Note: Descriptions are shown in the official language in which they were submitted.
BACKGROUND OF THE INVENTION
The present invention relates generally to cytokine
receptors and, more specifically, to Interleukin-4 receptors.
Interleulcin-4 (IL-4, also known as B cell stimulating
factor, or BSF-1) Haas originally characterized by its ability to
stimulate the prol:Lferation of B cells in response to low
concentrations of <~ntibo~dies directed to surface immunoglobulin.
More recently, IL-~E has lbeen shown to possess a far broader
spectrum of biological a~~tivities, including growth co-stimulation
of T cells, mast cells, granulocytes, megakaryocytes, and
erythrocytes. In addition, IL-4 stimulates the proliferation of
several IL-2 and Ih-3 dependent cell lines, induces the expression
of class II major histor.ompatibility complex molecules on resting
B cells, and enhances the secretion of IgE and IgGi isotypes by
stimulated B cells, Both murine and human IL-4 have been
definitively characterized by recombinant DNA technology and by
purification to honnogene:ity of the natural murine protein (Yokota,
et al., Proc. Natl.Acad.Sci. USA 83:5894, 1986; Noma, et al.,
Nature 319:640, 19E36; and Grabstein, et al., J. Exp.Med. 163:1405,
1986).
The biological activities of IL-4 are mediated by
specific cell surface receptors for IL-4 which are expressed on
primary cells and in vitro cell lines of mammalian origin. IL-4
binds to the receptor, which then transducer a biological signal
to various immune e;ffector cells. Purified IL-4 receptor (IL-4R)
compositions will therefore be useful in diagnostic assays for
- 1 -
..
_>d, ~ .
13~O~1~i
IL-4 or IL-4 receptor, and in raising antibodies to IL-4 receptor
for use in diagnosis or therapy. In addition, purified IL-4
receptor compositions may be used directly in therapy to bind or
scavenge IL-4, providing a means for regulating the biological
activities of the cytokine.
Although IL-4 has been extensively characterized, little
progress has been made in characterizing its receptor. Numerous
studies documentin~~ the existence of an IL-4 receptor on a wide
range of cell types have been published; however, structural
characterization his been limited to estimates of the molecular
weight of the protE~in as determined by SDS-PAGE analysis of
covalent complexes formed by chemical cross-linking between the
receptor and radio:labele~d IL-4 molecules. Ohara, et al., (Nature
325:537, 1987) and Park, et al. (Proc.Natl.Acad.Sci. USA 84:1669,
1987) first establ,Lshed 'the presence of an IL-4 receptor using
radioiodinated recombinant murine IL-4 to bind a high affinity
receptor expressed in l.ow numbers on B and T lymphocytes and a
wide range of cell:> of tlhe haematopoietic lineage. By affinity
cross-linking 125I__IL-4 to IL-4R, Ohara, et al. and Park, et al.
identified receptor proteins having apparent molecular weights of
60,000 and 75,000 c~alton~s, respectively. It is possible that the
small receptor sizes observed on the murine cells represents a
proteolytically cleaved :Fragment of the native receptor.
Subseguent experiments by Park, et al. (J.
- 1a -
t
~t6~~r~~~
Exp. Med. 166:476, 1987) using yeast-derived recombinant human
IL-4 radiolabeled with 1251 showed that human IL-4 receptor is
present not only on ~ce~ll lines of B, T, and hematopoietic cell
lineages, but is also found on human fibroblasts and cells of
epithelial and endothelial origin. IL-4 receptors have since
been shown to be present on other cell lines, including CBA/N
splenic H cells (Nakajima et al., J. Immunol. 139:774, 1987),
Burkitt lymphoma Jijoye cells (Cabrillat et al., Bjochem. &
Biophys. Res. Commun. 149:995, 1987) a wide variety of
hemopoietic and nonhe~riopoietic cells (Lowenthal et al.,
J. Immunol. 140:456, 1988) and murine Lyt-2 /L3T4 thymocytes.
More recently, Park et al. (UCLA Symposia, J. Cell B.tol.,
Suppl. 12A, 1988) reported that, in the presence of sufficient
protease inhibitors, 1251-IL-4-binding plasma membrane
receptors of 138-145 k.Da could be identified on several murine
cell lines. Considerable controversy thus remains regarding
the actual size and structure of IL-4 receptors.
Further study of the structure and biological
characteristics of IL-4 receptors and the role played by IL-4
receptors in the responses of various cell populations to IL-4
or other cytokine stimulation, or of the methods of using IL-4
receptors effectively in therapy, diagnosis, or assay, has not
been possible because of the difficulty in obtaining
sufficient quantities of purified .IL-4 receptor. No cell
lines have previously been known to express high levels of
IL-4 receptors constitutively and continuously, and in cell
lines known to express detectable levels of IL-4 receptor, the
2
72249-23
_.
~~~~"~~ 1
level of expression i:~ generally limited to less than about
2000 receptors per cell. Thus, efforts to purify the IL-4
receptor molecule for use in biochemical analysis or to clone
and express mammalian genes encoding IL-4 receptor have been
impeded by lack of purified receptor and a suitable source of
receptor mRNA.
SUMMARY OF THE INVENTION
The present invention provides DNA sequences
encoding mammalian Interleukin-4 receptors (IL-4R) or subunits
thereof. Preferably, such DNA sequences are selected from the
group consisting of: (a) cDNA clones having a nucleotide
sequence derived from the coding region of a native IL-4R
gene; (b) DNA sequences capable of hybridization to the cDNA
clones of (a) under moderately stringent conditions and which
encode biologically active IL-4R molecules; and (c) DNA
sequences which are degenerate, as a result of the genetic
code, to the DNA sequences defined in (a) and (b) and which
encode biologically ,active IL-4R molecules. The present
invention also provides recombinant expression vectors
comprising the DNA sequences defined above, recombinant IL-4R
molecules produced using the recombinant expression vectors,
and processes for producing the recombinant IL-4R molecules
using the expression vectors. Such an expression vector may
comprise (1) such a synthetic or cDNA sequence, operably
linked to (2) a transcriptional and t ranslational regulatory
element derived from a mammalian, microbial, viral or insect
gene, said regulatory element including (a) a transcriptional
2a
72249-23
~~t~~ ~~1
promoter, (b) a sequence encoding suitable mRNA ribosomal
binding site andL ( c ) :sequences which cont rol the terminat ion
of t ransc ript ion. and t; rans lat ion .
The present invention also provides substantially
homogeneous protein compositions comprising mammalian IL-4R.
The full length murinE~ molecule is a glycoprotein having a
molecular weight of about 130,000 to about 140,000 Mr by
SDS-PAGE. The apparent binding affinity (Ka) for COS
cells transfected with murine IL-4 receptor clones 16 and
18 from the CTLL 19.4 library is 1 to 8 x 109 M 1. The Ka
for COS cells transfected with murine IL-4 receptor clones
7B9-2 and 7B9-4 from the murine 7B9 library is 2 x 109 to
1 x lOlOM 1. The mature murine IL-4 receptor molecule has
an N-terminal amino acid sequence as follows:
I K V L G E P T C F S D Y I R T S T C E W.
2b
72249-23
~3~~~~b~.
The human IL-4R mol~scule is believed to have a molecular weight of between
about 110,000
and 150,000 Mr and has an N-terminal amino acid sequence, predicted from the
cDNA sequence and
by analogy to the biochemically deternnined N-terminal sequence of the mature
murine protein, as
follows: MKVLQEPTCVSDYMSISTCEW.
The present invention also provides compositions for use in therapy,
diagnosis, assay of IL-4
receptor, ar in raising ar~bodi~as to IL-4 receptors, comprising effective
quantities of soluble receptor
proteins prepared according to the foregoing processes. Such soluble
recombinant receptor
molecules include truncated proteins wherein regions of the receptor molecule
not required for IL-4
Minding have been deleted. These anc! other aspects of the present invention
will become evident
upon reference to the following detailed description and attached drawings.
RI :F DESCRIPTION OF THE DRAWINGS
Figure 1 shows restricl;ion maps. of cDNA clones containing the coding regions
(denoted by a
bar) of the rnurine and human iL-4R cDNAs. The restriction sites EcoRl, Pvull,
Hinc II and Sst I are
represented by the letters R, P, H and S, respectively.
Figures 2A-C depict the cDNA sequence and the derived amino acid sequence of
the coding
region of a murine IL-4 receptor, as dE;rived from clone 7B9-2 of the 7B9
library. The N-terminal
isoleucine of the mature protein is designated amino acid number 1. The coding
region of the full-
length membrane-bound protelin from cNone 7B9-2 is defined by amino acids 1-
785. The ATC codon
specifying the isoleuane residue constituting the mature N-terminus is
underlined at position 1 of the
protein sequence; the putative transmembrane region at amino acids 209-232 is
also underlined. The
sequences of the coding regions of clones 7B9-4 and clones CTLL-18 and CTLL-16
of the CTLL
19.4 library are identical to that of 7B9-2 except as follows. The coding
region of CTLL-16 encodes a
membrane-bound IL-4-bindinl~ receptor defined by amino acids -25 through 233
(including the
putative 25 amino acid signal peptide aequence), but is followed by a TAG
terminator codon (not
shown) which ends the open reading frame. The nucleic acid sequence indicates
the presence of a
splice donor site at this position (indicates! by an arrow in Figure t ) and a
splice acceptor site near the 3'
end (indicated by a second arrow), suggesting that CTLL-16 was derived from an
unspliced mRNA
intermediate. Clones 7B9-4 and CTLL-18 encode amino acids 23 through 199 and -
25 through 199,
respectively. After amino acid 199, a 1 X14-base pair insert (identical in
both clones and shown by an
open box in Figure a) introducE~s six nevv amino acids, followed by a
termination codon. This form of
the receptor is so~uWe.
Figure 3 is a schematic illustration of the mammalian high expression plasmid
pCAV/NOT,
which is described in greater detail in Example 8.
Figures 4A-C depict the coding sequence of a human IL-4 receptor cDNA from
clone T22-8,
which was obtained from a cDNA librar)r derived from the T cell line T22. The
predicted N-terminal
methionine of the mature protein and the transmembrane region are underlined.
Figures 5A-B are a comparison c~f the predicted amino acid sequences of human
(top line) and
murine (bottom line) IL-4 receptor cDNA clones.
3
1340~1~i
DETAIL DESCRIPTION OF THE INVENTION
As used herein, the terms "IL-~4 receptor" and "IL-4R" refer to proteins
having amino acid
sequences which are substarrtia.i~yr slm'ctar to the native mammalian
Interleukin-4 receptor amino acid
sequences disclosed in Figurers 2 and 4, and which are biologically active as
defined below, in that
they are capable of binding Intc;rleukin-4~ (1L-4) molecules or transduang a
biological signal initiated by
an IL-4 molecule binding to a all, or cross-reacting with anti-IL-4R
antibodies raised against IL-4R from
natural (i.e., nonrecombinant) sources. The native murine IL-4 receptor
molecule is thought to have
an apparent molecular weight by SDS-PAGE of about 140 kilodaltons (kDa). The
terms "IL-4 receptor"
or "IL-4R" include, but are not; limited to, analogs or subunits of native
proteins having at least 20
amino acids and which exhibit at least some biological activity in common with
IL-4R. As used
throughout the specification, the term "mature" means a protein expressed in a
form lacking a leader
sequence as may be present in full-length transcripts of a native gene.
Various bioequivalent protein
and amino acid analogs are de;~cribed in detail below.
The term "substantially similar," when used to define either amino acid or
nucleic acid
sequences, means that a particular subject sequence, for example, a mutant
sequence, varies from a
reference sequence by one or more substitutions, deletions, or additions, the
net effect of which is to
retain biological activity of the IL-4R protein. Alternatively, nucleic acid
subunits and analogs are
"substantially similar" to the s~yecitic DMA sequences disclosed herein if:
(a) the DNA sequence is
derived from the coding region ~of a native: mammalian IL-4R gene; (b) the DNA
sequence is capable of
hybridization to DNA sequences of (a) under moderately stringent conditions
and which encode
biologically active IL-4R molecules; or DIVA sequences which are degenerate as
a result of the genetic
code to the DNA sequences defined in (a) or (b) and which encode biologically
active IL-4R
molecules. Substantially similar analog proteins will be greater than about 30
percent similar to the
corresponding sequence of the native IL-4R. Set~ences having lesser degrees of
similarity but
comparable tHOlogical activity 2~re considlered to be equivalents. More
preferably, the analog proteins
will be greater than about 80 percent siimilar to the corresponding sequence
of the native IL-4R, in
which case they are defined as; being "substantially identical." In defining
nucleic acid sequences, all
subject nucleic acid sequences capable of encoding substantially similar amino
acid sequences are
considered substantially simil~~r to a reference nucleic acid sequence.
Percent similarity may be
determined, for example, by c;omparine,~ sequence information using the GAP
computer program,
version 6.0, available from the ljryversity of Wisconsin Genetics Computer
Group (UWGCG). The GAP
program uti~zes the alignment method of hleedlernan and Wunsch (J. Mol. Biol.
48:443, 1970), as
revised by Smith and Waterman (Adv. ,Appl. Math. 2:482, 1981). Briefly, the
GAP program defines
similarity as the number of aligned symW Is (i.e., nucleotides or amino acids)
which are similar, divided
by the total number of symbols in the shorter of the two sequences. The
preferred default parameters
for the GAP program inGude: (1 ) a unary comparison matrix (containing a value
of 1 for identities and 0
for non-identities) for nucleotides, and the weighted comparison matrix of
Gribskov and Burgess,
4
13~~~1~~.
Nucl. Acids Res. 14:6745, 1986 as described by Shwartz and
Dayhoff, ed., Atl3s o:f Protein Seduence and Structure,
National Biomedical Research Foundation, pp. 353-358, 1979;
(2) a penalty of 3.0 for each gap and an additional 0.10
penalty for each symbol in each gap; and (3) no penalty for
end gaps.
"Recombinant," as used herein, means that a protein is
derived from recombinant (e. g., microbial or mammalian)
expression systems. "Microbial" refers to recombinant
proteins made in bacterial or fungal (e. g., yeast) expression
systems. As a pr~~duct_, "recombinant microbial" defines a
protein produced :in a microbial expression system which is
essentially free of native endogenous substances. Protein
expressed in most bacterial cultures, e.g., E. coli, will be
free of glycan. ~rotein expressed in yeast may have a
glycosylation pat-~ern different from that expressed in
mammalian cells .
"Biologically active," as used throughout the
specification as a characteristic of IL-4 receptors, means
that a particular molecule shares sufficient amino acid
sequence similari-~y with the embodiments of the present
invention discloss=d herein to be capable of binding
detectable quanti-~ies of IL-4, transmitting an IL-4 stimulus
to a cell, for example, as a component of a hybrid receptor
construct, or cross-reacting with anti-IL-4R antibodies
raised against IL-4R from natural (i.e., nonrecombinant)
sources. Preferably, biologically active IL-4 receptors
within the scope c~f the present invention are capable of
binding greater than 0.1 nmoles IL-4 per nmole receptor, and
most preferably, greater than 0.5 nmole IL-4 per nmole
receptor in standard binding assays (see below).
"DNA sequencE~" refers to a DNA molecule, in the form of
a separate fragment or as a component of a larger DNA
construct, which lzas been derived from DNA isolated at least
t
5
once in substantially pure form, i.e., free of contaminating
endogenous materials and in a quantity or concentration
enabling identification, manipulation, and recovery of the
sequence and its component nucleotide sequences by standard
biochemical metho<~s, for example, using a cloning vector.
Such sequences are preferably provided in the form of an open
reading frame uninterrupted by internal nontranslated
sequences, or introns, which are typically present in
eukaryotic genes. Genomic DNA containing the relevant
sequences could a=Lso be used. Sequences of non-translated
DNA may be present= 5' or 3' from the open reading frame,
where the same do not interfere with manipulation or
expression of the coding regions.
"Nucleotide sequence" refers to a heteropolymer of
deoxyribonucleoti<~es. DNA sequences encoding the proteins
provided by this invention can be assembled from cDNA
fragments and short oligonucleotide linkers, or from a series
of oligonucleotides, to provide a synthetic gene which is
capable of being Expressed in recombinant transcriptional
unit.
"Recombinant expression vector" refers to a replicable
DNA construct used either to amplify or to express DNA which
encodes IL-4R and which includes a transcriptional unit
comprising an assembly of (1) a genetic element or elements
having a regulatory role in gene expression, for example,
promoters or enhancers, (2) a structural or coding sequence
which is transcribed into mRNA and translated into protein,
and (3) appropriai=a transcription and translation initiation
and termination sEquences. Structural elements intended for
use in yeast expression systems preferably include a leader
sequence enabling extracellular secretion of translated
protein by a host cell. Alternatively,
x
5a
where recombinant protein is expressed without a leader or
transport sequence, it may include an N-terminal methionine
residue. This residue may optionally be subsequently cleaved from
the expressed recombinant protein to provide a final product.
"Recombinant microbial expression system" means a
substantially hom~~geneous monoculture of suitable host
microorganisms, for example, bacteria such as E, coli or yeast
such as S, cerevisiae, which have stably integrated a recombinant
transcriptional unit into chromosomal DNA or carry the recombinant
transcriptional unit as a component of a resident plasmid.
Generally, cells ~:onstituting the system are the progeny of a
single ancestral i~ransformant. Recombinant expression systems as
defined herein w ill express heterologous protein upon induction of
the regulatory elE:ments linked to the DNA sequence or synthetic
gene to be expres:~ed.
The pre:~ent invention therefore provides an isolated DNA
sequence encoding a mammalian IL-4 receptor (IL-4R) capable of
binding IL-4, wherein said DNA sequence is selected from the group
consisting of:
(a) cDNA clones comprising a nucleotide sequence selected
from the sequence presented as nucleotides -75 to 2355 of Figures
2A-2C, nucleotide;> 1 to 2355 of Figures 2A-2C,nucleotides -75
to 2400 of Figure~~ 4A-4C, and nucleotides 1 to 2400 of Figures
4A-4C;
(b) DNA sequences capable of hybridization to a cDNA of (a)
under moderately :stringent conditions, and which encode an IL-4R
polypeptide capab7.e of binding IL-4; and
6
.
~.3~076:~
(c) DNA sequences that are degenerate as a result of the
genetic code to a DNA defined in (a) or (b), and which encode an
IL-4R polypeptide capable of binding IL-4.
In prefE~rred .embodiments:
(a) said DN~~ sequ:snce comprises a nucleotide sequence
selected from the group consisting of nucleotides -75 to 2355 of
Figures 2A-2C, nucleotides 1 to 2355 of Figures 2A-2C, nucleotides
-75 to 2400 of Figures 4A-4C, and nucleotides 1 to 2400 of Figures
4A-4C;
(b) said DNFv sequence comprises a nucleotide sequence
selected from the group consisting of nucleotides -75 to 621 of
Figure 4A, and nuc:leoti<ies 1 to 621 of Figure 4A;
(c) the DNA sequence encodes an amino acid sequence that is
greater than 80% ~;imilar to an amino acid sequence selected from
residues -25 to 800, 1 t:o 800, -25 to 207, or 1 to 207 depicted in
Figures 4A-4C;
(d) the DNA sequence encodes a soluble human IL-4 receptor,
wherein said DNA encoder an amino acid sequence consisting
essentially of amino acid residues -25 to 207 depicted in Figures
4A or 1-207 depicted in Figure 4A.
The invention also provides a substantially homogenous
biologically active recombinant human interleukin-4 receptor
protein substantially free of contaminating endogenous materials
and without associated native-pattern glycosylation, which protein
has an N-terminal amino acid sequence Met-Lys-Val-Leu-Gln-Glu-
Pro-Thr-Cys-Val-Ser-Asp-Tyr-Met-Ser-Ile-Ser-Thr-Cys-Glu-Trp and is
6a
~,3~~'lG
capable of bindin~~ greater than 0.1 nmole interleukin-4 per nmole
of the receptor.
Preferably such a protein is in the form of a
glycoprotein. In particular embodiments (a) the protein comprises
an amino acid sequence that is greater than 80% similar to the
sequence of amino acid residues 1-800 depicted in Figures 4A, 4B
and 4C, or especi<~lly (.b) comprises an amino acid sequence
consisting essent_Lally of residues 1-800 depicted in Figures 4A,
4B and 4C.
Proteins and Anal<3qs
The present invention provides substantially homogeneous
recombinant mamma7.ian I1L-4R polypeptides substantially free of
contaminating endogenous materials and, optionally, without
associated native--patte:rn glycosylation. The native murine and
human IL-4 receptor molecules are recovered from cell lysates as
glycoproteins having an apparent molecular weight by SDS-PAGE of
about 130-145 kilodaltons (kDa). Mammalian IL-4R of the present
invention include:c, by way of example, primate, human, murine,
canine, feline, bovine, ovine, equine and porcine IL-4R.
Derivatives of IL-~4R wii~hin the scope of the invention also
include various st;ructun~al forms of the primary protein which
retain biological activity. Due to the presence of ionizable
amino and carboxyl. groups, for example, an IL-4R protein may be in
the form of acidic: or basic salts, or in neutral form. Individual
amino acid residues may also be modified by oxidation or
reduction.
6b
.._
The primary amino acid structure may be modified by
forming covalent or aggregative conjugates with other chemical
moieties, such as glycosyl groups, lipids, phosphate, acetyl
groups and the like, or by creating amino acid sequence mutants.
Covalent derivatives are prepared by linking particular functional
groups to IL-4R amino acid side chains or at the N- or C-termini.
Other derivatives of IL-4R within the scope of this invention
include covalent or aggregative conjugates of IL-4R or its
fragments with other proteins or polypeptides, such as by
synthesis in recombinant culture as N-terminal or C-terminal
fusions. For example, the conjugated peptide may be a signal (or
leader) polypepti<ie sequence at the N-terminal region of the
protein which co-i:ranslationally or post-translationally directs
transfer of the p~°otein from its site of synthesis to its site of
function inside or outside of the cell membrane or wall (e.g., the
yeast a-factor leader). IL-4R protein fusions can comprise
peptides added to facilitate purification or identification of
IL-4R (e. g., poly-His). The amino acid sequence of IL-4 receptor
can also be linked to the peptide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys
(DYKDDDDK) (Hope et al.,, BiolTechnology 6:1204, 1988). The latter
sequence is highly antigenic and provides an epitope reversibly
bound by a specifj.c monoclonal antibody, enabling rapid assay and
facile purification of expressed recombinant protein. This
sequence is also ~;pecif~lcally cleaved by bovine mucosal
enterokinase at th.e res~~due immediately following the Asp-Lys
pairing. Fusion ~~roteins capped with this peptide may also be
resistant to intra.cellul.ar degradation in E. coli.
~C
k
._.. 13~~~161
IL-4R derivatives may also be used as immunogens, reagents in receptor-based
immunoassays, or as Minding agents for affinity purification procedures of IL-
4 or other binding ligands.
IL-4R derivatives may also he obtained by cross-linking agents, such as M-
maleimidobenzoyl
succinimide ester and N-hydroxysuccinimide, at cysteine and lysine residues.
IL-4R proteins may also
be covalently bound through reactive side groups to various insoluble
substrates, such as cyanogen
bromide-activated, bisoxirane-activateei, carbonyldiimidazole-activated or
tosyl-activated agarose
structures, or by adsorbing to f~otyolefin surfaces (with or without
glutaraldehyde cross-linking). Once
bound to a substrate, IL-4R many be used to selectively bird (far purposes of
assay or purification) anti-
IL-4R antibodies or IL-4.
The present invention also includes IL-4R with or without associated native-
pattern
glycosylation. IL-4R expressed in yeast or mammalian expression systems, e.g.,
COS-7 cells, may be
similar or significantly different in molecular weight and glycosylation
pattern than the native molecules,
depending upon the expression system. Expression of IL-4R DNAs in bacteria
such as E. toll
provides non-glycosylated molecules. Functional mutant analogs of mammalian IL-
4R having
inactivated N-glycosylatior sites can be produced by oligorucleotide synthesis
and ligation or by site-
specific mutagenesis techniques. These analog proteins can be produced in a
homogeneous,
reduced-carbohydrate form in good yield using yeast expression systems. N-
glycosylation sites in
eukaryotic proteins are charac~lerized by the amino acid triplet Asn-At-Z,
where A1 is any amino acid
except Pro, and Z is Ser or Thr. In this sequence, asparagine provides a side
chain amino group for
covalent attachment of carbohydrate. ;such a site can be eliminated by
substituting another amino
acid for Asn or for residue Z, deleting Asn or Z, or inserting a non-Z amino
acid between A~ and Z, or
an amino acid other than Asn between A,sn and A~ .
IL-4R derivatives may ;also be obtained by mutations of IL-4R or its subunits.
An IL-4R mutant,
as referred to herein, is a polypeptide homologous to IL-4R but which has an
amino acid sequence
different from native !L-4R because of a deletion, insertion or substitution.
Like most mammalian
genes, mammalian IL-4 receptors are presumably encoded by multi-exon genes.
Alternative mRNA
constructs which car be attributed to different mRNA splicing events following
transcription, and
which share large regions of identity or :;in~ilarity with the cDNAs claimed
herein, are considered to be
within the scope of the present invention.
Bioequivalent analogs of IL-4R proteins may be constructed by, for example,
making various
substitutions of residues or sequences or deleting terminal or iMemal residues
or sequences not
needed for biological activity. For example, cysteine residues can be deleted
or replaced with other
amino acids to prevent formation of incorrect intramolecular disulfide bridges
upon renaturation.
Other approaches to rrnrtagenesis inva~lve modification of adjacent dibasic
amino acid residues to
enhance expression in yeast; systems in which KEX2 protease activity is
present. Generally,
substitutions should be made conservatively; i.e., the most preferred
substitute amino acids are those
having physicochemical characteristics resembling those of the residue to be
replaced. Similarly,
when a deletion or insertion strategy is adopted, the potential effect of the
deletion or insertion on
biological activity should be coinsiderad.
7
1340r~~~
Subunits of IL-4R may be conslivcled by deleting terminal or internal residues
or sequences.
Particularly preferred subunits include those in which the Iransmembrane
region and intracellular
domain of IL-4R are deleted or subshluled with hydrophilic residues to
facilitate secretion of the
rucontor Into tlro cull culluro modiurn. 'fho rosulllng protoin Is a soluble
IL-4R molocule which may
retain its ability to bind IL-4. Particular examples of soluble IL-4R include
polypeptides having
substantial IdenUty to the sequence of amino acid residues 1-208 fn Figure 2A,
and residues t-207 in
Figure 4A.
Mutations in nucleotide sequences constructed for expression of analog IL-4Rs
must, of
course, preserve the reading Irame phase of the coding sequences and
prelerably will not create
complementary regions that could hybridlize to produce secondary mRNA
structures, such as loops or
halrp(ns, which would adversely allect Iranslation of the receptor mRNA.
Although a mutation site may
be predetermined, il is not necessary Ihal the nature of the mulalton per se
be predetermined. For
example, in order to select for optimum characteristics of mutants at a given
site, random mulagenesis
may be conducted at the target colon and the expressed IL-4R mutants screened
for the desired
activity.
Not all mutations in Ihn nucleotide sequence which encodes IL-4R will be
expressed in the
Iinal product, for example, nucleotide su~~bslitutions may be made to enhance
expression, primarily to
avoid secondary structure loops in the transcribed mRNA (see EPA 75,444A~
or to provide colons that are. more readily translated by the selected host,
e.g., the well-
known E. coti preference colons for E. coli expression.
Mutations can be introduced at particular loci by synthesizing
oligonucleolides containing a
mutant sequence, Ilanked by restriction sites enabling ligalion to fragments
of the native sequence.
Following Ilgation, the resulting recons;lrucled sequence encodes an analog
having the desired
amino acid insertion, substitution, or delErlion.
Alternatively, oligonucleotide-~direcled site-specilic mutagenesis procedures
can be
empbyed to provide an atterecf gene having particular colons altered according
to the substitution,
deletion, or Insertion required. Exemplary methods of making the alterations
set lorth above are
disclosed by Walder et al. I;Gene 4.2:133, 1986); Bauer et al. (Gene 37:73,
1985); Craik
(BioTechniques, January 1985~, 12-19); Smiih et ai. (Genetic Engineering:
Principles and Methods,
Plenum Press, 1981); and U.;i. Patent Nos. 4,518,584 and 4,737,462,
EXRtBS. l11r11:_48
The present Invention provides recombinant expression vectors which include
synthetic or
cDNA-derived ONA Iragmenls trncoding mammalian IL-4R or bioequivalenl analogs
operably linked to
suitable Iranscripltonal or transl,ational regulatory elements derived from
mammalian, microbial, viral or
Insect genes. Such regulatory elements Include a Iranscriptional promoter, an
optional operator
sequence Io control iranscripticrn, a sequence encoding suitable mRNA
ribosomal binding sites, and
sequences which control the termination of Iranscription and Iranslallon, as
described in detail below.
_. g _
1340r161
The ability to replicate in a host, usually conferred by an
origin of replication, and a selection gene to facilitate
recognition of transformants may additionally be
incorporated. DNA regions are operably linked when they are
functionally related tc each other. For example, DNA for a
signal peptide (secretory leader) is operably linked to DNA
for a polypeptide if .it is expressed as a precursor which
participates in the secretion of the polypeptide; a promoter
is operably linked to a coding sequence if it controls the
transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so
as to permit translation. Generally, operably linked means
contiguous and, in the case of secretory leaders, contiguous
and in reading frame.
DNA sequences encoding mammalian IL-4 receptors which
are to be expressed in a microorganism will preferably
contain no introns that could prematurely terminate
transcription of DNA into mRNA; however, premature
termination of transcription may be desirable, for example,
where it would result in mutants having advantageous C-
terminal truncations, for example, deletion of a
transmembrane region to yield a soluble receptor not bound to
the cell membrane. Due to code degeneracy, there can be
considerable variation in nucleotide sequences encoding the
same amino acid sequence; exemplary DNA embodiments are those
corresponding to the nucleotide sequences shown in the
Figures. Other embodiments include sequences capable of
hybridizing to the sequences of the Figures under moderately
stringent conditions (50°C, 2 X SSC) and other sequences
hybridizing or degenerate to those described above, which
encode biologically active IL-4 receptor polypeptides.
Transformed host cells are cells which have been
transformed or transfected with IL-4R vectors constructed
using recombinant DNA techniques. Transformed host cells
ordinarily express IL-9R, but host cells transformed for
purposes of cloning or amplifying IL-4R DNA do not need to
express IL-4R. Expres~;ed IL-4R will be deposited in the cell
membrane or secreted into the culture supernatant, depending
on the IL-4R DNA selected. Suitable host cells for
expression o:f mammalian. IL-4R include prokaryotes, yeast or
higher eukryotic cells under the control of appropriate
promoters. Prokaryotes include gram negative or gram
positive organisms, for example E. coli or bacilli. Higher
eukaryotic cells include established cell lines of mammalian
origin as described below. Cell-free translation systems
could also be employed to produce mammalian IL-4R using RNAs
derived from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with
bacterial, fungal, yeast, and mammalian cellular hosts are
described by Pouwels et al. (Cloning Vectors: A Laboratory
Manual, Elsevier, New York, 1985), the relevant disclosure of
which is hereby i:zcorporated by reference.
Prokaryotic expression hosts may be used for expression
of IL-4Rs that do not require extensive proteolytic and
disulfide processing. Prokaryotic expression vectors
generally comprise one or more phenotypic selectable markers,
for example a gene encoding proteins conferring antibiotic
resistance or sups?lying an autotrophic requirement, and an
origin of replica-ion recognized by the host to ensure
amplification within the host. Suitable prokaryotic hosts
for transformation include E. coli, Bacillus subtilis,
Salmonella typhim~:~rium, and various species within the genera
Pseudomonas, Stre~~tomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
Useful expre:~sion vectors for bacterial use can comprise
a selectable marker and bacterial origin of replication
derived from commc=rcially available plasmids comprising
genetic elements of the well known cloning vector pBR322
. rt
1
(ATCC 37017). Such corr,mercial vectors include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and
pGEMl (Promega Biotec, Madison, WI, USA). These pBR322
"backbone" sections are combined with an appropriate promoter
and the structural sequence to be expressed. E. coli is
typically transformed using derivatives of pBR322, a plasmid
derived from an E. coli species (Bolivar et al., Gene 2:95,
1977). pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides simple means for identifying
transformed cells.
Promoters co~iunonly used in recombinant microbial
expression vectors include the (3-lactamase (penicillinase)
and lactose promoter system (Chang et al., Nature 275:615,
1978; and Goeddel et al., Nature 281:544, 1979), the
tryptophan (trp) ~~romoter system (Goeddel et al., Nucl. Acids
Res. 8:4057, 1980; and EPA 36,776) and tac promoter
(Maniatis, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, p 412, 1982). A particularly
useful bacterial c=_xpression system employs the phage 7~ PL
promoter and c1857ts thermolabile repressor. Plasmid vectors
available from the American Type Culture Collection which
incorporate derivatives of the 7~ PL promoter include plasmid
pHUB2, resident in E. coli strain JMB9 (ATCC 37092) and
pPLc28, resident in E. coli RRl (ATCC 53082).
Recombinant IL-4R proteins may also be expressed in
yeast hosts, prefc=rably from the Saccharomyces genus, such as
S. cerevisiae. YE~ast of other genera, such as Pichia or
Kluyveromyces may be also employed. Yeast vectors will
generally contain an origin of replication from the 2~, yeast
plasmid or an autonomously replicating sequence (ARS),
promoter, DNA encoding IL-4R, sequences for polyadenylation
and transcription termination and a selection gene.
._ Preferably, yeast vectors will include an origin of
,c
replication and s~=_lectable marker permitting transformation
11
13~O~lGs
of both yeast and E. coli, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae trpl gene, which provides a
selection marker for a :mutant strain of yeast lacking the
ability to grow in trytophan, and a promoter derived from a
highly expressed ~~east gene to induce transcription of a
structural sequence downstream. The presence of the trpl
lesion in the yea:~t host cell genome then provides an
effective environment f~~r detecting transformation by growth
in the absence of trypt~~phan.
Suitable pronoter sequences in yeast vectors include the
promoters for metallothionein, 3-phosphoglycerate kinase
(Hitzeman et al., J. Bi~~l. Chem. 255:2073, 1980) or other
glycolytic enzyme: (Hess et al., J. Adv. Enzyme Reg. 7:149,
1968; and Holland et al., Biochem. 17:4900, 1978), such as
enolase, glyceralc~ehyde-3-phosphate dehydrogenase,
hexokinase, pyruvate de~~arboxylase, phosphofructokinase,
glucose-6-phosphat:e isomerase, 3-phosphoglycerate mutase,
pyruvate kinase, t:riosephosphate isomerase, phosphoglucose
isomerase, and glucokin,~se. Suitable vectors and promoters
for use in yeast Expression are further described in
Hitzeman, EPA 73,Ei57.
Preferred yeast ve~~tors can be assembled using DNA
sequences from pBR322 f~~r selection and replication in E.
coli (Ampr gene and origin of replication) and yeast DNA
sequences including a glusose-repressible ADH2 promoter and
a,-factor secretion leader. The ADH2 promoter has been
described by Russell et al. (J. Biol. Chem. 258:2674, 1982)
and Beier et al. (Nature 300:724, 1982). The yeast a-factor
leader, which directs secretion of heterologous proteins, can
be inserted between the promoter and the structural gene to
be expressed. SeE~, e.g., Kurjan et al., Cell 30:933, 1982;
and Bitter et al., Proc. Natl. Acad. Sci. USA 81:5330, 1984.
The leader sequen<:e may be modified to contain, near its 3'
12
end, one or more useful restriction sites to facilitate
fusion of the leader sequence to foreign genes.
Suitable yeast transformation protocols are known to
those of skill in the art; an exemplary technique is
described by Hinnen et al., Proc. Natl. Acad. Sci. USA
75:1929, 1978, selecting for Trp+ transformants in a
selective medium consisting of 0.670 yeast nitrogen base,
0.5o casamino acids, 2o glucose, 10 ~g/ml adenine and 20
~g/ml uracil.
Host strains transformed by vectors comprising the ADH2
promoter may be grown for expression in a rich medium
consisting of to yeast extract, 2o peptone, and to glucose
supplemented with 80 ~g/ml adenine and 80 ~g/ml adenine and
80 ~.g/ml uracil. Derepression of the ADH2 promoter occurs
upon exhaustion of medium glucose. Crude yeast supernatants
are harvested by filtration and held at 4°C prior to further
purification.
Various mamm<~lian or insect cell culture systems can be
employed to express recombinant protein. Baculovirus systems
for production of heterologous proteins in insect cells are
reviewed by Luckow and Summers, Bio/Technology 6:47 (1988).
Examples of suitaJ~le mammalian host cell lines include the
COS-7 lines of monkey kidney cells, described by Gluzman
(Cell 23:175, 198L), and other cell lines capable of
expressing an appropriate vector including, for example, L
cells, C127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK
cell lines. Mammalian expression vectors may comprise
nontranscribed elements such as an origin of replication, a
suitable promoter and enhancer linked to the gene to be
expressed, and other 5' or 3' flanking nontranscribed
sequences, and 5' or 3' nontranslated sequences, such as
necessary ribosome binding sites, a polyadenylation site,
splice donor and acceptor sites, and transcriptional
termination sequences.
.., 13
134~1~~~i.
The transcriptional and translational control sequences
in expression vectors t:o be used in transforming vertebrate
cells may be provided by viral sources. For example,
commonly used promoter~~ and enhancers are derived from
Polyoma, Adenovirus 2, Simian Virus 40 (SV40), and human
cytomegalovirus. DNA ~,equences derived from the SV40 viral
genome, for example, SV40 origin, early and late promoter,
enhancer, splice, and polyadenylation sites may be used to
provide the other genetic elements required for expression of
a heterologous DN.A sequence. The early and late promoters
are particularly useful because both are obtained easily from
the virus as a fragment which also contains the SV40 viral
origin of replication (Hers et al., Nature 273:113, 1978) .
Smaller or larger SV40 fragments may also be used, provided
the approximately 250 by sequence extending from the Hind III
site toward the B~~1 I site located in the viral origin of
replication is in~~luded. Further, mammalian genomic IL-4R
promoter, control and/or signal sequences may be utilized,
provided such con-~rol sequences are compatible with the host
cell chosen. Additional details regarding the use of
mammalian high ex~~ression vectors to produce a recombinant
mammalian IL-4 receptor are provided in Example 8 below.
Exemplary vectors can be constructed as disclosed by Okayama
and Berg (Mol. Ce_L1. Biol. 3:280, 1983).
A useful sysi=em for stable high level expression of
mammalian receptor cDNAs in C127 murine mammary epithelial
cells can be constructed substantially as described by Cosman
et al. (Mol. Immunol. 23:935, 1986).
A particular=_y preferred eukaryotic vector for
expression of IL-~1R DNA is disclosed below in Example 2.
This vector, referred t~~ as pCAV/NOT, was derived from the
mammalian high expressi~~n vector pDC201 and contains
regulatory sequences fr~~m SV40, adenovirus-2, and human
cytomegalovirus. pCAV/1VOT containing a human IL-7 receptor
14
~.340~~~i
insert has been c'.eposit;ed with the American Type Culture
Collection (ATCC) under deposit accession number 68014.
Purified marrsnalian IL-4 receptors or analogs are
prepared by culturing suitable host/vector systems to express
the recombinant translation products of the DNAs of the
present invention, which are then purified from culture media
or cell extracts.
For example, supernatants from systems which secrete
recombinant protein, into culture media can be first
concentrated using a commerically available protein
concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. Following the concentration
step, the concentrate can be applied to a suitable
purification matrix. for example, a suitable affinity matrix
can comprise an IL-4 or lectin or antibody molecule bound to
a suitable support. Alternatively, an anion exchange resin
can be employed, for example, a matrix or substrate having
pendant diethylaminoethyl (DEAE) groups. The matrices can be
acrylamide, agarose, dextran, cellulose or other types
commonly employed in protein purification. Alternatively, a
can on exchange step can be employed. Suitable cation
exchangers include various insoluble matrices comprising of
sulfopropyl or ca:rboxymethyl groups. Sulfopropyl groups are
preferred.
Finally, one or more reversed-phase high performance
liquid chromatography (RP-HPLC) steps employing hydrophobic
RP-HPLC media, e.c~., silica gel having pendant methyl or
other aliphatic g..oups, can be employed to further purify an
IL-4R composition. Some or all of the forgoing purification
steps, in various combinations, can also be employed to
provide a homogeneous recombinant protein.
Recombinant protein produced in bacterial culture is
usually isolated by initial extraction from cell pellets,
followed by one or more concentration, salting-out, aqueous
X
14a
~J~~ ~~~.L
ion exchange or size e~:clusion chromatography steps.
Finally, high performance liquid chromatography (HPLC) can be
employed for final purification steps. Microbial cells
employed in expression of recombinant mammalian IL-4R can be
disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysing agents.
Fermentation of yeast which express mammalian IL-4R as a
secreted protein greatly simplifies purification. Secreted
recombinant protein resulting from a large-scale fermentation
can be purified by methods analogous to those disclosed by
Urdal et al. (J. Chromatog. 296:171, 1984). This reference
describes two sequential, reversed-phase HPLC steps for
purification of recombinant human IL-2 on a preparative HPLC
column.
Human IL-4R synthesized in recombinant culture is
characterized by the presence of non-human cell components,
including proteins, in amounts and of character which depend
upon the purification steps taken to recover human IL-4R from
the culture. These components ordinarily will be of yeast,
prokaryotic or non-human higher eukaryotic origin and
preferably are prE=_sent in innocuous contaminant quantities,
on the order of lE~ss than about 1 percent by weight.
Further, recombinant cell culture enables the production of
IL-4R free of proi=eins which may be normally associated with
IL-4R as it is found in nature in its species of origin, e.g.
in cells, cell exudates or body fluids.
IL-4R compos_~tions are prepared for administration by
mixing IL-4R having the desired degree of purity with
physiologically accepta:ole carriers. Such carriers will be
nontoxic to recip__ents ,~t the dosages and concentrations
employed. Ordinarily, the preparation of such compositions
entails combining the I:G-4R with buffers, antioxidants such
' as ascorbic acid, low molecular weight (less than about 10
F~'
14b
l3~UrG1
residues) polypept~ides, proteins, amino acids, carbohydrates
including glucose,. sucrose or dextrins, chelating agents such
as EDTA, glutathione and other stabilizers and excipients.
IL-4R compos:_tions may be used to regulate the function
of B cells. For exampl~s, soluble IL-4R (sIL-4R) inhibits the
proliferation of B cell cultures induced by IL-4 in the
presence of anti-..g. sIL-4R also inhibits IL-4 induced IgGl
secretion by LPS-activated B cells as determined by isotype
specific ELISA anc~ inhibits IL-4 induced Ia expression on
murine B cells as determined by EPICS analysis. sIL-4R also
inhibits IL-4 induced IgE synthesis and may accordingly be
used to treat IgE--induced immediate hypersensitivity
reactions, such a:~ alle:rgic rhinitis (common hay fever),
bronchial asthma, atopic dermatitis and gastrointestinal food
allergy.
IL-4R compositions may also be used to regulate the
function of T cel~_s. F«r example, IL-4R inhibits IL-4
induced proliferation o:E T cell lines, such as the CTLL T
cell line. sIL-4R also inhibits functional activity mediated
by endogenously pz:oducec~ IL-4. For example, sIL-4R inhibits
the generation of allorc~active cytolytic T lymphocytes (CTL)
in secondary mixed leukocyte culture when present in culture
concomitantly with a monoclonal antibody against IL-2, such
as S4B6. Neutralizing agents for both IL-2 and IL-4 are used
to inhibit endogenous I:~-2 and IL-4, both of which regulate
CTL generation anct are produced in such cultures.
In therapeutic app:Lications, a therapeutically effective
quantity of an IL--4 receptor composition is administered to a
mammal, preferably a human, in association with a
pharmaceutical carrier car diluent.
The following examples are offered by way of
illustration, and not by way of limitation.
14c
L'VTTA1~T L'C
Example 1
Binding assays for IL-4 receptor
A. Radiolab~sling of IL-4. Recombinant murine and human
IL-4 were expressf~d in yeast and purified to homogeneity as
described by Park,, et al., Proc. Natl. Acad. Sci. USA 84:5267
( 1987 ) and Park ei. al . , J. Exp. Med. 166: 476 ( 1987 )
respectively. The purified protein was radiolabeled using a
commercially avai:Lable enzymobead radioiodination reagent
(BioRad). In thi:~ procedure 2.5 ~g rIL-4 in 50 ~.g 0.2 M
sodium phosphate, pH 7.2 are combined with 50 ~1 enzymobead
reagent, 2 MCi of sodiu:~ iodide in 20 ~1 of 0.05 M sodium
phosphate pH 7.0 <~nd 10 ~l of 2.5o b-D-glucose. After 10
min. at 25°C, sodium az=~de (101 of 50 mM) and sodium
metabisulfite (10 ~1 of 5 mg/ml) were added and incubation
continued for 5 m:in. at 25°C. The reaction mixture was
fractioned by gel filtration on a 2 ml bed volume of
Sephadex~ G-25 (S:igma) equilibrated in Roswell Park Memorial
Institute (RPMI) 1640 medium containing 2.5% (w/v) bovine
serum albumin (BS~~), 0.20 (w/v) sodium azide and 20 mM Hepes
pH 7.4 (binding me=dium). The final pool of 1251-IL-4 was
diluted to a working stock solution of 2 x 10-8 M in binding
medium and stored for up to one month at 4°C without
detectable loss o:E receptor binding activity. The specific
activity is routinely in the range of 1-2 x 1016 cpm/mmole
IL-4.
B. Binding to Adherent Cells. Binding assays done with
cells grown in suspension culture (i.e., CTLL and CTLL-19.4)
were performed by a phthalate oil separation method (Dower et
al., J. Immunol. 132:751, 1984) essentially as described by
Park et al., J. Biol. Chem. 261:4177, 1986 and Park et al.,
supra. Binding assays were also done on COS cells
14d
b
transfected with ~~ mammalian expression vector containing
cDNA encoding an IL-4 receptor molecule. For Scatchard
analysis of bindi:zg to adherent cells, COS cells were
transfected with ~~lasmid DNA by the method of Luthman et al.,
Nucl. Acids. Res. 11:1295, 1983, and McCutchan et al.,~J.
Natl. Cancer Inst. 41:351, 1968. Eight hours following
transfection, cells were trypsinized, and reseeded in six
well plates (Cost;~r, Cambridge, MA) at a density of 1 x 104
COS-IL-4 receptor transfectants/well mixed with 5 x 105 COS
control transfectf=_d cells as carriers. Two days later
monolayers were a:~sayed for 1251-IL-4 binding at 4°C
essentially by thE= method described by Park et al., J. Exp.
Med. 166:476, 198'7. Nonspecific binding of 1251-IL-4 was
measured in the presence of a 200-fold or greater molar
excess of unlabelf=_d IL-4. Sodium azide (0.20) was included
in all binding assays to inhibit internalization of 1251-IL-4
by cells at 37°C.
For analysis of inhibition of binding by soluble IL-4R,
supernatants from COS cells transfected with recombinant IL-
4R constructs werE~ harvested three days after transfection.
Serial two-fold d:ilusions of conditioned media were pre-
incubated with 3 :~ 10-1OM125I-IL-4 (having a specific
activity of about 1 x 1016 cpm/mmol) for one hour at 37°C
prior to the addi~=ion of 2 x 106 CTLL cells. Incubation was
continued for 30 minutes at 37°C prior to separation of free
and cell-bound mu:rine 1251-IL-4.
C. Solid Ph~~se Binding Assays. The ability of
IL-4 receptor to he stably adsorbed to nitrocellulose from
detergent extract; of CTLL 19.4 cells yet retain IL-4 binding
activity provided a means of monitoring purification. One ml
aliquots of cell extracts (see Example 3), IL-4 affinity
column fractions (see Example 4) or other samples are placed
on dry BA85/21 nitrocellulose membranes (Schleicher and
Schuell, Keene, Nl-~) and allow to dry. The membranes are
14e
~.3~~1~~~1
incubated in tissue culture dishes for 30 minutes in Tris
(0.05 M) buffered saline (0.15 M) pH 7.5 containing 3o w/v
BSA to block nonspecific binding sites. The membrane is then
covered with 4 x 10-11 M125I-IL-4 in PBS + 3o BSA with or
without a 200-fold molar excess of unlabeled IL-4 and
incubated for 2 hr at 4°C with shaking. At the end of this
time, the membranes are washed 3 times in PBS, dried and
placed on Kodak X-OmatT°~ AR film for 18 hr at -70°C.
14f
~34o~rm
Example 2
~~1 of CTLL cells with high IL-4 recg~ tour .~ r - ion
~,y fluorescemce activated cell sorting (FACS)
The preferred cell lime for obtaining high IL-4 receptor selection is CTLL, a
murine IL-2
dependent cytotoxic T cell line (ATCC 1'IB 214). To obtain higher levels of IL-
4 receptor expression,
CTLL cells (parent cells) were sorted using fluorescence-activated cell
sorting and fluorescein-
conjugated recombinant murirxe IL-4 (m~IL-d) in which the extensive
carbohydrate attached to rmlL-4
by the yeast host is used to a~d~vanEage 15y coupling fluorescein hydrazide to
periodate oxidized sugar
moieties. The fluorescein-conjugated IIL-4 was prepared by combining aliquots
of hyperglycosylated
rmlL-4 (300 N.g in 300 pl of 0.1 M citrate-phosphate buffer, pH 5.5) with 30
p.l of 10 mM sodium m-
periodiate (Sigma), freshly prepared in I).1 M citrate-phosphate, pH 5.5 and
the mixture incubated at
4°C for 30 minutes in the dark. The reaction was quenched with 30 l,~l
of 0.1 M glycerol and dialyzed
for 18 hours at 4°C against 0.1 M citrate-phosphate pH 5.5. Following
dialysis, a 1/10 volume of 100
mM 5-(((2-(carbohydrazino)methyl)thio)acetyl)-aminofluorescein (Molecular
Probes, Eugene OR)
dissolved in DMSO was addE:d to the sample and incubated at 25°C for 30
minutes. The IL-4-
fluorescein was then exhaustively dialyzed at 4°C against PBS, pH 7.4
and protein concentration
determined by amino acid analysis. The final product was stored at 4°C
following the addition of 1%
(w/v) BSA and sterile filtration.
In order to sort, CTLL cells (5 x 106) were incubated for 30 min at
37°C in 150 ~I PBS + 1
BSA containing 1 x 10-g M IL-~4-fluoresc:ein urxier sterile conditions. The
mixture was then chilled to
4°C, washed once in a large volume of FIBS + 1% BSA and sorted using an
EPICS~ C flow cytometer
(Coulter Instruments). The cells providing the highest level fluorescence
signal (top 1.0%) were
collected in bulk and the population expanded in liquid cell culture.
Alternatively, for single cell
cloning, cells exhibiting a fluorescence ;signal in the top 1.0% were sorted
into 96 well tissue culture
microtiter plates at 1 cell per well.
Progress was monitored by doing binding assays with 1251-IL-4 following each
round of FACS
selection. Unsorted CTLL cells (CTLL parent) Iyplcally extriblted 1000-2000 IL-
4 receptors per cell.
CTLL cells were subjected to 19 rounds of FRCS selection. The final CTLL cells
selected (CTLL-19)
exhibited 5 x 105 to 1 x 106 IL-4 receptors per cell. At this point the CTLL-
19 population was
subjected to EPICS~ C-assist~:d single cell cloning and individual clonal
populations were expanded
and tested for 1251-IL-4 binding. A single clone, designated CTLL-19.4,
exhibited 1 x 106 IL-4
receptors per cell and was selected for purification and cloning studies.
While the ca~ulated apparent
Ka values are similar for the two lines, CTLL-19.4 expresses approximately 400-
fold more rec~:ptors on
its surface than does the CTLL parent.
Example 3
eteraent extraction of CTLL cells
CTLL 19.4 cells were maintained in RPMI 1640 containing 10% fetal bovine
serum:, 50 U/ml
penicillin, 50 lrglml streptomycin and 10~ ng/ml of recomt~inant human IL-2.
Cells were grc,wvn to 5 x
105 cells/ml in roller bottles, harvested by centrifugation,
washed twice in serum free DMEM and sedimented at 2000 x g
for 10 minutes to form a packed pellet (about 2 x 108
cells/ml). To the pellet was added an equal volume of~PBS
containing 1'o Triton0 X-100 and a cocktail of protease
inhibitors (2 mM phenylmethysulfonylfluoride, 10 ~M
pepstatin, 10~M, leupeptin, 2 mM o-phenanthroline and 2 mM
EGTA). The cells were mixed with the extraction buffer by
vigorous vortexing and the mixture incubated on ice for 20
minutes after which the mixture was centrifuged at 12,000 x g
for 20 minutes at 8°C t'~ remove nuclei and other debris. The
supernatant was either used immediately or stored at -70°C
until use.
Example 4
IL-4 receptor purification by IL-4 affinity chromatography
In order to obtain sufficient quantities of murine IL-4R
to determine its N-terminal sequence or to further
characterize human IL-4R, protein obtained from the detergent
extraction of cells was further purified by affinity
chromatography. Recombinant murine or human IL-4 was coupled
to Affigel~-10.(BioRad) according to the manufacturer's
suggestions. For example, to a solution of IL-4(3.4 mg/ml in
0.4 ml of 0.1 M H?pes pH 7.4) was added 1.0 ml of washed
Affigel~-10. The solution was rocked overnight at 4°C and an
aliquot of the supernatant tested for protein by a BioRad
protein assay per the manufacturer's instructions using BSA
as a standard. Greater than 950 of protein had coupled to
the gel, suggesting that the column had a final load of 1.3
mg IL-4 per ml gel. Glycine ethyl ester was added to a final
concentration of 0.05 M to block any unreacted sites on the
gel. The gel was washed extensively with PBS-to Triton~
followed by 0.1 Glycine-HCl, pH 3.0 A 0.8 x 4.0 cm column was
-16-
ul
prepared with IL-4-coupled Affigel~ prepared as described
(4.0 ml bed volum~=) and washed with PBS containing to Triton~
X-100 for purific,~tion of murine IL-4R. Alternatively, 50 ~1
aliquots of 20o sv.zspension of IL-4 coupled Affigel~ were
incubated with 35;~-cysteine/methionine-labeled cell extracts
for small-scale affinity purifications and gel
electrophoresis.
Aliquots (25 ml) of detergent extracted IL-4 receptor
bearing CTLL 19.4 cells were slowly applied to the murine IL-
4 affinity column at 4°C (flow rate of 3.0 ml/hr). The column
was then washed sequentially with PBS containing to Triton~
X-100, RIPA buffe:= (0.05 M Tris, 0.15 M NaCl, to NP-40, to
deoxycholate and e).1% SDS), PBS containing O.lo Triton~ X-100
and lOmM ATP, and PBS with to Triton~ X-100 to remove all
contaminating mate rial except the mIL-4R. The column was
then eluted with pH 3.0 glycine HCl buffer containing O.lo
Tritons X-100 to remove the IL-4R and washed subsequently
with PBS containing O.lo Triton~ X-100. One ml fractions
were collected for the elution and 2 ml fractions collected
during the wash. Immediately following elution, samples were
neutralized with f30 ~,1. of 1 M Hepes, pH 7.4. The presence of
receptor in the fractions was detected by the solid phase
binding assay as descri:oed above, using 1251-labeled IL-4.
Aliquots were removed from each fraction for analysis by SDS-
PAGE and the rema=_nder frozen at -70°C until use. For SDS-
PAGE, 40 ~1 of each column fraction was added to 40 ~.1 of 2 X
SDS sample buffer (0.125 M Tris HC1 pH 6.8,40 SDS, 200
glycerol, 100 2-mercaptoethanol). The samples were placed in
a boiling water bath fo.r 3 minutes and 80 ~1 aliquots applied
to sample wells oj_ a 10o polyacrylamide gel which was set up
and run according to the method of Laemmli (Nature 227:680,
1970). Following electrophoresis, gels were silver stained
.. .., 17
1~40r1~i
as previously described by Urdal et al. (Proc. Natl. Acad.
Sci. USA 81:6481, 1984).
Purification by the foregoing process permitted
identification by silver staining of polyacrylamide gels of
two mIL-4R protein bands averaging 45-55 kDa and 30-40~kDa
that were present in fractions exhibiting IL-4 binding
activity. Experi::nents in which the cell surface proteins of
CTLL-19.4 cells wire radiolabeled and 1251-labeled receptor
was purified by affinity chromatography suggested that these
two proteins were expressed on the cell surface. The ratio
of the lower to higher molecular weight bands increased upon
storage of fractions at 4°C, suggesting a precursor product
relationship, possibly due to slow proteolytic degradation.
The mIL-4 receptor protein purified by the foregoing process
remains capable of binding IL-4, both in solution and when
adsorbed to nitrocellulose.
Example 5
Sequencing of IL-4 receptor protein
CTLL 19.4 mIL-4 receptor containing fractions from the
mIL-4 affinity column purification were prepared for amino
terminal protein sequence analysis by fractioning on an SDS-
PAGE gel and then transferred to a PVDF membrane. Prior to
running the protein fractions on polyacrylamide gels, it was
first necessary to remove residual detergent from the
affinity purification process. Fractions containing proteins
bound to the mIL-4 affinity column from three preparations
were thawed and concentrated individually in a speed vac
under vacuum to a final volume of 1 ml. The concentrated
fractions were then adjusted to pH 2 by the addition of 500
(v/v) TFA and injected onto a Brownlees RP-300 reversed-phase
HPLC column (2.1 x 30 mm) equilibrated with 0.1% (v/v) TFA in
H20 at a flow rate of 200 E~1/min running on a Hewlett Packard
Model 1090M HPLC. The column was washed with O.lo TFA in H20
18
r5 ~) _L
for 20 minutes post injection. The HPLC column containing
the bound protein was then developed with a gradient as
follows:
Time % Acetonitrile in O.lo TFA
0 0
5 30
30
70
70
10 35 100
0
1 ml fractions were collected every five minutes and analyzed
for the presence of protein by SDS-PAGE followed by silver
15 staining.
Each fraction from the HPLC run was evaporated to
dryness in a speed vac and then resuspended in Laemmli
reducing sample buffer, prepared as described by Laemmli,
U. K. Nature 227:680, 1970. Samples were applied to a 5-200
20 gradient Laemmli SDS gel and run at 45mA until the dye front
reached the botto:~ of the gel. The gel was then transferred
to PVDF paper and stained as described by Matsudaira, J.
Biol. Chem. 262:10035, 1987. Staining bands were clearly
identified in fractions from each of the three preparations
25 at approximately 30,000 to 40,000 Mr,
The bands fr~~m the previous PVDF blotting were excised
and subjected to ~~utomated Edman degradation on an applied
Biosystems Model 477A Protein Sequencer essentially as
described by March et al. (Nature 315:641, 1985), except
30 that PTH amino acids were automatically injected and analyzed
on line with an A~~plied Biosystems Model 120A HPLC using a
gradient and detecJtion system supplied by the manufacturer.
The following amino terminal sequence was determined from the
results of sequencing: NH2-Ile-Lys-Val-Leu-Gly-Glu-Pro-Thr-
18a
Cys/Asn-Phe-Ser-A:~p-Tyr-Ile. The bands from the second
preparation used :Eor amino terminal sequencing were treated
with CNBr using the in situ technique described by March et
al. (Nature 315:641, 1985) to cleave the protein after
internal methionine residues. Sequencing of the resulting
cleavage products yielded the following data, indicating that
the CNBr cleaved 1_he protein after two internal methionine
residues
Cycle _Re:~idues Observed
1 0 1 Va:L, Ser
2 Gly, Leu
3 Ile, Val
4 Ty_r, Ser
5 Arch, Tyr
6 Glu, Thr
7 Ash, A1a
8 Asn, Leu
9 Pr~~, Val
10 Ala
11 Glv.z, Val
12 Ph~=, Gly
13 I1=, Asn
14 Va.l, G1n
15 Ty.r, Ile
16 Ly,s, Asn
17 Val, Thr
18 Thr, Gly
When compared with the protein sequences derived from clones
16 and 18 (see Figure 2), the sequences matched as follows:
1 5
Sequence 1: (Met)-Val-Asn-Ile-Ser-Arg-Glu-Asp-Asn-
10 15 18
Pro-Ala-G lu-1?he-Ile-Va1-Tyr-Asn-Val-Thr
1 5
Sequence 2: (Met)-Ser-Gly-Val-Tyr-Tyr-Thr-Ala-Arg-
10 15 18
Val-Arg-V al-~~rg-Ser-Gln-Ile-Leu-Thr-Gly
Identical matc hes were found for all positions of sequence
1
except Asn(2) and sequence 2, except Arg at positions 8,
10,
and 12, Ser at poaition 13, and Leu at position 16. The
18b
~34~~t~Gi
above sequences c~~rrespond to amino acid residues 137-154 and
169-187 of Figure 2.
In addition, the amino terminal sequence matched a
sequence derived from the clone with position 9 being defined
as a Cys.
The above data support the conclusion that clones 16 and
18 are derived fr~~m the message for the IL-4 receptor.
x
'' 18c
Example 6
~vnthesis of hybrid-subtracted cDNA probe
In order to screen a lik>rary for clones encoding a murine IL-4 receptor, a
highly enriched IL-4
receptor cDNA probe was olbtained using a subtractive hybridization strategy.
Polyadenylated
(polyA+) mRNA was isolated prom two similar cell lines, the parent cell line
CTLL (which expresses
approximately 2,000 receptors per ceN) and the sorted cell line CTLL 19.4
(which expresses 1 x 106
receptors per cell). The mRNA content of these two cell lines is expected to
be identical except for
the relative level of IL-4 receptor mRNA,. A radiolabeted single-stranded cDNA
preparation was then
made from the mRNA of the sorted cell line CTLL 19.4 by reverse transcription
of polyadenylated
mRNA from CTLL 19.4 cells by a procedure similar to that described by Maniatis
et al., Molecular
Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory, New York, 1982).
Briefly, polyA+
mRNA was purified as describi,d by March et al. (Nature 315:641-647, 1985) and
copied into cDNA by
reverse transcriptase using align dT as a primer. To obtain a high level of
32P-labeling of the
cDNA,100 ~.Ci of 32P-dCTP (~s.a.=300(t Ci/mmol) was used in a 50 ~.I reaction
with non-radioactive
dCTP at 10 p.M. After reverse transcription at 42°C for 2 hours, EDTA
was added to 20 mM and the
RNA was hydrolyzed by adding NaOHI to 0.2 M and incubating the cDNA mixture at
68°C for 20
minutes. The single-strandE;d cDNA was extracted with a phenol/chloroform
(50/50) mixture
previously equilibrated with 10 mM Tris-CI, 1 mM EDTA. The aqueous phase was
removed to a clean
tube and made alkaline again by the addition of NaOH to 0.5 M. The cDNA was
then size-fractionated
by chromatography on a 6 ml Sephadex~ G50 column in 30mM NaOH and 1 mM EDTA to
remove
small molewlar weight contanu pants.
The resulting size-fractionated cDNA generated from the sorted CTLL 19.4 cells
was then
hybridized with an excess of mRNA from the unsorted parental CTLL cells by
ethanol-precipitating the
cDNA from CTLL 19.4 cells with 30 p.g of polyA+ mRNA isolated from unsorted
CTLL cells,
resuspending in 16 pl of 0.25 frl NaP04, pH 6.8, 0.2% SDS, 2 mM EDTA and
incubating for 20 hours
at 68°C. The cDNAs from the; sorted CTLL 19.4 cells that are
complementary to mRNAs from the
unsorted CTLL cells torm doulble stranded cDNA/mRNA hybrids, which can then be
separated from
the single stranded cDNA based on their different binding affinities on
hydroxyapatite. The mixture
was diluted with 30 volumes of 0.02 M NaP04, pH 6.8, bound to hydroxyapatite
at room temperature,
and single-stranded cDNA was then ehuted from the resin with 0.12 M NaP04, pH
6.8, at 60°C, as
described by Sims et al., Nature 3n2:541, 1984. Phosphate buffer was then
removed by
centrifugation over 2 ml Seph~~dex~ G!i0 spin columns in water. This hybrid
subtraction procedure
removes a majority of common sequenGSS between CTLL 19.4 and unsorted CTLL
cells, and leaves a
single-stranded cDNA pool enriched for radiolabeled IL-4 receptor cDNA which
can be used to probe
a cDNA ibrary (as described be~bw).
19
Example 7
~ypthesis of cDNA library and n, la~ue screening
A cDNA library was amstruded from polyadenylated mRNA isolated from CTLL 19.4
cells
using standard techniques (Gubler, et all., Gene 25:263, 1983; Ausubel et al.,
eds., Current Protocols
in Molecular Biology, Vol. 1, 1987). Ail.er reverse transcription using oligo
dT as primer, the single-
stranded cDNA was rendered double-stranded with DNA polymerase I, blunt-ended
with T4 DNA
polymerase, methylated with EcoR I methylase to protect EcbR t cleavage sites
within the cDNA, and
ligated to EcoR 1 tinkers. The resulting constructs were digested w'tth EcoR I
to remove all but one
copy of the linkers at each end of the cDNA, and ligated to an equimolar
concentration of EcoR I cut
and dephosphorylated 7vZAP~ arms ands the resulting ligation mix was packaged
in vitro (Gigapadc~)
according to the manufadurei"s instructions. Other suitable methods and
reagents for generating
cDNA libraries in ~. phage vectors are described by Huynh et al., DNA Cloning
Techniques: A Practical
Approach , IRL Press, Oxford (1984); Meissner et al., Proc. NatL Acad. Sci.
USA 84:4171 (1987), and
Ausubel et al., supra. 71ZAP~ is a phage ~, cloning vector similar to ~.gtl1
(U.S. Patent 4,788,135)
containing plasmid sequences from pUCl9 (Norrander et al., Gene 26101, 1987),
a polylinker site
located in a tact gene fragment, and an f1 phage origin of replication
permitting recovery of ssDNA
when host bacteria are superinieded wiith f1 helper phage. DNA is excised in
the form of a plasmid
comprising the foregoing elemc;nts, desi!~nated Bluescript~. Gigapack~ is a
sonicated E. colt extract
used to package ~, phage DN<~. ~ZAP~~, Bluescript~, and Gigapack~ are
registered trademarks of
Stratagene, San Diego, CA, USA.
The radiolabeled hybrid-subtracted cDNA from Example 6 was then used as a
probe to screen
the cDNA library. The amplified library was plated on BB4 cells at a density
of 25,000 plaques on each
of 20 150 mm plates and incubated overnight at 37°C. All manipulations
of 7~ZAP~ and exasion of the
Bluescript~ plasmid were as described by Short et al., (Nucl. Acids Res.
16:7583, 1988) and
Stratagene product literature. (Duplicate plaque lift filters were incubated
with hybrid-subtracted cDNA
probes from Example 6 in hybridization buffer containing 50% formamide, 5 X
SSC, 5 X Denhardt's
reagent and 10% dextran sulfate at 42°C for 48 hours as described by
Wahl et al., Proc. Natl. Acad.
Sci. USA7E.3683, 1979. Filters wrere then washed at 68°C in 0.2 X SSC.
Sixteen positive plaques
were purified for further analysis.
Bluescript~ plasmids c~ntainingi the cDNA inserts were excised from the phage
as described
by the manufacturer and. trau~.sfurmed into E coG. Plasmid DNA was isolated
from individual colonies,
digested with EcoR I to releasE; the cDNA inserts and eledrophoresed on
standard 1% agarose gels.
Four duplicate gels were blotted onto nylon filters to produce identical
Southern blots for analysis with
various probes which were (1) radiolaf.~:led cDNA from unsorted CTLL cells,
(2) radiolabeled cDNA
from CTLL 19.4 sorted cells, (,'3) hybrid ;subtracted cDNA from CTLL 19.4
sorted cells, and (4) hybrid
subtracted cDNA from CTLL 1!x.4 sorted cells after a second round of
hybridization to poly A+ mRNA
from an IL-4 receptor negative mouse cell line (LBRM 33 1A5B6). These probes
were increasingly
enriched for cDNA copies of rnRNA specific for the sorted cell line CTLL 19.4.
Of the 16 positive
13~0't~1
plagues isolated from t:he library, four clones (11A, 14, 16
and 18) showed a paral7_el increase in signal strength with
enrichment of the probe.
Restriction mapping (shown in Figure 1) and DNA
sequencing of the isolated CTLL clones indicated the
existence of at least t:wo distinct mRNA populations. Both
mRNA types have homo7_oqous open reading frames over most of
the coding region yet diverge at the 3' end, thus encoding
homologous proteins with different COOH-terminal sequences.
DNA sequence from inside the open reading frames of both
clones code for protein sequence that is identical to protein
sequence derived from ~:equencing of the purified IL-4
receptor described in r~tore detail in Example 5. Clone 16 and
clone 18 were used as the prototypes for these two distinct
message types. Clone 1.6 contains an open reading frame that
encodes a 258-amino acid polypeptide which includes amino
acids-25 to 233 of Figure 2A. Clone 18 encodes a 230-amino
acid polypeptide, the N-terminal 224 amino acids of which are
identical to the N-terminus of clone 16 but diverge at the 3'
end with nucleotides CfAAGTAATGAAAATCTG which encode the C-
terminal 6 amino acids, Pro-Ser-Asn-G7_u-Asn-Leu, followed by
a termination codon TGP.. Both clones were expressed in a
mammalian expression system, as described in Example 8.
Example 8
Expression of IL-4R in mammalian cells
A. Expression in C.'OS-7 Cells. A eukaryotic expression
vector pCAV/NOT, shown in Figure 3, was derived from the
mammalian high expression vector pDC201, described by Sims et
al., Science 241:585, 1988). pDC201 is a derivative of
pMLSV, previously described by Cosman et al., Nature 312:768,
1984. PCAV/NOT is designed to express cDNA sequences
inserted at its multiple cloning site (MCS) when transfected
into mamma7_ian cells and includes the following components:
21
1
SV40 (hatched box:) contains SV40 sequences from coordinates
5171-270 including the origin of replication, enhancer
sequences and early and late promoters. The fragment is
oriented so that the direction of transcription from the
early promoter is as shown by the arrow. CMV contains~the
promoter and enhancer regions from human cytomegalovirus
(nucleotides-671 to +7 from the sequence published by Boshart
et al., Ce11:41:521-530, 1985). The tripartite leader
(stippled box) contain; the first exon and part of the intron
between the first and ~;econd exons of the adenovirus-2
tripartite leader, the second exon and part of the third exon
of the tripartite leader and a multiple cloning site (MCS)
containing sites for Xl:~o I, Kpn I, Sma I, Not I, and Bg1 II.
pA (hatched box) contains SV40 sequences from 4127-4100 and
2770-2533 that include the polyadenylation and termination
signals for early transcription. Clockwise from pA are
adenovirus-2 sequences 10532-11156 containing the VAI and
VAII genes (designated by a black bar) followed by pBR322
sequences (solid line) from 4363-2486 and 1094-375 containing
the ampicillin resistance gene and origin of replication.
The resulting expression vector was designated pCAV/NOT.
Inserts in clone 16 and clone 18 were both released from
Bluescript~ plasmid by digestion with Asp 718 and Not 1. The
3.5 kb insert from clone 16 was then ligated directly into
the expression ve~~tor pCAV/NOT also cut at the Asp 718 and
Not I sites in thc= polylinker region. The insert from clone
18 was blunt-ended with T4 polymerase followed by ligation
into the vector pCAV/NOT cut with Sma I and dephosphorylated.
Plasmid DNA :From both IL-4 receptor expression plasmids
were used to tranafect a subconfluent layer of monkey COS-7
cells using DEAF-c~extran followed by chloroquine treatment,
as described by Luthman et al. (Nucl. Acids Res. 11:1295,
1983) and McCutch<~n et al. (J. Natl. Cancer Inst. 41:351,
y
~f~
1968). The cells were then grown in culture for three days
22
1
to permit transient expression of the inserted sequences.
After three days, cell culture supernatants and the cell
monolayers were assayer. (as described in Example 1) and IL-4
binding was confirmed.
B. Expression in CHO Cells. IL-4R was also expressed
in the mammalian CHO cell line by first ligating an
Asp718/Notl restriction fragment of clone 18 into the
pCAV/NOT vector as described in Example 8. The pCAV/NOT
vector containing the insert from clone 18 was then co-
transfected using a standard calcium phosphate method into
CHO cells with the dihydrofolate reductase (DHFR) cDNA
selectable marker under the control of the SV40 early
promoter. The DHFR sequence enables methotrexate selection
for mammalian cells harboring the plasmid. DHFR sequence
amplification events in such cells were selected using
elevated methotrexate concentrations. In this way, the
contiguous DNA sequences are also amplified and thus enhanced
expression is achieved. Mass cell cultures of the
transfectants secreted active soluble IL-4R at approximately
100 ng/ml.
C. Expression in HeZa Cells. IL-4R was expressed in
the human HeLa-EB~VA cell line 653-6, which constitutively
expresses EBV nuclear antigen-1 driven from the CMV
immediate-early enhancer/promoter. The expression vector
used was pHAV-EO-VEO (described by Dower et al., J. Immunol.
142:4314, 1989), a derivative of pDC201, which contains EBV
origin of replication and allows high level expression in the
653-6 cell line. pHAV-EO-NEO is derived from pDC201 by
replacing the ade:novirus major late promoter with synthetic
sequences from HIV-1 extending from -148 to +78 relative to
the cap site of the viral mRNA, and including the HIV-1 tat
gene under the control of the SV-40 early promoter. It also
contains a Bgl II-Sma I fragment containing the neomycin
resistance gene of pSV2NE0 (Southern & Berg, J. Mol. Appl.
X
23
9~~0'~~l
Genet. 1:332, 1982) inserted into the Bgl II and Hpa I sites
and subcloning downstream of the Sa1 I cloning site. The
resulting vector ~~ermits selection of transfected cells for
neomycin resistan~Je.
A 750 by IL-~~R fragment was released from the
Bluescript~ plasmid by digesting with EcoN I and Sst I
restriction enzymes. This fragment of clone 18 corresponds
to nucleotides 1-672 of Figure 2A, with the addition of a 5'
terminal nucleoti<~e sequence of GTGCAGGCACCTTTTGTGTCCCCA, a
TGA stop codon wh:LCh follows nucleotide 672 of Figure 2A, and
a 3' terminal nuc:Leotide sequence of
CTGAGTGACCTTGGGGGc;TGCGGTGGTGAGGAGAGCT. This fragment was
then blunt-ended using T4 polymerase and subcloned into the
Sa1 I site of pHA~I-EO-NEO. The resulting plasmid was then
transfected into 1=he 653-6 cell line by modified polybrene
transfection method as described by Dower et al. (J. Immunol.
142:4314, 1989) with the exception that the cells were
trypsinized at 2 days post-transfection and split at a ratio
of 1:8 into media containing 6418 (Gibco Co.) at a
concentration of :L mg/ml. Culture media were changed twice
weekly until neom~~cin-resistant colonies were established.
Colonies were then either picked individually using cloning
rings, or pooled i~ogether, to generate several different cell
lines. These cel=L lines were maintained under drug selection
at a 6418 concent:=ation of 250 ~g/ml. When the cells reached
confluency supernatants were taken and tested in the
inhibition assay of Example 1B. Cell lines produced from 100
ng/ml to 600 ng/m=L of soluble IL-4R protein.
Example 9
Expression of IL-4R in yeast cells
For expression of mIL-4R, a yeast expression vector
derived from pIXY:L20 was constructed as follows. pIXY120 is
identical to pYaHuGM (ATCC 53157), except that it contains no
24
~~ ~~~~ ~1
cDNA insert and includes a polylinker/multiple cloning site
with an Nco I site. This vector includes DNA sequences from
the following sources: (1) a large Sph I (nucleotide 562) to
EcoR I (nucleotide 4361) fragment excised from plasmid pBR322
(ATCC 37017), inc7_uding the origin of replication and the
ampicillin resist~~nce marker for selection in E. coli; (2) S.
cerevisiae DNA in<:ludin~~ the TRP-1 marker, 2~, origin of
replication, ADH2 promoter; and (3) DNA encoding an 85 amino
acid signal peptide de rived from the gene encoding the
secreted peptide cc-factor (See Kurjan et al., U.S. Patent
4,546,082). An A:~p 718 restriction site was introduced at
position 237 in tree a-f,~ctor signal peptide to facilitate
fusion to heterologous genes. This was achieved by changing
the thymidine residue at nucleotide 241 to a cytosine residue
by oligonucleotide-dire~~ted in vitro mutagenesis as described
by Craik, BioTechniques, January 1985, pp. 12-19. A
synthetic oligonuc:leotide containing multiple cloning sites
and having the fo7_lowing sequence was inserted from the
Asp718 site at amino acid 79 near the 3' end of the a-factor
signal peptide to a Spe I site in the 2~ sequence:
Asp718 Stu I Nco I
GTACCTTTGGATAAAAG~1GACTACAAGGACGACGATGACAAGAGGCCTCCP.TGGATC
BamHI Sma I Spe I
CCCCGGGACA
GAAACCTATTTTCTCTG~1TGTTCCTGCTGCTACTGTTCTCCGGAGGTACCTAGGGGGCCCT
GTGATC
~Polylinker~~
pBC120 also varies from pYa,HuGM by the presence of a 514 by
DNA fragment derived from the single-stranded phage fl
containing the origin o:f replication and intergenic region,
which has been in:~erted at the Nru I site in the pBR322
sequence. The presence of an fl origin of replication
x
~.3~~~~~i
permits generation of single-stranded DNA copies of the
vector when transformed into appropriate strains of E. coli
and superinfected with bacteriophage f1, which facilitates
DNA sequencing of the vector and provides a basis for in
vitro mutagenesis. To insert a cDNA, pIXY120 is digested
with Asp 718 which cleaves near the 3' end of the a-factor
leader peptide (nucleotide 237) and, for example, BamH I
which cleaves in the polylinker. The large vector fragment
is then purified and ligated to a DNA fragment encoding the
protein to be expressed.
To create a secretion vector for expressing mIL-4R, a
cDNA fragment encoding mIL-4R was excised from the
Bluescript~ plasrr.id of Example 8 by digestion with Ppum I and
Bg1 II to release an 831 by fragment from the Ppum I site
(see FIGURE) to a:n Bg1 II site located 3' to the open reading
frame containing the mIL-4R sequence minus the first two 5'
codons encoding I1e and Lys. pIXY120 was digested with Asp
718 near the 0 en~~ of the a-factor leader and BamHI. The
vector fragment was ligated to the Ppum I/Bg1 II hIL-4R cDNA
fragment and the following fragment created by annealing a
pair of synthetic oligonucleotides to recreate the last 6
amino acids of th~~ a-factor leader and the first two amino
acids of mature mIL-4R.
a-f: actor processing-~~
GTA CCT CTA GAT AAA AGA ATC AAG
G:~ GAT CTA TTT TCT TAG TTC CAG
Va.l Pro Leu Asp Lys Arg Ile Lys
f-mIL-4R
The oligonucleoti~~e also included a change from the
nucleotide sequen~~e TGG ATA to CTA GAT which introduces a Xba
x
26
~J~~r~~l
I restriction site, without altering the encoded amino acid
sequence.
The foregoing expression vector was then purified and
employed to transform a diploid yeast strain of S.
cerevisiae(XV2181) by ~>tandard techniques, such as those
disclosed in EPA 165,654, selecting for tryptophan
prototrophs. The resulting transformants were cultured for
expression of a secreted mIL-4R protein. Cultures to be
assayed for biological activity were grown in 20-50 ml of YPD
medium (1% yeast extract, 2o peptone, to glucose) at 37°C to a
cell density of 1-5 x 1.08 cells/ml. To separate cells from
medium, cells were removed by centrifugation and the medium
filtered through a 0.45 ~ cellulose acetate filter prior to
assay. Supernatants produced by the transformed yeast
strain, or crude extracas prepared from disrupted yeast cells
transformed the plasmid, were assayed to verify expression of
a biologically active protein.
Example 10
Isolation of fu~_1-length and truncated forms of murine IL-4
receptor cDNAs from unsorted 7B9 cells
Polyadenylated RNP, was isolated from 7B9 cells, an
antigen-dependent helper T cell clone derived from C57BL/6
mice, and used to construct a cDNA library in a,ZAP
(Stratagene, San Diego), as described in Example 7. The a,ZAP
library was amplified once and a total of 300,000 plagues
were screened as described in Example 7, with the exception
that the probe was a randomly primed 32P-labeled 700 by EcoR
I fragment isolated from CTLL 19.4 clone 16. Thirteen clones
were isolated and characterized by restriction analysis.
Nucleic acid sequence analysis of clone 7B9-2 revealed
that it contains a polyadenylated tail, a putative
t polyadenylation signal, and an open reading frame of 810
27
amino acids (shown in fig 2), the first 258 of which are
identical to those encoded by CTLL 19.4 clone 16, including
the 25 amino acid putative signal peptide sequence. The 7B9-
2 cDNA was subcloned into the eukaryotic expression vector,
pCAV/NOT, and the resulting plasmid was transfected into COS-
7 cells as described in Example 8. COS-7 transfectants were
analyzed as set forth in Example 12.
A second cDN.A form., similar to clone 18 in the CTLL 19.4
library, was isolated from the 7B9 library and subjected to
sequence analysis. This cDNA, clone 7B9-4, is 376 by shorter
than clone 7B9-2 at the 5' end, and lacks the first 47 amino
acids encoded by 7B9-2, but encodes the remaining N-terminal
amino acids 23-199 (in Fig. 2). At position 200, clone 7B9-4
(like clone 18 from CTLL 19.4) has a 114 by insert which
changes the amino acid sequence to Pro Ser Asn Glu Asn Leu
followed by a termination codon. The 114 by inserts, found
in both clone 7B9-4 and CTLL 19.4 clone 18 are identical in
nucleic acid sequ~ance. The fact that this cDNA form, which
produces a secret~Jd form of the IL-4 receptor when expressed
in COS-7 cells, w,as isolated from these two different cell
lines indicates that it is neither a cloning artifact nor a
mutant form pecu liar to the sorted CTLL cells.
Example 11
Isolation of human IL-4 receptor cDNAs from PBL and T22
libraries by cross-species hybridization
Polyadenylatf=d RNA was isolated from pooled human
peripheral blood :Lymphocytes (PBL) that were obtained by
standard Ficoll p»rification and were cultured in IL-2 for
six days followed by stimulation with PMA and Con-A for eight
hours. An oligo c~T primed cDNA library was constructed in
~,gtl0 using techn=~ques described in Example 7. A probe was
produced by synthesizing an unlabeled RNA transcript of the
27a
1~~U'~~
7B9-4 cDNA insert using T7 RNA polymerase, followed by 32p_
labeled cDNA synthesis with reverse transcriptase using
random primers (Boehringer-Mannheim). This murine single-
stranded cDNA probe was used to screen 50,000 plagues from
the human cDNA library in 50o formamide/0.4 M NaCl at 42°C,
followed by washing in 2 X SSC at 55°C. Three positive
plagues were puri:=ied, and the EcoR I inserts subcloned into
the Bluescript~ plasmid vector. Nucleic acid sequencing of a
portion of clone I?BL-1, a 3.4 kb cDNA, indicated the clone
was approximately 67o homologous to the corresponding
sequence of the murine IL-4 receptor. However, an insert of
68 bp, containing a termination codon and bearing no homology
to the mouse IL-4 receptor clones, was found 45 amino acids
downstream of the predicted N-terminus of the mature protein,
suggesting that c=_one PBL-1 encodes a non-functional
truncated form of the receptor. Nine additional human PBL
clones were obtained by screening the same library (under
stringent conditions) with a 32P-labeled random-primed probe
made from the clone PBL-1 (the 3.4 kb EcoR I cDNA insert).
Two of these clonE:s, PB:L-11 and PBL-5, span the 5' region
that contains the 68 by insert in PBL-1, but lack the 68 by
insert and do not extend fully 3' as evidenced by their size,
thus precluding functio:zal analysis by mammalian expression.
In order to obtain a co::zstruct expressible in COS-7 cells,
the 5' Not I-Hinc II fr~~gment of clones PBL-11 and PBL-5 were
separately ligatec~ to the 3' Hinc II-BamH I end of clone PBL-
1, and subcloned into the pCAV/NOT expression vector cut with
Not I and Bgl II described in Example 8. These chimeric
human IL-4R cDNAs containing PBL-11/PBL-1 and PBL-5/PBL1 DNA
sequences have been termed clones A5 and B4, respectively, as
further described in Example 12. These constructs were
transfected into C:OS-7 cells, and assayed for IL-4 binding in
a plate binding a=say substantially as described in Sims et
al. (Science 241:_'85, 1'x88). Both composite constructs
27b
13~~~~i
encoded protein which exhibit IL-4 binding activity. The
nucleotide sequencJe and predicted amino acid sequence of the
composite A5 construct correspond to the sequence information
set forth in Figures 4A-4C, with the exception that a GTC
codon encodes the amino acid Val at position 50, instead of
Ile. No other clones that were sequenced contained this
change. The consensus codon from clones PBL-1, PBL-5 and
T22-8, however, i:~ ATC and encodes I1e50, as set forth in
Figure 4A. The nucleotide and predicted amino acid sequence
of the composite B4 construct also shows that the 25 amino
acid leader sequence of PBL-11 is replaced with the sequence
Met-Gln-Lys-Asp-A_La-Arg-Arg-Glu-Gly-Asn.
Constructs e:~pressing a soluble form of the human IL-4
receptor were made by excising a 5'-terminal 0.8 kb Sma I-Dra
III fragment from PBL-5 and the corresponding 0.8 kb Asp718
Dra III fragment From PBL-11, of which the Dra III overhangs
were blunt-ended with T4 polymerase. The PBL-5 and PBL-11
fragments were separately subcloned into CAV/NOT cut with Sma
I or Asp 718 plus Sma I, respectively; these are called
soluble hIL-4R-5 and soluble hIL-4R-11, respectively. In
both constructs the final IL-4 receptor amino acid Thr194
codon is followed by the vector-encoded amino acids
GlyGlnArgProLeuGlnIleTyrAlaIle before terminating.
A second library made from a CD4+/CD8-human T cell
clone, T22 (Acres et al., J Immunol. 138:2132, 1987) was
screened (using duplicate filters) with two different probes
synthesized as described above. The first probe was obtained
from a 220 by Pvu II fragment from the 5' end of clone PBL-1
and the second probe was obtained from a 300 by Pvu II-EcoR I
fragment from the 3' end of clone PBL-1. Five additional
cDNA clones were :identified using these two probes. Two of
these clones span the 5' region containing the 68 by insert,
but neither contain the insert. The third of these clones,
T22-8, was approximately 3.6 kb in size and contained an open
27c
1340'~~G!
reading frame of 825 amino acids, including a 25 amino acid
leader sequence, ~~ 207 amino acid mature external domain, a
24 amino acid transmemb:rane region and a 569 amino acid
cytoplasmic domain. The sequence of clone T22-8 is set forth
in Figures 4A-4C. Figures 5A-5B compare the predicted~human
IL-4R amino acid sequence with the predicted murine IL-4R
sequence and show approximately 53o sequence identity between
the two proteins.
A third soluble human IL-4 receptor construct was made
as follows. cDNA clone T22-8 was cleaved at the DraIII site
in the Thr194 codon, and repaired with synthetic
oligonucleotides t;o regenerate the Thr194 and Lys195 codons,
followed by a termination codon, and a NotI restriction site.
A 0.68 kb StyI-Not:I restriction fragment of this clone was
then blunt-ended at the StyI site and subcloned into a SmaI-
NotI digested pCAV/NOT vector. This cDNA expression vector
was designed hIL-~3R-8.
Example 12
Analysis and purification of IL-4 receptor in COS
transfectants
Equilibrium bindin~~ studies were conducted for COS cells
transfected with rnurine IL-4 receptor clones 16 and 18 from
the CTLL 19.4 library. In all cases analysis of the data in
the Scatchard coordinate system (Scatchard, Ann. N.Y. Acad.
Sci. 51:660-672, (1949) yielded a straight line, indicating a
single class of h=ugh-affinity receptors for murine IL-4. For
COS pCAV-16 cells the c,~lculated apparent Ka was 3.6 x 109 M-
1 with 5.9 x 105 specific binding sites per cell. A similar
apparent Ka was c:~lculated for COS pCAV-18 cells at 1.5 x 109
M-1 but receptor number expressed at the cell surface was 4.2
x 104. Equilibrium binding studies performed on COS cells
transfected with =CL-4R DNA clones isolated from the 7B9 cell
;.
27d
~3~~~t~si
library also showed high affinity binding of the receptor to
IL-4. Specifical:Ly, studies using COS cells transfected with
pCAV-7B9-2 demonsvrated that the full length murine IL-4
receptor bound 12'I-IL-4 with an apparent Ka of about 1.4 x
1010 M-1 with 4.5 x 104 specific binding sites per cell. The
apparent Ka of CA'J-7B9-4 IL-4R was calculated to be about
final assay volumf= of 150 ~l gives approximately 500
inhibition of 1251-IL-4 binding to the IL-4 receptor on CTLL
cells. 1251-IL-4 receptor competing activity is not detected
in control pCAV t:ransfected COS supernatants. From
quantitative anal:~sis of the dilution of pCAV-18 supernatant
required to inhibit 1251-IL-4 binding by 500, it is estimated
that approximately 60-100 ng/ml of soluble IL-4 receptor has
been secreted by COS cells when harvested three days after
transfection. Similar results were obtained utilizing
supernatants from COS cells transfected with pCAV-7B9-4.
Conditioned medium from COS cells transfected with pCAV-
18 or pCAV-7B9-4 (see Example 8) and grown in DMEM containing
3o FBS was harvested three days after transfection.
Supernatants were centrifuged at 3,000 cpm for 10 minutes,
and frozen until :needed. Two hundred ml of conditioned media
was loaded onto a column containing 4 ml of muIL-4 Affigel
prepared as described above. The column was washed
extensively with PBS and IL-4 receptor eluted with 0.1 M
glycine, 0.15 M N~~Cl pH 3Ø Immediately following elution,
samples were neutralized with 80 ~1 of 1 M Hepes pH 7.4.
Samples were tested for their ability to inhibit binding of
1251-muIL-4 to CT:LL cells as set forth in example 1B.
Additionally samples were tested for purity by analysis on
SDS-PAGE and silver staining as previously described.
Alternative metho~~s for testing functional soluble receptor
activity or :LL-4 :oinding inhibition include solid-phase
binding assays, as described in Example 1C, or other similar
cell free assays which may utilize either radio iodinated or
27e
1340~1~i
colorimetrically developed IL-4 binding, such as RIA or
ELISA. The protein analyzed by SDS-PAGE under reducing
conditions has a rnolecular weight of approximately 37,500 and
appears approximately 90o pure by silver stain analysis of
gels.
Purified recombinant soluble murine IL-4 receptor
protein may also be tested for its ability to inhibit IL-4
induced 3H-thymid=Lne incorporation in CTLL cells. Pursuant
to such methods, soluble IL-4 receptor has been found to
block IL-4 stimulated proliferation, but does not affect IL-2
driven mitogenic response.
Molecular we__ght estimates were performed on mIL-4
receptor clones transfected into COS cells. Utilizing M2
monoclonal antibody pre.oared against murine CTLL 19.4 cells
(see example 13), IL-4 receptor is immunoprecipitated from
COS cells transfec:ted with CAV-16, CAV7B9-2 and CAV-7B9-4 and
labeled with 35S-cystei:ne and 35S-methionine. Cell
associated receptor from CAV-7B9-4 shows molecular weight
heterogeneity ranging from 32-39 kDa. Secreted CAV-7B9-4
receptor has molecular weight between 36 and 41 kDa. Cell
associated receptor from CAV-16 transfected COS cells is
about 40-41 kDa. This is significantly smaller than
molecular weight E'stima'tions from crosslinking studies
described by Park et al., J Exp. Med. 166:476, 1987; J. Cell.
Biol. Suppl. 12A, 1988. Immunoprecipitation of COS CAV-7B9-2
cell-associated receptor showed a molecular weight of 130-140
kDa, similar to the estimates of Park et al., J. Cell. Biol.,
suppl. 12A, 1988, estimated to be the full length IL-4
receptor. Similar= mole~~ular weight estimates of cell-
associated CAV-16 and C;~1V-7B9-2 IL-4 receptor have also been
made based upon cross-linking 125IL-4 to COS cells
transfected with these ~~DNAs. Heterogeneity of molecular
weight of the ind~_vidual clones can be partially attributed
to glycosylation. This data, together with DNA sequence
27f
analysis, suggests that: the 7B9-2 cDNA encodes the full
length cell-surface IL--4 receptor, whereas both 7B9-4 and
clone 18 represent soluble forms of murine IL-4 receptor.
.
27g
1340't~i
Receptor characterization studies were also done on COS cells transfected with
hIL-4R
containing expression plasmids. The two chimeric human IL-4R molecules A5 and
B4 (defined in
Example 11) were transfected into COS cells and equilibrium binding studies
undertaken. The COS
monkey cell itself has receptors capabl~a of binding hIL-4; therefore the
binding ca~ulations performed
on COS cells transtected with and overexpressing hIL-4R cDNAs represent
background binding from
endogenous monkey IL-4R molecules subtracted tram the total binding. COS cells
transfected with
hIL-4R A5 had 5.3 x 104 hIL-4. birxiing ;;ices with a calculated Ka of 3.48 x
109 M-1. Similarly, the hIL-
4R B4 expressed in COS cell;; bound 1251-hIL-4 with an affinity of 3.94 x 109
M-1 exhibiting 3.2 x 104
receptors per cell.
Molecular weight estimates of human IL-4R expressed in COS cells were also
performed.
COS cells transtected with clones A5 or B4 in pCAV/NOT were labeled with 35S-
cysteine/ methionine
and lysed. Human IL-4R was affinity purified from the resulting lysates with
hIL-4-coupled Affiget~ (as
descrtbed in Example 4). The hIL-4R A5 and B4 eluted from this affinity
support migrated at about
140,000 daltons on SDS-PAGiE, agreeing well with previous estimates of hIL-4R
molecular weight by
cross-linking (Park et al., J. E,rp. Med 166476, 1987), as well as with
estimates of full-length mIL-4R
presented here.
Because no soluble human IL-4R cDNA has thus tar been found occurring
naturally, as was
the case for the murine receptor (clones 18 and 7B9-4), a truncated form was
constructed as
described in Example 1t. Following expression in COS cells, supernatants were
harvested three
days after transtection with soluble hIL-4R-11 and soluble hIL-4R-5 and tested
for inhibition of t 2~1-
hIL-4 binding to the human B cell Gne Rah. Supernatants from two of the
soluble hIL-4R-11 and one of
the soluble hIL-4R-5 transfected plates contained 29-149 ng/ml of IL-4R
competing activity into the
medium. In addition, the truncated protein could be detected in 35S-
methionine/cysteine-labeled
COS cell transfectants by affinity purification on hIL-4-coupled Affiget~ as
approximately a 44 kDa
protein by SDS-PAGE. Supernatants from C4S cells transfected with h1L-4R-8
(encoding soluble truncated lL-4R) when concentrated 25-fold, inhibited human
IL-4 binding to Raji cells, and contained approximately 16 nglml of competing
activity.
Example 13
$~naration of monoclonal antif.~~jes to IL-4R
Preparations of purified recombinant IL-4 receptor, for example, human or
murine IL-4
receptor, transfected COS cells expressing high levels of IL-4 receptor or
CTLL 19.4 cells are
employed to generate monoclonal antiibodies against IL-4 receptor using
conventional techniques,
such as those disclosed in IU. S. Patent 4,411,993. Such antibodies are likely
to be useful in
interfering with 1L-4 binding 1o IL-4 receptors, for example, in ameliorating
toxic or other undesired
effects of iL-4.
To immunize rats, IL-~s receptor bearing CTLL 19.4 cells were used as
immunogen emulsified
in complete Freund's adjuvan~t and injected in amounts ranging from 10-100 p!
subcutaneously into
Lewis rats. Three weeks later, the irnmunized animals were boosted with
additiorra! immunogen
emulsified in incomplete Frf~und's acljuvant and boosted every three weeks
thereaffer. Serum
samples are periodically taken by retro~~ort~ital bleeding or tail-tip
excision for testing by dot-blot assay,
~. . - 2 8 -
134~Y161
ELISA (enzyme-linked inununosorbent assay), or inhibition of
binding of 1251-I7~-4 to extracts of CTLL cells (as described
in Example 1). 01=her assay procedures are also suitable.
Following detection of an appropriate antibody titer,
positive animals were given a final intravenous injection of
antigen in saline. Three to four days later, the animals
were sacrificed, :~plenocytes harvested, and fused to the
murine myeloma ce_L1 line AG8653. Hybridoma cell lines
generated by this procedure were plated in multiple
microtiter plates in a HAT selective medium (hypoxanthine,
aminopterin, and vhymidine) to inhibit proliferation of non-
fused cells, myeloma hybrids, and spleen cell hybrids.
Hybridoma clones thus generated were screened for
reactivity with I:~~-4 receptor. Initial screening of
hybridoma supernatants utilized an antibody capture and
binding of partia.Lly purified 1251-mIL-4 receptor. Two of
over 400 hybridomas screened were positive by this method.
These two monoclonal antibodies, M1 and M2, were tested by a
modified antibody capture to detect blocking antibody. Only
Ml was able to inhibit 1251-rmIL-4 binding to intact CTLL
cells. Both antibodies are capable of immunoprecipitating
native mIL-4R protein from CTLL cells or COS-7 cells
transfected with IL-4R clones labeled with 35S-
cysteine/methioni:ze. Ml and M2 were then injected into the
peritoneal cavities of nude mice to produce ascites
containing high c~~ncentrations (>1 mg/ml) of anti-IL-4R
monoclonal antibo~~y. The resulting monoclonal antibody was
purified by ammonium sulfate precipitation followed by gel
exclusion chromatography, and/or affinity chromatography
based on binding sf antibody to Protein G.
~x
29
Example 14
1340'~~1
Use of soluble IL-4R to suppress immune response in vivo
Experiments were conducted to determine the effect of
soluble IL-4R on allogenic host versus graft (HVG) response
in vivo using a p~~pliteal lymph node assay. In this model
mice are injected in the footpad with irradiated, allogeneic
spleen cells. Irradiated, syngeneic cells are then injected
into the contralaveral pad. An alloreactive response occurs
in the pad receiving the allogeneic cells, the extent of
which can be measured by the relative increase in size and
weight of the pop:Liteal lymph node draining the site of
antigen deposition.
On day 0 three BALB/C mice were injected in the footpad
with irradiated, <~llogeneic spleen cells from c57BL/6 mice
and in the contra:Lateral footpad with irradiated, syngeneic
spleen cells. On days -1,0 and +1 three mice were injected
(intravenously on days -1 and 0, and subcutaneously on day
+1) with 100ng of purified soluble IL-4R(sIL-4R) in phosphate
buffered saline, i~hree :mice were injected intravenously with
1 ~g of sIL-4R, three mice were injected with 2~g of sIL-4R
and three mice we..a injected with MSA (control). The mean
difference in weight of the lymph nodes from the sites of
allogeneic and syngeneic spleen cells was approximately 2.5
mg for the mice t..eated with MSA, 1 mg for the mice treated
with 100 ng of sIh-4R, and 0.5 mg for mice treated with leg
sIL-4R. No detect=able difference in weight of lymph nodes
was ascertainable for the mice treated with 2~.g sIL-4R.
Thus, IL-4R signi=icantly (p < 0.5 in all groups, using a
two-tailed T test; suppressed the in vivo lymphoproliferative
response in a dose dependent fashion relative to control
mice.
r
... 29a
