Note: Descriptions are shown in the official language in which they were submitted.
- 1 -
10 RECOMBINANT 2,5-DIKETOGLUCONIC ACID
REDUCTASE PRODUCTION
Background
~ 34' 08 5
The invention herein concerns aspects of a process for
the production of ascorbic acid. It specifically relates to
purification of a useful protein, to production of proteins
using recombinant techniques and to the use of such proteins
in chemical conversions. More particularly, the invention
relates to purification of and recombinant production of 2,5-
diketogluconic acid (2,5-DKG) reductase and the use of the
reductase so pr~~duced in converting 2,5-DKG stereoselectively
into 2-keto-L-gluconic acid (2 KLG), as well as to the
production of a single recombinant organism capable of
synthesizing 2-:KLG. The 2-KLG produced is a useful
intermediate in the production of ascorbic acid (Vitamin C).
Ascorbic acid has become a major chemical product in
the United States, and elsewhere in the world, due to its
importance in health
a
-2- 1 3 4 1 0 8 5
maintenance. While there may be some controversy over its efficacy
in ameliorating the tendency of individuals to contract certain
minor illnesses, such as, for example, the common cold, there is no
doubt that it is essential for human beings to ingest required
amounts of vitamin C. It has become ~; matter of concern in recent
years that "natural" foods may not provide adequate amounts of
vitamin C. Accordingly, there has developed a large demand for
ascorbic acid, both as an additive to foods which are marketed to
the consumer with supplemented levels of this vitamin, and as a
direct vitamin supplement. Furthermore, ascorbic acid is an
effective' antioxidant and thus finds applications as a preservative
both in nutritional and in other products.
There are a number of processes available, some commercially
viable, for the production of vitamin C. Several of these result in
the preliminary production of 2-keto-L.-gulonic acid (2-KLG) which
can then be rather simply converted to ascorbic acid through acid or
base catalyzed cyclization. Accordincily, 2-KLG has become, in
itself, a material of considerable economic and industrial
importance.
Means are presently available in t:he art to convert relatively
plentiful ordinary metabolites, such a.s, for example, D-glucose,
into 2,5-diketogluconic acid (2,5-DKG) by processes involving the
metabolism of prokaryotic microorganisms. See, for example, U.S.
Patent 3,790,444 (February 5, 1974); ?.,998,697 (December 21, 1976);
and EPO Application Publication No. 0046284 published February 24,
1982. The availability of this 2,5-DKG intermediate offers a
starting material 'which is converted t:o the desired 2-KLG only by
the single step of a two electron reduction. The reduction can be
effected chemically or catalyzed enzymatically. Various bacterial
strains are known which are capable of effecting this reduction.
Such strains are found in the genera Brevibacterium, Arthrobacter,
Micrococcus, Staphylococcus, Pseudomonas, Bacillus, Citrobacter and
Corynebacterium. See, for example, U.S. 3,922,194 (November 25,
3 1 341 08 5
1975), U.S. 4,245,049 (January 13, 19~~1) and U.S. 3,959,076 (May 25,
1976). Suc~~ strains have indeed been used to effect this reduction;
however, use of such strains per se arid without enzyme purification
does not permit certain alternative approaches available with the
use of purified enzyme. Such a system would permit, for example,
continuous production through immobilization of the enzyme on a
solid support. Further, access to the genetic machinery to produce
such an enzyme is of convenience making improvements in carrying out
this process since this machinery may be manipulated and localized
to achieve production of the enzyme at a site most convenient for
the conversion of 2,5-DKG. Most important among such loci is a site
within the same organism which is capable of effecting the
production of 2,5-~DKG. Thus, a single organism would be able to use
its own machinery to manufacture the ?_,5-DKG, and then convert this
endogenous 2,5-DKG in sii~u into the desired product, using the
2,5-DKG reductase gene and appropriate control sequences to produce
the catalyst.
It is helpful to undE~rstand the context into which the present
2p invention finds uJ:ility, by representing the process in terms of the
relevant chemical conversions. An outline of a typical overall
process for manuf<icture of ascorbic acid is shown in Reaction
Sc heme 1.
0
It
CHO CI70H COON COOH COOH C
-C-OH -C-OH C=0 C=0 ~=0 HO-~
HO-C- HO-C- HO-C- HO-C- HO-C- HO-C 0
1 t I t 1 1~
-C-OH ' -C-OH ~ -C-OH
' -C-OH ' -C-OH
' C
s I 1 1 t
-C-OH -C-OH -C-OH C=0 HO-C- HO-C
CH20H CH20H CH20H CH20H CH20H CH20H
D-glucose D-gluconic2-Keto-D- 2,5-diketo-D- 2-keto-L-ascorbic
acid gluconic gluconic gulonic acid
acid acid acid
4 ~1 341 08 5
Reaction Scheme 1
The process conveniently begins i~ith a metabolite ordinarily
used by a microorganism such as, for example, D-glucose which is the
illustration chosen for Reaction Scheme 1. Through enzymatic
conversions, the D-glucose undergoes a. series of oxidative steps to
give 2,5-diketo-D-gluconic acid. It has been shown that this series
of steps can be carried out in a single organism. (U. S. Patent
3,790,444, EPO Appl. A20046284 (supra); such organisms are, for
example, of the genus Gluconobacter, A,cetobacter or Erwinia).
Alternate preparations of ascorbic acid have circumvented the
2,5-DKG intermediate by a combination of fermentative and chemical
oxidations, and are clearly more cumbersome than the process shown.
Typical of these is the Reichstein synthesis which utilizes
diacetone-2-keto-L-gulonic acid as a precursor to ~-KLG. This
intermediate is generated through a se~ies of reductive and
oxidative steps involving fermentation, hydrogenation, and, e.g.,
permanganate oxidation, and the required sequence is clearly more
complex than that involved in the reactions shown. The conversion
of 2,5-DKG into 2-KLG can also be carried out enzymatically (U. S.
Patent 3,922,194; 3,959,076 (supra); a.nd 4,245,049 (Jan. 13, 1981)).
h1eans are presently well known in the art to convert the
resulting 2-KLG into ascorbic acid. This may be done either in the
presence of dilute acid and heat according to the method of
Yamazaki, or in a two-step process utilizing preliminary
esterification in methanol, followed t~y lactonization in base.
Effective procedures are described in Crawford, T.C., et al.,
Advances in Carbohydrate Chemistry and Biochemistry, 37, 79-155
(1980). These alternatives are straightforward and take advantage
of the greater stability and shelf life of 2-KLG over ascorbic
acid. Thus, it is more desirable and convenient to stockpile the
2-KLG intermediate for subsequent conversion to the desired final
product than to synthesize the ascorbic acid directly.
p'_ -5- 1 341 08 5
Because of the improvements of the present invention, alternate,
superior means are available to effect: certain aspects of this
overall conversion. In one approach, because the enzyme responsible
for the conversion of 2,~> DKG into 2-t;LG has been isolated and
purified, the reduction step can be carried out under more
controlled conditions, including those whereby the enzyme is
immobilized and the solution substrates are fed continuously over
the immobilized catalyst. In addition, the availability of
recombinant techniques makes possible the production of large
amounts of such enzyme available for ready purification. Further,
recombinant techniques permit the coding sequences and necessary
expression control mechanisms to be transformed into suitable host
organisms with improved characteristics. Thus, simply focusing on
the conversion of 2,5-DKG to 2-KLG, three levels of improvement are
attainable: 1) si:ricter control over variables; 2) availability of
continuous processing; and 3) selecti~~n .of host organism for the
enzyme which has desirable qualities pertinent to the reduction
reaction.
2p The scope of -improvement permitted by the effective cloning and
expression of the 2,5-DKI; reductase is, however, even broader.
Because of the availability of the appropriate genetic machinery, it
is possible, as well as desirable, to transform an organism which is
capable of producing the 2,5-DKG with the gene encoding the
reductase. Thus, the same organism can effect the entire process of
converting, for example, glucose or other suitable metabolite into
the stable, storable intermediate 2-KLG.
Summary of the Invention
The present invention effects dramatic improvements in the
process for converting a commonly available metabolite such as
glucose into 2-KLG, a stable storable precursor for ascorbic acid.
The pathway of the process described by the present invention
-5- 1 34 1 08 5
encompasses the step of converting ?,5-Df;G into 2-KLG. The current
processes for formation of the 2-KLG intermediate involve, at best,
the deployment of at least two organisms or killed cultures thereof,
do not permit regulation of the enzyme levels available, and are
limited to batchwise processes.
A major aspect of the present invention is a process for
preparing 2,5-DKG reductase in substantially pure form by a series
of chromatographic steps resulting in a homogeneous (by HPLC)
product. Further facets of this aspect of the invention include the
purified enzyme itself and the use of this purified enzyme in the
conversion of 2,5-DKG to 2-KLG. Such conversion may, preferably, be
carried out using the enzyme in immobilized form.
Another major aspect of the invention is a process for the
construction of a recombinant expression vector for the production
of 2,5-DKG reductase. Other facets of this aspect include the
expression vector so produced, cells and cell cultures transformed
with it, and the product of such cells and cell cultures capable of
effecting the reduction of 2,5-DKG stereospecifically to 2-KLG.
Still another facet of this aspect of the invention is a process for
converting 2,5-Dt:G to 2-KLG using recombinant reductase.
Finally, the invention also relates to a process for converting
glucose or other ordinary microbial metabolite into 2-KLG by
fermentation by a single recombinant organism, and thereafter to
ascorbic acid. It also relates to the recombinant organism capable
of carrying out this process. Such an organism is conveniently
constructed by tra~nsformi~ng a host cell capable of effecting the
30' conversion of the initial metabolite to 2,5-DKG with an expression
vector encoding and capable of expressing the sequence for the
2,5-DKG reductase. Alternatively, such a recombinant organism is
constructed by transform ing an organism already producing the
2,5-DKG reductase with vectors encoding the enzymes responsible for
the oxidation of metabolite to 2,5-DKG. In either event, use of
_,_
1 341 08 5
proper inducible F~ror~oters and control' systems within the
construction of the exare~ssion vectors permit the regulation of
enzymatic levels t:o optimize the rate at which the desired
conversion steps take place.
Brief Description of the Drav;inas
Figure 1 shows an exF~ression vector for the 2,5-DKG reductase
gene.
Figures 2 and 3 show the construction of an alternative
expression vector for the 2,5-DKG reductase gene.
Figure 4 shows a sequence including the 2,5-GKG reductase gene
and control regions of the pTrpl-35 expression vector.
Figure 5 shovrs a stained gel of a protein extract from Erwinia
herbicola (ATCC 21998) transformed wii:h the 2,5-DKG reductase
expression vector having the sequence of Fig. 4.
Detailed Description
A~ Definitions
As used herein, "2,5-~DKG reductasE~" refers to a protein which is
capable of catalyzing the conversion of 2,5-DKG stereoselectively to
2-KLG. In the specific example herein, the particular form of this
enzyme present in Corynebacterium was purified, cloned, and
expressed. However, other bacterial species, such as, for example,
those from the genera Brevibacterium, Arthrobacter, hlicrococcus,
Staphylococcus, Ps.eudomonas, Citrobaci:er, and Bacillus are also
known to synthesize an enzyme with the same activity as this
enzyme. These genera are illustrative of potential sources for an
-
1 341 ~8 5
enzyme similar to that present in Corynebacterium which may be
available to catalyze this conversion. Alternate sources in
addition to these naturally occurring ones in the prokaryotic
kingdom may well be found. In addition, as the invention herein
discloses and makes available the genetic sequence encoding such
enzymes, modifications of the sequence which do not interfere with,
and may, in fact, improve the performance of this enzyme are also
available to those knowledgeable in the art. Such modifications and
altered sequences are included in the definition of 2,5-DKG
reductase as used in this. specification. In short, the term 2,5-DKG
reductase has a functional definition and refers to any enzyme which
catalyzes the conversion of 2,5-DKG to 2-~:LG.
It is well understood in the art that many of the compounds
discussed in the instant specification, such as proteins and the
acidic derivatives; of sac:charides, may exist in variety of
ionization states depending upon their surrounding media, if in
solution, or on the solui:ions from which they are prepared if in
solid form. The use of a term such a>, for example, gluconic acid,
to designate such molecules is intended to include all ionization
states of the organic molecula referrE~d to. Thus, for example, both
"D-gluconic acid" and "D-gluconate" refer to the same organic
moiety, and are not intended to specify particular ionization
states. It is well known that D-gluconic acid can exist in
unionized form, or may be availabla as, for example, the sodium,
potassium, or other salt,. The ionized or unionized form in which
the compound is pe rtineni: to the disclosure will either be apparent
from the context i:o one :>killed in the art or will be irrelavent.
Thus, the 2,5-DKG reductase protein itself may exist in a variety of
ionization states depending on pH. A'11 of these ionization states
are encompassed by the tE~rm "2,5-DKG reductase".
Similarly, "cE~lls" and "cell cultures" are used interchangeably
unless the context: makes it clear that one or the other is referred
to. Transformation of cells or.of a cell culture amounts to the
-9- 1 3 4 1 8 8 5
same activity; it is clear, of course, that it is the organisms
themselves which take up the transforming material although it is a
culture of them that is treated v;ith t:he cloning vehicla or other
transforming agent. The cells and microorganisms of this invention
are defined to include any bacterial, or prokaryotic, organism.
"Expression vector" includes vectors which are capable of
expressing DtJA sequences contained therein where such sequences are
operably linked to other sequences caFable of effecting their
expression. It is implied, although not explicitly stated, that
expression vectors must be replicable in the host organisms either
as episomes or as an integral part of a chromosomal DtJA; clearly a
lack of replicability would render them effectively inoperable. In
sum, "expression vector" is also given a functional definition.
generally, expression vectors of utility in recombinant techniques
are often in the form of "plasmids," which term refers to circular
double stranded DNA molecules which, in their vector form, are not
bound to the chromosome. Other effective vectors commonly used are
phage and non-circularized DNA. In the present specification,
~~Plasmid" and "vector" are often used interchangeably; however, the
invention is intended to include such other forms of expression
vectors which serve equivalent functions and which are, or
subsequently become, known.
"Recombinant cells" refers to cells which have been transformed
with vectors constructed using recombinant DNA techniques. "Host"
cells refers to such cells before they have been transformed. In
general, recombinant cells produce protein products encoded by such
recombinant vectors and which they would not ordinarily produce
30~ without them; however, the, definition also includes cells which have
been transformed with vectors encoding proteins which are,
coincidentally, encoded in the bacterial chromosome or otherwise
endogenously expressed in the recipient cell. The definition
includes any cell which is producing the product of a xenogeneic
sequence by vi rtue of recombinant tech;ni ques.
-l0 1 3 4 1 8 8 5
"Ordinary metabolite" refers to such carbon sources as are
commonly utilized by bacteria for growth. Examples of such
metabolites are glucose, galactose, lactose, fructose or other
carbohydrates which are readily available foodstuffs for such
organisms. Such metabolites are defined herein to include enzymatic
derivatives of such foodstuffs which are convertible into
2,5-diketo-D-gluconic acid. Such derivatives include D-gluconic
acid, D-mannonic acid, L-gulonic acid., L-idonic acid,
2-keto-D-gluconic acid, 5-keto-D-gluconic acid, and
5-keto-D-mannonic acid.
B. General Description of Preferred Embodiments
B.1 Preparation of Substantially Pure 2,5-DKG Reductase
A preferred genus from which an organism is selected for
preparation of pure 2,5-D~KG reductase is Corynebacterium. However,
bacterial taxonomy is sufficiently uncertain that it is sometimes
difficult to ascertain the correct designation between related
9e~era. However, many of those speciE~s which have been found to
contain the reductase are members of i:he coryneform group, including
the genera Corynebacterium, Brevibacterium, and Arthrobacter; hence
it appears by virtue of present knowledge that the preferred source
for the enzyme is a member of the coryneform group.
In a preferred mode of preparation, the cell culture is
grown under suitable conditions dependent on the strain of bacterium
chosen, to an OD550 of about 20 or greater. The culture is then
centrifuged and the resulting cell paste (pellet) is treated to lyse
30~ the cells. This paste is.preferably washed, preliminarily, in
buffer solution to remove contaminating medium, and the washed
pellet treated with, for.example, lysozyme, or by sonication, or by
mechanical means t.o break open the cells. The resulting extracts
are then subjected to purification by ion exchange chromatography,
Preferably using a cellulose based support for an anion exchanger
-11- 1 3 4 1 0 8 5
such as, for example, DEAE cellulose. Other anion exchange resins, such as,
for
example, QAE or DEA,E sephadex* of course may also be used. Elution is
accomplished by means known in the art, typically, and preferably by
increasing the
ionic strength of the eluting solution by increasing the concentration of
dissolved
salts, preferably sodiurn chloride. The fraction of eluate containing 2,5-DKG
reductase activity is them further purified by adsorption onto an affinity
chromatographic support -- i.e., a support system to which it is covalently
bound, a
dye, or other organic li;gand which is similar to the enzyme substrate or its
cofactor.
If the solution to be treated with the affinity support contains substantial
amounts of
solutes, a preliminary dialysis is desirable. A pa~~icularly effective
affinity
chromatography support is Amic~on MatrexR gel blue A which exhibits an
affinity
for enzymes utilizing 1\IADH or NADPH. Elution from such columns may be
accomplished by increasing the concentration in the eluting solution of the
material
for which the enzyme exhibits an affinity, in this case NADP. Fractions
containing
the desired DKG reductase activity are then pooled for recovery of the pure
protein.
The specific activity of the pure protein is greater than 5 units/mg.
Final verification of purification is achieved by size separation using, for
example, sephadex gels, polyacrylamide gels, or TSK sizing gels using HPLC.
For the enzyme contained in Co ..rynebacterium sp ATTC 31090, separation by
the
TSKlHPLC method results in a peak corresponding to molecular weight 45,000
containing the entire complement of activity. However, when the enzyme is
subjected to SDS-PAGE, either under reducing or non-reducing conditions, the
protein migrates corresponding to a MW of 34,000. Additional characteristics
of
the protein of this preferred embodiment are given in Example 2.
In summary, the; purification of the enzyme involves the steps of cell lysis,
3 0 anion exchange chromatography, affinity chromatography and verification by
size
separation. With the
* Trade mark
1 341 88 5
-12-
exception of cell lysis, the steps may be performed in any
convenient order, and thEr transition between steps monitored by
assaying the activity according to the procedure in Example 2.
6.2 Conversion of 2,5-Df;G into 2-E;LG Usina Purified Enzyme
The conversion may be carried out with the purified enzyme
either in solution, or, preferably, in im;nobilized forn. As the
desired reaction is a reduction, a source of reducing equivalents is
required; the enzyme is specific for P~ADPH, and thus at least a
catalytic amount of the coenzyme must be present and the reduced
form constantly regenerated during the process. Sources of
electrons for the reduction of the coE~nzyme may be provided by any
reduced substrate in contact with an enzyme for its oxidation, such
as, glucose/glucos:e dehydrogenase; fo rmate/formate dehydrogenase; or
glutamate/glutamat:e dehydrogenase. The considerations in choosing a
suitable source of reducing equivalen~s include the cost of the
substrate and the specificity of the oxidation catalyzing enzyme
which must be compatible with the NADP requirement of the purified
2,5-DKG reductase. Other systems for regenerating NADPH cofactors
are known in the a.rt using, for example H2 as the source of
reducing equivalents and lipoamide dehydrogenase and hydrogenase or
ferredoxin reductase and hydrogenase as catalysts, as described by
along, C.H. et al. J. Am. Chem. Soc., :103: 6227 (1981). Additional
systems applicable to large scale processes are described by
Light, D., et al. 1983 in "Organic Chemicals from 8iomass",
D.L. Wise, ed., pp. 305-:358.
In a typical conversion, the starting solution will contain
30~ 2,5-DKG in the concentration range of about 1-200 g/L preferably
around 10-50 g/L arith thE~ pH of the medium controlled at about
5-7.5, preferably around 6.4. The pH may be maintained using
suitable buffers such as, for example, phosphate buffer. The
temperature range is about 15°C to 37"C, preferably around 25°C.
The concentration of reducing cofactor NADPH typically around
-13- 1 341 08 5
0.001 mM to 2 mM, preferably around 0.01-0.03 mtd with sufficient
source of reducing equivalents to maintain such concentrations
during the reaction.
If the enzyme is supplied in solution, its concentration is
of the order of 10 mg/L of substrate medium, although, of course,
the preferred concentration used vrill be depehdent upon the desired
rate of conversion and the specific enzyme chosen. If immobilized
enzymes are used, the above-described substrate solution is passed
over a solid support containing adsorbed or covalently bound 2,5-DKG
reductase. Ideally, the solid support nnill also contain a suitable
catalyst as described above for conversion of the source of reducing
equivalents in amounts sufficient to rnaintain the concentration of
~ADPH in the solution. for example, 'the solution in a typical
conversion Will contain am approximatcaly equimolar amount of
glucose, formate, glutamate or dissolved hydrogen to the 2,5-DKG
concentration and the solid support will contain sufficient reducing
catalyst to recycle continuously the tdADP formed by the desired
conversion to 2-KLG.
B.3 Cloning and Expression of 2, ti-DKG Reductase
Both the availability of large amounts of purified 2,5-OKG
reductase and its ability to be generated in situ in an organism
which makes 2,5-DK.G is greatly aided by the process of the invention
vrhich provides a means for cloning and expression of the gene for
the reductase enzyme. The general procedure by which this is
accomplished is summarized as follows" and a specific example of
such procedures is outlined herein below in Example 3.
The gene encoding 2,5-DKG reductase is cloned in either
plasmid or phage vehicles from a genomic library created by
partially digesting high molecular weight DtdA f tom Corynebacterium
or other suitable source using a restriction enzyme. For 2,5-DKG
reductase, a suitable restriction enzyme is Sau 3A. (Alternatively,
'_' -1 ~+-
1341085
a limit digest with a restriction enzyme having greater specificity,
such as BamHI or _Ps_tI, may be used.) 'The restriction digest is then
ligated to either plasmid vectors replicable in suitable bacterial
hosts, or into phade sequences capable of propagation in convenient
bacterial cultures., The a~esulting plasmid and phage libraries are
then screened using probes constructed based on the known partial
sequence of the 2,'.>-DKG rE~ductase protein (See Example 2). The
efficiency of probe design may be improved by selecting for probe
consf ruction those codons ~~rhich are known to be preferred by
bacterial hosts. identification of the desired clones from the
plasmid.~nd phage i,ibraries is best effected by a set of probes such
that the desired gene will hybridize to all of the probes under
suitable stringency conditions and false positives from the use of
only one probe elirninated. Upon recovery of colonies or phage
successful in hybridizing with the oligonucleotides provided as
probes, identity of the sequence with the desired gene is confirmed
by direct sequencing of the DNA and by in vivo expression to yield
the desired enzyme..
The complete functional gene is ligated into a suitable
expression vector containing a promoter and ribosome binding site
operable in the host cell into which the coding sequence will be
transformed. In tine current state of the art, there are a number of
promotion/ control systems and suitable prokaryotic hosts available
which are appropriate to the present invention. Similar hosts can
be used both for cloning .and for expression since prokaryotes are,
in general, preferred for cloning of D1JA sequences, and the method
of 2-KLG production is most conveniently associated with such
microbial systems. E. coli K12 strain 294 (ATCC No. 31446) is
particularly useful as a cloning host. Other microbial strains
30~
which may be used include E. coli strains such as E. coli B, E. coli
X1776 (ATTC No. 31537) and E. coli DH-1 (ATCC No. 33849). For
expression, the aforementioned strains, as well as E. coli 4!3110
(F-, a-, prototrophic, ATTC No. 27325), bacilli such as Bacillus
subtilus, and other enterobacteriaceaE~ such as Salmonella
-15- 1 341 08 5
typhimurium or Serratia _marcesans, and various Pseudomonas species
may be used. A particularly preferred group of hosts includes those
cultures which are capable of converting glucose or other commonly
available metabolite to 2,5-DKG. Examples of such hosts include
Erwinia herbicola ATTC No. 21998 (also considered an Acetomonas
albosesamae in U.S. Patent 3,998,697); Acetobacter melanoaeneum, IFC
3293, Acetobacter cerinus_, IFO 3263, a;nd Gluconobacter rubiainosus,
IFO 3244.
In general, plasmid expression or cloning vectors
containing replication and control sequences which are
derived from
species compatible with t:he host cell are used in connection
with
these hosts. The vector ordinarily c<irries a replication
site, as
well as marking sequences: which are capable of providing
phenotypic
selection in transformed cells. For c=_xample, E. coli
is typically
transformed using pBR322" a plasmid derived from an E.
coli species
(Bolivar, et al., Gene 2.. 95 (1977)). pBR322 contains
genes for
ampicillin and tet:racycliine resistance and thus provides
easy means
for identifying transformed cells. For use in expression,
the
pBR322 plasmid, or other microbial pl~asmid must also
contain, or be
modified to contain, prornoters which can be used by the
microbial
organism for expression of its ovm proteins. Those promoters
most
commonly used in recombin ant DNA construction include
the
s-lactamase (penicillinaae) and lactose promoter systems
(Chang
et al, Nature, 27~i: 615 (1978); Itakura, et al, Science,
198: 1056
(1977); (Goeddel, et al Nature 281: 544 (1979)) and a
tryptophan
_ (trp) promoter system (Goeddel, et al, Nucleic Acids Res.,
8: 4057
(1980); EPO Appl Publ No. 0036776). k~hile these are the
most
commonly used, otiner microbial promoters have been discovered
and
utilized, and details coincerning their nucleotide sequences
have
been published, enabling a skilled worker to ligate them
functionally in operable relationship to genes in transformation
vectors (Siebenli:;t, et al, Cell 20: 269 (1980)).
1 341 08 5
-16-
By suitable cleavage and ligation of DNA sequences included
in the aforementioned vectors and promoters with gene sequences
prepared as outlined above encoding 2.,5-DKG reductase, and by
deleting any unnecessary or inhibitory sequences, prokaryotic host
cells are transformed sv as to be caused to produce the enzyme. The
enzyme may then either be purified as outlined above, the intact or
broken cells used directly as catalysts, or, alternatively, the host
may be chosen so that once transformed it is capable of effecting
the entire conversion of glucose or other suitable metabolite to the
desired 2-KLG product.
B.4 Conversion of Glucose or Other Metabolite to
2-KLG by a Single Recombinant: Organism
The availability of recombinant techniques to effect
expression of enzymes in foreign hosts. permits the achievement of
the aspect of the invention which envisions production of 2-KLG in a
single host organism from a readily available metabolite. This
method has considerable advantage over presently used methods in
that a single viable organism fermentation is substituted for two
fermentations, and there is at least a partial balance of the
oxidizing and redu~~ing equivalents required for this conversion. At
present there is no naturally occurring organism which is kno~m to
be capable of catalysis of this entire sequence of steps.
Organisms are, however, known which effect the conversion
of glucose or other ordinary metabolic substrate, such as, for
example, galactose or fructose into 2,5-DKG. Another group of
organisms is known which effects the conversion of the 2,5-DKG into
2-KLG, the latter conversion, of course, being catalyzed by a single
enzyme within that organism, but utilizing the power of that
organism to supply reducing equivalents.
One approach to producing a single organism conversion that
is included in this invention comprises construction of an
-m- 1 341 08 5
expression vector for 2,5-DKG reductase as outlined above, and
transformation of this vector into ce'ils which are capable of the
initial conversion of ordinary metabolites into the 2,5-DKG
substrate for this enzyrne. As outlined in Example 3 below, this
transformation results in a single organism 2-KLG factory. The
details of the vector construction, transformation, and use of the
resultant organism in the transformation are outlined in the herein
specification.
An alternative approach is to clone and express the genes
encoding..the enzymes known to effect t;he conversion of glucose or
other ordinary metabolite to 2,5-Df;G from the organisms known to
contain them (as enumerated above) to construct expression vectors
containing these cloned gene sequences, and using such vectors
~5 transform cells which normally producE~ the reductase. A third
approach is to transform a neutral host with the entire sequence of
enzymes comprising the ordinary metabolite to 2-KLG scheme. This
last approach offers the advantage of choice of host organism almost
at will, for whatever desirable growth characteristics and
20 nutritional requirements it may have. Thus, the use as host cells
of organisms which have the heritage of a reasonable history of
experience in their culture and gro~rth, such as _E. coli and
Bacillus, confers the advantage of uniformity with other procedures
involving bacterial production of enzymes or substrates.
Once the organism capable carrying out the conversion has
been created, the process of the invention may be carried out in a
variety of ways depending on the nature of the construction of the
expression vectors for the recombinant. enzymes and upon the growth
characteristics of the host. Typically, the host organism will be
grown under conditions which are favorable to production of large
quantities of cells and under conditions which are unfavorable for
the expression of any foreign genes encoding the enzymes involved in
the desired conversion. When~a large number of cells has
accumulated, suitable inducers or derepressors are added to the
~ 341 ~8 5
medium to cause the promoters supplied with such gene sequences to become
active
permitting the transcription and translation of the coding sequences. Upon
suitable
expression of these genes, and hence the presence of the desired catalytic
quantities
of enzyme, the starting material, such as glucose, is added to the medium at a
level
of 1-500 g/L and the culture maintained at 20°C to about 40°C,
preferably around
25-37°C for several hours until conversion to 2-KLG is effected. The
starting
material concentration may be maintained at a constant level through
continuous
feed control, and the 2-KLG produced is recovered from the medium either
batchwise or continuously by means known in the art.
C. General Metho~Js Employed in the Invention
In the examples below, the following general procedures were used in
connection with probe construction, screening, hybridization of probe to
desired
material and in vector construction.
C.1 Probe Preparation
Synthetic DNA probes were prepared by the method of Crea, R. and Horn,
T., Nucleic Acids Res., 8: 2231 (1980) except that 2,4,6-
triisopropylbenzenesulfonyl-3-nitro-1,2,4-triazole (TPS-NT) was used as
coupling
agent (de Rooij, J. et al, Rec. Tray. Chim. Pads-Bas, 98: 537 (1979)).
C.2 Isolation of Plasmids. Cleavage with Restriction Enz,
Plasmids were isolated from the identified cultures using the cleared lysate
method of Clewell, D.I3. and Helinski, Biochemistry 9: 4428 (1970), and
purified
by column chromatography on Biorad* A-50 Agarose. Smaller amounts (mini-
preps) were prepared using the procedure of Birnboim, H.C. Nucleic Acids
Research, 7:1513(1979).
* Trade mark
.~ . _
.- -19_ 1 341 ~8 5
Fragments of the cloned plasmids were prepared for sequencing by
treating about 20 i~g of plasmids with 10 to 50 units of the
appropriate restriction enzyme or sequence of restriction enzymes in
approximately 600 i~l solution containing the appropriate buffer for
the restriction enzyme used for sequence of buffers); each enzyme
incubation was at 37°C for one hour. After incubation with each
enzyme, protein was removed and nucleic acids recovered by
phenol-chloroform extraction and ethanol precipitation.
Alternatively, plasmids were fragmented by DNAase I digestion in the
Presence of MnCl2 (Anderson, S. (1981). Nucleic Acids Res. 9,
3015) or.by sonication (D~eininger, P.L. (1983). Analyt. Biochem.
129, 216).
After cleavage, the preparation was treated for one hour at 37°C
~~ith 10 units Klenow DNA polymerase or T4 DNA polymerase in 100u1 of
K1 enow buffer ( 50mt~1 KPi , ~pH 7.5, 7mt~ MgC12, lmhl BME ) , contai ni ng
50 nmol dNTP. Protein was removed and nucleic acids recovered as
above, and the nucleic acids suspended in 40u1 of loading buffer for
loading onto 6 percent polyacrylamide gel, as described above, for
sizing. (Alternatively, fragments may be cloned direc-tly into an ~i13
vector. )
DtJA sequencing was performed by the dideoxynucleotide chain
termination method (Sanger, F. et al (1977). Proc. Natl. Acad. Sci.
USA 74, 5463) after cloning the fragments in an M13-derived vector
(Messing et al (19.81). Nucleic Acids Res. 9, 309).
C.3 Liaation Procedures
DNA fragments, including cleaved expression plasmids were
ligated by mixing the desired components (e.g. vector fragment cut
from 0.25 ug plasmid is mixed with insert cut from 1 ug of plasmid
in 20 ul reaction .mixture), which components were suitably end
tailored to provide correct matching, with T4 DNA ligase.
APProximately 10 units ligase were required for ug quantities of
'~' .' -20- 1 3 4 1 ~ 8 5
vector and insert components. The resulting plasmid vectors were
then cloned by transforming E. coli K12 strain 294 (ATCC 31446) or
DH-1 (ATCC 33849). The transformation and cloning, and selection of
transformed colonies, were carried out: as described belovr. Presence
of the desired sequence was confirmed by isolation of the plasmids
from selected colonies, and DNA sequencing as described above.
Preparation A
Isolation, and Characterization of Sodium (Calcium) 2,5
Diketo-D-gluconate_
Because 2,5-DKG is not readily commercially available, it was
prepared by isolation from Erwinia he rbicola, (ATTC 21998) or from
Acetobacter cerinus, IFO 3263. Sodium 2;5-diketo-D-gluconate was
isolated from the Erwinia fermentation by passage of the broth
through AG1-X8, 100-200 mesh anion exchange column, washing with
water, and eluting with Ci.05N HC1. Fractions containing
2,5-diketo-D-gluconic acid vrere pooled, neutralized v~ith sodium
bicarbonate to pH 5.5, and lyophilized to dryness. (See for
example, Bernaerts, M. et. al., AntoniE~ van Leeuwenhoek 37: 185
(1971)). Characterization performed by methods useful for organic
acids involving HPLC and TLC (Gossele, F. et al., Zbl. Bokt. Hyg.,
26 1: Abt. Orig. C, 178 (1980)), 13C Nt~iR and the formation of the bis
2,4-dinitrophenylhydrazone as described by Wakisika, Y. fir. Biol.
Chem. 28: 819 (19E~4) confirmed the identity of the compound.
(Alternatively the calcium salt may be prepared by passage of the
concentrated broth throucth a column o'' a cation exchange resin
(Dowex 50, Ca2+ form) followed by elution with water. Fractions
containing 2,5-DKG by HPLC analysis are pooled and lyophilized to
give a pale yellow calcium salt.)
The following examples serve to illustrate but not to limit the
invention:
21 1 341 08 5
Example 1 -- Isolation and Purification of 2.5-DKG Reductase from
Corynebacterium
A. Cell Lysis and :Extraction
CorSrnebacterium sp. ATCC 31090 was l;rown in a 10-liter fermenter and
harvested during log-phase growth. Cell paste was recovered by centrifugation
of
the fermentation broth, and stoned at -20 degree; C. 450 grams of cell past
was
thawed, resuspended in 650 ml 20mM Tris buffer pH 8.0, 0.5M NaCI to wash the
cells, and the cells re-harvested by centrifugation, followed by resuspension
in 650
ml Tris buffer containing 2mg/ml lysozyme to release intracellular proteins.
Cell
debris was separated from soluble material by centrifugation, and the
resulting pellet
reextracted with Tris buffer containing 0.1 percent (w/w) Tween 80*, a non-
ionic
detergent. The extracts were assayed for 2,5-DKG reductase activity and
pooled.
B . Ion Exchange C:hromatogranhv
The crude cell extract (1264m1) was adsorbed batchwise onto
diethylaminoethylcellulose (Whatman DE-52*, 250 ml wet settled volume), and
stirred for 0.5 hrs at room temperature, followed by recovery of the DE-52
resin in
a glass filter funnel. The DE-52 resin was packed into a 5x30 cm column and
washed with Tris buffer until baseline was established (A280=0.7, A260/A280-
1.7, indicating that nucleic acids were slowly washing off the column). The
column was then eluted with a 0-1M linear NaCI gradient (1200m1) at a flow
rate of
110m1/hr., and fractions were collected and assayed for DKG reductase
activity.
Two distinct peaks of activity catalyzing DKG reduction were found: a peak
eluting
at approximately 0.4M NaCI contained the desired 2,5-DKG reductase (which
3 0 converts 2,5-DKG into 2-KLG):; another eluting at approximately 0.25M NaCI
which did not convert :~,5-DKG into 2-KLG.
* Trade mark
-22- 1 3 41 4 8 5
C . Affinity ChromatogranhX
The 0.4M eluting peak from the DE-52 column was dialysed overnight vs.
20mM Tris pH 8.0 and. applied 'to a 2.5 x 4.5 column of Amicon Matrex Gel Blue
A; (This resin consists of agaros;e beads with a covalently linked dye
(Cibacron blue
F3GA*) which has an ;affinity for enzymes utilizing NADH or NADPH as a
cofactor.) The column was washed with Tris buffer and eluted with l.OmM
NADP. Fractions were; collected and assayed for DKG reductase activity, and
the
activity pool concentrated 16-fold by ultrafiltration (Amicon stirred cell YM-
5
membrane).
D. High Pressure Li uid Chromato~ranhy (HPLC)
The concentrated materiel from the Blue A column was dialysed overnight
vs. 20mM Tris pH 8.0 and applied to an Altex TSK column (0.5 x 60cm) buffered
with 200 mM ammonium bicarbonate. (The TSI~ column separates proteins
according to molecular weight.) The 2,5-DKG reductase activity eluted in a
single
peak that corresponded to a molecular weight of 45,000 daltons and showed >99
percent purity -- i.e., was homol;eneous according to this criterion.
Example 2 -- Characterization of CorSrnebacterium 2.5-DKG Reductase
2 5 A. Electrophoresis
The enzyme was electrophoresed in an acrylamide gel in the presence of
sodium dodecyl sulfate (SDS). Under both non-reducing and reducing conditions,
a single protein band with a molecular weight of approximately 34,000 daltons
was
found. No protein was found in the 45,000 dalton range (as was found with
HPLC).
* Trade mark
4
-23- 1 3 4 1 0 8 5
B. N-terminal Amino Acid Seguence
Amino acid sequence data show that the purified enzyme contains
a single ~J-terminal sequence. (u = undetermined)
thr val pro ser ile val leu asn asp gly asn ser ile pro gln leu gly
tyr gly val phe lys val pro pro ala asp ala gln arg ala val glu
glu ala leu glu val gly t,yr a his ile asp a ala a a tyr gly
C~ wino Acid Comcosition
Amino acid hydrolysis data gives the folloE~ring composition:
viol a
AA Fercent
asx 11.52
thr 4.75
ser 3.85
glx 10.47
pro 6.15
gly 8.22
ai a 14.69
cys 0.00
val 7.47
met 1.36
ile 4.82
leu 7.90
tyr 2.40
phe 2.37
his 3.67
lys 3.10
arg 5.21
trp ~ 2.05
D. t;inetic Parameters,Substrate Specificity and Cofactor Requirements
- -. -2d- 1 3 4 1 0 8 5
The following assay conditions were used to determine kinetic
parameters:
Sodium phosphate buffer 150mi°i, pH 6.4, 25°C
NADPH 11-300uM
Enzyme l0ug
2,5-DKG 0.43-43mM
Assay volume 1.0 ml
Michaelis constants (l~.m) 2,5-DhG: 15.5mP~1
NADPEi: 33.7uh1
Waximum velocity (Vmax) 9.8 units/mg (1 unit =1.0 uMole/min)
The enzyme is specific fo r NADPH. No activity was observed with
2-KDG, 5-KDG, D-gluconic acid, 2-KLG, NADH.
20
No alteration of activity was observed in the presence of
tdg++, Mn++, Ca++, Zn++, EDTA, cystein~e, ADP, ATP.
E. pH Optimum
htaximal activity was observed at pH 6.4. The enzyme is active
over a broad pH range of 5.0-7.6.
F. Stereosoecificitv and Quantitative Conversion
In order to ciuantitate the conversion of 2,5-DKG into 2-KLG, a
reaction was carried out; containing 2,5-DKG, 1.33 mM NADPH, 0.3mg
2,5-DKG reductase in 1 ml of O.1M Tr-is:Cl pH 7.5. After 5 h at 25°C
the reaction had stopped and was analyzed for NADPH oxidation and
30~ 2-KLG production.. A change in the absorbance at 380nm corresponding
to 0.40 mM NADPH oxidized was observed. HPLC analysis on an organic
acids column showed a single peak corresponding to 0.42 mM 2-KLG.
No 2-KDG (2-keto~-D-gluconic acid) or 5-KDG (5-keto-D-gluconic acid)
was observed. HPLC analyses were verified by analysis of the GCMS
of per-trimethylailylated derivatives prepared by addition of
-...
-25- 1 3 41 0 8 5 .
trimethylsilylimid.azole/ pyridine: 50;50 to a lyophilized reaction
mixture for 30 min at 90°C, on a 25 m«ter 5 percent crosslinked
phenylmethylsilicone fused silica bonded capillary column. Thin
layer chromatography is also consistent ~~~ith the above results.
Example 3 -- Recombinant 2,5-DKG Reductase
A. Probe Design
The Tm of the,Corynebacterium sue. (ATCC 31090) DNA was measured
and fourib to be 81.5°C in 7.5 mM sodium phosphate, 1 mh1 EDTA (pH
6.8). This corresponds to a G+C content of 71 percent, using
Pseudomonas aeru inosa DNA (Tm = 79.7°C, G+C = 67 percent) as a
standard. Hence, in the constructions, those codons known to be
prevalent in bacterial DNAs of high G+C content (Goug, M., et al
Nucleic Acids Res. 10, 7055 (1982)) were employed: phe, TTC; lys,
AAG; val, GTG; pro, CCG; ala, GCC; asp, GAC; gln, CAG; arg, CGC;
glu, GAG; asn, AAC; ser, TCC; ile, ATC; leu, CTG; gly, GGC; tyr,
TAC. The partial amino acid sequence of the 2,5-DKG reductase f rpm
Corynebacterium sp. (ATCC 31090) is shown in Example 2; this
sequence and the above codons were used to construct suitable
probes, using the method of Anderson and Kingston (Proc. Natl. Acad.
Sci. USA 80, 6838 [1983]). Two 43 mess were synthesized by the
phosphotriester method of Crea, R. _et _al., Nucleic Acids Res., 8:
2331 (1980) 5'GGCCTCCTCCACGGCGCGCTGGGCGTCGGCC GGCGGCACCT?G3' and
5'CTCCATCCCGCAGCTGGGCTACGGCGTGTTCAAGGTGCCGCCG3'. The
oligonucleotide probes are phoshorylated with 100 uCi [Y-32P] ATP
(5,000 Ci/mmole, Amersham) and polynucleotide kinase (P-L
Biochemicals).
B. Construction of a Plasmid Genomic Library
Genomic DNA was isolated from Corynebacterium sp_. ATCC 31090 by
the method of Schiller et al. Antimicro. Agents Chemotherapy _18, 814
(lgg0). Large fragments (>100kb) were purified by CsCI density
1 341 OS 5
-26-
gradient centrifugation and partially digested with Sau 3A. The digest was
size
fractionated by agaros~e gel electrophoresis into size classes of 1-2kb, 2-
3kb, 3-4kb,
and 4-6kb. A genomic; library was prepared from each size class of DNA
fragments
using the vectors pBR:322 and pACYCl84 (Bolivar, F. et al Gene 2, 95 (1977);
Chang, A.C.Y., and Cohen, S.IV. J. Bacteriol. 1.34, 1141 (1978)) by cleavage
of
the BamHI site and insertion of the Sau3A fragnnents using T4 DNA ligase. The
resulting plasmids were used to transform a recA- derivative of E. coli strain
MM294. (ATCC 31446) or DFf-1 (ATCC 33849) employing the transformation
protocol of D. Hanahan (J. Mol.. Biol., 166, 557 1983). Each genomic library
contained 104 - 105 independent recombinants. (In an alternative procedure,
additional plasmid libr;~ries may be prepared in pBR322 using BamHI fragments
(size range 2.0-2.5 Kb) and Pst fragments (size range 0.5-1.5 Kb) of
Corynebacterium~. (ATCC 31.090) DNA.)
C. Screening of the Plasmi<i Library in E. coli
The colonies were picked into microtiter dishes, incubated overnight, and
2 0 stamped onto nitrocellulose filters (BA85) placed on LB plates containing
ampicillin
or chloramphenicol. The remaining portions of the colonies in the microtiter
dishes
were preserved by adding 25p,1 of 42 percent DMSO and storing at -20°C.
The transferred portions of the colonies were incubated for 8 to 9 hours at
2 5 37°C and amplified by 'transferring the filters to plates
containing 12.5p,g/ml
chloramphenicol or spectinomyc.in and incubating at 37°C overnight.
The plasmid library in E. coli is screened by filter hybridization. The DNA
is denatured and bound to duplicate filters as described by Itakura, K. et al.
Nucleic
3 0 Acids Res. 9:879-894 ( 1981 ). T'he filters for hybridization were wetted
in about 10
ml per filter of 5X SET, 5X Denhardt's solution .and 50 pg/ml denatured
~34~88.5
-27-
salmon sperm DNA, a.nd 0.1 percent sodium pyrophosphate + 20 percent
formamide (5X SET =: 50 mM Tris-HCl (pH 8.0), 5mM EDTA, 500 mM NaCI; 5X
Denhardt's solution = 0.1 percent bovine serum albumin, 0.1 percent
polyvinylpyrolidone, 0.1 percent Ficoll; see Denhardt, Biochem. Biophys. Res.
Comm., 23:641 (1966)). The fiilters are prehybridized with continuous
agitation at
42° for 14-16 hrs, and probed with ~1 x 108 cpm of probe as prepared in
subparagraph A of this Example: at 42°C. The filters that were
hybridized with the
probes of subparagraph A are washed with .2 x SSC, .l percent SDS, .l percent
sodium pyrophosphate at 42°C for 3 x 30 rains. Each of the duplicate
filters is
blotted dry, mounted on cardboard and exposed to Kodak* XR5 X-Ray film with
Dupont* Cronex 11R :~tra life Lightning-plus intensifying screens at -
70°C for 4-24
hrs.
Cells from positive colonies were grown up and plasmid DNA was isolated
by the method of Clewell and Helinski (Proc. Natl. Acad. Sci. USA 62, 1159
[1969]). DNA was fragmented with Alul and PstI and subcloned into the vectors
M13mp8 and Ml3mp!) (Messing, J. and Viera, J. [1982] Gene 19, 269).
2 0 Subclones that hybridized to the; probes were sequenced using the dideoxy
chain
termination procedure (Sanger, F. et al., Proc. l'datl. Acad. Sci. (USA) 74:
5463
(1977)) in order to verify that the DNA coded for the 2,5-DKG reductase.
D. Construction of Expression Vectors for 2.5-DKG Reductase Gene
The 2,5-DKG reductase gene, accompanied by either its own or a synthetic
ribosome binding site, is inserted 'downstream' of the E. Coli tro (or tae)
promoter
or the pACYC184 CA'r promoter on expression plasmids, which also contain a
tetracycline resistance l;ene or other selectable matker, and an origin of
replication
derived from plasmids ColEl. 1.5A, or RSF1010. Some constructs may contain, in
addition, an active gene coding for E. Coli tro repressor or the E.coli lac
repressor
which allows the expression of the 2,5-DKG reductase gene to be regulated by
exogenously added indole acryliic acid or IPTG. Various mutated versions of
the
above plasmids are also employed for the expre;~sion of 2,5-DKG reductase.
* Trade mark
.v
-28- ~ 3 41 0 8 5
Construction of Expression Vector for 2.5-Df;G Reductase
A cloned 2.2 Kb BamHI fragment of Corynebacterium ~ (ATCC
31090) DNA, containing a portion of the 2,5-DKG reductase gene, was
isolated with the 43-mer probes as described in Example 3. An 0.12
Kb PstI/BamHI fragment of this plasmid was further used as a probe
to isolate an overlapping 0.88 Kb PstI fragment of Corynebacterium
sp DNA, which contained the rest of the gene. As described in
Figure 2, pDKGR2 (containing the 2.2 Kb BamHI fragment) was digested
with NcoI, treated with E. coli DNA polymerase I Klenow fragment and
dNTPs to~create flush-ended DNA, then further digested with BamHI to
release an 0.87 Kb fragment; this fragment was purified by
electrophoresis on low-melting-point agarose. The plasmid pDKGR9
(containing the 0.88 Kb PstI fragment) was digested with PstI and
BamHI, and the resultant 0.76 Kb fragment similarly isolated on
low-melting-point agarose. The 0.87 kb NcoI/BamHI fragment and the
0.76 Kb BamHI/PstI fragment were then combined with SmaI/PstI -
digested M13mp9 and ligated to yield an M13 recombinant ("mitl2")
with a 1.6 Kb insert of Corynebacterium sp DNA containing the entire
2p 2,5-DKG reductase gene (Figure 2).
To mitl2 single-stranded DNA a "deletion primer" (sequence:
ACGGCCAGTGAATTCTATGACAGTTCCCAGC) and AIuI fragments of M13mp9 DNA
were annealed. This template-primer combination was then treated
with E. coli DNA polymerase Klenow fragment in the presence of dNTPs
and T4 DNA ligase 'to create in vitro heteroduplex mitl2 RF
molecules, as described by Adelman et al., (DNA 2, 183 (1983).
These molecules were used to transform the host tM101, and
recombinant phage incorporating the desired deletion were detected
30~ bY Plaque hybridization using the deletion primer as a probe
(Adelman et al., (!)NA 2, 183 (1983)). This construction was
designated mitl2o (Fig. 3).
The thitl2e RF DNA was digested with EcoRI and HindIII to yield a
1.5 Kb fragment containing the 2,5-DKG reductase gene. The human
-2g- 1 341 08 5
growth hormone expression plasmid, pHGH207-lptrpeRl5',
(pHGH207-lptrpaRIS' is a derivative of pHGH207-1 (de Boer et al.,
(1983), Proc. Natl. Acad. Sci.,USA _80, 21) in which the EcoRI site
between the ampicillin resistance gene and the trp promoter has been
deleted), was digested with EcoRI and PstI to yield a 1.0 Kb
fragment containing the E. coli trp promoter and pBR~22 was digested
with PstI and HindIII to yield a 3.6 Kb fragment. These three
fragments were ligated together to form an expression plasmid for
2,5-DKG reductase, designated pmitl2e/trpl (Fig. 3). This plasmid
eras unable to confe r tetracycline resistance on host cells. A
plasmid that would encode a complete tetracycline resistance
function was constructed as follows. pmitl2e/trpl DIJA was digested
with HindIII, treated with E. coli DNA polymerase I Klenow fragment
and dRITPs to produce flush ended DNA, then digested with SphI; the
resultant 5.6 Y,b fragment was purified by electrophoresis on low
melting agarose. :Similarly, pBR322 DNA was digested with EcoRI,
treated with _E. col_i DNA polymerase I Klenow fragment and dNTPs,
digested with S~hI, and the resultant 0.56 Kb fragment purified on
low melting agaros~e. The 5.6 Kb and C.56 Kb fragments were then
ligated together to yield a tetracycline-resistant 2,5-DKG reductase
expression plasmid, designated ptrpl-:.5 (Figure 3). The DNA
sequence of the trp promoter, synthetic ribosome binding site, and
2,5-DKG reductase gene contained on this plasmid is shown in
Figure 4.
E. Production of Recombinant 2,5-DKG Reductase
Cells are prepared for transformation by the method of Lacy and
Sparks, Phytopatholoaical Society, 69:. 1293-1297 (1979). Briefly a
30- loop of suitable host cells, Erwinia herbicola (ATCC 21998), or
_E. coli MM294 (ATCC 314645), is inocu'ated into 5 ml of LB medium
and incubated at 3.0°C for 14-16 hrs. A 1:100 dilution of this
overnight growth is inoculated into LE>, the culture grown to OD5g0
of 0.4, and the cells recovered by centrifugation at 4°C. The
pellet was resuspended in 1/3 volume of 10 mM NaCI, again
-3c- 1 3 4 1 0 $ 5
centrifuged at 4°C, the pellet resuspended in an equal volume of
30 mM CaCl2, and after 60 minutes at 0°C, the cells again
centrifuged at 4°C. The pellet is resuspended in 1/12 volume of 30
rr~ CaCl2 and stored at 4°C overnight. (Alternatively, cells may' ,
be resuspended in 30 mho CaCl2, 15 percent glycerol, and stored at
-70°C.)
Transformation is effected by incubation of 1 ug plasmid in 0.2
ml of competent cells at 0°C for 2 hr followed by heating to
42°C
for 1 min. 3 ml of LB broth is added and cells are allowed to
recover for 4 hrs at 37°C, then cells are plated on selective medium
as described by Lacy and Sparks (supra). Successful transformants
are grown on LB broth to a density of O.D.550 = 1.0, then
centrifuged and resuspended in rr,inimal medium in the presence of 0.2
percent glucose. IAA or IPTG is then added to the medium, and after
0.5-1.0 hrs, the cells recovered by centrifugation and lysed by
treatment with lysozyme and a detergent (Tween 80).
The supernatant is aasayed for the presence of 2,5-DKG reductase
2p as outlined in Example 21D. (Table I), and the proteins analyzed by
SDS polyacrylamide gel electrophoresis (Fig. 5). The protein band
representing the recombiinant 2,5-DKG reductase was identified
immunologically using the Western blotting procedure (Tobin, H, et
al., Proc. Natl. ~4cad. Sci. USA 76, 4350 (1979)).
TABLE I
2,5-DKG reductase activity
30- Extract . (e Absorbance (340 nm) min-1/100 uL)
pBR322 transformed - 0.087
Erwinia herbicola (ATCC .?1998)
ptrpl-35 transforrned - 1,925
Erwinia herbicola (ATCC 21998)
-31- 1 3 4 1 4 8 5
Example 4 -- Production of 2-KL~ntactin9 Recombinant Organism
with 2,5-DKG
Cells of ptrpl-35 transformed Erw. _her_bicola (ATCC 21998) were
5streaked from a frozen glycerol stock onto LB solid medium (10 9/L
tryptone, 5 g/L yeast extract, 10 g/L tdaCl, 15 g/L agar) containing
mg/L tetracycline, 'then incubated 48 hrs at 30°C. A single colony
was picked and used to inoculate 5 ml of LB liquid medium containing
5 mg/L tetracycline, and this was shaken in a test tube for 16 hrs
10at 30°C. 1.0 ml of this culture was used to inoculate 100 ml LB
liquid medium containing 5 mg/L tetracyc,iine, and this was then
shaken at 200 rpm for 16 hrs>. at 30°C. Cells were harvested by
centrifugation, washe d once in an equal volume of fresh LB medium,
then resuspended in 50 ml of LB medium containing 5 mg/L
tetracycline and 20 g/L 2,5-DY,G. A 10 ml aliquot of this was shaken
in a 125 ml flask at 200 rpm for 16 hrs at 30°C. The resultant
broth was analyzed by HPLC and found to contain 2.0 g/L of 2-KLG. A
control culture containing pBR322-transi'ormed Erw. herb (ATCC
21998), treated in a similar fashion, contained no 2-KLG.
Example 5 -- Production of 2-KLG f rpm Glucose by Recombinant Organism
Cells of ptrpl-35-transformed Erw. herbicola (ATCC 21998) were
streaked from a frozen glycerol stock onto LB solid medium (10 g/L
tryptone, 5 g/L yeast extract, 10 g/L NaCI, 15 g/L agar) containing
5 mg/L tetracycline, then incubated for 48 hrs at 30°C. A single
colony was picked and used to inoculate 5 ml of LB liquid medium
containing 5 mglL tetracycline, and this was shaken in a test tube
for 16 hrs at 30°C. 1.0 ml of this culture was used to inoculate
100 ml of ATCC medium 1038 (3.0 g/L glucose, 5.0 g/L yeast extract,
5.0 g/L peptone, 7.5 g/L CaC03, pH 7.0) containing 5 mg/L
tetracycline, and this was shaken at 200 rpm in a 500 ml flask at
30°C for 16 hrs. Cells from 75 ml of this culture were then
harvested by centrifugation, resuspended in 50 ml of fresh ATCC
medium 1038 containing 5 mg/L tetracycline and 20 g/L glycerol, and
_~ ~J~__ 1341085
shaken at 200 rpm in a 500 ml flask at; 30°C for 48 hrs. The
resultant broth was analyzed by HPLC and GC/MS and found to contain
1.0 g/L 2-KLG. A control culture containing pBR322-transformed Erw.
herbicola (ATCC 21998), treated in a similar fashion, contained no
2-KLG.
Example 6 -- Production of 2-KLG by the Organism of the Present
Invention
To demonstrate the production of 2-KLG from readily available
carbon sources, the following experiment was performed.
Production of 2-KL.G from Glucose
The production of 2-I;LG by Erwinia herbicola (ATCC
21998)/ptrpl-35 vras accomplished by growing the cells in a medium
containing the fo'ilowing:
Yeast Extract (INestles) lOg/1
Calcium Carbonate 20 g/1
2p Corn Steep Liquor 10 g/1
Glucose 20 g/1
Tetracycline 5 mg/1
The glucose and the tetracycline were sterilized separately and
added prior to inoculation.
An inoculum was prepared by adding 1.0 rnl of a fro w stock
culture to 50 ml of Luria broth containing 5 g/1 glucose and 5 mg/1
tetracycline. The 250 rrnl baffled flask containing the inoculum was
~ incubated at 30°C for lf.hours with shaking.
A 250 ml baffled flask was filled with 50 ml of the production
medium above and inoculated with 1 ml of the inoculum. The flask
was incubated with shaking at 30°C. The pH of the medium at the
time of inoculation was 5.1 due to the acidity of corn steep
-33- 1 3 41 ~ 8 5
liquor. After 57 hours the pH had risen to 8.71 and 2-KLG was shown
to be present at a concentration of O.fi mg/ml by HPLC. The presence
of 2-KLG was confirmed by HPLC and GC-t~1ass Spectrometry.
10
20
30
