serious:
a) Expression of B. thuringiensis protoxin genes from the native
expression sequences is possible only in certain cases.
b) Generally there is no, or only a slight, secretion of expressed
foreign proteins.
c) Correct folding of the ~-endotoxins is not always guaranteed in the
reducing medium of heterologous host cells, and this could result in an
undesirable change in the specific activity or in the host range of the
toxins.
d) If expression occurs at all, the expression rates of the cloned
foreign genes among the native expression sequences are mostly only low.
); )Schnepf and Whitley (1981; 1985) estimate that the B. thuringiensis
toxin cloned in E. coli constitutes only 0.5 % to 1 % of the total cell
protein of E. coli, whereas the crystalline protein in B. thuringiensis
amounts to between 30 % and 40 % of the dry weight of sporulating
cultures. These considerable discrepancies between the expression rates
may possibly be attributed to the lack of sporulation-specific control
signals in the heterologous host systems and to difficulties in the
recognition of the B. thuringiensis promoters and/or to problems in the
post-translational modification of the toxin molecule by the foreign
host.
~33~73~
e) Many of the host strains generally used for expression are
toxicologically not as harmless as B. thuringiensis and B. cereus.
f) B. thuringiensis and B. cereus form a natural major component of
microbial soil flora, which is not true of most of the host strains
generally used for expression.
The problems and difficulties mentioned above could be overcome if the
said B. thuringiensis genes could be cloned directly in the homologous
host system where it is possible to use the natural gram-positive
promoters of the protoxin genes for the expression.
As yet, however, there is no process that would make B. thuringiensis,
this very important bacterium from the commercial point of view, amenable
to direct genetic modification, and that would consequently render
possible, for example, efficient reinsertion of a cloned protoxin gene
into a B. thuringiensis strain.
The reason for this can be regarded, in particular, as being the fact
that the development of an efficient transformation system for
B. thuringiensis and the closely related B. cereus that would ensure
adequately high transformation rates and consequently render possible the
application also to B. thuringiensis of established rDNA techniques has
not as yet been successful.
The processes used so far to produce new B. thuringiensis strains having
novel insecticidal properties are based chiefly on transfer by
conjugation of plasmid-encoded protoxin genes.
Successful reinsertiOn of a cloned B. thuringiensis crystalline proteingene into B. thuringiensis has to date been described only in one case
(ll)Klier A. et al., 1983), but in that case too, owing to the lack of a
suitable transformation system for B. thuringiensis, it was necessary to
resort to transfer by conjugation between B. subtilis and
B. thuringiensis. Furthermore, in this process described by Klier et al.
E. coli is used as intermediate host.
~3~73~
-- 6 --
The processes of transfer by conjugation, however, have a whole series of
serious disadvantages that makes them appear unsuitable for routine use
for the genetic modification of B. thuringiensis and/or B. cereus.
a) The transfer of plasmid-encoded protoxin genes by conjugation is
possible only between B. thuringiensis strains and between B. cereus and
B. thuringiensis strains that are compatible with one another.
b) With transfer of plasmids by conjugation between more distant strains~
often only a low transfer frequency is achieved.
c) There is no possible way of regulating or modifying the expression of
the protoxin genes.
d) There is no possible way of modifying the gene itself.
e) If several protoxin genes are present in one strain the expression of
individual genes may be greatly reduced as a result of the so-called
gene-dosage effect.
f) Instabilities may arise as a result of a possible homologous
recombination of related protoxin genes.
Alternative transformation processes, which have since been used
routinely for many gram-positive organisms, have proved unsuitable both
for B. thuringiensis and for B. cereus.
One of the above-mentioned processes is, for example, the direct trans-formation of bacterial protoplasts by means of polyethylene glycol
treatment, which has been used successfully in the case of many
Streptomyces strains ( )Bibb J.J. et al., 1978) and in the case of
B. subtilis ( )Chang S. and Cohen S.N., 1979), B. megaterium
( )Brown B.J. and Carlton B.C., 1980), Streptococcus lactis
(15)Kondo J.K. and McKay L.L., 1984), S. faecalis ( )Wirth R. et al.),
Corynebacterium glutamicum ( )Yoshihama M. et al., 1985) and numerous
other gram-positive bacteria.
_ 7 _ ~3 3~7 3 '1
To use this process, the bacterial cells must first of all be convertedto protoplasts, that is to say the cell walls are digested using lytic
enzymes.
Another prerequisite for the success of this direct transformation
process is the expression of the newly introduced genetic information and
the regeneration of the transformed protoplasts on complex solid media
before successful transformation can be detected, for example using a
selectable marker.
This transformation process has proved unsuitable for B. thuringiensis
and the closely related B. cereus. As a result of the high resistance of
B. thuringiensis cells to lysozyme and the very poor regenerability of
the protoplasts to intact cell wall-containing cells, the rates of
transformation achievable remain low and difficult to reproduce
( )Alikhanian S.J. et al., 1981; 19)Martin P.A. et al., 1981;
)Fischer H-M et al., 1984).
With this process it is possible therefore, at the most, for very simple
plasmids, which are unsuitable for work with recombinant DNA, to be
inserted at a low frequency into B. thuringiensis or B. cereus cells.
Individual reports on satisfactory rates of transformation that it has
been possible to achieve using the afore-described process rely on the
formulation of very complex optimising programmes, but these programmes
are always applicable specifically to one particular B. thuringiensis
strain only and involve high expenditure in terms of time and money
(21)Schall D., 1986). Such processes are therefore unsuitable for routine
application on an industrial scale.
As the intensive research work in the field of B. thuringiensis genetics
demonstrates, there is substantial interest in developing new processes
that would make B. thuringiensis or the closely related B. cereus
amenable to direct genetic modification and would thus, for example,
- 8 - ~3 3 ~ ~ 3 ~
render possible the cloning of protoxin genes in the natural host system.
Despite this research there are still no satisfactory solutions to the
existing difficulties and problems.
Suitable transformation processes that render possible a rapid, efficient
and reproducible transformation of B. thuringiensis and/or B. cereus with
an adequately high transformation frequency are not available currently,
and neither are suitable cloning vectors that permit the application also
to B. thuringiensis of the recombinant DNA techniques already established
for other bacterial host systems. The same is true for B. cereus.
This object has now surprisingly been achieved within the scope of the
present invention by the use of simple process steps, some of which are
known.
The present invention thus relates to a novel process, based on
recombinant DNA technology, that for the first time renders possible a
direct, specifically controlled and reproducible genetic manipulation of
B. thuringiensis and of B. cereus by transforming Bacillus thuringiensis
and/or Bacillus cereus with high efficiency by means of a simple
transformation process using a recombinant DNA that is suitable for the
said genetic manipulation of Bacillus thuringiensis and/or Bacillus
cereus.
The present invention furthermore relates to a process for inserting,
cloning and expressing genes or other useful DNA sequences, but
especially protoxin genes, in B. thuringiensis and/or B. cereus, which
comprises:
a) isolating the said genes or DNA;
b) if desired operably joining the isolated genes or DNA to expression
sequences that are capable of functioning in Bacillus thuringiensis
and/or B. cereus;
c) introducing the genetic constructs from section b) into Bacillus
thuringiensis and/or B. cereus cells by transformation using suitable
vectors; and
d) if desired expressing a corresponding gene product and, if desired,
isolating it.
~ 3 3 n;! 7 ~ ~
The present lnventlon also lncludes a direct process
for clonlng, expresslng and ldentlfylng genes or other useful
DNA sequences, but especlally protoxln genes, ln B.
thurlnqiensls and/or B. cereus, whlch comprlses:
a) dlgestlng the total DNA of Baclllus thurlnqlensls
uslng sultable restrlctlon enzymes;
b) lsolatlng from the resultlng restrlctlon fragments
those of sultable size;
c) lnsertlng the sald fragments lnto a suitable vector;
d) transformlng Baclllus thurlnqlensls and/or B. cereus
cells wlth the sald vector; and
e) locatlng novel DNA sequences uslng sultable
screenlng methods and, lf deslred, lsolatlng them from the
transformants.
The present lnventlon provldes a process for
lnsertlng and clonlng DNA sequences ln gram posltlve bacterla
selected from the group conslstlng of Baclllus thurlnqlensls
and Baclllus cereus, comprlslng:
(a) lsolatlng the DNA to be lntroduced;
(b) clonlng the thus lsolated DNA ln a clonlng vector
that ls capable of repllcatlng ln a bacterlal host cell
selected from the group conslstlng of Baclllus thurlnglensls
and Baclllus cereus cells ln a heterologous clonlng system;
(c) dlrectly lntroduclng the thus cloned vector DNA lnto
lntact cells of sald bacterlal host cell vla electroporatlon
at a transformatlon rate whlch overcomes the restrlctlon
barrler present ln the sald bacterlal cells; and
C
21489-7728
~33~-J ~
- 9a -
(d) cultivatlng the thus transformed bacterial cells and
lsolating the thus cloned vector DNA. In a preferred
embodiment the DNA of step (a) is obtainable by digestlng
total DNA of a bacterial donor selected from Bacillus
thuringlensls and Baclllus cereus.
The present invention also provides a process for
inserting, cloning and expressing DNA sequences in gram
positlve bacterla selected from the group consisting of
Bacillus thurinqiensis and Baclllus cereus, comprislng:
(a) isolatlng the DNA to be introduced and optionally
llgating the thus isolated DNA with expresslon sequences that
are capable of functioning in bacterial cells selected from
the group conslstlng of Bacillus thurlnqiensls and Baclllus
cereus cells;
(b) cloning the thus isolated DNA in a cloning vector
that is capable of repllcating ln a bacterial host cell
selected from the group consisting of Bacillus thurinqiensis
and Bacillus cereus cells in a heterologous cloning system;
(c) directly introducing the thus cloned vector DNA into
lntact cells of sald bacterial host cell via electroporation
at a transformation rate which overcomes the restrlction
barrier present in the said bacterial cells; and
(d) cultivatlng the thus transformed bacterial cells and
lsolatlng the thus cloned vector DNA and the expressed gene
product. In a preferred embodlment a suspenslon of host cells
ls prepared ln an aerated medium which allows for the growth
of the cells. The culture medium preferably comprlses
,~,, . ~ .
21489-7728
- 9b - ~ e~ 1
a) complex nutrlent medla wlth readily asslmllable
carbon and nltrogen sources that are conventlonally employed
for culturlnq aeroblc Baclllus species; or
b) fully synthetlc or seml-synthetic nutrient medla
that contaln
bl~ a complex or alternatlvely a defined readlly
asslmilable carbon and nltrogen source or a combinatlon of the
two and also
b2) essential vltamlns and metal lons.
The inventlon further provides a bifunctional vector
that when used ln such a process as deflned above, apart from
belng capable of repllcating in bacterlal cells selected from
the group conslsting of B. thurlnqiensls and B. cereus cells,
ls capable of repllcatlng ln at least one other heterologous
host organlsms and that ls ldentlflable ln both the homoloqous
and the heterologous host system and that comprlses under the
control of expression sequences that are capable of
functioning ln bacterial cells selected from the group
consisting of Bacillus thurinqlensis and Bacillus cereus cells
a structural gene encoding a 6-endotoxin polypeptide that
occurs naturally ln B. thurinqiensis, or for a polypeptlde
that has substantlal structural homologies therewlth and has
stlll substantlally the toxiclty propertles of the sald
crystalline 6-endotoxin polypeptide.
The lnvention also provides a process for the
identificatlon of new 6-endotoxin encoding genes in Bacillus
thurinqiensls, which process comprlses
'C
,.. . .
21489-7728
L~3~73'~
-- gc --
(a) digestlng the total DNA of Bacillus thurlnglensls
uslng a restrlctlon enzyme;
(b) lsolatlng from the resultlng restrlctlon fragments
those of the requlred slze;
(c) lnsertlng sald fragments lnto a DNA clonlng vector;
(d) constructlng a genomlc DNA llbrary by transformlng
Baclllus thurlnqlensls host cells wlth sald vector uslng a
process accordlng to clalm l;
(e) screenlng the thus obtalnable DNA llbrary for new
6-endotoxln encodlng genes.
Apart from structural genes it ls obviously also
posslble for any other useful DNA sequences to be used ln the
process accordlng to the lnventlon, such as, for example, non-
codlng DNA sequences that have a regulatory functlon, such as,
for example, "antl-sense DNA".
The process of the lnventlon thus opens up a large
number of new posslbllltles that are of extraordlnary lnterest
from both sclentlflc and commerclal polnts of vlew.
For example, lt ls now posslble for the flrst tlme
to obtaln lnformatlon on a genetlc level about the regulatlon
of ~-endotoxln synthesis, especially ln respect of
sporulatlon.
Also, lt should now be posslble to clarlfy at whlch
posltlon of the toxln molecule the reglon(s) responslble for
the toxlclty to lnsects ls (are) located, and to what extent
thls (these) ls (are) also assoclated with the host
speclflclty.
21489-7728
- lo- ~~ 3973'i
Knowledge of the molecular organisation of the various toxin molecules
and of the toxin genes coding for these molecules from the various
species of B. thuringiensis is of extraordinary practical interest for a
controlled genetic manipulation of those genes, which is now possible for
the first time using the process of the invention.
In addition to a controlled modification of the ~-endotoxin genes
themselves, the novel process of the invention permits also the
manipulation of the regulatory DNA sequences controlling the expression
of those genes, as a result of which the specific properties of the
~-endotoxins, such as, for example, their host specificity, their
resorption behaviour inter alia, can be modified in a specifically
controlled manner, and the production rates of the ~-endotoxins can be
increased, for example by the insertion of stronger and more efficient
promoter sequences.
By specifically controlled mutation of selected genes or subgenes in
vitro it is thus possible to obtain new B. thuringiensis and/or B. cereus
variants.
Another possible way of constructing novel B. thuringiensis and/or
B. cereus variants comprises splicing together genes or portions of genes
that originate from different B. thuringiensis sources, resulting in
B. thuringiensis and/or B. cereus strains with a broader spectrum of use.
It is also possible for synthetically or semi-synthetically produced
toxin genes to be used in this manner for constructing new
B. thuringiensis and/or B. cereus varieties.
In addition, the process according to the invention renders possible for
the first time, as a result of the pronounced increase in the
transformation frequency and the simplicity of the process, the
establishment of gene banks and the rapid screening of modified and new
genes in B. thuringiensis and/or B. cereus.
~3~3 l
In particular, the process of the invention now for the first time
renders possible direct expression of gene banks in B. thuringiensis
and/or B. cereus and the identification of new protoxin genes in
B. thuringiensis using known, preferably immunological or biological
processes.
The subject of the present invention is accordingly a process, based on a
pronounced increase in the efficiency of B. thuringiensis/B. cereus
transformation compared with known processes, that for the first time
renders possible a direct genetic modification of the B. thuringiensis
and/or B. cereus genome.
In particular, the present invention relates to a process for the
transformation of B. thuringiensis andlor B. cereus by inserting
recombinant DNA, especially plasmid and/or vector DNA, into
B. thuringiensis and/or B. cereus cells by means of electroporation.
Preferred is a process for the transformation of B. thuringiensis and/or
B. cereus with DNA sequences coding for ~-endotoxin and DNA sequences
coding for a protein that has substantially the insect-toxic properties
of the said B. thuringiensis toxins.
The present invention also relates to the expression of DNA sequences
that code for an ~-endotoxin, or for a protein that at least has
substantially the insect-toxic properties of the B. thuringiensis toxin,
in transformed B. thuringiensis and/or B. cereus cells.
The present invention also includes a process for the production of
bifunctional vectors, so-called "shuttle" vectors, for B. thuringiensis
and/or B. cereus, and the use of the said "shuttle" vectors for the
transformation of B. thuringiensis and/or B. cereus cells.
Preferred is the construction of bifunctional vectors that in addition to
replicating in B. thuringiensis and/or B. cereus also replicate in one or
more other heterologous host systems, but especially in E. coli cells.
-12- 133~3'i
The present invention relates especially to a process for the production
of "shuttle" vectors for B. thuringiensis and/or B. cereus that contain a
DNA sequence coding for a ~-endotoxin polypeptide that occurs naturally
in B. thuringiensis, or at least a polypeptide that is substantially
homologous therewith, that is to say that at least has substantially the
insect-toxic properties of the B. thuringiensis toxin. The present
invention also includes the use of these "shuttle" vectors for the
transformation of B. thuringiensis and/or B. cereus cells and the
expression of the DNA sequences present on the said "shuttle" vectors,
especially those DNA sequences that code for a ô-endotoxin of
B. thuringiensis or at least for a protein that has substantially the
insect-toxic properties of the B. thuringiensis toxins.
The present invention also includes the use of B. thuringiensis and/or
B. cereus as general host organisms for cloning and expressing homologous
and especially also heterologous DNA, or a combination of homologous and
heterologous DNA.
This invention also relates to the above more closely characterised
plasmids and "shuttle" vectors themselves, to the use thereof for the
transformation of B. thuringiensis and/or B. cereus, and to
B. thuringiensis and B. cereus cells that have been transformed with
them.
Especially preferred within the scope of this invention are the
bifunctional ("shuttle") vectors pXI61 (=pK61) and pXI93 (=pK93) which,
introduced by transformation into B. thuringiensis var. kurstaki HDlcryB
and into B. cereus 569K, have been deposited at the "Deutsche Sammlung
von Mikroorganismen" (Braunschweig, Federal Republic of Germany),
recognised as an International Depository, in accordance with the
Budapest Treaty under the number DSM 4573 (pXI61, introduced by
transformation into B. thuringiensis var. kurstaki HDlcryB) and DSM 4571
(pX193, introduced by transformation into B. thuringiensis var. kurstaki
HDlcryB) and DSM 4573 (pXI93, introduced by transformation into B. cereus
569K).
- 13 - ~ 73ll
The present invention relates especially to novel B. thuringiensis and
B. cereus varieties that have been transformed with a DNA sequence that
codes for a ~-endotoxin of B. thuringiensis and that can be expressed, or
transformed with a DNA sequence coding for at least one protein that has
substantially the toxic properties of the B. thuringiensis toxins.
The transformed B. thuringiensis and B. cereus cells and the toxins
produced by them can be used for the preparation of insecticidal
compositions, to which the present invention also relates.
The invention also relates to methods of, and to compositions for,
controlling insects using the above more closely characterised
transformed B. thuringiensis and/or B. cereus cells or a cell-free
crystalline body-( ~-endotoxin) preparation containing protoxins produced
by the said transformed Bacillus cells.
The following is a brief description of the Figures:
Figure 1: Transformation of E. coli HB 101 with pBR322 (o) and
*B. thuringiensis HDlcryB with pBC16(~ number of surviving *HDlcryB
cells).
Figure 2: Influence of the age of a *B. thuringiensis HDlcryB culture on
the transformation frequency.
Figure 3: Influence of the pH value of the PBS buffer solution on the
transformation frequency.
Figure 4: Influence of the saccharose concentration of the PBS buffer
solution on the transformation frequency.
Figure 5: Interdependence of the number of transformants and the amountof DNA used per transformation.
7 3 ~
Figure 6: Simplified restriction map of the "shuttle" vector *pXI61. The
shaded region characterises the sequences originating from the
gram-positive pBC16, the remainder originating from the gram-negative
plasmid pUC8.
Figure 7: Simplified restriction map of *pXI93. The shaded region
characterises the protoxin structural gene (arrow, Kurhdl) and the 5' and
3' non-coding sequences. The remaining unshaded part originates from the
"shuttle" vector *pXI61.
Figure 8: SDS (sodium dodecyl sulfate)/polyacrylamide gel electrophoresis
of extracts of sporulating cultures of *B. thuringiensis HDlcryB,
B. cereus 569K and their derivatives. [1: *HDlcryB (pXI93), 2: *HDlcryB
(pXI61), 3: *HDlcryB, 4: HD1, LBG B-4449, 5: *B. cereus 569K (pXI93),
6: 569K]
a) Comassie-dyed, M: molecular weight standard, M~: molecular weight
(Dalton), arrow: position of the 130,000 Dalton protoxin.
b) ~estern blot of the same gel, to which there have been added
polyclonal antibodies to the K-1 crystalline protein of B. thuringiensis
HD1.
Positive bands were found with the aid of labelled anti-goat antibodies.
Arrow: position of the 130,000 Dalton protoxin. Other bands: degradation
products of the protoxin.
Figure 9: Transformation of B. subtilis LBG B-4468 with pBC16 plasmid DNA
using the electroporation process optimised for B. thuringiensis.
(o: transformants/~g plasmid DNA; ~: number of living bacteria/ml)
* The internal reference pK selected for the nomenclature of the plasmids
in the priority document has been replaced for the Auslandsfassung
(foreign filing text) by the officially recognised designation pXI.
Also, the names for the asporogenic B. thuringiensis HDl mutants used in
the Embodiment Fxamples have been changed from cryR to cryB.
- 15 - ~ 3 .3 ~ ~3~
An essential aspect of the present invention concerns a novel
transformation process for B. thuringiensis and B. cereus based on the
insertion of plasmid DNA into B. thuringiensis andlor B. cereus cells
using electroporation technology, which is known per se.
All attempts up to the time of the present invention to apply the
transformation processes already established for other bacterial host
systems to B. thuringiensis and the closely related B. cereus having been
frustrated, it is now possible within the scope of this invention to
achieve surprising success using electroporation technology and
accompanying steps.
This success must also be considered surprising and unexpected, espe-
cially since electroporation tests with B. thuringiensis protoplasts were
carried out at an earlier date by a Soviet group (2 )Shivarova N. et al.,
1983), but the transformation frequencies achieved were so low that this
process was subsequently regarded as unusable for B. thuringiensis
transformation and consequently received no further attention.
Building upon investigations into the process parameters critical for an
electroporation of B. thuringiensis andlor B. cereus cells, it has now
surprisingly been possible to develop a transformation process that is
ideally adapted to the requirements of B. thuringiensis and B. cereus and
results in transformation rates ranging from 106 to 108 cellsl~g of
plasmid DNA, but especially from 106 to 107 cellsl~g of plasmid DNA.
Roughly equally high transformation rates with values from 102 to a
", of 106 transformantsl~g of plasmid DNA could hitherto be achieved
only with the PEG (polyethylene glycol) transformation process described
by 2 )Schall (1986). High transformation rates remained restricted,
however, to those B. thuringiensis strains for which the PEG process was
specifically adapted in very time-consuming optimisation studies, which
makes this process appear unsuitable for practical use.
Furthermore, the reproducibility of that process in practice is in manycases non-existent or poor.
- 16 - ~3~31
In contrast, the process of the present invention is a transformation
process that in principle is applicable to all B. thuringiensis and
B. cereus strains, and that is less time-consuming, more rational and
consequently more efficient than the traditional PEG transformation
process.
For example, in the process of the invention it is possible to use. forexample, whole intact cells, thus dispensing with the time-consuming
production of protoplasts critical for B. thuringiensis and B. cereus and
with the subsequent regeneration on complex nutrient media.
Furthermore, when using the PEG process, carrying out the necessary
process steps can take up to a week, whereas with the transformation
process of the invention the transformed cells can be obtained within a
few hours (as a rule overnight).
Another advantage of the process of the inventiol) concerns the number of
B. thuringiensis and/or B. cereus cells that can be transformed per unit
of time.
Whereas in the traditional PEG process only small aliquots can be plated
out simultaneously in order to avoid inhibition of the regeneration as a
result of the growth of the cells being too dense, when using the
electroporation technique large amounts of B. thuringiensis and/or
B. cereus cells can be plated out simultaneously.
This renders possible the detection of transformants even at very low
transformation frequencies, which with the afore-described processes is
not possible or is possible only with considerable expenditure.
Furthermore, amounts of DNA in the nanogram range are sufficient to
obtain at least some transformants.
- 17 - ~ ~ 3 ~ 73 ~
This is especially important if a very efficient transformation system is
necessary, such as, for example, when using DNA material from E. coli,
which on account of a strongly pronounced restriction system in
B. thuringiensis cells can lead to a reduction of the transformation
frequencies by a factor of 103 compared with B. thuringiensis DNA.
The transformation process of the invention, which is based essentiallyon electroporation technology known per se, is characterised by the
following specific process steps:
a) Preparation of a cell suspension of suitable cell density in a culture
medium suitable for growing B. thuringiensis cells and with aeration
adequate for the growth of the cells;
b) separation of the cells from the cell suspension and resuspension in
an inoculation buffer suitable for the subsequent electroporation;
c) addition of a DNA sample in a concentration suitable for the
electroporation;
d) introduction of the batch described under points b) and c) into an
electroporation apparatus;
e) one or more brief discharges of a capacitor across the cell suspension
for the short term-production of high electric field strengths for a
period that is adequate for transformation of B. thuringiensis and/or
B. cereus cells with recombinant DNA;
f) optional reincubation of the electroporated cells;
g) plating out of the electroporated cells onto a suitable selection
medium; and
h) selection of the transformed cells.
In a specific embodiment of the process of the invention that is
preferred within the scope of the invention, the B. thuringiensis cells
are first of all incubated in a suitable nutrient medium with adequate
~ 3 ~ 7 ~ 1
- 18 -
aeration and at a suitable temperature, preferably of from 20~C to 35~C,
until an optical density (ODs 5 0 ) of from 0.1 to 1.0 is achieved. The age
of the Bacillus cultures provided for the electroporation has a distinct
effect on the transformation frequency. An optically density of the
Bacillus cultures of from 0.1 to 0.3, but especially of 0.2, is therefore
especially preferred. Attention is, however, drawn to the fact that it is
also possible to achieve good transformation frequencies with Bacillus
cultures from other growth phases, especially with overnight cultures
(see Figure 2).
Generally, fresh cells or spores are used as starting material, but it is
also equally possible to use deep-frozen cell material. The cell material
is preferably cell suspensions of B. thuringiensis and/or B. cereus cells
in suitable liquid media to which, advantageously, a certain amount of an
"antifreeze solution" has been added.
Suitable antifreeze solutions are especially mixtures of osmotically
active components and DMSO in water or a suitable buffer solution. Other
suitable components that can be used in antifreeze solutions include
sugars, polyhydric alcohols, such as, for example, glycerol, sugar
alcohols, amino acids and polymers, such as, for example, polyethylene
glycol.
If B. thuringiensis spores are used as starting material, they are first
of all inoculated in a suitable medium and incubated overnight at a
suitable temperature, preferably of from 25~C to 28~C, and with adequate
aeration. This batch is then diluted and further treated in the manner
described above.
To induce sporulation in B. thuringiensis it is possible to use any
medium that causes such a sporulation. Within the scope of this invention
a GYS medium according to )Yousten A.A. and Rogoff M.H., (1969) is
preferred.
Oxygen is usually introduced into the culture medium by moving the
culture, for example using a shaker, speeds of rotation of from
50 revs/min to 300 revs/min being preferred.
~33~73 i
- 19 -
B. thuringiensis spores and vegetative microorganism cells are culturedwithin the scope of the present invention according to known generally
customary processes, liquid nutrient media preferably being used for
reasons of practicability.
The composition of the nutrient media may vary slightly depending on the
strain of B. thuringiensis or B. cereus used. Generally, complex media
with loosely defined, readily assimilable carbon (C-) and nitrogen (N-)
sources are preferred, like those customarily used for culturing aerobic
Bacillus species.
In addition, vitamins and essential metal ions are necessary, but theseare usually contained in an adequate concentration as constituents or
impurities in the complex nutrient media used.
If desired, the said constituents, such as, for exan,ple, essential
vitamins and also Na , K , CU , Ca , Mg , Fe , NH4 , PO4 , SO4
Cl , C03 ions and the trace elements cobalt and manganese, zinc, etc.,
can be added in the form of their salts.
In addition to yeast extracts, yeast hydrolysates, yeast autolysates and
yeast cells, especially suitable nitrogen sources are in particular soya
meal, maize meal, oatmeal, edamine (enzymatically digested lactalbumin),
peptone, casein hydrolysate, corn steep liquors and meat extracts,
without the subject of the invention being in any way limited by this
list of examples.
The preferred concentration of the mentioned N-sources is from
1.0 g/l to 20 g/l.
Suitable C-sources are especially glucose, lactose, sucrose, dextrose,
maltose, starch, cerelose, cellulose and malt extract. The preferred
concentration range is from 1.0 g/l to 20 g/l.
- 20 - J 3 r3 9 7 34
Apart from complex nutrient media it is obviously also possible to use
semi- or fully-synthetic media that contain the above-described nutrients
in a suitable concentration.
Apart from the LB medium preferably used within the scope of the present
invention it is also possible to use any other culture medium suitable
for culturing B. thuringiensis and/or B. cereus, such as, for example,
Antibiotic Medium 3, SCGY medium, etc.. Sporulated B. thuringiensis
cultures are preferably stored on GYS media (inclined agar) at a
temperature of 4~C.
After the cell culture has reached the desired cell density, the cells
are harvested by means of centrifugation and suspended in a suitable
buffer solution that has preferably been cooled beforehand with ice.
In the course of the investigations, the temperature proved not to be
critical and is therefore freely selectable within a broad range. A
temperature range of from 0~C to 35~C, preferably from 2~C to 15~C and
more especially a temperature of 4~C, is preferred. The incubation period
of the Bacillus cells before and after electroporation has only a slight
effect on the transformation frequency attainable (see Table 1). Only an
excessively long incubation results in a decrease in the transformation
frequency. An incubation period of from 0.1 to 30 minutes, especially of
10 minutes, is preferred. In the course of the investigations, the
temperature proved not to be critical and is therefore freely selectable
within a broad range. A temperature range of from 0~C to 35~C, preferably
from 2~C to 15~C and more especially a temperature of 4~C, is preferred.
This operation can be repeated one or more times. Buffer solutions that
are especially suitable within the scope of this invention are
osmotically stabilised phosphate buffers that contain as stabilising
agent sugars such as, for example, glucose or saccharose, or sugar
alcohols, such as, for example, mannitol, and have pH values set to from
5.0 to 8Ø More especially preferred are phosphate buffers of the PBS
type having a pH value of from 5.0 to 8.0, preferably of from 5.5 to 6.5,
that contain saccharose as stabilising agent in a concentration of from
O.lM to l.OM, but preferably of from 0.3M to 0.5M (see Figures 3 and 4).
- 21 - 1 ~ 3 9 73'1
Aliquots of the suspended Bacillus cells are then transferred into
cuvettes or any other suitable vessels and incubated together with a DNA
sample for a suitable period, preferably for a period of from
0.1 to 30 minutes, but especially of from 5 to 15 minutes, and at a
suitable temperature, preferably at a temperature of from 0~C to 35~C,
but especially at a temperature of from 2~C to 15~C and more especially
at a temperature of 4~C.
When operating at low temperatures it is advantageous to use cuvettes
that have already been precooled, or any other suitable precooled
vessels.
Over a wide range there is a linear relationship between the number oftransformed cells and the DNA concentration used for the electroporation,
the number of transformed cells increasing as the DNA concentration
increases (see Figure 5). The DNA concentration preferred within the
scope of this invention is in a range of from 1 ng to 2Q ~g. A DNA
concentration of from 10 ng to 2 ~g is especially preferred.
Subsequently the entire batch containing B. thuringiensis and/or
B. cereus cells and plasmid DNA or another suitable DNA sample is
introduced into an electroporation apparatus and subjected to
electroporation, that is to say is briefly exposed to an electric pulse.
Electroporation apparatus suitable for use in the process of the
invention is already available from a variety of manufacturers, such as,
for example, from Bio Rad (Richmond, CA, USA; "Gene Pulser~Apparatus"),
Biotochnologies and Experimental Research Inc. (San Diego, CA, USA;
"BTX Transfector~100"), Promega (Madison, WI, USA; "X-Cell 2000 Electro-
poration System"), etc..
It is obviously also possible to use any other suitable apparatus in the
process of the invention.
Various pulse forms can be used, for example rectangular pulses or
alternatively exponentially decaying pulses.
c~--I rQc~-rnark
- 22 - 1 ~ 3 ~ ~ 3 ~
The latter are preferred within the scope of this invention. They are
produced by the discharging of a capacitor and are characterised by an
initially very rapid increase in voltage and by a subsequent exponential
decaying phase as a function of resistance and capacitance. The time
constant RC provides a measure of the length of the exponential decay
time. It corresponds to the time necessary for the voltage to decay to
37 % of the initial voltage (V ).
One parameter decisive in influencing the bacterial cell concerns the
strength of the electric field acting on the cells, which is calculatsd
from the ratio of the voltage applied to the distance between the
electrode plates.
Also of great importance in this connection is the exponential decay
time, which depends on the configuration of the apparatus used (for
example the capacitance of the capacitor) and on other parameters, such
as, for example, the composition of the buffer solutiGn or the volume of
cell suspension provided for the electroporation.
In the course of the investigations it has been demonstrated, for
example, that reducing by half the volume of the cell suspension provided
for the electroporation results in an increase in the transformation
frequency by a factor of 10.
A prolongation of the exponential decay time by way of an optimisation of
the buffer solution used also results in a distinct increase in the
transformation frequency.
All measures that result in a prolongation of the exponential decay time
and consequently in an increase in the transformation frequency are
therefore preferred within the scope of this invention.
The decay time preferred within the scope of the process of the invention
is from approximately 2 ms to approximately 50 ms, but especially from
approximately 8 ms to approximately 20 ms. Most especially preferred is
an exponential decay time of from approximately 10 ms to approximately
12 ms.
- 23 - 1~3~3~
Within the scope of the present invention, the bacterial cells are acted
upon for short periods by very high electric field strengths by means of
brief discharge(s) of a capacitor across the DNA-containing cell
suspension; as a result of this, the permeability of the B. thuringiensis
cells is briefly and reversibly increased. The electroporation parameters
are so coordinated with each other in the course of the process of the
invention that optimum absorption into the Bacillus cells of the DNA
located in the electroporation buffer is ensured.
The capacitance setting of the capacitor within the scope of this
invention is advantageously from 1 ~F to 250 ~F, but especially from 1 ~F
to 50 ~F and more especially is 25 ~F. The choice of the initial voltage
is not critical, and is therefore freely selectable, within wide ranges.
An initial voltage V of from 0.2 kV to 50 kV, but especially of from
0.2 kV to 2.5 kV and more especially of from 1.2 kV to 1.8 kV, is
preferred. The distance between the electrode plates depends, inter alia,
on the size of the electroporation apparatus. It is advantageously from
0.1 cm to 1.0 cm, preferably from 0.2 cm to 1.0 cm, and more especially
is 0.4 cm. The field strength values that act on the cell suspension
result from the distance between the electrode plates and the initial
voltage set in the capacitor. These values are advantageously in a range
of from 100 V/cm to 50,000 V/cm. Field strengths of from 100 V/cm to
10,000 V/cm, but particularly of from 3,000 V/cm to 4,500 V/cm, are
especially preferred.
The fine coordination of the freely selectable parameters, such as, forexample, capacitance, initial voltage, distance between plates etc.,
depends to a certain extent on the architecture of the apparatus used and
can therefore vary from case to case within certain limits. In certain
cases, therefore, it is possible to exceed or fall below the limiting
values indicated, should this be necessary in order to achieve optimum
field strengths.
The actual electroporation operation can be repeated one or more times
until the optimum transformation frequency for the system in question has
been achieved.
- 24 -
~ ~! .3~ 3 1
Following the electroporation, the treated Bacillus cells can advantage-
ously be reincubated, preferably for a period of from 0.1 to 30 minutes,
at a temperature of from 0~C to 35~C, preferably from 2~C to 15~C. The
electroporated cells are then diluted with a suitable medium and in-
cubated again for a suitable period, preferably from 2 to 3 hours, with
adequate aeration and at a suitable temperature, preferably of from 20~C
to 35~C.
The B. thuringiensis cells are then plated out onto solid media that
contain as an additive an agent suitable for selecting the new DNA
sequences introduced into the bacterial cell. Depending on the nature of
the DNA used, the said agent may be, for example, an antibiotically
active compound or a dye, inter alia. Antibiotics selected from the group
consisting of tetracycline, kanamycin, chloramphenicol and erythromycin
are especially preferred within the scope of this invention for the
selection of Bacillus thuringiensis and/or B. cereus cells.
Also preferred are chromogenic substrates, such as, for example, X-gal
(5-bromo-4-chloro-3-indolyl-~-D-galactoside), which can be detected by
way of a specific colour reaction.
Other phenotypic markers are known to the skilled person and can also be
used within the scope of this invention.
It is possible to use any nutrient medium suitable for culturing
B. thuringiensis cells, to which one of the conventionally employed
solidifying media, such as, for example, agar, agarose, gelatin, etc., is
added.
The process parameters described hereinbefore in detail for
B. thuringiensis are applicable in the same manner to B. cereus cells.
Unlike the processes hitherto available in the prior art, the process of
the invention for the transformation of B. thuringiensis and B. cereus
described hereinbefore is not limited to the use of specific natural
- 25 - 13 3 ~7 3 ~
plasmids occurring in B. thuringiensis and/or B. cereus but is applicable
to all types of DNA.
It is accordingly now possible for the first time to transform
B. thuringiensis and/or B. cereus in a controlled manner, it being
possible to use apart from homologous plasmid DNA, that is to say plasmid
DNA occurring naturally in B. thuringiensis or the closely related
B. cereus, also plasmid DNA of heterologous origin.
This may be either plasmid DNA that occurs naturally in an organism other
than B. thuringiensis or the closely related B. cereus, such as, for
example, plasmids pUB110 and pC194 from Staphylococcus aureus
( )Horinouchi S. and ~eisblum B., 1982; 25)Polak J. and Novick R.P.,
1982) and plasmid pIM13 from B. subtilis ( )Mahler J. and
Halvorson HØ, 1980), which are capable of replicating in
B. thuringiensis and/or B. cereus, or hybrid plasmid DNA constructed by
recombinant DNA technology from homologous plasmid DNA or from hetero-
logous plasmid DNA or alternatively from a combination of homologous and
heterologous plasmid DNA. The last-mentioned hybrid plasmid DNA is better
suited for work with recombinant DNA than the natural isolates.
There may be mentioned by way of example here, without the subject of the
present application in any way being limited, the plasmids pBD64
( )Gryczan T. et al., 1980), pBD347, pBD348 and pUB1664.
The cloning vectors already established for B. subtilis, such as, for
example, pBD64, may be of particular importance for carrying out the
cloning experiments in various B. thuringiensis and B. cereus strains.
Apart from plasmid DNA, it is now possible within the scope of the
present invention to introduce any other DNA into B. thuringiensis and
B. cereus by transformation. The transformed DNA can replicate either
autonomously or integrated in the chromosome. It may be, for example, a
vector DNA derived not from a plasmid but from a phage.
The present invention also relates to the construction of bifunctional
vectors ("shuttle" vectors).
- 26 - 3~3~3l
Especially preferred within the scope of this invention is the
construction and use of bifunctional (hybrid) plasmid vectors, so-called
"shuttle" vectors, that are capable of replicating in one or in several
heterologous host organisms apart from in B. thuringiensis or the closely
related B. cereus, and that are identifiable both in homologous and in
heterologous host systems.
Heterologous host organisms are to be understood within the scope of this
invention as all those organisms that do not belong to the
B. thuringiensis/B. cereus group and that are capable of maintaining in a
stable condition a self-replicating DNA.
According to the above definition it is therefore possible for both
prokaryotic and eukaryotic organisms to function as heterologous host
organisms. At this point there may be mentioned by way of example, as
representatives from the prokaryotic host organism group, individual
examples from the genera Bacillus, such as, for example, B. subtilis or
B. megaterium, Staphylococcus, such as, for example, S. aureus,
Streptococcus, such as, for example, Streptococcus faecalis,
Streptomyces, such as, for example Streptomyces spp., Pseudomonas, such
as, for example, Pseudomonas spp., Escherichia, such as, for example,
E. coli, Agrobacterium, such as, for example, A. tumefaciens or
A. rhizogenes, Salmonella, Erwinia, etc. From the eukaryotic host group
there may be mentioned especially yeasts and animal and plant cells. This
list of examples is not final and is not intended to limit the subject of
the present invention in any way. Other suitable representatives from the
prokaryotic and eukaryotic host organism groups are known to the skilled
person.
Especially preferred within the scope of this invention are B. subtilisor B. megaterium, Pseudomonas spp., and especially E. coli from the group
of prokaryotic hosts as well as yeasts and animal or plant cells from the
group of eukaryotic hosts.
~ 3 3~3 7.~'1
- 27 -
More especially preferred are bifunctional vectors that are capable of
replicating in both B. thuringiensis and/or B. cereus cells as well as in
E. coli.
The present invention also includes the use of the said bifunctional
vectors for the transformation of B. thuringiensis and B. cereus.
"Shuttle" vectors are constructed using recombinant DNA technology,
plasmid and/or vector DNA of homologous (B. thuringiensis, B. cereus) or
heterologous origin initially being cleaved using suitable restriction
enzymes and then those DNA fragments containing the functions essential
for replication in the respective desired host system being joined to one
another again in the presence of suitable enzymes.
The afore-mentioned heterologous host organisms can act as a source of
plasmid- and/or vector DNA of heterologous origin.
The joining of the various DNA fragments must be effected in such a
manner that the functions essential for replication in the different host
systems are retained.
In addition, obviously also plasmid DNA and/or vector DNA of purely
heterologous origin can be used for the construction of "shuttle"
vectors, but at least one of the heterologous fusion partners must
contain regions of DNA that render possible a replication in homologous
B. thuringiensis/B. cereus host systems.
As a source of plasmid DNA and/or vector DNA of heterologous origin that
is nevertheless capable of replicating in a B. thuringiensis/B. cereus
host system there may be mentioned at this point, by way of example, a
few representatives from the group of gram-positive bacteria, selected
from the group consisting of the genera Staphylococcus, such as, for
example, Staphylococcus aureus, Streptococcus, such as, for example,
Streptococcus faecalis, Bacillus, such as, for example, Bacillus
megaterium or B. subtilis, Streptomyces, such as, for example,
Streptomyces spp., etc. In addition to the representatives from the group
of gram-positive bacteria listed here by way of example, there is a whole
~3 ~ 73~
- 28 -
series of other organisms known to the skilled person that can be used in
the process of the invention.
The present invention thus accordingly also relates to a process for the
production of bifunctional vectors that are suitable for transforming
B. thuringiensis andlor B. cereus which comprises
a) first of all breaking down plasmid DNA of homologous or heterologous
origin into fragments using suitable restriction enzymes and
b) then joining to one another again, in the presence of suitable
enzymes, those fragments containing the functions essential for
replication and selection in the respective desired host system, this
being effected in such a manner that the functions essential for
replication and selection in the various host systems are retained.
In this manner bifunctional plasmids are obtained that contain, in
addition to the functions necessary for replication in B. thuringiensis
or B. cereus, further DNA sequences that ensure replication in at least
one other heterologous host system.
To ensure rapid and efficient selection of the bifunctional vectors in
both homologous and heterologous host system(s) it is advantageous to
provide the said vectors with specific selectable markers that can be
used in B. thuringiensis and/or B. cereus as well as in heterologous host
system(s), that is to say that render possible a rapid and uncomplicated
selection. Especially preferred within the scope of this invention is the
use of DNA sequences coding for antibiotic resistances, especially DNA
sequences that code for resistance to antibiotics selected from the group
consisting of kanamycin, tetracycline, chloramphenicol, erythromycin
etc..
Also preferred are genes that code for enzymes with a chromogenic
substrate, such as for example, X-gal
(5-bromo-4-chloro-3-indolyl-~-D-galactoside). The transformed colonies
can then be detected very easily by way of a specific colour reaction.
Other phenotypic marker genes are known to the skilled person and can
also be used within the scope of this invention.
- 29 - ~ 7 3 1
Especially preferred within the scope of this invention is the
construction of "shuttle" vectors that, in addition to DNA sequences that
permit replication in B. thuringiensis or B. cereus or in both host
systems, also contain regions of DNA that are necessary for replication
in other bacterial host systems, such as, for example, in B. subtilis,
B. megaterium, Pseudomonas spp., E. coli, etc..
Also preferred are "shuttle" vectors that replicate on the one hand
either in B. thuringiensis or B. cereus or in both, and on the other hand
in eukaryotic host systems selected from the group consisting of yeast,
animal and plant cells, etc..
More especially preferred is the construction of "shuttle" vectors that,
in addition to DNA sequences that are necessary for replication of the
said vectors in B. thuringiensis or B. cereus or in both systems, also
contain DNA sequences that render possible replication of the said
"shuttle" vectors in E. coli.
Examples of such starting plasmids for the construction of "shuttle"
vectors for the B. thuringiensis-B. cereus/E. coli system, which must
not, however, be regarded as in any way limiting, are the B. cereus
plasmid pBCl6, and the plasmid pUC8 derived from the E. coli plasmid
pBR322 ( )Vieira J. and Messing J., 1982).
The present invention also relates to bifunctional ("shuttle") vectors
that, in addition to the functions essential for replication and
selection in homologous and heterologous host systems, also contain one
or more genes in expressible form or other useful DNA sequences. This
invention also includes processes for the production of these vectors,
which comprise inserting the said genes or other useful DNA sequences
into these bifunctional vectors with the aid of suitable enzymes.
Using the "shuttle" vectors of the invention and the afore-described
transformation process it is thus now possible for the first time to
introduce into B. thuringiensis and/or B. cereus cells by transformation,
~33~3 1
- 30 -
with a high degree of efficiency, DNA sequences that have been cloned
outside B. thuringiensis cells in a foreign host system.
Accordingly it is now possible for the first time for genes or other
useful DNA sequences, especially also those having a regulatory function,
to be introduced in a stable manner into B. thuringiensis and B. cereus
cells and, if desired, expressed therein, as a result of which
B. thuringiensis and B. cereus cells with novel and desirable properties
are obtained.
Both homologous and heterologous gene(s) or DNA and synthetic gene(s) or
DNA according to the definition given within the scope of the present
invention, as well as combinations of the said DNAs, can be used as genes
in the process of the invention.
The coding DNA sequence can be constructed exclusively from genomic DNA,
from cDNA or from synthetic DNA. Another possibility is the construction
of a hybrid DNA sequence consisting of both cDNA and of genomic DNA
and/or synthetic DNA, or alternatively a combination of those DNAs.
In that case, the cDNA may originate from the same gene as the genomic
DNA, or alternatively both the cDNA and the genomic DNA may originate
from different genes. In any case, however, both the genomic DNA and/or
the cDNA may each be prepared individually from the same or from
different genes.
If the DNA sequence contains parts of more than one gene, these genes may
originate from one and the same organism, from several organisms that
belong to different strains, or to varieties of the same kind or
different species of the same genus, or from organisms that belong to
more than one genus of the same or of another taxonomic unit.
In order to ensure the expression of the said structural genes in the
bacterial cell, the coding gene sequences must first of all be operably
joined to expression sequences capable of functioning in B. thuringiensis
and/or B. cereus cells.
- 31 - ~ 73~
The hybrid gene constructs of the present invention thus contain, in
addition to the structural gene(s), expression signals that include both
promoter and terminator sequences as well as other regulatory sequences
of 3' and 5' untranslated regions.
Especially preferred within the scope of this invention are the naturalexpression signals of B. thuringiensis and/or B. cereus themselves and
mutants and variants thereof that are substantially homologous with the
natural sequence. Within the scope of this invention, one DNA sequence is
substantially homologous with a second DNA sequence when at least 70 %,
preferably at least 80 %, but especially at least 90 ~O~ of the active
regions of the DNA sequence are homologous. According to the present
definition of the expression "substantially homologous", two different
nucleotides in a DNA sequence of a coding region are regarded as
homologous if the exchange of the one nucleotide for the other is a
silent mutation.
Most especially preferred is the use of sporulation-dependent promotersof B. thuringiensis that ensure expression as a function of the
sporulation.
Especially preferred for the transformation of B. thuringiensis or
B. cereus within the scope of this invention is the use of DNA sequences
that code for a ~-endotoxin.
The coding region of the chimaeric gene of the invention preferably
contains a nucleotide sequence coding for a polypeptide that occurs
naturally in B. thuringiensis or, alternatively, for a polypeptide that
is substantially homologous therewith, that is to say that at least has
substantially the toxicity properties of a crystalline ~-endotoxin protein
of B. thuringiensis. Within the scope of the present invention, by
definition a polypeptide has substantially the toxicity properties of the
crystalline ~-endotoxin protein of B. thuringiensis if it has an
insecticidal activity against a similar spectrum of insect larvae to that
of the crystalline protein of a sub-species of B. thuringiensis. Some
suitable sub-species are, for example, those selected from the group
~ 3~3~
- 32 -
consisting of kurstaki, berliner, alesti, tolworthi, sotto, dendrolimus,
tenebrionis and israelensis. The preferred subspecies for Lepidoptera
larvae is kurstaki and, especially, kurstaki HDl.
The coding region may thus be a region that occurs naturally in
B. thuringiensis. Altenatively, the coding region can if desired also
contain a sequence that is different from the sequence in
B. thuringiensis but that is equivalent to it on account of the
degeneration in the genetic code.
The coding region of the chimaeric gene can also code for a polypeptidethat is different from a naturally occurring crystalline ~-endotoxin
protein but that still has substantially the insect-toxicity properties
of the crystalline protein. Such a coding sequence will normally be a
variant of a natural coding region. A "variant" of a natural DNA sequence
within the scope of this invention should, by definition, be understood
as a modified form of a natural sequence that, however, still fulfils the
same function. The variant may be a mutant or a synthetic DNA sequence
and is substantially homologous with the corresponding natural sequence.
Within the scope of this invention a DNA sequence is substantially
homologous with a second DNA sequence when at least 70 %, preferably at
least 80 %, but especially at least 90 %, of the active regions of the
DNA sequence are homologous. According to the present definition of the
expression "substantially homologous", two different nucleotides in a DNA
sequence of a coding region are regarded as homologous if the exchange of
one nucleotide for the other is a silent mutation.
Within the scope of the present invention, it is accordingly possible to
use any chimaeric gene coding for an amino acid sequence that has the
insecticidal properties of a B. thuringiensis ~-endotoxin and that meets
the disclosed and claimed requirements. Especially preferred is the use
of a nucleotide sequence that is substantially homologous at least with
the part or the parts of the natural sequence that is (are) responsible
for the insecticidal activity andlor the host specificity of the
B. thuringiensis toxin.
- 33 - ~ ~ 3~ 3 ~1
The polypeptide expressed by the chimaeric gene as a rule also has at
least some immunological properties in common with a natural crystalline
protein, because it has at least some of the same antigenic determinants.
Accordingly, the polypeptide that is encoded by the said chimaeric geneis preferably structurally related to the ~-endotoxin of the crystalline
protein produced by B. thuringiensis. B. thuringiensis produces a
crystalline protein with a subunit that corresponds to a protoxin having
a molecular weight (MW) of approximately from 130,000 to 140,000. This
subunit can be cleaved by proteases or by alkali into insecticidal
fragments having a MW of 70,000 and possibly even less.
For the construction of chimaeric genes in which the coding region
includes such fragments of the protoxin or even smaller parts,
fragmenting the coding region can be continued for as long as the
fragments or parts of those fragments still have the necessary
insecticidal activity. The protoxin, insecticidal fragments of the
protoxin and insecticidal parts of those fragments can be joined to other
molecules, such as polypeptides and proteins.
Coding regions suitable for use within the scope of the process of the
invention can be obtained from genes of B. thuringiensis that code for
the crystalline toxin gene (Whiteley et al., PCT application W086/01536
and US Patents 4 448 885 and 4 467 036). A preferred nucleotide sequence
that codes for a crystalline protein is located between nucleotides 156
and 3623 in formula I or is a shorter sequence that codes for an
insecticidal fragment of such a crystalline protein ( )Geiser et al.,
1986 and EP 238 441).
Formel I
GTT M CACCC TGGGTC M M ATTGATATTT AGTAA M TTA GTTGCACTTT GTGCATTTTT
100 110 120
TCAT M GATG AGTCATATGT TTT MM TTGT AGT M TG MM M CAGTATTA TATCAT M TG
~ t~P ~ 3 '1
130 140 lS0 160 170 180
MTTGGTATC TTMTMAAG AGATGGAGGT AACTTATGGA TAACAATCCG MCATCMTG
190 200 210 220 230 240
AATGCATTCC TTATAATTGT TTAAGTAACC CTGAAGTAGA AGTATTAGGT GGAGMMGM
250 260 270 280 290 300
TAGAAACTGG TTACACCCCA ATCGATATTT CCTTGTCGCT AACGCMTTT CTTTTGAGTG
310 320 330 340 350 360
MTTTGTTCC CGGTGCTGGA TTTGTGTTAG GACTAGTTGA TATMTATGG GGMTTTTTG
370 380 390 400 410 420
GTCCCTCTCA ATGGGACGCA TTTCTTGTAC AAATTGAACA GTTMTTMC CAAAGMTAG
430 440 450 460 47~ 480
AAGMTTCGC TAGGAACCAA GCCATTTCTA GATTAGAAGG ACTMGCMT CTTTATCMM
490 500 510 520 530 540
TTTACGCAGA ATCTTTTAGA GAGTGGGAAG CAGATCCTAC TMTCCAGCA TTMGAGMG
550 560 570 580 590 600
AGATGCGTAT TCMTTCAAT GACATGAACA GTGCCCTTAC AACCGCTATT CCTC;l l 1 l lG
610 620 630 640 650 660
CAGTTCMM TTATCMGTT CCTCTTTTAT CAGTATATGT TCMGCTGCA MTTTACATT
670 680 690 700 710 720
TATCAGTTTT GAGAGATGTT TCAGTGTTTG GACAAAGGTG GGGATTTGAT GCCGCGACTA
730 740 750 760 770 780
TCMTAGTCG TTATMTGAT TTMCTAGGC TTATTGGCAA CTATACAGAT CATGCTGTAC
790 800 810 820 830 840
GCTGGTACM TACGGGATTA GAGCGTGTAT GGGGACCGGA TTCTAGAGAT TGGATMGAT
- 35 _ ~3 3 9~ 3 !~
850 860 870 880 890 900
ATAATCAATT TAG M GAG M TT M CACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA
910 920 930 940 950 960
ACTATGATAG TAG M CGTAT CCAATTCG M CAGTTTCCCA ATT M C M GA G MM TTTATA
970 980 990 1000 1010 1020
C M ACCCAGT ATTAGAA M T TTTGATGGTA GTTTTCGAGG CTCGGCTCAG GGCATAGAAG
1030 1040 1050 1060 1070 1080
GAAGTATTAG GAGTCCACAT TTGATGGATA TACTTAACAG TAT M CCATC TATACGGATG
1090 1100 1110 1120 1130 1140
CTCATAGAGG AG M TATTAT TGGTCAGGGC ATC M AT M T GGCTTCTCCT GTAGGGTTTT
1150 1160 1170 1180 1190 1200
CGGGGCCAGA ATTCACTTTT CCGCTATATG GAACTATGGG AAAIGCAGCT CCAC M C M C
1210 1220 1230 1240 1250 1260
GTATTGTTGC TC M CTAGGT CAGGGCGTGT ATAG M CATT ATCGTCCACT TTATATAG M
1270 1280 1290 1300 1310 1320
GACCTTTT M TATAGGGATA M T M TC M C AACTATCTGT TCTTGACGGG ACAGAATTTG
1330 1340 1350 1360 1370 1380
CTTATGGAAC CTCCTCAM T TTGCCATCCG CTGTATACAG M AAAGCGGA ACGGTAGATT
1390 1400 1410 1420 1430 1440
CGCTGGATGA M TACCGCCA CAG M T M CA ACGTGCCACC TAGGC M GGA TTTAGTCATC
1450 1460 1470 1480 1490 1500
GATT M GCCA TGTTTCAATG TTTCGTTCAG GCTTTAGT M TAGTAGTGTA AGTAT M T M
1510 1520 1530 1540 1550 1560
GAGCTCCTAT GTTCTCTTGG ATACATCGTA GTGCTG M TT T M T M TATA ATTCCTTCAT
13~.~9~3 1
-- 36 --
1570 1580 1590 1600 1610 1620
CACMATTAC ACMATACCT TTAACAAAAT CTACTAATCT TGGCTCTGGA ACTTCTGTCG
1630 1640 1650 1660 1670 1680
TTAAAGGACC AGGATTTACA GGAGGAGATA TTCTTCGAAG MCTTCACCT GGCCAGATTT
1690 1700 1710 1720 1730 1740
CAACCTTAAG AGTMATATT ACTGCACCAT TATCACMMG ATATCGGGTA AGAATTCGCT
1750 1760 1770 1780 1790 1800
ACGCTTCTAC CACAAATTTA CAATTCCATA CATCAATTGA CGGAAGACCT ATTAATCAGG
1810 1820 1830 1840 1850 1860
GGMTTTTTC AGCAACTATG AGTAGTGGGA GTAATTTACA GTCCGGAAGC TTTAGGACTG
1870 1880 1890 1900 1910 1920
TAGGTTTTAC TACTCCGTTT MCTTTTCAA ATGGATCMG TGTATTTACG TTAAGTGCTC
1930 1940 1950 1960 1970 1980
ATGTCTTCAA TTCAGGCMT GMGTTTATA TAGATCGAAT TGAATTTGTT CCGGCAGMG
1990 2000 2010 2020 2030 2040
TAACCTTTGA GGCAGAATAT GATTTAGMA GAGCACAAAA GGCGGTGMT GAGCTGTTTA
2050 2060 2070 2080 2090 2100
CTTCTTCCAA TCAAATCGGG TTMAAACAG ATGTGACGGA TTATCATATT GATCMGTAT
2110 2120 2130 2140 2150 2160
CCAATTTAGT TGAGTGTTTA TCTGATGAAT TTTGTCTGGA TGAAAAA~A GAATTGTCCG
2170 2180 2190 2200 2210 2220
AGAAAGTCM ACATGCGMG CGACTTAGTG ATGAGCGGAA TTTACTTCM GATCCAAACT
2230 2240 2250 2260 2270 2280
TTAGAGGGAT CMTAGACM CTAGACCGTG GCTGGAGAGG AAGTACGGAT ATTACCATCC
-37- ~9~3l
2290 2300 2310 2320 2330 2340
MGGAGGCGA TGACGTATTC MAGAGMTT ACGTTACGCT ATTGGGTACC TTTGATGAGT
2350 2360 2370 2380 2390 2400
GCTATCCMC GTATTTATAT CMMMTAG ATGAGTCGM ATTMMGCC TATACCCGTT
2410 2420 2430 2440 2450 2460
AccMTTAAG AGGGTATATC GAAGATAGTC MGACTTAGA MTCTATTTA ATTCGCTACA
2470 2480 2490 2500 2510 2520
ATGCCAAACA CGAMCAGTA AATGTGCCAG GTACGGGTTC CTTATGGCCG CTTTCAGCCC
2530 2540 2550 2560 2570 2580
CMGTCCMT CGGMMTGT GCCCATCATT CCCATCATTT CTCCTTGGAC ATTGATGTTG
2590 2600 2610 2620 2630 2640
GATGTACAGA CTTAAATGAG GACTTAGGTG TATGGGTGAT ATTCAAGATT AAGACGCAAG
2650 2660 2670 2680 2690 2700
ATGGCCATGC MGACTAGGA MTCTAGMT TTCTCGMGA GAAACCATTA GTAGGAGMG
2710 2720 2730 2740 2750 2760
CACTAGCTCG TGTGMMGA GCGGAGMM MTGGAGAGA CAAACGTGM MMTTGGMT
2770 2780 2790 2800 2810 2820
GGGAAACMM TATTGTTTAT MMGAGGCM MGMTCTGT AGATGCTTTA TTTGTAAACT
2830 2840 2850 2860 2870 2880
CTCMTATGA TAGATTACM GCGGATACCA ACATCGCGAT GATTCATGCG GCAGATMAC
2890 2900 2910 2920 2930 2940
GCGTTCATAG CATTCGAGM GCTTATCTGC CTGAGCTGTC TGTGATTCCG GGTGTCMTG
2950 2960 2970 2980 2990 3000
CGGCTATTTT TGMGAATTA GMGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA
- 38 - ~ 3 3 ~ ~ 3 ~
3010 3020 3030 3040 3050 3060
GMMTGTCAT TMAAATGGT GATTTTMTA ATGGCTTATC CTGCTGGMC GTGMMGGGC
3070 3080 3090 3100 3110 3120
ATGTAGATGT AGMGMCM MCMCCACC GTTCGGTCCT TGTTGTTCCG GMTGGGMG
3130 3140 3150 3160 3170 3180
CAGMGTGTC ACMGMGTT CGTGTCTGTC CGGGTCGTGG CTATATCCTT CGTGTCACAG
3190 3200 3210 3220 3230 3240
CGTACMGGA GGGATATGGA GMGGTTGCG TAACCATTCA TGAGATCGAG AACAATACAG
3250 3260 3270 3280 3290 3300
ACGMCTGM GTTTAGCMC TGTGTAGMG AGGMGTATA TCCAMCMC ACGGTMCGT
3310 3320 3330 3340 3350 3360
GTMTGATTA TACTGCGACT CMGMGMT ATGAGGGTAC GTACACTTCT CGTMTCGAG
3370 3380 3390 3400 3410 3420
GATATGACGG AGCCTATGM AGCMTTCTT CTGTACCAGC TGATTATGCA TCAGCCTATG
3430 3440 3450 3460 3470 3480
MGMMAGC ATATACAGAT GGACGMGAG ACMTCCTTG TGMTCTMC AGAGGATATG
3490 3500 3510 3520 3530 3540
GGGATTACAC ACCACTACCA GCTGGCTATG TGACMMGA ATTAGAGTAC TTCCCAGAAA
3550 3560 3570 3580 3590 3600
CCGATMGGT ATGGATTGAG ATCGGAGMA CGGMGGMC ATTCATCGTG GACAGCGTGG
3610 3620 3630 3640 3650 3660
MTTACTTCT TATGGAGGM TMTATATGC TTTATMTGT MGGTGTGCA MTMMGMT
3670 3680 3690 3700 3710 3720
GATTACTGAC TTGTATTGAC AGATAAATAA GGAAATTTTT ATATGAATAA AAMCGGGCA
- 39 - ~ 3 .3 ~ ~ ;3 ~
3730 3740 3750 3760 3770 3780
TCACTCTTAA AAGAATGATG TCCGTTTTTT GTATGATTTA ACGAGTGATA TTTAAATGTT
3790 3800 3810 3820 3830 3840
TTTTTTGCGA AGGCTTTACT TAACGGGGTA CCGCCACATG CCCATCAACT TAAGAATTTG
3850 3860 3870 3880 3890 3900
CACTACCCCC AAGTGTCAAA AAACGTTATT CTTTCTAAAA AGCTAGCTAG AAAGGATGAC
3910 3920 3930 3940 3950 3960
ATTTTTTATG AATCTTTCAA TTCAAGATGA ATTACAACTA TTTTCTGAAG AGCTGTATCG
3970 3980 3990 4000 4010 4020
TCATTTAACC CCTTCTCTTT TGGAAGAACT CGCTAAAGAA TTAGGTTTTG TAAAAAGAAA
4030 4040 4050 4060 4070 4080
ACGAAAGTTT TCAGGAAATG AATTAGCTAC CATATGTATC TGGGGCAGTC AACGTACAGC
4090 4100 4110 4120 4130 4140
GAGTGATTCT CTCGTTCGAC TATGCAGTCA ATTACACGCC GCCACAGCAC TCTTATGAGT
4150 4160 4170 4180 4190 4200
CCAGAAGGAC TCAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ATATATTTTT
4210 4220 4230 4240 4250 4260
TCTGCATTAT GGAAAAGT M ACTTTGTAAA ACATCAGCCA TTTCAAGTGC AGCACTCACG
4270 4280 4290 4300 4310 4320
TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC AAGTACCGAA ACATTTAGCA
4330 4340 4350 4360
CATGTATATC CTGGGTCAGG TGGTTGTGCA CAAACTGCAG
The coding region defined by nucleotides 156 to 3623 of formula I codesfor a polypeptide of formula II.
~;3~ i3~3~
- 40 -
Formel II
Met Asp Asn Asn Pro Asn Ile Asn Glu Cys 10
Ile Pro Tyr Asn Cys Leu Ser Asn Pro Glu 20
Val Glu Val Leu Gly Gly Glu Arg Ile Glu 30
Thr Gly Tyr Thr Pro Ile Asp Ile Ser Leu 40
Ser Leu Thr Gln Phe Leu Leu Ser Glu Phe 50
Val Pro Gly Ala Gly Phe Val Leu Gly Leu 60
Val Asp Ile Ile Trp Gly Ile Phe Gly Pro 70
Ser Gln Trp Asp Ala Phe Leu Val Gln Ile 80
Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu 90
Phe Ala Arg Asn Gln Ala Ile Ser Arg Leu 100
Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr 110
Ala Glu Ser Phe Arg Glu Trp Glu Ala Asp 120
Pro Thr Asn Pro Ala Leu Arg Glu Glu Met 130
Arg Ile Gln Phe Asn Asp Met Asn Ser Ala 140
Leu Thr Thr Ala Ile Pro Leu Phe Ala Val 150
Gln Asn Tyr Gln Val Pro Leu Leu Ser Val 160
Tyr Val Gln Ala Ala Asn Leu His Leu Ser 170
Val Leu Arg Asp Val Ser Val Phe Gly Gln 180
Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn 190
Ser Arg Tyr Asn Asp Leu Thr Arg Leu Ile 200
Gly Asn Tyr Thr Asp His Ala Val Arg Trp 210
Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly 220
Pro Asp Ser Arg Asp Trp Ile Arg Tyr Asn 230
Gln Phe Arg Arg Glu Leu Thr Leu Thr Val 240
Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr 250
Asp Ser Arg Thr Tyr Pro Ile Arg Thr Val 260
Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn 270
Pro Val Leu Glu Asn Phe Asp Gly Ser Phe 280
Arg Gly Ser Ala Gln Gly Ile Glu Gly Ser 290
Ile Arg Ser Pro His Leu Met Asp Ile Leu 300
Asn Ser Ile Thr Ile Tyr Thr Asp Ala His 310
Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln 320
Ile Met Ala Ser Pro Val Gly Phe Ser Gly 330
Pro Glu Phe Thr Phe Pro Leu Tyr Gly Thr 340
Met Gly Asn Ala Ala Pro Gln Gln Arg Ile 350
- 41 - ¦~k .9 ~ ~ 3 '1
Val Ala Gln Leu Gly Gln Gly Val Tyr Arg 360
Thr Leu Ser Ser Thr Leu Tyr Arg Arg Pro 370
Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu 380
Ser Val Leu Asp Gly Thr Glu Phe Ala Tyr 390
Gly Thr Ser Ser Asn Leu Pro Ser Ala Val 400
Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu 410
Asp Glu Ile Pro Pro Gln Asn Asn Asn Val 420
Pro Pro Arg Gln Gly Phe Ser His Arg Leu 430
Ser His Val Ser Met Phe Arg Ser Gly Phe 440
Ser Asn Ser Ser Val Ser Ile Ile Arg Ala 450
Pro Met Phe Ser Trp Ile His Arg Ser Ala 460
Glu Phe Asn Asn Ile Ile Pro Ser Ser Gln 470
Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr 480
Asn Leu Gly Ser Gly Thr Ser Val Val Lys 490
Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu 500
Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr 510
Leu Arg Val Asn Ile Thr Ala Pro Leu Ser 520
Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala 530
Ser Thr Thr Asn Leu Gln Phe His Thr Ser 540
Ile Asp Gly Arg Pro Ile Asn Gln Gly Asn 550
Phe Ser Ala Thr Met Ser Ser Gly Ser Asn 560
Leu Gln Ser Gly Ser Phe Arg Thr Val Gly 570
Phe Thr Thr Pro Phe Asn Phe Ser Asn Gly 580
Ser Ser Val Phe Thr Leu Ser Ala His Val 590
Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp 600
Arg Ile Glu Phe Val Pro Ala Glu Val Thr 610
Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala 620
Gln Lys Ala Val Asn Glu Leu Phe Thr Ser 630
Ser Asn Gln Ile Gly Leu Lys Thr Asp Val 640
Thr Asp Tyr His Ile Asp Gln Val Ser Asn 650
Leu Val Glu Cys Leu Ser Asp Glu Phe Cys 660
Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys 670
Val Lys His Ala Lys Arg Leu Ser Asp Glu 680
Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg 690
Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp 700
Arg Gly Ser Thr Asp Ile Thr Ile Gln Gly 710
Gly Asp Asp Val Phe Lys Glu Asn Tyr Val 720
~.3~9 ~3'~
- 42 -
Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr 730
Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu 740
Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln 750
Leu Arg Gly Tyr Ile Glu Asp Ser Gln Asp 760
Leu Glu Ile Tyr Leu Ile Arg Tyr Asn Ala 770
Lys His Glu Thr Val Asn Val Pro Gly Thr 780
Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser 790
Pro Ile Gly Lys Cys Ala His His Ser His 800
His Phe Ser Leu Asp Ile Asp Val Gly Cys 810
Thr Asp Leu Asn Glu Asp Leu Gly Val Trp 820
Val Ile Phe Lys Ile Lys Thr Gln Asp Gly 830
His Ala Arg Leu Gly Asn Leu Glu Phe Leu 840
Glu Glu Lys Pro Leu Val Gly Glu Ala Leu 850
Ala Arg Val Lys Arg Ala Glu Lys Lys Trp 860
Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu 870
Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu 880
Ser Val Asp Ala Leu Phe Val Asn Ser Gln 890
Tyr Asp Arg Leu Gln Ala Asp Thr Asn Ile 900
Ala Met Ile His Ala Ala Asp Lys Arg Val 910
His Ser Ile Arg Glu Ala Tyr Leu Pro Glu 920
Leu Ser Val Ile Pro Gly Val Asn Ala Ala 930
Ile Phe Glu Glu Leu Glu Gly Arg Ile Phe 940
Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn 950
Val Ile Lys Asn Gly Asp Phe Asn Asn Gly 960
Leu Ser Cys Trp Asn Val Lys Gly His Val 970
Asp Val Glu Glu Gln Asn Asn His Arg Ser 980
Val Leu Val Val Pro Glu Trp Glu Ala Glu 990
Val Ser Gln Glu Val Arg Val Cys Pro Gly 1000
Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr 1010
Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr 1020
Ile His Glu Ile Glu Asn Asn Thr Asp Glu 1030
Leu Lys Phe Ser Asn Cys Val Glu Glu Glu 1040
Val Tyr Pro Asn Asn Thr Val Thr Cys Asn 1050
Asp Tyr Thr Ala Thr Gln Glu Glu Tyr Glu 1060
Gly Thr Tyr Thr Ser Arg Asn Arg Gly Tyr 1070
Asp Gly Ala Tyr Glu Ser Asn Ser Ser Val 1080
Pro Ala Asp Tyr Ala Ser Ala Tyr Glu Glu 1090
~ t! 3 9 7 3 ~
-- 43 --
Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asn 1100
Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp 1110
Tyr Thr Pro Leu Pro Ala Gly Tyr Val Thr 1120
Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp 1130
Lys Val Trp Ile Glu Ile Gly Glu Thr Glu 1140
Gly Thr Phe Ile Val Asp Ser Val Glu Leu 1150
Leu Leu Met Glu Glu End 1156
In order to introduce a chimaeric gene into B. thuringiensis or B. cereus
cells by transformation using the process of the invention, the gene is
preferably first of all inserted into a vector. The insertion is
especially preferably into a bifunctional vector of the invention.
If the corresponding gene is not available in an amount sufficient for
the insertion into the Bacillus cells, the vector can first of all be
amplified by replication in a heterologous host cell. Bacterial cells or
yeast cells are best suited for the amplification of genes. Uhen a
sufficient amount of the gene is available it is inserted into the
Bacillus cells. The insertion of the gene into B. thuringiensis or
B. cereus cells can be carried out with the same vector as was used for
the replication, or with a different vector. The bifunctional vectors of
the invention are especially suitable.
A few examples of bacterial host cells that are suitable for replication
of the chimaeric gene include bacteria selected from the genera
Escherichia, such as E. coli, Agrobacterium, such as A. tumefaciens or
A. rhizogenes, Pseudomonas, such as Pseudomonas spp., Bacillus, such as
B. megaterium or B. subtilis, etc.. As a result of the transformation
process of the invention it is now possible for the first time, within
the scope of this invention, also to use B. thuringiensis and B. cereus
themselves as host cells. Processes for cloning heterologous genes in
bacteria are described in US Patents 4 237 224 and 4 468 464.
The replication of genes in E. coli that code for the crystalline protein
of B. thuringiensis is described by )Uong et al. (1983)-
7 ~ ~
- 44 -
Some examples of yeast host cells that are suitable for the replicationof the genes of the invention include those selected from the genus
Saccharomyces (European Patent Application EP O 238 441).
Any vector into which the chimaeric gene can be inserted and which is
replicated in a suitable host cell, such as in bacteria or yeast, can be
used for the amplification of the genes of the invention. The vector may
be derived, for example, from a phage or from a plasmid. Examples of
vectors that are derived from phages and that can be used within the
scope of this invention are vectors derived from M13- and from ~-phages.
Some suitable vectors derived from M13 phages include M13mpl8 and
ml3mpl9. Some suitable vectors derived from ~-phages include ~gtll, ~gt7
and ~Charon4.
Of the vectors that are derived from plasmids and are especially suitable
for replication in bacteria, there may be mentioned here by way of
example pBR322 ( )Bolivar et al., 1977), pUC18 and pUC19
( )Norrander et al., 1983) and Ti-plasmids ( )Bevan et al., 1983),
without the subject of the invention being in any way limited thereby.
Preferred vectors for the amplification of genes in bacteria are pBR322,
pUC18 and pUC19.
Without any limitation being implied, especially direct cloning vectors,
such as, for example, pBD347, pBD348, pBD64 and pUB1664, and especially
"shuttle" vectors, which have already been described in detail
hereinbefore, may be mentioned for cloning directly in B. thuringiensis
and/or B. cereus.
Especially preferred within the scope of this invention are the
bifunctional ("shuttle") vectors pXI61 (=pK61) and pXI93 (=pK93) which,
introduced by transformation into B. thuringiensis var. kurstaki HDlcryB
and B. cereus 569K, have been deposited at the "Deutsche Sammlung von
Mikroorganismen" (Braunschweig, Federal Republic of Germany), recognised
as an International Depository, in accordance with the requirements of
the Budapest Treaty under the number DSM 4573 (pXI61, introduced by
transformation into B. thuringiensis var. kurstaki HDlcryB) and DSM 4571
~t~t .~3~
- - 45 -
(pXI93, introduced by transformation into B. thuringiensis var. kurstaki
HDlcryB) and DSM 4573 (pXI93, introduced by transformation into B. cereus
569K).
In order to construct a chimaeric gene suitable for replication in
bacteria, a promoter sequence, a 5' untranslated sequence, a coding
sequence and a 3' untranslated sequence are inserted into a vector or are
assembled in the correct sequence in one of the afore-described vectors.
Suitable vectors according to the invention are those that are capable of
being replicated in the host cell.
The promoter, the 5' untranslated region, the coding region and the
3' untranslated region can, if desired, first of all be combined in one
unit outside the vector and then inserted into the vector. Alternatively,
parts of the chimaeric gene can also be inserted into the vector
individually.
In the case of B. thuringiensis and B. cereus cloning vectorS this
process step can be omitted since the entire unit isolated from
B. thuringiensis, consisting of a 5' untranslated region, the coding
region and a 3' untranslated region, can be inserted into the vector.
The vector furthermore preferably also contains a marker gene which
confers on the host cell a property by which it is possible to recognise
the cells transformed with the vector. Marker genes that code for an
antibiotic resistance are preferred. Some examples of suitable
antibiotics are ampicillin, chloramphenicol, erythromycin, tetracycline,
hygromycin, G 418 and kanamycin.
Also preferred are marker genes that code for enzymes having a
chromogenic substrate, such as, for example, X-gal
(5-bromo-4-chloro-3-indolyl-~-D-galactoside). The transformed colonies
can then be detected very easily by way of a specific colour reaction.
3 ~
- - 46 -
The insertion of the gene into, or the assembly of the gene in, the
vector is carried out by way of standard processes, for example using
recombinant DNA (33)Maniatis et al., 1982) and using homologous
recombination (3 )Hinnen et al., 1978).
The recombinant DNA technology processes are based on the vector first of
all being cleaved and the desired DNA sequence being inserted between the
cleaved portions of the vector; the ends of the desired DNA sequence are
then joined to the corresponding ends of the vector.
The vector is preferably cleaved with suitable restriction endonucleases.
Suitable restriction endonucleases are, for example, those that form
blunt ends, such as Sma I, Hpa I and Eco RV, as well as those that form
cohesive ends, such as Eco RI, Sac I and Bam HI.
The desired DNA sequence normally exists as a region of a larger DNA
molecule, such as a chromosome, a plasmid, a transposon or a phage. The
desired DNA sequence is in these cases excised from its original source
and, if desired, so modified that its ends can be joined to those of the
cleaved vector. If the ends of the desired DNA sequence and of the
cleaved vector are blunt ends, then they can, for example, be joined to
one another with ligases specific for blunt ends, such as T4 DNA ligase.
The ends of the desired DNA sequence can also be joined in the form of
cohesive ends to the ends of the cleaved vector, in which case a ligase
specific for cohesive ends, ~hich may also be T4 DNA ligase, is used.
Another suitable ligase specific for cohesive ends is, for example, the
E. coli DNA ligase.
Cohesive ends are advantageously formed by cleaving the desired DNA
sequence and the vector with the same restriction endonuclease, in which
case the desired DNA sequence and the cleaved vector have cohesive ends
that are complementary to each other.
The cohesive ends can also be constructed by adding complementary
homopolymer tails to the ends of the desired DNA sequence and of the
cleaved vector with the aid of terminal deoxynucleotidyl transferase.
- 47 - ~ 3 3 ~ 7 3
Alternatively, cohesive ends can be produced by adding a synthetic
oligonucleotide sequence that is recognised by a particular restriction
endonuclease and is known as a linker, and cleaving the sequence with the
endonuclease (see, for example, 33)Maniatis et al., 1982).
It is thus now possible for the first time, within the scope of this
invention, genetically to modify B. thuringiensis genes, and especially
~-endotoxin-encoding DNA sequences, outside B. thuringiensis, to clone
those genes and then to return them into B. thuringiensis and/or
B. cereus cells, where the said ~-endotoxin genes can be expressed (in a
homologous bacterial host system).
This means that it is now possible also for the genome of
B. thuringiensis to be manipulated genetically in a specifically con-
trolled manner by first of all generating large amounts of plasmid
material in a foreign cloning system and then introducing this into
B. thuringiensis by transformation.
The possibility of modifying the ~-endotoxin genes and the control
sequences regulating the expression of those genes is of particular
interest here.
Apart from chimaeric genes, it is obviously also possible for any otherchimaeric genetic construct to be inserted into Bacillus thuringiensis
and/or Bacillus cereus cells using the process of the invention.
It is thus, for example, conceivable, using the process of the invention,
to insert non-coding "anti-sense" DNA into the genome of a Bacillus
thuringiensis and/or Bacillus cereus cell, so that in the course of the
expression of the said "anti-sense" DNA a mRNA is transcribed that
inhibits the expression of the corresponding "sense" DNA. In this manner
it is possible to inhibit in a specifically controlled manner the
expression in Bacillus thuringiensis and/or Bacillus cereus of certain
undesired genes.
- 48 - ~ 3 ~ ~ ~ 3 ~
Furthermore, apart from the preparation of improved, well-defined
B. thuringiensis strains for the preparation of improved bioinsecticides,
it is now also possible to use B. thuringiensis as a general host for
cloning and, if desired, expressing heterologous and/or homologous genes.
In a specific and preferred embodiment of the process of the invention it
is furthermore now possible for the first time to clone new genes, and
especially new protoxin genes, directly in the natural host, that is to
say in B. thuringiensis or B. cereus.
In the search for new protoxin genes, first of all a gene library of
B. thuringiensis is created.
In a first process step, the total DNA of a protoxin-producing
B. thuringiensis strain is isolated by processes that are known per se
and then broken down into individual fragments. The B. thuringiensis DNA
can be fragmented either mechanically, for example by the action of
shearing forces, or, preferably, by digestion with suitable restriction
enzymes. Digestion of the DNA sample is partial or complete, depending on
the choice of enzymes. Within the scope of this invention, the use of
restriction enzymes that contain quaternary recognition sites and/or
result in a partial digestion of the B. thuringiensis DNA are especially
preferred, such as, for example, the restriction enzyme Sau IIIA, but
this preference does not imply any limitation. Obviously, it is also
possible to use any other suitable restriction enzyme in the process of
the invention.
The restriction fragments obtained in the afore-described manner are then
separated according to size by processes known per se. Size-dependent
separation of DNA fragments is usually effected by centrifuging
processes, such as, for example, saccharose gradient centrifugation, or
by electrophoretic processes, such as agarose gel electrophoresis, or by
a combination of those processes.
Those fractions containing fragments of the correct size, that is to say
fragments that on account of their size are capable of coding for a
protoxin, are pooled and used for the next process steps.
- 49 -
I 339~3~1
The previously isolated fragments are first of all inserted into suitable
cloning vectors using standard processes, and then inserted directly into
Bacillus thuringiensis or B. cereus, but preferably into protoxin-free
strains of Bacillus thuringiensis, using the transformation process of
the invention.
The vectors used may be either gram-positive plasmids, such as, for
example, pBC16, pUB110, pC194, or the "shuttle" vectors described in
detail hereinbefore. The shuttle vector pXI200, which is described in
detail hereinafter (see Example 9.1), is especially preferred within the
scope of this invention. Suitable vectors preferably contain DNA
sequences that ensure easy identification of the transformed
vector-containing clones from among the immense number of untransformed
clones. Especially preferred are DNA sequences coding for a specific
marker that on expression results in an easily selectable feature, such
as, for example an antibiotic resistance. There may be mentioned by way
of example here a resistance to ampicillin, chloramphenicol,
erythromycin, tetracycline, hygromycin, G418 or kanamycin.
Also preferred are marker genes that code for enzymes having a
chromogenic substrate, such as, for example, X-gal
(5-bromo-4-chloro-3-indolyl-~-D-galactoside). The transformed colonies
can then be detected very easily by way of a specific colour reaction.
After electroporation the treated Bacillus thuringiensis or B. cereus
cells are transferred to a selective sporulation medium and are incubated
until sporulation is complete at a temperature of from 10~C to 40~C,
preferably from 20~C to 35~C, and more especially at a temperature of
from 29~C to 31~C. The sporulation medium contains as selective substance
preferably one of the above-mentioned antibiotics, depending on the
vector used, and a suitable solidifying agent, such as, for example,
agar, agarose, gelatin etc..
In the course of sporulation, autolysis of the sporulating cells occurs,
which is advantageous in industrial scale processing for the subsequent
screening since breaking open the cells artificially is dispensed with.
- 50 - ~ 9734
In clones that contain the desired protoxin gene and are expressed under
the control of their natural promoter, the crystalline proteins formed
are freely accessible in the medium. These crystalline proteins which
exist freely in the medium can then be immobilised, for example with the
aid of membrane filters or by other suitable measures. Suitable membrane
filters are, for example, nylon or nitrocellulose membranes. Membranes of
this kind are freely available on the market.
The crystalline proteins immobilised in this manner can then be locatedand identified very simply in a suitable screening process.
Immunological screening using protoxin-specific antibodies is preferredwithin the scope of this invention. Immunological screening processes are
known and are described in detail, for example, in )Young et al., 1983.
The use of monoclonal antibodies that recognise quite specifically a
particular region of the protein molecule is especially preferred within
the scope of the process of the invention. These antibodies can be used
either on their own or in the form of a mixture. It is, of course, also
possible, however, to use polyclonal antisera for the immunological
screening. Mixtures based on monoclonal and polyclonal antibodies are
also possible.
Processes for the production of monoclonal antibodies to Bacillus
thuringiensis protoxin proteins are known and are described in detail,
for example, in )Huber-Lukas (1984) and in )Huber-Lukac et al,
(1986). These processes can also be used in the present case.
The immunological screening process based on antibodies is part of the
present invention.
It is obviously also possible within the scope of this invention to useother suitable screening processes for locating novel DNA sequences in
B. thuringiensis and/or B. cereus.
- 51 - ~3~7~1
Bacillus thuringiensis and B. cereus cells that have been transformed
using the afore-described process, and the toxins produced by these
transformed Bacillus cells, are excellently suitable for controlling
insects, but especially for controlling insects of the orders
Lepidoptera, Diptera and Coleoptera.
The present invention accordingly also relates to a method of controlling
insects which comprises treating insects or the locus thereof
a) with B. thuringiensis or B. cereus cells, or with a mixture of the
two, that have been transformed with a recombinant DNA molecule
containing a structural gene that codes for a ~-endotoxin polypeptide
occurring naturally in B. thuringiensis or for a polypeptide essentially
homologous therewith; or alternatively
b) with a cell-free crystalline body preparation containing a protoxin
that is produced by the said transformed Bacillus cells.
The present invention also includes insecticidal compositions that, in
addition to the conventionally employed carriers, dispersants or carriers
and dispersants, contain
a) B. thuringiensis or B. cereus cells, or a mixture of the two, that
have been transformed with a recombinant DNA molecule containing a
structural gene that codes for a ~-endotoxin polypeptide occurring
naturally in B. thuringiensis or for a polypeptide essentially homologous
therewith; or alternatively
b) a cell-free crystalline body preparation containing a protoxin that is
produced by the said transformed Bacillus cells.
For use as insecticides, the transformed microorganisms containing the
recombinant B. thuringiensis toxin gene, preferably transformed living or
dead B. thuringiensis or B. cereus cells, including mixtures of living
and dead B. thuringiensis and B. cereus cells, as well as the toxin
proteins produced by the said transformed cells, are used in unmodified
form or, preferably, together with adjuvants customarily employed in the
art of formulation, and are formulated in a manner known per se, for
example into suspension concentrates, coatable pastes, directly sprayable
or dilutable solutions, wettable powders, soluble powders, dusts,
granulates, and also encapsulations in, for example, polymer substances.
_ 52 - 't~
As with the nature of the compositions, the methods of application, such
as spraying, atomising, dusting, scattering, coating or pouring, are
chosen in accordance with the intended objectives and the prevailing
circumstances.
Furthermore it is obviously also possible to use insecticidal mixtures
consisting of transformed living or dead B. thuringiensis and/or
B. cereus cells and cell-free crystalline body preparations containing a
protoxin produced by the said transformed Bacillus cells.
The formulations, that is to say the compositions or preparations
containing the transformed living or dead Bacillus cells or mixtures
thereof and also the toxin proteins produced by the said transformed
Bacillus cells and, where appropriate, solid or liquid adjuvants, are
prepared in known manner, for example by intimately mixing the
transformed cells and/or toxin proteins with solid carriers and, where
appropriate, surface-active compounds (surfactants).
The solid carriers used e.g. for dusts and dispersible powders, are
normally natural mineral fillers such as calcite, talcum, kaolin,
montmorillonite or attapulgite. In order to improve the physical
properties it is also possible to add highly dispersed silicic acid or
highly dispersed absorbent polymers. Suitable granulated adsorptive
carriers are porous types, for example pumice, broken brick, sepiolite or
bentonite; and suitable nonsorbent carriers are, for example, calcite or
sand. In addition, a great number of pregranulated materials of inorganic
or organic nature can be used, e.g. especially dolomite or pulverised
plant residues.
Suitable surface-active compounds are non-ionic, cationic and/or anionic
surfactants having good dispersing and wetting properties. The term
"surfactants" will also be understood as comprising mixtures of
surfactants.
Both so-called water-soluble soaps and also water-soluble synthetic
surface-active compounds are suitable anionic surfactants.
~33~73~
- 53 -
Suitable soaps are the alkali metal salts, alkaline earth metal salts or
unsubstituted or substituted ammonium salts of higher fatty acids
(Clo-C22), e.g. the sodium or potassium salts of oleic or stearic acid or
of natural fatty acid mixtures which can be obtained e.g. from coconut
oil or tallow oil. Mention may also be made of fatty acid methyltaurin
salts, such as, for example, the sodium salt of cis-2-(methyl-9-octa-
decenylamino)-ethanesulfonic acid (content in formulations preferably
approximately 3 %).
More frequently, however, so-called synthetic surfactants are used,
especially fatty sulfonates, fatty sulfates, sulfonated benzimidazole
derivatives or alkylarylsulfonates or fatty alcohols, such as, for
example, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (content in formulations
preferably approximately 2 ~o).
The fatty sulfonates or sulfates are usually in the form of alkali metal
salts, alkaline earth metal salts or unsubstituted or substituted
ammonium salts and contain a Cg-C22alkyl radical which also includes the
alkyl moiety of acyl radicals, e.g. the sodium or calcium salt of
lignosulfonic acid, of dodecylsulfate or of a mixture of fatty alcohol
sulfates obtained from natural fatty acids. These compounds also comprise
the salts of sulfated and sulfonated fatty alcohol/ethylene oxide
adducts. The sulfonated benzimidazole derivatives preferably contain
2 sulfonic acid groups and one fatty acid radical containing
8 to 22 carbon atoms. Examples of alkylarylsulfonates are the sodium,
calcium or triethanolamine salts of dodecylbenzenesulfonic acid, di-
butylnaphthalenesulfonic acid, or of a condensate of naphthalenesulfonic
acid and formaldehyde.
Also suitable are corresponding phosphates, e.g. salts of the phosphoric
acid ester of an adduct of p-nonylphenol with 4 to 14 moles of ethylene
oxide.
~33~73~
- 54 -
Non-ionic surfactants are preferably polyglycol ether derivatives of
aliphatic or cycloaliphatic alcohols, saturated or unsaturated fatty
acids and alkylphenols, said derivatives containing 3 to 30 glycol ether
groups and 8 to 20 carbon atoms in the (aliphatic) hydrocarbon moiety and
6 to 18 carbon atoms in the alkyl moiety of the alkylphenols.
Further suitable non-ionic surfactants are the water-soluble adducts ofpolyethylene oxide with polypropylene glycol, ethylenediaminopoly-
propylene glycol and alkylpolypropylene glycol containing 1 to 10 carbon
atoms in the alkyl chain, which adducts contain 20 to 250 ethylene glycol
ether groups and 10 to 100 propylene glycol ether groups. These compounds
usually contain 1 to 5 ethylene glycol units per propylene glycol unit.
Examples of non-ionic surfactants are nonylphenolpolyethoxyethanols,
castor oil polyglycol ethers, polypropylene/polyethylene oxide adducts,
tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxy-
polyethoxyethanol. Fatty acid esters of polyoxyethylene sorbitan, e.g.
polyoxyethylene sorbitan trioleate, are also suitable non-ionic sur-
factants.
Cationic surfactants are preferably quaternary ammonium salts which
contain, as N-substituent, at least one C~-C2zalkyl radical and, as
further substituents, unsubstituted or halogenated lower alkyl, benzyl or
hydroxy-lower alkyl radicals. The salts are preferably in the form of
halides, methylsulfates or ethylsulfates, e.g. stearyltrimethylammonium
chloride or benzyldi(2-chloroethyl)ethylammonium bromide.
The surfactants customarily employed in the art of formulation are
described, inter alia, in the following publications:
)1986 International McCutcheon's Emulsifiers & Detergents, The
Manufacturing Confectioner Publishing Co., Glen Rock, NJ, USA;
Helmut Stache "Tensid-Taschenbuch" Carl Hanser-Verlag Munich/Vienna 1981.
- 55 - ~ 3 .~ 9 7 3 ~
The agrochemical compositions usually contain 0.1 to 99 %, preferably
0.1 to 95 %, of the transformed living or dead Bacillus cells or mixtures
thereof or of the toxin proteins produced by the said transformed
Bacillus cells, 99.9 to 1 %, preferably 99.8 to 5 %, of a solid or liquid
adjuvant, and O to 25 %, preferably O.l to 25 %, of a surfactant.
Whereas commercial products will preferably be formulated as
concentrates, the end user will normally employ dilute formulations.
The compositions may also contain further auxiliaries such as stabili-
sers, antifoams, viscosity regulators, binders, tackifiers as well as
fertilisers or other active ingredients for obtaining special effects.
The transformed living or dead Bacillus cells or mixtures thereof
containing the recombinant B. thuringiensis toxin genes, as well as the
toxin proteins produced by the said transformed Bacillus cells, are
excellently suitable for controlling insect pests. Plant-destructive
insects of the order Lepidoptera should preferably be mentioned here,
especially those of the genera Pieris, Heliothis, Spodoptera and
Plutella, such as, for example, Pieris brassicae, Heliothis virescens,
Heliothis zea, Spodoptera littoralis and Plutella xylostella.
Other insect pests that can be controlled by the afore-described
insecticidal preparations are, for example, beetles of the order
Coleoptera, especially those of the Chrysomelidae family, such as, for
example, Diabrotica undecimpunctata, D. longicornis, D. virgifera,
D. undecimpunctata howardi, Agelastica alni, Leptinotarsa decemlineata
etc., as well as insects of the order Diptera, such as, for example,
Anopheles sergentii, Uranatenia unguiculata, Culex univittatus, Aedes
aegypti, Culex pipiens, etc..
The amounts in which the Bacillus cells or the toxin proteins produced by
them are used depends on the respective conditions, such as, for example,
the weather conditions, the soil conditions, the plant growth and the
time of application.
- 56 - ~J~ 3 ~ ~ ~ 3 ~
Formulation Examples for material containing B. thuringiensis toxin
In the following Formulation Examples the term "Bacillus cells" is usedto mean those B. thuringiensis and/or B. cereus cells containing a
recombinant B. thuringiensis gene of the invention. (The figures given
are percentages by weight throughout).
Fl. Granulates a) b)
Bacillus cells and/or toxin
protein produced by these cells 5 % 10 %
kaolin 94 %
highly dispersed silicic acid 1 %
attapulgite ~ 90 %
The Bacillus cells and/or toxin protein produced by these cells are first
of all suspended in methylene chloride, then the suspension is sprayed
onto the carrier, and the suspending agent is subsequently evaporated off
in vacuo.
F2. Dusts a) b)
Bacillus cells and/or toxin
protein produced by these cells 2 % 5 %
highly dispersed silicic acid 1 % 5 %
talcum 97 %
kaolin - 90 %
Ready-for-use dusts are obtained by intimately mixing the carriers withthe Bacillus cells andlor with toxin protein produced by these cells.
F3. Wettable powders a) b) c)
Bacillus cells andtor toxin
protein produced by these cells 25 % 50 % 75 %
sodium lignosulfonate 5 % 5 %
sodium laurylsulfate 3 % _ 5 %
sodium diisopropylnaphthalene-
sulfonate - 6 % 10 %
- 57 - 1 ~ 3 ~ 7 3 ~
octylphenol polyethylene glycol
ether (7-8 moles of ethylene oxide) - 2 %
highly dispersed silicic acid 5 % 10 % 10 %
kaolin 62 % 27 %
The Bacillus cells and/or toxin protein produced by these cells are
carefully mixed with the adjuvants and the resulting mixture is then
thoroughly ground in a suitable mill, affording wettable powders, which
can be diluted with water to give suspensions of the desired
concentration.
F4. Extruder granulates
Bacillus cells and/or toxin
protein produced by these cells10 %
sodium lignosulfonate 2 %
carboxymethylcellulose 1 %
kaolin 87 %
The Bacillus cells and/or toxin protein produced by these cells are mixed
with the adjuvants, carefully ground, and the mixture is subsequently
moistened with water. The mixture is extruded and then dried in a stream
of air.
F5. Coated granulate
Bacillus cells and/or toxin
protein produced by these cells 3 %
polyethylene glycol 200 3 %
kaolin 94 %
The homogeneously mixed Bacillus cells and/or toxin protein produced bythese cells are uniformly applied, in a mixer, to the kaolin moistened
with the polyethylene glycol. Non-dusty coated granulates are obtained in
this manner.
- 58 - ~ ~2 3 ~ ~ 3 ~
F6. Suspension concentrate
Bacillus cells and/or toxin
protein produced by these cells 40 %
ethylene glycol 10 %
nonylphenol polyethylene glycol
(15 moles of ethylene oxide) 6 %
alkylbenzenesulfonic acid
triethanolamine salt* 3 %
carboxymethylcellulose 1 %
silicone oil in the form of a
75 % aqueous emulsion 0.1 %
water
*Alkyl is preferably linear alkyl having from 10 to 14, especially from12 to 14, carbon atoms, such as, for example, n-dodecylbenzenesulfonic
acid triethanolamine salt.
The homogeneously mixed Bacillus cells and/or toxin protein produced bythese cells are intimately mixed with the adjuvants, giving a suspension
concentrate from which suspensions of any desired concentration can be
obtained by dilution with water.
Examples
General recombinant DNA techniques
Since many of the recombinant DNA techniques used in this invention areroutine for the skilled person, a brief description of the techniques
generally used is given in the following so that these general details
need not be given in the Embodiment Examples themselves. Unless expressly
indicated otherwise, all of these methods are described in the reference
work by 33)Maniatis et al., 1982.
- 59 - .~ 3~73~
A. Cleaving with restriction endonucleases
The reaction mixture will typically contain about 50 llg/ml to 500 llg/ml
DNA in the buffer solution recommended by the manufacturer, New England
Biolabs, Beverly, MA.. From 2 to 5 units of restriction endonuclease are
added for every llg of DNA and the reaction mixture is incubated at the
temperature recommended by the manufacturer for from one to three hours.
The reaction is stopped by heating at 65~C for 10 minutes or by extrac-
tion with phenol, followed by precipitation of the DNA with ethanol. This
technique is also described on pages 104 to 106 of the )Maniatis et al.
reference work.
B. Treatment of the DNA with polymerase to produce blunt ends
50 llg/ml to 500 llg/ml DNA fragments are added to a reaction mixture in
the buffer recommended by the manufacturer, New England Biolabs. The
reaction mixture contains all four deoxynucleotide triphosphates in
concentrations of 0.2 mM. An appropriate DNA polymerase is added and the
reaction is carried out for 30 minutes at 15~C and is then stopped by
heating for 10 minutes at 65~C. For fragments obtained by cleaving with
restriction endonucleases that produce 5' cohesive ends, such as Eco RI
and Bam HI, the large fragment, or Klenow fragment, of DNA polymerase is
used. For fragments obtained using endonucleases that produce 3' cohesive
ends, such as Pst I and Sac I, T4 DNA polymerase is used. The use of
these two enzymes is described on pages 113 to 121 of the
)Maniatis et al. reference work.
C. Agarose gel electrophoresis and cleaning DNA fragments to remove gelcontaminants
Agarose gel electrophoresis is carried out in a horizontal apparatus asdescribed on pages 150 to 163 of the )Maniatis et al. reference work.
The buffer used corresponds to the Tris-borate buffer or Tris-acetate
described therein. The DNA fragments are stained with 0.5 llg/ml ethidium
bromide which either is present in the gel or tank buffer during electro-
phoresis or is not added until after electrophoresis, as desired. The DNA
is made visible by illumination with long-wave ultra-violet light. If the
- 60 ~ g ~ 3 4
fragments are to be separated from the gel, an agarose that gels at low
temperature, obtainable from Sigma Chemical, St. Louis, Missouri, is
used. After electrophoresis, the desired fragment is excised, placed in a
small plastics tube, heated at 65~C for about 15 minutes, extracted three
times with phenol and precipitated twice with ethanol. This method has
been changed slightly compared with the method described by
)Maniatis et al. on page 170.
Alternatively, the DNA can be isolated from the agarose gel with the aid
of the 'Geneclean Kit' (Bio 101 Inc., La Jolla, CA, USA).
D. Removal of 5' terminal phosphates from DNA fragments
During the plasmid cloning steps, treatment of the plasmid vector with
phosphatase reduces the recircularisation of the vector (discussed on
page 13 of the )Maniatis et al. reference work). After cleaving the DNA
with the appropriate restriction endonuclease, one unit of calf
intestinal alkaline phosphatase, which can be obtained from
Boehringer-Mannheim, Mannheim, is added. The DNA is incubated for one
hour at 37~C and then extracted twice with phenol and precipitated with
ethanol.
E. Joining of DNA fragments
If fragments having complementary cohesive ends are to be joined to oneanother, about 100 ng of each fragment are incubated in a reaction
mixture of from 20 ~l to 40 ~l with about 0.2 unit of T4 DNA ligase from
New England Biolabs in the buffer recommended by the manufacturer. The
incubation is carried out for from 1 to 20 hours at 15~C. If DNA
fragments having blunt ends are to be joined, they are incubated as
described above except that the amount of T4 DNA ligase is increased to
from 2 to 4 units.
- 61 - 1~3 3 9 7 ~ ~
F. Transformation of DNA in E. coli
E. coli strain HB101 is used for most experiments. DNA is introduced into
E. coli using the calcium chloride process described by 33)Maniatis et al.,
pages 250 to 251.
G. Screening of E. coli for plasmids
After transformation, the resulting colonies of E. coli are examined for
the presence of the desired plasmid by a rapid plasmid isolation process.
Two commonly used processes are described on pages 366 to 369 of the
)Maniatis et al. reference work.
H. Large-scale isolation of plasmid DNA
Processes for the large-scale isolation of plasmids from E. coli are
described on pages 88 to 94 of the )Maniatis et al. reference work.
Media and Buffer Solutions
LB medium [g/l]
tryptone 10
yeast extract 5
NaCl 5
Antibiotic medium No. 3 (Difco Laboratories)
[g/l]
bovine meat extract 1.5
yeast extract 1.5
peptone 5
glucose
NaCl 3.5
KzHPO4 3.68
KHzPO4 1.32
SCGY medium [g/l] 1 3 ~ S 734
casamino acids
yeast extract 0.1
glucose 5
K2HP04 14
KH2P04 6
Na3-citrate
(NH 4 ) 2S0 4 2
MgS04 - 7 HzO 0.2
GYS medium ( )Yousten & Rogoff, 1969)
[g/l]
glucose
yeast extract 2
(NH4)2S04 2
K2HP0 4 0.5
MgS04 ~ 7 H20 0.2
CaClz ~ 2 H20 0.08
MnS04 ~ HzO 0.05
pH adjusted to 7.3 before autoclaving.
PBS buffer [mM]
saccharose 400
MgCl 2
phosphate buffer, pH 6.0 7
- 63 -
TBST buffer [mM]
Tween 20* 0.05 % (w/v) l ~ 3
Tris/HCl* (pH 8.0) 10
NaCl 150
*Tween 20: polyethoxysorbitan laurate
*Tris/HCl: ~ -Tris(hydroxymethyl)methylaminohydrochloride
The internal reference pK chosen for designating the plasmids in the
Priority Document has been replaced in the Auslandsfassung (foreign
filing text) by the officially recognised reference pXI.
Also, the designation for the asporogenic B. thuringiensis HD1 mutants
used in the Embodiment Examples has been changed from cry~ to cryB.
Example 1: Transformation of B. thuringiensis using electroporation
Example 1.1: 10 ml of an LB medium (tryptone 10 g/l, yeast extract 5 g/l,
NaCl 5 g/l) are inoculated with spores of B. thuringiensis var. kurstaki
HDlcryB ( )Stahly D.P. et al., 1978), a plasmid-free variant of
B. thuringiensis var. kurstaki HD1.
This batch is incubated overnight at a temperature of 27~C using a rotary
shaker at 50 revs/min. Subsequently the B. thuringiensis culture is
diluted 100-fold in from 100 ml to 400 ml of LB medium, and further
cultured at a temperature of 30~C using a rotary shaker at 250 revs/min
until an optical density (ODsso) of 0.2 is reached.
The cells are harvested by centrifugation and suspended in 1/40 volume of
an ice-cooled PBS buffer (400 mM saccharose, 1 mM MgClz, 7 mM phosphate
buffer pH 6.0). Centrifugation and subsequent suspension of the harvested
B. thuringiensis cells in PBS buffer is repeated once more.
The cells pretreated in this manner can be electroporated either direct-
ly, or alternatively after the addition of glycerin to the buffer
~ Trade ~ rk
7 3 '1
- 64 -
solution [20 % (w/v)], and are stored at from -20~C to -70~C, and used at
a later point in time.
800 ~l aliquots of the ice-cooled cells are then transferred into
precooled cuvettes, 0.2 ~g pBC16 plasmid DNA ( )Bernhard K. et al.,
1978) (20 ~g/ml) is subsequently added, and the entire batch is incubated
at 4~C for 10 minutes.
If deep-frozen cell material is used, a suitable aliquot of frozen cells
is first thawed in ice or at room temperature. The further treatment is
analogous to the procedure used for fresh cell material.
The cuvette is then introduced into an electroporation apparatus and the
B. thuringiensis cells present in the suspension are electroporated by
the action of voltages of from 0.1 kV to 2.5 kV from a single discharge
of a capacitor.
The capacitor used has a capacitance of 25 ~F and the distance between
the electrodes in the cuvette is 0.4 cm, which, when discharge occurs
results, depending on the setting, in an exponentially decreasing field
strength with initial peak values of from 0.25 kV/cm to 6.25 kV/cm. The
exponential decay time lies in the range of from 10 ms to 12 ms.
An electroporation apparatus from the firm Bio Rad ("Gene Pulser
Apparatus", #165-2075, Bio Rad, 1414 Harbour Way South, Richmond,
CA 94804, USA), for example, can be used for the described electro-
poration experiments.
It is obviously also possible to use any other suitable apparatus in the
process of the invention.
After a further 10 minutes' incubation at 4~C, the cell suspension is
diluted with 1.2 ml of LB medium, and incubated for 2 hours at a
temperature of 30~C using a rotary shaker at 250 revs/min.
Suitable dilutions are then plated out onto LB agar (LB medium solidified
with agar, 15 g/l), which contains as an additive an antibiotic suitable
- 65 - ~ 3 ~9 ~3~
for the selection of the newly obtained plasmid. In the case of pBC16
this is tetracycline, which is added to the medium in a concentration of
20 mg/l.
The transformation frequencies achieved for B. thuringiensis HDlcryB and
pBC16 as a function of the initial voltage applied for a given distance
between plates are reproduced in Figure 1.
The expression of the inserted DNA can be detected by way of the tetra-cycline resistance that occurs. As soon as 2 hours after the introduction
by transformation of pBC16 into B. thuringiensis a complete phenotypic
expression of the newly introduced tetracycline resistance occurs (see
Table 2).
Example 1.2: The transformation of B. thuringiensis cells is carried out
in exactly the same manner as that described in Example 1.1, except that
the volume of the cell suspension provided for the electroporation is in
this case 400 ~l.
The transformation frequency can be increased by a factor of 10 by thismeasure.
~xample 2: Transformation of B. thuringiensis HDlcryB with a number of
different plasmids
Most of the tests are carried out with plasmid pBC16, a naturally
occurring plasmid of B. cereus. In addition, however, other naturally
occurring plasmids can also be successfully inserted into
B. thuringiensis cells, such as, for example, pUB110 ( )Polack J. and
Novik R.P., 1982), pC194 ( )Horinouchi S. and Weisblum B., 1982) and
pIM13 ( )Mahler I. and Halvorson HØ 1980) (see Table 3).
Also, variants of these plasmids that are better suited than the natural
isolates for work wlth recombinant DNA can be introduced by trans-
formation into the B. thuringiensis strain HDlcryB using the process of
the invention, such as, for example, the B. subtilis cloning vector pBD64
( )Gryczan T. et al., 1980) and plasmids pBD347, pBD348 and pUB1664 (see
~3c~9~
- 66 -
Table 3; plasmids pBD347, pBD348 and pUB1664 can be obtained from
Dr. W. Schurter, CIBA-GEIGY AG, Basle).
The transformation results in Table 3 show clearly that using the
transformation process of the invention, transformation frequencies are
achieved that, with one exception, are all in the range of from
105 to 107, irrespective of the plasmid DNA used.
Example 3: Construction of a "shuttle" vector for Bacillus thuringiensis
Existing bifunctional vectors for E. coli and B. subtilis, such as, for
example, pHV33 ( )Primrose S.B. and Ehrlich S.D., Plasmid, 6: 193-201,
1981) are not suitable for B. thuringiensis HDlcryB (see Table 3).
For the construction of a potent bifunctional vector, first of all the
large Eco RI fragment of pBC16 is inserted with the aid of T4 DNA ligase
into the Eco RI site of plasmid pUC8 ( )Vieira J. and Messing J. 1982).
E. coli cells are then transformed with this construct. A construct
recognised as correct by restriction analysis is designated pXI62.
The removal of the Eco RI cleavage site situated distally from the pUC8polylinker region then follows. pXI62 is linearised by a partial Eco RI
digestion. The cohesive Eco RI ends are made up with Klenow polymerase
and joined together again with T4 DNA ligase. After introduction into
E. coli by transformation, a construct recognised as correct by restric-
tion analysis is selected and designated pXI61. A map of pXI61 with the
cleavage sites of restriction enzymes that cleave pXI61 only once, is
shown in Figure 6.
This construct can be introduced directly into B. thuringiensis HDlcryBusing the transformation process described in Example 1.
On account of the strong restriction barriers in B. thuringiensis
strains, the transformation rates are lower when using pXI61 DNA
originating from E. coli than when using plasmid DNA originating from
B. thuringiensis HDlcryB (see Table 3). Nevertheless pXI61 proves to be
very suitable for carrying out cloning experiments in B. thuringiensis.
- 67 - ~ 33~ i ~1 21489-7728
~xample 4: Insertion of the Kurhdl delta-endotoxin Rene into strains of
B. thuringiensis and B. cereus
The DNA sequence coding for a Kurhdl delta-endotoxin protein used within
the scope of this invention for insertion and expression in
B. thuringiensis and B. cereus originates from plasmid pK36, which was
deposited on 4th March 1986 under the Deposit Number DSM 3668 in accor-
dance with the requirements of the Budapest Treaty for the International
Recognition of the Deposit of Microorganisms for the Purposes of
Patenting, at the Deutsche Sammlung von Mikroorganismen, Federal Republic
of Germany, which is recognised as an International Depository.
A detailed description of the process for identifying and isolating the~-endotoxin genes and for the construction of plasmid pK36 is contained
in European Patent Application EP O 238 441.
pK36 plasmid DNA is completely digested with the restriction enzymes
Pst I and Bam HI and the 4.3 Kb fragment, which contains the Kurhdl
delta-endotoxin gene (cf. formula I), is isolated from an agarose gel.
This fragment is then inserted into pXI61, which has previously been
digested with Pst I and Bam HI and treated with alkaline phosphatase
from calf's stomach. After the transformation of E. coli HB101, a
construct recognised as correct by restriction analysis is isolated and
designated pXI93. A restriction map of pXI93 is reproduced in Figure 7.
pXI93 can be introduced into B. thuringiensis HDlcryB in 2 different
ways.
a) B. thuringiensis cells are transformed directly with a pXI93 isolate
of E. coli using the transformation process of the invention described in
Example 1.
b) pXI93 is first of all introduced into B. subtilis cells by trans-
formation, as described by Chang and Cohen, 1979. The complete and intact
pXI93 plasmid DNA contained in a transformant is isolated and then
introduced into B. thuringiensis HDlcryB by transformation using the
electroporation process described in Example 1.
3 ~
- 68 - 21489-7728
Both methods result in transformants that contain the intact pXI93
plasmid, which can be demonstrated by restriction analysis.
~xample 5: Evidence of the expression of the delta-endotoxin Rene in
B. thuringiensis
Sporulating cultures of B. thuringiensis HDlcryB, HDlcryB (pXI61),
HDlcryB (pXI93) and HD1 are compared under a phase contrast microscope at
a magnification of 400. Ihe typical bipyrimidal protein crystals can be
detected only in the strain containing pXI93 and in HD1. Extracts from
the same cultures are separated electrophoretically on an SDS poly-
acrylamide gel. A protein band of 130,000 Dalton, which corresponds to
the Kurhdl gene product, could be detected on the gel only for the strain
containing plasmid pXI93 and in HD1 (Figure ôa).
In a Western blot analysis (Figure 8b), this 130,000 Dalton protein andits degradation products react specifically with polyclonal antibodies
that have been prepared previously against crystalline protein of
B. thuringiensis var. kurstaki HD1 in accordance with the process
described by )Huber-LukacH., 1982. A detailed description of this
process can be found in European Patent Application EP 238 441.
Located on plasmid
pXI93, upstream of the toxin-encoding region, is a 156 Bp DNA region,
which contains the afore-described sporulation-dependent tandem promoter
(29)Wong H.C. et al., 1983). This sequence is adequate for a high
expression of the delta-endotoxin gene in B. thuringiensis HDlcryB and
B. cereus 569K.
.
~xample 6: Evidence of the toxicity of recombinant B. thurinRiensis
HDlcryB (pXI93)
B. thuringiensis HDlcryB and HDlcryB (pXI93) are cultured at 25~C in
sporulation medium (GYS mediumj. When sporulation is complete, which is
checked using a phase contrast microscope, spores and (if present)
protoxin crystals are harvested by centrifugation and spray-dried. The
resulting powder is admixed in various concentrations with the food of
L-1 larvae of Heliothis virescens (tobacco budworm). The mortality of the
larvae is ascertained after six days.
.
- 69 - ~ 3~73~1
As expected, the protoxin gene-free strain HDlcryB is non-toxic to
Heliothis virescens, whilst the strain transformed with plasmid pXI93
causes a dosage-dependent mortality of H. virescens (Table 4). This
demonstrates that recombinant strains produced by the electroporation
process can actually be used as bioinsecticides.
~xample 7: Electroporation of various B. thuringiensis and B. spec.
strains
The transformation protocol for B. thuringiensis HD1cryB described under
Example 1 can also be applied to other strains.
All tested strains of B. thuringiensis var. kurstaki can be very simplyand efficiently transformed by this process (Table 5).
Excellent transformation frequencies can also be achieved with a labora-
tory strain of B. cereus. The same applies also to other tested
B. thuringiensis varieties (var. israelensis, var. kurstaki). By
contrast, transformation of B. subtilis by the electroporation process is
very poor.
Using the protoplast-dependent PEG method for B. subtilis, on the otherhand, transformation rates of 4 x 106/~g plasmid DNA were achieved.
The low transformation rates of B. subtilis obtained using the electro-poration technique are not associated with incorrectly selected para-
meters, such as, for example, an unsuitable voltage, or with a high
mortality rate caused by electric pulses, as can be seen from Figure 9.
~xample 8: Transformation of B. thuringiensis HD1cryB with the ~-galacto-
sidase ~ene
8.1. Insertion of a Bam HI restriction cleavage site directly before the
first AUG codon of the B. thuringiensis protoxin gene
Before the R-galactosidase gene from the plasmid piWiTh5 (obtainable from
Dr. M. Geiser, CIBA-GEIGY AG, Basle, Switzerland) can be joined to the
- 70 ~ 7 3
promoter of the Kurhdl ~-endotoxin gene of B. thuringiensis, the DNA
sequence of the protoxin gene located in the region of the AUG start
codon must first be modified.
This modification is carried out by oligonucleotide-directed mutagenesis,
using the single-stranded phage M13mp8, which contains the 1.8 kB Hinc
II-Hind III fragment, of the ~-endotoxin gene containing the 5' region of
that gene.
First of all 3 ~g of plasmid pK36 (cf. Example 4) are digested with therestriction enzymes Hind III and Hinc II. The resulting 1.8 kb fragment
is purified by agarose gel electrophoresis and then isolated from the
gel.
In parallel with this, 100 ng of M13mp8 RF phage DNA (Biolab, Tozer Road,
Beverly MA, 01915, USA or any other manufacturer) are digested with the
restriction enzymes Sma I and Hind III, treated with phenol, and preci-
pitated by the addition of ethanol. The phage DNA treated in this manner
is then mixed with 200 ng of the previously isolated protoxin fragment
and joined thereto by the addition of T4 DNA ligase.
After the transfection of E. coli JM103, 6 white plaques are selected and
analysed by restriction mapping.
An isolate in which the join between the B-galactosidase gene and the
promoter of the Kurhdl ~-endotoxin gene of B. thuringiensis has been
carried out correctly is selected and designated M13mp8/Hinc-Hind.
An oligonucleotide with the following sequence is synthesized using a DNA
synthesizing apparatus ("APPLIED BIOSYSTEM DNA SYNTHESIZER"):
(5') GTTCGGATTGGGATCCATAAG (3')
This synthetic oligonucleotide is complementary to the M13mp8/Hinc-HindDNA in a region that extends from position 153 to position 173 of the
Kurdhl ~-endotoxin gene (cf. formula I). The oligonucleotide sequence
reproduced above has a "mismatch" in positions 162 and 163, however,
- 71 - ~ ~e 3 9 ~ 3 ll
compared with the sequence reproduced in formula I, so that the formation
of a Bam HI restriction cleavage site is necessary. The general procedure
for the mutagenesis is described by J. M. Zoller and M. Smith
( )J.M. Zoller and M. Smith; 19). Approximately 5 ~g of single-stranded
M13mpl8/Hinc-Hind phage DNA is mixed with 0.3 ~g of phosphorylated
oligonucleotides in a total volume of 40 ~l. This mixture is heated for
5 minutes at 65~C, cooled first to 50~C and then, gradually, to 4~C.
Buffer, nucleotide triphosphates, ATP, T4 DNA ligase and the large
fragment of DNA polymerase are then added and the batch is incubated
overnight at 15~C in the manner described (43)J.M. Zoller and M. Smith).
After agarose gel electrophoresis, circular double-stranded DNA is
purified and inserted into E. coli strain JM103 by transfection. As an
alternative, the E. coli strain JM107 can be used.
The resulting plaques are examined for sequences that hybridize with
32P-labelled oligonucleotide; the phages are examined by DNA restriction
endonuclease analysis.
A phage that contains a correct construct in which a Bam HI cleavage site
is located directly before the first AUG codon of the protoxin gene is
designated M13mp8/Hinc-Hind/Bam.
8.2. Joining the ~-galactosidase gene to the ~-endotoxin promoter
8.2.1: The ~-endotoxin promoter is on a 162 Bp Eco RI/Bam HI fragment of
the M13mp8/Hinc-Hind/Bam phage DNA. RF phage DNA is digested with
restriction enzyme Bam HI. The projections resulting at the 5' ends are
removed by treatment with "Mung Bean" nuclease (Biolabs) in accordance
with the manufacturer's instructions. Subsequently, the DNA is digested
with the restriction endonuclease Eco RI and, after carrying out agarose
gel electrophoresis, the 162 Bp fragment is isolated from the agarose
gel.
The ~-galactosidase gene is isolated from plasmid piWiTh5. piWiTh5 DNA is
first of all cleaved at the single Hind III cleavage site. The 3' re-
cessed ends are made up using the Klenow fragment of DNA polymerase (cf.
)Maniatis et al., 1983, page 113-114) and the modified DNA is then
- 72 - ~ ~ 3 ~ 7 3 4
digested with the restriction enzyme Sal I. The DNA fragment containing
the R-galactosidase gene is isolated by agarose gel electrophoresis.
The vector pXI61 (cf. Example 3) is digested with the restriction enzymes
Eco RI and Sal I and the two previously isolated fragments are inserted
into the vector pXI61.
After transformation of this ligation mixture in the E. coli strain HB101
or JM107, the correctly joined clones are selected by restriction
analysis and by their ~-galactosidase activity with respect to the
chromogenic substrate X-gal (5-bromo-4-chloro-3-indolyl-~-D-galactoside).
A clone containing a correct genetic construct is designated pXI80.
8.2.2: In an alternative embodiment, the 162 Bp Eco RI/Bam HI fragment
containing the ~-endotoxin promoter is isolated by cleavage of
M13mp8/Hinc-Hind/Bam with Eco RI and Bam HI, followed by separation by
gel electrophoresis.
The ~-galactosidase gene is isolated from plasmid pi~iTh5 in this
instance too (cf. Example 8.1.). In this case, the plasmid DNA is
digested with the restriction enzymes Bam HI and Bgl II and the large
fragment is eluted from the agarose gel after gel electrophoresis.
The vector pHY300 PLK (#PHY-001; Toyobo Co., Ltd., 2-8 Dojima Hama
2-Chome, Kita-ku, Osaka, 530 Japan), which can be obtained commercially
(cf. Example 9.1), is digested with the restriction enzymes Eco RI and
Bgl II. The two previously isolated fragments are then inserted into the
vector pHY300 PLK.
The entire ligation mixture is then introduced by transformation into the
E. coli strain JM107 (Bethesda Research Laboratories (BRL), 411 N,
Stonestreet Avenue, Rockville, MD 20850, USA). A clone having a ~-galac-
tosidase activity is further analysed by restriction digestions. A clone
containing a correct genetic construct is designated pXI101.
~ 33~3~
- 73 -
8.3. Introduction by transformation into B. subtilis and B. thuringiensis
of plasmid pXI80 or pXI101
pXI80 or pXI101 plasmid DNA is first of all introduced into B. subtilis
protoplasts by transformation according to a known test protocol des-
cribed by Chang and Cohen (13)Chang and Cohen, 1979).
A correct clone is selected, the DNA to be transformed is isolated by
standard processes and introduced by transformation into B. thuringiensis
HDlcryB cells by way of electroporation (cf. Example 1).
The transformed B. thuringiensis cells are plated out onto GYS agar
(sporulation medium), which contains X-gal as an additive.
Correctly transformed clones turn blue when sporulation commences.
A B. thuringiensis HDlcryB strain transformed by the pXI61 vector, on the
other hand, remains white under the same conditions.
Restriction analysis shows that with correctly transformed clones, an
intact pXI80 or pXI101 plasmid is present in the B. thuringiensis cells.
8.4. ~-galactosidase gene under the control of a sporulation-dependent
promoter
B. thuringiensis HDlcryB cells containing plasmid pXI80 or pXI101 are
cultured on GYS medium in the manner described hereinbefore. At intervals
during the growth phase (both during the vegetative growth phase and
during the sporulation phase) a ~-galactosidase assay is carried out in
accordance with the test protocol described by )J.H. Miller ("Experi-
ments in Molecular Genetics", Cold Spring Harbor Laboratory, 1972,
Experiment 48 and 49).
The individual differences from the above-mentioned test protocol concern
the use of X-gal as chromogenic substrate and the measurement of the
coloured hydrolysis product, which is formed by the cells after approxi-
mately 1 hour.
- 74 - ~ 7 3 ~
The cells are then removed by centrifugation, and the optical density of
the supernatant is ascertained at a wavelength of 650 nm (OD6so)-
An increase in the optical density as a function of sporulation isobserved. The non-transformed B. thuringiensis cells, on the other hand,
cannot hydrolyse the chromogenic substrate X-gal.
Example 9: Creation of gene banks in Bacillus thuringiensis
9.1. Construction of pXI200
Plasmid pXI200 is a derivative of plasmid pHY300 PLK, which can be
obtained commercially from Toyobo Co., Ltd. (#PHY-OO1; Toyobo Co., Ltd.,
2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan). Plasmid pHY300, the
construction of which is described in European Patent Application
EP 162 725, contains both an ampicillin (amp ) and a tetracycline (tetr )
resistance gene.
Plasmid pHY300 PLK is completely digested with Bgl I and Pvu I. The
resulting restriction fragments are then separated by agarose gel
electrophoresis. The 4.4 Kb fragment is isolated from the agarose gel,
purified and then religated with T4 DNA ligase.
The whole ligation batch is introduced by transformation into E. coli
HB101. After incubation of the transformed E. coli HB101 cells at 37~C on
a selective L-agar containing 20 ~g/ml tetracycline, the tetracycline-
resistant (Tcr) transformants are selected. It is then possible to
isolate from an ampicillin-sensitive (Aps) clone (100 ~g/ml ampicillin) a
plasmid that has lost the Pst I cleavage site in the Apr gene together
with the 0.3 Kb Pvu I/Bgl I fragment. This plasmid is designated pXI200.
9.2 Cloning protoxin genes of Bacillus thuringiensis var. kurstaki HD1 in
Bacillus thuringiensis HDlcryB
The total DNA (50 ~g) of Bacillus thuringiensis var kurstaki HD1 is
completely digested by incubation with the restriction enzymes Pst 1 and
Hpa 1. The restriction fragments so obtained are transferred to a
continuous saccharose gradient [5 % (w/v) - 23 % (w/v)] where they are
separated according to size by density gradient centrifugation and
- 75 ~ 3 ~ 7 3 l~
collected in 500 ~1 fractions. The centrifugation is carried out in a
TST 41-rotor (Kontron Ausschwingrotor) at a temperature of 15~C at
max 2.4 x 105 g for a period of 16 hours. Subsequently, in order to
determine the fragment size aliquots, each of 50 ~1, are transferred to
an agarose gel [0.8 ~O (w/v) agarose in Tris acetate EDTA or Tris borate
EDTA; see 3 )Maniatis et al., 1982]. Those fractions containing fragments
between 3 Kb and 6 Kb are pooled and concentrated to a volume of 10 ~1 by
ethanol precipitation.
5 ~g of the "shuttle" vector pXI200 described in Example 9.1 are digested
with the restriction enzymes Pst 1 and Sma 1. The 5' phosphate groups of
the resulting restriction fragments are then removed by treatment with
calf intestinal alkaline phosphatase. 0.2 ~g to 0.3 ~g of the previously
isolated HD1 DNA is then mixed with 0.5 ~g of the pXI200 vector DNA and
incubated overnight at 14~C with the addition of 0.1 U of T4 DNA ligase
(so-called "Weiss Units"; one unit of T4 DNA ligase corresponds to an
enzymatic activity sufficient to convert 1 nM [32P] from pyrophosphate at
a temperature of 37~C and within a period of 20 minutes into a Norit-
absorbable material). The entire ligation batch is then introduced by
transformation directly into Bacillus thuringiensis HDlcryB cells by
means of electroporation (cf. Example 1). The electroporated
B. thuringiensis cells are then plated out onto a selective sporulation
agar containing 20 ~g/ml of tetracycline as selecting agent, and in-
cubated at a temperature of 25~C until sporulation is complete.
9.3. Manufacture of monoclonal antibodies to B. thuringiensis protoxin
protein
The manufacture of monoclonal antibodies to ~-endotoxin of Bacillus
thuringiensis var. kurstaki HD1 is carried out analogously to the
description in )Huber-Lukas (1984) and in )Huber-Lukacet al.,
(1986).
The hybridoma cells used for the antibody manufacture are fusion products
of Sp2/O-Ag myeloma cells (described in )Shulman et al., 1978; can be
obtained at the "American Type Culture Collection" in Rockville,
Maryland, USA) and splenocytes of Balb/c mice that have previously been
immunised with ~-endotoxin of B. thuringiensis var. kurstaki HD1.
- 76 - ~.~3~3~
In this manner it is possible to obtain monoclonal antibodies that are
directed specifically against the ~-endotoxin of B. thuringiensis.
Especially preferred are monoclonal antibodies that either bind specifi-
cally to an epitope in the N-terminal half of the protoxin protein (for
example antibody 54.1 of the Huber-Lukac et al., 1986 reference), or
recognise an epitope in the part of the protein constant in Lepidoptera-
active protoxins, the C-terminal half (for example antibody 83.16 of the
Huber-Lukac et al., 1986 reference).
It is, however, also entirely possible for other monoclonal or also
polyclonal antibodies to be used for the subsequent immunological
screening (cf. Example 9.4).
9.4. Immunological Screening
The monoclonal antibodies produced in accordance with Example 9.3, or
other suitable monoclonal antibodies, are used for the immunological
screening.
First of all, the crystalline proteins present in free form after the
sporulation of the B. thuringiensis cells are bound by means of transfer
membranes (for example Pall Biodyne transfer membrane; Pall Ultrafine
Filtration Corporation, Glen Cove, N.Y.) by applying the filter membranes
to the plates for a period of approximately 5 minutes. The filters are
subsequently washed for 5 minutes with TBST buffer [0.05 % ~w/v)
Tween 20, 10 mM Tris/HCl (pH 8.0), 150 mM NaCl in bidist. HzO] and then,
in order to block non-specific binding, incubated in a mixture of
TBST buffer and 1 % (w/v) skimmed milk for from 15 to 30 minutes.
The filters prepared in this manner are then incubated overnight with the
protoxin-specific antibodies [antibody mixture of 54.1 and 83.16
( )Huber-Lukac et al., (1986)]. The unbound antibodies are removed by
washing the filter three times with TBST buffer for from 5 to 10 minutes
each time. To detect the antibody-bound protoxin the filters are in-
cubated with a further antibody. The secondary antibody used is an
anti-mouse antibody labelled with alkaline phosphatase, which can be
obtained commercially, for example, from Bio-Rad [Katalog #170-6520,
~ 3~73l~
goat's anti-mouse IgG(H+L)-alkaline phosphatase conjugate]. After an
incubation period of 30 minutes the unbound secondary antibodies are
removed in the manner described above by washing the filters with
TBST buffer three times (for from 5 to 10 minutes each time). The filters
are then incubated with a substrate mixture consisting of NBT ['p-nitro
blue tetrazolium chloride; nitro-blue tetrazolium chloride] and BCIP
[5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt]. The enzymatic
reaction is carried out in accordance with the manufacturer's instruc-
tions [Bio-Rad; 1414 Harbour Way South, Richmond CA, 94804, USA].
.
Positive, that is to say protoxin-containing clones, can be recognised
very easily by their violet colouring. This occurs as a result of the
enzymatic reaction of the alkaline phosphatase with the afore-mentioned
substrate mixture. Between 800 and 1000 transformants result from the
transformation described in Example 9.2 with the ligation batch indicated
in that Example. Of these transformants 2 colonies exhibit clearly
positive signals in the above-described enzyme reaction.
Plasmid DNA is isolated from positive clones in which expression of theprotoxin gene could be detected by way of the described enzyme reaction.
The cloned protoxin genes can be further characterised and ultimately
identified by restriction analysis and comparison with known restriction
maps.
Both clones contain a recombinant plasmid with an insert of 4.3 Kb. Thesubsequent restriction digestions with Hind III, Pvu II, Eco RI and Xba I
permit identification of the gene on the insert by comparison with the
known restriction maps of the endotoxin genes of B. thuringiensis
var. kurstaki HD1. In both cases the gene is the Kurhdl gene, which is
also known as the 5.3 Kb protoxin gene and is described in
)Geiser et al., 1986.
This gene, cloned directly in B. thuringiensis and identified by immuno-
logical screening, furthermore hybridises with a 1847 Bp Bam HI/Hind III
fragment of the 5.3 Kb gene in plasmid pK36 ( )Geiser et al., 1986). In
1 3 !3 ~ 7 3 1
-- 78 ~
the SDS/PAGE, both clones exhibit a band of 130,000 Dalton typical of the
protoxin, which in a Western blot ( 6)Towbin et al., 1979) react specifi-
cally with the afore-described (see Example 9.4) monoclonal antibodies.
Tables
Table 1: Influence of the incubation time at 4~C, before and after
electroporation, on the transformation frequency. B. thuringiensis
HDlcryB was transformed using the electroporation process with 0.2 yg
pBC16 per batch.
Example 1 2 3 4 5 6 7 8
preincu-
bation *
(minutes) 0 5 10 20 20 20 20 20
subsequent
incuba-
tion **
(minutes) 20 20 20 20 0 5 10 20
Transfor-
mation
frequency
(Trans-
formants
/~lg
Plasmid
DNA) 2.6x106 2.1x106 2.2x106 2.3x106 2.5x106 1.9x106 3.3x106 1.7x106
*
Incubation at 4~C between the addition of DNA and electroporation
Incubation at 4~C between electroporation and the beginning of the
expression period
- 79 - ~ ~
Table 2: Expression of the tetracycline resistance of pBC16 after
introduction into B. thuringiensis HDlcryB by transformation
B. thuringiensis HDlcryB was transformed with pBC16 plasmid DNA
using the electroporation protocol according to the invention.
After various incubation periods in LB medium at 30~C, the
transformed cells are selected by plating out onto LB agar
containing 20 ~g/ml tetracycline.
Time taken to express Transformation Number of livingtetracycline resis- frequency (Trans- cells
tance-(hours) formants/~gDNA)
0.5 0 4x 108
1 1.6 x lo6 109
2 8.8 x lo6 1.4 x 109
3 8 x lo6 1.6 x 109
- 80 - ~33~31
Table 3: Transformation of the B. thuringiensis strain HDlcryB with
various plasmids
Plasmid I Origin I resistance marker Transformation
¦ gram negativel gram positive¦ frequency
naturally occuring plasmids
pBC16 B. cereus - Tc 1.9 x 106
pUB110 Staphylococcus Km, Ble 3.3 x 106*
aureus
pC194 S. aureus - Cm 6 x 106*
pIM13 B. subtilis - Em 1.8 x 105
modified plasmids/cloning vectors
pBD64 pUB110
replicon - Km, Cm 5 x 106
pBD347 pIM13 repli-
con, - Cm 2.9 x 105
pBD348 pIM13 repli-
con, - Em, Cm 1.1 x 105
pUB1664 pUB110 repli-
con, - Cm, Em 3.5 x 104
"shuttle" vectors
pHV33 pBR322/pC194, Amp, Tc Cm < 50*
pK61 pUC8/ pBC16, Amp Tc 2.8 x 104
1: Tc: tetracycline; Km: kanamycin; Ble: bleomycin; Cm: chloramphenicol;
Em: erythromycin
2: All plasmid DNA originates from B. thuringiensis HDlcryB with the
exception of * isolated from B. subtilis LBG4468.
Table 4: Biotest of B. thuringiensis HDlcryB and HDlcryB (pXI93) against
Heliothis virescens.
Spray-dried sporulated cultures (spores and (if present)
protoxin crystals) are admixed, in the amounts indicated, with
the food of L-1 larvae of Heliothis virescens.
7 :~ ~
- 81 -
Concentration of Mortality (%) of H. virescens
spores and protoxin caused by:
crystals (~g/g food)
HD1 cryB HD1 cryB (pXI93)
200 ~ 57
100 ~ 43
3 27
0 10
12.5 0 0
Table 5: Transformability of strains of B. thuringiensis, B. cereus and
B. subtilis. All strains were transformed with plasmid pBC16 in
accordance with the electroporation process described under
Example 1
Strain Transformation
frequency
B. thuringiensis var. kurstaki
HD1cryB
HD1 dipel 0.25
HD1-9 0.9
HD 73 0.1
HD 191 0.5
B. thuringiensis var. thuringiensis
HD 2-D6-4 13.8
B. thuringiensis var. israelensis
LBG B-4444 2.6
B. cereus
569 K 7.5
B. subtilis
LBG B-4468 0.0002
relative values based on the transformation frequency, defined as 1,
achieved with B. thuringiensis var. kurstaki HDlcryB.
Deposit of Microor~anisms
A culture of each of the microorganisms listed in the following that are
used within the scope of the present invention has been deposited at the
"Deutsche Sammlung von Mikroorganismen", recognised as an International
Depository, in Braunschweig, Federal Republic of Germany, in accordance
with the requirements of the Budapest Treaty for the International
- 82 - 13 3~ 7 3 ~
Recognition of the Deposit of Microorganisms for the Purposes of
Patenting. A declaration concerning the viability of the deposited
samples has been issued by the said International Depository.
Deposit of Micoorganisms
Microorganisms Deposit Date Deposit Number Date of the
viability
certificate
HB 101 (pK36) 4. March 1986 DSM 3668 7. March 1986
(E. coli HB101
transformed
with pK36
plasmid DNA)
*HD1 cryB 4. May 1988 DSM 4574 4. May 1988
(Bacillus thu-
ringiensis var.
kurstaki HD1 cryB
*HD1 cryB (*pK 61) 4. May 1988 DSM 4572 4. May 1988
(B. thuringiensis
HD1 cryB trans-
formed with *pK61
plasmid DNA)
*HD1 cryB (*pK 93) 4. May 1988 DSM 4571 4. May 1988
(B. thuringiensis
HD1 cryB trans-
formed with *pK93
plasmid DNA)
569 K 4. May 1988 DSM 4575 4. May 1988
(Bacillus cereus
569 K)
569 K (*pK 93) 4. May 1988 DSM 4573 4. May 1988
(B. cereus 569 K
transformed with
*pK93 plasmid DNA)
The internal reference pK selected for the designation of the plasmids in
the Priority Document has been replaced for the Auslandsfassung (foreign
filing text) by the officially recognised designation pXI.
Also, the designation for the asporogenic B. thuringiensis HD1 mutants
used in the Embodiment Examples has been changed from cry~ to cryB.
-83- 1~t~3
Literature references
1. Goldberg L. and Margalit J., Mosquito News, 37: 355-358, 1977
2. Krieg A. et al., Z. Ang. Ent., 96: 500-508, 1983
3. Schnepf, H.E. and Whiteley H.R., Proc. Natl. Acad. Sci., USA,
78: 2893-2897, 1981
4. Klier A. et al., The EMBO J., 1: 791-799, 1982
5. Geiser M. et al., Gene, 48: 109-118, 1986
6. Haider M.Z. et al., Gene, 52 : 285-290, 1987
7. Gonzalez J.M. et al., Proc. Natl. Acad. Sci. USA, 79: 6951-6955, 1982
8. Obukowicz M.G. et al., J. Bacteriol., 168 : 982-989, 1986
9. Donovan L.P. et al., Mol. Gen. Genet., 214: 365-372, 1988
10. Schnepf H.E. and Whitely H.R., J. Biol. Chem., 260: 6273, 1985
11. Klier A. et al., Mol. Gen. Genet., 191: 257-262, 1983
12. Bibb J.J. et al., Nature, 274: 398-400, 1978
13. Chan~ S. and Cohen S.N., Molec. Gen. Genet., 168: 111-115, 1979
14. Brown B.J. and Carlton B.C., J. Bacteriol., 142: 508-512, 1980
15. Kondo J.K. and McKay L.L., Appl. Environ. Microbiol., 48: 252-259,
1984
16. Wirth R. et al., J. bacteriol., 165: 831-836, 1986
17. Yoshihama M. et al., J. Bacteriol., 162 : 591-597, 1985
18. Alikhanian S.J. et al., J. Bacteriol., 146, 7-9, 1981
19. Martin P.A. et al., J. Bacteriol., 145: 980-983, 1981
20. Fischer H.M., Arch. Microbiol., 139: 213-217, 1984
21. Schall D., Genubertragung zwischen Isolaten von Bacillus
thuringiensis durch Protoplastentransformation und -fusion (Gene
transfer between isolates of Bacillus thuringiensis by protoplast
transformation and fusion). Dissertation, University of Tubingen,
1986.
22. Shivarova N., Zeitschr. Allgem. Mikrobiol., 23: 595-599, 1983
23. Youston A.A. and Rogoff M.H., J. Bacteriol., 100: 1229-1236, 1969
24. Horinouchi S., and Weisblum B., J. Bacteriol., 150: 815-825, 1982
25. Polak J. and Novick R.P., Plasmid, 7: 152-162, 1982
26. Mahler J. and Halvorson H.O., J. Gen. Microbiol., 120: 259-263, 1980
27. Gryczan T. et al., J. Bacteriol., 141: 246-253, 1980
28. Vieira J. and Messing J., Gene, 19: 259-268, 1982
29. Wong et al., J. Biol. Chem., 258: 1960-1967, 1983
- 84 - ~ 3~73 i
30. Bolivar et al., Gene 2: 95-113, 1977
31. Norrander et al., Gene, 26: 101-104, 1983
32. Bevan et al., Nature, 304: 184-187, 1983
33. Maniatis et al., Molecular Cloning. A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, USA, 1982
34. Hinnen et al., Proc. Natl. Acad. Sci., USA, 75: 1929-1933, 1978
35. Young R.A. et al., Proc. Natl. Acad. Sci., USA, 80: 1194-1198, 1983
36. Huber-Lucac M., Dissertation No. 7547 "Zur Interaktion des delta-
endotoxins von Bacillus thuringiensis mit monoklonalen Antikorpern
und Lipiden" (on the interaction of the delta-endotoxin of Bacillus
thuringiensis with monoclonal antibodies and lipids), ETH Zurich,
1984
37. Huber-Lucac M. et al., Infect. Immunol., 54: 228-232, 1986
38. McCutcheon's, 1986 International McCutcheon's Emulsifiers & Deter-
gents, The Manufacturing Confections Publishing Co., Glen Rock, NJ,
USA.
39. Stahly D.P. et al., Biochem. Biophys. Res. Comm., 84: 581-588, 1978
40. Bernhard K. et al., J. Bacteriol., 133: 897-903, 1978
41. Primrose S.B., Ehrlich S.D., Plasmid 6: 193-201, 1981
42. Huber-LukacH., Dissertation, Eidgenossische Technische Hochschule,
Zurich, Switzerland, No. 7050, 1982
43. Zoller J.M. and Smith M., Nucl. Acids Res., 10: 6487, 1982
44. Miller J.H., Experiments in Molecular Genetics, Cold Spring Harbor
Laboratory, 1972
45. Shulman et al., Nature, 276: 269, 1978
46. Towbin H. et al., Proc. Natl. Acad. Sci., USA, 76: 4350-4354, 1979
Patent Literature
EP 162 725
EP 238 441
W0 86/01536
US-P 4 448 885
US-P 4 447 036
US-P 4 237 224
US-P 4 468 464
