Note: Descriptions are shown in the official language in which they were submitted.
Human interleukin-2 (I1-2), formerly called T-cell
growth factor, is a soluble protein which can be produced
from T-cells activated with a lectin or an antigen and which
is capable of modulating lymphocyte reactivity and promoting
the long-term in vitro culture of antigen-specific effector
T-lymphocytes. IL-2 is also known to enhance thymocyte mito-
genesis and to induce cytotoxic T-lymphocyte reactivity.
Accordingly, this lymphocyte regulatory substance is useful
in potentiating humoral and cellular immune responses and in
restoring immune deficient state to a normal humoral and
cellular immune state. These identified immunological acti-
vities of IL-2 indicate that IL-2 is useful for medical
immunotherapy against immunological disorders including neo-
plastic diseases, bacterial or viral infections, immure
deficient diseases, autoimmune diseases etc. (Papermaster,
B. et al., Adv. Immunopharm., 507, [1980]). Recently, a
review article in the Journal of The American Medical Asso-
ciation, Vol. 249, No. 2 at pages 166-171 (January 14, 1983)
discusses the clinical applications of various lymphokines
including particularly human IL-2.
Human IL-2 derived from induced human malignant cells
has recently been purified to homogeneity using multiple
high performancee liquid chromatography (HPLC) steps. The
resulting homogeneous human IL-2 demonstrated a specific
activity of about 1.4 x 109 units/mg (see e.g. European
patent application No. 83.109202.8, publication No. 106 179).
Taniguchi et al. reported on the cloning and sequencing
of the IL-2 gene and expression of the immature form of
human Interleukin-2 at the Third Annual Recombinant DNA
congress in Philadelphia, Pennsylvania on February 9, 1983
~~4.~8~~
- 2 -
(Nature, 302, 305-310 [1983]). The cDNA from which the amino
acid sequence of the IL-2 protein was derived was prepared
from mRtJA obtained from Jurkat cells induced with Concanava-
lin A. The full length cDNA clone is 800 base pairs long and
codes for a protsin of 153 amino acids. See also European
patent application, publication No. 91539.
Other groups have also reported the cloning and sequen-
cing of the IL-2 gene. See Devos et al., ~~Molecular Cloning
of Human Interleukin-2 cDNA and Its Expressior_ in E. coli~~,
Nucleic Acids Research, 11, 4307-4323 (1983). See also Euro-
pean patent application, publication No. 118 977.
Although these references describe the expression of
IL-2 in transformed host cells, especially in E. coli, no
purification procedures are disclosed which would permit one
skilled in the art to obtain mature recombinant human IL-2
in a homogeneous or'substantially pure form.
The present invention relates to a process for the puri-
fication of recombinant IL-2 especially of recombinant
mature human IL-2. It provides a method for the purification
of recombinant mature human IL-2 to homogeneity which over-
comes the limitations of prior art purification methods.
This method comprises
(a) cultivating a transformed organism containing a DNA
sequence which codes for mature human IL-2;
(b) causing a culture of the transformed organism of step
(a) to express and accumulate mature human IL-2:
(c) lysing the culture of transformed organisms of step (b)
to form a cell lysate mixture;
(d) separating the cell membrane components from the cell
lysate mixture of step (c);
(e) ~,aasring the isolated cell membrane components with an
extraction solution to yield a wash solution containing
IL-2 ; and
- 3 -
(f) chromatographically purifying the wash solution of step
(e) to yield a substantially pure or homogenous recombinant
human IL-2.
Brief Description of the Drawings
Fig. 1 represents the DNA nucleotide sequence of pIL2-2B
and the corresponding amino acid sequence of mature human
interleukin-2 (arrow represents amino terminus of mature
IL-2 protein).
Fig. 2 graphically illustrates the construction of pRC2
from pBR322.
Fig. 3 graphically illustrates the construction of pRC23
containing a PL promoter.
Fig. 4 shows the construction of the structural gene for
expression of Ser-IL-2.
Fig. 5 graphically illustrates the construction of a
mature IL-2 expression vector without a promoter system (pRC
201/IL-2).
Fig. 6 graphically illustrates the construction of the
mature IL-2 expression vector including a PL promoter
system (pRC 233/IL2).
The procedure of the present invention relies on the
surprising finding that the IL-2 protein expressed by a
microbe tends to associate with the membrane fractions of
the host microbe, principally the inner membrane of the
microbe (the membrane being a lipid bi-layer often associa-
ted with hydrophobic proteins). Therefore, separation of
these membranes during the process of recovering IL-2 from
the transformed microorganisms ensures high yield and purity
levels of IL-2 at the end of the whole purification proce-
4
dure.
While different known methods of cell lysis can be used
in the process of the present invention, such as enzymatic
or chemical lysis, lysis by sonification is the preferred
method. The inner and outer cell membranes are then separa-
ted from the other cellular components by known methods such
as centrifugation.
Once the cell membranes are separated from the lysate
mixture, they are washed with an extraction solution, pre-
ferably salt and detergent solutions to yield a solution
comprising at least about 50% IL-2. In a preferred embodi-
ment, the cell membranes are washed in four separate steps
with the salt and detergent solutions. The first step pre-
ferably comprises washing the cell membranes with a salt
solution, preferably 1M NaCl. In the second step the cell
membrane fraction is washed with a detergent solution, pre-
ferably 1% Triton X-100. In the third step the cell membrane
fraction is washed with another salt solution, preferably
1.75M to 2M guanidine-HCl. The final wash is also with a
salt solution, preferable about 4M to 7M guanidine-HC1. The
wash solution which results from the fourth and final wash
comprises at least about 50% IL-2.
The final IL-2 wash solution is then further purified by
chromatography, preferably by reverse phase high performance
liquid chromatography (HPLC). The HPLC step yields active
IL-2 in a substantially 100% pure or homogeneous form. It is
also forseeable that antibody affinity chromatography
columns, utilizing polyclonal or monoclonal antibodies to
IL-2, could be used as an alternative to HPLC. Other chroma-
tographic procedures can also be utilized such as dye-affi-
nity columns (e.g., Procion red agarose - as described in
European Patent Application No. 83103582.9 published under
No. 92163 on October 26, 1983) or sephacryl*5200 columns. In
another preferred embodiment of this invention the chromatc-
* trade mark.
_ 5 _
graphy comprises multiple steps, i.e. HPLC followed by a
dye-affinity chromatography step.
In accordance with this invention the aforementioned
purified IL-2 can be used for similar purposes as the other
known immunomodulator compounds, e.g. as a means for trea-
ting immunosuppressive conditions. It may be administered in
pharmaceutically acceptable oral, injectable or topical com-
position and modes. Dosage and dose rate may parallel that
currently being used in clinical applications of known
immunomodulator compounds, typically about 1-200 x106
units daily. These pharmaceutical compositions of the inven-
tion contain said IL-2 in association with a compatible
pharmaceutically acceptable carrier material. Any conventio-
nal carrier material can be utilized. The carrier material
can be an organic or inorganic inert carrier material sui-
table for enteral, percutaneous or parenteral administra-
tion. Suitable carriers include water, gelatin, gum arabic,
lactose. starch, magnesium stearate, talc, vegetable oils,
polyalkylene-glycols, especially polyethylene-glycols,
petroleum jelly and the like. Furthermore, the pharmaceu-
tical preparations may contain other pharmaceutically active
agents. Additional additives such as flavoring agents,
preservatives, stabilizers, emulsifying agents, buffers and
the like may be added in accordance with accepted practices
of pharmaceutical compounding.
The pharmaceutical preparations can be made up in any
conventional form including: a) a solid form for oral
administration such as tablets, capsules, pills, powders,
granules, and the like; b) a liquid form for oral adminis-
tration such as solutions, syrups, suspensions, elixirs and
the like; c) preparations for parenteral administration such
as sterile solutions, suspensions or emulsions; and d) pre-
parations for topical administrations such as solutions,
suspensions, ointments, creams, gels, micronized powders,
aerosols and the like. The pharmaceutical preparations may
be sterilized and/or may contain adjuvants such as preserva-
- 6 -
tives, stabilizers, wetting agents, emulsifiers, salts for
varying the osmotic pressure and/or buffers.
Parenteral dosage forms may be infusions or injectable
solutions which can be injected intravenously or intramuscu-
larly. The preparations can also contain other medicinally
active substances. Additional additives such as preservati-
ves, stabilizers, emulsifying agents, buffers and the like
may be added in accordance with accepted practices of phar-
l0 maceutical compounding.
The construction of IL-2 expression vectors and of
transformants capable of expressing IL-2 is described in
more detail below.
The amino acid sequence of the mature IL-2 protein is
given in Figure 1. The~protein may be expressed in its
mature form with a methionine at the amino terminus of the
protein if the gene initiation codon is ATG. The methionine
may or may not be removed by the host cell after expression.
The expression vectors used in this invention are deri-
vatives of pBR322 containing the PL promoter isolated from
bacteriophage lambda DNA. PL was the promoter of choice
since it is a very strong promoter that can be efficiently
and conveniently controlled by the lambda cI repressor, the
gene for which may be located on the microorganism s chromo-
some, a compatible vector or the same vector as that con-
taining the PL promoter. The gene encoding the repressor
carries a mutation, cIts, which renders tre repressor tempe-
rature-sensitive. A vector which may be used with this
invention and which contains the cI mutation is pRK248cIts,
which is known in the art and is described by Kahn et al.,
P4ethods in Enzymology, 68, 268 (1979). At 30°C the repressor
functions normally, and from about 37°C to about 42°C it is
inactivated. Thus, the Pr promoter is repressed (turned-
-cff) at 30°C and derepressed (turned-on) at 42°C. The abi-
1~~08~3
_ 7 _
~,
lity to control the PL promoter allows one to grow the
culture at about 30°C to about 36°C without expressing the
gene product and at an optimum time, shift the temperature
from about 30°C to about 42°C to produce the desired mature
human IL-2 product.
The preferred vector used in the present invention also
contains an EcoRI restriction site distal (downstream in 3'
direction) from the SD sequence. The following description
serves to illustrate the preparation of a preferred vector,
pRC23, into which the IL-2 gene is then introduced. However,
other vectors may also be used.
In accordance with the procedure outlined in Figures 2
and 3 20 micrograms of pBR322 were digested with EcoRI and
then used in two different reactions: 1) treatment with S1
nuclease to remove the 5' overhang, and 2) treatment with
the Klenow fragment of DNA polymerase I to fill-in the ter-
mini. Both reactions were terminated by phenol extraction
followed by ethanol precipitation. DNA from each reaction
was ligated to a synthetic BglII linker, digested with BglII
and PstI, and subjected to gel electrophoresis in 1% aga-
rose. The 3600 by (base pairs) and 760 by fragments from
both reactions were recovered from the gel. For the con-
struction of pRC2, the 3600 by fragment from the Klenow
reaction was ligated to the 760 by fragment from the S1
reaction. E. coli RR1 was transformed with the ligation
mixture and transformants were selected on media containing
50 ug/ml ampicillin. Transformants containing the expected
plasmid construction, i.e. a plasmid containing a BglII
restriction site in proximity of the EcoRl restriction site,
were identified by restriction analysis of the isolated
plasmid DNA. pRC23 was constructed by ligating synthetic
oligonucleotides comprising a "consensus" or computer gene-
rated ribosome-binding site (RBS), [Scherer et al. Nucleic
Acids Research, 8, 3895 (1980)] to a 250 by Bgl II - Hae III
fragment containing the lambda. PL promoter, and inserting
-a-
~3~~~~3
the ligation product into pRC2.
In order to isolate the 250 by DNA fragment containing
the lambda PL promoter, 1 microgram of a 450 by Bgl II -
Hpa I DNA fragment (from by #35260 to 35710 of the lambda
phage DNA sequence) was digested with Hae III and the pro-
ducts were isolated by preparative gel electrophoresis in 5%
polyacrylamide. About 200 ng of the 250 by Bgl II - Hae III
fragment was ligated to 60 pmoles each of the synthetic
oligonucleotides shown in Figure 3 which comprise most of
the ~~consensus~~ RBS sequences generated by computer analysis
as described by Scherer et al. The ligated molecules were
digested with Bgl II and EcoRl (to eliminate oligomers) and
purified by gel electrophoresis. The ligated products were
then inserted into pRC2 which also had been digested with
Bgl II and EcoRI. Transformation of E. coli strain
RR1(pRK248cIts) was performed using standard methods and
transformants were seclected on media containing ampicillin
(50 ug/ml) at 30°C. 50 transformants were obtained, DNA
was isolated from 8 of those and analyzed by digesting with
Hinc II. 6 of the 8 showed the expected restriction pattern
and Maxam-Gilbert nucleotide sequence analysis of one of
these confirmed the expected construction (designated pRC23).
Construction of a alasmidic expression vector containinu DN_A
coding for mature human IL-2
(1) Isolation of mRNA coding for human IL-2
mRNA was isolated from H33HJ-JAI cells (ATCC No.
CRL-8163, deposited August 26, 1982), a clone of Jurkat
cell line FHCRC, after induction with PHA and PMA.
12,000 ml of H33HJ-JAI clone cell cultures (106
cells/ml) were grown in RPMI 1640 tissue culture medium
supplemented with 10% Fetal Bovine Serum, 50 U/ml peni-
cillin, 50 ug/ml streptomycin, 50 ug/ml gentamycin,
and 300 ug/ml fresh L-glutamine. These cells were
collected by centrifugation and resuspended in 6 1 of
13~0~~3
_ g _
the above detailed medium, lacking serum, but further
supplemented with 1% PHA and 10 ng/ml PMA. Cells were
dispended in 6 1 aliquots to sterile glass roller
bottles and placed on a roller mill (10 rpm at 37°C).
Eight hours later, cells were collected by centrifuga-
tion and mRNA was extracted using a standard phenol
chloroform extraction procedure. Following phenol
chloroform extraction, ethanol precipitated RNA was
pelleted by high speed centrifugation, and resuspended
in a 0.5M salt solution. Poly A-tailed mRNA contained in
the total RNA population was collected by passage of
this material over an oligo(dT)cellulose column. Ethanol
precipitated mRNA was resuspended in water to a concen-
tration of 500 ug/ml. 30 ng of RNA was then microin-
jected into Xenopus oocytes. After 24 hours of incuba-
tion in sterile Barth~s solution, 4 eggs were trans-
ferred into a sterile 1.5 ml Eppendorf centrifuge tube
and fed with 540-1500 microliters of fresh sterile
Barth~s solution. 48 hours later, 200 microliters of egg
conditioned medium was harvested and assayed for IL-Z
activity using a standard CTLL Cell 3H-Tdr incorpora-
tion assay (Gillis et al., J. Immunoi. 120, 2027
[1978]). mRNA preparations which when translated by
oocytes gave rise to significant IL-2 activity, were
pooled, sized by standard sucrose density gradient
centrifugation techniques and ethanol precipitated for
cDNA library construction.
(2) cDNA Synthesis
3.5 ug of purified mRNA (approximately 10S on sucrose
gradients) were used to synthesize double-stranded
complementary DNA (ds cDNA) by the following method
(Gubler and Hoffmann, Gene 25, 263-269 [1983]).
~3~-0853
- 10
(a) First strand cDNA synthesis:
The mRNA was suspended in 17.5 ml containing 50 mM
Tris-HC1, pH 8.3, 10 mM MgCl2, 10 mM DTT, 4 mM
Na-pyrophosphate, 1.25 mM dATP, 1.25 mM dGTP,
1.25 mM dTTP, 0.5 mM dCTP, 100 ug/ml of
oligo(dT)12-18' and 10 Ci of 32P-dCTP (Amersham
3000 Ci/mMole). After incubation for 5 min. at
43°C, 3x00 units AMV reverse transcriptase/ml (Life
Sciences, Inc.) was added and the mixture incubated
for 30 min. at 43°C. The reaction was stopped by
the addition of EDTA to 20 mM, extracted with
phenol-cresol, and concentrated by ethanol precipi-
tation. The yield of the first strand synthesis, as
assayed by TCA-insoluble radioactivity, was calcu-
lated to be 58.6 ng (1.7%).
(b) Second strand synthesis: ,
The cDNA-mRNA hybrid was resuspended in 5.8 micro-
liters H20. To this solution, 7.7 microliters of
the second strand synthesis mix was added to give a
solution containing 20 mM Tris-HC1, pH 7.5, 5 mM
MgCl2, 10 mM (NH4)2504, 100 mM KC1, 0.15 nM
beta-NAD, 50 ug/ml BSA, 40 mM dNTPs, 8.5 units/ml
of E. coli RNase H (Bethesda Research Labs), 230
Units/ml DNA polymerase I (Boehringer Mannheim), 10
units/ml E.coli DNA ligase (New England Biolabs).
The mixture was incubated for 60 min. at 12°C, then
for 60 min. at 22°C. The reaction was stopped by
addition of EDTA to 20 mM, and extracted with
phenol-cresol. The cDNA was separated from free
nucleotides by passage over a Sephadex G-50 fine
column in 10 mM TEAB. The yield from this reaction
was 107 ng of dscDNA (91%).
(~) Annealing and transformation
64 ng of dscDNA were tailed by addition of dGTP
using standard methods. The vector was prepared by
- 11
digestion of pBR322 DNA with EcoRV (New England-
Biolabs) and tailing with dCTP. 100 ng of tailed
BR322 DNA and 1.25 ng of tailed cDNA inserts
(ratio - 80:1) were annealed in 250 ul of O.O1M
Tris, pH 7.5, 1 mM EDTA, 0.15 M NaCl for 90 min. at
58°C, and transformed into competent E.coli RRI
cells. Transformed cells were plated on LB plates
containing 100 ug/ml ampicillin (Bristol Labs),
and incubated at 3?°C for 12 hours. A total of
3,200 colonies were generated for the IL-2 cDNA
library.
(3) Screenincr of cDNA library for.IL-2 gene seauences
To detect full-length cDNA copies of the IL-2 gene, a
synthetic deoxy-oligonucleotide probe was used which
corresponds to nucleotides 45-65 of the human IL-2 cDNA
sequence published by Taniguchi~ et al. (Nature 302,
305-310 [1983]). This probe [ACAATGTACAGGATGCAACTC] was
synthesized by the solid-phase phosphodiester method,
purified by HPLC, and labeled by using 32P-ATP (ICN
Pharmaceuticals, 7000 Ci/mM) and polynucleotide kinase
(New England Biolabs). Colonies representing the cDNA
library were transferred to nitrocellulose filters by
the method of Grunstein and Hogness (Methods in Enzymo-
logy 68, 379 [1979]). After hybridization at 30°C for
16 hours, filteres were washed in 4xSSC at 45°C for
45 minutes, dried, and autoradiographed. A single posi-
tive colony was detected and found to contain the entire
IL-2 coding sequence. This colony, designated pIL2-2B,
was used to prepare DNA for nucleotide sequence analysis
and for expression in E.coli. Nucleotide sequence analy-
sis showed it to be identical to that of the sequence
published by Taniguchi et al. with two differences:
pIL2-2B contains an insert which begins at nucleotide
17, as designated in the Taniguchi sequence, and has a
substation of a G at position 503.
.. ~~~OS~3
- 12 -
(4) Construction of the E.coli plasmidic vector containin
DNA coding for Ser-IL-2.
An E.coli expression vector for IL-2 was constructed
from three segments (see Fig. 4): (1) the vector pRC23,
with the lambda PL promoter, (2) a synthetic adapter
molecule, and (3) a Hgi AI - Aha III fragment isolated
from the IL-2 cDNA. The vector DNA was prepared by
digestion of 50 ng of pRC23 DNA with EcoRI and EcoRV,
followed by phenol extraction and ethanol precipitation.
l0 The synthetic adagter molecule was obtained by annealing
two complementary synthetic deoxy-oligonucleotide
sequences, A and B:
(A) 5' AATTCAATTATGAGTGCA 3'
(B) 3' GTTAATACTC 5'
This double-stranded adapter can anneal to an EcoRI site
at its 5' end and to a HgiAI site at its 3' end. The
cDNA insert was prepared by digestion of pIL2-2B DNA
with the restriction enzyme BamHl (Bethesda Research
Labs), which releases the 1 kilobase IL-2 insert from
this clone. The BamHl fragment was gel-purified and
further digested with HgiAI (New England Biolabs) and
Aha III (New England Biolabs), then phenol-extracted and
ethanol precipitated. HgiAI cuts between the alanine and
proline codons at the beginning of the sequence coding
for mature IL-2. The cloning strategy for expression
uses the EcoRI site adjacent to the PL promoter in the
pRC23 vector. The synthetic adapter molecule can join
this EcoRI site in the vector to the HgiAI site at the
start of the cDNA IL-2 sequence. The adapter was desig-
ned to create the methionine codon for translation ini-
tation. Codons for serine and for alanine, the first
amino acid of mature IL-2, are created when the adapter
and the cDNA are ligated at the HgiAI site. The cDNA is
joined to pRC23 via blunt-end ligation of the AhaIII
site to the EcoRV site in the vector DNA.
M
- i3 -
Ligation of the three segments was performed in a volume
of 10 y.l which contained 0.05 pM each of the vector,
synthetic adapter and cDNA insert DNAs, 65 mM Tris, pH
7.6, 10 mM MgCl2, 0.5 mM ATP, and 15 mM beta-mercapto-
ethanol. The ligation mixture was heated at 65°C for
5 minutes, cooled to 4°C before addition of 200 Units of
T4 DNA ligase (New England Biolabs), then incubated at
4°C for 16 hours. The T4 DNA ligase was inactivated by
heating at 65°C for 5 minutes. Then the ligated DNAs
were digested with EcoRV to remove any undigested vector
DNA. The mixture was then used for transformation of
E.coli strain RRI (pRK248cIts), and these cells were
grown at 30°C for 15 hcurs.
The colonies were transferred to nitrocellulose filters
as described previously, baked, and hybridized with a
radioactive probe of 32P-labeled synthetic adapter
molecule A. One positive colony, designated pRC23/IL-2,
#4-1, was chosen for analysis. This clone was found to
synthesize more than 200,000 units/ml of IL-2 when the
PL promoter was induced to express at 42°C. The IL-2
activity was detected by bioassay on CTLL cells, an
indicator cell line for IL-2 (as described in Gillis et
al. J. Immunol. 120, 2027 [1978]).
(5) Construction of an E.coli ex ression vector for urodu-
cing mature IL-2 (with alanine as the first amino acid
at the amino terminus)
To express mature IL-2 in E.coli, the following strategy
(illustrated in Fig. 5) was followed. A HgiAI restric-
tion endonuclease site is located at the Ser-Ala junc-
tion, the cleavage site for the removal of the signal
peptide of IL-2 (Robb et al., PNAS, 80, 5990-5994
[1983]). Following digestion with HgiAI, the termini
were made blunt-ended by treating with T4 DNA poly-
merase. The resulting molecules were then blunt-end
ligated to a 108 by BglII-Hae III fragment isolated from
- 14 -
phage lambda DNA, digested with BglII and XbaI and
inserted between BglII and RbaI sites in the vector
pRC23/IL-2, #4-1. This intermediate cloning step was
included to ensure that the T4 DNA polymerase treatment
occurred as expected, which was confirmed by the crea-
tion of a new StuI site from the joining of the HaeIII
terminus to the blunt-ended HgIAI terminus. Redigesting
with StuI conveniently regenerates at this site the
blunt end beginning with the CCT proline codon. The
intermediate plasmid construction was designated
pRC201/I1-2. Two synthetic deoxyoligonucleotides were
designed which incorporate an ATG-translational initia-
tion codon, restore the alanine codon, and create an
EcoRI terminus. These oligomers were ligated to the
EcoRI terminus of the expression vector pRC23, digested
with PstI, and the resulting 1025 by fragment was gel
purified. The 1025 by (PstI to blunt-end) fragment was
inserted between the PstI site and the newly created
StuI site in pRC201/IL-2. Transformants containing the
expected construction were identified by restriction
analysis of the isolated plasmid DNA. The confirmed
plasmid construction was designated pRC233/I1-2 (see
Fig. 6).
Preferred host organisms for transformation by a vector
containing the gene for IL-2 in connection with the
present invention include bacteria such as strains of
E.coli; bacillaceae, such as Bacillus substillis and
the like. Yeasts form a further preferred group of
microorganisms for transformation.
A specifically preferred microorganism employed as the
recipient in the transformation procedures is Esche-
richia coli K-12 strain 294 as described in British
patent Publication No. 2055382A, deposited with the
American Type Culture Collection, ATCC Accession No.
31446, on October 28, 1978. However, also other known
13~.0~~3
- 15 -
E.coli strains such as E.coli RR1, ATCC Accession No.
31343, or other microorganisms many of which are deposi-
ted and available from recognized microorganism deposi-
tory institutions, such as the American Type Culture
Collection can be used as host organisms. In the prac-
tice of this invention overnight cultures of the trans-
formed E.coli are grown in LB broth at 30°C. One liter
of the overnight culture is preferably diluted to 10
liters with minimal M-9 medium containing casamino
acids. At logarithmic growth, the culture is shifted
from 30°C to 42°C to induce IL-2 production. Following
incubation at 42°C for 2-3 hours, the bacteria are
harvested by centrifugation. All fermentations and
procedures were performed in accordance with recombinant
DNA guidelines of the National Institutes of Health. The
purification steps are described in detail in the follo- -
wing Examples.
Example 1
One gram of IL-2 (having serine at the NH2 terminus)
producing transformed E.coli cells were suspended in 30 mM
Tris-HC1, pH 8.0, 5 mM EDTA, 1 mM phenylmethylsulfonyl
fluoride and lysed by sonification. The lysis mixture was
centrifuged at 14,000 x g for 15 minutes. The membrane
portion of the centrifuged lysate was then removed and iso-
lated from the other components of the lysate. The membrane
component was then subjected to the four washing or IL-2
extraction steps shown below in Table 1. Each wash solution
was used in an amount of at least 5 ml/gram of cells. The
bulk of the IL-2 activity was extracted in the final wash as
detailed in Table 1. The final resultant wash solution which
contained the bulk of the IL-2 activity and which was at
least about 50% pure as judged by SDS-PAGE, was then subjec-
ted to reverse phase HPLC (RP-C8). There was a 40-60% reco-
very of substantially 100% pure IL-2 (with serine at the
NH2 terminus). The IL-2 activity was found to be at least
<",, ,
*Trademark
-16 - ~3~0~~~
1 x loa u/mg.
Table 1
Extraction of IL-2 from E.coli membrans
Total Total IL-2 Specific
Protein Activity Activity
Extraction (mcr) units u/m
1M NaCl wash 0.4 mg 0.03 x 106 0.1 x 106
1% Triton wash 2 mg 0.75 x 106 0.4 x 106
1.75 guanidine-
HC1 wash 1 mg 1.5 x 106 1.5 x 106
7M guanidine-HC1
wash 4.7 mg 250 x 106 53 x 106
(99%)
252.3 x 106
Example 2
This example serves to demonstrate that IL-2 tends to
become associated with the membrane components of the trans-
formed E.coli host cells.
In order to demonstrate this, one gram of serine-NH2
terminus IL-2 producing transformed E.coli cells were sus-
pended in 10 ml of 20% sucrose, 30 mM Tris-HC1, pH 8.0, and
lysed using lysozyme-EDTA to separate proteins which are
localiced in the periplasmic space. The remainder of the
lysed mixture was then subjected to sonification. The mem-
brane portion (inner and outer membranes) was then separated
from the other cellular components by sucrose gradient cen-
trifugation with which the inner and outer membranes were
also separated. Table 2 shows that the majority of IL-2
activity was located in the inner cellular membrane.
_ 17 - ~3~O8~J
Table 2
Localization of IL-2 in E.coli cells
Total Total IL-2 Recovery of
Protein Activity IL-2
Fraction (mct) (units) [%~
Soluble Fraction 37 mg 2 x 106 0.3
Periplasmic
Fraction 2 mg 10 x 106 1.5
Outer Membrane 6 mg 8 x 106 1.2
Inner Membrane 15 mg 6.6 x 108 97
Example 3
One gram of mature IL-2 producing transformed E.coli
cells was suspended in 30 mM Tris-HC1, pH 8, 5 mM EDTA, 1 mM
phenylmethylsulfonyl'fluoride and lysed by sonification. The
lysis mixture was centrifuged at to 14,000 x g for 15 minu-
tes. The membrane portion of the centrifuged lysate was iso-
lated from the other components of the lysate. The membrane
portion was then subjected to the four washing or IL-2
extraction steps shown below in Table 3. Each wash solution
was used in an amount of at least 5 ml per each gram of
cells. The bulk of the IL-2 activity was finally extracted
in the final wash as detailed in Table 3. The final resul-
tant wash solution which contained the bulk of the IL-2
activity and which was at least 50% pure as judged by SDS-
-PAGE, was then subjected to reverse phase high performance
liquid chromatography (RP-C8). The recovery of substantially
100% pure mature IL-2 was about 60%. The IL-2 activity was
found to be approximately 4 x 108 U/mg.
- 18 -
Table 3
Extraction of Mature IL-2 from E.coli membrane
Total Total IL-2 Specific
Protein Activity Activity
Extraction (ma) (units) _ (u/mcr)
1M NaCl wash 0.5 0.3 x 106 0.6 x 105
1% Triton wash 3.3 5.5 x 106 1.7 x 106
1.75M guanidine-
HC1 wash 2.5 10.0 x 106 4.0 x 106
7M guanidine-HC1
wash 10.1 779 x 106 77.1 x 106
(98%)
794.8 x 106
Example 4
The following example illustrates the purification of
mature IL-2 from transformed E.coli paste utilizing a
Procion Red Agarose chromatographic step in addition to HPLC.
Membrane Extraction of Cells
Frozen E.coli cells (containing the plasmid for human
IL-2) are thawed and 1 gm is added to 5 ml of Buffer A
(0.03 M Tris-HC1, pH 8.0, 0.005 M EDTA). After mixing
10 minutes, the cells are removed by centrifugation in a
Sorval SS-34 rotor (10,000 rpm for 10 minutes). The superna-
tant is removed and the cells resuspended in 5 ml Buffer A.
The suspended cells are broken with a Branson Cell Disruptor
350 (sonicator) (6 x 30 sec). The broken cells are centri-
fuged (10,000 rpm for 10 minutes) and the supernatant con-
taining the soluble proteins is discarded. The residue is
washed once with 5 ml Buffer A and centrifuged (10,000 rpm
for 10 minutes). The residue containing the membrane frac-
Lion is suspended in Buffer B (1 M NaCl, 0.03 M Tris-HC1, pH
8.0, 0.005 M EDTA) with a Wheaton Dounce tissue homogenizes.
After mixing 10 minutes, the membrane fraction is removed by
._ 13~08~~
- 19 -
centrifugation in a Sorval SS-34 rotor (15,000 rpm for
minutes). The residue is suspended in 5 ml Buffer C (1%
Triton X-100, 0.03 M Tris-HC1, pH 8.0), homogenized, mixed
and centrifuged (15,000 rpm for 10 minutes). The centrifuged
5 residue is suspended in 5 ml of 1.75 M guanidine-HC1, homo-
genized, mixed and centrifuged (15,000 rpm for 10 minutes).
The residue is washed once with 5 ml Buffer A and centrifu-
ged. The membrane fracticn (residue) is extracted with 5 ml
of 7 M guanidine-HC1. After centrifugation, the extract con-
10 taming the IL-2 is saved and the residue is extracted a
second time with 5 ml of 7 M guanidine-HC1. This extract is
also Saved.
Chromatoaraphy on Procion Red Aq_arose
The column is set up at room temperature and washed with
two volumes of 7 M guanidine-HC1 before using the first
time. The column is equilibrated with equilibration buffer
(0.01 M Tris-HC1,'pH 7.9, 0.035 M NaCl) at 4°C. At least
1 ml of Procion red agarose should be used for each 100 y.g
of IL-2 expected. The flow rate is 2 bed volumes per hour.
The 7 M guanidine-HC1 extract containing the IL-2 is diluted
40-fold with equilibration buffer and the precipitate remo-
ved by centrifugation. The supernatant is then loaded on the
column. The column is washed with two column volumes of
equilibration buffer. The IL-2 is eluted in a peak after
1.5-2 volumes of elution buffer (0.01 M Tris-HC1, pH 7.9,
1.035 M NaCl). After the IL-2 has been removed, the column
is rid of extraneous materials by washing with 6M guani-
dine-HC1.
Chromatocrraphy on RP-P (C-18)
The pH of the Procion red eluate is adjusted to 7 with a
slow addition of 1.0 M acetic acid. Aliquots of 0.1 ml each
are removed for assay purposed before and after pH adjust-
ment. The neutralized eluate (60 mi) is pumped with
1 ml/min. onto a 0.31 x 25 cm RP-18 column, equilibrated
with an equilibration buffer mixture consisting of 5% HPLC-
13~.08~~
- 20 -
-Buffer II and 95% HPLC-Buffer I. Column flowthrough is
collected and assayed for protein content and IL-2 bioacti-
vity. The column is eluted at room temperature according to
the gradient profile outlined in Table 4. The effluent is
monitored at 220 nm and 1.5 ml fractions are collected and
assayed for protein content and IL-2 activity. The peak of
maximum IL-2 activity elutes at ca. 74% HPLC-Buffer II (59%
acteonitrile). Fractions are stored at 4 to 8°C and are
pooled according to specific activity.
Table 4
Conditions for the chromatography of a typical
Procion-red eluate on an RP-18 column
Sample Load: 60 ml
Column Dimensions 0.41 x 25 cm Flow Rate: 1 ml/min
HPLC Buffer I: - 0.01 M phosphoric acid, 0.05 M
lithium chloride
HPLC-Buffer II: 0.01 M phosphoric acid, 0.05 M
lithium chloride, 80% acetonitrile
% HPLC-Buffer II Duration (min)
Equilibration 5 20
Sample load - 60
Wash 5 15
Step 1, gradient 5 to 35 15
Step 2, gradient 35 to 85 50
Step 3, constant 85 5
Step 4, constant 5 5
All chromatographic steps are carried out at room tempe-
rature.
