Note: Descriptions are shown in the official language in which they were submitted.
1
~'LANT STRUCTURAL GENE EXPRESSION
BACKGROUND
Shuttle Vectors
Shuttle vectors, developed by Ruvkun and Ausubel
(1981) Nature 289:85-88, provide a way to insert
foreign genetic materials into positions of choice in a
large plasmid, virus, or genome. There are two main
problems encountered when dealing with large plasmids or
- genomes. Firstly, the large plasmids may have many
sites for each restriction enzyme. Unique, site-
specific cleavage reactions are not- reproducible and
multi-site cleavage reactions followed by ligation lead
to great difficulties due to the scrambling of the many
fragments whose order and orientation one does not want
changed. Secondly, the transformation efficiency with
large DNA plasmids; is very low. Shuttle vectors allow
one to overcome these difficulties by facilitating the
insertion, often _i.n vitro, of the foreign genetic
material into a smaller plasmid, then transferring,
usually by in_ vivo techniques, to the larger plasmid.
A shuttle vector consists of a DNA molecule,
usually a plasmid, capable of being introduced into the
ultimate recipient: bacteria. It also includes a copy of
the fragment of the recipient genome into which the
foreign genetic material is to be inserted and a DNA
segment coding for a selectable trait, which is also
inserted into the recipient genome fragment. The
selectable trait ("marker") is conveniently inserted by
transposon mutagenesis or by restriction enzymes and
ligases.
The shuttle vector can be introduced into the
ultimate recipient: cell, typically a bacterium of the
genus Acrrobacterium by a tri-parental mating (Ruvkun and
Ausubel, supra), direct transfer of a self-mobilizable
vector in a bi-parental mating, direct uptake of
exogenous DNA by P~grobacterium cells ("transformation",
la 1340'~1~
using the conditions of M. Holsters et al (1978) Molec.
Gen. Genet. 163:181--187), by spheroplast fusion of
Ag~robacterium_ with another
~~ .~ 3 ~4 d '~ 1 ~
bacterial cell; by uptake of liposome-encapsulated DNA; or infection with a
shuttle vector that is based on a virus that is capable of being packaged _in
vitro. A tri-parental mating involves the mating of a strain containing a
mobilizable plasmid, which carries genes for plasmid mobilization and
conjugative transfer, with the strain containing the shuttle vector. If the
shuttle vector is capable of being mobilized by the plasmid genes, the shuttle
vector is transferred to the recipient cell containing the large genome, e.g.
the Ti or Ri plasmids o,F Agrobacterium strains.
After the shuttle vector 'is introduced into the recipient cell, possible
events include a double cross over with one recombinational event on either
side of the marker. This evens: will result in transfer of a DNA segment
containing the marker to the recipient genome replacing a homologous segment
lacking the insert. To select for cells that have lost the original shuttle
vector, the shuttle vector must: be incapable of replicating in the ultimate
host cell or be incompatible with an independently selectable plasmid pre-
existing in the recipient cell. One common means of arranging this is to
provide in the third parent another plasmid which is incompatible with the
shuttle vector and which carries a different drug resistance marker.
Therefore, when one selects for' resistance to both drugs, the only surviving
cells are those in which the marker on the shuttle vector has recombined with
the recipient genome. If the shuttle vector carries an extra marker, one can
then screen for and discard cells that are the result of a single cross-over
between the shuttle vector and the recipient plasmid resulting in cointegrates
in which the entire shuttle vector is integrated with the recipient plasmid.
If the foreign genetic material is inserted into or adjacent to the marker
that is selected for, it will also be integrated into the recipient plasmid as
a result of the same double recombination. It might also be carried along
when inserted into the h~~mologous fragment at a spot not within or adjacent
to
the marker, but the greater the distance separating the foreign genetic
material from the marker, the more likely will be a recombinational event
occurring between the foreign genetic material and marker, preventing
transfer of the foreign ~lenetic material.
Shuttle vectors have proved useful in manipulation of Agrobacterium
plasmids: see D. J. GariFinkel ~e_t _al. (1981) Cell 27:143-153, A. J. M.
Matzke
and M. D. Chilton (1981) J. Molec. Appl. Genet. _1:39-49, and J. Leemans _et
_al.
(1981) J. Molec. Appl. GE~net. 1.;149-164, who referred to shuttle vectors by
the term "intermediate vectors""
-2-
~.~~0'~14
Agrobacterium--Overview
Included within the gram-negative bacterial family Rhizobiaceae in the
genus Agrobacterium are the species A. turnefaciens and A. rhizogenes. These
species are respectivel~~ the causal agents of crown gall disease and hairy
root disease of plants. Crown gall is characterized by the growth of a gall
of dedifferentiated tissue. Hairy root is a teratoma characterized by
inappropriate induction of rooi:s in infected tissue. In both diseases, the
inappropriately growing plant tisssue usually produces one or more amino acid
derivatives, known as opines, not normally produced by the plant which are
cataboTized by the infecting bacteria. Known opines have been classified into
three families whose type members are octopine; nopaline, and agropine. The
cells of inappropriately growing tissues can be grown in culture, and, under
appropriate conditions, be regEm erated into whole plants that retain certain
transformed phenotypes.
Virulent strains of Agrobacterium harbor large plasmids known as Ti
(tumor-inducing) plasmids in A._ tumefaciens and Ri (root-inducing) plasmids
in
A. rhizogenes. Curing a strain of these plasmids results in a loss of
pathogenicity. The Ti plasmid contains a region, referred to as T-DNA
(transferred-DNA), which in tumors is found to be integrated into the genome
of the host plant. The T-DNA encodes several transcripts. Mutational studies
have shown that some of these are involved in induction of tumorous growth.
Mutants in the genes for tml, tmr, and tms, respectively, result in large
tumors (in tobacco), a propensity to generate roots, and a tendency for shoot
induction. The T-DNA also encodes the gene for at least one opine synthetase,
and the Ti plasmids are ~~ften classified by the opine which they caused to be
synthesized. Each of the T-DNA genes is under control of a T-DP~A promoter.
The T-DNA promoters resemble eukaryotic promoters in structure, end they
appear to function only in the transformed plant cell. The Ti ~lasmid also
carries genes outside the T-DNA region. These genes are involved in functions
which include opine catabolism, oncogenicity, agrocin sensitivity,
replication, and autotransfer to bacterial cells. The Ri plasmid is organized
in a fashion analogous to the Ti plasmid. The set of genes and DNA sequences
responsible for transforming the plant cell are hereinafter collectively
referred to as the transformation-inducing principle (TIP). The designation
TIP therefore includes both Ti <ind Ri plasmids. The integrated segment of a
TIP is termed herein "T-ETNA", whether derived from a Ti plasmid or an Ri
-3-
134014
4
plasmid. Recent general reviews of AQrobacterium-caused
disease include those by D.J. Merlo (1982), Adv. Plant
Pathol. _1:139-178 L.W. Ream and M.P. Gordon (1982),
Science 218:854-85~9, and M.W. Bevan and M.D. Chilton
(1982), Ann. Rev. Genet. 16:357-384: G. Kahl and J.
Schell (1982) Molecular Biology of Plant Tumors.
Agrobacterium--Infection of Plant Tissues
Plant cells c:an be transformed by Agrobacterium in
a number of methods known in the art which include but
are not limited to co-cultivation of plant cells in
culture with A_grobacterium, direct infection of a plant,
fusion of plant protoplasts with AQrobacterium
spheroplasts, direct transformation by uptake of free
DNA by plant cell protoplasts, transformation of
protoplasts having partly regenerated cell walls with
intact bacteria, transformation of protoplasts by
liposomes containing T-DNA, use of a virus to carry in
the T-DNA, microinjection, and the like. Any method
will suffice as long as the gene is reliably expressed,
and is stably transmitted through mitosis and meiosis.
The infection of plant tissue by Aarobacterium is a
simple technique well known to those skilled in the art
(for an example, see D. N. Butcher et al. (1980) in
Tissue Culture Methods for Plant Pathologists, eds.:
D.S. Ingrams and J'.P. Helgeson, pp. 203-208). Typi-
cally a plant is wounded by any of a number of ways,
which include cutting with a razor, puncturing with a
needle, or rubbing with abrasive. The wound is then
inoculated with a solution containing tumor-inducing
bacteria. An alternative to the infection of intact
plants is the inoculation of pieces of tissues such as
potato tuber disks. (D. K. Anand and G.T. Heberlein
(1977) Amer. J. Bot. 64:153-158) or segments of tobacco
stems (K. A. Barton et al (1983) Cell 32:1033-1043).
After induction, t:he tumors can be placed in tissue
culture on media lacking phytohormones. Hormone
A340'~1~
independent growth is typical of transformed plant
tissue and i;s in great contrast to the usual conditions
of growth of such tissue in culture (A. C. Braun (1956)
Cancer Res. 16:53-56).
5 Aarobacterium is also capable of infecting isolated
cells and ce:Lls grown in culture, Marton et al (1979)
Nature 277:1:29-131, and isolated tobacco mesophyll
protoplasts. In the latter technique, after allowing
time for paritial regeneration of new cell walls,
Aqrobacterium cells were added to the culture for a time
and then kil:Led by the addition of antibiotics. Only
those cells taxpose~d to A. tumefaciens cells harboring
the Ti plasm:id were capable of forming calli when plated
on media laclcing hormone. Most calli were found to
contain an enzymatic: activity involved in opine
anabolism. Other 'workers (R. B. Horsch and R.T. Fraley
(18 January :L983) 15th Miami Winter Symposium) have
reported transformations by co-cultivation, leading to a
high rate (goeater than 10%) of calli displaying
hormone-independent growth, with 95% of those calli
making opine:a. M.:R» Davey et al (1980) in Ingram and
Helgeson, su,~~a_. p;p» 209-219, describe the infection of
older cells i~hat h.ad been regenerated from protoplasts.
Plant protoplasts can be transformed by the direct
uptake of TI1? plas:mids. M.R. Davey et al (1980) Plant
Sci. Lett. lt3_:307-313, and M.R. Davey et al (1980) in
Ingram and Helgeso:np supra, were able to transform
Petunia protoplasts with the Ti plasmid in the presence
of poly-L-~~ha-or:nithine to a phenotype of opine
synthesis and hormone-independent growth in culture. It
was later shown (J. Draper et al (1982) Plant and Cell
Physiol. 23:451-458, M.R. Davey et al (1982) in Plant
Tissue Cultu~__°e 1982, ed: A. Fujiwara, pp. 515-516) that
polyethelene glycol stimulated Ti uptake and that some
T-DNA sequences were integrated into the genome. F.A.
Krens et al (1982) Nature 296:72-74, reported similar
13~0~1~
5a
results using polyethelene glycol following by a
calcium shock, though their data suggests that the
integrated T-DNA included flanking Ti plasmid sequences.
An alternative method to obtain DNA uptake involves
the use of liposomes. The preparation of DNA containing
liposomes is taught by Papahadjopoulos in U.S. Patents
4,078,052 and 4,235,871. Preparations for the introduc-
tion of Ti-D:NA via,:liposomes have been reported (T.
Nagata et al (1982) in Fujiwara, s, u~ra, pp. 509-510,
and T. Nagat~a (1981) Mol. Gen. Genet. 184:161-165). An
analogous system involves the fusion of plant and
bacterial cells after removal of their cell walls. An
example of tihis technique is the transformation of Vinca
protoplast by Aarobacterium spheroplasts reported by S.
Hasezawa et ;al (1981) Mol. Gen. Genet. 182:206-210.
Plant protoplasts can take up cell wall delimited
Agrobacteriwm_ cells (S. Hasezawa et al (1982) in
Fujiwara, su~~ra pp. 517-518).
T-DNA cyan be transmitted to tissue regenerated from
a fusion of 'two protoplasts, only one of which had been
transformed (G. J. Wullems et al (1980) Theor. Appl.
Genet. 56:20.3-208). As detailed in the section on
Regeneration of Plants, T-DNA can pass through meiosis
and be transmitted to progeny as a simple Mendelian
trait.
~~~~'~lt~
Agrobacterium--Re4eneration of Plants
Differentiated plant tissues with normal morphology have been obtained
from crown gall tumors. A. C. Braun and H. N. Wood (1976) Proc. Natl. Acad.
Sci. USA 73:496-500, grafted tobacco teratomas onto normal plants and were
able to obtain normally appearing shoots which could flower. The shoots
retained the ability to make opines and to grow independently of phytohormones
when placed in culture. In the plants screened, these tumor phenotypes were
not observed to be transmitted to progeny; apparently being lost during
meiosis (R. Turgeon et ~1. (1976) Proc. Natl. Acad. Sci. USA 73:3562-3564).
Plants which had spontaneouly lost tumorous properties, or which were derived
from teratoma seed, were initially shown to have lost all their T-DNA (F.-M.
Yang et al. (1980) In Vitro 16:87-92, F. Yang et al. (1980) Molec. Gen. Genet.
177:707-714, M) Lemmers et al. (1980) J. Mol. Biol. 144:353-376). However,
later work with plants that had become revere ants after hormone treatment
(lmg/1 kinetin) showed that plants which had gone through meiosis, though
losing T-DNA genes responsible for the transformed phenotype, could retain
sequences homologous to both ends of T-DNA (F. Yang and R. B. Simpson (1981)
Proc. Natl. Acad. Sci. UiSA 78:4151-4155). G. J. Wullems et _al. (1981) Cell
24:719-724, further demonstrated that genes involved in opine anabolism were
capable of passing throuigh meiosis though the plants were male sterile and
that seemingly unaltered T-DNA could be inherited in a Mendelian fashion (G.
Wullems et al. (1982) in A) Fujiwara, su ra . L. Otten et al. (1981) Molec.
Gen. Genet. 183:209-213, used Tn7 transposon-generated Ti plasmid mutants in
the tms (shoot-inducing) locus to create tumors which proliferated shoots.
When these shoots were regenerated into plants, they were found to form self-
fertile flowers. The resultant seeds germinated into plants which contained
T-DNA and made opines. Similar experiments with a tmr (root-inducing) mutant
showed that full-length 'T-DNA could be transmitted through meiosis to
progeny,
that in those progeny no,paline genes could be expressed, though at variable
levels, and that cotrans~Formed ,yeast alcohol dehydrogenase I gene was not
expressed (K. A. Barton ~e_t _al. (1983) (Cell _32:1033-1043). It now appears
that regenerated tissues which lack T-DNA sequences are probably descended
from untransformed cells which "contaminate" the tumor (G. Ooms _et _al.
(1982)
Cell 30:589-597).
Roots resulting from transformation from _A, rhizogenes have proven
relatively easy to regenerate into plantlets (M.-D. Chilton et al. (1982)
Nature 295:432-434.
._ -6-
1340'14
7
Ag~robacterimm--Genes on the TIP Plasmids:
A number of genes have been identified within the
T-DNA of the: TIP plasmids. About half a dozen octopine
plasmid T-DNfA transcripts have been mapped (S. B. Gelvin
et al (1982) Proc., Natl. Acad. Sci. USA 79:76-80, L.
Willmitzer ea al 1;1982) EMBO J. 1:139-146) and some
functions have been assigned (J. Leemans et al (1982)
EMBO J. 1:147-152). The four genes of an octopine type
plasmid that. have been well defined by transposon
mutagenesis include tms, tmr, and tml (D. J. Garfinkel
et al (1981) Cell 27:143-153). Ti-plasmids which carry
mutations in theses genes respectively incite tumorous
calli of Nicotiana tabacum which generate shoots,
proliferate roots,. and are larger than normal. In other
hosts, mutants of these genes can induce different
phenotypes (see Bs:van and Chilton, s_upra). The
phenotypes c~f tms and tmr are correlated with
differences in ths: phytohormone levels present in the
tumor. The differences in cytokinin:auxin ratios are
similar to those which in culture induce shoot or root
formation in. untransformed callus tissue (D. E. Akiyoshi
et al (1983) Proc.. Natl. Acad. Sci. USA 80:407-411).
T-DNA containing a functional gene for either tms or tmr
alone, but n.ot functional tml alone, can promote signif-
icant tumor growth. Promotion of shoots and roots is
respectively stimulated and inhibited by functional tml
(L.W. Ream e.t al (1983) Proc. Natl. Acad. Sci. USA
80:1660-1664). Mutations in T-DNA genes do not seem to
affect the insertion of T-DNA into the plant genome (J.
Leemans et al (1982) supra, L.W. Ream et al (1983)
supra). The ocs gene encodes octopine synthetase, which
has been sequenced by H. De Greve et al (1982) J. Mol.
Appl. Genet. _1:495-511. It does not contain introns
(intervening' sequs:nces commonly found in eukaryotic
genes which are posttranscriptionally spliced out of the
messenger precursor during maturation of the mRNA). It
134071~~
8
does have sequences that resemble a eukaryotic tran-
scriptional signal ("TATA box") and a polyadenylation
site. As plant cells containing the enzyme octopine
synthetase detoxify homo-arginine, the ocs gene may
prove to be .a useful selectable marker for plant cells
that have been transformed by foreign DNA (G.M.S. Van
Slogteren et al (1982) Plant Mol. Biol. 1:133-142).
Nopalin~e Ti plasmids encode the nopaline synthetase
gene (nos), 'which has been sequenced by A. Depicker et
al (1982) J. Mol. Appl. Genet. _1:561-573. As was found
with the ocs gene, nos is not interrupted by introns.
It has two putative polyadenylation sites and a
potential "T:~TA box"'. In contrast to ocs, nos is pre-
ceded by a sequence which may be a transcriptional
signal known as a "CAT box". J.C. McPhersson et al
(1980) Proc. Natl. Acad. Sci. USA 77:2666-2670,
reported the in vitro translation of T-DNA encoded mRNAs
from crown gall tissues.
Transcription .from hairy root T-DNA has also been
detected (L. Willmitzer et al (1982) Mol. Gen. Genet.
186:16-22). Functionally, the hairy root syndrome
appears to bra equivalent of a crown gall tumor incited
by a Ti plasmid mutated in tmr (F. F. White and E.W.
Nester (198 0,) J. Bacteriol. 144:710-720.
In euka:ryotes, methylation (especially of cytosine
residues) of DNA is correlated with transcriptional
inactivation: genes that are relatively undermethylated
are transcribed into mRNA. Gelvin et al (1983) Nucleic
Acids Res. 1:159-174 have found that the T-DNA in crown
gall tumors :is always present in at least one unmethyl-
ated copy. '.that the same genome may contain numerous
other copies of T-DNA which are methylated suggests that
the copies o:E T-DNA in excess of one may be biologically
inert. (See also G. Ooms et al (1982) Cell
30:589-597.)
The Ti plasmid encodes other genes which are
outside of tile T-DNA region and are necessary for the
infection process. (See M. Holsters et al (1980)
1340714
8a
Plasmid 3_:212-230 for nopaline plasmids, and H. De
Greve et al (1981) Plasmid 6:235-248, D.J. Garfinkel
and E.W. Nester (1980) J. Bacteriol. 144:732-743, and G.
Ooms (1980) .J. Bacteriol. 144:82-91 for octopine plas-
mids. Most important are the one genes, which when
mutated result in T:i plasmids incapable of oncogenicity.
(These loci .are also known as vir for virulence). The
one genes function :in trans, being capable of causing
the transformation of plant cells with T-DNA of a
different plasmid type and physically located on another
plasmid (J. l3ille et al (1982) Plasmid 7:107-118, H.J.
Klee et al (:1982) J. Bacteriol. 150:327-331, M.-D.
Chilton (18 ;January 1983) 15th Miami Winter Symp.
Nopaline Ti DNA has direct repeats of about 25 base
pairs immediately adjacent to the left and right borders
of the T-DNA which might be involved in either excision
from the Ti plasmid or integration into the host genome
(N.S. Yadav et al (1982) Proc. Natl. Acad. Sci. USA
79:6322-6326;x, and a homologous sequence has been
observed adjacent to an octopine T-DNA border (R. B.
Simpson et a:l (1982) Cell 29:1005-1014). Opine
catabolism i:a specified by the ocs and nos genes,
respectively of octopine- and nopaline-type plasmids.
The Ti plasm:id also encodes functions
~. 3 ~ Q '~ 14
necessary for its own reproduction including an origin of replication. Ti
plasmid transcripts have been detected in A. tumefaciens cells by S. B. Gelvin
et al. (1981) Plasmid 6,:17-29, who found that T-DNA regions were weakly
transcribed along with non-T-DNA sequences. Ti plasmid-determined
characteristics have been reviewed by Merlo, supra (see especially Table II),
and Ream and Gordon supra.
Agrobacterium-TIP Plasmid DNA
Different octopine-type Ti plasmids are nearly 100% homologous to each
other when examined by DNA hybridization (T. C. Currier and E) W. Nester
(1976) J. Bacteriol. l2Ei:157-165) or restriction enzyme analysis (D. Sciaky
et
al. (1978) Plasmid 1:238-253). Nopaline-type Ti plasmids have as little as
67% homology to each other (furrier and Nester, su ra . A survey revealed
that different Ri plasmiids are very homologous to each other (P. Costantino
_et
al. (1981) Plasmid 5:17(1-182). N. H. Drummond and M.-D. Chilton (1978) J.
Bacteriol. 136:1178-118~~, showed that proportionally small sections of
octopine and nopaline type Ti plasmids were homologous to each other. These
homologies were mapped in detail by G. Engler _et _al. (1981) J. Mol. Biol.
152:183-208. They found. that three of the four homologous regions were
subdivided into three (cw erlapping the T-DNA), four (containing some one
genes), and nine (having one genes) homologous sequences. The uninterrupted
homology contains at least one tra gene (for conjugal transfer of the Ti
plasmid to other bacterial cells;), and genes involved in replication and
incompatibility. This uninterrupted region has homology with a Stern plasmid
(involved in symbiotic nitrogen fixation) from a species of Rhizobium, a
different genus in the family Rhizobiaceae (R. K. Prakash _et _al. (1982)
Plasmid 7:271-280). The order of the four regions is not conserved, though
they are all oriented in the same direction. Part of the T-DNA sequence is
very highly conserved between nopaline and octopine plasmids (M.-D. Chilton
_et
al. (1978) Nature 275:14'7-149, A. Depicker et _al. (1978) Nature 275:150-
153). Ri plasmids have Keen shown to have extensive homology among
themselves, and to both octopine (F. F. White and E. W. Nester (1980) J.
Bacteriol. 144:710-720) rind nopaline (G. Risulea- _et _al. (1982) Plasmid
_7:45-
51) Ti plasmids, primarily in regions encoding one genes. Ri T-DNA contains
extensive though weak homologies to T-DNA from both types of Ti plasmid (L.
Willmitzer et al. (1982) Mol. Gen. Genet. 186:3193-3197). Plant DNA from
uninfected Nicotiana glauca contains sequences, referred to as cT-DNA
-g_
.,
(cellular T=DNA); that show homology to a portion of the Ri T-DNA (F. F. White
et al. (1983) Nature 301.:348-350).
It has been shown that a portion of the Ti (M.-D. Chilton et _al. (1977)
Cell 11:263-271) or Ri -(M.-D. Chilton (1982) Nature 295:432-434, F. F. White
et al. (1982) Proc. Natl. Acad) S ci. USA 79:3193-3197, L. Willmitzer (1982)
Mol. Gen. Genet. 186:16-22) plasmid is found in the DNA of tumorous plant
cells. The transferred DNA is known as T-DNA. T-DNA is integrated into the
host DNA (M. F. Thomashow et al. (1980) Proc. Natl. Acad. Sci. USA _77:6448-
6452, N. S. Yadav et al. (1980) Nature 287:458-461) in the nucleus (M. P) Nuti
et al. (1980) Plant Sci. Lett..18:1-6, L. Willmitzer _et _al. (1980) Nature
287:359-361, M.-D. Chilton et a_1. (1980) Proc. Natl. Acad) Sci. USA 77:4060-
4064).
M. F. Thomashow et al. (19.80) Proc. Natl. Acad. Sci. USA _77:6448-6452,
and M. F. Thomashow et al. (1980) Cell _19:729-739, found the T-DNA from
octopine-type Ti plasmid~~ to have been integrated in two separate sections,
TL-DNA and TR-DNA, left ~~nd right T-DNAs respectively. The copy numbers of TR
and TL can vary (D. J. Merlo et al. (1980) Molec. Gen. Genet. 177:637-643). A
core of T-DNA is highly homologo us to nopaline T-DNA (Chilton et _al. (1978)
supra and Depicker et al" (1978;).su ra , is required for tumor maintenance,
is
found in TL, is generally present in one copy per cell, and codes for the
genes tms, tmr, and tml. On the other hand TR can be totally dispensed with
(M. De Beuckeleer et al. (1981) Molec. Gen. Genet. 183:283-288, G. Ooms _et
_al.
(1982) Cell 30:589-597), though found in a high copy number (D. J. Merlo _et
al. (1980) su ra . G. Oc~ns et dl. (1982) Plasmid _7:15-29, hypothesized that
TR is involved in T-DNA integration, though they find that when TR is deleted
from the Ti plasmid, A. _tumefaciens does retain some virulence. G. Ooms _et
al. (1982) Cell 30:589-597, showed that though T-DNA is occasionally deleted
after integration in the plant genome, it is generally stable and that tumors
containing a mixture of cells that differ in T-DNA organization are the result
of multiple transformation events. The ocs is found in TL but can be deleted
from the plant genome without loss of phenotypes related to tumorous growth.
The left border of integrated TL has been observed to be composed of repeats
of T-DNA sequences which .are in either direct or~inverted orientations (R. B.
Simpson et al. (1982) Cell 29:1005-1014).
In contrast to the situation in octopine-type tumors, nopaline T-DNA is
integrated into the host ~Ienome in one continuous fragment (M. Lemmers et
'~ -10-
~34~'~1~
11
al. (1980) .J. Mol. Biol. 144:353-376, P. Zambryski et
al (1980) Science 209:1385-1391). Direct tandem
repeats were observed. T-DNA of plants regenerated from
teratomas had minor modifications in the border frag-
ments of the inserted DNA (Lemmers et al s. upra).
Sequence analysis of the junction between the right and
left borders revealed a number of direct repeats and one
inverted repeat. The latter spanned the junction
(Zambryski et al (1980) supra). The left junction has
been shown to vary by at least 70 base pairs while the
right junction varies no more than a single nucleotide
(P. Zambrysk:i et al (1982) J. Molec. Appl. Genet.
1:361-370). Left and right borders in junctions of
tandem array; were separated by spacers which could be
over 130 bp. The spacers were of unknown origin and
contained some T-DNA sequences. T-DNA was found to be
integrated into both repeated and low copy number host
sequences.
N. S. Yadav et al (1982) Proc. Natl. Acad. Sci.
USA 79:6322-6326, have found a chi site, which in the
bacteriophage lambda augments general recombination in
the surrounding DN,A as far as 10 kilobases away, in a
nopaline Ti plasmi~d just outside the left end of the
T-DNA. R.B. Simpson et al (1982) Cell 29:1005-1014,
have not obs<srved a chi sequence in an octopine Ti
plasmid, though the possible range of action does not
eliminate thE: possibility of one being necessary and
present but outside of the region sequenced. The
significance of the chi in the Ti plasmid is not known.
If the chi has a function, it is probably used in
Actrobacteriurn_ cells and not in the plants, as chi is not
found within the T-DNA.
Acrrobacterium-Maniyulations of the TIP Plasmids
As detailed i:n the section on Shuttle Vectors,
technology has been developed for the introduction of
altered DNA sequences into desired locations on a TIP
1340714
12
plasmid. 'Transposons can be easily inserted using this
technology (D. J. Garfinkel et al (1981) Cell
27:143-153). J.-P. Hernalsteen et al (1980) Nature
287:654-656, have shown that a DNA sequence (here a
bacterial transposon) inserted into T-DNA in the Ti
plasmid is transferred and integrated into the
recipient ;plant's genome. Though insertion of foreign
DNA has been done with a number of genes from different
sources, tic date the genes have not been expressed
under control of their own promoters. Sources of these
genes include alcohol dehydrogenase (Adh) from yeast
(K. A. Barton et al (1983) Cell, 32:1033-1043), AdhI
and zein from corn, interferon and globin from mammals,
and the mammalian virus SV40. M. Holsters et al (1982)
Mol. Gen. Genet. 185:283-289, have shown that a
bacterial transposon (Tn7) inserted into T-DNA could be
recovered :in a fully functional and seemingly unchanged
form after integration into a plant genome.
Deletions can be generated in a TIP plasmid by
several methods. Shuttle vectors can be used to
introduce deletions constructed by standard recombinant
DNA techniques (Cohen and Boyer U.S. Pat. 4,237,224).
Deletions with one predetermined end can be created by
the improper excision of transposons (B.P. Koekman et
al (1979) 1?lasmi~d 2:347-357, G. Ooms et al (1982)
Plasmid 7::L5-29). J. Hille and R. Schilperoot (1981)
Plasmid 6::L51-154, have demonstrated that deletions
having both ends at predetermined positions can be
generated by use of two transposons. The technique can
also be usE:d to construct "recombinant DNA" molecules
in vivo.
The nopaline synthetase gene has been used for
insertion of DNA segments coding for drug resistance
that can beg used to select for transformed plant cells.
M. Bevan (neport~ed by M.-D. Chilton et al (18 January
1340'14
12a
1983) 15th Miami Winter Symp., see also J.L. Marx
(1983) Science 219:830) and R. Horsch et al (18 January
1983) 15th Miami Winter Symp., see Marx, supra, have
inserted the kanamycin resistance gene (neomycin
phosphotransferase) from Tn5 behind (under control of)
the nopaline promoter. The construction was used to
transform plant cells which in culture displayed
resistance t~o kanamycin and its analogs such as 6418.
J. Schell et al (18 January 1983) 15th Miami Winter
l0 Symp. (see also Marx, supra), reported a similar
construction, in which the methotrexate resistance gene
(dihydrofolate reductase) from Tn7 was placed behind the
nopaline synthetase promoter. Transformed cells were
resistant to methotrexate. As plant cells containing
octopine synthetase are resistant to the toxic chemical
homo-arginine, G.M.S. Van Slogteren et al (1982) Plant
Mol. Biol. 1_:133-142, have proposed using that enzyme as
a selectable marker.
M.-D. C:hilton. et al (1983) supra, reported that A.
De Framond has constructed a "mini-Ti plasmid". In the
nopaline T-D:NA there is normally only one site cut by
the restriction enzyme KunI. A mutant lacking the site
was constructed anal a KpnI fragment, containing the
entire nopaline T-DNA, was isolated. This fragment
together with a ka.namycin resistance gene was inserted
into pRK290, thereby resulting in a plasmid which could
be maintained in A. tumefaciens and lacked almost all
non-T-DNA Ti sequences. By itself, this plasmid was not
able to transform plant cells. However when placed in
an
A. tumefaciens strain containing an octopine Ti plasmid; tumors were induced
which synthesized both octopine and nopaline. This indicated that the missing
nopaline Ti plasmid functions were complemented by the octopine Ti plasmid,
and that the nopaline "mini-Ti" was functional in the transformation of plant
cells. Chilton et al. (1983) supra also reported on the construction of a
"micro-Ti" plasmid made by resectioning the mini-Ti with SmaI to delete
essentially all of T-DNA but the nopaline synthetase gene and the left and
right borders. The micro-Ti was inserted into a modified pRK290 plasmid that
was missing its SmaI site, and employed in a manner similar to mini-Ti, with
comparable results.
H. Lorz et al. (19132) in _~Plant Tissue Culture 1982, ed: A. Fujwara,
pp. 511-512, reported v~the construction of a plasmid vector, apparently
independent of the TIP ~~ystem for DNA uptake and maintenance, that used the
nopaline synthetase gene as a marker.
Phaseolin and ene re ul'ation
In general the genE~s of higher eukaryotes are highly regulated. A
multicellular organism, such as a plant, has a number of differentiated
tissues, each with its own specialized functions, each of which requires
specialized gene products. One such tissue is the cotyledon. In legumes, the
cotyledons usually serves as the storage tissue for the seed, holding reserves
of lipid, carbohydrate, minerals, and protein until the seed needs them during
germination. In Phaseolus vulgaris L. (also known as the French bean, kidney
bean, navy bean, green bean and other names), the maj or storage protein is
known as phaseolin. This protein comprises a small number of molecular
species that are extremely homologous and equivalent to one another.
Phaseolin contributes most of the nutrition value of dried beans, often
comprising more than 10% of the weight of a dried bean.
Phaseolin is highly regulated during the life cycle of _P. vulgaris. The
protein is made essentially only while seed is developing within the pod.
Levels rise from the limit of detection to as much as half the seed's protein
content, following genetically .determined schedules for synthesis. At its
peak, phaseolin synthesi~~ can a~~count for over 80% of a cotyledon cell's
protein synthesis. At oi:her times and in other tissues, phaseolin synthesis
is undetectable. The extreme nature of phaseolin's regulation, coupled with
its worldwide nutritionall importance, has lead to much interest in the study
of phaseolin, its properties, and its regulation.
__ -13-
13~U~14
SUMMARY OF THE INVENTION
In accordance with one aspect of the present inention, there is
provided a DNA vector comprising T-DNA having a plant structural gene
inserted therein under control of a T-DNA promoter. The invention
also includes a k>acterial strain containing and replicating the DNA
vector.
The novel C)NA vector of the present invention permits the
provision of a plant comprising a genetically modified plant cell
having a plant structural gene introduced and expressed therein under
control of a T-DNA promoter. Further, the invention permits the
provision of plant tissue comprising a plant cell whose genome
includes T-DNA camprisin~g a plant structural gene inserted in such
orientation and spacing with respect to a T-DNA promoter as to be
expressible in the plant cell under control of the T-DNA promoter.
The experimental work disclosed herein is believed to be the
first demonstration that plant structural genes are expressible in
plant cells under control of a T-DNA promoter, after introduction via
T-DNA, that is to say, by inserting the plant structural genes into
T-DNA under control of a f-DNA promoter and introducing the T-DNA
containing the insert into a plant cell using known means. The
disclosed experiments are also believed to provide the first demon-
stration that plant structural genes containing introns are expressed
in plant cells under control of a T-DNA promoter after introduction
via T-DNA. These results are surprising in view of the fact that the
genes previously ~~eported to be expressible in T-DNA under control of
a T-DNA promoter, either endogenous T-DNA genes or inserted foreign
genes, lacked introns. The results are unexpected also in view of
the prior art fai:fure to demonstrate that a T-DNA promoter could
function to control expression of a plant structural gene when the
latter is introdu<:ed into T-DNA under the proper conditions. The
invention is useful for genetically modifying plant tissues and whole
plants by inserting useful plant structural genes from other plant
species or strain~~. Such useful plant structural genes include, but
are not limited to, genes coding for storage proteins, lectins,
disease resistance factor's, herbicide resistance factors, insect
resistance factors,
-14-
131U714
environmental stress tolerance factors, specific flavor
elements, an~d the like. The invention is exemplified by
introduction and expression of a structural gene for
phaseolin, t:he major seed storage protein of the bean
5 Phaseolus vul~aris, L., into sunflower and tobacco plant
cells. Once plant cells expressing a plant structural
gene under control of a T-DNA promoter are obtained,
plant tissues and whole plants can be regenerated
therefrom using methods and techniques well known in the
10 art. The re~~enerated plants are then reproduced by
conventional means and the introduced genes can be
transferred to other strains and cultivars by conven-
tional plant breeding techniques. The introduction and
expression of the structural gene for phaseolin, for
15 example, can be used to enhance the protein content and
nutritional 'value of forage crops such as alfalfa.
Other uses of the invention, exploiting the properties
of other structural genes introduced into other plant
species will be readily apparent to those skilled in the
art. The invention in principle applies to any
introduction of a plant structural gene into any plant
species into which 't-DNA can be introduced and in which
T-DNA can remain stably replicated. In general these
species include, but are not limited to, dicotyledenous
plants, such as sunflower (family Compositeae), tobacco
(family Sola:naceae), alfalfa, soybeans and other legumes
(family Legu~minoseae) and most vegetables.
DET;I ED DESCRIPTION OF THE INVENTION
The following definitions are provided, in order to
remove ambiguities to the intent or scope of their usage
in the specification and claims.
T-DNA: A segment of DNA derived from the tumor-
inducing principle (TIP) which becomes integrated
in the plant genome. As used herein, the term
includes DNA originally derived from any tumor-
inducing strain of Aarobacterium including A.
134Q714
16
tumefac:iens a=nd A. Rhizogenes, the inserted segment
of the :Latter sometimes referred to in the prior
art as R-DNA. In addition, as used herein the term
T-DNA includes any alterations, modifications,
mutations, insertions and deletions either natur-
ally occ:urring or introduced by laboratory proce-
dures, a principle structural requirement and
limitat=ion to such modifications being that
sufficiE:nt right and left ends of naturally-
occurring T-DNAs be present to insure the expected
function of stable integration in the transformed
plant ce=ll genome which is characteristic of T-DNA.
In addit=ion, 'the T-DNA must contain at least one
T-DNA promote=r in sufficiently complete form to
control initiation of transcription and initiation
of tran:elation of an inserted plant structural
gene. ~~referably, an insertion site will be
provided "downstream" in the direction of tran-
scription and translation initiated by the
promote:-, so :Lacated with respect to the promoter
to enab7.e a plant structural gene inserted therein
to be expressed under control of the promoter,
either direct:ly or as a fusion protein.
Plant st=ructural gene: As used herein includes
that pox-tion of a plant gene comprising a DNA
segment coding for a plant protein, polypeptide or
portion thereof but lacking those functional
element:c of a plant gene that regulate initiation
of trans>cript:ian and inititation of translation,
commonl~~ referred to as the promoter region. A
plant st=ructural gene may contain one or more
introns or it may constitute an uninterrupted
coding :>equence. A plant structural gene may be
derived in whole or in part from plant genomic DNA,
cDNA and chem=ically synthesized DNA. It is further
contemplated that a plant structural gene could
13~0'~1~
include modifications in either the coding segments
or the introns which could affect the chemical
structure of the expression product, the rate of
expression or the manner of expression control.
Such modifications could include, but are not
limited to, mutations, insertions, deletions, and
"silent" modifications that do not alter the
chemical stru~,cture of the expression product but
which affect intercellular localization, transport,
excretion or stability of the expression product.
The structural gene may be a composite of segments
derived from a plurality of sources, naturally
occurring or synthetic, coding for a composite
protein, the composite protein being in part a
plant protein.
T-DNA t~:romote_r: Refers to any of the naturally
occurring promoters commonly associated with
integrated T-DNA. These include, but are not
limited to, promoters of the octopine synthetase
gene, nopaline synthetase gene, tms, tml and tmr
genes, depending in part on the TIP source of the
T-DNA. Expression under control of a T-DNA
promoter may take the form of direct expression in
which the structural gene normally controlled by
the promoter is removed and replaced by the in-
serted plant structural gene, a start codon being
provided either as a remnant of the T-DNA struc-
tural gene or as part of the inserted plant
structural gene, or by fusion protein expression in
which part or all of the plant structural gene is
inserted in correct reading frame phase within the
existing T-DN;~1 structural gene. In the latter
case, the expression product is referred to as a
fusion protein.
i3 40'~ 14
18
Plant tissue: Includes differentiated and undif-
ferentiated tissues of plants including roots,
shoots, pollen, seeds, tumor tissue, such as crown
galls, and various forms of aggregations of plant
cells in culture, such as embryos and calluses.
Plant ce~~: As used herein includes plant cells in
plants and plant cells and protoplasts in culture.
Production of a genetically modified plant expres-
sing a plant structual gene introduced via T-DNA com-
bines the spE:cific teachings of the present disclosure
with a variei:y of 'techniques and expedients known in the
art. In moss: instances, alternative expedients exist
for each stage of 'the overall process. The choice of
expedients dE~pends on variables such as the choice of
the basic TI1?, the plant species to be modified and the
desired regeneration strategy, all of which present
alternative process steps which those of ordinary skill
are able to :select and use to achieve a desired result.
The fundameni:al aspects of the invention are the nature
and structure= of t:he plant structural gene and its means
of insertion into 'r-DNA. The remaining steps to
obtaining a genetically modified plant include trans-
ferring the modified T-DNA to a plant cell wherein the
modified T-DNA becomes stably integrated as part of the
plant cell genome, techniques for in vitro culture and
eventual regcaneration into whole plants, which may
include step:a for selecting and detecting transformed
plant cells and steps of transferring the introduced
gene from the originally transformed strain into
commercially acceptable cultivars.
A principal feature of the present invention is the
construction of T-DNA having an inserted plant struc-
tural gene wader control of a T-DNA promoter, as these
terms have been defined, supra. The plant structural
gene must be inserted in correct position and orienta-
tion with respect to the T-DNA promoter. Position has
1340'~1~
19
two aspects. The first relates to on which side of the
promoter the structural gene is inserted. It is known
that the majority ~of promoters control initiation of
transcription and 'translation in one direction only
along the DNA. The region of DNA lying under promoter
control is s<iid to lie "downstream" or alternatively
"behind" the promoter. Therefore, to be controlled by
the promoter,, the correct position of plant structural
gene insertion must be "downstream" from the promoter.
(It is recognized that a few known promoters exert bi-
directional ~~ontrol, in which case -either side of the
promoter cou:Ld be considered to be "downstream" there-
from). The ;second aspect of position refers to the
distance, in base pairs, between known functional
elements of ithe promoter, for example the transcription
initiation sate, and the translational start site of the
structural gene. Substantial variation appears to exist
with regard to this distance, from promoter to promoter.
Therefore, tine structural requirements in this regard
are best described :in functional terms. As a first
approximation, reasonable operability can be obtained
when the distance between the promoter and the inserted
structural gene is similar to the distance between the
promoter and the T-DNA gene it normally controls.
Orientation :refers to the directionality of the struc-
tural gene. By convention, that portion of a structural
gene which ultimately codes for the amino terminus of
the plant protein is termed the 5' end of the structural
gene, while that e.nd which codes for amino acids near
the carboxyl end o~f the protein is termed the 3' end of
the structural gene. Correct orientation of the plant
structural gene is. with the 5' end thereof proximal to
the T-DNA promoter. An additional requirement in the
case of constructions leading to fusion protein expres-
sion is that the insertion of the plant structural gene
into the T-DNA structural gene sequence must be such
13~071~
that the coding sequences of the two genes are in the
same reading frame phase, a structural requirement which
is well understood in the art. An exception to this
requirement, of relevance to the present invention,
5 exists in the case where an intron separates the T-DNA
gene from the first coding segment of the plant
structural gene. In that case, the intron splice sites
must be so positioned that the correct reading frame for
the T-DNA gene and the plant structural gene are
10 restored in phase after the intron is removed by
post-transcr:iptional processing. The source of T-DNA
may be any o:E the 'TIP plasmids. The plant structural
gene is inserted by standard techniques well known to
those skilled in t:he art. Differences in rates of
15 expression may be observed when a given plant structural
gene is inserted under control of different T-DNA
promoters. Different properties, including such prop-
erties as stability" inter-cellular localization,
excretion, antigenicity and other functional properties
20 of the expre:used protein itself may be observed in the
case of fusion proteins depending upon the insertion
site, the length and properties of the segment of T-DNA
protein included within the fusion protein and mutual
interactions between the components of the fusion
protein that effect folded configuration thereof, all of
which preseni~ numerous opportunities to manipulate and
control the :Euncti~onal properties of the expression
product, depending upon the desired end use. Expression
of the phaseolin structural gene has been observed when
that gene wa:~ inserted under control of the nopaline
synthetase promoter from an octopine plasmid of A.
tumefaciens (see Example 1).
A convenient :means for inserting a plant structural
gene into T-1~NA involves the use of a shuttle vector, as
described supra, having a segment of T-DNA (that segment
into which insertion is desired) incorporated into a
1~~0'~1~~
21
plasmid capable of replicating in ~. coli The T-DNA
segment contains a. restriction site, preferably one
which is unique to the shuttle vector. The plant
structural gene ca.n be inserted at the unique site in
the T-DNA segment and the shuttle vector is transferred
into cells of the appropriate Agrobacterium strain,
preferably one whose T-DNA is homologous with the T-DNA
segment of the shuttle vector. The transformed
Agrobacterium_ strain is grown under conditions which
permit selection of a double-homologous recombination
event which results in replacement of a pre-existing
segment of the Ti plasmid with a segment of T-DNA of the
shuttle vector.
Following the: strategy just described, the modified
T-DNA can be transferred to plant cells by any technique
known in the art. For example, this transfer is most
conveniently accomplished either by direct infection of
plants with the novel Ag~robacterium strain containing a
plant structural grease incorporated within its T-DNA, or
by co-cultivation of the Actrobacterium strain with
plant cells. The former technique, direct infection,
results in due course in the appearance of a tumor mass
or crown gall at the site of infection. Crown gall
cells can be subsequently grown in culture and, under
appropriate circumstances known to those of ordinary
skill in the art, regenerated into whole plants that
contain the inserted T-DNA segment. Using the method of
co-cultivation, a certain proportion of the plant cells
are transformed, that is to say have T-DNA transferred
therein and inserted in the plant cell genome. In
either case, the transformed cells must be selected or
screened to distinguish them from untransformed cells.
Selection is most readily accomplished by providing a
selectable marker incorporated into the T-DNA in addi-
tion to the plant structural gene. Examples include
either dihydrofola:te reductase or neomycin phosphotrans-
~3~~'~14
22
ferase expressed under control of a nopaline synthetase
promoter. These markers are selected by growth in
medium containing methotrexate or kanamycin, respec-
tively or their analogs. In addition, the T-DNA
provides endogenous markers such as the gene or genes
controlling hormone-independent growth of Ti-induced
tumors in cu:Lture, the gene or genes controlling
abnormal morphology of Ri-induced tumor roots, and genes
that control resistance to toxic compounds such as amino
acid analogs,, such resistance being provided by an opine
synthetase. Screening methods well known to those
skilled in the art include assays for opine production,
specific hybridization to characteristic RNA or T-DNA
sequences, or immunological assays for specific
proteins, inc:ludin~g ELISA (acronym for "enzyme linked
immunosorbani~ _assay"), radioimmune assays and "western"
blots.
An alternative to the shuttle vector strategy
involves the use of plasmids comprising T-DNA or
modified T-D1JA, into which a plant structural gene is
inserted, sa:Ld plasmids being capable of independent
replication :in an ;Acrrobacterium strain. Recent
evidence ind:LCates that the T-DNA of such plasmids can
be transferrcad from an Aqrobacterium strain to a plant
cell provided the ;Actrobacterium strain contains certain
trans-acting genes whose function is to promote the
transfer of '.C-DNA to a plant cell. Plasmids that
contain T-DNA and are able to replicate independently in
an Aqrobacter'um strain are herein termed "sub-TIP"
plasmids. A spectrum of variations is possible in
which the sub-TIP ;plasmids differ in the amount of T-DNA
they contain.. One end of the spectrum retains all of
the T-DNA from the TIP plasmid, and is sometimes termed
a "mini-TIP" plasmid. At the other end of the spectrum,
all but the minimum amount of DNA surrounding the T-DNA
border is de:Leted, the remaining portions being the
1340'14
23
minimum necessary to be transferrable and integratable
in the host cell. Such plasmids are termed "micro-TIP".
Sub-TIP plasmids a:re advantageous in that they are small
and relatively easy to manipulate directly. After the
desired structural. gene has been inserted, they can
easily be introduced directly into an Aarobacterium
containing the traps-acting genes that promote T-DNA
transfer. Introduction into an Agrobacterium strain is
conveniently accomplished either by transformation of
the Agrobacterium strain or by conjugal transfer from a
donor bacterial cell, the techniques for which are well
known to those of ordinary skill.
Regeneration is accomplished by resort to known
techniques. An object of the regeneration step is to
obtain a whole plant that grows and reproduces normally
but which retains integrated T-DNA. The techniques of
regeneration vary somewhat according to principles known
in the art, depending upon the origin of the T-DNA, the
nature of any modifications thereto and the species of
the transformed plant. Plant cells transformed by an
Ri-type T-DN,A are readily regenerated, using techniques
well known to those of ordinary skill, without undue
experimentation. Plant cells transformed by Ti-type
T-DNA can be regenerated, in some instances, by the
proper manipulation of hormone levels in culture.
Preferably, :however, the Ti-transformed tissue is most
easily regenerated if the T-DNA has been mutated in one
or both of t:he tmr; and tms genes. Inactivation of these
genes return's the hormone balance in the transformed
tissue towards normal and greatly expands the ease and
manipulation of the tissue's hormone levels in culture,
leading to a plant with a more normal hormone physiology
that is readily regenerated. In some instances, tumor
cells are able to regenerate shoots which carry integra-
ted T- DNA a;nd express T-DNA genes, such as nopaline
synthetase, ,and which also express an inserted plant
13~0~14
24
structural gene. The shoots can be maintained vege-
tatively by grafting to rooted plants and can develop
fertile flowers. The shoots thus serve as parental
plant materiel for normal progeny plants carrying T-DNA
and expressing the plant structural gene inserted
therein.
Examples
The following Examples utilize many techniques well
known and accessible to those skilled in the arts of
molecular biology and manipulation of TIPs and
Ag~robacterium; such methods are not always described in
detail. Enz,Ymes are obtained from commercial sources
and are used according to the vendor's recommendations
or other variations known to the art. Reagents, buffers
and culture ~~onditions are also known to those in the
art. Reference works containing such standard
techniques include the following: R. Wu, ed. (1979)
Meth. Enzymol. 68: J.H. Miller (1972) Experiments in
Molecular Genetics; R. Davis et al (1980) Advanced
Bacterial Ge:netics,; and R.F. Schleif and P.C. Wnesink
(1982) Practical Methods in Molecular Biologv.
In the :Examples, special symbols are used to
clarify sequences. Sequences that do or could code for
proteins are underlined, and codons are separated with
slashes (/). The positions of cuts or gaps in each
strand caused by restriction endonucleases or otherwise
are indicated by the placement of asterisks (*). (In
Example 4 a double-stranded DNA molecule is represented
by a single line flanked by asterisks at the sites of
restriction enzyme. cuts; the approximate position of a
gene is there indicated by underlined "X"'s under the
single line). With the exception of the plasmid IIc,
plasmids and only plasmids are prefaced with a "p", e.g.
p3.8 or pKS4. Cells containing plasmids are indicated
by identifying the: cell and parenthetically indicating
13~0'~~.4 _
the plasmid, e.g., A. tumefaciens(pTi15955) or
K802 (pKS4-:KB) .
In the Examples, reference is made to the
5 accompanying drawings:
Figure 1 depicts the T-DNA region of pTi15955;
Figure 2 contains the nucleotide and derived amino
acid sequences of the octopine synthase gene:
Figure 3 contains the nucleotide sequence for a
10 phaseolin gene and the nucleotide and derived amino
acid sequences of a cDNA:
Figure 4 contains the nucleotide and derived amino
acid sequences of nopaline synthase;
Figura_ 5 shows the restriction sites for plasmid
15 pKS-nop IV;
Figure 6 shows the steps of formation pKS Nop IV
KB 3.8 from pTic58;
Figur~ss 7 and 8 show the restriction sites for
plasmids plKS4-KB and pNNNl;
20 Figure 9 shows formation of plasmid pNNN2;
Figure 10 contains the nucleotide sequence for the
DNA from the HindIII site of plasmid p401 past the ClaI
site to it;~ right,;
Figure 11 shows the mapping of a 1450bp mRNA;
25 Figure 12 shows the formation of plasmid pKS-ProI;
Figure. 13 shows the restriction sites of p7.2;
Figure 14 shows the restriction sites of pKS-PRI
I-KB:
Figure 15 shows the structure of the phaseolin
storage protein gene;
Figures 16, .L7, 18 and 19 show the restriction
sites for ~?lasmids p 3.8, pBR 322, pKS-4 and pKS-KB 3.8
respectively;
Figure 20 shows the formation of plasmid pKS4-KB
2,4:
Figure 21 shows the restriction map for plasmid
pKS 4 -KB 2 . ~~
13 4 0'~ 1'~
25A
Figure 22 shows the cloning of phaseolin cDNA into
phaseolin genomic environment:
Figure 23 chows the formation of plasmid pl-B:
Figure 24 shows the restriction map for plasmid pKS-
proI A:
Figures 25, 26 and 27 show the formation of
plasmids pKS-5 .arid pKS-oct.Cam203:
Figu~.~es 28, 29 and 30 show the restriction maps
10 for plasmids pK;S-oct.del. II, pKS-oct.del. I and pRK290
respectivEaly
Figures 31, 32, 33, 34, 35, 36 and 37 show the
formation of pl~asmids p2f, pie, pKS-oct.del. III, pKS-
6, p2, pKf>-oct.del. IIIa and p203 with inserted BalII
site, respectimely:
Figure 38 chows the restriction sites for plasmid
pKS-oct . trnr .
Figure 39 captains a comparison of the restriction
sites for constructions described in Examples 11, 12
and 14;
Figure 40 :is a Table containing the genetic code;
Figure 41 .is a nucleotide sequence of a "large
tumor" gene;
Figures 42 and 43 are the restriction maps for
plasmids containing a Bam 17 T-DNA fragment and pKS-
B17-KB3.0 respectively.
Table: I provides an index useful for identifying
the plasmids their formation and their
interrelat:ionsh:ip with respect to the various Examples.
30 Of the drawings not specifically identified in
Table I, Figure 3 illustrates the structural gene for
the bean :need storage protein phaseolin, Figure 4
illustratsa the structural gene for nopaline
synthetase. Figure l0 illustrates the structural gene
35 for the portion of the construct of Figure 1 from the
HindIII site of p401 past the ClaI site to its right,
and Figure: 37 i:ll.ustrates conversion of the HpaI site
in p203 to a Bg:III site.
Tabls: 2 provides an index of deposited strains.
13~U714
25B
Fig. 39 provides a useful comparison of the
constructions described in Examples 11, 12, and 14.
Fig. 40 se=is forth the genetic code and is useful
forinterpreting sequences. The nucleotide sequence of
an important T-1DNA gene, tml, though not used in these
Examples, is set forth in Fig. 41; it is useful in
designing constructions not described herein.
Example 1
A fusion protein gene was constructed consisting
of the ocl:opine synthetase promoter, the amino terminal
90 amino acids of the structural gene for octopine
synthetasE: a 3 amino acid overlap between the two
genes, and all of phaseolin except for codons encoding
its first 11 amino acids. Prior to the start of
construct~Lon, a clone of pTi15955 T-DNA, p233, (the
sequences defined by p203 and p303, in pBR322, see Fig.
1) was sec;uenced from the BamHI site to the PvuII site.
This includes a:Ll of the octopine synthetase gene (Fig.
2). The octopine synthetase sequence and reading frame
...
were found to be as follows near a site cut by the
restriction enzyme EcoRI:
EcoRI
5'...AT(J/GGC CAG/CAA/GG*A,/ATT/CTT...3'
3'...TAC CCG GTC GTT CC T TAA*GAA...5'
...Mei~ Gly Gln Gln Gly Ile Leu...
84 85 8fi 87 88 89 90
Cleavage with EcoRI yields a fragment with the following
end:
...ATG GGC/CA~~CAA GG 3'
...TAC CCG GTC GTT CCTT 5'
The structural gene for the bean seed storage protein
phaseolin (previously sequenced, Fig. 3) contains an
EcoRI site near its 5' (amino terminal) end as follows:
ECORI
...CTG '.CTG CT~~GG*A/ATT/CTT/TTC...
...GAC AAC GAC CC T TAA*GAA AAG...
. . . Leu l~eu Leu Gly Ile Leu Phe. . .
9 :LO 11 12 13 14 15
Cleavage with EcoRI yields a fragment with an end as
follows:
5' ~3TT CT'r TTC . . .
3' GAA AAG...
These two fragments, after ligation, form the following
structure:
EcoRI
...ATG/GGCJCAGJCAA./GG*~AT T/CTT/TTC...
...TAC CCG GTC GTT CC T TA*A GAA AAG...
...Met Gly G~Ln Gln Gly Ile Leu Phe...
84 85 8(i 87 88 89 90 octopine
synthetase
12 13 14 15 phaseolin
Not only are the same reading frames preserved, but
there are no intervening stop signals generated.
So in short, 'the EcoRI/BamHI restriction endo-
nuclease fragment ~of the Phaseolin gene was ligated at
the EcoRI sii:e to 'the octopine synthase gene of the
T-DNA of pTi:L5955. This fusion gene contains the ocs
promoter, thEa first 90 amino acids of octopine synthe-
tase, the phaseoli:n gene minus its promoter and its
first 11 amino acids, and a three amino acid junction
identical to sequences present in both parent proteins.
1340'14
_1~ Removal of the EcoRI site from pBR322
The EcoRI site in pBR322 was removed by digesting
with EcoRI, filling in with T-4 DNA polymerase, blunt
end ligation and transformation into ~. coli strain
HB101. Selecaion of transformants was made with
ampicillin and colonies were screened by isolating small
amounts of pl.asmid DNA (D. Ish-Horowicz (1982) in
Molecular Clon_ incr, c:.S.H.) and selecting a clone without
an EcoRI site' callead pBR322-R.
~ Clonina of the BamHI T-DNA fractment into pBR322-R
p203 (Fig. 42;1 was isolated and digested with
BamHI. The 9a.7kbp fragment of T-DNA was isolated by
agarose gel electrophoresis and ligated into the BamHI
site of pBR3~:2-R. 'This plasmid was transformed into E.
co ' strain HB101 and selected for using ampicillin
resistance and tetracycline sensitivity. A positive
clone was selected and called pKS169.
1.3 Removal of the EcoRI sites and fragments from the
octopine: synthetase gene
pKS169 Gras isolated and digested with EcoRI. An
8.6kbp fragment wa:~ isolated by agarose gel electro-
phoresis and purified. This fragment had the 2 small
(0.36kbp and 0.2kbp) fragments in the ocs gene removed.
1-44 Isolation of the EcoRI fragment containing' the
phaseolin gene. DNA fragment and the kanamycin
resistance qen~
pKS4-KB (Fig. 7) was purified and digested with
EcoRI. A 4.8kbp fragment was isolated using 3.Okbp
EcoRI/BamHI F~haseo:lin gene fragment ligated at the BamHI
site to a l.EtSkbp DNA fragment containing the kanamycin
resistance gene encoding neomycin phosphotransferase II
(NPTII).
1.5 Ligation of the phaseolin gene to the octopine
synthase~
The pha:~eolin,iNPTII fragment was then ligated at
the EcoRI sites to the EcoRI fragment described in
Example 1.3. The :Ligated DNA was transformed into HB101
and colonies were :elected on ampicillin and kanamycin.
~3~~71~
A colony named pKS-B17-KB3.0 (Fig. 43) was selected
that contained a plasmid that had the correct
orientation (i.e., the phaseolin gene ligated to the ocs
gene in the correct direction and reading frame). This
5 was ascertained by the restriction mapping of plasmids
from a small number of colonies. DNA sequence of the
appropriate region was determined to verify the
construction.
1.6 Transfer of the T-DNA fragment containing the
10 NPTII, aseolin and ocs DNA into pRK290
pRK290, a broad host range plasmid, was digested
with BalII a:nd ligated to a 9.lkbp BamHI fragment
containing t:he T-DNA, the NPTII gene, and the phaseolin
DNA from pKS-B17-KB3Ø This was accomplished by
15 partially digesting pKS-B17-KB3.0 with BamHI and
isolating a 9.lkbp fragment from 6 other bands from an
agarose gel .electrophoresis. After ligation and
transformati~~n into E. coli strain K802, colonies were
selected on :kanamycin and tetracycline. A colony was
20 selected that had the desired restriction pattern and
was labeled ;pKS-OS-KB3Ø
1.7 Replacement of octopine synthetase on pTi15955 with
the octouine ~nthetase phaseolin fusion protein
gene
25 Using triparental mating of A. tumefaciens
(streptomyci:n resistant), E_. coli(pKS-OSI-KB3.0), and E.
coli(pRK2013), we selected for colonies resistant to
streptomycin, kanamycin, and tetracycline. One colony
was mated with E_. coli (pPHlJ1). A colony was selected
that is resistant to kanamycin and gentamycin. This was
shown to be ;A. tum.efaciens with p15955-12A, a pTi15955
that has the phaseo:lin gene and kanamycin resistance
gene engineered into the EcoRI site of the ocs gene by
restriction enzyme mapping, and filter hybridization of
electrophore~tically separated restriction fragments
(Example 19). An analogous triparental mating is done
with A_. tumefaciens(pTiA66). Shoots transformed by the
~340'~14
_. 25; ~ _,..
resulting pl~~smid, pA66-12A, are shown to contain
phaseolin as described above.
1-88 Crown crall foformation and expression
Sunflower plants were inoculated with the
engineered T:i plas~mid. Crown galls were established in
tissue culture. Expression was tested by running ELISAs
and by filter hybridization to electrophoretically
separated mRIJA ("Northern blots", Example 19). RNA of
the expected size 'was detected with hybridization probes
to both the ~?haseolin and octopine synthetase genes, and
comprised about 0.5~ of total poly(A)5+4 RNA. Poly
(A)5+4 RNA isolated from galls directed the in vitro
synthesis of a protein of the expected size which was
precipitatab:le by antibodies raised against phaseolin.
Example 2
A fusion protein gene similar to that taught in
Example 1 wars constructed from phaseolin and nopaline
synthetase, under control of the latter gene's promoter.
It contained the nopaline synthetase promoter, and
encoded the :first 59 amino acids of nopaline synthetase
(of which the last residue was
synthetically added); a one amino acid junction; and all of the phaseolin
structural gene except for its first 12 amino acids. Prior to the start of
construction, a clone of pTiC58 T-DNA (pCF44A; Fig. 6) was sequenced from the
,VIII site on the extreme left through the middle HindIII site, which is
x outside of the T-DNA re~~ion. 'This included all of the nos gene (Fig. 4).
The
nopaline synthetase sequence and reading frame were found to be as follows
near a site cut by the restriction enzyme CIaI:
CIaI
5'...CCA/GGA/T~/ATC/TCA...3'
3'...GGT CCT A GC*TAG A(;T...S'
...Pro Gly Ser Ile Ser...
56 57 58 59 60
Cleavage with CIaI yields a fragment with the following end:
...CCA GGA T 3'
...GGT CCT AGC 5'
As stated in Example 1, the following phaseolin EcoRI site:
EcoRI
...CTG/GG*7CTCTT/CTT/TTC...
...GAC CC T TAA*GAA AAG...
...Leu Gly Ile Leu Phe...
11 12 13 14 15
can be cleaved to following structure:
5' A/ATT CTT TTC...
3' G G...
The following two linkers
a) 5' CGATCCC 3'
b) 5' AATTGGGAT 3'
can be annealed to form the following structure
5' CGATCCC 3' (a
3' TAGGGTTAA 5' (b
-26-
.. 4340714
27
Which can link together the DNA fragments to form the
following structure:
New Linker
...CCA/GGA/T*CG ATC/CC*A/ATT/CTT/TTC...
...GGT CCT A GC*TAG GG T TAA*GAA AAG...
...Pro Gly S~sr Ile Pro Ile Leu Phe...
56 57 5.3 59 nopaline
synthetase
13 14 15 phaseolin
Note that the linker serves several functions: a
new amino acid is introduced; part of the deleted
sequence of nopaline synthetase is reconstructed; two
incompatible restriction sites are made compatible, and
an open reading frame is preserved.
So in slaort, the EcoRI/BamHI restriction fragment
of the phaseolin gene was ligated to the ClaI site of
the nopaline synthase gene after a linker converted the
EcoRI site to a Cla_I site. The fusion gene contained
the nopaline synthetase promoter, the first 58 amino
acids of nopaline synthetase, a linker which reconstruc-
ted some of 'the nopaline synthetase sequence and
inserted a newel amino acid, and all of phaseolin
except for the first twelve amino acid residues.
2.1 Synthesis of Linkers
The following two linkers were synthesized:
a ) 5' CG~~TCCC 3 '
b ) 5' AA'rTGGGAT 3 '
These were s:Ynthesized by the methods of Example 17.
The oligonuc:leotide a) and b) were annealed together to
form the structure
5' CGATCCC 3' (a
3' TAGGGTTAA 5' (b
2.2 Preparation of the shuttle vector
pKS-nop:IV, whose construction wa.s described in Fig.
6, is pRK290 with nopaline T-DNA cloned into its BalII
site. Its n~opaline T-DNA contains a single ClaI site
resulting fr~~m deletion between the ClaI site in nos and
the C7~I site downstream outside the nos gene (Figs. 5
27a ~3~071~
and 6). We purified pKS4-KB (Fig. 7) and digested with
EcoRI. The ~E.8kbp kan bean resistance fragment
--- ~3~0'~1~
was purified by gel electrophoresis. This fragment contains the EcoRI/BamHI
phaseolin DNA fragment (referred to as bean in the label kan bean) ligated at
the BamHI site to the BamHI/EcaRI fragment of the kanamycin resistance gene
(kan of TnS.
We ligated CIaI linearized pKS-nopIN with purifed kan/bean fragment and
the linkers from Example 2.1. E. coli K802 was transformed and selected for
kanamycin and tetracycline resistant colonies. Two orientations were present,
one with phaseolin DNA ligated to nopaline synthetase gene and the other with
kanamycin resistance gene ligated next to nopaline synthetase gene.
Restriction site mapping was used to determine which cells contained a
plasmid, pNNNl, having the desired orientation as shown in Fig. 8.
2.3 Replacement of the nopaline synthetase ene '. Tp iC58 with the modified
phaseolin
A triparental matin!~ (see Background-Shuttle Vectors) with _A.
tumefaciens-strR C58, E. coli(pRK2013), and E. coli(pNNNly was used to insert
the construction into a '~i plasmid. We selected for A. tumefaciens cells
resistant to streptomycin, kanamycin and tetracycline. The selected
transformants were mated with E. coli(pPHlJ1) and colonies resistant to
kanamycin and gentamycin were selected.
2.4 Crown Gall Formation and Expression
Sunflowers were inoculated and crown galls established in tissue
culture. Expression was tested by ELISA and hybridization to mRNA as
described in Examples 17 and 20"
Example 3
The aim of this example is to reconstruct the complete phaseolin gene
coding sequence from the ATG translational start signal to the EcoRI site
which can then be ligatedl to the remainder of the structural gene. A CIaI
site will be constructed at the 5' end so the gene can be easily recovered.
The following two oligonu~cleotide sequences will be synthesized:
-28-
~~4~'~1~
a) 5' AATTCCCAGCAACAGGAGTGGAACCCTTGCTCTCATCAT 3'
b) 5' CGATGATGAGAGCAAGGGTTCCACTCCTGTTGCTGGG 3'
These can be rennealed to form the following structure:
CIaI EcoRI
5' CG/ATG/ATG/AGA/GCA/AGG/GTT/CCA/CTC/CTG/TTG/CTG/GG 3' (a
TAC TAC TCT CGT TCC CAA GGT GAG GAC AAC GAC CCT TAA 5' (b
Met Met Arg Ala Arg Hal Pro Leu Leu Leu Leu Gly Ile
1 2 3 4 5 6 7 8 9 10 11 12 13
As stated in Example 1, the following phaseolin EcoRI site:
...CTG/GG*A/ATT/CTT/TTC...
...GAC CC T TAA*GAA AAG...
Leu Gly Ile Leu Phe
11 12 13 14 15
can be cleaved to following structure:
5' A/ATT/CTT TTC...
3' GAA G...
Ligation of this end to the synthetic double-stranded oligonucleotide
described above results in a structural gene encoding a complete phaseolin
polypeptide, with CIaI sticky-ends immediately ahead of the start of the
coding sequence.
3.1 Synthesis of linker,
The following two linkers were synthesized by the method of Example 17:
a) 5' AATTCCCAGCAACAGGAGTGGAACCCTTGCTCTCATCAT 3'
b) 5' CGATGATGAGAGCAAGGGTTCCACTCCTGTTGCTGGG 3'
They were annealed i;o form the following structure:
5' CGATGATGAGAGCAAGGGTTCCACTCCTGTTGCTGGG 3' (b
3' TACTACTCTCGTTCCCAAGGTGAGGACAACGACCCTTAA 5' (a
3.2 Construction of complete phaseolin ene and kanamycin resistance ene
cloned in pKS-nopIV
-29-
CIaI linearized pKS-nopIV is ligated with reannealed linker from Example
3.1 and purified kan/bean EcoRI fragment from KS4-KB (see Example 2.2). E.
coli K802 is transformed and selected for tetracycline and kanamycin resistant
colonies. Again; though two orientations are possible, only one is phaseolin
gene ligated next to the nopaline synthetase gene. The correct orientation is
selected after endonuclease mapping the clones.
3-33 Crown gall formation and expression
The homologous recornbination and crown gall tissue culture isolation is
performed as outlined in Example 21, and the testing of crown gall tissues for
phaseolin gene expression is as in Examples 19 and 20.
Exam le 4
The purpose of this construction is to teach how to construct a Shuttle
Vector to be used in pTi system for expressing foreign genes in crown gall
cells, the foreign gene being under control of the nos promoter, part of which
is chemically synthesized, and 'is missing codons for the nopaline synthetase
gene. Prior to the start: of construction, a clone of pTiC58 T-DNA (pCF44A)
was sequenced to discover the nns promoter (Fig. 4).
4.1 Isolation of the 5' op rtion of the nos promoter
pCF44A is cut with x;hoI, religated, and labeled pCF44B, which has the
following structure:
BgIII CIaI C1'aI SstII SstII SstII BgIII
...* 1160bp * 1300 * 355 * 620 * 420 * 1155b~ *...
3' nopaline 5'
synthetase
This new plasmid is of the SstII fragments. The resulting plasmid, pCF44C
~gIII CIaI CIaI SstII BgIII
... 1160 ~ 1300 ~ 355 * 1155 *...
* * XXXXXXXXXXXXXXX*XXXXXXXXX*
3' nopaline 5'
synthetase
is digested with Bc~III, and a 3.6kbp fragment is inserted into the Bc~III
site
of pRK290. A colony selected for hybridization to T-DNA in a Grunstein-
-30-
._.
Hogness assay is labeledl pKS-napV; digested with CIaI; and relegated; forming
pKS-nopVI.
B~,1TII CIaI SstII B~III
...* 1160bp * 355 * 1155bp **...
* *XXXXXXXXX*
--
This is digested with CIaI and SstII giving a 22kbp linearized vehicle and a
355bp fragment. These are easily separated by centrifugation through a salt
gradient. After the small fragment is digested with HinfI the 149bp
SstII/HinfI and the 208bp CIaI/HinfI fragments are isolated by gel
electrophoresis.
4.2 Synthesis of linkers
The following two linkers were synthesized by the method of Example 17:
a) 5' AGTCTCATACTCACTCTCAATCCAAATAATCTGCCATGGAT 3'
b) 5' CGATCCATGGCAGATTATTTGGATTGAGAGTGAGTATGAG 3'
They were annealed together to form the following structure:
5' AGTCTCATACTCACTCTCAATCCAAATAATCTGC_CATGGAT 3' (a
3' GAGTATGAGTGAGAGTTAGGTTTATTAGACGGTACCTAGC 5' (b
This sequence has a HinfI site on the left, and NcoI and CIaI sites on the
right. An alternate sequence will have a BcII site between the NcoI and CIaI
sites. The sequence is identical to that found in T-DNA except for the
underlined bases which replace an A-T base pair with a C-G base pair.
4.3. Assembly of Np NN2
The 22kbp CIaI/SstIt vehicle is legated as shown in Fig. 9 with the 149bp
SstII/HinfI fragment and the synthetic linker, forming the following
structure:
HinfI synthetic linker NcoI CIaI
5'...149bp...TAG*AGT CTCATACTCACTCTCAATCCAAATAATCTGC*CATG GAT*CG
AT...1160bp...3'
3'...T-DNA...ATC TCA*GAGTATGAGTGAGAGTTAGGTTTATTAGACG GTAC*CTA GC*TA...T-
DNA....5'
-31-
I3~07I~
32
4.4 Insertion and expression of a phaseolin gene
pNNN2, t:he plasmid constructed in Example 4.3 (Fig.
9) is cut with Cla:I, mixed with the ClaI/EcoRI linker
synthesized in Example 4.2 and electrophoretically
purified EcoRI/Cla:I kan bean fragment from pKS4-KB,
ligated, transformed, isolated, and restriction mapped.
The appropriate plasmid, pNNN4, is transferred and
tested for expression as described in Examples 21, 19
and 20.
4.5 Insertion and expression of a phaseolin gene
lacking intro:ns
The procedure outlined in Example 4.4 is repeated
with the sub:~titution for pKS4-KB of a pcDNA31 or
pMC6-cDNA-derived .analog of pKS4-KB. (see Example 9).
4.6 Insertion and expression of a phaseolin cDNA
This construction is analogous to Example 10 in its
use of cDNA, a single stranded PstI linker, and the PstI
kan fragment,, and is analogous to Examples 4.1, 4.2 and
4.3 in the u:ae of the semisynthetic nos promoter. Char-
acterization,, transfer and testing of expression is as
described in Example 4.4.
pNNN2, ithe plasmid constructed in Example 4.3 (Fig.
9) is cut wiith ClaI, mixed with and ligated to the
ClaI/EcoRI linker synthesized in Example 4.2, the
electrophoretically purified l.7kbp EcoRI/PstI bean
fragment iso:Lated from pKS4-KB~, the electrophoretically
purified 0.9:3 kbp PstI Tn5 kan fragment, and the
single-strancied Cla_I/PstI linker 5'CGAATT3', previously
synthesized by the method of Example 17.
Example 5
The purpose of this construction is to ligate the
phaseolin gene from the EcoRI site to BamHI site, into
the active T~-DNA gene that lies across the HindIII sites
on p403. This mRNA of this T-DNA gene is labeled 1.6 on
the map, shown in Fig. 1, and 1450 by and ProI in the
map shown in Figure 11. This T-DNA gene is referred to
a340'~1~
33
herein as the "1.6 transcript gene". The sequence (see
Fig. 10) was determined from the HindIII site of p401
past the Cla:C site to its right (see Fig. 11). There is
an open reading frame that starts between the HindIII
and ClaI site going toward the HindIII site (see the
1450bp mRNA mapped in Fig. 11). The ClaI site is in
the untranslated leader of the mRNA of the gene spanning
the HindIII rites. We create a promoter vehicle by
cutting out i~he Clal fragment in the middle of p403.
This is possible because the internal ClaI sites are not
methylated in some E. coli strains, whereas the ClaI
site next to the EcoRI site is methylated.
The phaaeolin gene is now ligated into the ClaI
site bringing with it an ATG. This can be acaomplished
by using pKS~~-3.OKB. The base sequence from the ClaI
site of pBR3:Z2 through the EcoRI site of phaseolin is as
follows:
ClaI FmRI
5' . . .AT*C,/G AT/GATE',~CIGJ~/AAC/A~/AG*~,/ATr~~. . . 3'
3'...TA G C*TA CIA TfG GAC GAC AGT TIG TAC TC T TAA*GAA AAC...S'
Met Arg/Ile Leu Phe...
13 14 15
...derived frcan pBR322/phaseolin...
Note the open reading frame and the ATG. There are
l8bp between the ClaI site and the translational start
signal (ATG). This compares to l2bp from the ClaI site
to the start of the T-DNA gene:
_Cla_I
5'...AT'*CG ALTGG/ACA,/TGC/TGT/ATG...3'
3'...TA GC*T ACC TGT ACG ACA TAC...5'
Met...
Again, ;note the open reading frame and the ATG.
Thus, ligati~on into the ClaI site of the promoter clone
should create an active phaseolin gene in T-DNA. The
phaseolin gene has a substitution of 2 amino acids for
the naturally occur.ing amino terminal 12 residues.
5.1 Construction of a Promoter vehicle
pKSIII, which is a pRK290 clone corresponding to
the T-DNA clone p403 (see Fig. 1), is digested with ClaI
134Q'~14
34
and then reli.gated. The ligation mix is transformed
into K802 andl selecaed for kanamycin resistance.
Plasmids are isolated by doing "minipreps" (plasmid
preparations from :small volume cell cultures) and
restriction maps are obtained to prove the structure.
The new vehicle, pKS-proI, is not able to be digested
by HindIII but can be linearized by ClaI (Fig. 12).
pKS-proI is purified and linear molecules are produced
by digestion with <:laI.
5.2 Ligation of a partial phaseolin crene to a
kanamyci.n resistance crepe
A 3.Okbp fragment containing extensive 3' flanking
sequences andl all but the extreme 5' coding sequences of
the phaseolin gene was obtained by elution from an
agarose gel after electrophoresis of an HindIII and
BamHI digest of p7,.2 (Fig 13), a pBR322 subclone of the
phaseolin genomic clone 177.4 whose construction is
described in Examp.'Le 6.1. This was mixed with and
ligated to a 3.Okbp kanamycin resistance HindIII/BamHI
fragment similarly isolated from pKS4 (Fig. 18), and
HindIII-linearized pBR322. After restriction mapping of
plasmids isolated from ampicillin resistant tranwsfor-
mants, a plascmid having the structure shown in Fig. 7
was labeled ~>KS4-KB.
5.3 Purifica 'on of the kan/bean fragment from
pKS4-3 . C)KB
pKS4-KB (Fig. 7) is digested with ClaI and the
4.9kbp fragment purified by agarose gel electrophoresis.
5.4 Lig~atior~ of C:LaI kan/bean resistance gene into ClaI
digested pKS-ProI
pKS-pro7: is l:inearized by digestion with ClaI and
the kanamycir~ resi:atance gene/bean fragment from Example
5.3 are ligat:ed together and transformed into K802.
Kanamycin re:~istanit transformants are selected and
plasmids isolated by "minipreps" are restriction mapped
434014
to detect onE: having the proper orientation. The
plasmid is labeled pKSProI-KB (Fig. 14).
5.5 Transfo~:~mation and expression
Cells containing pKS-proI-KB are mated with
5 Aarobacteriurn_ cells containing pTi15955 or pTiA6 or
other appropriate 'TIP plasmids. After selection of
recombinants with :kanamycin, plants are inoculated and
crown galls are established in tissue culture. Testing
for the synthesis ~of phaseolin is as described in
10 Examples 19 and 20.
Example 6
This example teaches manipulations of a gene for
phaseolin, the major seed storage protein of the bean
Phaseolus vul~aris L., preparatory to further manipula-
15 tions which :insert the phaseolin gene into vectors
described in various other examples.
6.1 Subclon:ing of a phaseolin gene
A genom:ic clone of phaseolin in a Charon 24A
AG-PVPh177.4 (or 177.4; S.M. Sun et al (1981) Nature
20 289:37-41, J.L. Slightom et al (1983) Proc. Natl. Acad.
Sci. USA 80 l?ig. 15) was digested with BalII and BamHI.
The 3.8kbp fragment carrying the phaseolin gene and its
flanking sequences, isolated by agarose gel electrophor-
esis was mixed with and ligated to BamHI-linearized
25 p8R322. The mixture was transformed into HB101, and
colonies resistant to ampicillin and sensitive to
tetracycline were selected. Plasmid isolated from these
clones was restriction mapped. A plasmid having the
structure shown in Fig. 16 was selected and labeled
30 AG-pPVPh3.8 (or alternatively, p3.8). The ligation of
BalII and Bam_HI sites with each other inactivates both
sites.
Another subclone of 177.4 was constructed by
digestion with EcoRI, isolation of a 7.2kbp fragment
35 containing e:Ktensive 3' flanking sequences and all but
the extreme !~' end of the phaseolin gene, and isolated
~340'~1~
35a
after ampicillin selection of HB101 transformants were
restriction mapped. A plasmid having the insert
oriented so that tree HindIII site of pBR322 was adjacent
to the 5' end. of the phaseolin gene and distal to the 3'
untranslated region was labeled AG-pPVPh7.2 (or p7.2;
Fig. 13; Sun et al and Slightom et al, supra).
6.2 Cloninct and isolation of a kanamycin resistance
gene
pRZ102 (R. A. Jrorgenson et al (1979) Molec. Gen.
Genet. 177:65-72), a ColEI plasmid carrying a copy of
the transposo~n TnS) was digested with BamHI and HindIII,
mixed with pE~R322 (Fig. 17) previously linearized with
the same two enzymea, ligated, and transformed into
K802. Plasmi.ds, i:~olated from transformants selected
for resistance to both ampicillin and kanamycin were
restriction mapped and one having the structure shown in
Fig. 18 was labeled pKS-4.
6.3 Linkage of then phaseolin Qene with a kanamycin
resistance gent
p3.8 was. digested with ClaI and BamHI, and a 4.2kbp
fragment cont.aininc3 the phaseolin gene and some pBR322
sequences was. isolated by agarose gel electrophoresis.
This was mixed with a ClaI/BamHI fragment of Tn5
carrying a ka.namycin resistance (neomycin
phosphotransferase LI) gene from pKS4 (Fig. 18) and
pBR322 (Fig. 17) which had been linearized with ClaI.
The mixture was ligated and transformed into K802.
After selection of colonies resistant to ampicillin and
kanamycin, pl.asmids were isolated and restriction
mapped. A colony having the structure shown in Fig. 19
was labeled pKS-KB:3.8.
The cons~truct:Lon of another useful plasmid,
pKS4-KB, is described in Example 5.2.
~~~o~~~
Example 7
This example is analogous to the construction described in Example 5,
except for the substitution of a cDNA clone for the genomic clone of
phaseolin. This construction will result in a gene lacking introns.
7.1 Construction of ~~4-KB2.4 analo ous to KS4-KB
After pMC6 (Fig. 20~) is digested with EcoRI and BamHI, a 2.4kbp phaseolin
cDNA fragment is isolats~d by centrifugation through a salt gradient or gel
electrophoresis. A 1.9k.bp fragment containing a gene for kanamycin resistance
is purified from a EcoRI and BamHI digest of pKS4 (Fig. 18); mixed with the
cDNA fragment and EcoRI-linearized pBR322, ligated, and transformed into
K802. Colonies are selected for kanamycin resistance, and after plasmid
isolation and restriction mapping, a plasmid as shown in Fig. 21 is labeled
pKS4-KB2.4.
7.2 Ligation of the CIaI kan bean DNA into CIaI digested S-ProI
pKS4-KB2.4 is digested with CIaI and ligated with CIaI-linearized pKS-
proI (Fig. 12). After transformation, selection, plasmid isolation and
characterization, the desired construction, having the phaseolin sequences
adjacent to the T-DNA promoter, is transferred to a Ti plasmid. Inoculation
and testing is as described in Examples 21, 19, and 20.
Exampl a 8
This example teaches a method of removing the introns from a gene. This
is the same as placing a cDNA in a genomic environment. Restriction enzyme
sites are found, or created by site specific mutagenesis, in exons on both the
5' and 3' extremities of the unprocessed transcript. These sites exist in
both the genomic clones and cDNA. The intervening intron-containing DNA can
be removed from the genanic clone and be replaced with the corresponding
intronless cDNA clone fragment spanning the two sites. The reverse operation
is also possible: intron-containing genomic sequences can be placed in a cDNA
environment. One inserts an internal fragment of the genomic clone into a
corresponding gap cut oui: of a cDNA clone. This latter strategy is analogous,
though often technically more difficult as the introns may contain sites
susceptible to the enzymes chosen to create the exchanged fragment. This
difficulty can be overcane by careful selection of conditions of partial
-36-
4340714
37
digestion and by purification of the desired fragment by
agarose gel electrophoresis. Further elaborations of
this strategy include the manipulation of individual
introns within a gene while leaving other introns and
exons unaffecaed, and the stepwise exchange of sequences
when inconvenient :intervening restriction sites are
present within intr0ns as discussed above.
8.1 Replacement o:f a fragment containing phaseolin's
introns with cDNA
p3.8, a plasm:id clone of the phaseolin gene and its
flanking sequences, was digested respectively partially
and to complexion with EcoRI and SacI, and a 6.4kbp
fragment, containing the pBR322 vector and both the 5'
and 3' ends of the gene, was isolated by agarose gel
electrophore:ais. pcDNA3l, a pBR322 plasmid clone of
cDNA made from pha;seolin mRNA, was digested respectively
partially and to completion with SacI and EcoRI, and a
1.33kbp fragnnent, containing the entire phaseolin cDNA
except for sE:quences at the extreme 5' and 3' ends, was
isolated by agarose gel electrophoresis. These two
fragments were ligated together and transformed into
HB101. After selection of colonies, growth of cells,
and plasmid isolat.ian, restriction mapping identified a
plasmid having the desired structure. This plasmid was
labeled p3.8--cDNA (Fig. 22).
8.2 Use of x~3.8~cDNA
Note that p3.~B--cDNA can substitute for the genomic
DNA source, E~.g., p3.8, used in other Examples and that
when so used will :result in analogous constructions
differing in that 'they are lacking introns. Alterna-
tively, this strategy can be used to remove introns from
construction: already made.
Example 9
This example 'teaches the expression of an intron-
less gene. '.Che phaseolin cDNA is prepared as described
~~4om4
38
in Example 8, but a gene that naturally lacks introns
could also be: used,.
An analogous c:onstruction to those taught in
Examples 7 and 8 i:a used. pKS4-KB and pMC6 are digested
with EcoRI arid Sac7C as taught in Example 8 and as
described thE:re, the cDNA insert is ligated into the
pKS4-KB fragment containing the vector and the 5' and 3'
extremities of the phaseolin gene. The new plasmid,
pKS4-KBc, is used in constructions in an analogous
manner to pKS:4-KB.
Example 10
The purpose of this example is to teach the place-
ment within T-DNA of the cDNA for a Phaseolus vulgaris
lectin under the control of a T-DNA gene promoter, the
transfer of this construction to a plant cell, and the
detection of this c:onstruction's expression within plant
tissue.
This cor~struci~ion utilizes a single-stranded linker
to connect the sticky-ends resulting from digestion with
the restriction en~.ymes PstI and HindIII. When PstIII
and HindIII sites
Pst7: HindIII
5'...C TCCA~'G...3'' S'...A*AGCT T...3'
3'...G*ACGT C...5'' 3'...T TCGA*A...S'
are cleaved t:o form the following ends:
PstI HindIII
5'...CTGCA AGCTT...3'
3'...G A...5'
and are mixed together in the presence of a linker of
3 0 appropriate :sequence
5' . . . CT~rCA AGCTT . . . 3'
3'...G A...5'
3' ACGTTCGAS'
they can be l.igated together to form the following
suture:
13~071~
39
_HindIII
5' ..C '.fGCA*AGCT T...3'
3'...G*ACGT TOGA*A...5'
Note that a HindIII site is reconstructed.
The lecmin cD:HA is obtained from a plasmid clone,
pPVL134, ATCC39181, that was constructed by poly C-
tailing double-stranded cDNA followed by insertion into
PstI cut, G-mailed pBR322. This clone was described by
L. Hoffman eit al (1982) Nucleic Acids Res.10:7819-7828.
10.1 Svnthe:ais of the linker
The linlter 5'.AGCTTGCA3' is synthesized by the
method of Example 1'l.
10.2 Construction of a clone containing lectin cDNA and
a kanam~,rcin resistance ciene
pPVL134 is digested with Bcll and PstI, and the
intermediate-sized fragment containing the lectin coding
sequence, 3' untranslated region, and a C/G tail is
isolated by elution from an agarose gel after separation
by electrophoresis. pBR325 is digested with BclI and
HindIII and 'the largest fragment is isolated after
sedimentation through a salt gradient. The BclI/HindIII
pBR325 vector is mixed with and ligated to the BclI/PstI
lectin fragment and the PstI/HindIII linker prepared in
Example 10.1. E. coli K802 is transformed, selected for
drug resistance and presence of lectin sequences, and
the plasmid isolated from such cells is labeled IIc.
The largest fragment resulting from HindIII and BamHI
digestion of IIc is mixed with and ligated to the
kanamycin resistance gene-carrying HindIII/BamHI frag-
ment of pKS-4 which is previously isolated by agarose
gel electrophoresis (Fig. 23). K802 is transformed, and
colonies are selected for kanamycin resistance, plasmics
are isolated and characterized by restriction mapping.
The desired plasmid is labeled pL-B.
10.3 Chance of a ClaI site to GamHI site in pKS-proI
pKS-proI, whose construction was described in
Example 5.1 (see F'ig. 12) is digested with ClaI. This
13~071~
39a
cut is located between the promoter and ATG translation
start signal of the l.6kbp transcript (see Fig. 1). The
sticky-ends are converted to blunt-ends by filling in by
DNA polymerase I. BamHI linkers are ligated into the
gap, trimmed to expose BamHI sticky-ends, ligated, and
transformed into K802. Colonies harboring the desired
plasmid, pKS-proIA (Fig. 24), are selected after
"miniprep" plasmid isolations and a characterization by
restriction enzyme mapping.
10.4 Insertion of lectin and kanamycin resistance enes
into pKS-proI~~
pL-B (Ex:ample 10.2) is digested with BclI and
BamHI, and th.e fragment carrying the kanamycin
resistance gene and lectin sequences is eluted from an
agarose gel after e~lectrophoretic separation. This
fragment is mixed with and ligated to BamHI linearized
pKS-proIA. T'he lic~ation mixture is transformed into
K802. Plasmids are: isolated from kanamycin resistant
colonies, characterized by restriction mapping, and the
desired construction labeled pLK-proIA (Fig. 25).
h ~-_ ~3~0'~1~
10.5 Expression i_n plants
pLK-proIA is transferred to a Ti plasmid by a triparental mating (Example
21) of K802(pLK-proIA);.E-.. coli.(2013),and A. tumefaciens (pTi15955)
(streptomycin resistant). After additional conjugational transfer of pPHlJ1
into the Agrobacterium, double-homologous recombinants are selected by growing
cells on kanamycin, streptomycin, and gentamycin. Lectin is detected by ELISA
with the appropriate antibodies.
Example 11
The purpose of this example is to generate a Ti plasmid with a deletion
from the tms ("shooting" locus) through the tmr ("rooting" locus) of pTi15955
and other octopine Ti pl,asmids. This derivative is useful because cells
transformed by it are easier to regenerate to whole plants than cells
transformed by pTi15955 with intact tms and tmr genes.
The tms-tmr deleted pTi15955 is ultimately changed in two ways: the in
activation of tms-tmr and the insertion of a foreign gene. Should these two
changes be located at different points of the T-DNA, each change is inserted
independently by different shuttle vectors. Each shuttle vector dependent
change is selected independently which will necessitate use of at least two
markers selectable in Agi~obacterium. In addition to the usual kanamycin
resistance, this example utilized a chloramphenicol resistance derived from
pBR325.
11.1 Construction of a c:hloramphenicol resistance ene clone
pBR325 is digested with HincII and blunt end legated with HindIII
linkers. The resultant preparation is digested with HindIII, relegated,
selected for chlorampheniicol resistance (cam), and labeled pKS-5 which
will serve as a source of the HindIII/BcII fragment which contains the cam
~ gene (Fig. 26).
11.2 Construction of a pBR322 clone of T-DNA with a deletion and a cam ene
A 9.2kbp linear DNA fragment is isolated from a complete HindIII and
partial BamHI digest of E>203. lfhe fragment carrying the cam gene is isolated
from pKS-5, mixed with the 9.2kbp linear fragment, legated, transformed into
E. cola) selected for chloramphenicol resistance, and labeled pKS-Oct.Cam203
(Fig. 27).
-40-
13~~711~
pKS-oct.Cam203 is a plasmid clone that can now be used to construct
a number of deletion n mutants of pTi15955. It contains the right hand arm
of TL and a resistance gene to the left of the right arm. We can attach
various left-hand arms of TL to the left of the cam gene (HindIII site). For
instance, if p102 is attached the deletion is 5.2kbp long and includes all of
tms and tmr. If p103 is attached the deletion is 3.2kbp long and includes
part of tms and all of t~,mr. See Fig. 1.
pKS-oct.Cam203 is digested with HindIII. p102 or p103 is digested with
HindIII and the 2.2kbp or 2.Okbp T-DNA fragment is isolated and ligated with
the linearized pKS-oct.Cam203, transformed, isolated yielding pKS-oct.delII
(Fig. 28) or pKS-oct.delI (Fig) 29), respectively. These constructions are
moved into A. tumefaciens by mating, homologous recombinations, and selection
for chloramphenicol resistance. Alternatively, one moves the constructions
into pRK290 by use of established methods by linearizing the construction
carrying plasmids with B~amHI and ligating into the B~,1_II site of pRK290
(Fig.
30).
Example 12
The Ti plasmid is mutated in this example by deleting the T-DNA between
the HpaI site in tmr to vthe SmaI site in tml. The Ti plasmids that can be
modifed include pTi15955) pTiB6, pTiA66 and others. This construction is
diagrammed in Fig. 31.
12.1 Isolation of the cam ene
pKS-5 (Fig. 26) is digested with HindIII and BcII. The smallest fragment
is isolated after separala on on an agarose gel, as taught in Example 11.
12.2 Construction of a pBR322 clone of T-DNA with a deletion
The right hand arm of the 'f-DNA deletion is constructed by insertion of
Bc~III sites into the Smal~ sites of p203 (see Fig. 1). p203 is digest, by
SmaI, ligated with BqIII linkers, digested with Bc~III, religated,
and transformed into K80i!. In an alternative construction, BamHI linkers may
be substituted for Bc~III linkers and the appropriate BamHI partial digest
products are isolated.) fhe resultant plasmid is labeled p203-BgIII, and is
digested with B~,1_II and HindIII. The large BqIII/HindIII vector containing
fragment is ligated with the chloramphenicol resistance fragment whose
... -41-
134071
isolation was described in Example 12.1. Chloramphenicol resistance is
selected for after transformation into K802. The resultant plasmid is labeled
p2f (Fig. 31).
12.3 Construction of left-hand arm of T-DNA deletion clone
HindIII sites are inserted into the H~aI site of p202 by digestion with
H~aI and ligation with HindIII linkers. After unmasking of the HindIII sticky
ends by digestion with tlhat restriction enzyme, the 2kbp HMI fragment which
now bears HindIII ends i~s isolated. HindIII digested HindIII-ended H~aI
fragment and transformed into K~B02. After a colony containing the desired
construction is isolated; and characterized, the plasmid is labeled pie (Fig.
32).
12.4 Construction of the T-DNA deletion clone
The left-hand arm of the clone is obtained by purifying a 2kbp fragment
of a HindIII digest of p:3e by elution from an agarose gel after
electrophoresis. p2f is cut by HindIII, treated~~with alkaline phosphatase,
mixed with the 2kbp fragrnent, ligated, transformed into K802; and selected
for
chloramphenicol resistance) Plasmids are isolated from individual colonies
and characterized by resi:riction mapping. A plasmid having the two arms in
the desired tandem orientation is chosen and labeled pKS-Oct.delIII (Fig. 33).
pKS-oct.delIII is moved into A. tumefaciens by mating, and homologous
recombinants are selected with chloramphenicol. Sunflower and tobacco roots
and shoots are inoculated as described in other Examples and the tumors
generated are tested for opines.
Exam le 13
This example teaches a construction deleting tmr and tml that provides an
alternative to that taught in E;Kample 12.
13.1 Construction of a c;hloramphenicol resistant fragment with a BgIII site
pBR325 is digested with HincII, blunt-end ligated with BgI,II
linkers, digested with BdIII, and religated (Fig. 34). Chloramphenicol
resistance is selected for after transformation of either K802 or GM33. The
resultant plasmid, pKS-6 serves as a source of the BgIII/BcII fragment
carrying the cam gene.
-42-
I3~0'~14
13.2 Construction of the tmr; tml deletion clone
p203 is digested with H~aI and SmaI. After blunt end ligation with Bc~II
linkers, it is digested with B~III to expose the BgIII sticky-ends, religated,
and transformed into K802. The desired construction is identified and labeled
p2 (Fig. 35).
13.3 Construction of the T-DNA deletion clone (pKS-oct.delIIIa)
The BgIII fragment carrying the cam gene is isolated from pKS-6 and
ligated into BgIII-cut p~2. Chloramphenicol resistance is selected for after
transformation of K802. The resultant plasmid is labeled pKS-oct.delIIIa
(Fig. 36), and is tested as described in Example 12.4.
Example 14
The purpose of this construction is to provide an example of the mutation
of the tmr locus only at the H~aI site by insertion of the chloramphenicol
resistance gene. This gene is isolated as the Bc~III/BcII fragment from pKS-6,
and is ligated into the,H~aI site of p203 after that site is changed to a
_B~III site.
14.1 Conversion of the HpaI site to a BgIII site
p203 is digested with H~aI, ligated to BgIII linkers, trimmed with BgIII
and relegated. After transformation of K802, colonies are selected and
screened by restriction mapping for insertion of B~III sites (Fig. 37).
14.2 Isolation of the cam gene,
pKS-6 is digested with BgIII and BcII. The smallest fragment is isolated
by agarose gel electrophoresis.
14.3 Construction of the mutated T-DNA clone
The modified p203 from Example 14.1 is digested with BgIII, legated with
the purified cam gene from Example 14.2 and transformed into K802.
Chloramphenicol resistance is selected for, and after isolation from the
resistant transformants and characterization by restriction enzyme mapping,
the plasmid is labeled pi~CS-oct.tmr (Fig. 38).
-43-
1340~1~
44
Example 15
Regeneration in this example involves carrot tumors
incited by an Ri-based TIP plasmid and is effected
essentially ~~s described by M. D. Chilton et al (1982)
Nature 295:4:32-434.
15.1 Infection with hairy root
Carrot disks axe inoculated with about 10594
bacteria in 0.1 ml of water. One to 1.5 cm segments of
the ends of 'the roots obtained are cut off, placed on
solid (1-1.5~~ agar) Monier medium lacking hormones (D. A.
Tepfer and J.C. Tempe (1981) C.R. Hebd. Seanc. Acad.
Sci., Paris 295:153-156), and grown at 25°C to 27°C in
the dark. Cultures uncontaminated by bacteria are
transferred ~svery 2 to 3 weeks and are subcultured in
Monier medium lacking hormones and agar.
15.2 Regeneration of roots to plants
The cultured root tissue described in Example 15.1
is placed on solidified (0.8% agar) Monier medium
supplemented with 0.36uM 2,4-D and 0.72uM kinetin.
After 4 week,, the resulting callus tissue is placed in
liquid Monie:r medium lacking hormones. During incuba-
tion at 22 t~o 25°C on a shaker (150 r.p.m.) for one
month, the callus disassociates into a suspension
culture from which embryos differentiate, which, when
placed in Petri dishes containing Monier medium lacking
hormone, develop into plantlets. These plantlets are
grown in culture, and after "hardening" by exposure to
atmospheres of progressively decreasing humidity, are
transferred to soil in either a greenhouse or field
plot.
15.3 Use of non-ha.irv root vectors
Ti-based vectors which do not have functional tmr
genes are used instead of the Ri-based vectors as
described in Examples 15.1 and 15.2. Construction of
suitable deletions. is described in Examples 12, 13, and
14.
140714
Examt~le 16
Regeneratic>n in this example involves tobacco
tumors incited x>y a Ti-based TIP plasmid and is
5 effected essentially as described by K.A. Barton et al
(1983) Cell.
16.1 Infection with crown .gall
Tobacco tissue is transformed using an approach
utilizing invert:ed stem segments first described by
10 A.C. Braun (195E~) Canc. Res. 16:53-56. Stems are
surface sterilized with a solution that was 7%
commercial Chlot-ox* and 80% ethanol, rinsed with
sterile distills:d water, cut into 1 cm segments, and
placed basal end up in Petri dishes containing
15 agar-solidified MS medium (T. Murashige and F. Skoog
(1962) Physiol. Plant. 15:473-479) lacking hormones.
Inoculation is effected by puncturing the cut basal
surface of the :aem with a syringe needle and injecting
bacteria. Stem:: are cultured at 25°C with 16 hours of
20 light per day. The calli which develop are removed
from the upper surface of the stem segments, are placed
on solidified M~~ medium containing 0.2 mg/ml
carbenicillin and lacking hormones, are transferred to
fresh MS-c:arbenicillin medium three times at intervals
25 of about a. month, and are tested to ascertain whether
the cultures had been ridden of bacteria. The axenic
tissues are maintained on solidified MS media lacking
supplements unde=r the culture conditions (25°C; 16
hr.:8 hr. light:: dark) described above.
30 16.2 Culture of transformed tissue
Clonea are obtained from the transformed axenic
tissues as'. described by A. Binns and F. Meins (1979)
Planta 145:365-:369. Calli are converted into
suspensions of c=ells by culturing in liquid MS having
35 0.02 mg/1 naphthalene acetic acid (NAA) at 25°C for 2
or 3 days while being shaken at 135 r.p.m.,and filter-
ing in turn through 543 and 213~,m stainless steel
1340!714
45A
meshes. The passed filtrate is concentrated, plated in
5m1 of MS
* Trade-mark
134071
46
medium containing 0.5% melted agar, 2.0 mg/1 NAA, 0.3
mg/1 kinetin and 0,.4 g/1 Difco yeast extract at a
density of ax~out 8 x 10534 cells/ml. Colonies reaching
a diameter of aboui~ 1 mm are picked by scalpel point,
placed onto a:nd grown on solidified MS medium having 2.0
mg/1 NAA and 0.3 mg/1 kinetin. The resulting calli are
split into pieces and tested for transformed phenotypes.
16.3 Regeneration of plants
Transformed c7Lones are placed onto solidified MS
medium having 0.3 mg/1 kinetin, and cultured as des-
cribed in Example 16.1. The shoots which form are
rooted by putaing i:hem on a solid (1.0% agar) medium
containing 1/'10 strength MS medium salts, 0.4 mg/1
thiamine, lacking :sucrose and hormones, and having a
pH of 7Ø Footed plantlets are grown in culture,
hardened as described in Example 15.2, and are
transferred t:o soi7L in either a greenhouse or field
plot.
16.4 Vectors used
The methods dEascribed in Examples 16.1, 16.2 and
16.3 are suitable Ti.-based vectors lacking functional
tmr genes. ~'.onstruction of suitable deletions is
described in Examp7Les 12, 13, and 14. These methods are
also effective when used with Ri-based vectors. The
method described in Example 16.1 for infection of
inverted stem segments is often useful for the
establishment: of T7CP transformed plant cell lines.
Example 17
The techniques for chemical synthesis of DNA
fragments used in i~hese Examples utilize a number of
techniques well known to those skilled in the art of DNA
synthesis. Z'he modification of nucleosides is described
by H. Schalle:r et al. (1963) J. Amer. Chem. Soc. 85:
3821-3827. The prs:paration of deoxynucleoside phosphor-
amidites is described by S.L. Beaucage and M.H.
Caruthers (1981) TEarahedron Lett. 22:1859. Preparation
1340714
47
of solid phase resin is described by S.P. Adams et al
(1983) J. Ame:r. ChEam. Soc. Hybridization procedures
useful for tree formation of double-stranded synthetic
linkers are olescribed by J.J. Rossi et al (1982) J.
Biol. Chem. 2.57:92:'6-9229.
Example 18
Phaseoli.n is 1_he most abundant storage protein
(approximatel.y 50% of the total seed protein) of
Phaseolis vul.Qaris. Transfer of the functional
phaseolin gene to alfalfa plants and translation of the
phaseolin m-F;NA ini:o stored phaseolin is of significant
economic value since it introduces storage protein into
leaf material. to be used as fodder. Alfalfa is a
valuable plant for the transfer and expression of the
phaseolin genie bec<iuse of its acceptance as cattle
fodder, its rapid growth, its ability to fix nitrogen
through Rhizobial :symbiosis, its susceptibility to crown
gall infection and the ability to regenerate alfalfa
plants from ~~ingle cells or protoplasts. This example
teaches the introduction of an expressible phaseolin
gene into intact alfalfa plants.
18.1 Construcaion of shuttle vector
Alfalfa plant:a are regenerated from crown gall
tissue containing genetically engineered Ag~robacterium
plasmids as described hereafter. In the first step we
construct a "'shutt:Le vector" containing a tmr5-4 and a
tms5-T-DNA mutant :Linked to a phaseolin structural gene
under control. of a T-DNA promoter. This construction
is, in turn, linked to a nopaline synthetase promoter
which has a functional neomycin phosphotransferase
(NPTII) strucaural gene (kanamycin resistance) down-
stream (reported b~~ M.D. Chilton et al (18 January
1983) 15th Miami Winter Symposium; see also J.L. Marx
(1983) Science 219:830 and R. Horsch et al (18 January
1983) 15th Miami Winter Symposium). A phaseolin
130714
48
structural gs:ne under control of a T-DNA promoter is
illustrated in Example 1.
18.2 Transfer to Ac~robacterium and plant cells
The "shuttle vector" is then transformed by con-
s ventional tec;hniques (Example 21) into a strain of
Aqrobacterium_ cont<~ining a Ti plasmid such as pTi15955.
Bacteria containing recombinant plasmids are selected
and co-cultivated with alfalfa protoplasts which are
regenerated c;ell w<~lls (Marton et al (1979) Nature
277:129-131: G. J. Wullems et al (1981) Proc. Natl
Acad. Sci. (Lf.S.A.) 78:4344-4348; and R.B. Horsch and
R.T. Fraley (18 January 1983) 15th Miami Winter
Symposium).
Cells are grown in culture and the resulting callus
tissue is tee>ted for the presence of the appropriate
mRNA by Northern blotting (Example 19) and for the
presence of t:he appropriate proteins by ELISA tests
(Example 20) (see ~T.L. Marx (1983) Science 219:830: R.B.
Horsch and R.T. Fraley (18 January 1983) 15th Miami
Winter Sympo~~ium) .
18.3 Plant re:aeneration
Alfalfa plant:a are then regenerated from callus
tissue by methods :similar to those previously used by
A.V.P. Dos Santos eat al (1980) Z. Pflanzenphysiol.
99:261-270, T.J. McCoy and E.T. Bingham (1977) Plant
Sci. Letters 10:59-66 and K.A. Walker et al (1979)
Plant Sci. Leaters 16:23-30. These regenerated plants
are then propagated by conventional plant breeding
techniques forming the basis for new commercial
varieties.
Example 19
In all Examples, RNA was extracted, fractionated,
and detected by the following procedures.
19.1 RNA extractioy
This procedure was a modification of Silflow et al
(1981) Biochemistry 13:2725-2731. Substitution of LiCl
X340714
48a
precipitation for CsCl centrifugation was described by
Murray et al (1981;) J. Mol. Evol 17:31-42. Use of 2 M
LiCl plus 2M urea to precipitate was taken from Rhodes
(1975) J. Biol. Chem. 25:8088-8097.
Tissue was homogenized using a polytron or ground
glass homogenizer :in 4-5 volumes of cold 50 mM Tris-HC1
(pH 8.0) containing 4% p-amino salicylic acid, 1%
tri-isopropyl. naptlzalene sulfonic acid, to mM
dithiothreitol (fr~ashly made) and 10 mM Na-metabisulfite
(freshly madE:) . N~-octanol was used as needed to
control foaming. An equal volume of Tris-saturated
phenol containing :1% 8-hydroxyquinoline was added to
the homogenate which was then shaken to emulsify and
centrifuged at 20,000-30,000 g for 15 minutes at 4°C.
The aqueous upper phase was extracted once with
chloroform/ocaanol (24:1) and centrifuged as above.
Concentrated LiCl-urea solution was then added to a
final concentration of 2 M each and the mixture was left
to stand at :>.0°C for. several hours. The RNA precipitate
was then centrifuged down and washed with 2 M LiCl to
disperse the pellet. The precipitate was then washed
with 70% ethanol-0.3M Na-acetate and dissolved in
sufficient sterile water to give a clear solution. One
half volume of ethanol was added and the mixture put on
ice for 1 hour, after which it was centrifuged to remove
miscellaneous polysaccharides. The RNA precipitate was
then recoverE:d and re-dissolved in water or in sterile
no salt poly I;U) bu:Efer.
19.2 Poly(U)/Sephadex chromatocrraphy
Two poly(U) Sephadex (trademark: Pharmacia, Inc.,
Uppsala, Sweden) buffers were used: the first with no
salt contain~Lng 20 mM Tris, 1 mM EDTA and 0.1% SDS, and
the second with 0.:1 M NaCl added to the first. In order
to obtain a good match at A42605, a 2x stock buffer
should be made and the salt added to a portion. After
adjusting then final concentrations, the buffers were
autoclaved.
~~~:o~~~
Poly(U) Sephadex ways obtained from 8ethesda Research Laboratories and lgm
poly(U) Sephadex was use, per 100ug expected poly(A)RNA. The poly(U) Sephadex
was hydrated in no salt ipoly-U buffer and poured into a jacketed column. The
temperature was raised to 60°C and the column was washed with no salt
buffer
until the baseline at 260mm was flat. Finally the column was equilibrated
with the salt containing poly(U) buffer at 40°C. The RNA at a
concentration
of less than 500ug/ml was then 'heated in no salt buffer at 65°C for 5
minutes,
after which it was cooled on ice and NaCI added to a concentration of O.1M.
The RNA was then placed on the column which should be run at no more than
lml/min until the optica~i density has fallen to a steady baseline. The column
temperature was then rai~~ed to 60°C and the RNA was eluted with no
salt
poly(U) buffer. The RNA will usually wash off in three column volumes. The
eluted RNA was then concentrated with secondary butanol to a convenient volume
after addition of NaCI to lOmM, and precipitated with 2 volumes ethanol. The
ethanol precipitate was dissolved in water and NH445-acetate added to O.1M,
followed by re-precipitation with ethanol. Finally the RNA was redissolved in
sterile water and stored at -70'°C.
19.3 Formaldehyde RNA gels
The method used followed that of Thomas (1980) Proc. Nat'1. Acad. Sci.
(U.S.A) 77:5201 and Hoffman, et al. (1981) J. Biol. Chem. 256:2597.
0.75-1.5% agarose gels containing 20mM Na-phosphate (pH 6.8-7.0) were
cast. If high molecular weight aggregate bands appeared, then the experiments
were repeated with the addition of 6% or 2.2M formaldehyde (use stock solution
of 36%) to the gels. The formaldehyde was added to the agarose ater cooling
to 65°C. Addition of fonnaldehyde caused visualization with ethidium
bromide
to be very difficult. The running buffer was lOmM Na-phosphate (pH 6.8-7.0).
Prior to electrophoresis, the RNA was treated with a denaturing buffer
having final concentrations of 6% formaldehyde, 50% formamide) 20mM Na-
phosphate buffer and 5mM EDTA. The RNA was incubated in the buffer at
60°C
for 10-20 minutes. The iincubation was terminated by addition of stop
buffer. For a 20u1 sample, 4u1 50% glycerol, lOmM EDTA, 5mM Na-phosphate and
bromphenol blue were added.
Submerged electrophoresis was used. The RNA was loaded before the
gel was submerged, and run into the gel at 125mA for 5 minutes. The gels were
then submerged and the current reduced to 30mA (overnight) or 50mA (6-8
-49-
.r
hours). The buffer was recirculated and the electrophoresis was done in a
cold room.
19.4 "Northern" blots
If the gel was to b~e blotted to detect a specific RNA, it was not
stained; but a separate marker lane was used for staining. Staining was with
5ug/ml ethidium bromide in O.1M Na-acetate and destaining was for several
hours in O.1M Na-acetate. Treatment in water at 60-70°C for 5-10
minutes
prior to staining helped visualization.
A gel to be blotted was soaked for 15 minutes in lOx standard
saline citrate (SSC)-3% formaldehyde. If large RNA molecules were not eluting
from the gel then a prior treatment in 50mM NaOH for 10-30 minutes helped to
nick the RNA. If base treatment was used, the gel should be neutralized and
soaked in SSC-formaldehyd a before blotting. Transfer of the RNA to
nitrocellulose was done by standard methods.
Prehybridization was done at 42°C for a minimtan of 4 hours in 50%
formamide, 10% dextran sulfate, 5x SSC, 5x Denhardt's, 100ug/ml denatured
carrier DNA, 20ug/ml pol;~(A), 40mM Na-phosphate (pH 6.8-7.0) and 0.2% SDS.
Hybridization was done b~~ addition of the probe to the same buffer with
overnight incubation. The probe was not be used at more than approximately 5
x 10554 c.p.m./ml.
After hybridization, the nitrocellulose was washed a number of times at
42°C with 2x SSC, 25mM Na-phosphate, 5mM EDTA and 2mM Na-pyrophosphate
followed by a final wash for 20 minutes at 64°C in lx SSC. Best results
were
obtained if the filter was not dried prior to autoradiography and the probe
could be removed by extensive washing in 1mM EDTA at 64°C.
Exa_ mple 20
"Western" blots, to detect anitgens after SDS-polyacryamide gel
electrophorsis, were done essentially as described by R. P. Legocki and D. P.
S. Derma (1981) Analyt. f3iochem. 111:385-392.
Micro-ELISA (enzyme--linked inmuno-sorbant assay) assays were done
using Imnulon-2 type plai:es with 96 wells by the following steps:
-50-
~3407~~
20.1 Bindin antibody to lp ates
On Day 1; thE~ wells were coated with 1:1000 dilution of antibody (rabbit
antiphaseolin IgG) in coating buffer. 200u1/well incubated at 37°C for
2-4
hours. The plates. were covered with Saran Wrap: Then the plates were rinsed
three times with phosphate buffered saline-Tween *(PBS-Tween) allowing a 5
minute waiting period between each rinse step. Then 1% bovine serum albumin
(BSA) was added to rinse and, after addition to the well, left to sit for 20
minutes before discarding. Rinsing was repeated five times more with PBS-
Tween.
20.2 Tissue homogenization
The tissue was sliced up into small pieces and then homogenized with a
poly~tron using lgm of tissue/ml phosphate buffered saline-Tween-2% polyvinyl
pyrollidone-40 (PEIS-Tween-2% PVP-40). All samples were kept on ice before and
after grinding and standard phaseolin curves were obtained. One standard
curve was done in tissue homogenates and one standard curve was also done in
buffer to check tree recovery of phaseolin when ground in tissue. Following
centrifugation of the homogenized samples, 100u1 of each sample were placed in
a well and left overnight at 4°C. To avoid errors, duplicates of each
sample
were done. The plates were sealed during incubation.
20.3 Bindin enmnne
After the ovE~rnight incubation, the antigen was discarded and the wells
were washed five tames with PBS-Tween allowing 5 minutes between each rinse.
A conjugate (,rabbit anti-phaseolin IgG alkaline phosphatase-linked) was
the diluted 1:30011 in PBS-Tween-2% PVP containing 0.2%BSA and 150u1 was added
to each well; followed by incubation for 3-6 hours at 37°C. After the
incubation, the conjugate was discarded and the wells were rinsed five times
with PBS-Tween) allowing five minutes between each rinse as before.
20.4 Assay
Irtmediately before running the assay) a 5mg tablet of p-nitrophenyl
phosphate (obtained from Sigma and stored frozen in the dark) was added per
lOml substrate ancf vorte~;ed until the tablet was dissolved. 200u1 of the
room
temperature solution was quickly added to each well. The reaction was
measured at various times.) e.g. t=0) 10, 20) 40, 60, 90 and 120 minutes,
using
* Trademarks
-51-
~.~ ~~71~
a dynatech micro-elisa reader. When p-nitrophenyl phosphate, which is
colorless, was hydrolysed by alkaline phosphatase to inorganic phosphate and
p-nitrophenol, the latter compound gave the solution a yellow color, which
could be spectrophotometrically read at 410nm. The lower limit of detection
was less than O.lng.
Example 21
Triparental matings were generally accomplished as described below; other
variations known to those skilled in the art are also acceptable. E. coliK802
(pRK290-based shuttle vector) was mated with E. coli(pRK2013) and an A.
tumefaciens strain resistant to streptomycin. The pRK2013 transferred to the
shuttle vector carrying strain and mobilized the shuttle vector for transfer
to the Agrobacterium. Growth on a medium containing both streptomycin and the
drug to which the shuttle vector is resistant, often either kanamycin or
chloramphenicol, resulted in the selection of Agrobacterium cells containing
shuttle vector sequences. A mating of these cells with E. coli(pPHlJ1)
resulted in the transfer of pPHlJ1 to the Agrobacterium cells. pPHlJ1 and
pRK290-based shuttle vectors cannot coexist for long in the same cell. Growth
on gentamycin, to which pPHlJ1 carries a resistance gene, resulted in
selection of cells having lost the pRK290 sequences. The only cells resistant
to streptomycin, gentamycin, and either kanamycin or chloramphenicol are those
which have Ti plasmids that have undergone double-homologous recombination
with the shuttle vector and now carry the desired construction.
-52-
13~071~
" "i
~m- 'o
c~
ov .S
r
I~ ~ r1 ~ NI
~
O
.r.,
° ~ ~ w
w
1~0 N N C01
" ~ ~,
..
y-~i M N ~O d'
..
rl N N e-I ~~ LW-i r-I ri tn
1C 10 1C 00 r-I e-1 N d' d' e-i
O
N N tf1 ~ 00 U 00
f~1 O O ~ N N N
8
53
1340714
M
WOI
1
O O ri M
W ~ o~ ov o o M O
~ N~ L7r ~ H H
N N didU' ~ M~N ~.~~f~0ly
'» tOd'd' 1 1 O OW
~i
H
N N M M
01 In 01 I~ 01 01 M 01 01 d' d' d'
~y-~1 N M M M M M N N ~-1
r~
M ~. e-i wl N N N d' M M ~O e-1 M d'
N
1fl lf1 ~ ~ ~~~I e~-I ~ ~~~i ~ ~ ~ In
O H N H H O
H~
~'.~~ ~~~ ~~~ ~a.a.
w ~ ~ a~ ~ s~ ~~ ~ ~ c~ a w ~ a w w
~.340'~14
Plasmid BacteriumMade or Ussd Shorn tn Made Out Of Refxences Comments
-
)
ra n) c. T F'~s: -'- or ynonyms
ExamPTs:
pKS4 6.2 18 pBR322) pRZ102
pKS4-KB2.4 7,1 21 pBR322, pKS4)
P~
pKS4-KB 5,2 7 pBR322, pKS4, = pKS4-3.OKB, =
pKS4-KB3,0
P7.2
pKS-KBc 9 pKS4-KB, pMC6
pKS-5 11.1 26 p8R325
pKS-6 13.1 34 pBR325
pKSil1 (5.1) 12 pRK290) p403
pKS-169 1,2 pBR322-R) p203
pL-B 10.2 23 pKS4, Ilc
pLK-prolA 10.4 25 pKS=prolA) pL-B
pMC6 14,5, 9 20 pBR322/phas.cDNAequivalent to
pMC36
pNNNi 2,2 8 pKS-noplV)
pKS4-KB
pNNN2 4,3 9
pKS-nopVl
pNNN4 4,4 pKS4-KB) pNNN2
pPHIJI 21 used to eliminate
shuttle
vector) same exclusion
group as pRK290,
carries
gene for resistance
to
gsntamycin) P.R,
Htrsh
(1973) Thesis) Univ,
E.
Anglia)
pPBL134 (10) 23
p8R322/IeccDNA
pRK290 common 30 G. Dttta, et al
(1980)
Proc, Nat,~cea,
Sct, USA
77:7347-7357.
pRK2013 21 used to mobilize
the
shuttle vector)
carries tra
genes that mobilize
a mod
site on pRK290 for
-
conJugaitonai transfer
of
pRK290 to A robacterium,
D)
H, Ftgursk , ,
Helinski) (1979)
Proc, Nat,
4cad, Sct, USA 76:1648-
1652, -
pRZ102 (6,2> ColEt, Tn5 = p7,2
pTtA66 1, 5, 12
octopine-type plasmld,
pTtA6 rtth a natural
insertion in tms
pTt86 -
pTi86 (12)
pTiC58 (2) 4)
nopaltne-type plasmid
pTt15955 common
1) 11 octoptne-type plasmld
Table 1
Page 2
~3~~7'~1~
Plasn~td BactsrtueMads x llsed Shorn tn Made Out Of References
Co~ents.
~fra n, c. T~ Exainp~ s: 'FT'gure: -- or ynonya~s
p2 13.2 35 p203
p2f 12,2 31 pKSS) p203- ?pKS-oct,can~203
Bglll
p2f-rt,/p3e-ift) 39
= pKS-oct,ca~n203
p2f-rt,/p102-lft,12,5 39
p2f, p102
p2f-rt./p103-lft,12.5 39
p2f) p103
pie 12.3 32 pBR322) p202
p3.8 6,1 22) 16
p8R322, 177,4= pJS3.8
p3,8-cDNA 8.1 22 pcDNA3l) p3.8
p7,2 6.1 13 p8R322) 177.4= pSS7,2, S. M,
Sun)
et al,
(1981) Nature 287:32-41,
p202 32 pBR322,
pTt15955
p203 1) 2, 11, 12) 13, 31, 35) pBR322,
36,
id 42 pT115955
p203-Bglll 12.2
31 p203
p401 5 11 def) p8R322)
2
def pT115955
p403 5 2 def pBR322,
pT115955
15955-12A 1.7 pTiA66) pKS-
OSI-K83.0
Ilc 10.1 23
pBR325, pPYL134
177.4 (6.1) 15 Charon AG-PVPh177,4) S,
M, Sun et
24A/phas. al, (1981) Nature
gene 289:3
Ta bl a 1
Pa ge 3
-S~-
~~~~1714
,:..
TABLE 2
NRRLB-153715 A.tumefaciens/p15955-12A
NRRLB-15394 E.coli C600/pKS4
NRRLB-1539;2 E.coli HB101/p3.8
NRRLB-15391 E..coli HB101/pcDNA31
ATCC 39181 E..coli HB101/pPUL134 '
~ _ ,.
