Note: Descriptions are shown in the official language in which they were submitted.
DERIVATI9E8 OF sOLOHLE T-4
BACKGROUND OF THE INVENTION
Within this application several publications are refer-
enced by Arabic numerals within parentheses. Full
citations f~~r these references may be found at the end
of the specification immediately preceding the claims.
The disclosures of these publications are of interest
herein to more fully describe the state of the art to
which this :Lnvention pertains.
' The different functional classes of T lymphocytes rec-
ognize antigen on the surface of distinct populations
of target cells. Helper T cells interact largely with
macrophages and B cells: cytotoxic T cells interact
with a broader range of antigen-bearing. target cells.
j These cellctlar recognition events are likely to be
25 mediated by the specific association of surface mole
cules on bath effector and target cells. The surface
of T cells is characterized by a number of polymor
phic, as well as nonpo3ymorphic, proteins which are
restricted for the most part to T lymphocytes. A1
though most: of these molecules are common to all T
cells, two classes of surface proteins consistently
differ on the different functional classes of T cells,
and these proteins have been implicated in T cell-tar
get cell initeractions.
One class o:E surface molecules distinguishes the major
functional subsets of T lymphocytes: the surface
glycoproteins T4 and T8. Early in thymic development,
the glycoproteins T4 and T8 are coexpressed on the
surface of thymocytes (1). In the peripheral immune
system, the T4 and T8 molecules are expressed on mutu-
ally exclusive subsets of T cells and are only rarely
expressed on the same cell (2, 3). The T4 molecule is
expressed on T cells that interact with targets bearing
class II ma:ior hi.stocompatibility complex (l~iC) mole
cules, whereas T8-bearing T cells interact with targets
expressing class I I~iC proteins (4, 5, 6, 7, 8, g),
The T4 population of T lymphocytes contains helper
cells, whereas the T8 population contains the majority
of cytotoxic and suppressor cells (6, 10). However,
rare T4+ T cells can function as cytotoxic or supres
sor cells (6,, 10), suggesting that the expression of T4
or T8 is more stringently associated with I~iC class
recognition than with effector function. The signifi
cance of thence molecules in T cell-target cell interac
tions can beg demonstrated by studies with monoclonal
antibodies. Antibodies directed against specific
epitopes of 'the T4 molecule (or the murine equivalent
L3T4) inhibit antigen-induced T cell proliferation,
lymphokine release and helper cell function (7, 8, il,
12, 13). Similarly, monoclonal antibodies directed
against T8 (or the murine equivalent Lyt2) inhibit
cytotoxic T cell-mediated killing (14, 15). These
observations, along with the fact that T4 and T8 do
not reveal significant polymorphism, has led to the
hypothesis that T4 and T8 recognize nonpolymorphic
regions of class II and class I molecules, respective-
ly.
i~~~70~
-3-
A second class of proteins thought to differ on differ-
ent effecto:r T cells are the receptors that recognize
antigen in .association with polymorphic regions of MHC
molecules (:L6, 17, 18). The interactions of helper T
lymphocytes are largely restricted to antigen-bearing
target cells: expressing class II MHC proteins, whereas
cytotoxic and suppressor T cells are restricted to tar-
gets bearingf class I MHC molecules (4, 5, 6, 7, 8, 9) ,
These specific interactions may be mediated by the T
cell receptor (or receptors) that recognize antigen in
the context of specific MHC molecules (17, 18). Thus,
the T lymphocyte may have two independent receptors
capable of recognizing both constant and polymorphic
determinants of MHC proteins, and these receptors may
be responsible for specific targeting of functionally
distinct populations of T cells.
The human acquired immune deficiency syndrome (AIDS) is
characterized by a depletion of T4+ lymphocytes. As
a consequence, T cell-mediated immunity is impaired in
AIDS patients, resulting in the occurrence of severe
opportunistic; infections and unusual neoplasms. AIDS
results from the infection of T lymphocytes with a
collection of closely related retroviruses (LAV, HTLV
III, or ARV), now termed human immunodeficiency virus
(HIV). The range of infectivity of these agents is
restricted to cells expressing the T4 glycoprotein on
their surface.
Therefore, th;e T4 glycoprotein may serve not only as a
receptor for molecules on the surface of target cells,
but also as a receptor for the AIDS virus. Monoclonal
antibodies directed against T4 block AIDS virus infec-
tion of T4+ cells in vitro. Furthermore, recent stud-
ies have demonstrated that when T4+ T lymphocytes are
'~ ~3~~~'
-4-
exposed to AIDS virus, the 110 kd envelope glyco-
protein of the virus is associated with the T4 molecule
on the host cell» The lymphotropic character of the
virus could therefore be explained by the restricted
expression of its receptor, T4, in subpopulations of T
lymphocytes.
The depletion of T4+ T lymphocytes in AIDS results in
the impairment of the cellular immune response. In
addition, AIDS is frequently accompanied by central
nervous system (CNS) dysfunction, most often the conse
quence of a subacute encephalitis. AIDS virus RNA and
DNA has been identified in affected brains, and virus
has been isolated from both brain and cerebrospinal
fluid from patients with neurological disorders. These
observations suggest that the AIDS virus infects brain
cells and is directly responsible for the CNS lesions
observed in AIDS patients. Thus, the AIDS virus may
be neurotropic as well as lymphotropic. It is
therefore important to detenaine whether T4 is also
expressed :in the CNS or whether additional brain-
specific surface molecules may serve as a receptor for
the AIDS virus.
The elucidation of the specific interactions of T4 and
T8 would be facilitated by the isolation of the T4 and
T8 genes, the determination of their structure, and the
ability to introduce them into different cellular en
vironments. The isolation and sequence of a cDNA en
coding the 'r8 molecule has recently been reported (19,
20, 21). The deduced protein sequence indicates that
T8 is a membrane-bound glycoprotein with an N-terminal
domain that bears homology to the variable region of
immunoglobul.in light chains.
_~ -5- ~~~o~
SUMMARY OF TIME INVENTION
This invention pravides a therapeutic agent capable of
specifically fonaing a complex with human immunodefi-
ciency virus. envelope glycoprotein comprising a poly-
peptide. In one embodiment of the invention, the
amino acid aequence of the polypeptide comprises the
amino acid sequence shown in Figure 6 from about +3 to
about +185 fused to the amino acid sequence from about
+351 to about +36'9. In another embodiment of the in-
vention, the amino acid sequence of the polypeptide
comprises the amino acid sequence shown in Figure 6
from about +3 to about +106 fused to the amino acid
sequence from about +351 to about +369. In yet a fur-
ther embodiment of the invention, the amino acid se-
15 quence of t:he polypeptide comprises the amino acid
sequence shown in Figure 6 from about +3 to about +185.
This invention also provides a method for treating a
subject infected with a human immunodeficiency virus.
2~ The method comprises administering to the subject an
effective amount of a pharmaceutical composition com-
prising an eaffective amount of a therapeutic agent of
the invention and a pharmaceutically acceptable carri-
er.
LIST OF DRAWINGS
Figure 1. Cytofluorographic Patterns of Indirect
Immunofluorescent Staining with OKT*4 and OKT*8;
3p Figure 2. Northern Blot Analysis of RNA Derived
from T4+ and T4-L Cells and Human Cells;
Figure 3. Restriction Nuclease Maps of pT4B and
the T4 Gene, Sequencing Strategy, and Recombinant
Vectors:
Figure 4. Southern Blot Analysis of DNA from
Untransforme:d and T4+ L Cells and T, B, and Nonlymphoid
Human Cells:
* Trademarks,
- ~~~070~
-5a-
;,~'~ OF DRAWINGS (CONT' D)
Figure 5. 7;mmunoprecipitation of the T4 Glycoprotein from
NIH 3T3 Cells Transformed with the Retroviral Expression
Constructs:
Figure 6. Nucleotide Sequence of the T4 cDNA AND
Translated Sequence of the T4 Protein:
Figure 7. In Vitro Translation RNA derived from SP6
Transcription:
Figure 8. Schematic diagram of the T4 glycoprotein spanning
the cell membrane:
Figure 9. Alignment of the Variable, Joining, and
Transmembrane Regions of T4 with Members of the Immunoglobulin
Gene Family:
Figure 10. Fcestriction nuclease map of the T4 gene in human
chromosomal DNA:
Figure 11. Recombinant Retroviral Expression Vectors and
Construction of Transformed Cells:
Figure 12. The Efficiency of Infection of Naturally-Isolated
and Transformed T4+ Cells:
Figure 13. Formation of Syncythia in T4+ HeLa
Transformants:
Figure 14. Flow C'ytometry Analysis of AIDS Virus binding to
T4+ Transformed Cells;
Figure 35. Northern Blot Analysis of RNA Derived from Human
and Mouse Brain, Lymphoid, and Myeloid Cells;
Figure 16. F~lasmid map of a psT4DHFR:
Figure 17. Fluorescent histogram (cell number vs.
fluorescence inte:nsity):
Figure 18. Inhibition of HIV infectivity by sT4.
ri,,
r~,. .:; ,:.
-6- 1~~0702
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. C~rtofluoroaraphic Patterns of Indirect Im
munofluorescent Staining with OKT~4*and OKTe8*
Cells (~~ x 105) where incubated with the mouse
monoclonal antibodies OKT~4H or OKT~8, washed, and then
incubated with FITC conjugated goat anti-mouse immuno-
globulin. The cells were analyzed on a FRCS IV Cell
Sorter and plotted by a VAX 11/780 computer as cell
number vsc. log fluorescence. Untransformed NIB 3T3
cells an<i L cells gave identical cytofluorographic
tracings. Fro 2.2 is a leukemic T cell line with phe-
notype T3 ; T4+; T8+; T11+. LTD-4 is a T4+ primary L
cell tran,sformant obtained following transfer of total
genomic DNA. 3A+ is an NIB 3T3 cell line that was
,transformed with the T4-pMV6tk/neo retroviral expres
sion construct.
Figure 2. Northern Hlot Analysis of RNA Derived from
T4+ and T4: I, Cells and Human Cells
Three micrograms of poly(A)+ RNA or 12 ~g of .total RNA
(peripheral T cells and thymocytes) were electrophore
sad through a 0.8% agarose-formaldehyde gel, blotted
onto GenaScreeri (New England Nuclear), and probed with
a 3ZP-labeled 0.6 kb T4 cDNA insert. T4+ cells include
LTD-4 (T4+, T8 L cell transformant), SK-7 T cell hy-
bridoma (T'4+, T8-), OT-CLL leukemia (T4+, T8 ), Fro
2.2 leukemia (T4+, T8 ), T4- enriched peripheral T
lymphocytes, and human thymocytes. T4 cells include
untransfonned cells, tk7 (T8+ L cell transfonaant),
HeLa cells, human neuroblastoma cells (Il~t), and T8
enriched peripheral T lymphocytes. The human thymo
cyte lane was exposed four times longer and photo
* Trademar~;s
-
graphed on high contrast film.
Figure 3. Restriction Nuclease MaDS of pT4B and the T4
Gene, SeguE:ncing Strategy, and Recombinant Vectors
A. Alignment of the Bam HI restriction fragments of
pT4B cDNA and the T4 gene. The order of Bam HI frag-
ments in the T4 gene was determined by Southern blot
analysis and genomic clone mapping. The alignment of
the 5' end of pT4H and the T4 gene is shown by dotted
lines, and the shaded region in pT4B corresponds to the
coding sequence. The indicated sizes are in kilobases.
B. Sequencing strategy. Arrows indicate length of
sequence determined by subcloning fragments into M13
and sequencing by the dideoxy termination procedure
(36) .
C. Eukaryotic expression vectors. These constructs
contain two Moloney murine leukemia virus long terminal
repeats (L'rRs) whose orientations are indicated by
arrows. The pT4B cDNA was subcloned into the Eco RI
site of each vector in the orientation indicated. (a)
The T4-pVcos7 construct. (b) The T4-pMV6tk/neo con
struct contains the neomycin phosphotransferase gene
fused to the HSV thymidine kinase promoter.
Figure 4. Southern Blot Analysis of DNA from Untrans-
formed and 'r4+ L Cells and T, B, and Nonlym hoid Human
Cells
Ten microgr<ims of cellular DNAs were digested with Bam
HI, electrophoresed through a 0.8% agarose gel, blotted
onto GeneScreen, and probed with a nick-translated pT4B
cDNA insert., The indicated size markers are in kilo
~.3~~'~~?
_$_
bases. Hybridizing bands of sizes 20 kb, 6.6 kb, 4 kb,
1.8 kb, and 1 kb appear in all human DNAs. DNAs from
T4 , nonlymphoid origin include untransformed L cells,
human fibroblasts (GM), human neuroblastoma cells (NB),
and HeLa ~~ells. CB, CP58, and CP94 are DNAs derived
from EBV-transformed human B cell lines. LTD-4 is the
T4+ primary L cell transformant. RPMI and HSH2 are T4
human T cell leukemic lines; E+ cells and thymocytes
(Thym.) contain T4+ T cells. OT-CLL, Jurkat (lurk.),
Fro 2.2, c:EM, and Molt 4 are T4+ T cells. gaM4 is a
genomic clone which contains sequences spanning the 3~
end of the T4 gene.
Figure 5. Cmmunoprecipitation of the T4 Glycoprotein
from NIH 3T3 Cells Transformed with the Retroviral
Expression Constructs
L-[35S]-methionine labeled proteins from two indepen
dent NIH 3T3 transformants, peripheral T lymphocytes,
and untran~sformed 3T3 cells were subjected to lentil
lectin chromatography to enrich for glycoproteins. 2.5
x 106 cpm of each sample was precleared and then im
munoprecipitated with OKT~4 monoclonal antibodies and
Protein A-S~epharose. The beads were washed, dissolved
in sample buffer, and electrophoresed through a l0%
SDS-polyacrylamide gel under reducing (lanes a-d) and
nonreducing (lanes a and f) conditions. Lane a, un
transformed NIH 3T3 cells. Lane b, T4C2, an NIH 3T3
cell transformed with the T4-pVcos7 construct. Lanes c
and e, 3A+,, an NIH 3T3 cell transformed with the T4
pMV6tk/neo construct. Lanes d and f, peripheral human
T lymphocyi:es. Relative molecular masses (Mr) are
given in ki:Lodaltons.
1~~~~~?
-g-
Figure 6. Nucleotide Seguence of the T4 cDNA and Trans
lated Sectu~ence of the T4 Protein
The nucleotide and predicted amino acid sequences of
the cDNA clone pT4B obtained according to the sequenc-
ing strategy outlined in Figure 38. Numbers shown
above the amina acid sequence designate amino acid
residue positions, The numbers on the right show nu
cleotide F~ositions. All extracellular cysteines are
marked by (~) or (o). The leader sequence (L), vari
able-like (V), joining-like (J), transmembrane (TM),
and cytopla~smic (CYT) regions are indicated by horizon
tal arrows below the sequence, although the exact
boundaries are ambiguous. Two potential N-linked gly
cosylation sites (Asn-Leu-Thr) are also indicated
(cxo).
Figure 7. In Vitro Translation RNA derived from SP6
Transcri ti~on
The full length T4 cDNA insert was subcloned into the
RNA expression vector pSP65 (Promega Biotec). Linear-
ized plasmid DNA was transcribed with SP6 polymerise
(40), and RNA was translated in a wheat germ system
(~thesda Research Laboratories) containing L-[35S]-
methionine. The in vitro translation products were
subjected to electrophoresis through a 10% SDS-poly-
acrylamide gel (lane T4). Bovine pituitary RNA (BP)
was used as a control. Relative molecular masses (Mr)
are given in kilodaltons.
Figure 8: Schematic diagram of the T4 glycoprotein
spanning the: cell membrane
-10-
T4 consists of four tandem VJ-like domains (ViJi-V4J4),
a hydrophobic membrane-spanning segment (shaded area),
and a charged cytoplasmic region (CYT). Two potential
N-linked glycosylation sites in the extracellular por-
tion are :Lndicated ( ---). The positions of introns
2-8 in the T4 gene are also marked ( ).
Figure 9. i~lignment of the Variable, Joining, and Tran-
smembrane Regions of T4 with Members of the Immuno-
globulin Gene Family
A. Alignment of the variable region amino acid se
quence of T4 with a mouse kappa light chain immuno
globulin J606 (66), T8 (20), a human T cell antigen
receptor p-chain YT35 (97) , and a human T cell antigen
receptor a--chain HPB-MLT a(98). The invariant resi
dues in the light chain variable region are included
(Inv.) in the alignment. The alignment was performed
in order to maximize identities and structural homolo
gies with T4, which appear as boxed residues. The
lines below the sequence with letters A, B, C, C', D,
E, F, and G indicate the residues which form ,B-strands
(67). ,B-strand G continues into the J sequence.
B. Alignment of the joining region amino acid sequence
o! T4 with the consensus J sequences of the T cell
antigen receptor p-chain, immunoglobulin lambda and
kappa light: chains, and the J sequence of the human T
cell receptor a-chain (99).
C. Alignment of the transmembrane regions of T4 and an
MHC class II ,B-chain (100). The putative transmem-
brane domain (TM) is indicated below the sequence.
-11-
Figure 10. Restriction nuclease map of the T4 Qene in
human chromosomal DNA
The positions of the 9 axons were determined by genomic
clone mapping, Southern blot analysis, and nucleotide
sequencing. The leader sequence (L), variable-like
(V), joining-like (J), transmembrane (TM), and cyto-
plasmic (C:YT) regions are boxed. The position of the
methionine codon surrounded by the intitiation consen-
0 sus sequence is indicated (ATG) at the beginning of the
leader axon (L) N the termination codon TGA is shown at
the end o~f the second cytoplasmic axon (CYT). The
indicated sizes are in kilobases.
~5 Figure 1l.:Recombinant Retroviral Expression Vectors and
Construction of Transformed Cells
A. Recombinant retroviral expression vectors. pMV7
contains t.wo directly repeated Moloney murine sarcoma
20 virus long terminal repeats (LTRs) in the orientation
indicated by arrows. pMV7 also contains the bacterial
neomycin plhosphotransferase gene (neo) fused to the HSV
thymidine kinase promoter (tk). Full length cDNA in-
serts encoding T4 (T4H) (70) or T8 (T8F1) (20) were
25 subcloned :into the Eco RI site in the orientation indi-
cated by arrows, generating T4-pMV7 and T8-pMV7, re-
spectively,. The coding sequences are shown as shaded
regions. '.Che indicated sizes are in kilobases.
8. Retrovirus-Mediated Gene Transfer Strategy.
Figure 12. The Efficiency of Infection of Naturally-
Isolated and Transformed T4+ Cells
~. ~ f~ (~ '~l (~ ~
-12-
Calls were inoculated with serial 10-fold dilutions of
AIDS virus, incubated for 18 hours at 37°C, washed, and
plated in microculture. The frequency of infected
cultures was determined by an enzyme-linked immunoab-
sorbent assay (ELISA) 12 days post-infection (46). The
results were plotted as % positive cultures vs. log
virus dilution. Infectious virus titer (ID-50) is
defined as 'the reciprocal of the dilution at which 50%
of the cultures are positive for virus (47). Naturally
isolated T4+ cells include phytohemagglutinin (PHA)
stimulated normal peripheral lymphocytes
and the T cell line CEM ( U---O ) , T4+ transfected
cell lines include HSH2-T4+ T cells ( ~--~1 ) and
Ra j i-T4+ H cells ( ~----/ ) . The T8+ transfected cell
lines HSB2-'T8+ and Raj i-T8+ ( D--.~ ) served as
controls in these studies.
Figure 13. Formation of Syncythia in T4+ HeLa Tran-
formants
A. 2 x 105 monolayer HeLa-T4+ tranformants were mixed
with 2 x 104 AIDS virus-producing H9 cells and incubat-
ed at 37'C. Inspection of the cultures after 18 hours
revealed that over 90% of nuclei in the monolayer sheet
wars contained within syncytia.
H. Anti-T4A :monoclonal antibody (1:20) was added to the
mixed cultures at the time of seeding. Inspection of
the cultures. after 18 hours revealed a complete ab-
sence of cell fusion.
Cultures were photographed at 160 X magnification.
Figure 14. 1?low Cytometry Analysis of AIDS Virus bind-
ing to T4+ ~~ransformed Cells
-13-
Column A. Cells (5 x 105) were incubated with fluores-
cein-conjugated anti-T4A (-) or anti-T8 (---)
monoclonal. antibodies, washed, and analyzed by cyto-
f luoromet=y .
Column e. Cells (5 x 105) were incubated with buffer
(---), or AIDS virus ( ), washed, incubated with
fluorescei.n-conjugated anti-AIDS virus antibody, and
analyzed by cytafluorometry.
Column C. Cells (5 x 105) were incubated with buffer
(---), or with anti-T4A monoclonal antibody followed by
AIDS virus: ( ), or with anti-T8 monoclonal antibody
followed by AIDS virus (-'-'-). After a wash, fluores-
cein-conjugated anti-AIDS virus antibody was added and
the cells were analyzed by cytofluorometry.
Flouorescence histograms (cell number vs. fluorescence
intensity) of each cell line are arranged horizontally.
Figure 15. Northern Blot Analysis of RNA Derived from
Human and 1!iouse Brain, Lymphoid, and Myeloid Cells
A. Northern blot analysis of human RNA samples. One
microgram ~of poly (A) + RNA from Ra j i (T4 B cell line) ,
U937 T4+ monoc tic cell line
( y ) , and Jurkat (T4+ T cell
line), and five micrograms of poly(A)+ RNA from cere-
bral corte:~c, were electrophoresed through a 1% agarose-
formaldehy<ie gel, blotted onto Hybond (Amersham), and
probed with a 32F-labelled T4 cDNA insert, pT4B (70).
B. Northern blot analysis of mouse RNA samples. Five
micrograms of paly(A)+ RNA from 3T3 cells (fibroblast
cell line), forebrain, and hindbrain, and 20 micrograms
of total RNA from thymocytes, were eletrophoresed
~~~~0~~~
-14-
through a 1% agarose-formaldehyde gel, transferred onto
Hybond, and probed with a 32P-labelled L3T4 cDNA in-
sert, pL3T4B.
Figure 16. Plasmid map of psT4DHFR
Plasmid psT4DHFR is a pUCl8 derivative containing by 1-
1257 of the T4 cDNA clone pT4B which encodes the leader
and extracellular segment of T4. This sT4 cDNA is
inserted bE~tween an SV40 early promoter and a synthetic
linker containing a TAA termination codon (inset) fol-
lowed by the polyadenylation region of the bovine
growth honnone gene. The sT4 expression cassette is
linked to a mouse hdfr expression cassette consisting
t5 of the ~-g:lobin promoter, mouse dhfr coding sequence,
and the SV40 polyadenylation region.
Figure 17. Fluorescent histogram (cell number vs
fluorescence intensity)
sT4 inhibits HIV binding to T4+ CEM cells. Cells were
incubated with buffer (~-.-.-), HIV preincubated with
sT4 ( - ), or with HIV preincubated with concentrat-
ed control supernatant from untransformed DXB-11 cells
(- - -), waslhed, exposed to fluorescent-conjugated anti-
HIV antibody, and analyzed by cytofluorometry. A fluo-
rescent histogram (cell number vs. fluorescence inten-
sity) is shown.
Figure 18. Inhibition of HIV infectivity by sT4
Infectivity titration of an HIV inoculum (ID-50 assay)
was performead. Serial 10-fold dilutions of virus inocu
lum are incubated with indicator cells (PHA-stimulated
human lymphocytes) for 18 hrs. The cells are then
-15-
washed and plated in microculture (1 X 105 cells per
culture, :l0 cultures per dilution). At day 4, 8, and
12, supernatants are tested for HIV by the antigen
capture assay. ID-50 titrations were performed in
media coni:aining 8.6 ~g/ml sT4 which was added to the
HIV dilution 30 minutes prior to inoculation of cells
and maintained in the culture media throughout the
experiment. ( ~ ), or in media containing sT4 introduced
after the initial 18 hr inoculum ( O ) (delayed addi-
0 tion control), or in media without sT4 ( O ) (con-
trol).
A. Plot of percent of cultures positive for HIV at day
8 versus dilution of virus inoculum.
H. Plot of ID-50 (reciprocal of virus dilution at which
50% of cultures are positive) at days 4, 8, and
12.
C. Plot of percent of cultures positive for HIV at day
_
8 versus varying concentrations of sT4 using a 10
dilution of HIV.
30
-16-
DETAILED DESCRIPTION OF THE INVENTION
This invention provides a therapeutic agent capable of
specifically forming a complex with human immunodefi-
ciency virus envelope glycoprotein comprising a poly-
peptide. :Cn one embodiment of the invention, the
amino acid sequence of the polypeptide comprises the
amino acid aequence shown in Figure 6 from about +3 to
about +185 fused to the amino acid sequence from about
+351 to about +369. In another embodiment of the in-
vention, the amino acid sequence of the polypeptide
comprises the amino acid sequence shown in Figure 6
from about +3 to about +106 fused to the amino acid
sequence from about +351 to about +369. In yet a fur-
ther embodiment of the invention, the amino acid se-
~5 quence of the polypeptide comprises the amino acid
sequence shown in Figure 6 from about +3 to about +185.
A pharmaceutical composition useful as a therapeutic
agent for the treatment of a subject infected with a
20 human immunodeficiency virus is also provided. This
pharmaceutical composition comprises an amino acid
sequence of the present invention which is capable of
specifically forming a complex with a human immunode-
ficiency vi~:-us envelope glycoprotein and is soluble in
25 an aqueous solution and a pharmaceutically acceptable
carrier. Such pharmaceutically acceptable carriers are
known in the art to which the present invention per-
tains and include, but are not limited to, 0.01-O.1M,
preferably 0.05 M, phosphate buffer or 0.8% saline.
A method for treating a subject infected with a human
immunodefic:Lency virus is also provided. This method
comprises administering to the subject an effective
amount of a pharmaceutical composition containing a
1340~I02
-17-
pharmaceutically acceptable carrier and an amino acid
sequence of the present invention, capable of specifi-
cally forming a complex with a human immunodeficiency
virus envelope glycoprotein and soluble in an aqueous
solution, so as to render human immunodeficiency virus-
es (also referred to herein as AIDS viruses) with which
the subject is infected incapable of infecting T4+
cells.
Characterization of the in vitro biological and immuno
logical properties of the sT4 protein indicate the
protein is of value in the prevention and treatment of
AIDS. Studies indicate the sT4 protein acts as an
inhibitor of extracellular and cell to cell spread of
the virus. Because sT4 has been shown to block virus
binding to T4+ target cells in culture, it is believed
administrai:ion of sT4 to infected persons would' act to
inhibit the extracellular spread of the virus. There-
fore, sT4 is of value both as a prophylactic and thera-
peutic agent for treatment of AIDS.
As a prophylactic, sT4 is administered to individuals
at high-risk for the disease or individuals who show
exposure to HIV by the presence of antibodies to virus.
Administration of an effective amount of sT4 at an
early stages of the disease or prior to its onset acts
to inhibit infection of T4+ lymphocytes by HIV. As a
therapeutic., administration of sT4 to persons infected
with HIV acts to inhibit extracellular spread of the
virus.
Fusion between HIV infected cells and other T4+ lympho
cytes also appears to be a route of virus spread.
Further, fusion may be responsible, in part, for the
impainaent of T~+ lymphocyte function and ultimately
~.'~~0'~~~
the depletion of T4+ lymphocytes in infected individu-
als. Ce7.1 fusion is dependent on both viral envelope
gene products and the T4 receptor and can be inhibited
by the 01tT4A, or similar monoclonal antibodies (blabs)
(120). ::T4 interferes with cell fusion and therefore
is expected to diminish the cell to cell spread of
virus and the loss of T4+ lymphocyte function.
The T4 receptor is monomorphic and thus sT4 is believed
to be a universal inhibitor of virus which recognize
the surface domain of the T4 receptor, including all
HIV.
sT4 may be used in combination with other agents, for
example, in association with agents directed against
other HIV proteins, such as reverse transcriptase,
protease or tat. An effective therapeutic agent
against HIV should prevent virus mediated as well as
cell to cell transmission of infection. sT4 may also
be used in combination with other anti-viral' agents,
for examp7.e, azidothymidine (AZT).
The sT4 protein of this invention also has utility as
an inhibitor of T4+ cell function. Numerous studies
suggest a critical role for the CD4 receptor (CD4 is
general tearminology for the human T4 receptor and its
counterparts in other mammalian cells) in immune toler-
ance, parl:icularly in the pathogenesis and progression
of autoimmune diseases and in host specific graft re-
jection. Of particular relevance to sT4 are the obser-
vations with anti-C04 blabs. Through their association
with the C:D4 receptor, certain of these blabs ameliorate
autoimmune: responses and graft rejection. Examples of
such action include inhibition of T-cell function _in
vitro, for example, antigen induced proliferation,
1~4~'~U~
-19-
lymphokine secretion and helper cell function by cer-
tain anti-CD4 Mabs; treatment of systemic lupus erythe-
matosus by administration of anti-CD4 Mabs to retard
the onset of murine lupus: and grafting studies in mice
wherein a single dose of murine Mab directed against
the murine CD4 receptor results in acceptance of the
allograft.
The molecu:Lar consequence of the binding of Mab to CD4
is unclear. The Mabs may block the association of CD4
with its ligand, which ligand, evidence suggests, is a
conserved ~epitope on MHC class II antigens (121,122).
However, at least some of these same Mabs inhibit CD4
cell activation by an apparent class II independent
path.
sT4 is also believed to inhibit T-cell interactions as
a competitor of cellular T4, perhaps by binding to
extracellul.ar target molecules which normally interact
with the surface domain of the T4 receptor. This dis
tinction between Mabs and sT4 could have important
functional consequences. For example, whereas some
Mabs direcited against T4 elicit a response on the T4
cell, sT4 may elicit a response on cells expressing MHC
class II antigens. Also, the affinity of T4 for its
presumed class II ligand appears to be quite low com-
pared to t;he high affinities of Mabs directed against
T4. Thus, although Mabs and sT4 may interfere with the
same processes, they would affect different target
molecules and different target cells.
As a prophylactic or therapeutic, sT4 is administered
parenterally, preferably intravenously. The agent can
be administered by infusion or by injection, e.g.,
daily, weekly or monthly. The amount and rate of sT4
-20-
administration is selected so as to maintain an effec-
tive amount of sT4 in circulation. An alternative mode
of administration would be extracorporal, employing sT4
as a dialysis agent.
The sT4 protein of this invention can also be used as a
reagent t~o identify natural, synthetic or recombinant
molecules which act as therapeutic agents or inhibitors
of T4+ cell interactions.
For examp7le, sT4 protein can be used in screening as-
says, such as assays for protein interaction measured
by ELISA based methodologies, to provide a biochemical-
ly pure, aqueous soluble reagent which may be used in
combination with other reagents to assay for competi-
tore of the T4 receptor surface domain interactions.
For example, since sT4 binds to HIV env protein or
mixtures containing HIV env proteins, it can be used to
screen for inhibitors of virus binding. Based on _in
vitro data. showing that sT4 binds to cells expressing
HIV env proteins, sT4 can also serve as a selective
targeting molecule for HIV infected cells in vivo. As
a target sspecific carrier protein, sT4 can serve, for
example, as the carrier protein for delivery of cyto-
toxic agents to the infected cells.
In addition, based on data showing that the T4 receptor
specifically associates with I~iC class II antigens on
antigen-presenting cells as suggested by the class re-
striction of T4+ cells, sT4 can be used in combination
with class II antigens to test for inhibitors of T4
lymphocyte - target cell interactions. In addition to
these examples, which are based on direct binding as
says between sT4 and its target molecules, more complex
assays can be designed which rely on the biochemical
-21- 1340'02
responses to sT4 recognition.
Further provided is an expression vector encoding a
polypeptide, the amino acid sequence of which comprises
the amino acid sequence shown in Figure 6 from about +3
to about +185 fused to the amino acid sequence from
about +351 to about +369. In another embodiment of the
invention, the expression vector encodes a polypeptide,
the amino acid sequence of which comprises the amino
acid sequence shown in Figure 6 from about +3 to about
+106 fused t:o the amino acid sequence from about +351
to about +369. In yet an additional embodiment of the
invention, the expression vector encodes a polypeptide,
the amino acid sequence of which comprises the amino
acid sequence shown in Figure 6 from about +3 to about
~5 +185.
A host cell comprising the expression vectors of this
invention is also provided by the present invention.
In one embodliment of the invention, the suitable host
is a bacterial cell. In another embodiment of the
invention, the bacterial cell is an Escherichia coli
cell. In yet another embodiment of the invention, the
suitable host a eucaryotic cell. In a further embodi-
ment of the invention, the eucaryotic cell is a mamma-
25 lian cell. In yet a further embodiment of the inven-
tion, the eucaryotic cell is a yeast cell. In still
another embodiment of the invention, the suitable host
is an insect cell.
30 The present :invention also provides a means for produc
ing sT4 consisting of the predicted extracellular do
main of the T4 receptor. Using that portion of the T4
cDNA which encodes the leader and extracellular domains
of the T4 receptor, i.e., pre sT4, vectors are con
-22- 13 4 0'~ 0 2
structed c:apable of overexpression of sT4 in mammalian
cells.
The sequence of one sT4 is as follows:
10
20
30
~
~ - _
20 30 40 80 60
CAA GOC CAG AGC ixT GOC ATP TCT G'IG GGC T~C'A GGT CXx TAC 'IGC TCA GaC C)CT
'IOC TCc
5 70 80 90 100 110 120
C'I~C GGC AAG GOC AC'A AZG AAC COG GGA GI~C OLT TIT AGG CAC TIG CTT CZC GZG
CIG C~F1
Met Asn Arg Gly Val F3~ Phe Arg Isis Ieu IEU Ieu Va1 Leu Gln
130 140 150 160 170 180
* * * +1
cIG GC~ CiC CIC CX'A GCA GCC ACT C3~G GGA AAG AAA GTG GIG CIG OGC AAA AAA GOG
GAT
1p Leu Ala Leu Leu Faro Ala Ala 'Ihr Gln Gly Lys Lys Val Val Ieu Gly Lys Lys
Gly Asp
190 200 210 220 230 240
ACA GIG GAA CZG AOC TGT ACA GCT 'IOC (34G AAG AAG AGC ATA CAA TIC CAC 'It3G
AAA AAC
Thr Val Glu I~ Thr Cys Zhr Ala Ser Gln Lys Lys Ser Ile Gln F3~e His Trp Lys
Asp
250 260 270 280 290 300
* *
T~ AAC cAG ATA Ate ATr c~ Gc,~ AAT c~ Gcc Toc Toc TrA Acr ~ c~cr aA 'roc AAG
Ser Asn Gln Ile Lys Ile Leu Gly Asn Gln Gly Ser Ffie Leu 'Ihr Lys Gly Pro Ser
Lys
310 320 330 340 350 360
* * * *
CIG AAT GAT CGC C~:.T GA~C TCA AGA AGA AGC CIT 2CIG GAC CAA GGA AAC TIr CCC
CIG AZC
Leu Asn Asp Axg A:la Asp Ser Arg Arg Ser Leu Trp Asp Gln Gly Asn Pipe Pro Ieu
Ile
370 380 390 400 410 420
A2C AGG AAT CTr A~~G ATA GAA GAC TrA GAT ACT TAC ATC TGT GAA GTG GAG GAC C:yG
AAG
Ile Lys Asn Leu Lyg Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu Asp Gln
Lys
430 440 450 460 470 480
* * * 104
GAG GAG G'IG CAA T1C CTA GTG TIC C~ T~ A(,~I, ~ p,~ ~ ~ ACC CAC C'IG CTT CMG
Glu Glu Val Gln L~u I~ Val Ptse Gly Ieu 'Ihr Ala Asn Ser Asp ~. ~ ~ ~ Gln
490 500 510 520 530 540
GGG CMG AGC C1G ACC CIG ACC TIC GAG AGC OOC OCT GGT ALT AGC COC 'I~'A GTG CAA
TGT
Gly Gln Ser Leu Thr Ieu Thr Leu Glu Ser Pro Faro Gly Ser Ser Pro Ser Val Gln
Cys
550 560 570 580 590 600
AGG AGT CCA AGG GGT AAA AAC ATA CAG GGG GGG AAG ACC CTC T~OC GIG TrT CMG CIG
GAG
~ ~ ~ ~ Gly Lys Asn Ile Gln Gly Gly Lys Thr Leu Ser Val Ser Gln ~ Glu
610 620 630 640 650 660
C'TC C~G GAT AGT G~3 AC7C TGG ACA TGC ACT G'DC TIG CAG AAC CAG AAG AAG GIG GAG
TIr
Leu Gln Asp Ser Gly Zhr Trp Thr L~ ~ V~ ~ G~ ~ G~ Lys Ly5 Val Glu Phe
- 24 -
670 680 690 710 720 730
* * * 183* *
AAA ATA GAC ATC GIG GTG CPA GCT Tit CAG AAG GOC TaC AOC ATA GTC TAT AAG A1~1
GAG
Lys Ile Asp Ile Val Val Ieu AIa plye Gln Lays Ala Ser Set Ile Val Tyr Lyg Lys
Glu
730 740 750 760 770 780
* * *
GGG GAA CAG GTG i;~4C TTC TOC TIC OCR CTC GaC TIT AC~~ GTT GA71 AAG CZG AID
GOC AGT
Gly Glu Gln Val ;4sp phe Ser Ffie pto L~ pea p~ ~ Val Glu Lys Leu ~1r Gly Set.
790 800 810 820 830 ' 840
* * * * * *
~ GAG CIG TGG '.tt3G CAG GCG GAG AOG GtZ' TCC TaC TrOC AJ~G TCt' TC~G ATC AiOC
TIT G~1C
Gly Glu Ieu Trp ~,~p Gln Ala Glu Arg Ala Ser Ser Ser L~ys Ser ~p Ile Thr pl~e
Asp
850 860 870 880 890 900
CIG AAG AAC AAG CAA GTG TCT GTA AAA CGG GTP AOC CAG GAC CCT AAG CTC CAG ATG
GOC
Leu Lys Asn Lys Gilu Val Ser Va1 Lys Azg Val ~r Gln Asp Pro Lyg ~ G~ ~ Gly
910 920 930 940 950 960
* * * *
A~ Apc crc o~ rrc cAC cIr Aroc cIC ooc c~ ccc Trc ocT cac TAT ccT occ TcT Gc,~
Lys Lys Leu Pto Leu Hi.s Leu ~r Leu Pro Gln Ala Lai Pto Gln Tyr Ala Gly Ser
Gly
970 980 990 1000 1010 1020
AAC CTC A(aC CIG GOC CIT GAA GCS AAA ACA GGp. AAG TTG CAT CAG GAA GTG AA~C CTG
GTG
Asn I,eu Thr LQU Ala LQU G:lu Ala Lys Thr Gly Lys LEU Hi.s Gln Glu Val Asn Leu
Val
1030 1040 1050 1060 1070 1080
* ~k * * * *
GTG ATG AGA GOC Fur' Q~G CTC CAG A~1A AAT TIG AOC TGT GAG GTG TGG GGA COC AG1C
TCC
Val Met Atg Ala ~r Gln Leu Gln Lys Asn Leu ~r Cys Glu Val Ttp Gly Pro Zhr Ser
1090 1100 1110 1120 1130 1140
ttT AAG CIG ATG C'.LG AGC TTG AAA CIG GAG AAC AAG GAG Gc~ AAG GTC T~fT AAG CMG
GAG
~'° LYs ~u ~t Leu Ser LEU Lys Leu Glu Asn Lys Glu Ala Lys Val Ser Lys
Arg Glu
1150 1160 1170 1180 1190 upp
* *
AAG GCS GTG TGG G7~ CTG AAiC OCT GAG GOG c~G ATG 'IGG CAG TGT CTG CTG AGT GAC
TCG
Lys Ala Val Ttp Va~l Lau Asn pro Glu Ala Gly Met Ttp Gln Cys LQU Ieu Ser Asp
Ser
u10 1220 1230 1240 1250 1260
* ,w
GGA CAG GTC CIG CIG GAA TtSC AAiC ATC AAG GTT CTG DOC ACA T3G TOC AOC CCG GIG
TAA
35~ G1n val Lai Less Glu Ser A~ Ile Lys Val Leu Pte 'tier Trp Ser 'Ihr Pro3
1 1270
*
Tu~G ~C CT~C TAG A
....
-25-
The coding sequence for sT4 is obtained, for example,
by synthesizing 'the gene using the known DNA sequence,
by standard cloning techniques based on the sequence
and by. reis~olation by detection of protein, i.e., tran
sfection of cDNA clones from T4 expressing cell lines
and identii'ication by antibodies directed against the
protein. c:DNA clones carrying the sT4 coding sequence
are identified by use of oligonucleotide hybridization
probes. The probes are designed based on the known
sequence of the T4 protein. Having identified a clone
carrying th.e sT4 coding sequence, the coding sequence
is excised by the use of restriction endonucleases and
inserted into cloning and/or expression vectors. In
an expression vector, the sT4 coding sequence is opera-
tively linked to regulatory functions required or de-
~5 sirable for transcription, translation and processing
of the coding sequence.
Regulatory functions include, for example, functions
required for RNA polymerase binding and transcription,
as well as other functions such as polyadenylation and
enhancement of transcriptional sequences. The promoter
can be regu:latable so that, for example, expression is
not induced until after transfection and selection of
transformed clones. Promoters useful in the practice
0! the invention include, for example, the SV40 early
promoter, anal the long terminal repeats (LTR's) of rows
sarcoma virus, moloney sarcoma virus or cytomegalovirus
(CMV) .
prior to transfection, the sT4 minigene, i.e., the gene
encoding the leader and extracellular domains of the T4
receptor, preferably is incorporated into a larger DNA
molecule which comprises a genetic selection marker
system. The selection marker system consists of any
-26-
gene or genes which cause a readily detectable pheno-
typic change in a transfected host cell. Such pheno-
typic change may be, for example, foci formation, drug
resistance, such as genes for 6418 or hygromycin B
resistanc~a: or other selectable markers such as xan-
thine guanine phosphoribosyl transferase (xgprt), thy-
midine kinase (TK) and galactokinase (galK). A selec-
tion marker which permits gene amplification can be
employed i.o increase copy number, whether by increased
0 transfectj.on efficiency or by enhanced intracellular
replication of the gene of interest and the selection
marker. Such markers which also serve to amplify gene
copy number include genes for dihydrofolate reductase
(methotrexate resistance), CAD (N-phosphonacetyl-L
aspartate resistance) and adenosine deaminase (2-de
oxycoformycin resistance).
Following transcription and translation in mammalian
cells, the: leader sequence appears to be cleaved and
mature sT4 is secreted into the conditioned medium.
In the preferred practice of the invention, the sT4
minigene is linked with a human H-ras or a mouse dihy
drofolate reductase (DHFR) minigene to create the ex
Pression v~actors.
The sT4 minigene is linked, for example, with the human
H-ras or naouse DHFR in order to provide a selection
marker and means to selectively amplify gene expression
through co~-transfection with these genes. Common se-
lection markers include, for example, DHFR, 6418 or
hygromycin which select for integration of as few as a
single copy of the gene of interest. Amplification
with, for example, methotrexate (mtx) in the DHFR sys-
tem results. in overexpression of the gene.
-27-
An alternate means of increased expression of the gene
includes u,se of the ras proto-oncogene. The ras gene
family includes the H-ras, K-ras and N-ras genes. In a
preferred application of the invention, the H-ras gene
is used.
Other DNA l:unctions can be linked directly or indirect-
ly to the sT4 minigene or such functions may be un-
linked. See, for example, Axel, U.S. Patent No.
4,399,216.
Overexpression of gene products in mammalian cells can
be achieved by transient or stable means. Transient
~5 overexpression can be achieved by viral methods such as
the use of vaccinia virus vectors or by gene amplifica-
tion methods such as with SV-40 based vectors in cells
which support SV-40 replication. These methods ulti-
mately lead to cell death. Stable overexpression can
20 be achieved by generation of multiple gene copies such
as through selection for gene amplification or through
the use of t:he ras proto-oncogenes.
Overexpressj.on of sT4 protein by co-transfection using
25 the H-ras gE:ne system can be achieved using a number of
di!lerent cell lines, with the preferred cell line
being the NI:H-3T3 cell line which is a contact inhibit
ed mouse fi.broblast cell line. other cell lines in
clude the na~rmal rat kidney (NRK) (ATCC 1571) cell line
and the rat. embryo fibroblast 52 (REF-52) cell line
( 115 ) .
When using the selection marker system, for example,
DHFR with avethotrexate (DHFR/MTX technique), wherein
amplification of gene copy number is achieved by selec
~.r'~~~~1 ~~
-28-
tive amplification, the Chinese hamster ovary cell line
(CHO) is preferred. In particular, CHO cells deficient
in DHFR are used (116). Other cell types which may be
used include, for example, any mammalian cell which
has been modified so as to be DHFR .
Some DHFR+ cell types may be used in combination with
mutant DHF'R genes which are less sensitive to metho-
trexate than normal DHFR (Axel, U.S. Patent No. 4,399,-
0 216). In principle, DHFR+ cells may be used in combi
nation with normal DHFR genes and an additional domi
nant selectable gene such as the gene for 6418 resis
tance (117). Transfection is carried out using stan
dard techniques (118, 119). These techniques include,
for example, calcium phosphate precipitation, DEAE
dextrin induced pinocytosis, electroporation and viral
transfection.
Following transfection, a cell which carries the sT4
minigene i:; cultured in a nutrient medium under condi
tions which permit amplification of the selectable
gene. Standard mammalian cell culture medium can be
employed, for example, F12 medium (GIBCO, Grand Island,
New York) 'without hypoxanthine and thymidine and con
taining 10~% fetal bovine serum. Cell cultures are
maintained at ambient pressure at 30 to 45'C. Cells
which survive selection and express high levels of sT4
protein are selected for further culturing. Such cells
are culturesd under selective conditions and the prod-
uct, the sT4 protein, is collected and purified.
Cell culture methods which may be employed in the prac
tice of th.e invention include, for example, use of
adherent cells ar growth of cells in a suspension.
Conditioned medium (CM) can be collected from cells
~.~~o~~oz
-29-
grown in suspension or adhered to solid supports, i.e.,
CM is prpeared from adherent cells grown in roller
bottles or grown on solid supports and cultured in
suspension or in fluidized or packed beds. CM is pre-
y pared from suspension cells in stirred-tank vessels.
The sT4 of the invention includes derivatives of the
extracellul.ar domain of T4. Such derivatives comprise
addition, deletions or subsitutions which alterations
do not significantly adversely affect secretion of the
protein into the conditioned medium and the affinity of
the protein for HIV env protein, i.e., gp120. For
example, one or a few amino acids can be added to or
deleted from the N- or C- terminus. Or, one or a few
amino acids, preferably no more than four amino acids
can be inserted into, deleted or substituted for inter
nal amino acids. Alternatively, a hybrid protein,
i.e., a translational fusion, can be constructed be
tween sT4 and a protein carrier, another antigen or
other sT4 molecules to prepare a poly-sT4 molecule. In
yet another alternative, sT4 can be synthetically con-
jugated to .3 carrier molecule.
One embodiment of a sT4 derivative is illustrated in
th. Examples below (ses Example 3). Affinity of the
sT4 for HIV env can be demonstrated by a competitive
binding assay using a sT4 molecule having a known af
finity or using antibodies which recognize the T4 re
ceptor, such as OKT4 and OKT4A. Useful derivative sT4
molecules o1a the invention are selectively precipitated
from conditioned medium by oKT4A as shown in Example 3.
Derivatives can be prepared chemically, after expres-
sion, or genetically, prior to expression, by manipula-
tion of the coding sequence for the leader and/or
extracellula,r domain.
-30-
The sT4 of the invention can be purified from the spent
culture media using various protein purification tech-
niques, for example, affinity chromatography; ion ex-
change chromatography; size exclusion chromatography;
hydrophobic chromatography or reversed phase chromatog-
raphy.
sT4 can bas purified by affinity chromatography using
general group-specific adsorbents, for example, carbo-
hydrate binding or dye affinity ligands: or using
ligands that specifically bind to sT4, for example,
monoclonal antibody or HIV gp120 protein or portions
thereof.
An exemplas.-y purification scheme comprises: (1) grow-
ing cells in a serum-free selection growth media; (2)
clarification of the conditioned media: and (3) separa-
tion of sT4 of the invention from other proteins
Present in the canditioned media.
In the prei'erred method, the sT4 is purified from the
serum-free culture medium using a series of chromatog-
raphy steps which are based on the physical properties
0! the sT4 molecule. The sT4 may also be purified from
culture medium captaining serum using similar chroma-
tography meithods .
In the pre:~erred method of purification of sT4, the
culture medium is f first passed through an ion exchange
column, preferably an S-Sepharosee (Sulpho-propyl
Sepharose) column, which binds the sT4 while the major-
ity of contaminating proteins flow through the column.
The protein sample is then eluted using a linear salt
gradient. A second ion exchange column is used. This
140"l0~
-31-
column, preferably a Q-Separose~ (quarternary amino
ethyl Sepharose~ column has properties such that the
contaminating proteins present in the sample are bound
to the column while the sT4 does not bind and is. recov-
ered in the column flow-through buffer. Finally, a gel
filtration column is used which acts to remove remain-
ing contaminating materials.
An alternative method of purification of sT4 involves
the use of monoclonal antibodies directed against sT4.
The sT4 protein can be purified in one step by passage
of clarified culture media through an affinity gel
support to which monoclonal antibody directed against
sT4 is bound. The sT4 will bind to the column at the
antibody binding site while all contaminating proteins
wash through the column. The sT4 is then eluted from
the column under conditions that prevent sT4 protein
from being inactivated.
Further provided is a method of producing any one of
the above described therapeutic agents capable of spe
cifically forming a complex with human immunodeficiency
virus envelope glycoprotein which comprises growing the
host vector system of the invention under suitable
conditions permitting production of the therapeutic
agent and recovering the therapeutic agent so produced.
The sT4 can be used in diagnostic assays for the detec-
tion of T4 proteins or the molecules with which they
interact. For example, quantitation of T4 and T4+
cells and antibodies to T4 would be of diagnostic value
for AIDS.
In addition, sT4 can be used to generate new diagnostic
reagents, for example, Mabs or other types of molecules
-32-
for use i.n the standard immunologic assays, i.e.,
ELISA, capture immunoassays, radioimmune assays. Be-
cause sT4 displays the OKT4, the OKT4A and most if not
all of the other surface epitopes of the T4 receptor,
sT4 is especially useful in immunodiagnostic assays as
it can be used for absolute quantitation of T4 levels
in a system. Ourrently there are no standards for
quantitating the T4 receptor.
The T4 receptor resides in three diverse chemical envi-
ronments: the oxidizing, hydrophilic cell surface; the
hydrophobic membrane: and the reducing, hydrophilic
cytoplasm. These diverse environments would most like
ly preclude the isolation of the receptor in its fully
native state. sT4, which consists of only the extra
cellular domain, is secreted as a soluble protein into
the cell supernatant and its conformation appears to
mimic the surface of the receptor surface domain.
Thus, sT4 ins suitable for detailed structural analysis,
in particular for x-ray crystallography. Determination
of the three-dimensional structure of sT4 alone or in a
complexed form with other interactive molecules could
provide a basis for the rational design of selective
antagonists and agonists for sT4.
The various prophylaxis and immunization methods for
AIDS provided by the present invention are based upon
the abilities of the novel peptides, antibodies, and
DNA molecules disclosed herein to form complexes with,
or hybridize to, specific molecules and to invoke an
i~unologica,l response effective for neutralizing the
AIDS virus. These molecules, methods for their prepa
ration, and methods of AIDS treatment will be better
understood by reference to the following experiments
and examples which are provided for purposes of illus
'' ~ 1.3~~~~~~
-33-
tration and are not to be construed as in any way lim-
iting the scope of the present invention, which is
defined by the claims appended hereto.
10
20
30
a.~~o~oz
-34-
Materials and Methods
Cells and Antibodies
Peripheral blood leukocytes isolated by Ficoll-Hypaque
density gradient centrifugation were fractionated into
sheep erythrocyte rosette-positive (E+) cells. T4+ and
T8+ subset: within the E+ population were isolated by
positive selection of T8-bearing cells with anti-T8
antibody anal human erythrocytes conjugated with affini
ty-purified rabbit anti-mouse IgG (10). Cytofluoro-
metric analysis of these subsets demonstrated that the
T4+ cells were 95% T4+ and 2% T8+, whereas the T8+
cells were 95% T8+ and 2% T4+.
_
The Fro 2.2 T cell line (T3 , T4+, T8+, T11+) was de-
rived from .an adult patient with undifferentiated acute
leukemia. ;Jurkatt is T3 , T4+, T8+, T11 , RPMI 8402 is
T3 , T4 , T'8 , T11+. OT-CLL is a chronic lymphocytic
leukemia which is T3+, T4+, T8 , and T11+ (22j. The
T4+ cell lines CEM and Molt 4 were obtained from the
American Type Culture Collection. All leukemic T cell
lines were continuously grown in RPMI 1640 medium con
taining 5% :fetal calf serum. Transformed B cell lines
C8, CP58 an<i CP94 were derived as previously described
(23) .
Affinity-purified rabbit anti-mouse IgG was conjugated
to human erythrocytes by the chromium chloride method
(24) .
' -35-
Cotransformation of L Cells and NIH 3T3 Cells
Murine L tk aprt- cells were maintained in Dulbecco's
modified Eagle's medium (DME) supplemented with 10%
calf serum (Gibco) and 50 micrograms/ml diaminopurine
(DAP). L cells were plated out at a density of 5 x 104
cells per 10 cm dish, 1 day before transformation.
Calcium phasphate precipitates were prepared by the
method of Graham and van der Eb (25), as modified by
Wigler et al. (26), using 100 ng of pTK and 20 micro-
grams of hj.gh molecular weight T cell or L cell DNA
pez dish. The L cells were placed under selection in
DME with 10% calf serum, 15 micrograms/ml hypoxanthine,
1 microgram/ml aminopterin and 5 micrograms/ml thy-
~5 midine (HAT medium (27)) on the following day. After
12-14 days of HAT selection, tk+ transformants were
screened using the rosetting assay.
Murine NIH 3T3 cells were maintained in DME supplement-
20 ed with 10% newborn calf serum (Gibco) . NIH 3T3 cells
were plated out at a density of 5 x 104 cells per 10 cm
dish, 2 days before transformation. A calcium phos-
phate p;ecipitate was applied to the cells using 10
micrograms of carrier DNA and either 10 micrograms of
25 T4-pMV6tk/neo or 10 micrograms of T4-pVcos7 and 500 ng
of pSV2neo. After 2 days, the cells were placed under
selection in DME with 10% calf serum and 500 micro-
grams/ml 6418 (Geneticin°; Gibco). Rosetting assays
were performed on surviving colonies one week after
30 gr°~"~h in selective medium.
RosettinQ Asst
After one rinse with phosphate-buffered saline (PBS),
35 the plates were incubated with 2.5 ml of tha purified
J.
-36-
monoclonal antibody OKT'4A (1 mg/ml) diluted at 1/500
in PBS containing 5% fetal calf serum for 45 minutes at
room temperature. Free antibody was removed from the
plates with three gentle rinses in PBS. Six millili-
tens of human erythrocytes conjugated with purified
rabbit anti-mouse IgG antibody (2% v/v stock suspen-
sion, diluted 1,/10 in PBS/5% fetal calf serum) were
added and the plates were left at room temperature.
After 45 minutes, free erythrocytes were gently aspi-
rated and PBS was added prior to inspection for ro-
sette-positive colonies.
Cytofluorometric Analysis
~5 Adherent cells ware removed with 0.005 M EDTA in PBS
and washed once with PHS containing 1% bovine serum
albumin (BSA) and 0.01% sodium azide (cytowash). Cells
(5 x 106) i.n 0.1 ml were added to tubes with appropri-
ate dilutions of OKT~4, OKTs8 or control antibodies.
20 The cell-antibody mixture was incubated for 45 minutes
at 4'C and then washed twice in cytowash. Fluorescein
isothiocyanate (FITC)- conjugated goat anti-mouse IgGJ+
A + M (Cappel) was added to the cells and incubated for
1 hour at 4'C. The cells were then washed three times
in cytowash and resuspended in 0.5 ml of PBS with 0.01%
sodium azid,e. The cells were analyzed on a Becton
Dickinson F~ACS IV Cell Sorter and the data was stored
and plotted using a VAX 11/780 computer (Digital Equip-
ment Co.)
35
13~~'~02
-37-
RNA and DNA Isolation
Total RNA was isolated from cells by homogenation in 4
M guanidinium thiocyanate, followed by ultracentri-
fugation through a 5.7 M CsCl cushion (28). Poly(A)+
selection was achieved by oligo(dT)-cellulose chroma-
tography (Type 3, Collaborative Research) (29). High
molecular weight genomic DNA was prepared as described
by Wigler et al. (26).
cDNA and Genomic Libraries
Double-stranded cDNA was synthesized from poly(A)+ RNA
derived from peripheral human T cells (20). After
treatment with EcoRI methylase and T4 DNA polymerise,
the double-stranded cDNA was cloned into the EcoRI site
of agtl0 (30) using EcoRI linkers. The Charon 4 human
genomic library was generously provided by Dr. Tom
Maniatis (Harvard University) (31).
Synthesis o:f a Subtracted cDNA Probe
32p-labeled cDNA was synthesized from poly(A)~ RNA
derived from the primary transformant, LTD-4, as de-
scribed by Davis et al. (32). After annealing the cDNA
to an excess of untransformed L cell poly(A)+ RNA (Rot
= 3000), single-stranded sequences, which were enriched
for human cDNAs, were isolated by hydroxyapatite chro
matography (32). Prior to filter hybridization, the
subtracted c:DNA probe was concentrated with sec-butanol
and desalted on a G-50 Sephadex column equilibrated in
TE.
-3$_ ~.~40'~02
Screening of cDNA and Genomic Libraries
The peripheral human T cell library was plated on _E.
cola C600/HFL and the human genomic library was plated
on E. cola LE392. Screening of duplicate filters was
carried out: according to the standard procedure (33),
with the hybridization performed in 50% formamide and
5x SSC at 42'C. In the screen of the cDNA library, 6 x
104 cpm of subtracted probe was applied per 137 mm
nitrocellulose filter. Filters from the genomic li
brary were hybridized to a nick-translated (34) cDNA
insert. The washes were performed at 68'C, with a
final wash in 0.2 x SSC. Autoradiography was performed
at -70'C in the presence of intensifying screens for 1-
2 days.
DNA Sequencing
Restriction fragments of pT4B were subcloned into the
M13 vectors mpl8 and mpl9 (35). Sequencing reactions
were performed using the dideoxy chain termination
technique (:36). The sequencing strategy is depicted
in Figure 3H..
Southern and Northern Hlot Hybridizations
High molecular weight cellular DNAs were digested with
5 units of restriction nuclease per microgram of DNA
according to the manufacturer's recommendation (Hoeh-
ringer Mannheim). Samples (10 micrograms) were sub-
jected to electrophoresis on a 0.8% agarose gel. DNA
fragments were transferred to GeneScreen (New England
Nuclear: (37)) and hybridized as described by Church
and Gilbert i;38).
-- I~~O'~~2
-39-
RNA was run on a 0.8% agarose-formaldehyde gel (39) and
transferred to GeneScreen. Northern hybridization was
performed according to the procedures supplied by the
manufacturer. Hoth Southern and Northern blots were
hybridized. to nick-translated probes.
Synthesis and In Vitro Translation of SP6 RNA
The kb T4 cDNA was subcloned into the EcoRI site of
pSP65 (Promega Biotec) and linearized with HindIII.
Transcription of linearized plasmid DNA (1 microgram)
with SP6 polymerise in the absence of radiolabeled
nucleotides was perfonaed as described (40), except
that GpppG and unlabeled CTP were added to the tran-
~5 scription buffer. One-tenth of the reaction mixture
was translated in a wheat germ system (Bethesda Re-
search Laboratories) containing L-[32S]-methionine
(Amersham) and 1 micromolar S-adenosylmethionine. The
in vitro translation products were subjected to SDS-
20 Polyacrylamide electrophoresis under reducing condi-
tions as described below.
Cell Labeling, Lectin ChromatoQrachy and Immunopre
cioitation
fills were grown for 12 hours in methionine-free DME
medium containing 10% dialyzed calf serum and 1 mCi of
L-[32S]-methionine (Amersham) as previously described
(41). The cells were solubilized in 10 mM Tris (pH
W 4)~ 150 mM NaCI (TBS) containing 0.5% Nonidet P-40
(Shell) and 0.2 mM phenylmethylsulfonyl fluoride (Sig-
ma). The lysates were centrifuged for 1 hour at
100,000 x ~~, and the supernatants were subjected to
lentil lectin chromatography (Pharmacia) according to
the procedures of Hedo et al. (42) . Eluates were pre-
~. ~ 1340'02
-40-
absorbed once with a mixture of control mouse ascites
and protein A-Sepharose (Pharmacia) for 1 hour at 4'C
and twice with protein A-Sepharose alone for 1 hour at
4'C. Of each supernatant, 2.5 x 104 cpm were then
mixed with 10 microliters monoclonal antibody (approxi
mately 1 mg/ml) and protein A-Sepharose and incubated
on a turntable overnight at 4' C. The beads were then
washed four times with cold TBS containing 0.5~ NP-40
and 0.2t SDS and were resuspended in electrophoresis
sample butler.
Gal Electrochoresis
SDS-polyacrylamide gel electrophoresis was performed
~5 according to the procedure of Laemmli (43). The im-
munoprecipatates and in vitro translation products
were dissolved in sample buffer with or without 2-mer-
captoethanol and then were applied to 10~ poly-acryl-
amide gala.. Autoradiography was performed on Kodak
XAR-5* film in the presence of intensifying screens
(DuPont Chemical Company).
Costranaformation and Rosettina Assav
25 Mouse ~6-2 cells (44) were maintained in Dulbecco~s
modilied Eagle's medium (DME) supplemented with 10~
calf serum (CS) (Gibco) . ~b-2 cells were plated out at
a density of 5 x 105 cells per 10 cm dish, 2 days be-
fore trans:~ormation. Calcium phosphate precipitates
were prepared by the method of Graham and van der Eb
(25) , as modified by Wigler et al. (27) . Precipitates
were applied to the cells using to micrograms of carri-
er DNA and either 10 micrograms of T4-pMV7 or 10 micro-
grams o! T8-pMV7. After 2 days, the cells were placed
35 under selection in DME/10~ CS and 500 micrograma/ml
* Trademark
-41-
6418 (Genet:icin~: Gibco).
Rosetting assays to identify T4+ or T8+ colonies were
performed on surviving colonies 1 week after growth in
selective medium. After one rinse with phosphate-buff
eyed saline (PBS), the plates were incubated with 2.5
ml of the purified monoclonal antibody OICT~4A or OKTeg
(img/ml; Ori:ho) diluted at 1/500 in PHS containing 5%
fetal calf serum (FCS) for 45 minutes at room tempera
ture. Free antibody was removed from the plates with
three gentle. rinses in PBS. 6 ml of human erythrocytes
conjugated with purified rabbit anti-mouse IgG antibody
(2% v/v stock suspension, diluted 1/10 in PBS/5% FCS)
were added and the plates were left at room tempera-
ture. After 45 minutes, free erythrocytes were gently
aspirated and PBS was added prior to inspection. T4+
and T8+ ,~-2 clones were purified by colony isolation
and characterized by flow cytometry and Northern blot
analysis.
Recombinant Retrovirus Production and Infection
T4+ and T8+ ,~-2 clones were isolated which produce
recombinant retrovirus stocks with titers of 105 cfu/
ml. Viral stocks were prepared by adding 10 ml of
fresh DME/10% CS to a near confluent monolayer of the
T4.+ or T8+ ~~-2 clones. After 24 hours, the medium was
removed and filtered through a 0.45 micrometer filter
(Millipore). For infection, 5 x 105 cells were incu-
bated with 2 ml of viral supernatant (or a dilution) in
the presence of 8 micrograms/ml polybrene (Aldrich).
After 3 hours, 8 ml of fresh medium was added. 3 days
after infection the cells were reseeded into DME/10% CS
containing 500 micrograms/ml 6418, grown for 2 weeks,
scored for G4~18r colonies, and screened for surface T4
134~'~t72
-42-
or T8 expression using the in situ rosetting procedure
or flow cytometry.
~b-2 culture supernatants were used to infect mouse ~-AM
cells as described above. T4+ or T8+ adherent trans-
formants were purified by the in situ rosetting assay
followed by colony isolation; T4+ or T8+ non-adherent
transforma:nts were purified by fluorescence-activated
cell sorting (FRCS). Non-adherent human lymphoid cell
lines (HS82, RPI~I-T cells; Raji - B cells) and adherent
epithelial cells (HeLa) were infected by co-cultivation
with T4+ or T8+ ,~-AM clones (pretreated with 10 micro-
grams/ml m.itomycin-C for 2 hours; Sigma) and were puri-
fied.
Cell lines were selected for 6418 resistance at a con-
centration of 1.5 mg/ml, except for HeLa cells which
require 1 mg/ml, and fibroblasts which require 0.5
mg/ml. All cell cultures producing recombinant ampho-
trophic viruses (4-AM) were maintained under P3 con-
tainment conditions.
AIDS Virus
The prototype LAV strain of HTLV-III/LAV was obtained
from J.-C. Cherman (Institut Pastuer, Paris; (45)).
Virus inocula used in these studies were from the sec-
ond to fifth passages of virus in our laboratory.
Inocula are cu7.ture supernatants from HTLV-III/LAV-
infected, phytohemagglutinin (PHA)-stimulated peripher
al lymphocytes which were harvested by sequential cen
trifugatior~ (300 x g for 7 minutes followed by 1500 x g
for 20 minutes), and were stored in liquid nitrogen.
For binding studies, virus was concentrated from cul
ture supernatants, harvested as above, by ultracentri
-43-
fugation at 90,000 x g for 90 minutes over a 15% cush-
ion of Renagraffin (E.R. Squibb) in 0.01 M Tris, 0.15 M
NaCl, 1 mM EDTA, pH 8Ø
Anti-HTLV-III/LAV Reagents
Serum with high levels of antibody to HTLV-III/LAV was
obtained from a hamosexual man with chronic lymphadeno-
pathy, and its specificity by immunofluorescence (46),
Western blot analysis (47), and radioimmunoprecipi-
tation (48) has been described. Portions of the IgG
fraction were coupled with fluorescein isothiocyanate
(FITC; FIZ'C:protein ratio of 10.7 micrograms/ml),
horseradish peroxidase (HPO; type VI: Sigma) and aga-
rose as described (47, 49, 50, 51) . Conjugates of IgG
from a nonimmune serum were prepared in parallel.
Reverse Transcriptase Assay
20 Magnesium-dependent, particulate reverse transcriptase
(RT) activity was measured with a template primer of
(A)n(dT)12-1.8 (or (dA)n(dT)12-18 as the negative con-
trol) in the: presence of 7.5 mM Mg2+ (52).
25 Immunofluorescence Detection of C to lasmic AIDS Virus
Cultured ce:Lls (1 x 105 in 0.1 ml) were centrifuged
onto glass slides (Shandon Cytocentrifuge), fixed in
95% ethanol and 5% acetic acid at -20'C for 30 minutes,
and rehydra~ted with three 10 minute changes of PBS
(0.01 M P04, 0.15 M NaCl, pH 8.0). Slides were exposed
to a 1/500 dilution of FITC-anti-HTLV-III/LAV (19 mi
crograms/ml) for :30 minutes at room temperature. The
slides were then washed (three changes, 10 minutes
each) and mounted under a coverslip with 50% glycerol
......
-44-
in PBS. T'he slides were examined with an epi-illumi-
nated LeitZ; Orthoplan microscope at 630 x power. Under
these conditions, the FITC-anti-HTLV-III/LAV reagent is
specific for HTLV-III/LAV. Uninfected PHA-stimulated
cells, Epsi:ein Barr (EB) virus-infected B cell lines,
an adenovir~us-infected cell line, several T cell lines,
and HTLV-I and HTLV-II infected cell lines were not
stained.
AIDS Virus Immunoassay (Antigen Capture Assay)
This is a sandwich immunoassay that has been described
in detail (47). Briefly, culture supernatant is added
to microtiter plate wells coated with anti-HTLV-III/LAV
~5 IgG. After the plates are washed, bound virus antigen
is detectedt with HPO-anti-HTLV-III/LAV. This assay,
which is at least as sensitive as the RT assay, is
negative with culture supernatants from PHA-stimulated
lymphocytes from numerous donors, EB virus-infected B
20 cell lines, several T cell lines, polyclonal and cloned
IL-2 dependent T cell lines, the myeloid line K562, as
well as cell lines that harbor HTLV-I or HTLV-II. The
cutoff OD49~~ for discriminating a positive from a nega-
tive supernatant was determined in each run from the
25 mean plus 2 SD of at least 10 replicative determina-
tions on control (uninfected cell culture) supernatants
harvested at: the same time.
AIDS Virus Infectivity (ID-50) Assay
The microcul.ture assay for the titration of infectious
HTLV-III/LAV' has been described in detail (47). Brief-
ly, PHA-stimulated lymphocytes or cell lines (2 x 106
cells/ml) are inoculated with serial 10-fold dilutions
of virus inoculum and incubated for 18 hours at 37'C.
-45- 1~~~J~~2
Tha cells were then washed and plated in microculture
(10 to 20 cultures per dilution: 1 x 105 CBIIS rlor
culture in 0.25 ml medium). Every 4 days, 100 microli-
ters of supernatant was removed and replaced with fresh
medium. Supernatants were then assayed for viral anti-
gen by the antigen capture assay as described above.
Infectious virus titer (ID-50) is defined as the recip-
rocal of tlhe dilution at which 50~ of the cultures are
positive for virus (47).
VSV Pseudotype Assay
Vesicular stomatitis virus (VSV, Indiana strain, wild
type) was propagated in cells producing the retrovirus
~5 required for the envelope pseudotype as described (53).
Hyperimmune neutralizing sheep anti-VSV serum was added
to the harvested VSV to inactivate non-pseudotype
virions. The pseudotype titers ranged between 104 and
105 PFU/ml. For the assay, 2 x 105 cells to be infect-
ed with VSV pseudotypes were plated in 30 mm diameter
tissue culture wells. HeLa, NIH 3T3, and L cells were
naturally adherent: all other cells types were attached
by pretreatment of the substratum with 50 micrograms/ml
poly-L-lysine. After virus adsorption for 1 hour, the
cells were washed and 106 mink CCL64 or bovine MDBK
calls were added to each well. These cells provide
excellent plaques for secondary VSV infection but are
resistant to infection by pseudotype virions. After
allowing the plaque indicator cells to settle and
spread (app.roximately 90 minutes), the monolayers were
overlaid with agar medium. VSV plaques were counted 2
days after infection. Anti-T4A monoclonal antibody
(1:20), ani_i-HTLV-III serum (1:10), or anti-HTLV-I
serum (1:10) were used to inhibit pseudotype plaque
formation by pretreatment of cells 30 minutes before
-46-
addition of pseudotypes as described by (54).
Syncytium Induction Assay
2 x 105 cells were co-cultivated with 2 x 104 H9 cells
infected by and producing HTLV-III (55) in 10 mm diame
ter wells" The cultures were incubated at 37~C and
examined for syncytia formation after 18 hours as pre
viously described (54, 56). Cells were five or more
syncytia were scored as positive. Syncytium inhibition
was assayed by adding anti-T4A monoclonal antibody
(1:20) to the mixed cultures at the time of seeding.
~tofluorometric Analysis and AIDS Virus Binding
The method has been described in detail (46). Briefly,
cell surfa<:e T4 or T8 expression was detected by direct
immunofluorescence with fluorescein-conjugated anti-T4A
or anti-T8 monoclonal antibodies (OKTs4A, OK'i'~8). The
diluent/was.h buffer was 0.01 M P04, 0.15 M NaCl, pH
7.4, conta:Lning 0.1% bovine serum albumin, 2% v/v AB+
human serum, and 0.01% NaN3. All reagents were pre
titered for optimal (saturating) binding. Cells (5 x
105) were incubated in a 25 microliter dilution of
monoclonal antibody for 30 minutes at 4'C. The cells
were washed; by centrifugation (300 x g for 7 minutes) ,
resuspended in 0.5 ml of 1% paraformaldehyde in saline,
and analyzed with a fluorescence-activated cell sprter
(FRCS IV, Hecton Dickinson). For HTLV-III/LAV binding,
5 x 105 cells were incubated with HTLV-III/LAV (500 ng
in 10 microliters) for 30 minutes at 37'C. Washed
cells were resuspended in 25 microliters of fluoresce
in-conjugated anti-HTLV-III/LAV for 30 minutes at 4'C.
The cells were washed, resuspended in 1% paraformal
dehyde, and analyzed by FACS as above. For inhibition
-47-
of HTLV-II:C/LAV binding, cells were preincubated with
anti-T4A o:r anti-T8 (20 ng in 20 microliters) for 30
minutes at 4'C followed by addition of HTLV-III/LAV
(500 ng in 10 microliters) for 30 minutes at 37'C. The
cells were washed incubated with fluorescein-conjugated
anti-HTLV-III/LAV, washed, resuspended in paraform-
aldehyde, and analyzed by FACS as above.
Cell Surface Radioiodination, Immunooreci itation, and
Gal Electrophoresis
T4+ NIH 3T:~ transformants were surface radioiodinated
by the lactoperoxidase technique (18) as follows: 4 x
107 cells were suspended in 1 ml of PBS containing 0.5
mM EIYrA, 2 mCi Na125I, and 20 micrograms lactoperoxi-
dase. At times 0, 1, 5, 10, and 15 minutes, 10 micro-
liters of 0.03% H202 were added. The reaction was
carried out at 23°C and was stopped at 20 minutes by f
centrifugati.ons in 50 volumes of cold PBS containing 10
20 ~ NaI. Labeled cells were split into 4 tubes and
incubated, .as indicated, with HTLV-III/LAV (2 micro-
grams in 20 microliters) for 30 minutes at 37'C. Sub-
sequent washes and manipulations were performed at 0'
to 4'C. Washed cells were lysed by adding 1 ml of
25 detergent lysing buffer (LB; 0.02 M Tris, 0.12 M NaCl,
pH 8.0, containing 0.2 mM phenylethlsulfonylfluoride, 5
micrograms/ml aprotinin, 0.2 mM EGTA, 0.2 mM NaF, 0.2%
sodium deoxycholate, and 0.5% (v/v) Nonidet P-40).
Tubes were held on ice for 15 minutes, and nuclei were
30 removed by centifugation at 3000 x g for 20 minutes.
For absorpti.ons, Sepharose conjugates of human anti-
HTLV-III/LAV IgG, human nonimmune IgG, anti-T4A, and
anti-TS antibodies were prepared as described (48).
35 LYsates were preabsorbed with 200 microliters of Sepha-
.
-48-
rose-nonimmuna human IgG for 1.5 hours with rotation,
and then immunoprecipitated with 20 microliters of
Sepharosa conjugates (as indicated) for 3 hours with
rotation. Sepharose absorbents were washed 3 times:
once with L8: once with LB containing 0.5 M NaCl; and
once with LB captaining 0.1% sodium dodecyl sulfate
(SDS). Absorbed material was eluted at 65'C for 30
minutes with 20 microliters of sample buffer (0.01 M
Tris, pH 8.,0, containing 2% SDS, 5% 2-mercapto-ethanol
(v/v), 25 micrograms bromphenol blue, and 10% glycerol
(v/v). E:lectrophoresis was performed in a 3.3-20%
gradient p~olyacrylamide gel with a 3% stacking gel
(57), and autoradiographs were developed with Kodak
XAR-5 film.
Virus Inhibition Assay
2 x 105 T4+~ JM T cells were exposed to AIDS virus at 0
minutes. The inhibitors ammonium chloride (20 mM) or
amantadine (20 mM) were added at various times during
the course of virus infection (0 minutes, 30 minutes,
and 60 minutes). After 6 hours, cells were washed and
replated in fresh medium (RPMI/10%FCS). The effect of
these agents on AIDS virus infection was determined 5
days post infection. The fraction of infected cells in
the cultures expressing viral antigens was determined
by immunof7.uorescence microscopy as described above
(58) .
RNA Isolation and Northern Blot Hybridizations
Total RNA was isolated from cells by homogenation in 4M
guanidinium thiocyanate, followed by ultracentrifu
gation through a 5.7 M CsCl cushion (28). Poly(A)+
selection w,as achieved by oligo(dT)-cellulose chroma
-49-
tography (Type 3, Collaborative Research) (29).
RNA was electrophoresed through a 1% agarose-formald-
hyde gel (39) and transferred onto Hybond (Amersham).
Northern blot hybridization was performed according to
the procedures supplied by the manufacturer. Probes
were nick-translated to a specific activity of 0.5-1 x
109 cpm/microgram with a32P-labeled deoxynucleotide
triphosphavtes (59).
15
25
35
r--
-50-
RESULTS
Isolation of a T4 cDNA
The strategy used to isolate a T4 cDNA initially in-
volved constructing L cell transformants that express
T4 on their- surface. cDNA synthesized from the mRNA of
a T4+ transformed. fibroblast was enriched by substrac-
tive hybridization and used as a probe to isolate a
cDNA encoding T4 from a cDNA library made from the mRNA
of peripheral T lymphocytes. The identity of T4+ cDNA
clones was determined by Northern and Southern blot
analyses, and ultimately by the ability of these clones
to transfer the T4+ phenotype to recipient cells.
~5 Similar te~~hniques have previously been employed to
isolate the gene encoding the T8 protein (20).
Mouse L cells deficient in thymidine kinase (tk) were
cotransformed with genomic DNA from the T cell leuke-
20 mic cell line I~IUUT-102 along with the tk-containing
plasmid, pTK (25, 26). tk+ L cell transformants ex-
pressing T cell surface proteins were identified by an
in situ rosetting assay. tk+ colonies were exposed to
mouse monoclonal antibodies directed against T4 and
were then incubated with red blood cells coupled with
rabbit anti-mouse immunoglobulin. T4+ transformants
ara visibly red by virtue of their specific associa
tion with red blood cells. In this manner, one primary
T4+ transformant, LTD-4, was obtained: The expression
of the T4 molecule by this clone was independently
verified by cytofluorometric analysis (Figure 1).
The mRNA papulatian of the T4+ transformant, LTD-4,
should differ from that of an untransformed L cell only
in the expression. of newly transformed genes. These
~ ~-~ ~M~~2
-51-
sequences were enriched for by annealing highly radio-
active cDN~A prepared from poly(A)+ RNA of the T4+
transformant with a vast excess of RNA from an untrans-
formed L cell (32, 60). cDNA incapable of hybridiz-
ing, even at high Rot values, was isolated by hydroxy-
apatite chromatography and used to screen a human pe-
ripheral T cell cDNA library constructed in the lambda
cloning vector gtl0. Four weakly hybridizing plaques
were identified, plaque-purified and analyzed for the
presence of T4 sequences.
To determine whether any of these clones encoded T4,
Northern blot analyses were initially performed with
RNA from TS4+ and T4 peripheral T cells, leukemias,
~5 thymocytes, L cell transformants and nonlymphoid cells
(Figure 2). One of the four clones hybridized to an
RNA present only in T4+ cells. This clone detects a 3
kb RNA present in the T4+ transformant, LTD-4, which is
also present: in a population of T4+ peripheral lympho-
20 cytes, a variety of T4+ leukemic cell lines, and thymo-
cytes. No hybridization was observed with RNA from
untransformed fibroblasts, T4 peripheral lymphocytes,
HeLa cells, or human neuroblastoma cells.
Tha pattern of expression of RNA detected by this clone
is consistent with the possibility that it encodes T4.
However, this cDNA, is only 0.6 kb in length but hybrid
izes to a 3 kb mRNA. Therefore, the human peripheral T
cell cDNA library was rescreened and one clone (pT4B)
was obtained which contained a 3 kb insert, close in
size to that of the mature messenger RNA. Restriction
maps of this clone are shown in Figures 3A and 3B.
-52-
Genomic Blot Analysis
Southern blot experiments (37) were next performed to
demonstrate that the isolated cDNA clone hybridized
with DNA from the T4+ transformant as well as human
DNA, but not with untransformed mouse L cell DNA (Fig-
ure 4). Genomic DNA from a variety of human cells
reveals a set of five hybridizing fragments after
cleavage with the enzyme BamHI. As expected, T4 se-
quences can be detected in the transformant LTD-4, but
not in unt:ransfarmed L cell DNA. The BamHI fragment
closest to the 3' end of the gene (6.6 kb) is not
present in LTD-~, presumably as a consequence of the
integration event. Moreover, no gross rearrangements
~5 are apparent at this coarse level of analysis when
comparing L~NA from lymphoid and nonlymphoid cells. The
sum of the moleaular_weights of the hybridizing frag
ments is 33 kb, suggesting that the T4 gene is quite
large. A complete set of genomic clones spanning this
region was obtained (see below) and the BamHI fragments
were ordered by restriction analysis of these clones
(Figure 3A), confirming that the gene is large and must
contain introns of significant lengths.
Expression of the T4 cDNA in Transformed Mouse Fibro-
blasts
Further evidence that the isolated cDNA encodes T4
would be provided if this clone could convert fibro
blasts to t;he T4~ phenotype after transformation. The
T4 gene in chromosomal DNA is large and spans several
genomic clones. Therefore, the cDNA clone was intro
duced into two retroviral expression vectors, pVcos7
and pMV6kt/neo, which contain the Moloney murine leuke
mia virus long terminal repeats (LTRs) flanking a sin
-53-
gle EcoRI cloning site (Figure 3C). The 5'-LTR pro-
motes transcription through the cloning site and the
3'-LTR contains sequences necessary for cleavage and
polyadenylation. The vector pMV6tk/neo also contains
the tk promoter fused to the coding region of the neo-
mycin phosphotransferase gene. The construct employing
pVcos7 requires transformation with an unlinked selec-
table marker, whereas pMV6tk/neo carries the neomycin
resistance marker, which permits linked cotransformat-
ion. Neo+ colonies of NIH 3T3 cells obtained after
transformation were selected by their ability to grow
in media containing the neomycin analogue 6418, and
were screened using the rosetting procedure to detect
the expression of T4 on the cell surface. Approximate
ly 50% of the 6418 colonies obtained with pVcos7 and
75% of the colonies obtained with pMV6tk/neo were posi-
tive for T4 in this assay. Rosette-positive colonies
were further analyzed by cytofluorometry to confirm
that T4 is. expressed on the transformed cell surface
(Figure 1).
Metabolic protein labeling experiments were performed
which demonstrate that the T4+ transformed fibroblast
and the T :lymphocyte express a T4 protein of identical
molecular weight. Untransformed NIH 3T3 cells, T4+
transformants and T lymphocytes were labeled for 12
hours in the presence of L-[35S]-methionine (41). The
cells were detergent solubilized and the lysate was
passed over lentil lectin columns to enrich for
glycoproteins (42). The bound glycoprotein fraction
was eluted and immunoprecipitated with monoclonal anti
bodies directed against T4 (Figure 5). Under reducing
conditions, a glycoprotein migrating at a relative
molecular mass of 55 kd is detected in extracts from T
lymphocytes and two independent T4+ transfonaants.
l~~~v~~
-54-
This protein is not detected in control 3T3 fibro-
blasts. Under nonreducing conditions, a 51 kd glyco-
protein is immunoprecipitated with anti-T4 in T cells
and in the transformed fibroblasts.
These experiments demonstrate that the transformants
express a 55 kd glycoprotein immunoprecipitated with
anti-T4 which is identical in size to that expressed on
the surfaces of T lymphocytes. Thus, Northern and
Southern analyses using the isolated cDNA, taken to-
gether with the ability of this cDNA to confer the T4+
phenotype to mouse fibroblasts, indicate that the en-
tire coding sequence of the T cell surface protein T4
had been cloned.
Nucleotide Secruence of the T4 cDNA and the Deduced
Protein Sequence
The complete nucleotide sequence of the T4 coding re-
gion was determined by sequencing both strands of the 3
kb cDNA insert using the dideoxy termination method
(35, 36). The complete nucleotide sequence and the
predicted protein sequence are shown in Figure 6. The
longest open reading frame begins at position 76 with a
methionine c;odon surrounded by the initiation consen-
sus sequence PurNNATGPur (61). This reading frame
extends 13744 nucleotides, encoding a polypeptide con-
taining 458 amino acids. The contiguity of this read-
ing frame was confirmed by inserting this cDNA into the
~A expression vector pSP6 (40). RNA synthesized from
this vector,, when translated in vitro, directs the
synthesis of an unmodified 51 kd protein, the precise
molecular weight predicted from the nucleotide sequence
(Figure 7).
-55-
T4 is comprised of a leader sequence, four tandem vari-
able-joining (VJ)-like regions, and a membrane-spanning
domain each sharing homology with corresponding re-
gions of different members of the immunoglobulin gene
family (62, 63) (Figures 6 and 8). A stretch of hydro-
phobic residues, corresponding to a leader peptide
predicted by a Kyte-Dolittle (64) hydropathicity plot,
immediately follows the initiation codon. Although the
exact position at which the native T4 protein is pro-
cessed cannot be determined, it is contemplated that
cleavage occurs just after the threonine at positions -
1 based on known cleavage patterns (65). Therefore,
the signal. peptide contains 23 amino acids and the
processed 't4 protein consists of 435 residues.
Residues 1-94 of the mature protein share both amino
acid and ;structural homology with the immunoglobulin
light chain variable domain (Figure 9A). The overall
homology o~f this domain with immunoglobulin variable
regions is. 32%. Sequence comparison between the V
regions of light chain immunoglobulins and the N-ter
minal V-like region (V1) of T4 demonstrates that eight
out of 14 invariant residues are conserved (66). This
domain contains two cysteine residues, separated by 67
amino acids, whose positions and spacing are analogous
to that found in light chain immunoglobulins and relat
ed molecules (67). These cysteines may be capable of
forming the conserved intrastrand disulphide bond
characteristic of V domains. This suggestion is sup
ported by our observation that T4 migrates more rapidly
under nonreducing conditions than under reducing condi-
tions, con:aistent with the formation of at least one
intrastrand. linkage (Figure 5, lanes a and f).
1~~:~'~~~
-56-
Aside from homologies at the level of individual amino
acids, the V1 domain of T4 shares structural features
with immu:noglobulin variable regions. Immunoglobulin
variable and constant domains fold in a characteristic
pattern in which a series of antiparallel ~-strands
fold to form two ~9-sheets (67, 68). These ~-sheets
are held together both by a disulphide bridge and by
characteristic hydrophobic interactions. To determine
how the predicted secondary structure of the V-like
0 domain of T4 compares with the structure of the V do-
mains of light chain immunoglobulins, two-dimensional
structural alignments were performed. Also, a plot of
probable ~9-strands and ,B-turns in these sequences
using the empirically derived algorithm of Chou and
~5 Fasman (69~) was obtained. These analyses suggest the
presence of seven ~-strands within the V-like domain
of T4 which closely match those found in the immuno-
globulin V' domain (Figure 9A). The two conserved cys-
teines of T4 are found within ~-strands B and F,
matching exactly the positions of the cysteines in the
V region known to form the conserved disulphide bond in
immunoglobulin. A tryptophan residue lies 12 amino
acids downstream of the first cysteine and a tyrosine
residue is. situated two amino acids before the second
25 cysteine. These residues are highly characteristic
o! ~9-strands C and F, respectively in light chain V
regions. In addition, an aspartate residue is found
six amino acids before the second cysteine, and an
arginine residue lies at the base of p-strand D. These
charged residues are highly characteristic of V domains
(67). Finally, patches of alternating hydrophobic
residues a,re present throughout the ~-strands, which
strengthen the interaction of the two ~B-sheets.
1~ ~:~°~~~
-57-
Tha V1 domain of T4 is followed by a stretch of amino
acid residues bearing significant homology to the join-
ing (J)regi.ons of immunoglobulins and T cell antigen
receptors. In Figure 9B, this J-like region of T4 is
aligned with the consensus joining sequences of immuno-
globulin light chains and the two chains of the T cell
antigen receptor. This J-like region is followed by a
265 amino acid stretch which may be structurally divid-
ed into thrcae additional VJ-like domains with statisti-
cally significant sequence and structural homology to
prototype immunoglobulin VJ regions (Figures 6 and 8).
Additionally, this sequence contains two potential N-
linked glycosylation sites (Asn-Leu-Thr: Figure 6).
~5 The extracellular domain is followed by a putative
transmembrane sequence, predicted by a hydropathicity
plot (64), which contains only hydrophobic and neutral
amino acid ~~esidues. This segment bears striking ho-
mology to t:he transmembrane exon of the ~9-chains of
20 class II major histocompatibility proteins (Figure 9C).
Alignment of the transmembrane regions of T4 and I~IC
class II p-chains reveals 48% homology without gaps.
Following the membrane-spanning segment, a highly
charged sequence of 40 amino acids comprise the cyto-
25 plasmic doma:Ln (Figures 6 and 8).
Tha T4 Gene: Chromosomal Location and Intron-Exon
Positions
The T4 cDNA was used to determine the chromosomal loca-
tion of the T4 gene by analyzing its segregation pat
tern in a panel of mouse-human somatic cell hybrids and
by in situ h~rbridization to human metaphase chromosomes
(lol). Genomic blot experiments and in situ hybridiza
tion indicate that the T4 gene resides on the short arm
-58-
of human chromosome 12, between regions 12p12 and
l2pter.
A set of overlapping genomic clones spanning the T4
gene was obtained by screening human genomic libraries
constructed in the lambda cloning vectors Charon 4 and
EMLB-3 (31) with a radiolabeled pT4B cDNA insert (70).
Characterization. of these clones by both restriction
and Southearn blot analyses indicated that they con-
twined the entire T4 coding sequence. The complete
intron-exan organization of the T4r~gene was then deter-
mined by ;sequencing specific fragments of the genomic
clones us~lng the dideoxy termination procedure (35,
36) .
The T4 gene is comprised of 9 exons split by 8 introns
as shown in Figures 8 and 10. The first exon contains
the 5'-untoanslated region and the leader segment. The
first variable-like domain, V1, is split by a large
intron located at nucleotide position 289 (Figure 6).
Therefore, the V1J1 domain is encoded by the second and
third exon:: and 'the V2J2, V3J3, V4J4, and transmembrane
(TM) domains are each encoded by separate exons (axons
4-7). The cytoplasmic domain (CYT) is split by an
intron and the last portion of the cytoplasmic domain
and the 3'-~untranslated region are encoded by the ninth
axon.
The Construction of T4+ and T8+ Transformed Cells
The experimental approach used to study the role of T4
in AIDS virus infection initially involved the intro-
duction of the T~ gene into T4 cell lines incapable of
supporting viral infection. The transformed cells were
than tested. for susceptibility to AIDS virus, followed
.--.
-59-
by studies on the mechanism by which T4 mediates viral
infection.
A full length cDNA clone encoding the surface protein
T4 was subc:loned into the retroviral expression vector,
pMV7. The expression vector, pMV7 (Figure 11A), con-
tains two directly repeated Moloney murine sarcoma
virus long terminal repeats (LTRs) which flank a single
EcoRI cloning site. The 5'-LTR constitutively promotes
transcription through the cloning site, whereas the 3'-
LTR provides sequences necessary for cleavage and poly-
adenylation of the RNA. In addition, pMV7 contains the
herpesvirus thymidine kinase promoter (tk) fused to the
coding regj.on of the bacterial neomycin phosphotrans-
ferase genes (neo), a dominant selectable marker, per-
mitting linked cotransformation and infection.
T4-pMV7 was introduced into ~-2 and ~-AM cells,. NIH
3T3 cell lines containing defective ecotropic and am-
photropic proviruses, respectively (Figure 11B)
(44,59). Both cell lines are incapable of encapsidating
endogenous viral RNA but can provide all obligate traps
viral funct:fons. Stable transfection of these cell
lines with T4-pMV7 results in the production of recom-
25 binant retroviral stocks encoding T4 which are free of
helper viru:a. These pure viral stocks can then be used
to efficiently introduce T4 sequences into both mouse
and human cealls without the production of retrovirus by
the target cell.
Briefly, T4.-pMV7 DNA was introduced into ,~-2 cells
using the procedure of DNA-mediated gene transfer (Fig-
ure 11B) (2fi, 27). Neo+ positive colonies were select-
ed by their ability to grow in media containing the
neomycin analog 6418 (Geneticin~) and screened for the
-60-
expression of T4 on the cell surface using an in s-
rosetting assay (20, 70). Colonies of transfected ~6-2
cells expressing T4 were then identified which produce
recombinant retrovirus in titers of 105 cfu/ml.
T4+ ~-2 clones were then used to generate retroviruses
capable o:~ infecting mouse ,~-AM cells. T4 express-
ing ~-AM clones were isolated which yield recombinant
retroviral titers of 104 cfu/ml. T4+ human transfor-
mants were generated by co-cultivation of cells with
mitomycin-~~ treated or ~-AM clones (Figure 11B). T4+
transformants were subsequently analyzed by Northern
blot analysis and flow cytometry to confirm that T4 is
expressed .and is present on the cell surface. Control
cell lines expressing the surface protein T8 were con-
~5 structed in an analogous manner.
T4 is Essential for AIDS Virus Infection
To initially determine whether the presence of the T4
protein on the surface of a human lymphocyte is suffi-
cient to :render the cell susceptible to AIDS virus
infection, transformants of the primitive T cell leuke-
mic line, HSB2 (71), which expresses only the early T
lymphocyte proteins T1 and T11 on its surface, were
25 constructedl. HS82 expresses neither T4 nor T8, nor
does it express the T cell antigen receptor or the
associated complex of T3 proteins. Transformants of
HSB2 which express either the T4 or T8 proteins on the
cell surface were selected and used to determine the
susceptibility of these cell lines to AIDS virus infec
tion. Several different experimental approaches were
employed to assess AIDS virus infection, including
expression of reverse transcriptase (52), expression of
virus in t:he cytoplasm of the cell by immunofluores
cence microscopy (46), detection of viral antigens in
.... ~.3~~r1 ~?
-61-
the culture supernatant using an immunoassay (47), as
well as production of infectious virions by supernate
subculture with phytohemagglutinin (PHA)-stimulated
peripheral lymphocytes (46). Using these assays, evi-
deuce of AIDS virus infection of the HSB2 cell line was
not observed (Table I).
15
25
35
en~~~.. ~ Ci
- 62 -
. + I t + Q t + t t +
ctt
N y ~ ~ tp
~ ~ ..~ ~ > v
.., ~ ~r w to v
... ~ + 1 I + t t + I ~ + U C ~
C H n ~ W O y
H e~~ ip
C C
y t~.~ ..1 ~ v
> .~'~ y . ' 'C ..~, ~ 'C
1 O ~ + 1 1 + i t + t t + ~ ,O > > ~ ~.0~~
~ ~ 'O ~ O
O C ~ ~ v
vN O V
+ I I i0 U ~ v O
+ ~ t + I t + ~ ~ ~ ~ C
w ''
Cry '
CJ > ~~ ~ . G
Vj 'C 1~ v C Z
~' p v N to
~r ~.
1 t + ~ 1 + I I + 4 c~oc~ ~O ~ E
~ y ~sr CD
.~ W ~ NU ~ .~ G4
V 3 ~1 m .O
~ ~ a
y ~~ N ~.1 ~0
+ + t t + ~ t + ~o 'v .~ v o t
I t + ~ y v it 'C
a w o; ° c v ..:
44~J ~ v
~ °: w
. ~ ,.) ,~~ ~ O ie1 y C M .. 'p y Q'
wo .~ Q ~ ~ am ~n 3 '~ ~ C ~f
v ~ C ~ ~ ,gyp ~ ~ ~ . >) ro ~ '~
a p ,D ip G0 w O
~~r ~y ~ v Z 'O ~ O pp ~.
V7 voU Z R O y ~ +
..
.) ~ + 1 ~ ~ ~ > U
H t p" ~» ~ it ~'' O v
~yw
c~a~a~ '~.oC ~w > Hw
~.~-~~P~~2
-63-
In addition, it has been previously demonstrated that
extensive cell fusion occurs when uninfected human
cells bearing receptors for AIDS virus are co-cultivat-
ed with cells producing AIDS virus (54). In this as-
say, there is no induction of syncytia when HS82 cells
are mixed with AIDS virus-producing H9 cells (Table I),
although abundant syncytia are formed With HTLV-I and
HTLV-II producing cells (data not shown).
Finally, viral entry.~was tested for using pseudotypes
of vesicular stomatitis virus (VSV) bearing the enve-
lope glycoproteins of the AIDS virus (Table I) (53,
54). When cells infected with AIDS virus are super-
infected with VSV, a proportion of the progeny VSV
assemble sufficient AIDS virus envelope glycoprotein to
resist neutralization by hyperimmune anti-VSV serum.
The host range of these VSV (AIDS) pseudotype virions
is restrict~sd to cells expressing receptors specific to
the AIDS virus. Following penetration of the cell and
uncoating o:E the virion, the transcapsidated VSV genome
replicates ito produce non-pseudotype particles. During
the secondary infection, progeny VSV released from
infected cells penetrate and destroy neighboring indi-
cator cells resistant to VSV (AIDS) pseudotype infec-
tion (mink CCL64 or bovine MDBK cells), resulting in
the formation of VSV plaques which are then scored.
Thus, infeci:ion with VSV (AIDS) pseudotypes provides a
quantitiative cytopathic plaque assay for viral entry
(54). In this assay, no plaques over background were
observed when HSH2 cells were exposed to VSV (AIDS)
pseudotypes (Table I). In control experiments with
pseudotypes of VSV RNA encapsidated in an HTLV-I enve-
lope (VSV (HTLV-I)), numerous plaques were observed,
demonstrating that the HSH2 cell, which bears HTLV-I
1~~~'~~~
-64-
receptors, is capable of replicating VSV efficiently.
These observations demonstrate that the VSV genome
encapsidated in an AIDS virus envelope is incapable of
entering HSB2 cells.
Whether th.e introduction of a functional T4 cDNA into
HSH2 would. render this cell susceptible to AIDS virus
infection was next studied (Table I). Exposure of
HSH2-T4+ transformants to AIDS virus results in a pro-
ductive viral infection as determined by expression of
reverse t:canscriptase activity (52), expression of
virus in t:he cytoplasm of the cell by immunofluores-
cence microscopy (46), detection of viral antigen in
the culture supernatant using an immunoassay (47), as
~5 well as the production of infectious virus by supernate
subculture with PHA-stimulated lymphocytes (Table I)
(46). Control HS82-T8+ cells were consistently nega-
tive in each of the assays.
In addition, the efficiency with which different T4+ T
cells are :infected with AIDS virus was also examined.
HSB2-T4+ and HSB2-T8+ transformants, the naturally-
isolated T4+ T cell line CEM, as well as PHA-stimulated
peripheral lymphocytes were exposed to serial 10-fold
25 dilutions c~f AIDS virus, washed, and plated in micro
culture. The frequency of infected cultures was then
determined using an immunoassay 12 days after exposure
to virus (Figure 12) (47). In this manner, the titer of
AIDS virus required to infect 50% of the exposed cul
tures (ID-50) was defined. The ID-50 of PHA-stimulated
peripheral lymphocytes is 2-3 orders of magnitude
greater than that observed for either naturally-isolat-
ed or trans;fonaed T4+ cell lines. The efficiency of
infection of HSB2-T4+ cells is about 10 fold higher
than that observed for the naturally-isolated T4+ T
l~~Or~~
-65-
cell line C7~M (Figure 12). Control HSB2-T8+ cells are
not susceptible to infection even at the highest virus
titers examined.
The ability of HSB2-T4+ cells to support both syncytia
formation and the replication of VSV (AIDS) pseudotypes
was also studied. when HSB2-T4+ cells are co-cultivat-
ed with AID~i virus producing H9 cells, syncytia forma-
tion is readily observed within 18 hours (Tables I and
II). Moreover, syncytium induction is abolished by
pretreating cultures with anti-T4A monoclonal antibody
(Table II). Finally, when HSB2-T4+ cells are exposed
to VSV (AIDS) pseudotypes, infectious VSV particles are
produced which destroy neighboring indicator cells
~5 (Tables I and III). Furthermore, plaque formation is
inhibited by pretreatment with either anti-AIDS virus
antibody or anti-T4A monoclonal antibody (Table III).
Control HSB~!-T8+ cells are consistently negative in
each of the seven assays employed to detect AIDS virus
20 infection (Tables I, II, and III). These observations
provide genetic evidence that in an immature human T
lymphocyte, the mere presence of the T4 protein pro-
vides an essential function required for AIDS virus
infection.
30
m:~~~~z
- 66 -
Table II
Ir~trtion of S~rn~yt.ia in T1+ Min '~ansloaronts
S~CN
H9~ Fi9/~
a
JM (TI+)
8166(T~+) ~
IiSB~ ~
H582-T8+ ~
~H2~T4+
Ra7i ~
Raj i-rT8+ ~ '
Raji~TI+ ,.
H~'T8+ I~
Hela-T4+
2 x 105 cells wee co-cultivated
with 2 x 10 AIDS virus-
producing H9 cells (H9/AIDS) and
incubated at 37oC, The cultures
were examined for syncytia
formation after 18 hours. The
resin is are expressed as the
approximate percentage of nuclei
cor;tained within syncytia: - (no
syncytia); ++ (25%); +++ (50%)
+++++(g0%);ND (not determined) .
Syncyti um inhibition was
assayed by adding anti-T4A
monoclonal antibody (aT4A; 1:20)
to the mixed cultures at the
time of seeing. The natuarlly-
i sol aced T4 T cel l 1 ine s JM and
8166 served as positive controls
in these studies.
'~ ~ 1~~40'~02
- G7 -
Table III
y5V Pseudotype Cytop~athic Pla4ue Assay cn T~+ and T8~ fitnmn Transformants
V5y PSSC1D0~'Yp~ ~g (?'FZJ/ntl)
FitI~1 C~~L.S V5y ( HTLV-I V5~1 ~
) (AZ 1
+ LV-I + aAI D + aT~
aHT
CES'!IT+) 20, 000 50 42, 000 50 200
~ 0 H582~1'8~ 10, 000 50 0
HS82~T4~ 12,080 50 1,000 100 300
Raji~f8+ 5,000 I~ 0
Raji~T4 5,000 50 1,500 25 150
10,000 :m 0
~~4 10,000 50 17,000 50 200
2 x 105 cells were incubated with V SV
(ADS) pseudotypes (53, 54) for 1 hour at
37 C. The cell s were then washed and 1
x 106 mink CCL64 or bovine MDHK plaque
indicator cells, permissive to VSV
infection but resistant to vSV (AIDS) ,
were adc9ed to each well. The cultures
were theen overl aid w ith aga r medi um and
scored for VSV plaques two days post
i of ect i on. Ant i-T4 A monocl onal ant i body
(tiT4At 1:20) or anti-AIDS virus serum
(aAIDS; 1:10) were used to inhibit VSV
(AIDS) pseudotype plaque formation be
pretreatment of cells 30 minutes before
exposure to pseudotypes (54) . VSV (HTLV-
I) pseudotypes, which plate on a wide
variety of human cell types (54), were
used as controls in these experiments.
Anti-HTLtJ=I serum ( 1:10) was used to block
VSV (HTLV-I) pseudotype plaque formation.
The results are expressed as PFU/ml; ND
(not determined) .
-68-
AIDS Virus :Cnfection Is Not Restricted to T Lymphocytes
A functiona:L T4 cDNA was introduced into two human non-
T cell lines: HeLa, an epithelial cell line derived
from a cervical carcinoma (72), and Raji, a B lympho-
blastoid cell line derived from a patient with
Burkitt~s lymphoma (73) (Figure 11B). Prior to retro-
virus-mediated gene transfer, these~cell lines do not
express surface T4 protein or T4 mRNA, nor are they
susceptible to AIDS virus infection (Table I). In
addition, the parental cell lines do not support the
induction oi.° syncytium nor the plating of VSV (AIDS)
pseudotypes (Tables I, II and III).
In contrast,. T4+ Raji and HeLa transformants support
AIDS virus infection by all of the criteria previously
described ('fable I). The efficiency with which Raji
T4+ cells ca.n be infected with AIDS virus approximates
that of HSB2-T4+ cells and is about 10 fold higher than
the efficiency of infection of the naturally-isolated
T4+ T cell line CEM (Figure 12). Moreover, upon co
cultivation with AIDS virus-producing H9 cells, Raji
T4+ and HeLa-T4+ cells support the induction of syncy
tia which is abolished by pretreating cultures with
anti-T4A monoclonal antibody (Tables I and II: Figure
13). In addition, exposure of these cells to VSV
(AIDS) pseudotypes results in the production of infec-
tious VSV and the formation of plaques which are inhib-
ited by pretreatment with anti-AIDS virus antibody or
anti-T4A monoclonal antibody (Tables I and III). Con-
trol Raji-T8+ and HeLa-T8+ transfonaants are consis-
tently negative in each of these assays (Tables I, II,
and III).
~~~o~o~
-69-
Therefore, the introduction of a functional T4 gene
into either human T lymphocytes, B lymphocytes, or
epithelial cells is sufficient to render such cells
susceptible to AIDS virus infection. Taken together,
these observations indicate that the T4+ T cell tropism
observed in vivo is a consequence of the restricted
expression of the T4 molecule and not the nature of the
cell type i.n which it is expressed.
AIDS Virus Binds to Surface T4 Protein
The previous experiments provide genetic evidence that
T4 expression is required for AIDS virus infection but
do not provide information on the role of this molecule
in the Viral life cycle. The observation that surface
~5 expression of T4 is necessary for AIDS virus infection
suggests that T4 is the AIDS virus receptor. Cyto-
fluorometry was therefore used to examine the binding
of AIDS Vi~:vs to the surfaces of T4+ and T8+ trans-
fonaed human cells (Table I: Figure 14). HSH2, Raji,
and HeLa cells, and the T4+ or T8+ transformants, were
incubated with AIDS virus. Following viral absorption,
the cells were washed, exposed to fluorescein-conjugat-
ed anti-AIDS virus antibody, and analyzed by flow cyto-
matry. This assay indicated that the AIDS virus binds
efliciently and specifically to the human transformants
expressing surface T4, but not to the T4 parental
cells nor to the T8+ transformants (Figure 14, column
B: Table I). The binding of AIDS virus to the T4+
cells is abolished by preincubation with anti-T4A
monoclonal antibody but not by preincubation with anti
T8 monoclonal antibody (Figure 14, column C). More
over, when T4+ transformed cells are exposed to AIDS
virus, the T4 glycoprotein coprecipitates with the
viral envelope glycoprotein , suggesting a direct phys
C7
-70-
ical association between these molecules (data not
shown). These results indicate that the AIDS virus
binds to the T4 molecule on the cell surface and that
this binding is independent of other T cell-specific
proteins since binding occurs to all T4+ cell types
examined.
Previous studies have described two distinct pathways
of entry for enveloped viruses (74, 75, 76, 77). Some
viruses fuse directly with the plasma membrane, releas
ing their nucleocapsids into the cytoplasm, whereas
others are internalized by receptor-mediated endocyto
sis. The acidic environment of the endosome then fa
cilitates fusion of the viral envelope with the limit
ing membrane of the vacuole. Infection by viruses
which enter cells via the endocytic pathway can be
inhibited b:Y treating cells with agents such 'as weak
bases which deacidify the endosome (58, 78, 79, 80),
In the press:nce of ammonium chloride, fusion is blocked
in the endc~some but lysosomal degradation still pro
ceeds at a reduced rate (80).
The effect o~f ammonium chloride on AIDS virus infection
of the T4+ '.C cell line JM was therefore examined. In
the absence of ammonium chloride, over 50% of JM cells
exposed to ,IDS virus express viral antigens five days
after infection as determined by immunofluorescence
microscopy. If JM cells are exposed to ammonium chlo
ride (for 6 hours) either at the time of addition of
virus or witlhin 30 minutes after the addition of virus,
greater than 95% inhibition of viral infection was
observed. however, if cells were treated with ammonium
chloride one hour after the addition of virus, no inhi
bition of infection was observed, a finding consistent
with the kinetics of viral entry described for other
,,,.. ,
-71-
viruses which enter cells via receptor-mediated endocy-
tosis. Finally, the ammonium chloride effect was com-
pletely reversible. Cells exposed to ammonium chlo-
ride for one hour, and then washed free of the compound
and exposed to AIDS virus, supported control levels of
viral infection. These results are consistent with
previous observations that upon removal of ammonium
chloride, th~a pH of the endosome returns to the origi-
nal low values within 1-2 minutes (78, 80). Similar
results with amantadine, a compound which deacidifies
the endosome) were abtained.
These results are consistent with a mechanism of viral
entry which involves endocytosis of the T4-AIDS virus
complex and l.ow pH-induced fusion of the viral envelope
with the limiting membrane of the endosome, releasing
the viral nucleocapsid into the cytoplasm of the cell.
T4 mRNA is Expressed in the Brain
In addition to the disruption of the cellular immune
system, AIDS is frequently accompanied by central ner-
vous system (CNS) disorders which are thought to be the
consequence of the direct infection of brain cells by
the AIDS virus (81). It was therefore of interest to
determine whether T4 is expressed in cells within the
CNS, thereby providing an explanation for the neurotro
pic properties of the virus. Northern blot analyses of
RNA prepared from both human and mouse brains were
performed to determine whether T4 mRNA sequences are
expressed in the CNS (Figure 15). Poly(A)+ RNA derived
from human cerebral cortex contains two distinct T4
mRNAs with molecular weights of approximately 3 and 1.8
kb (Figure 15~A) . The weaker 3 kb RNA is identical in
size to the mRNA expressed by two T4+ leukemic cell
-72-
lines, U93~i (monocytic cell line) and Jurkat (T cell
line), as well as by peripheral T lymphocytes. The
smaller, more abundant 1.8 kb mRNA absent from T lym-
phocytes could result from alternative splicing or
alternative 5' or 3' termini.
A more careful analysis of the localization of T4 mRNA
was performed by isolating poly(A)+ RNA from specific
regions of 'the mouse brain (Figure 15B). Hybridization
with radiolabeled cDNA encoding the murine homologue of
T4, L3T4, r~aveals an intense 2.2 kb mRNA in mouse fore
brain which is absent from hindbrain samples. The 2.2
kb L3T4 mRNA is detectable in the cortex, hypothalamus,
and is most: abundant in the striatum, but is absent
from the cerebellum, brain stem, or spinal cord (data
not shown). This 2.2 kb mRNA detected in the CNS is
approximately 1 kb smaller than the 3.2 kb mRNA encod
ing L3T4 in thymocytes (Figure 15B). These results
indicate that the neurotropism displayed by the AIDs
virus is likely to be the result of surface expression
of the T4 molecule on brain cells. The level of mRNA
detected in forebrain is about 1/30th the level in
thymocytes. This may reflect low level expression by a
large number of cells or higher levels of expression by
a small sub;population of cells. It is not known at
present whether T~ is expressed by neurons or support-
ing cells. The presence of a variant transcript in the
CNS, however, makes it unlikely that the T4 mRNA in
brain is expressed by the rare invading T lymphocyte.
Discussion
The segregation of T4 and T8 with functionally distinct
subsets of T cells suggests that these molecules may be
important in the interaction of T lymphocytes with
,.-..
-73-
appropriate target cells. As a first step in under-
standing the specific role of these proteins, cDNA
clones were obtained of both the T4 and T8 molecules
and their nucleotide sequences were determined (20,
70). Comparison of the deduced protein sequences of
T4 and T8 indicates that these molecules share signifi
cant sequence and structural homology with immunoglo
bulin variable (V) domains and as members of the im
munoglobulin supergene family. However, the N-ter
minsl V-like domains of T4 and T8 are quite different:
they share .only u8% homology and are therefore less
homologous to each other than each is to immunoglobulin
light chains. (Figure 9A). Moreover, the regions of
maximum conservation between T4 and T8 are also the
regions of strongest homology to immunoglobulin and T
cell receptor V regions. Thus, the immunoglobulin-like
domains of these two molecules, although structurally
similar, show significant sequence divergence consis-
tent with the hypothesis that they recognize different
molecules on different subsets of target cells.
The V-like region structural homology shared by the N-
terminal domains of T4 and T8 may be of particular
relevance to the functions of these proteins. Virtu-
ally all members of the immunoglobulin supergene family
pa~icipate :in the immune res onse
p (62). Moreover,
the individual members of this family show a strong
tendency to associate with each other to form dimers.
This association is apparent in the interaction of the
heavy and light chains of immunoglobulin, the alpha and
beta chains of the T cell antigen receptor, p2-micro
globulin and class I MHC proteins and the alpha and
beta chains of class II MHC molecules. The T8 glyco
protein formsc a disulphide bond with T6, a presumed
MHC-like molecule, on the surface of thymocytes (82),
-74-
and exists as multimers of the 32 kd subunit on periph-
eral T lymphocytes (83). The presence of four V-like
domains in T4 indicates that these regions associate
with one another as well as with specific ligands on
the surface of other cells or viruses. These specific
affinities of immunoglobulin-like molecules may be
essential for the recognition functions of T4 and T8.
Evolution of T4
In the immunoglobulin and T cell antigen receptor
genes, the 'V and J exons are widely separated and be-
come juxtaposed only after a somatic recombination
event (62, Ei3). The T4 mRNA encodes four contiguous V-
and J-like elements without the requirement for DNA
recombination events. It is therefore possible that
T4 reflects a more primitive gene that evolved before
the emergence of rearrangement mechanisms. Further
support for this derives from recent observations that
the first V--like region of T4 (V1) is split by an in
tron not present in the V genes encoding either the
immunoglobulins or T cell antigen receptors. Accumu
lating evidence suggests that it is far more likely for
introns to be precisely removed during evolution that
for introns to be inserted in ~ a previously intron-free
environment. Thus, T4 may represent an ancestral im
munoglobulin gene which underwent duplications, diver
gence, and :rearrangement to generate the current im
munoglobulin gene family. Although functional in a far
more complex immune system at present, T4 may reflect
receptors operative in more primitive cellular immune
responses. Primitive immune responses, such as those
of invertebrates, do not appear to involve a diverse
repertoire of receptor molecules, but in the simplest
cases are restricted to a distinction between self and
13~~"l~~
-75-
nonself (8!i, 86) and are likely to be accommodated by
a "static" set of genes that do not undergo rearrange-
ment.
Whatever the order of appearance of T4 in evolutionary
time, the organixation of this genes reveals an inter-
esting example of exon shuffling. T4 consists of four
V-J-like domains, a J-like region and a transmembrane
segment, each sharing homology with different members
of the immunoglobulin supergene family. The V- and J-
like domains are homologous to the equivalent regions
of both immunoglobulins and the T cell antigen receptor
chains: the transmembrane domain shows considerable
homology to this region in the p-chains of class II
t5 I~iC molecules (Figure 9C) . T4, therefore, consists of
a collection of axons conserved in several members of
the immunog:lobulin supergene family which are shuffled
in different: ways to generate a large number of differ-
ent molecules which participate in the immune response.
T4 is the AIDS Virus Receptor
The data provided herein suggest a mechanism of AIDS
virus infection which initially involves the specific
association of the AIDS virus with T4 molecules on the
cell surface. This association may be demonstrated on
T lymphocytes, B lymphocytes, and epithelial cells, and
therefore does not require the participation of addi
tional T cell-specific proteins. Additionally, the
data provided herein indicates that the T4-AIDS virus
complex is .internalized via receptor-mediated endocy
tosis and the viral envelope then fuses with the limit
ing membrane of the endosome, releasing the nucleocap
sid into thEa cytoplasm. Viral replication and tran
scription can then occur in both lymphoid and non-lym
-76-
phoid cell lines. Moreover, the T4 gene is expressed
in the brain as well as in lymphocytes, providing an
explanation for the dual neurotropic and lymphotropic
character ~of the AIDS virus. In this manner, a T lym-
phocyte surface protein important in mediating effector
cell-target: cell interations has been exploited by a
human retrovirus to specifically target the AIDS virus
to populations of T4+ cells.
Cell surface receptors have been identified for a num-
0 ber of enveloped viruses and the pattern of expression
of these receptors is often responsible for the host
range and tropic properties of specific viruses (74,
76). Some viruses will infect only a narrow range of
cell types, reflecting the expression of the viral
~5 receptor cn specific populations of target cells.
Rabies virus, for example, interacts with the nicotinic
acetylcholine receptor (87) and infects largely skele-
tal muscle and neurons, whereas the Epstein-Harr virus
interacts with the C3d complement receptor type 2 (88)
20 and infects H lymphocytes. Other viruses, such as the
myxoviruses, interact with ubiquitously distributed
sialic acid residues on the cell surface and infect a
much broader range of cell types.
25 ~m restricaed expression of cell surface receptors
provides only one explanation for viral tropism. Some
viruses will replicate only in a restricted set of
differentiated cell types whereas others will only be
efficiently transcribed in specific cell types. Hence,
30 the Moloney marine leukemia virus (Mo-MuLV) induces T
cell lymphomas in newborn mice " yet the closely-relat
ed Friend helper marine leukemia virus (Fr-MuLV) induc
es primarily erythroleukemias (89, 90, 91). This tro
pism is thought to result from differences in the LTRs
. -"- 1340~~0~
which facilitate tha efficient transcription of the Mo-
MuLV genome in T lymphocytes and the Fr-MuLV genome in
erythroid precursors (92, 93, 94).
As indicated herein, the primary tropic determinant of
the AIDS vi~:vs is the expression of the T4 protein on
the surface of the target cell. In vivo infection is
restricted t,o lymphoid cells and myeloid cells as well
as brain cells: three populations which express T4.
-In vitro demonstrations indicate that the introduction
of T4 into T4 human ,B lymphocytes and epithelial
cells, cellsc which are not natural targets for AIDS
virus, renders these cells susceptible to productive
infection by AIDS 'virus.
20
30
-78-
Example 1: Soluble T4 Frarnnents
Soluble T4 glycoprotein fragments are prepared using
limited protease digestion from cell preparations.
Alternatively, DNA expression vectors encoding T4
fragments which lack the transmembrane domain, a region
containing neutral and hydrophobic residues, may be
constructed and used to produce such T4 fragments.
These fragments are soluble in aqueous solutions and
contain leader (signal) sequences. When expressed in
mammalian cells, these fragments are transported to the
rough endop:lasmic reticulum/golgi complex and eventual-
ly secreted from the cells.
Example 2: Treatment of AIDS Patients
Soluble T4 c~lycoprotein fragments as described iri Exam-
ple 1, tyica~lly in a pharmaceutically acceptable carri-
er, are administered to patients infected with a human
immunodeficiency ~rirus so as to bind to virus present
in the the subject's blood and other body fluids and
block infection of T4+ cells in vivo. Alternatively or
additionally, a patient's blood is cycled through a
column containing either immobilized T4 glycoproteins
or soluble T'4 fragments so that the virus may be sepa-
rated from the blood. Such measures permit the immune
system to mount a more effective immunologic response
against the virus, i.e., allow uninfected T4+ T cells
to proliferate.
Soluble T4 fragments are used as a therapeutic, i.e.,
an inhibitor of extracellular and cell-cell spread of
HIV infection. Applicants have shown that soluble T4
fragments inhibit in vitro HIV binding to, and infec-
tion of, T4+ target cells (see Example 4). Administra-
~.:~~U°~~?
-79-
tion of soluble T4 fragments to persons infected with
HIV inhibits extracellular spread of the virus infec-
tion. Additionally, fusion of HIV-infected T4+ cells
and nonin:~ected T4+ cells, which is also a route by
which the virus spreads, are inhibited by administra-
tion of soluble T4 fragments.
Therefore, administration of soluble T4 fragments slows
the course of disease, alleviates several symptoms
associated with AIDS, and prevents occurrence of new
pathologic changes.
Soluble T4 fragments, biochemically pure, aqueous solu
ble reagents, are used in combination with other re
agents to assay for competitors of the T4-HIV interac
tion. Thus, soluble T4 fragments, in combination with
HIV envelope prateins or biochemical mixtures contain-
ing HIV envelope proteins, are used to screen for in-
hibitors o:E viral binding.
Example 3: Production of Soluble T4 Fractments
A cDNA encoding the membrane-bound T4 protein (pT4B)
has been isolated, characterized, and expressed in a
variety o! mammalian cell types (70). Soluble T4 frag
manta are produced in bacterial, yeast, insect, and
mammalian ;systems. Because the T4 protein likely folds
in a complex manner and is glycosylated, expression in
mammalian ;systems is preferred. Soluble T4 fragments
are produced by truncating pT4H after the V4J4 domain.
Such DNA fragments terminate before the transmembrane
segment, which begins at approximately nucleotide posi
tion 1264 (Figure 6). This recombinant DNA molecule
lacks both the transmembrane and the cytoplasmic do
mains. The EcoRI-HpaII fragment, which encompasses
~.~4~7~~
-80-
nucleotides 1 through 1252, is isolated by assemblying
it from smaller fragments of pT4B. Alternatively, the
membrane-spanning segment alone is deleted, leaving the
V4J4 domain fused to the cytoplasmic domain. One ap-
proach is to delete the fragment spanning the HpaII
sites from nucleotides 1252-1342 from pT4H. Such con
structs maintain the T4 signal sequence necessary for
entry into the rough endoplasmic reticulum/golgi com
plex and eventual secretion from the cell. In addi
tion, these: constructs maintain the extracellular por
tion of the: T4 protein in which the binding domain for
the human :immunodeficiency virus envelope glycoprotein
exists.
In order to express soluble T4 fragments in mammalian
-
systems, the modified T4 cDNA fragment is subcloned
into vectors containing strong eukaryotic promot
ers/enchancers as well as polyadenylation sites re
quired for cleavage and polyadenylation of the RNA.
For example, the simian virus (SV40) early promoter and
enchancer is positioned upstream from the soluble T4
cDNA fragment. Transcription termination and RNA poly-
adenylation are achieved by placing the polyadenylation
site of either SV40 or the human growth hormone gene
downstream from the soluble T4 cDNA fragment. Intro-
duction of a construct containing these elements to-
gather with a selectable marker into eukaryotic cells
by any of several methods known in the art leads to the
stable integratian of exogenous DNA. Transformants
selected by virtue of their ability to grow in selec-
tive media secrete soluble T4 fragments into the cul-
tune supernatant. Soluble T4 fragments are detected in
the supernatant by one of several assays, e.g. radioim-
munoprecipit,ation) and then purified.
-.
-81- 1~4~'~~~
Purification and characterization of soluble T4 frag-
ments is greatly enhanced by constructing a cell line
which overexpresses the secreted protein fragment.
Strategies which allow the overexpression of proteins
have been employed in bacteria, yeast, insect, and
mammalian systems. Inducible expression systems have
also been employed in bacteria and yeast to overproduce
proteins which may be toxic if constitutively ex
pressed. Overexpression of soluble T4 fragments is
accomplished by amplifying a soluble T4 expression
vector, resulting in constitutive overexpression. The
amplificaticm of dihydrofolate reductase (dhfr) genes
by growth in progressively increased concentrations of
the drug mei:hotrexate, an antagonist of dhfr, has been
widely employed. Since the amplified unit is not limit
ed to dhfr coding sequences, this approach results in
the coamplification of sequences adjacent to them.
Therefore, dhfr is used as a selectable marker and as a
means of coamplifying newly introduced sequences. This
strategy has been successfully employed to increase the
expression ~~f several different genes cotransformed
with dhfr plasmids. An alternative amplification scheme
involves cotransfection of the soluble T4 cDNA expres-
sion vector with the plasmid pdLAT-3 followed by a
selection scheme as previously described (102).
Therefore, t;he soluble T4 cDNA expression construct is
cotransfecte<i with a dhfr expression plasmid. Alterna-
tively, the dhfr gene resides on the same plasmid as
the soluble T4 cDNA fragment, allowing linked cotrans-
formation. ~rransfection of these constructs into dhfr
deficient (dhfr ) Chinese hamster ovary (CHO) cells and
subsequent selection in methotrexate permits the isola
tion of stable transformants that express newly intro
duced sequen<:es. Several clones are purified and cul
134702
-82-
tuts supernatants collected and assayed for the pres
ence of soluble T4 fragments. Clones which produce the
greatest levels of soluble T4 fragments are further
characterized by Northern and Southern blot analyses.
These cell lines are then cultivated in selective media
containing stepwise increased concentrations of metho
trexate. This selective pressure results in the ampli
fication of the newly introduced dhfr gene and adjacent
T4 sequences. After reaching the highest methotrexate
concentration, surviving cells are subjected to North
ern and Southern blot analyses to determine the extent
of amplification and culture supernatants are examined
for the presence of soluble T4 fragments.
In order to characterize the soluble T4 fragments in
the culture supernatant, several transformants are
metabolically labeled with (35S)-methionine. Cell
lysates and supernatants are then analyzed by radioim-
munoprecipil:ation and Western blot analysis using com-
mercially available anti-T4 antibodies. SDS-polyacryl-
amide gel electrophoresis is performed on the precipi-
tates and a~ band of the predicted relative ,molecular
mass (Mr) of the secreted, truncated form of T4 is
observed. Because it is synthesized in a mammalian
system, this protein is properly glycosylated and fold-
ed, i.e. disulphide bridges are formed. In order to
purify the soluble T4 fragments from culture superna-
tant, immunoaffinity column chromatography is performed
using anti-'f4 antibodies. Protein bound to the column
is eluted at high salt concentrations and low pH. SDS-
polyacrylamide gel electrophoresis of the eluted mate
rial is performed in order to determine the Mr and
purity of tlhe eluted protein fraction. In addition,
radioimmunoprecipitation and Western blot analysis is
also performed in order to further characterize the
''-..
-83-
affinity-purified material.
Similar approaches may be undertaken in bacteria, yeast
and insects to produce soluble T4 fragments. In addi
tion, fragments smaller in size than the one described
herein, e.g. containing only the V1J1 domain may be
produced.
Construction of vectors
Using recombinant DNA manipulations, base pairs (bp) 1-
1257 of the :human T4 cDNA seguence were placed between
an SV-40 early promoter and a TAA termination codon
followed by the polyadenylation region of the bovine
growth hormone gene. This sequence of the T4 cDNA
encodes the leader and predicted extracellular domain
of the T4 receptor. This sT4 minigene was joined with
a human H-ras, or a mouse dihydrofolate reductase mini
gene, to cr~aate the vectors pST4CHras and pST4DHFR
respectively. The construction of these vectors was
as follows:
Construction of pST4sal: Plasmid pST4sa1 was con-
structed from two other plasmids, JRT4 and pUCsT4. The
construction of these plasmids is detailed below.
Construction of plasmid JRT4: To create plasmid JRT4,
plasmid DSP1 (103) was cut with XhoI, the SV40 polyA
early region was deleted and the Xho I sites were
filled in using Klenow fragment of DNA polymerise. The
bovine growth hormone polyadenylation region (113) was
cut with PwII and KpnI, and the KpnI site was blunted
by treatment 'with T4 DNA polymerise. This 230 by frag-
ment was ligated to DSP1 to create DSP1BGH.
.
.. ~.'~~0~0~
-84-
DSP1HGH was cut with SmaI and SalI and the galK cas-
sette (consisting of the SV40 early promoter, galK
coding region and BGH polyA region) was ligated into
pUCl9 (107) at the SalI site by using a synthetic link-
s er consisting of a SalI end, a BglII site, and a SmaI
end. This. three part ligation resulted in plasmid
DSP18ZHGH.J'T.
DSP18ZBGH.JT, which was cut with StuI and BclI to de-
lets the galK coding region, was ligated to a 1.7 kb
EcoRi (fil:led in)-BamHI fragment, containing the T4
cDNA from plasmid pT4B (70) to create plasmid JRT4.
Construction of plasmid pUCsT4: To create plasmid
pUCsT4, a HaeII and HpaII fragment (1125 bp) of the T4
cDNA from plasmid pT4B was ligated through the use of
synthetic linkers to vector pUCl8 which had been cut
with KpnI a,nd Xbal. The HaeII end of the T4 cDNA was
ligated to the KpnI site of pUCl8 using a synthetic
linker with a Kpn I end and a HaeII end. The HpaII end
of the T4 cDNA was ligated to the XbaI site of pUCl8
using a synthetic linker with a HpaII end and an XbaI
end. This linker also inserted a TAA stop codon after
nucleotide 1257 of the T4 coding region. The resulting
plasmid was pUCsT4.
To create plasmid pST4sal, plasmied JRT4 was cut with
BglII and Sacl and 959 by fragment (consisting of the
SV40 early promoter and the first 602 nucleotides of
the T4 cDNA) was isolated. Plasmid pUCsT4 was cut with
SacI and XbaI and a 660 by fragment (consisting of the
T4 cDNA from nucleotides 603-1257 followed by the TAA
codon from the synthetic linker) was isolated. These
two fragments were ligated into DSP1HZBGH.JT which had
been cut with Bg:LII and XbaI to delete the SV40 early
.--,
-g5-
promoter and full length T4 coding region. The re-
sulting plasmid was pST4sal.
Construction of pST4DHFR: To create plasmid pST4DHFR,
a BglII-HamHI fragment containing a ~-globin DHFR ex-
pression cassette was ligated into the BamHI site of
pST4sal. The ~-globin DHFR expression cassette con
sists of: the mouse ~-globin promoter (550 by HincII
fragment from plasmid pPK288 (108) modified at its 5'
end with a synthetic linker to contain a BglII site;
the mouse I)HFR coding region (735 by HindIII (fill-in)
fragment from plasmid pSV2-DHFR (109); NheI (fill-in)-
BamHI (fill-in) SV40 polyA early region from DSP1
(103); and the mouse DHFR terminator region (907 by
HindIII (fill-in fragment from plasmid mDH9_ (110),
modified at its 3' end with a synthetic linker to cre-
ate a BamHI site. The plasmid map of pST4DHFR is shown.
Construction of pST4cHras: Plasmid pMERcHras was cre-
ated by cutting plasmid pSVK (111) with EcoRV and
HindIII (fill-in), to remove the galK region, and li-
gating in an 870 by NdeI (fill-in)-SalI (blunted by
mung bean nuclease) fragment, containing the coding
region for ~~Hras, from plasmid pSKcHras (112).
The soluble T4 transcription cassette was removed from
pST4sal via a BglII-BamHI fragment and ligated into the
BamHI site (3' to the SV40 polyA early) of pMERcHras
to create pST4cHras.
Expression ~of soluble T4 (sT4) miniQenes in mammalian
cells
Expression of psT4cHras in NIH-3T3 cells: Plasmid
pST4c8ras (10 y~g) was co-precipitated by the calcium
1~~~0'~02
-86-
phosphate precipitation method with 10 ~g of plasmid
pTKneo, a vector conferring 6418 resistance, in the
presence of .10 ~g carrier DNA (NIH-3T3 genomic DNA) onto
NIH-3T3 cel7:s (seeded at 5 X 105 cells per 60 mm
culture dish. on the preceding day). The cells were
incubated with the precipitated DNA for 6 hours at 37~
C. The DNA precipitate was removed and fresh media
5% Nu-Serums (Collaborative Research, Inc.,
Lexington, M;assachusetts)) was added to the dishes.
The cells were trypsinized 16 hours later and seeded
into three 100 mm dishes and maintained in the above
media. Foci (approximately 50 per dish) appeared in
12-14 days. Eleven of the transfonaed foci were se
lected, expanded and then seeded at 5 x 105 cells per
100 mm dish for selection in the above media plus 500
~g/ml GENETICINe 6418 (Gibco Laboratories, Grand Is-
land, New York). All 11 clones survived 6418 selection
(500 ~g/ml) and were screened for H-ras (p21) levels by
standard protein immunoblot analysis.
The clones which expressed the highest levels of p21
(approximately 2 ng p21/~g Triton-soluble protein) were
assayed for e:~cpression of sT4. Confluent cultures were
incubated for 18 hours With 35S-labelled methionine
and cysteine. Culture supernatants and cell lysates
were immunoprecipitated with monoclonal antibodies
specific for the T4 (OKT4, OKT4A) and the T8 (OKT8)
receptors, polyclanal antibody specific for ras
proteins, or nonspecific mouse IgG. A protein of about
45 kd, the predicted size of sT4, was specifically
precipitated from the culture medium by both of the
monoclonal antibodies directed against the T4 receptor.
The sT4 band was not observed in cell lysates. As
expected, p21 was precipitated from the cell but not
from the culture supernatants. Subsequent quantitation
~.~~1~'~~2
-87-
shows, compared to purified sT4, these cells produce
relatively low levels of sT4, i.e., approximately 100
fold lower than with CHO cells as described in Example
2B.
Expression ~of pST4DHFR in Chinese Hamster Ovary (CHO)
cells: DXB-11 cells, a DHFR deficient CHO cell line
(104) were transfected by calcium phosphate precip-
tiation with 10 to 30 ~g of pST4DHFR in the presence of
~g carrier DNA (NIH-3T3 genomic DNA), one day after
seeding 60 :mm dishes with 5 X 105 cells. Cells were
incubated with the DNA precipitate for 6 hours at 37'
C, the media was removed, and fresh media (F12, 10%
FBS, 100 units/ml penicillin and streptomycin) was
added to the dishes. The media was changed again after
16 hours and the cells were incubated for another 24
hours. The cells were then trypsinized, seeded into
three 100 mm dishes and selected in nucleoside-free
media (F-12 without hypoxanthine and thymidine, 10%
dialyzed FBS, and 100 units/ml penicillin and strepto-
mycin). Colonies (approximately 100 per dish) appeared
in 7-10 days. Colonies from each dish were pooled,
expanded and. then seeded at 5 x 103 and at; 5 x 104
cells per well in 24 well culture plates, or at 5 x 105
cells per 100 mm dish. The cells were allowed to re-
cover for 3 days before beginning selection in nucleo-
side free mEadia containing 20 nM methotrexate (mtx).
Individual wells ar clones were assayed at confluence
for sT4 expressian, and those selected for further
amplification were seeded into 24 well culture plates
at the densities described above. Selection at 800 nM
mtx in nucleoside-free media was started 3 days after
seeding. This selection procedure was repeated for.
selections at, 8 ~M mtx and 80 ~M mtx.
-88-
Several cell lines were derived using this method which
express soluble T4 at a minimum of 3 pg/cell/24 hrs.
Purification of sT4: Conditioned medium (CM) was pre-
pared serum-free from adherent cell cultures expanded
into 850 cm2 roller bottles under mtx selective condi-
tions. At confluence, the cells were washed twice with
phosphate buffered saline (PBS) without Mg2+ and Ca2+
and the growth medium (Ham s F12 without hypoxanthine
and thymid~ine, 10% fetal bovine serum, 100 units/ml
penicillin and streptomycin and mtx at the selective
concentration) was replaced with the same medium minus
serum and mtx and plus 1 x ITS (insulin, transferrin
and selenium (Collaborative Research Inc.). After 24
48 hrs., tt~e medium was removed and replaced with se
lective growth medium. Serum-free medium was then
reapplied within 3-5 days and this cycle repeated in
definitely, i.e., for more than two months. CM was
clarified by centrifugation at 8,000 x g. A protease
inhibitor PMSF (phenylmethylsulfonylfluoride) was add
ed to 0.5 ar,M and the CM was concentrated about 10-fold
by pressure membrane filtration. This concentrated CM
was clarified by centrifugation at 2000 x g and
Aprotinin, protease inhibitor (Sigma Chemical, St.
Louis, Missouri) was added to a final concentration of
5 ~g/ml. The sample was processed directly or after
storage at ~-7 0' C .
The concentrated CM sample was diluted 2-fold with 50
mM MES [2-~(N-morpholino)-ethanesulfonic acid], pH 6.0
and filtered through a o.45 micron filter. The sample
was then treated with 100 ~m pAPMSF (p-amidinophenyl-
methylsulfonylfluoride) (Cal8iochem-Behring, San Diego,
California) and applied to a S-Sepharosea (Sulpho-pro-
pyl) (Pharmacia F-L Biochemicals, Piscataway, New Jer-
~.~4~'~~~
-89-
say) column equilibrated in 50 mM MES, pH 6.0 at a
protein concentration of 1.5-2.0 mg/ml gel. The sample
was eluted using a linear gradient of 0-0.5 M NaCi in
50 mM MES, pH 6Ø Peak fractions which eluted at
approximately 0.2 M NaCl were pooled and treated with
pAPMSF to 100 ~Mf. Fractions containing sT4 were con-
firmed by ;SDS-PAGE and immunoblot assays. After sit-
ting at 4'C: for 1 hour the sample was dialyzed against
50 mM Bis-~Tris propane [1,3-bis[tris-(hydroxymethyl)-
methyl amino]propane), pH 6Ø
The sample was treated with 100 ~M pAPMSF and 0.1% thio-
diglycol, pH 9.0 was then applied to a Q-Sepharose°
(quarternary amino ethyl) column (Pharmacia) (5 ml
~5 sample/ml c~el) equilibrated in 50 mM Bis-Tris propane
(BTP), pH 9Ø 'rhe sT4 sample does not bind to the Q-
Sepharose° and was recovered in the unbound fraction
and column wash. The unbound sample was immediately
adjusted to pH 6Ø
The final step was chromatography on a 30 micron Supe-
rose° 12 column (2.5 x 46 cm) (Phanaacia) equilibrated
in 50 mM phosphate, 0.15 M NaCl pH 7Ø The column was
run at a flow rate of 3.0 ml/min. Ten ml injections
were made and the 42 minute peak was collected batch-
wise. The process yielded approximately 1Ø mg of
product per' 20.0 mg of total protein for a cell line
producing approximately 3 pg/cell/day.
35
1~~~'~U~
-90-
Characterization of the sT4
Physical Properties: Total protein concentration was
determined using the colormetric BCA protein assay
(Hicinchoninic Acid, Pierce Chemical Co., Rockford,
Illinois). Absolute concentrations were determined by
quantitiativ~e amino acid analysis. The measured amino
acid composition of the purified sT4 was performed
using standard amino acid analysis techniques and was
found to agree with the predicted sequence for the
molecule to within experimental error (+/- 15%).
Through the first 20 residues the sequence was as pre
dicted except that it begins lys-lys-val-val----.
Thus, the mature amino terminus begins at position +3
with respect to the predicted leader clip site and dif
fers from the predicted sequence at that position by an
asn to lys change. The position of the mature amino
terminus agrees well with the determined termini of the
mouse and sheep CD4 proteins. The asn to lys change may
represent a ;sequencing error (single base change) or a
mutation which arose during recombinant procedures.
Immuno-epito es: The monoclonal antibodies OKT4 and
OKT4A recognize non-interfering surface epitopes of the
T4 receptor (114). These antibodies are specific for
the native conformation in that they will not bind to
reduced, SDS denatured protein in immuno-blot assays.
It was shown that both antibodies specifically precipi-
tate sT4 from 35S-labeled culture supernatants using
the following immunoprecipitation procedure:
Cultures of sT4-producing cells containing 1 x 106
cells per 60 mm culture dish were labeled for 16 hours
at 37~C in 1.5 ml methionine and cysteine free F12
medium containing ITS, and 170 ~Ci/ml [35S]methionine
-91-
and 30 ~Ci/ml (35SJcysteine (ICN Biomedicals, Inc.,
Costa Mesa, California). Clarified medium (100 ~l) was
diluted with an equal volume of precipitation buffer
(10 mM sodium phosphate pH 7.5, 100 mM NaCl, 0.1% NP-
40°, 0.5% non-fat dry milk) and incubated with 3 ~g
rabbit IgG for 15 min. at 4°C followed by 30 ~l (packed
volume) of protein A sepharose beads (Pharmacia P-L
Biochemical;s) for 30 min. at 4'C. The precleared su-
pernatant was incubated with 5 ~g of OKT4, OKT4A and
OKTS (gift: of P. Rao, Ortho Pharmaceuticals Corp.,
Raritan, N'ew Jersey), mouse IgG (Cooper Biomedical,
Malvern, Pennsylvania), or rabbit a-mouse IgG (Cooper
Biomedical) for 30 min at 4'C. OKT4, OKT4A, OKT8,
mouse IgG, and rabbit a-mouse IgG were precipitated by
incubation with 20 ~1 (packed volume) of protein A
sepharose beads :Eor 30 min. at 4°C. Following precipi
tation, thE: beads were washed twice with 200 ~1 precip
itation buffer and once with 200 ~1 precipitation buff
er minus NP-40° and non-fat dry milk. The washed beads
were boiled for 5 min. in 20 ~1 sample buffer (125 mM
Tris-HC1 pH 6.8, 20% glycerol, 1.4 M p-mercaptoe
thanol), a;nd the supernatants were analyzed by elec
trophoresis on a 12.5% SDS-polyacrylamide gel. Similar
results were obtained with OKT4B, OKT4C, OKT4D, OKT4E,
OKT4h and other Mabs specific for T4. These results
suggest that the conformation of sT4 accurately mimics
the surface: domain of the T4 receptor.
To determine whether sT4 can associate with HIV gp120
and whether this association can inhibit the binding of
HIV to T4 cells, approximately 5 micrograms of purified
sT4 were absorbed to Sepharose beads coated with OKT4
or control antibody. The beads were then mixed with a
lysate of 35S-methionine labeled HIV. The complex of
sT4 with OKT4 caprecipitates only the 120 kd envelope
glycoprotei,n. No viral proteins are precipitated by
-92-
ORT4 beads in the absence of sT4 or in the presence of
control supernatants from the untransfected CHO cells.
Furthermore, viral protein is not precipitated if
Sepharose beads coated with control mouse immunoglo-
bulin (isotype matched to OKT4) are incubated with sT4.
These studies indicate that the sT4 obtained, which is
free of other cell surface components present on the
surface of T lymphocytes, is capable of specifically
associating with the envelope glycoprotein of the AIDS
~i~s.
Cytofluorometry was performed to demonstrate that the
interaction of T~ with gp120 of intact HIV abolishes
the binding of AIDS virus to the surface of T4+ cells.
T4+ CEM cells were exposed to HIV in the presence or
absence of ;sT4. Following viral absorption, the cells
were washed,, exposed to fluorescein conjugated anti-HIV
antibody, and analyzed by flow cytometry (Figure 17)
(48). In t:he absence of sT4, HIV binds efficiently to
T4+ CEM cells. If HIV is preincubated with sT4, the
binding of Virus to T4+ cells is abolished (Figure 17).
Ten nanograms of purified sT4 is sufficient to inhibit
the binding of 100 nanograms of viral protein. If the
envelope glycoprotein comprises 5% of the total viral
protein, an estimated a 5:1 molar ratio of T4 to gp120
is capable of complete inhibition of HIV binding to T4+
c~lls.
The ability of sT4 to inhibit the infection of T4+
cells by H7:V was also studied. Phytohemagglutinin-
stimulated ;human 1 hoc tes were a
Ymp y xposed to serial
ten-fold dil.utions of an HIV inoculum in the presence
or absence of sT4, washed, and plated in microculture.
The frequency of infected cultures was determined using
an immunoassay 4.8 and 12 days after exposure to virus
~ ~~o~fl~
-93-
(47). In this manner the infectious virus titer, ID-50
is defined as the reciprocal of the dilution required
to infect 50~% of the exposed cell cultures at day 12.
In the absence of sT4, the ID-50 observed with the
viral inoculum is approximately 105. However, in the
presence of .e micrograms/ml of purified soluble T4, the
infectively is diminished by almost 4 logs to an ID-50
of 101'5 (Fi.gure 18). This dramatic reduction in in-
fectivity by HIV is observed throughout the entire
course of infection. As a control for nonspecific
inhibition or toxic effects of sT4, sT4 was added to
cultures 18 hours after the initial exposure to virus.
Cultures exposed to sT4 18 hours after infection show
only a 1 loci inhibition in the ID-50 which presumably
results from inhibition of virus spread following the
initial inoculation. Thus, the 4 log reduction in
virus infectivity observed when virus 'is preincubated
with sT4 is :Likely to result from the specific associa
tion of sT4 with gp120 on the surface of virus. These
particles are therefore no longer capable of interact
ing with thE: T4 receptor on the cell surface. Four
logs of inhibition were observed when 105 infectious
particles/ml are preincubated with 8 micrograms/ml of
sT4. The viral preparations of 105 infectious parti
cles/ml were estimated to contain 109 particles/ml. If
each particle contains 1,000 envelope glycoproteins,
then the inhibition is obtained at a ratio of 100 T4
molecules/mol.ecule of envelope protein.
The availability of relatively large quantities of
structurally intact sT4 facilitates the study of the
mechanism of interactions of T4 with the surface of
both antigen-presenting cells as well as with HIV vi
rus. The :specificity of interaction of T4+ helper
cells with antigen-presenting cells (B cells and macro
,.
1~~Q~~~
-94-
phages) may result, at least in part, from the associa-
tion of T4 with class II l~iC molecules (105, 106j. The
availability of significant amounts of purified sT4
permits a direct demonstration of a physical associa-
tion between T4 and class II I~iC molecules.
The ability of sT4 to bind gp120 and inhibit viral
infection in vitro indicates that sT4 is an effective
anti-viral agent for treating AIDS patients.
15
25
35
1340'02
-95-
Example 4: Production of Soluble V1V2J4 Soluble T-4
Fragments
Construction of Vectors
Construction of psT4BBVIDHFR: To create plasmid psT4B-
BVIDHFR, pl<ismid pST4DHFR (described in example 3) was
cut with EcoRI arid XbaI and the smaller fragment con-
taining the sT-4 coding region was deleted. Plasmid
sT4sa1 was cut with XbaI and BbvI and a 1120 base pair
coding fragment containing the sequence for soluble T-
4 minus the leader region was isolated. This fragment
was ligated to the EcoRI/XbaI-cut pST4DHFR, using a
synthetic linker with an EcoRI end, a KpnI site, and a
BbvI end. This fragment is compatible with the BbvI
~5 overhang on the sT-4 fragment isolated above. The
resulting pl.asmid was called pST4BBVIDHFR.
Construction of OMPAST4: To create plasmid OMPAST4,
plasmid OMPA.GS was digested with NcoI and SaII and the
20 smaller fragment containing the linker region was de-
leted. OMP,~.GS is a derivative of pASI (Rosenberg et
al., Meth. Enzymo:l., 101:123 (1983): U.S. Patent 4,578,-
355) having a synthetic sequence inserted into the NdeI
site at the: 3' end of the cII ribosome binding se-
25 quence. T:he synthetic sequence comprises the OMPA
leader followed by a multiliner sequence. The synthet-
ic sequence was substantialy as follows:
5' -T ATG AAA AAG ACA GCT ATC GCG ATT GCA GTG GCA CTG
30 GCT GGT TTC GCT ACC GTA GCG CAG GCC GGC TCT AGA GTC GAC
CTA GTT AAC TAG-3'
Plasmid pUCsT4 was cut with Ncol and SaII and the 1149
base pair fragment containing SCD-4 sequence [T-4
1~44'~0~
-96-
nucleotides 124-1.257) was isolated. This fragment was
ligated to 'the NcoI/SaII cut OMPA.GS to create OMPAST4.
Construction of OMPAST4BbvI: To create plasmid OMPAS-
T4BbvI, plasmid OMPAST4 was cut with NaeI and XBaI.
The smaller fragment resulting from this cut, contain-
ing the s'.~-4 coding region was deleted. Plasmid
ST4BBVIDHFR was cut with KpnI and the resulting 3'
overhang was blunt ended with T4 DNA polymerase. The
blunt ended. DNA was then cut with XBaI and the 1124
base pair fragment containing the nucleotides 145-1257
of the CT4 cDNA was isolated. The isolated fragment
was ligated to the NaeI/XbaI cut OMPAST4 plasmid to
create plasmid OMPASTI4BbVI.
~5 Construction of pucGT4184: To created plasmid pucSt-
4184, an EcoRI-NheI fragment from the T-4 cDNA [a 682
by fragment. encoding aminoacids (-23) to (+178)] was
ligated to the synthetic linker sk727/725 (NheI and
Aval ends) at the NheI site. sk727/725 codes for T-4
20 amino acids 179-:L85). The AvaI end of sk727/725 was
ligated to ;gin AvaI-Xba 1 fragment of pUcST4 (comprising
by 1198-125'7 of the human cDNA and encoding amino acids
351-369 of the T-~4 receptor followed by a TAA termina-
tion codon). This sequence, which is flanked by EcoRI
25 and XbaI ends, was inserted into pUCl9 at the EcoRI and
Xba 1 ends in the. puCl9 polylinker (sk727/725). sk727-
/725 is substantially as follows:
5'gaccagaaggaggaggtgcaattgctagtgttcggattgactgccaac 3'
30 gtcttcci~cctccacgttaacgatcacaagcctaactgacggttgagc 5'
Construction of pucST4106: To create plasmid pucST-
4106, an Ec~oRI-Ava II fragment (comprising by 1-413,
and encoding amino acids (-) 25-87) of the T-4 cDNA was
140702
-97-
joined to the synthetic linker sk791/792 (Ava II-AvaI
ends) at the AvaI:I site. sk791-792 codes for T-4 amino
acids 88-104. The AvaI end of sk791/792 was ligated to
an AvaI-XbaI fragment of pucST4 (comprising by 1198-
1257 of the human cDNA, and encoding amino acids 351-
369 of the T-4 receptor followed by a TAA termination
codon). This sequence, which is flanked by EcoRI and
XbaI, ends was inserted into pUCl9 at the EcoRI and
XbaI ends in the puCl9 polylinker. sk791/792 is sub-
stantially ass follows:
5' gaccagaaggaggaggtgcaattgctagtgttcggattgactgccaac
gtcttcct:cctccacgttaacgatcacaagcctaactgacggttgagc 5'
Construction of sT4184DHFR: To create plasmid sT41-
84.DHFR, an EcoRI-XbaI fragment of pucST4184 (encoding
amino acids -25 to 183 fused to 355 to 373) was ligat-
ed to the EcoRI and XbaI ends of psT4DHFR in place of
the EcoRI-Xx~aI fragment encoding sT-4.
Construction of sT4106DHFR: To create plasmid sT4106.-
DHFR an Ec:oRI-XbaI fragment of pucST4106 (encoding
amino acids -23 to 106 fused to 351 to 369) was ligated
to the EcoR:C and XbaI ends of psT4DHFR in place of the
EcoRI -Xba 1. fragment encoding sT-4.
Expression of pST4184DHFR in Chinese Hamster Ovary
(CHO) cells:
DXB-11 cells, a DHFR deficient CHO cell line (Urlaub,
et al., sera) were transfected by calcium phosphate
precipitation with 10 to 30 ~cg of pST-4184DHFR in the
presence of 10 ~g carrier DNA (NIH-3T3 genomic DNA), one
day after Needing 60 mm dishes with 5 x 105 cells.
Precipitate:c were removed after 6 hrs. and replaced
-98-
with F12 medium without hypoxanthine or thymidine,
containing 10% dialyzed fetal bovine serum. Colonies
(approximat:ley 100 per dish) appeared in 16 days.
Colonies from each dish were pooled, expanded and then
seeded at :c x 104 cells per well in 24 well culture
plates. These cells were grown in nucleoside free
media conta~lning 80 nM methotrexate (mtx) to select for
potential amplification of the transfected dhfr and
V1V2J4 minigene. After two weeks in 8 nM mtx, actively
growing cells were clearly visible. Individual wells
or clones were assayed at confluence for expression of
the deletion mutants and those selected for further
amplification were seeded into 24 well culture plates
at the density described above. A number of subpopu-
lations which expressed high levels of V1V2J4 were
grown in increasing levels of mtx to select for further
amplification of the dhfr transcription unit and the
T4184s(V1V2-J4) mi.nigene.
Several cells lines were derived using this method
which expresses the deletion mutants in amounts of at
least about 2 pg/cell/24 hrs.
Conditioned medium (CM) was prepared serum-free from
25 adherent cell cultures expanded into 850 cm2 roller
bottles under mtx selective conditions. At confluence,
tha cells were washed twice with phosphate buffered
saline (PBS) without Mg2+ and Ca2+ and the growth medi
um (Ham's F7.2 without hypoxanthine and thymidine, 10%
fetal bovine serum, 100 units/ml penicillin and strep
tomycin and mtx at the selective concentration) was
replaced witlh the same medium minus serum and mtx and
plus 1 x ITS (insulin, transferrin and selenium (Col
laborative Research Inc.). After 24-48 hrs. the medium
was removed and replaced with selective growth medium.
.~, 1340'02
-99-
Serum-free medium was than reapplied within 3-5 days
and this cy<:le repeated indefinitely) i.e., for more
than two months. CM was clarified by centrifugation at
8,000 x g. A protease inhibitor PMSF (phenylmethyl-
sulfonylfluoride) was added to 0.5 mM and the CM was
concentrated about lOx fold by pressure membrane fil-
tration. This concentrated CM was clairified by cen-
trifugation at 2000 x q and Aprotinin, protease inhibi-
tor, (Sigma chemical, St. Louis, Missouri) was added to
a final concentration of 5 ~g/ml. The sample was pro-
cessed directly or after.storage at -70'C.
Western Blot Analysis: Conditioned media from ViV2J4
producing CHO cells was concentrated and run on a 15~
~5 polyacrylamide reducing gel. Protein was transferred
to nitrocellulose paper and probed with polyclonal
antisera raised against a denatured E. coli derived T-
4-NSI fusion molecule. This antisera specifically
recognizes a V1V2J4 doublet migrating at approximately
20 25 Kd. This corresponds to the predicted size of the
V1V2J4 coding sequence after leader processing. The
physical basis for the doublet is not known. It is not
likely to result from the differences in N-linked gly-
cosylation, since the two consensus sequences in T-4
25 for this glyc~osylation are not present in V1V2J4.
Immuno-epitopes: The monoclonal antibodies OKT-4 and
OKT-4A, OKT4B, OKT4C, OKT4D, OKT4E and OKT4F specifi
cally recognize surface epitopes on the native, mem
brane bound ~.C-4 receptor (Rao, et al., Cell Immunol.
80:310(1983)). These antibodies are specific for the
native conformation. in that they will not bind to re
duced, SDS-denatured protein in immuno-blot assays. It
was shown that both antibodies specifically precipitate
V1V2J4 from 3~'S-labelled culture supernatants using the
,.:..,,.
-100-
following immunoprecipitation procedure.
Cultures of ViV2J4 producing cells containing 1 x 106
cells per X50 mm culture dish, were labelled for 16
hours at 37'C in 1.5 ml methionine and cysteine free
F12 medium containing ITS, and 170 ~Ci/ml [35S]methio
nine and 30 ~Ci/ml.[35S]cysteine (ICN Biomedicals, Inc.,
Costa Mesa, CA). Clarified medium (100 ~1) was diluted
with an equal volume of precipitation buffer lOmM so
dium phosphate pH 7.5, (100 mM NaCl, 0.1$ NP-40°, 0.5%
non-fat dry milk) and incubated with 3 ~g rabbit IgG for
min at 4'C followed by 301 (packed volume) of pro
tein A sepha.rose beads (Pharmacia P-L Biochemicals) for
30 min at 4'C. The precleared supernatant was incu
bated with !i ~g of each of the OKT4 antibodies refer
enced above, mouse IgG (Cooper Biomedical, Malvern,
PA), or rabbit a-mouse IgG (Cooper Biomedical) for 30
min at 4'C. The UKT4 antibodies, mouse IgG, and rabbit
a-mouse IgG were precipitated-by incubation with 20 ~1
(packed volume) of protein A sepharose beads for 30
min at 4'C. Following precipitation, the beads were
washed twice with 200 ~1 precipitation buffer and once
with 200 ~1 precipitation buffer minus NP-40° and non-
fat dry milk;. The washed beads were boiled for 5 min
in 20 ~1 sample buffer (125 mM Tris-HCL pH 6.8, 20%
glycerol, 1.4 M ~-mercaptoethanol), and the
supernatants were analyzed by electrophoresis on a
12.5% SDS-polyacrylamide gel. With the exception of
OKT4, each of the monoclonal antibodies specifically
precipitated the V1V2J4 from 35S-labelled cultured
supernatants..
Competition of HIV binding: The recognition of V1V2J4
by OKT4A indicated that V1V2J4 would inhibit the bind
ing of the AIDS virus to susceptible cells. CM con
w 1340'~0~
-101-
taining or lacking ViV2J4 was used in the initial as-
says. HIV was incubated with the CM and virus binding
to the T-4~ CEM cell line was quantitated by incuba-
tion with a FITC conjugated, anti-HIV antibody and FAGS
(Fluorescein activated cell sorter) analysis as de-
scribed by McDougal, et al., supra (1985). CM from the
V1V2J4 producing cell line inhibited HIV binding in a
dilution dependent manner, whereas no response was seen
with CM from matched non-producer (DXB-11) cells.
The protein V1J4 was similarly expressed in CHO cells.
However, in these preliminary experiments, the protein
apparently was not exported into the media. Based on
other studies showing that V1J4 produced in other re-
combinant organisms binds OKT4A, it appears that V1J4
expressed in mammalian cell culture would inhibit HIV
binding.
ZO
Example 5: Preparation of Anti-Soluble T4 Fragment
Antibodies
Eight week old Balb/c mice are injected intraperito-
neally with 50 micrograms of a purified soluble T4
fragment of the present invention (prepared as de-
scribed above) in complete Freund's adjuvant, 1:1 by
volume. Mice are then boosted, at monthly intervals,
with the soluble T4 fragment mixed with incomplete
Freund's ad:fuvant, and bled through the tail vein.
Zmmunoglobul.in cuts of sera are generated by ammonium
sulfate precipitation and specific anti-soluble T4
fragment antibodies are purfified by affinity chroma-
tography using an immobilized T4 fragment.
,... ,
)~~~~~
-102-
Example 6: Preparation of Soluble T4 Fragment Anti-
Idiotypic Antibodies
Syngenic and congenic mice are injected intraperito-
neally with 50 micrograms of a purified anti-soluble T4
fragment antibody) of the present invention (prepared
as described above) in complete Freund's adjuvant and
boosted with the anti-soluble T4 fragment antibody in
incomplete Freund's adjuvant monthly. On days 4, 3,
and 2 prior to fusion, mice are boosted intravenously
with 50 micr~~grams of immunoglobulin in saline. Splen-
ocytes are then fused with P3X63 AG8.653 non-secreting
myeloma cells accarding to procedures which have been
described and are :known in the art to which this inven-
~5 tion pertains. Two weeks later, hybridoma supernatants
are screened for binding activity against anti-soluble
T4 fragment antibodies by radioimmunoassay. Positive
clones are then assayed for the ability to bind a human
immunodeficie:ncy virus envelope glycoprotein and AIDS
20 virus. Alternatively, using the "one-step" procedure,
mice are injected intraperitoneally with a soluble T4
fragment in <:omplete Freund's adjuvant, boosted intra-
venously with the soluble T4 fragment in saline, and
mice spleen ~~ells fused with myelomas as above. Hy-
25 bridoma supernatants are then assayed directly for
soluble T4 fragment. anti-idiotypic antibodies.
35
r.
-103-
REFERENCES
1. E.L. Reinherz et al., "Discrete Stages of
Human Intrathymic Differentiation: Analysis
of Normal Thymocyte and Leukemic Lymphoblasts
of T Cell Lineage", Proc. Natl. Acad. Sci.
USA 77: 1588-1592 (1980).
2. E.L. Reinherz and S.F. Schlossman, "The Dif-
ferentiation and Function of Human T Lympho-
cytes", Cell 19: 821-827 (1980).
3 . M. L. Hlue et al . , "Coexpression of T4 and T8
on Peripheral Blood T Cells Demonstrated by
Two-color Fluoroescence Flow Cytometry", J.
Immunol. 134: 2281-2286 (1985)
4. E.is. Engleman et al., "Activation of Human T
Lymphocyte subsets: Helper and Suppres
sor/Cytotoxic T Cells Recognize and Respond
to Distinct Histocompatibility Antigens", J.
Immunol. 127: 2124-2129 (1981)
5. A.M. Krensky~et al., "Long-term Human Cyto-
lytic T-cell Lines Allospecific for HLA-DR6
Antigen Are OKT4+", Proc. Natl. Acad. Sci.
USA 79: 2365-2369 (1982).
6. S.C:. Meuer, S.F. Schlossman and E. Reinherz,
"Cl.onal Analysis of Human Cytotoxic T Lympho
cyt:es T4~ and T8+ Effector T Cells Recognize
Products of Different Major Histocompatibili-
ty Complex Regions", Proc. Natl. Acad. Sci.
USA, 79: 4395-4399 (1982).
,... .
-l04-
7. W.E. Biddison et al., "Possible Involvement
o:f the OKT4 Molecule in T Cell Recognition of
Class II HLA Antigens", J. Exp. Med. 156:
1065-1076 (1982).
8. D.R: Wilde et al., "Evidence Implicating L3T4
in Class II MHC Antigen Reactivity Monoclonal
Antibody GK 15 (Anti-L3T4) Blocks Class II
MHC Antigen-Specific Proliferation, Release
oiF Lymphokines and Binding by Cloned Murine
Helper T Lymphocyte Lines", J. Immunol. 131:
27L78-2183 (1983) .
9. S.L. Swain, "T Cell Subsets and the Recogni-
tion of MHC Class", Immunol. Rev. 74: 129-142
-
(7.983) .
10. Y. Thomas et al., "Functional Analysis of
Human T' Cell Subsets Defined by Monoclonal
Antibodies. IV. Induction of Suppressor Cells
ZO
Wj.thin the OKT4+ Population", J. Exp. Med.
15~4: 459-467 (1981).
11. E.G. Engleman et al., "Antibodies to Membrane
Structures that Distinguish Suppressor/Cyto-
tc~xic and Helper T Lymphocyte Subpopulations
Block the Mixed Leukocyte Reaction in Man",
J. Exp. Med. 154: 193-198 (1981).
12. P. Marrack et al., "The Mayor Histocompati-
bility Complex-restricted Antigen Receptor on
T Cells. II. Role of the L3T4 Product", J.
Exp. Med. 158: 1077-1091 (1983).
13~~'702
-105-
13. L.. Rogozinski et al., "The T4 Surface Antigen
is Involved in the Induction of Helper Func-
tion", ;J) Immunol. 132: 735-739 (1984).
14. S.L. Swain, "Significance of Lyt Phenotypes:
Lyt2 Antibodies Block Activities of T Cells
that Recognize Class I Major Histocompatibil-
ity Complex Antigens Regardless of Their Fun-
ction", Proc. Natl. Acad. Sci. USA 78: 7101-
7105 (1981).
15. U. Landegren et al., "Selective Inhibition of
Human T Cell Cytotoxicity at Levels of Target
Recognition of Initiation of Lysis by Mono-
~5 clonal OKT3 and Leu-2a Antibodies", J. Exp.
Med. 155: 1579-1584 (1982).
16. R.M. Zinkernagel and P.C. Doherty, "MHC-re-
stricted Cytotoxic T Cells: Studies on the
20 Biological Role of Polymorphic Major Trans-
plantation Antigens Determining T Cell Re-
striction, Specificity, Function, and Respon-
siveness"', Adv. Immunol. 27: 52-177 (1979).
25 17. J. Kappler et al., "The Major Histocompati-
bil.ity Complex-Restricted Antigen Receptor on
T Cells in Mouse and Man: Identification of
Constant and Variable Peptides", Cell _35:
295-302 (' 1983 ) .
18 ~ O. Acuto et al . , "The Human T Cell Receptor:
Appearance in Ontogeny and Biochemical Rela-
tionship of Alpha and Beta Subunits on IL-2
Dependent Clones and T Cell Tumors", Cell
34: 717-726 (1983).
-106-
19. P. Kavathas et al., "Isolation of the Gene
Coding for the Human T Lymphocyte Antigen
Leu-2 (T8) by Gene Transfer and cDNA Subtrac-
tion", Proc. Natl. Acad. Sci. USA 81: 7688-
7692 (1984).
20. D.R. Littman et al., "The Isolation and Se-
quence of the Gene Encoding T8: A Molecule
Defining Functional Classes of T Lymphocy
tes", Cell 40:_237-246 (1985).
21. V.P.~Sukhatma et al., "The T Cell Differenti-
ation Antigen Leu-2/T8 is Homologous to Im-
munoglobulin and T Cell Receptor Variable
Regions",, Cell 40: 591-597 (1985).
22. S.M. Friedman et al., "OT-CLL: A Human T
Cell Chronic Lymphocytic Leukemia That Pro-
duces IL-2 in High Titer", J. Immunol. 128:
935-940 (1982).
23. D.A. Thurley-Lawon, L. Chess and J.L. Stro
minger, "Suppression of In Vitro Epstein-Barr
Infection: A New Role for Adult Human T
Cells", J. Exp. Med. 146: 495-508 (1977).
24. J.W. Goding, "The Chromic Chloride Method of
Coupling Antigens to Erythrocytes: Defini-
tion of Some Important Parameters", J. Im-
munol. Methods 10: 61-66 (1976).
25. F.L" Graham and A.J. van der Eb, "A New Tech-
niqi,ie for the Assay of Infectivity of Human
Adenovirus DNA", Virology 52: 456-467 (1973).
-
I~34~'~~2
-107-
26. M. Wigler et al., "Biochemical Transfer of
Single-Copy Eucaryotic Genes Using Total Cel-
lular DNA as Donor", Cell 14: 725-731 (1978).
27 ~ M., Wigler et al . , "Transfer of Purified Her-
pes Virus Thymidine Kinase Gene to Cul-tured
Mouse Cells", Cell 11: 223-232 (1977).
28. J.M. Chirgwin et al., "Isolation of Biologi-
cally Active Ribonucleic Acid from Sources
Enriched in Ribonuclease", Biochemistry 18:
5294-5299 (1979).
~5 29~ H. Aviv and P. Leder, "Purification of Bio-
logically Active Globin Messenger RNA by
Chromatography on Oligothymidylic Acid-Cellu-
lose", Proc. Natl. Acad. Sci. USA _69: 1408-
1412 (1972).
30. T. Huynh, R.A. Young and R.W. Davis, "Con-
st:ruction and Screening cDNA Libraries in
gtl0 and gtll", DNA Cloning Technigues - A
Practical Approach, D.M. Glover, ed. (Oxford:
IR~L Press) , in press.
31. T. Maniatis et al., "The Isolation of Struc-
tural Genes from Libraries of Eucaryotic
DNA", Cell 15: 687-701 (1978).
32. M.M. Davis et al., "Cell-Type-Specific cDNA
Probes and the Murine I Region: the Local-
ization and Orientation of Ad Alpha", Proc.
Nat:l. Acad. Sci. USA 81: 2194-2198 (1984).
-108-
33. T. Maniatis, E.F. Fritch and J. Sambrook,
Molecular Cloning (Cold Spring Harbor, NY;
Cold Spring Harbor Laboratory) (1982).
34. P.W.J. Rigby et al., "Labeling Deoxyribo-
nucleic Acid to High Specific Activity In
Vitro by Nick Translation with DNA Polymerise
I", J. Mol. Biol. 113: 237-251 (1977).
35. J. Vieira and J. Messing, "The pUC Plasmids,
an M13mp7-Derived System for Insertion Muta-
genesis and Sequencing with Synthetic Univer-
sal Primers", Gene 19: 259-268 (1982).
36., F. Singer, S. Nicklen and A. Coulson, "DNA
Sequencing with Chain-Terminating Inhibi-
tors", proc. Natl. Acid. Sci. USA _74: 5463-
5467 (1977).
20 37' E~ Southern, "Detection of Specific Sequences
Among DNA Fragments Separated by Gel Electro-
phoroesis", J. Mol. Biol. 98: 503-517 (1975).
38. G.;M. Church and W. Gilbert, "Genomic Sequenc
25 ing", Proc. Natl. Acid. Sci. USA 81: 1991
19~95 ( 1984 ) .
39. R.H. Scheller et al., "A Family of Genes that
Codes for ELH, a Neuropeptide Eliciting a
30 Stereotyped Pattern of Behavior in Aplysia",
Ce:Ll 28: 707-719 (1982).
40. K. Zinn, D. DiMaio and T. Maniatis, "Identi-
fic:ation of Two Distinct Regulatory Regions
35 Ad:lacent to the Human Beta-Interferon Gene",
13~~'~02
-109-
Cell 34.: 865-879 (1983).
41. C. Terhorst et al., "Further Structural Stud-
ies of the Heavy Chain of HLA Antigens and
It.s Similarity to Immunoglobulins", Proc.
Natl. Acad. Sci. USA 74: 4002-4006 (1977).
42. J..A. Hedo, L.C. Harrison and J. Roth, "Bind
ing of Insulin Receptors to Lectins: Evi
dence for Common Carbohydrate Determinants on
Se~~eral Membrane Receptors", Biochemistry _20:
3385-3393 (1981).
43. U.K. Laemmli, "Cleavage of Structural Pro
tej.ns During the Assembly of the Head of Bac
teriophage T4", Nature 227: 680-685 (1970).
44. R. Mann, R.C. Mulligan, and D. Baltimore,
Construction of a retrovirus packaging mutant
and its use to produce helper-free defective
retrovirus, Cell 33, 153-159 (1983).
45. F. Barre-Sinoussi,et al., Isolation of a T
lymphotropic retrovirus from a patient at
risk for acquired immune deficiecny syndrome
(AI17S), Science 220, 868-871 (1983).
46. J.S" McDaugal, et al., Cellular tropism of
the human retrovirus HTLV-III/LAV. I. Role of
T cell activation and expression of the T4
antj.gen, ~T. Immol. 135, 3151-3162 (1985).
47. J.S. McDougal, et al., Immunoassay for the
detection and quantitation of infectious
human retrovirus, lymphadenopathy-assoicated
I3~~'~
-110-
virus (LAV), J. Immunol. Meth. 76, 171-183
1;1985) .
48. J.S. McDougal, et al., Binding of HTLV-
I:II/LAV to T4+ T cells by a complex of the
l,lOK viral protein and the T4 molecule, Sci-
ence 231, 382-385 (1986).
49~ C.B. Reimer, et al., Standardization of
ligand binding assays for alpha-fetoprotein.
In Immunofluorescence and Related Staining
Techniques. W., Knapp, K. Holubar, and G.
Wick, eds. (Amsterdam:Elsevier/North Holland
Press) p. 189 (1978).
50. M.B. Wilson and P.K. Nakane, Recent develop-
ments i.n the periodate method of conjugating
horseradish peroxidase (HRPO) to antibodies.
In Immunofluorescence and Relating Staining
Techniques, W. Knapp, K. Holubar, and G.
Wick, eds. (Amsterdam:Elsevier/North Holland
Press), p. 215 (1978).
51. J,. Porath, R. Axen, and S. Ermback, Chemical
coupling of proteins to agar, Nature 215,
14491-1493 (1967) .
52. B.J. Poiesz, et al., Detection and isolation
of type C retrovirus particles from fresh and
cultured lymphocytes of a patient with cuta-
neous T cell lymphoma. Proc; Natl. Acd. Aci.
USA 77, 7415-7419 (1980).
53. P. Clapham, K. Nagy, and R.A. Weiss, Pseudo-
types o:E human T-cell virus types 1 and 2:
1:~ ~ 0 '~ ~ 2
-ill-
Neutralization by pateints' sera, Proc. Natl.
l~,cad. Sci. USA 81, 2886-2889 (1984).
54. A..G. Dalgleish, et al., The CD4 (T4) antigen
is an essential component of the receptor for
the AIDS retrovirus, Nature 312, 763-766
(1984) .
55. M. Popovic, et al., Detection, isolation, and
continuous production of cytopathic retor-
v:iruses (HTLV-III) from patients with AIDS
and Pre-AIDS, Science 224, 497-500 (1984).
56. K., Nagy, et al . , Human T-cell leukemia virus
~5 type 1: induction of sycytia and inhibition
by patients' sera, Int. J. Cancer 32, 321-328
(7.983) .
57. D.M. Neville and H. Glossman, Molecular
weight determination of membrane protein and
glycoprotein subunits by discontinuous gel
electrophoresis in dodecyl sulfate, Methods
Enzymol. 32, 92-102 (1974))
25 58 ~ A. Helenius, et al . , On the entry of Semliki
Forest virus into BHK-21 cells, J. Cell.
Biol. 84,, 404-420 (1980).
59. R.D. Cone and R.C. Mulligan, High-efficiency
30 gene transfer into mammalian cells: Genera-
tion of helper-free recombinant retroviruses
with broad mammalian host range, Proc. Natl.
Acad. Sci. USA 81, 6349-6353 (1984).
-112- 1
60. F.W. Alt et al., "Probes for Specific mRNAs
by Subtractive Hybridization: Anomalous Ex-
pression of Immunoglobulin Genes", in Eucary-
otic Gene ReQUlation, R.Axel, T.Maniatis and
C.F. Fox) eds. (New York: Academic Press),
pp. 407-419 (1979).
61. M. Kozak) "Comparison of Initiation of Pro-
tein Synthesis in Procaryotes, Eucaryotes and
Organelles", Microbiol. Rev. 47: 1-45 (1983).
62. L. Hood, M. Kronenberg and T. Hunkapiller, "T
Cell Antigen Receptors and the Immunoglobulin
Supergene Family", Cell 40: 225-229 (1985).
63. S. 'ronegawa, "Somatic Generation of Antibody
Diversity", Nature 302: 575-581 (1983).
64. J. Kyte and R.F. Doolittle, "A Simple Method
for Displaying the Hydropathic Character of a
Protein", J. Mol. Biol. 157: 105-132 (1982).
65. G. von Heijne, "Patterns of Amino Acids Near
Signal-Sequence Cleavage Sites", Eur. J. Bio-
chem,. 133: 17-21 (1983).
66. E.A. Kabat et al., "Sequences of Proteins of
Immunologi.cal Interest" (Washington, D.C.;
U.S. Department of Health and Human Servic-
es), p. 281 (1983).
67. A.F. Will.iams et al., "Cell Surface Glyco
proteins and the Origins of Immunity", In the
Proceedings of the Sigrid Juselius Symposi
um, L.C. Andersson, C.G. Gahmberg and P.
-113-
Ekblom, eds. (New York: Academic Press), in
press (1984).
68. L~.M. Amzel and R.J. Poljak, "Three-Dimension-
al Structure of Immunoglobulins", Ann. Rev.
Biochem. 48: 961-997 (1979).
69. P.Y. Chou and G.D. Fasman, "Empirical Predic-
tions of Protein Conformation", Ann. Rev.
-Biochem. 47: 251-276 (1978).
70. P.J. Maddon, et al., The isolation and nu
cleotide sequence of a cDNA encoding the T
cell surface protein T4: A new member of the
immunoglobulin gene family, Cell 42, 93-104
(:1985) .
71. R.A. Adams, A. Flowers and B.J. Davis, Direct
implantation and serial transplatation of
human acute lymphoblastic leukemia in ham
st:ers, SB-2, Can. Res. 28~ 1121-1125 (1968).
72. G.O. Gey, W.D. Coffman and M.T. Kubicek,
Tissue culture studies of the proliferative
capacity of cervical carcinoma and normal
epithelium, Cancer Res. 12, 264-265 (1952).
73. R.J.V. Pulvertaft, Cytology of Burkitt's
tumor (African lymphoma), Lancet _I, 238-240
(1964) .
74. N.~J. Dimmock, Initial stages of infection
with animal viruses, J. Gen. Virol. 59, 1-22
( 1'982 ) . .
-114-
75. J. White, M. Kielian and A. Helenius, Mem-
brane fusion proteins of enveloped animal
viruses, Quart. Rev. Biophys. _16, 151-195
(1983).
76 ~ M'. Marsh, The entry of enveloped viruses into
cells by endocytosis, Biochem. J. 2I8, 1-10
(1984).
77~ M. Kielian and A. Helenius, Entry of alpha-
viruses. In the Togaviridae and Flaviviri-
dae, S. Schlesinger and M.J. Schlesinger,
a<is., (Plenum Publishing Corp.), pp. 91-119
(:1986) .
78. S.. Ohkuma, and B. Poole, Fluorescence probe
measurements of the intralysosomal pH in
living cells and the pertubation of pH by
various agents, Proc. Natl. Acad. Sci. USA
3327-3331 (1978).
79~ F.R. Maxfield, Weak bases and ionophore rap-
idly and reversibly raise the pH of endocytic
vesicles in cultured mouse fibroblasts, J.
Cell. Biol. 95, 676-681 (1982).
-
80~ A. Helenius, M. Marsh, and J. White, Inhibi-
ti~~n of Semliki Forest virus penetration by
ly~sosomotropic weak bases, J. Gen. Virol. _58,
47~-61 (1982) .
81. R.'.C. Johnson and J. C. McArthur, AIDS and the
brain, TINS 9, 91-94 (1986).
..,
-115-
82. P.M. Snow, M. Van de Rijn and C. Terhorst,
"Association Between the Human Thymic Differ-
entiation Antigens T6 and T8", Eur. J. Im-
munol., in press (1985).
83~ P.M. Snow and C. Terhorst, "The T8 Antigen is
a Multimeric Complex of Two Distinct Subunits
on Human Thymocytes but Consists of Homo-
mu.ltimeric Forms on Peripheral Blood T Lym-
ph~~cytes", J. Biol. Chem. 258: 14675-14681
(1!83) .
84. C. Terhorst et al., "Biochemical Analysis of
Human T Lymphocyte Differentiation Antigens
T4 and T5", Science 209: 520-521 (1980).
85. W.H. Hildemann, "Immunocompetance and Allo-
geneic Polymorphism Among Invertebrates",
Transplantation 27: 1-3 (1979).
86. V.L. Scofield et al., "Protochordate Allore-
cognition is Controlled by a MHC-like Gene
System", Nature 295: 499-502 (1982).
87) T.L. Lentz, et al., Is the acetylcholine
receptor a rabies virus receptor ?, Science
215 182-184 (1982).
88. J.D~. Fingeroth, et al., Epstein-Barr virus
receptor of human B lymphocytes is the C3d
receptor CR2, Proc. Natl. Acad, Sci. USA 81,
4510-4514 (1984).
89~ P.E. Tambourin, et al., The physiopathology
of Friend leukemia, Leukemia Res. 3, 117-129
_
-116-
('1979) "
90. A,. Oliff, et al., Isolation of transplantable
erythraleukemia cells from mice infected with
helper-independent Friend murine leukemia
virus, Hlood 58, 244-254 (1981).
91~ J.E. Silver and J.M. Fredrickson, Suscep-
tibility to Friend helper virus leukemias in
C:?CB recombinant inbred mice, J. Exp. Med.
1.'58, 1693-1702 (1983) .
92~ P.A. Chatis, et al., Role for the 3' end of
the genome in determining disease specificity
of Friend and Moloney murine leukemia virus-
es, Proc. Natl. Acad. Sci, USA. 80, 4408-4411
(7.983) .
93~ P.A. Chatis, et al., A 3' end fragment encom
passing the transcriptional enhancers of
nondefective Friend virus confers erthyro-
leukemogenicity on Moloney leukemia virus, J.
Virol. 52, 248-254 (1984).
94. A. Bosze, H.J. Thiesen and P. Charnay, A
transcriptional enhancer with specificity for
erythroi.d cells is located in the long termi-
nal repeat of the Friend murine leukemia
virus, EMBO J. 5, 1615-1623 (1986).
95~ A.N. Barclay, et al., Immunoglobulin-related
structures associated with vertebrate cell
surfaces, in press.
1340'l0~
-117-
96. M.O. Dayhoff, W.C. Barker and L.T. Hunt,
Establishing homologies in protein sequences.
In Methods in Enzymology. Enzyme Sturcture
Part I, C.H.W. Hirs and S.N. Timasheff, eds.
(;New York: Academic Press), pp. 524-545
(1983).
97~ Y. Yanagi, et al., A human T cell-specific
cl7NA clone encodes a protein having extensive
homology to immunoglobulin chains, Nature
308, 145-149 (1984).
98~ G.K. Sim, et al., Primary structure of human
T-cell receptor -chain, Nature 312, 771-775
( 1.984 ) .
99~ H. Saito, et al., A third rearranged and
expressed gene in .a clone of cytotoxic T
lymphocytes, Nature 312, 36-40 (1984).
ZO
100. H. Saito, et al., Complete primary structure
of the E chain and gene of the mouse major
histocompatibility complex, Proc. Natl. Acad.
USA 80, 5520-5524 (1983).
101. M. Isobe, et al., The gene encoding the T-
ce:Ll surface protein T4 is located on human
chromsome 12, Proc. Natl. Acad. Sci. USA, _83,
43Si9-4402 (1986) .
102. J.M. Roberts and R. Axel, Gene Amplification
and Gene Correction in Somatic Cells, Cell
29, 109-119 (1982).
.,-.. .
. .
-118-
103. D.t3. Pfarr, G. Sathe and M.E. Reff, A Highly
Modular Cloning Vector for the Analysis of
Euc:aryotic Genes and Gene Regluatory Ele-
ments, DNA, 4, 461-467 (1985).
104. G. Urlaub and L.A. Chasin, Isolation of Chi-
nese Hamster Cell Mutants Deficient In Dihy-
drofolate Reductase Activity, Proc. Natl.
Acad. Sci.. USA, 77, 4216-4220 (1980).
105. Gay, D. et al., Nature 328: 626-629 (1987).
106. Sleckman, B.D. et al., Nature 328: 351-353
(1987) .
107. Yan:isch-Perron, et al., Gene 33: 103 (1985).
108. Berg, P.,. et al. Mol. Cell. Hiol. _3: 246
(1983) .
109. Subramani" et al., Mol. Cell Biol. _1: 854
(198.1) .
110. Frayne, et al., Mol. Cell Biol. _4: 2921
(1984) .
111. Schumperli., et al., Proc. Natl. Acad. Sci.
USA ,79: 257 (1982).
112. Gross, et. al., Mol. Cell Biol. 5: 1015
_
(198'5) .
113. Pfarr, et al., DNA 5: 115 (1986).
114. Rao, et al., Cell Immunol. 80: 310 (1983).
-
,.~.. .
1 ~~0'~02
-119-
115. Mr.Clure, et al., Cold Spring Harbor Confer-
ence on Cell Proliferation 9: 345 (1982).
116. Urlaub, et al., Cell 33: 405 (1983).
117. K~.m, et al., Cell 42: 129 (1987).
118. Wi.gler, et al., PNAS USA 76: 1373 (1979).
119. Copeland, et al., Cell 17: 993 (1979).
120. Sattentau, et al., Science 234: 1120 (1986).
121. Greenstein, et al., Ann. Inst. Pastuer 138:
134 (1987) .
122. Gay, et al., Ann. I9nst. Pasteur 138: 127
( 1'9 8 7 ) .
25
35~
