Note: Descriptions are shown in the official language in which they were submitted.
l~in~6~
ANTISENSE OLIGONUCLEOTIDES TO C-MYB
PROTO-ONCOGENE AND USES THEREOF
Field of the Invention
The invention relates to antisense oligonucleotides
to proto-oncogenes, and in particular to antisense oligo-
nucleotides to the c-myb gene, and the use of such oligo-
~0 nucleotides as antineoplastic and immunosuppressive agents.Reference to Government Grant
The invention described herein was supported in
part by National Institutes of Health grants CA36896,
CA01324 and CA46782.
Background of the Invention
Antisense Oligonucleotides
The proto-oncogene c-myb is the normal cellular
homologue of the avian myeloblastosis virus-transforming
gene v-myb. The c-myb gene codes for a nuclear protein
expressed primarily in hematopoietic cells. It is a proto-
oncogene, that is, it codes for a protein which is required
for the survival of normal, non-tumor cells. When the gene
is altered in the appropriate manner, it has the potential
to become an oncogene. Oncogenes are genes whose expres-
sion within a cell provides some function in the transfor-
mation from normal to tumor cell.
*
1340369
. .
The human c-myb gene has been isolated, cloned, and
sequenced. Majello et al, Proc. Natl. Acad. Sci. U.S.A.
83, 9636-9640 (1986).
C-myb is preferentially expressed in primitive
5hematopoietic tissues and hematopoietic tumor cell lines of
several species. Westin et al., Proc. Natl. Acad. Sci.
U.S.A. 79 2194 (1982). As cells mature, c-myb expression
declines. Duprey et al., Proc. Natl. Acad. Sci. U.S.A. 82,
6937, (1985). The constitutive expression of exogenously
10introduced c-myb inhibits the erythroid differentiation of
a murine erythroleukemia cell line (MEL) in response to
known inducing agents. Clarke et al., Mol. Cell. Biol. 8,
884-892 (Feb. 1988). Although these data may implicate the
c-myb gene product as a potentially important regulator of
15hematopoietic cell development, this evidence is largely of
an indirect nature.
Some investigators report that c-myb may play an
important role in regulating hematopoietic cell prolif-
eration, and perhaps differentiation, Slamon et al, Science
20233, 347 (1986); Westin et al, supra; Duprey et al, supra.
The function of the c-myb proto-oncogene in normal hema-
topoiesis remains speculative.
Expression of specific genes may be suppressed by
oligonucleotides having a nucleotide sequence complementary
25to the mRNA transcript of the target gene. This "anti-
sense" methodology finds utility as a molecular tool for
genetic analysis. Antisense oligonucleotides have been
extensively used to inhibit gene expression in normal and
abnormal cells in studies of the function of various proto-
30oncogenes.
Proliferation of the human promyelocytic leukemia
cell line HL-60, which over-expresses the c-myc proto-
oncogene, is inhibited in a sequence-specific, dose-depen-
dent manner by an antisense oligodeoxynucleotide directed
35against a predicted hairpin loop containing the initiation
codon of human c-myc. Wickstrom et al, Proc. Natl. Acad.
13~0~fi~
.
Sci. USA 85, 1028-1032 (Feb. 1988). Inhibition of c-myc
expression and/or cell proliferation in HL-60 or other
cells by c-myc antisense oligonucleotides is described by
the following: Loke et al, Clin. Res. 36 (3), 443A
(abstract) (1988); Holt et al, Mol. Cell. Biol. 8, 963-973
(Feb. 1988); Yakoyama et al, Proc. Natl. Acad. Sci. U.S.A.
84, 7363-7367 (Nov. 1987); Harel-Bellan et al, J. Immunol.
140, 2431-2435 (Apr. 1988) and J. Cell. Biochem. Supplement
12A, 167 (Jan. 1988).
Antisense methodology has been used to study the
expression of c-fos, another proto-oncogene. C-fos expres-
sion and cell transition from Go to renewed growth is
inhibited in 3T3 fibroblast cells transformed with an
antisense oligodeoxynucleotide to the proto-oncogene.
Nishikura et al, Mol. Cell. Biol. 7, 639-649 (Feb. 1987)
and J. Cell. Biochem. Supplement llA-D, 146 (1987). Also
see Riabowol et al, Mol. Cell. Biol. 8, 1670-1676 (April
1988).
Mercola et al, Biochem. Biophys. Res. Comm. 147,
288-294 (Aug. 1987) disclose transfection of v-sis trans-
formed cells with a plasmid directing expression of anti-
sense c-fos RNA. The transfected cells exhibited a
decrease in growth.
Groger et al., Proc~e~;ngs American Assn. for
Cancer ~e~rch 29, 439 (March 1988) report inhibition of
c-fos expression in both transformed and non-transformed
human hematopoietic cells by an Epstein Barr virus episomal
vector containing c-fos antisense RNA.
Transfection of transformed MethA fibroblast and
non-transformed 3T3 cells by antisense RNA to the oncogene
p53 has resulted in reduction of growth rate and cell
proliferation. Shohat et al., Oncogene 1, 277-283 (1987).
Penno et al., American Journal of Human Genetics 39
(3), Supplement, A38 (1986) report inhibition of Yl mouse
adrenal carcinoma cell growth after transfection with a
plasmid directing antisense to the Ki-ras oncogene.
1340~
Reed et al., J. Cell. Biochem. Supplement 12A, 172,
(Jan. 1988) report inhibition of leukemic B cells and
normal peripheral blood lymphocytes with antisense oligonu-
cleotides to bc1-2, a gene suggested to have oncogenic
potential.
U.S. Patent 4,689,320 discloses inhibition of
viruses using antisense oligodeoxynucleotides as anti-viral
agents.
While the antisense methodology is a useful tool
for genetic analysis, TIG, Jan. 1985, p.22-25, antisense
oligonucleotides have not been used as anti-tumor agents
in practical applications. Moreover, there have been no
reports of antineoplastic agents utilizing antisense
oligonucleotides complementary to c-myb mRNA.
Bone Marrow Purqing
Bone marrow transplantation is of two types.
Allogeneic transplantation comprises the removal of healthy
bone marrow cells from a donor and transplantation into a
recipient having incomplete, incompetent or diseased bone-
marrow. Autologous transplantation involves removal ofdiseased bone marrow, in vitro purging of the removed
marrow of diseased cells, and return of the marrow to the
same individual. Autologous transplant is preferable to
allogeneic transplant since the need for tissue-typing and
immunosuppression of the recipient, and possible tissue
rejection, is obviated.
Bone marrow purging of tumor cells in autologous
grafting is presently accomplished by in vitro incubation
of the transplanted marrow with anti-cancer agents. Many
drugs and antibodies have been evaluated as purging agents.
See Dicke et al., (eds) Autologous Bone Marrow Transplanta-
tion, Proree~ings of the Third International Symposium (The
University of Texas, M.D. Anderson Hospital and Tumor
Institute, Houston, Texas, 1987). Such drugs are highly
toxic, and must be used at relatively high doses in order
to maximize tumor cell kill. High doses may lead to the
13~03fi~
. .
death of a substantial number of normal marrow cells and/or
graft failure. At lower doses, some tumor cells may
survive the purging procedure, accounting for the relative-
ly high rate of malignancy relapse in patients undergoing
autologous transplantation.
What is needed is an antineoplastic agent useful
for treating hematologic neoplasia. In particular, a bone
marrow purging agent is needed which effectively purges
marrow of all malignant cells, while leaving normal marrow
cells substantially intact.
Summary of the Invention
Antisense oligonucleotides and pharmaceutical
compositions thereof with pharmaceutical carriers are
provided. Each oligonucleotide has a nucleotide sequence
complementary to at least a portion of the mRNA transcript
of the human c-myb gene. The oligonucleotide is hybrid-
izable to the mRNA transcript. Preferably, the oligo-
nucleotide is at least a 15-mer oligodeoxynucleotide, that
is, an oligomer containing at least 15 deoxynucleotide
residues. Most preferably, the oligodeoxynucleotide is a
15- to 21-mer. While in principle oligonucleotides having
a sequence complementary to any region of the c-myb gene
find utility in the present invention, oligodeoxynucleo-
tides complementary to a portion of the c-myb mRNA trans-
cript beginning with the second codon from the 5' end ofthe transcript are particularly preferred.
As used in the herein specification and appended
claims, unless otherwise indicated, the term "oligonucleo-
tide" includes both oligomers of ribonucleotide i.e.,
oligoribonucleotides, and oligomers of deoxyribonucleotide
i.e., oligodeoxyribonucleotides (also referred to herein as
"oligodeoxynucleotides").
As used herein, unless otherwise indicated, the
term "oligonucleotide" also includes oligomers which may be
large enough to be termed "polynucleotides".
1340369
The terms "oligonucleotide" and "oligodeoxynucleo-
tide" include not only oligomers and polymers of the
biologically significant nucleotides, i.e. nucleotides of
adenine ("A"), deoxyadenine ("dA"), guanine ("G"), deoxy-
5 guanine ("dG"), cytosine ("C"), deoxycytosine ("dC"),thymine ("T") and uracil ("U"), but also oligomers and
polymers hybridizable to the c-myb mRNA transcript which
may contain other nucleotides. Likewise, the terms "oligo-
nucleotide" and "oligodeoxynucleotide" include oligomers
10 and polymers wherein one or more purine or pyrimidine
moieties, sugar moieties or internucleotide linkages is
chemically modified.
The invention provides a method for treating
hematologic neoplasms in vivo or ex vivo comprising admin-
15 istering to an individual or cells harvested from theindividual an effective amount of c-myb antisense oligonu-
cleotide. The invention also provides a method for treat-
ing an individual to induce immunosuppression by adminis-
tering to the individual an effective amount of such
20 oligonucleotide.
In one embodiment, the method for treating hemato-
logic neoplasms comprises a method for purging bone marrow
of such neoplasms. Aspirated bone marrow cells are treated
with an effective amount of a c-myb antisense oligonucleo-
25 tide as described above.
Description of the Figures
Figure 1 shows the effect of the c-myb antisense
oligodeoxynucleotide in inhibiting phytohemagglutinin-
stimulated lymphocyte proliferation. Normal blood lympho-
30 cytes were treated at various times with phytohemagglutininand/or the c-myb antisense oligodeoxynucleotide 5'-GCC CGA
AGA CCC CGG CAC--3'
.
Figure 2 is a series of microscopic (200X) photo-
graphs of untreated seven-day cultures of normal human
35 myeloid cell colonies (Fig. 2A); ARH-77, an IgG-secreting
13~03~9
plasma cell leukemia (Fig. 2B); and HL-60 promyelocytic
leukemia cells (Fig. 2C).
Figure 3 is a series of microscopic (40X) photo-
graphs of a 1:1 mixture of ARH-77 cells and normal hemato-
poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20
~g/ml (t=18 hours) of the c-myb sense oligodeoxynucleotide
5'-GCC CGA AGA CCC CGG CAC-3' (Fig. 3A); 10 ~g/ml (t=0)
plus 5 ~g/ml (t=18 hours) of the c-myb antisense oligode-
oxynucleotide 5'-GTG CCG GGG TCT TCG GGC-3' (Fig. 3B); and
40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the same c-myb
antisense oligomer (Fig. 3C). The photographs were taken
at t=day 7.
Figure 4A is a high magnification (200X) view of
the persisting normal myeloid colony indicated by arrows in
Figure 3C. Figure 4B is a 200X view of the plasma cell
leukemia cells shown is Figure 3A.
Figure 5 is a series of microscopic (40X) photo-
graphs of a 1:1 mixture of HL-60 cells and normal hemato-
poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20
~g/ml (t=18 hours) of the c-myb sense oligodeoxynucleotide
5'-GCC CGA AGA CCC CGG CAC-3'(Fig. 5A); 10 ~g/ml (t=0) plus
5 ~g/ml (t=18 hours) of the c-myb antisense oligodeoxynu-
cleotide 5'-GTG CCG GGG TCT TCG GGC-3'(Fig. 5B); and 40
~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the same c-myb
antisense oligomer (Fig. 5C). The photographs were taken
at t=day 7.
Figure 6A is a high magnification (200X) view of
the persisting normal myeloid colony (small arrow) and
degenerating HL-60 colony (large arrow) indicated by the
same size arrows in the corresponding lower power view of
Figure 5C; Figure 6B is a 200X view of the HL-60 cells
shown in Figure 5A.
Figure 7 shows the effect of the same c-myb anti-
sense oligodeoxynucleotide in inhibiting lymphocyte prolif-
eration in a mixed lymphocyte reaction, as determined by
1340369
-
cell count (Fig. 7A) and tritiated thymidine incorporation
(Fig. 7B).
Figure 8A shows the effect of maintaining a human T
cell leukemia line and normal bone marrow mononuclear cells
in the absence of c-myb oligodeoxynucleotides (CONT-T LEUK
and CONT-BMC, respectively), or in the presence of 40 ~g/ml
(t=0), followed by 10 ~g/ml (t=18 hours), c-myb sense
oligodeoxynucleotide (T-LEUK-MYB S and BMC-MYB S, respec-
tively). Figure 8B shows the effect on the same cell lines
of 20 ~g/ml (t=O), followed by 5 ~g/ml (t=18 hours) of c-
myb antisense oligodeoxynucleotide (LEUK-MYB AS, BMC-MYB
AS). Daily cell counts and viability determinations were
performed. Results presented are the mean + standard
deviation of four experiments. The sense and antisense
oligodeoxynucleotides were the same as in Figure 5.
Figure 9 is a series of photomicrographs (100X) of
T leukemia cells maintained in liquid suspension culture
for four days and then cultured in methylcellulose for an
additional ten days. Colonies formed by cells in a control
culture containing no oligomers appear in Figure 9A.
Colonies formed by cells exposed to c-myb sense oligodeoxy-
nucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18 hours) are
shown in Figure 9B. Cells exposed to c-myb antisense
oligodeoxynucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18
hours) are shown in Figure 9C. The sense and antisense
oligodeoxynucleotides were the same as in Figure 5.
Figure 10 is a series of low and high magnification
photomicrographs of Wright's stained cytocentrifuge prep-
arations of T leukemia cells (Fig. 10A: 100X; Fig. 10B:
400X) and a mixture of bone marrow cells and T leukemia
cells (Fig. 10C: 100X; Fig. 10D: 400X). T leukemia cells
were cultured in the presence of c-myb sense oligodeoxynuc-
leotide. The bone marrow/T-leukemia cell mixture was
cultured in the presence of c-myb antisense oligodeoxynuc-
leotide. The sense and antisense oligodeoxynucleotideswere the same as in Figure 5.
13~0~69
Figure 11 is a series of low and high magnification
photomicrographs of myeloid leukemia cells (Fig. llA: lOOX;
Fig. llB: 400X), normal bone marrow cells (Fig. llC: lOOX;
Fig. llD: 400X), and a 1:1 mixture of leukemia cells and
normal bone marrow cells (Fig. llE: lOOX; Fig. llF: 400X)
cloned in plasma clot culture after exposure to c-myb
antisense oligodeoxynucleotide, and then stained in situ.
Stars in Figure llF mark mature myeloid elements (polymor-
phonuclear leukocytes, bands, and metamyelocytes). The~0 antisense oligodeoxynucleotide was the same as in Figure 5.
Detailed Description of the Invention
We have discovered that the c-myb gene plays a
critical role in regulating normal human hematopoiesis. We
have further discovered a differential sensitivity of
normal and malignant hematopoietic cells to c-myb antisense
oligonucleotides, that is, oligonucleotides complementary
to and hybridizable with the mRNA transcript of the human
c-myb gene. This differential sensitivity makes possible
the use of c-myb antisense oligonucleotides as effective
anti-neoplastic agents, in particular, in the purging of
neoplastic cells from bone marrow.
While many drugs and antibodies have been evaluated
as bone marrow purging agents, the present invention is
particularly advantageous for this application. The c-myb
antisense oligonucleotides are much less toxic to normal
cells at effective purging doses than known purging agents.
A greatly increased engraftment rate of purged marrow is
thus possible. Since many more normal progenitors survive
exposure to the c-myb antisense oligomers than is typically
observed after optimal exposure to standard chemotherapeu-
tic agents, more intensive treatment is possible. More-
over, because of their high therapeutic index, the anti-
sense oligonucleotides of the invention may be employed in
combination regimens with more conventional agents, which
could then be employed at lower doses.
1340~
.,.
The c-myb antisense oligonucleotides are also
useful as immunosuppressive agents, as they inhibit prolif-
eration of normal human peripheral blood lymphocytes.
The putative DNA sequence complementary to the mRNA
transcript of the human c-myb gene has been reported in
Majello et al, Proc. Natl. Acad. Sci. U.S.A. 83, 9636-9640
(1986). That sequence, from initiation codon to termination
codon, and the predicted 640 amino acid sequence of the
putative c-myb protein, are as follows:
ATGGCCCGAAGACCCCGGCACAGCATATATAGCAGTGACGAGGATGATGAGGACTTTGAGATG
MetAlaArgArgProArgHisSerIleTyrSerSerAspGluAspAspGluAspPheGluMet
TGTGACCATGACTATGATGGGCTGCTTCCCAAGTCTGGAAAGCGTCACTTGGGGAAAACAAGG
CysAspHisAspTyrAspGlyLeuLeuProLysSerGlyLysArgHisLeuGlyLysThrArg
TGGACCCGGGAAGAGGATGAAAAACTGAAGAAGCTGGTGGAACAGAATGGAACAGATGACTGG
TrpThrArgGluGluAspGluLysLeuLysLysLeuValGluGlnAsnGlyThrAspAspTrp
AAAGTTATTGCCAATTATCTCCCGAATCGAACAGATGTGCAGTGCCAGCACCGATGGCAGAAA
LysValIleAlaAsnTyrLeuProAsnArgThrAspValGlnCysGlnHisArgTrpGlnLys
GTACTAAACCCTGAGCTCATCAAGGGTCCTTGGACCAAAGAAGAAGATCAGAGAGTGATAGAG
ValLeuAsnProGluLeuIleLysGlyProTrpThrLysGluGluAspGlnArgValIleGlu
CTTGTACAGAAATACGGTCCGAAACGTTGGTCTGTTATTGCCAAGCACTTAAAGGGGAGAATT
LeuValGlnLysTyrGlyProLysArgTrpSerValIleAlaLysHisLeuLysGlyArgIle
GGAAAACAATGTAGGGAGAGGTGGCATAACCACTTGAATCCAGAAGTTAAGAAAACCTCCTGG
2~ GlyLysGlnCysArgGluArgTrpHisAsnHisLeuAsnProGluValLysLysThrSerTrp
ACAGAAGAGGAAGACAGAATTATTTACCAGGCACACAAGAGACTGGGGAACAGATGGGCAGAA
ThrGluGluGluAspArgIleIleTyrGlnAlaHisLysArgLeuGlyAsnArgTrpAlaGlu
ATCGCAAAGCTACTGCCTGGACGAACTGATAATGCTATCAAGAACCACTGGAATTCTACAATG
IleAlaLysLeuLeuProGlyArgThrAspAsnAlaIleLysAsnHisTrpAsnSerThrMet
CGTCGGAAGGTCGAACAGGAAGGTTATCTGCAGGAGTCTTCAAAAGCCAGCCAGCCAGCAGTG
ArgArgLysValGluGlnGluGlyTyrLeuGlnGluSerSerLysAlaSerGlnProAlaVal
GCCACAAGCTTCCAGAAGAACAGTCATTTGATGGGTTTTGCTCAGGCTCCGCCTACAGCTCAA
AlaThrSerPheGlnLysAsnSerHisLeuMetGlyPheAlaGlnAlaProProThrAlaGln
CTCCCTGCCACTGGCCAGCCCACTGTTAACAACGACTATTCCTATTACCACATTTCTGAAGCA
LeuProAlaThrGlyGlnProThrValAsnAsnAspTyrSerTyrTyrHisIleSerGluAla
CAAAATGTCTCCAGTCATGTTCCATACCCTGTAGCGTTACATGTAAATATAGTCAATGTCCCT
GlnAsnValSerSerHisValProTyrProValAlaLeuHisValAsnIleValAsnValPro
--10--
- 1340~63
CAGCCAGCTGCCGCAGCCATTCAGAGACACTATAATGATGAAGACCCTGAGAAGGAAAAGCGA
GlnProAlaAlaAlaAlaIleGlnArgHisTyrAsnAspGluAspProGluLysGluLysArg
ATAAAGGAATTAGAATTGCTCCTAATGTCAACCGAGAATGAGCTAAAAGGACAGCAGGTGCTA
IleLysGluLeuGluLeuLeuLeuMetSerThrGluAsnGluLeuLysGlyGlnGlnValLeu
CCAACACAGAACCACACATGCAGCTACCCCGGGTGGCACAGCACCACCATTGCCGACCACACC
ProThrGlnAsnHisThrCysSerTyrProGlyTrpHisSerThrThrIleAlaAspHisThr
AGACCTCATGGAGACAGTGCACCTGTTTCCTGTTTGGGAGAACACCACTCCACTCCATCTCTG
ArgProHisGlyAspSerAlaProValSerCysLeuGlyGluHisHisSerThrProSerLeu
CCAGCGGATCCTGGCTCCCTACCTGAAGAAAGCGCCTCGCCAGCAAGGTGCATGATCGTCCAC
ProAlaAspProGlySerLeuProGluGluSerAlaSerProAlaArgCysMetIleValHis
CAGGGCACCATTCTGGATAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTCCAATTTATA
GlnGlyThrIleLeuAspAsnValLysAsnLeuLeuGluPheAlaGluThrLeuGlnPheIle
GATTCTTTCTTAAACACTTCCAGTAACCATGAAAACTCAGACTTGGAAATGCCTTCTTTAACT
AspSerPheLeuAsnThrSerSerAsnHisGluAsnSerAspLeuGluMetProSerLeuThr
TCCACCCCCCTCATTGGTCACAAATTGACTGTTACAACACCATTTCATAGAGACCAGACTGTG
SerThrProLeuIleGlyHisLysLeuThrValThrThrProPheHisArgAspGlnThrVal
AAAACTCAAAAGGAAAATACTGl~llllAGAACCCCAGCTATCAAAAGGTCAATCTTAGAAAGC
LysThrGlnLysGluAsnThrValPheArgThrProAlaIleLysArgSerIleLeuGluSer
TCTCCAAGAACTCCTACACCATTCAAACATGCACTTGCAGCTCAAGAAATTAAATACGGTCCC
SerProArgThrProThrProPheLysHisAlaLeuAlaAlaGlnGluIleLysTyrGlyPro
CTGAAGATGCTACCTCAGACACCCTCTCATCTAGTAGAAGATCTGCAGGATGTGATCAAACAG
LeuLysMetLeuProGlnThrProSerHisLeuValGluAspLeuGlnAspValIleLysGln
GAATCTGATGAATCTGGATTTGTTGCTGAGTTTCAAGAAAATGGACCACCCTTACTGAAGAAA
GluSerAspGluSerGlyPheValAlaGluPheGlnGluAsnGlyProProLeuLeuLysLys
ATCAAACAAGAGGTGGAATCTCCAACTGATAAATCAGGAAACTTCTTCTGCTCACACCACTGG
IleLysGlnGluValGluSerProThrAspLysSerGlyAsnPhePheCysSerHisHisTrp
GAAGGGGACAGTCTGAATACCCAACTGTTCACGCAGACCTCGCCTGTGCGAGATGCACCGAAT
GluGlyAspSerLeuAsnThrGlnLeuPheThrGlnThrSerProValArgAspAlaProAsn
ATTCTTACAAGCTCCGTTTTAATGGCACCAGCATCAGAAGATGAAGACAATGTTCTCAAAGCA
IleLeuThrSerSerValLeuMetAlaProAlaSerGluAspGluAspAsnValLeuLysAla
TTTACAGTACCTAAAAACAGGTCCCTGGCGAGCCCCTTGCAGCCTTGTAGCAGTACCTGGGAA
PheThrValProLysAsnArgSerLeuAlaSerProLeuGlnProCysSerSerThrTrpGlu
CCTGCATCCTGTGGAAAGATGGAGGAGCAGATGACATCTTCCAGTCAAGCTCGTAAATACGTG
ProAlaSerCysGlyLysMetGluGluGlnMetThrSerSerSerGlnAlaArgLysTyrVal
AATGCATTCTCAGCCCGGACGCTGGTCATG
AsnAlaPheSerAlaArgThrLeuValMet
134036g
The antisense oligonucleotides of the invention may
be synthesized by any of the known chemical oligonucleotide
synthesis methods. Such methods are generally described,
for example, in Winnacker, From Genes to Clones: Introduc-
tion to Gene Technology, VCH Verlagsgesellschaft mbH (H.
Ibelgaufts trans. 1987).
Any of the known methods of oligonucleotide syn-
thesis may be utilized in preparing the instant antisense
oligonucleotides.
The antisense oligonucleotides are most advantag-
eously prepared by utilizing any of the commercially
available, automated nucleic acid synthesizers. The device
utilized to prepare the oligonucleotides described herein,
the Applied Biosystems 380B DNA Synthesizer, utilizes ~-
cyanoethyl phosphoramidite chemistry.
Since the complete nucleotide synthesis of DNA
complementary to the c-myb mRNA transcript is known, anti-
sense oligonucleotides hybridizable with any portion of
the mRNA transcript may be prepared by the oligonucleotide
synthesis methods known to those skilled in the art.
While any length oligonucleotide may be utilized in
the practice of the invention, sequences shorter than 15
bases may be less specific in hybridizing to the target c-
myb mRNA, and may be more easily destroyed by enzymatic
digestion. Hence, oligonucleotides having 15 or more
nucleotides are preferred. Sequences longer than 18 to 21
nucleotides may be somewhat less effective in inhibiting c-
myb translation because of decreased uptake by the target
cell. Thus, oligomers of 15-21 nucleotides are most
preferred in the practice of the present invention, par-
ticularly oligomers of 15-18 nucleotides.
Oligonucleotides complementary to and hybridizable
with any portion of the c-myb mRNA transcript are, in
principle, effective for inhibiting translation of the
transcript, and capable of inducing the effects herein
described. It is believed that translation is most effec-
-12-
1340~6'3
-
tively inhibited by blocking the mRNA at a site at or near
the initiation codon. Thus, oligonucleotides complementary
to the 5'-terminal translated region of the c-~yb mRNA
transcript are preferred. The oligonucleotide is prefer-
ably directed to a site at or near the initiation codon forprotein synthesis. Oligonucleotides complementary to the
c-myb mRNA, beg~nn~ng with the codon adjacent to the
initiation codon (the second codon from the 5/ tran~lated
end of the traDslated portion of transcript), may be thus
advantageously employed.
The following lS- through 21-mer oligodeoxynucleo-
tides are complementary to the c-myb mRNA transcript
beginning with the second codon of the translated portion
of the transcript:
5'-GCT GTG CCG GGG TCT TCG GGC-3'
5'-CT GTG CCG GGG TCT TCG GGC-3'
5'-T GTG CCG GGG TCT TCG GGC-3'
5'-GTG CCG GGG TCT TCG GGC-3'
5'-TG CCG GGG TCT TCG GGC-3'
5'-G CCG GGG TCT TCG GGC-3'
5'-CCG GGG TCT TCG GGC-3'
Oligonucleotides hybridizable to the c-myb mRNA
transcript finding utility according to the present inven-
tion include not only native oligomers of the biologically
significant nucleotides, i.e., A, dA, G, dG, C, dC, T and
U, but also oligonucleotide species which have been modi-
fied for improved stability and/or lipid solubility. For
example, it is known that enhanced lipid solubility and/or
resistance to nuclease digestion results by substituting a
methyl group or sulfur atom for a phosphate oxygen in the
internucleotide phosphodiester linkage. The phosphoro-
thioates, in particular, are stable to nuclease cleavage
and soluble in lipid. They may be synthesized by known
automatic synthesis methods.
The antisense oligonucleotides of the invention
inhibit normal human hematopoiesis. However, they inhibit
'1 ,
-13-
-
1340363
the growth of malignant hematopoietic cells at a significa-
ntly lower concentration than normal cells. This
pharmaceutically significant differential sensitivity makes
the instant oligonucleotides very useful in treating
hematologic neoplasms.
Hematologic neoplastic cells believed sensitive to
the instant c-myb antisense oligonucleotides include, for
example, myeloid and lymphatic leukemia cells, malignant
plasma (myeloma) cells and lymphoma cells. The appearance
of these cells in the bone marrow and elsewhere in the body
is associated with various disease conditions, such as all
of the various French-American-British (FAB) subtypes of
acute myeloid and lymphatic leukemia; chronic lymphatic and
myeloid leukemia; plasma cell myeloma and plasma cell
dyscrasias; the various non-Hodgkin's lymphomas as des-
cribed, for example, in the Working Formulation classifica-
tion, Devita, Cancer: Principles and Practice of Oncology
(2d ed. 1985), p. 1634; and possibly Hodgkin's disease.
Hematologic neoplastic cells would likely arise de
novo in the marrow. In Hodgkin's disease, and in some of
the various lymphomas, tumor cells may metastasize to the
marrow from a primary tumor situated elsewhere in the body.
While inhibition of c-myb mRNA translation is
possible utilizing either antisense oligoribonucleotides or
oligodeoxyribonucleotides, oligoribonucleotides are more
susceptible to enzymatic attack by ribonucleases than
deoxyribonucleotides. Hence, oligodeoxyribonucleotides are
preferred in the practice of the present invention.
The antisense oligonucleotides of the invention
find utility as bone marrow purging agents. They may be
utilized in vitro to cleanse bone marrow contaminated by
hematologic neoplasms. They are useful as purging agents
in either allogeneic or autologous bone marrow transplanta-
tion. They are particularly effective in the treatment of
hematological malignancies or other neoplasias which
metastasize in the bone marrow.
-14-
13~0.363
According to a method for bone marrow purging, bone
marrow is harvested from a donor by standard operating
room procedures from the iliac bones of the donor. Methods
of aspirating bone marrow from donors are well known in the
art. Examples of apparatus and processes for aspirating
bone marrow from donors are disclosed in U.S. Patents
4,481,946 and 4,486,188. Sufficient marrow is withdrawn so
that the recipient, who is either the donor (autologous
transplant) or another individual (allogeneic transplant),
may receive from about 4 x 1o8 to about 8 x 1o8 processed
marrow cells per kg of bodyweight. This generally requires
aspiration of about 750 to about 1000 ml of marrow. The
aspirated marrow is filtered until a single cell suspen-
sion, known to those skilled in the art as a "buffy coat"
preparation, is obtained. This suspension of leukocytes is
treated with c-myb antisense oligonucleotides in a suitable
carrier, advantageously in a concentration of about 8
mg/ml. Alternatively, the leucocyte suspension may be
stored in liquid nitrogen using standard procedures known
to those skilled in the art until purging is carried out.
The purged marrow can be stored frozen in liquid nitrogen
until ready for use. Methods of freezing bone-marrow and
biological substances are disclosed, for example, in U.S.
Patents 4,107,937 and 4,117,881.
One or more hematopoietic growth factors may be
added to the aspirated marrow or buffy coat preparation to
stimulate growth of hematopoietic neoplasms, and thereby
increase their sensitivity to the toxicity of the c-myb
antisense oligonucleotides. Such hematopoietic growth
factors include, for example, interleukin-3 and granulocyte
macrophage colony stimulating factor (GM-CSF). The
recombinant human versions of such growth factors are
advantageously employed.
After treatment with the antisense oligonucleo-
tides, the cells to be transferred are washed with auto-
-- 1340369
logous plasma to remove unincorporated oligomer. The
washed cells are then infused into the recipient.
The instant c-myb antisense oligonucleotides also
inhibit proliferation of human peripheral blood lympho-
cytes. Accordingly, they are useful as immunosuppressiveagents, that is, they may be utilized to inhibit immune
response, particularly cellular response. They are partic-
ularly useful in situations where rapid, but short term,
inactivation of the immune system is desirable. Such
circumstances may include, but are not limited to, acute
graft-versus-host disease, acute organ rejection (heart,
liver, kidney, pancreas), and flares of autoimmune-type
diseases such as acute systemic lupus erythematosus,
rheumatoid arthritis and multiple sclerosis.
For in vivo use, the antisense oligonucleotides may
be combined with a pharmaceutical carrier, such as a suit-
able liquid vehicle or excipient and an optional auxiliary
additive or additives. The liquid vehicles and excipients
are conventional and commercially available. Illustrative
thereof are distilled water, physiological saline, aqueous
solution of dextrose, and the like. For in vivo antineo-
plastic or immunosuppressive use, the c-myb mRNA antisense
oligonucleotides are preferably administered intravenously.
It is also possible to administer such compounds ex vivo by
isolating lymphocytes from peripheral blood, treating them
with the antisense oligonucleotides, then returning the
treated lymphocytes to the peripheral blood of the donor.
Ex vivo techniques have been utilized in treatment of
cancer patients with interleukin-2 activated lymphocytes.
In addition to administration with conventional
carriers, the antisense oligonucleotides may be adminis-
tered by a variety of specialized oligonucleotide delivery
techniques. For example, oligonucleotides have been
successfully encapsulated in unilameller liposomes.
Reconstituted Sendai virus envelopes have been successfully
-16-
l3~o36~
used to deliver RNA and DNA to cells. Arad et al.,
Biochem. Biophy. Acta. 859, 88-94 (1986).
For ex vivo antineoplastic application, such as,
for example, in bone marrow purging, the c-myb antisense
oligonucleotides may be administered in amounts effective
to kill neoplastic cells while maintaining the viability of
normal hematologic cells. Such amounts may vary depending
on the nature and extent of the neoplasm, the particular
oligonucleotide utilized, the relative sensitivity of the
neoplasm to the oligonucleotide, and other factors. Con-
centrations from about 10 to 100 ~g/ml per 105 cells may be
employed, preferably from about 40 to 60 ~g/ml per 105
cells. Supplemental dosing of the same or lesser amounts
of oligonucleotide are advantageous to optimize the treat-
ment. Thus, for purging bone marrow containing 2 x 107
cell per ml of marrow volume, dosages of from about 2 to 20
mg antisense per ml of marrow may be effectively utilized,
preferably from about 8 to 12 mg/ml. Greater or lesser
amounts of oligonucleotide may be employed.
For in vivo use, the c-myb antisense oligonucleo-
tides may be administered in an amount sufficient to result
in extracellular concentrations approximating the above
stated in vitro concentrations. The actual dosage admin-
istered may take into account the size and weight of the
patient, whether the nature of the treatment is prophy-
lactic or therapeutic in nature, the age, weight, health
and sex of the patient, the route of administration, and
other factors. The daily dosage may range from about 0.1
to 1,000 mg oligonucleotide per day, preferably from about
10 to about 1,000 mg per day. Greater or lesser amounts of
oligonucleotide may be administered, as required.
The present invention is described in greater
detail in the following non-limiting examples.
. 13403fi.~
Example 1
Effect of c-myb Antisense Oligomer on
Normal Peripheral Blood
LYmphocyte Proliferation in Response to PHA Ex~osure
The c-myb antisense oligonucleotides have
immunosuppressant activity, as demonstrated by the
following experiment wherein lymphocyte proliferation is
markedly suppressed by treatment with the oligomer. Normal
blood lymphocytes were treated with the c-myb antisense
oligodeoxynucleotide 5 '-GTG CCG GGG TCT TCG GGC-3' at a
final concentration of 40 ~g/ml. C-myb antisense and/or
phytohaemagglutinin (PHA) were added to the cells as
follows: (i) PHA alone, t=0 (no oligonucleotide); (ii) c-
myb antisense alone, t=0 (no PHA); (iii) c-myb antisense,
t=0; PHA, t=24 hours; (iv) c-myb antisense + PHA, both t=0;
(v) PHA, t=0; c-myb antisense, t=24 hours; and (vi) PHA,
t=0; c-myb antisense t=24 and 48 hours. Cell counts were
performed at t=day 6. The results are shown in Figure 1.
As is evident from the figure, PHA treatment alone resulted
in marked cell proliferation when compared to cells exposed
to 40 ~g/ml c-myb antisense oligomer. One dose of oligomer
alone in the absence of PHA did not appear to be toxic to
normal lymphocytes through day 6. As can be noted in
Figure 1, however, once cells were exposed to PHA, either
simultaneously or within 24 hours of c-myb antisense treat-
ment, the 40 ~g/ml dose became very toxic to the cells, as
manifested by the low cell numbers present on day 6.
Additional doses of c-myb at 24 and 48 hours did not appear
to be essential in order to inhibit PHA-induced
proliferation of normal cells.
-18-
~'- 13403~
Example 2
Effect of c-mYb Antisense Oliqomer on
Normal Peripheral Blood
Lymphocyte Proliferation in
Mixed Lymphocyte Reaction
The following experiment further demonstrates the
immunosuppressant activity of the c-myb antisense oligonu-
cleotides. Normal peripheral blood mononuclear cells
(Figure 7: X cells) were either stimulated with PHA alone
or mixed with mitomycin C-treated mononuclear cells from
another normal donor (Figure 7: Y* cells). In two cul-
tures, X cells were pre-incubated for 18 hours with 40
~g/ml of the c-myb sense oligonucleotide 5'-GCC CGA AGA CCC
CGG CAC-3', or the c-myb antisense oligonucleotide used in
Example 1. The thus treated X cells were then mixed with
Y* cells. At 24 and 48 hours, an additional 10 ~g/ml of
oligomers was added to the cultures. After five days, cell
counts were performed (Figure 7A), and tritiated thymidine
incorporation was determined (Figure 7B). Inhibition of
mixed lymphocyte-induced cell proliferation and tritiated
thymidine incorporation was observed only with the c-myb
antisense-treated cells.
Example 3
Differential Sensitivity of Tumor (ARH-77) and
Normal Proqenitor Cells Toward c-myb Oligonucleotide
The following experiment was performed to establish
the differential sensitivity of normal progenitor and tumor
cells to c-myb antisense oligonucleotide. Accordingly,
tumor cells (1 x 106 cells/ml) or normal human marrow cells
(1 x 105 cells/ml) were cultured alone or mixed together in
a 1:1 ratio (total cell number cultured = 1 x 105 cells/
ml) in the presence or absence of c-myb oligonucleotides.
Figures 2A, 2B and 2C respectively show a high
magnification view (200X) of untreated (A) normal human
myeloid cell colonies, (B) ARH-77 cells (IgG-secreting
plasma cell leukemia, ATCC No. CRL 1621), and (C) HL-60
--19--
13~03~9
. .
(promyelocytic leukemia cells), all after seven days of
culture. It can be observed that the normal marrow cells
grow in widely separate aggregates of relatively small cell
number. The tumor cells grow much more luxuriantly, and
appear to overgrow each other.
Figure 3 is a series of low magnification (40X)
photographs of a 1:1 mixture of ARH-77 cells and normal
hematopoietic progenitor cells exposed to: (A) high dose
c-myb sense 5'-GCC CGA AGA CCC CGG CAC-3' (40 ~g/ml, t=0;
20 ~g/ml supplement at t=18 hours); (B) low dose c-myb
antisense 5'-GTG CCG GGG TCT TCG GGC-3'; (10 ~g/ml t=0; 5
~g/ml supplement at t=18 hours); and (C) high dose c-myb
antisense (40 ~g/ml, t=0; 20 ~g/ml supplement at t=18
hours). The Figure 3 photographs were taken at t=day 7.
While the sense-treated plate (Figure 3A) was overwhelmed
with tumor cells on day 7, the low dose antisense plate
(Figure 3B) displayed persistent, but dramatically reduced
numbers of tumor cells. The high dose antisense plate
(Figure 3C) contained a normal myeloid colony with complete
disappearance of tumor cells. The arrow heads in Figure 3C
surround a normal myeloid colony which is shown at high
magnification in Figure 4A. A high magnification view of
the sense-treated plasma cell leukemia cells of Figure 3A
is shown in Figure 4B.
Example 4
Differential Sensitivity of Tumor (HL-60) and
Normal Proqenitor Cells Toward c-myb Oligonucleotide
The sense/antisense dosing procedure of Example 3
was repeated substituting HL-60 leukemia cells for ARH-77
cells, and utilizing the same dosages and dose times from
Example 3. The results are shown in Figures 5 and 6.
Figure 5 is a series of low (40X) magnification
views of a 1:1 mix of HL-60 cells and normal hematopoietic
progenitor cells exposed to: (A) high dose c-myb sense,
(B) low dose c-myb antisense, and (C) high does c-myb
antisense. While a very large HL-60 tumor aggregate
-20-
~ 1340369
appeared in the sample treated with a high dose of c-myb
sense oligodeoxynucleotide (Figure 5A), the colony treated
with a low dose of antisense oligonucleotide is much
smaller, with fewer tumor cells being apparent (Figure 5B).
A high power view of Figure 5A is shown in Figure 6B. At
the high dose of antisense (Figure 5C), normal hemato-
poietic progenitor cells are unaffected as evidence by the
normal myeloid colony indicated by the small arrow head in
Figure 5C. An HL-60 colony was observed to be degenerat-
ing, as indicated by the large arrowhead.
The colonies featured in Figure 5C are shown athigher magnification in Figure 6A.
Example 5
Differential Sensitivity of Leukemic T Cells and
Normal Proqenitor Cells Toward c-myb Oliqonucleotide
The following experiment further demonstrates that
when normal marrow hematopoietic cells are combined with
leukemic blast cells in the presence of c-myb antisense
oligonucleotide, leukemic cell cloning efficiency is
preferentially inhibited, and is accompanied by leukemic
cell death. Colony formation in semi-solid cultures was
employed as an indicator system to assess survival of
clonogenic progenitor cells. Of great importance, many
normal hematopoietic progenitor cells were observed to
survive exposure to c-myb antisense oligonucleotide, and to
continue to form colonies in semi-solid culture medium.
Bone marrow cells from normal consenting donors and
cells of the human T cell leukemia cell line CCRF-CEM,
obtained from the American Type Culture Collection, were
treated as follows. Normal hematopoietic progenitor cells
were enriched from light density bone marrow mononuclear
cells. The normal cells and the T leukemia cells were
placed in liquid suspension cultures (RPMI 1640 with 20%
fetal bovine serum, either alone or in a 1:1 mix). Control
cultures were left untreated. Treated cultures received
varying amounts of the same c-myb sense and antisense
-21-
.
1340~fi9
oligomers applied in the procedure of Example 3, namely 5-
80 ~g/ml (~ 1 ~M to 14 ~M) at t=0, supplemented with
additional oligomer (25% of the initial dose)) at about 18
hours after the start of incubation. Cultures were in-
cubated (5% C02, 37~C) for four days, during which timedaily cell counts were performed and cell viability was
recorded. At the end of the four days, the cells remaining
in suspension (to a maximum of 2 x 105/ml) were transferred
to methylcellulose cultures, Leary et al., Blood 71, 1759
(1988) containing 24 U/ml and 5 ng/ml respectively of
recombinant human interleuken-3 (rH IL-3) and recombinant
human granulocyte macrophage colony stimulating factor (rH
GM-CSF). After a total of ten to twelve days in culture,
the culture plates were scanned in their entireties with
the aid of an inverted microscope, and total colonies per
cluster in the dishes were enumerated. To verify the
origin of the colonies, that is, whether they were derived
from the leukemic or from normal hematopoietic progenitor
cells, all cells were removed from the dishes by diluting
the methylcellulose in tissue culture medium, transferring
the culture dish's contents to a polypropylene tube, and
then preparing cytocentrifuge preparations from the con-
tents of the tube for histochemical or immunochemical
identification of tumor cells. Histochemical identifica-
tion of tumor cells was carried out by air drying thecytocentrifugation slides, flooding the slides with Modi-
fied Wright's stain (Sigma Chemical Company, #WS lb) for 5
minutes, followed by rinsing with de-ionized water for 2
minutes. The slides were then coverslipped. Clots were
fixed with 4% glutaraldehyde for 8 minutes, flushed with
distilled water for 12 minutes, and then dried into a film.
The plates were then flooded with Modified Wright's stain
for 3 minutes, rinsed in de-ionized water for 6 minutes,
and coverslipped. The immunochemical identification of
tumor cells was according to the procedure of Gewirtz et
al., J. Immunol. 139, 2195 (1987), utilizing the Leu-3a
~ 13~0369
monoclonal antibody (Becton-Dickenson, Mountainview, CA.).
The Leu-3a antibody is directed against the CD4 epitope.
The effect of maintaining the T cell leukemia line
and the marrow cells in suspension culture according to the
procedure of Example 5, in the presence or absence of the
c-myb oligomers, is shown in Figure 8. In the absence of
the oligomers, the T cell leukemia continued to divide in
culture, whereas the numbers of bone marrow cells remained
essentially unchanged. See Figure 8A. Cell viability
remained high among both cell populations and always
exceeded 90%, as assessed by trypan blue exclusion. Treat-
ment of cells with high doses (40 ~g/ml, t=0; 10 ~g/ml,
t=18 hours) of the c-myb sense oligomer did not signif-
icantly effect the growth or viability of either cell type
(Figure 8A). In distinct contrast (Figure 8B), when the T
leukemia cells were incubated in suspension with c-myb
antisense oligomer (20 ~g/ml, t=0; 5 ~g/ml, t=18 hours)
cell proliferation was not only inhibited, but there was a
daily decline in cell numbers and viability as well. After
four days only approximately 25-30% of the cells initially
added to the culture remained; the viability of these cells
was also greatly reduced (~ 70% reduction). The effect of
the antisense oligomer is even more dramatic if one com-
pares cell numbers (mean + standard deviation (hereinafter
"SD"); n=4) in the control cultures at four days (285 + 17
x 104/ml) with the number remaining in the antisense-
containing culture (4.7 + 0.8 x 104 /ml). Importantly, when
suspended in the same dose of antisense oligomer, the
normal marrow mononuclear cells exhibited only a slight
decline in numbers and viability over the same time period
(~ 90% of initial cells remaining; viability >90%). These
numbers were not significantly altered if hematopoietic
growth factors were added to the bone marrow cell suspen-
sion during the four day incubation period.
Results from a typical experiment, repeated three
times are shown in Table 1 ("BMC" = normal bone marrow
-23-
1340369
cells; "MYB S" = c-myb sense oligonucleotide; "MYB AS" =
c-myb antisense oligonucleotide; "TNTC" = to numerous to
count):
TABLE 1
Cells No. Cells Oligonucleotide Colony/Cluster
Plated Added Amt. Added Count
(~g/ml at t=0; (Mean t Stan-
t=18 hours) dard Deviation)
BMC 5 x 104/ml None 24+4
MYB S (20; 5.0) 31+4
MYB S (20; 5.0) 30+6
T 5 x 104/ml None TNTC
LEUKEMIA MYB S (20; 5.0) TNTC
MYB S (20; 5.0) 1:1
BMC+ 5 x 104/ml None TNTC
LEUKEMIA of each MYB S (20; 5.0) TNTC
MYB AS (2; 0.5) TNTC
MYB AS (5; 1.0) TNTC
MYB AS (10; 2.5) 41+5
MYB AS (20; 5.0) 34+1
In dishes containing untreated bone marrow cells,
colony numbers varied directly with the number of cells
plated (5 x 104/ml to 2 x 105/ml), and ranged between 31+4
(mean +SD) and 274+18. In dishes containing the untreated
leukemia cells, cloned at equivalent concentrations, growth
was always luxuriant and the numbers of colonies were too
numerous to count (TNTC) (Figure 9A). Exposure to the c-
myb sense oligomer had no effect on either normal, or
leukemic cell (Figure 9B) growth when compared to growth in
untreated cultures. Colony formation by cells in Figure 9A
and Figure 9B were essentially identical. When leukemic
blasts were cultured alone in the higher doses of antisense
oligomer, the numbers of resulting colony/clusters were
reduced from TNTC to a maximum of about 2 per 5 x 104
leukemia cells plated (Figure 9C). In distinct contrast,
in dishes containing bone marrow cells exposed to c-myb
antisense, colony formation was not significantly perturbed
-24-
1340369
by the dose and exposure schedule employed (see Table 1).
Not unexpectedly then, when bone marrow cells were mixed
1:1 with T leukemia cells and then exposed to the c-myb
antisense oligomer at concentrations S5 ~g/ml and 1 ~g/ml
(t=0 and t=18 hours, respectively), the leukemic cells
continued to grow vigorously, and the number of colonies
were too numerous to count. However, when the oligomer
exposure intensified, a definite dose-response relationship
became apparent. At an initial dose of 10 ~g/ml, followed
by 2.5 ~g/ml eighteen hours later, the leukemia cells no
longer overgrew the plate, and distinct colones could be
enumerated in the mixed cell cultures. Nevertheless,
histochemical and immunochemical staining demonstrated that
~50% of the colonies that formed in these mixed cell dishes
appeared to be of leukemic blast cell origin. When the
dose of antisense oligomer employed equaled or exceeded 20
~g/ml (t=0) followed by 5 ~g/ml (t=18 hours), leukemic
colonies could no longer be identified with certainty in
the cultures by simple visual analysis.
To more rigorously examine the cultures for resid-
ual leukemic elements, the methylcellulose cultures were
liquified with tissue culture medium, and the entire cell
contents were deposited onto slides by cytocentrifugation.
Low (lOOx) and high (400x) magnification photomicrographs
of Wright's stained T leukemia cells after twelve days of
culture in methylcellulose are shown in Figures lOA and
lOB, respectively. Most cells were small, had only a thin
rim of cytoplasm, and resembled unactivated lymphocytes,
though occasional large, undifferentiated blast cells with
prominent nucleoli were also noted (arrows). Neither of
these cell types could be identified in the culture dishes
containing the leukemia plus normal cell populations which
had been cultured in the high dose of c-myb antisense
oligomer. As demonstrated in Figures lOC (lOOx) and lOD
(400x), respectively, only normally maturing cells could be
identified in these cultures. The colonies which developed
13403~9
.
in the high dose antisense plates were also numerically
equivalent to those enumerated in the bone marrow cell
control plates.
Immunochemical staining with Leu 3a antibody of
either T leukemia cells alone, marrow mononuclear cells
alone, or mixtures of normal marrow mononuclear cells and T
leukemia célls, maintained in liquid suspension cultures
for eight days, corroborated these results. After eight
days in culture, only 4% of bone marrow cells stained Leu
3a positive, while ~93% of T cell leukemia cells were
labeled with this antibody. When bone marrow cells and T
leukemia cells were mixed 1:1, and then stained after eight
days in culture, ~98% of cells were stained with Leu 3a in
the untreated culture, and in the culture containing the c-
myb sense oligomer. These results indicated that the T
leukemia cells outgrew the bone marrow cells, and essen-
tially replaced them in these cultures. In marked con-
trast, in the mixed cell culture containing the c-myb
antisense oligomer, only 3% of the cells stained with Leu
3a after eight days. This value is identical to that
obtained in the bone marrow control culture, and suggests
again that the leukemic cells were eliminated from the
culture.
ExamPle 6
Effect of High Dose c-myb Antisense
Oligomer On Leukemic Blast Cells From
Acute Myeloqenous Leukemia Patients
Th following experiment illustrates the effect of
high dose c-myb antisense oligomer exposure on colony/clus-
ter formation by leukemic blast cells isolated directly
from patients with acute myelogenous leukemia.
The peripheral blood of leukemic blast cells were
isolated form patients with acute myelogenous leukemia by
Ficoll gradient centrifugation. The blast cells (2 x
105/ml) were washed in fresh tissue culture medium and then
exposed to c-myb sense or antisense oligomers (40 ~g/ml,
-26-
13403~
t=0; 10 ~g/ml, t=18 hours) in suspension culture. Four to
six hours after addition of the last dose of oligomer, the
blast cells were seeded into plasma clot or methylcellulose
cultures and cultured for ten to twelve days to assess the
presence of residual colony/cluster forming units. Cell
colonies and cell clusters were enumerated in sense (S) and
antisense (AS) containing plates, and the values compared
to growth in control cultures which contained no oligomers.
The results are expressed in Table 2 as % residual control
culture growth (arbitrary 100% value). Significance of
changes in colony/cluster growth in AS-treated plates, in
comparison to that observed in controls, is given as a P
value derived by Student's t test for unpaired samples.
-27-
~ 1340~6~
TABLE 2
Case # Cell Colonies Cell Clusters P Value
S/AS1 S/AS ColonY/Cluster
#1 86%/18% 60%/37% [.058]/[.080]
#4 NG2 90%/28% [----]/[.036]
#5 NG 70%/22% [----]/[.101]
#6 NG 79%/22% [----]/[.026]
#7 170%/100% 76%/128% [.423]/[.502]
#8 92%/11% 96%/46% [.008]/[.020]
#10 NG 190%/216% [----]/[.034]
#11 45%/14% 58%/21% [.021]/[.084]
#14 68%/01% 90%/53% [.152]/[.071]
#15 66%/81% 100%/100% [.736]/[.896]
#16 NG 66%/24% [----]/[.001]
#17 NG 16%/8% [----]/[.023]
#18 NG 110%/77% [----]/[.164]
#19 113%/116% 91%/91% [-717]/[-763]
#20 92%/09% 100%/50% [.051]/[.009]
#21 94%/00% 90%/06% [.006]/[.004]
#22 80%/13% 103%/11% [.001]/[.015]
#23 63%/06% 74%/27% [.001]/[.004]
#24 87%/17% 91%/26% [.002]/[.018]
#25 100%/00% 107%/38% [.019]/[.364]
#26 76%/00% 89%/00% [-009]/[.001]
#27 79%/21% 59%/18% [-014]/[.043]
#28 88%/20% 94%/152% [.009]/[.096]
1 S/AS = percentage of cell colonies or cell clusters
remaining in sense (S) or antisense (AS) containing plates,
compared to growth in control cultures which contained no
oligomers.
2 NG = no growth.
-28-
1340369
Of the twenty-eight cases studied, we were able to
gather colony, and/or cluster formation data in twenty-
three cases (Table 2). Growth of cells from patients #2,
#3, #9 and #12-#13 was too poor to evaluate the effect of
treatment. A decline in either colony or cluster formation
in comparison to growth in untreated cultures was observed
in eighteen of the twenty-three evaluable cases (78%). Of
those cases in which this response was observed, the
decline in colony number was statistically significant
(p<.05) in 11/13 cases (85%). In the two cases where the
decrease was not of statistical significance, the p values
were .058 (Case #1) and .051 (Case #20). Similarly, the
decrement in cluster formation was statistically signifi-
cant in 13/17 (76%) of the cases. The degree of inhibition
was also impressive. Mean (+SD) residual leukemic colony
formation in the eleven responding cases was 10.0+7.9% of
control (untreated leukemia cell) colony formation. Mean
(+SD) residual leukemic cluster formation in the seventeen
responding cases was 25.7+15.3% of control.
Example 7
Complete Purginq of Patient-Derived Myeloid
Leukemia Cells From Normal Bone Marrow Cells
The following experiment demonstrates that a more
intensive exposure to the antisense c-myb oligomer results
in complete elimination of myeloid leukemic progenitor
cells from a mixture of normal bone marrow progenitor
cells, with adequate survival of the normal progenitor
cells.
Normal bone marrow cells and blasts obtained from
Case #26 (Example 6, Table 2) were utilized for purging
using the T cell purging protocol described in Example 5.
The only modification involved was the addition of oligomer
(20 ~g/ml) just prior to plating after four days in suspen-
sion culture. In untreated cultures, the blasts formed
25.5+3.5 (mean +SD per 2 x 105 cells plated) colonies and
157+8.5 clusters in growth factor stimulated cultures. The
-29-
1340~6~
.
addition of c-myb sense oligomers at doses equivalent to
those added to antisense containing cultures did not
significantly alter these numbers (19.5+.7 colonies and
140.5+7.8 clusters). As expected (see Table 2), antisense
oligomers again totally inhibited colony/cluster formation
by the leukemic blasts. Colony formation as also inhibited
in the plates containing normal bone marrow cells, but only
by ~50% in comparison to untreated control plates. (Con-
trol colony formation = 296+40 per 2 x 106 cells plated;
Treated = 149+15.5 per 2 x 106 cells). Histochemical
staining of the leukemic blast cell cultures revealed only
scattered residual cells in the antisense treated plates
(Fig. llA: lOOx). At high magnification, these "cells"
appeared to be non-viable naked nuclei (Fig. llB: 400x).
As was stated above, at an equivalent antisense oligomer
dose, bone marrow cells formed numerous, though smaller,
colonies which contained cells that had matured normally
(Fig. llC and llD; lOOx and 400x, respectively). In the
culture dishes in which normal marrow and leukemic blast
cells had been mixed in a 1:1 ratio, only normal elements
could be identified with certainty (Fig. llE: lOOx; Fig.
llF: 400x). Stars in Fig. llF mark mature myeloid elements
(polymorphonuclear leukocytes, bands, and metamyelocytes).
C-myb oligonucleotide, administered to cell cul-
tures at concentrations utilized above, effectively kills
neoplastic cells. The same concentrations, however, are
non-toxic to normal progenitor cells. Thus, the oligomers
are useful as anti-neoplastic agents, particularly as bone
marrow purging agents.
The following non-limiting example illustrates one
methodology for bone marrow purging according to the
present invention.
-30-
13~ 036~9
Example 8
Bone Marrow Purging with c-myb
Antisense Oligonucleotide
Bone marrow is harvested from the iliac bones of a
donor under general anesthesia in an operating room using
standard techniques. Multiple aspirations are taken into
heparinized syringes. Sufficient marrow is withdrawn so
that the marrow recipient will be able to receive about 4 x
108 to about 8 x 108 processed marrow cells per kg of body
weight. Thus, about 750 to 1000 ml of marrow is withdrawn.
The aspirated marrow is transferred immediately into a
transport medium (TC-l99, Gibco, Grand Island, New York)
containing 10,000 units of preservative-free heparin per
100 ml of medium. The aspirated marrow is filtered through
three progressively finer meshes until a single cell
suspension results, i.e., a suspension devoid of cellular
aggregates, debris and bone particles. The filtered
marrow is then processed further into an automated cell
separator (e.g., Cobe 2991 Cell Processor) which prepares a
"buffy coat" product, (i.e., leukocytes devoid of red cells
and platelets). The buffy coat preparation is then placed
in a transfer pack for further processing and storage. It
may be stored until purging in liquid nitrogen using
standard procedures. Alternatively, purging can be carried
out immediately, then the purged marrow may be stored
frozen in liquid nitrogen until it is ready for transplan-
tation.
The purging procedure may be carried out as
follows: Cells in the buffy coat preparation are adjusted
to a cell concentration of about 2 x 107/ml in TC-l99
containing about 20% autologous plasma. C-myb antisense
oligodeoxynucleotide, for example, in a concentration of
about 8 mg/ml is added to the transfer packs containing the
cell suspension. Recombinant human hematopoietic growth
factors, e.g., rH IL-3 or rH GM-CSF, may be added to the
suspension to stimulate growth of hematopoietic neoplasms
-31-
,
13 !1~ 3 ~ ~
and thereby increase their sensitivity c-myb antisense
oligonucleotide toxicity. The transfer packs are then
placed in a 37~C waterbath and incubated for 18 - 24 hours
with gentle shaking. The cells may then either be frozen
in liquid nitrogen or washed once at 4~C in TC-199
containing about 20% autologous plasma to remove
unincorporated oligomer. Washed cells are then infused
into the recipient. Care must be taken to work under
sterile conditions wherever possible and to maintain
scrupulous aseptic techniques at all times.
The present invention may be embodied in other
specific forms without departing from the spirit or
essential attributes thereof and, accordingly, reference
should be made to the appended claims, rather than to the
foregoing specification, as indicating the scope of the
invention.
-32-
13~0369
SUPPLEMENTARY DISCLOSURE
While in principle oligonucleotides having a
sequence complementary to any region of the c-myb gene find
utility in the present invention, oligodeoxynucleotides
complementary to the 5'-terminal portion of the c-~yb mRNA
transcript are particularly preferred.
The putative DNA sequence complementary to the mRNA
transcript of the human c-~yb gene has been reported in
Majello et al, Proc. Natl. Acad. ~ci. U.S.A. 83, 9636-9640
(1986). The 5'-untranslate~ region upstream of the initia-
tion oodon (i.e., upstream of the codon comprising
nucleotidesll4-116Ofthecompletetranscript)is as follows:
- GGCGGCAGCGCCCTGCCGACGCCGGGGAGGGACGCAGGCAGGCGGCGGGC
AGCGGGAGGCGGCAGCCCGGTG~-~-CCCCGCGGCTCTCGGCGGAGCCCCGCCGCCCGCCGCGCC
The termination codon TGA at position 2034 is
followed by a 3'-untranslated region spanning about 1200
nucleotides, which is followed by a poly(A) tail of about
140 nucleotides:
TGAGACATTTCCAGAAAAGCATTATGGTTTTCA
GAACAGTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTTCATGAATGGGAGA
AGAACCTATTTTTG~ GGTACAACAGTTGAGAGCACGACCAAGTGCATTTAGTTGAATGAA
GTCTTCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATT
ATTAGGTAATGAATTGTAGCCA~ll~llAATATCTTAATGCAGAlllllllAAAAAAAAACAT
AAAATGATTTATCTGGTATTTTAAAGGATCCAACAGATCAGTAllllllCCTGTGATGGGTTT
TTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCA~ ~lCGATCACTAAACATATG
CATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATT
TAATCCAGATTGTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAA
CCATTTTATGAGTTTT~lGllAGCTTGCTTTAAAAATTATTACTGTAAGAAATAGTTTTATAA
AAAATTATATTTTTATTCAGTAATTTAAllll~lAAATGCCAAATGAAAAACGllllllGCTG
CTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTACAGCTTGGACAGAAAG
AAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGA~lllllAATTTTATAT
ATATATACAlrllllllCCTTCTGCAATACATTTGAAAACll~lllGGCAGACTCTGCATTTT
TTATTGTGGlllllllGllAllGllGGTTTATACAAGCATGCGTTGCACTT~llllllGGGAG
ATGTGTGll~llGATGTTCTA~l~llll~llll~lGlGTAGCCTGA~l~llllATAATTTGGGA
GTTCTCGATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACl~llGCATGG
ATCCTGl~lllGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAAC
ATTTGATGCAAGATGGCCAGCACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAG
CAAAATAAAGATGTGCCCTTATTTT A~AAAAAAA
While antisense oligomers complementary to the 5'-
terminal region of the c-myb transcript are preferred,
particularly the region including the initiation codon, it
should be appreciated that useful antisense oligomers are
- SD-33 -
1340363
not limited to those complementary to the sequences found
in the translated portion (nucleotides 114 to 2031) of the
mRNA transcript, but also includes oligomers complementary
to nucleotide sequences contained in, or extending into,
S the 5'- and 3'-untranslated regions. We have shown that
oligomers whose complementarity extends into the 5'-
untranslated region of the c-myb transcript are particular-
ly effective in inhibiting translation. Oligomers having a
nucleotide sequence complementary to a portion of the c-myb
mRNA transcript including at least a portion of the S'-
untranslated region therefore comprise one group of prefer-
red oligomers.
The following 15- through 21-mer oligodeoxynucleo-
tides are complementary to the c-myb mRNA transcript
beginning with nucleotide 111 and extending through the
initiation site:
5'-CCG GGG TCT TCG GGC CAT GGC-3'
5'-CG GGG TCT TCG GGG CAT GGC-3'
5'-G GGG TCT TCG GGC CAT GGC-3~
5'-GGG TCT TCG GGC CAT GGC-3'
5'-GG TCT TCG GGC CAT GGC-3'
5'-G TCT TCG GGC CAT GGC-3'
5'-TCT TCG GGC CAT GGC-3'
Example 9
Inhibition of Leukemic T Cells and Tumor
(HL-60) Cells by c-myb Antisense Oliqonucleotide
The following experiment is directed to the inhi-
bition of growth of malignant hematopoietic cells with
further c-myb antisense oligonucleotides.
Four 18-mers, designated oligomers A through D,
were prepared:
(A) 5'-GCC ATG GCC CGA AGA CCC-3', the sense
oligomer corresponding to c-myb nucleotides 111
through 129;
- SD-34 -
1 3 ~ 0 3 ~ 9
(B) 5'-GGG TCT TCG GGC CAT GGC-3', the
anti~e~ce oligomer to c-myb nucleotides 111 through
129;
(C) 5'-CGC GTA CCG CAG GAA CCC-3', a "scram-
- bled" version of 18-mer (A); and
(D) 5'-ACT GCT ATA TAT GCT GTG-3', the
antisense oligomer to c-myb nucleotides 129 through
147.
CCRF-CEM cells (1 x 10~ cell~) were seeded into 500
10 ~1 of tissue culture medium containing 0-80 ~g/ml of
oligomer A, B, C or D (t=0). The cultures were supple-
mented with additional oligomer (25% of the initial dose at
t=18 hours). A control culture received no oligomer.
- Cultures were incubated for four days, after which time a
cell count was taken. The results, as a function of
oligonucleotide dosage, are set forth in Table 3:
TABLE 3
CE~L COUNT
(Cells/~l; Mean + Standard Deviation)
Oligomer Dosage
at t=0/t=18 hrs. Oligomer Oligomer Oligomer Oligomer
(ug/ml) A B C D
Control
25(no oligomer) 968+17 1636+39 1814+58 1616+38
10/2.5 1279~15 996~13 1452+18 1146+16
20/5 1297~39 646~12 1367+36 810+15
40/10 1202~29 616~17 1290+28 723+37
80/20 1136+34 504+22 1317+35 690+ 9
Neither the cense (oligomer A) or "scrambled" sense
(oligomer C) molecules significantly effected leukemic cell
growth. Both authentic antisense oligomers (B, D) gave
inhibition. Oligomer B (70% inhibition), directed to c-
myb transcript nucleotides 111-129, was more potent than
oligomer D (57% inhibition), which is directed to c-myb
~ SD-35 -
13 lO36~
transcript nucleotides 129-147. This result indicates that
the most efficient inhibition of translation is obtained by
inhibiting translation via hybridization of antisense
oligomers at or near the site of translation initiation
(nucleotides 114-116).
Very similar results were obtained with HL-60 cells
using oligomers A, B and C. However oligomer D inhibited
cell growth only ~25%, again indicating that the most
efficient inhibition of translation is obtained at or near
the site of translation inhibition.
- SD-36 -
