Note: Descriptions are shown in the official language in which they were submitted.
134180
NON-HUMAN CARBONYL HYDROLASE MUTANTS,
DNA SEQUENCES AND VECTORS ENCODING SAME
AND HOSTS TRANSFORMED WITH SAID VECTORS
The recent development of various in vitro techniques
to manipulate the DNA sequences encoding
naturally-occuring polypeptides as well as recent
developments in the chemical synthesis of relatively
short sequences of single and double stranded DNA has
resulted in the speculation that such techniques can
be used to modify enzymes to improve some functional
property in a predictable way. Ulmer, K.M. (1983)
Science ~, 666-671. The only working example
disclosed therein is the substitution of a single
amino acid within the active site of tyrosyl-tRNA
synthetase (Cys35~Ser) which lead to a reduction in
enzymatic activity. See Winter, G., et al. (1982)
Nature 299, 756-758; and Wilkinson, A.J., et al.
(1983) Biochemistry 22, 3581-3586 (Cys35-~Gly mutation
also resulted in decreased activity).
When the same t-RNA synthetase was modified by
substituting a different amino acid residue within the
active site with two different amino acids, one of the
mutants (Thr51--Ala) reportedly demonstrated a
predicted moderate increase in kcat/Km whereas a
second mutant (Thr51--Pro) demonstrated a massive
increase in kcat/Km which could not be explained with
1341280
-2-
certainty. Wilkinson, A.H., et al. (1984) Nature 307,
187-188.
Another reported example of a single substitution of
an amino acid residue is the substitution of cysteine
for isoleucine at the third residue of T4 lysozyme.
Perry, L.J., et al. (1984) Science 226, 555-557. The
resultant mutant lysozyme was mildly oxidized to form
a disulfide bond between the new cysteine residue at
position 3 and the native cysteine at position 97.
This crosslinked mutant was initially described by the
author as being enzymatically identical to, but more
thermally stable than, the wild type enzyme. However,
in a "Note Added in Proof", the author indicated that
the enhanced stability observed was probably due to a
chemical modification of cysteine at residue 54 since
the mutant lysozyme with a free thiol at Cys54 has a
thermal stability identical to the wild type lysozyme.
Similarly, a modified dihydrofolate reductase from
E.coli has been reported to be modified by similar
methods to introduce a cysteine which could be
crosslinked with a naturally-occurring cysteine ire the
reductase. Villafranca, D.E., et al. (1983) Science
222, 782-788. The author indicates that this mutant
is fully reactive in the reduced state but has
significantly diminished activity in the oxidized
state. In addition, two other substitutions of
specific amino acid residues are reported which
resulted in mutants which had diminished or no
activity.
EPO Publication No. 0130756 discloses the substitution
of specific residues within B. amyloliquefaciens
subtilisin with specific amino acids. Thus, Met222
has been substituted with all 19 other amino acids,
134120
-3-
G1y166 with 9 different amino acids and G1y169 with
Ala and Ser,
As set forth below, several laboratories have also
reported the use of site directed mutagensis to
produce the mutation of more than one amino acid
residue within a polypeptide.
The amino-terminal region of the signal. peptide of the
prolipoprotein of the E. coli outer membrane was
stated to be altered by the substitution or deletion
of residues 2 and 3 to produce a charge change in that
region of the polypeptide. Inoyye, S., et al. (1982)
Proc. Nat. Acad. Sci. USA _79, 3438-3441. The same
laboratory also reported the substitution and deletion
of amino acid redisues 9 and 14 to determine the
effects of such substitution on the hydrophobic region
of the same signal sequence. Inouye, S., et al.
(1984) J. Biol. Chem. 259, 3729-3733.
Double mutants in the active site of tyrosyl-t-RNA
synthetase have also been reported. Carter, P.J., et
al. (1984) Cell 38, 835-840. In this report, the
improved affinity of the previously described
Thr511Pro mutant for ATP was probed by producing a
second mutation in the active site of the enzyme. One
of the double mutants, G1y35/Pro5l, reportedly
demonstrated an unexpected result in that it bound ATP
in the transition state better than was expected from
the two single mutants. Moreover, the author warns,
at least for one double mutant, that it is not readily
predictable how one substitution alters the effect
caused by the other substitution and that care must be
taken in interpreting such substitutions.
1 341 280
-4 -
A mutant is disclosed in U.S. Patent No. 4,532,207,
wherein a polyarginine tail was attached to the
C-terminal residue of ~-urogastrone by modifying the
DNA sequence encoding the polypeptide. As disclosed,
the polyarginine tail changed the electrophoretic
mobility of the urogastrone-polyaginine hybrid
permiting selective purification. The polyarginine
was subsequently removed, according to the patentee,
by a polyarginine specific exopeptidase to produce the
i0
purified urogastrone. Properly construed, this
reference discloses hybrid polypeptides which do not
constitute mutant polypeptides containing the
substitution, insertion or deletion of one or more
amino acids of a naturally occurring polypeptide.
Single and double mutants of rat pancreatic trypsin
have also been reported. Craik, C.S., et al. (1985)
Science 228, 291-297. As reported, glycine residues
at positions 216 and 226 were replaced with alanine
residues to produce three trypsin mutants (two single
mutants and one double mutant). In the case of the
single mutants, the authors stated expectation was to
observe a differential effect on Km. They instead
reported a change in specificity (kcat/Km) which was
primarily the result of a decrease in kcat. In
contrast, the double mutant reportedly demonstrated a
differential increase in Km for lysyl and arginyl
substrates as compared to wild type trypsin but had
virtually no catalytic activity.
The references discussed above are provided solely for
their disclosure prior to the filing date of the
instant case, and nothing herein is to be construed as
an admission that the inventors are not entitled to
antedate such disclosure by virtue of prior invention
or priority based on earlier filed applications.
1 341 280_
Based on the above references, however, it is apparent
that the modification of the amino acid sequence of wild type
enzymes often results in the decrease or destruction of biological
activity.
Accordingly, the invention seeks to provide carbonyl
hydrolase mutants which have at least one property which is
different from the same property of the carbonyl hydrolase
precursor from which the amino acid of said mutant is derived.
The invention also seeks to provide mutant DNA sequences
encoding such carbonyl hydrolase mutants as well as expression
vectors containing such mutant DNA sequences.
Still further, the present invention seeks to provide
host cells transformed with such vectors as well as host cells
which are capable of expressing such mutants either
intracellularly or extracellularly.
Summarv of the Invention
The invention includes carbonyl hydrolase mutants,
preferably having at least one property which. is substantially
different from the same property of the precursor non-human
carbonyl hydrolase from which the amino acid sequence of the
mutant is derived. These properties include oxidative stability,
substrate, specificity catalytic activity, thermal stability,
alkaline stability, pH activity profile and resistance to
proteolytic degradation. The precursor carbe~nyl hydrolase may be
naturally occurring carbonyl hydrolases or recombinant carbonyl
hydrolases. The amino acid sequence of the carbonyl hydralase
mutant is derived by the substitution, deletion or insertion of
one or more amino acids of the precursor carbonyl hydrolase amino
6 1 341 280
acid sequence.
The invention also includes mutant DNA sequences
encoding such carbonyl hydrolase mutants. Further the
invention includes expression vectors containing such mutant
DNA sequences as well as host cells transformed with such
vectors which are capable of expressing said carbonyl hydrolase
mutants.
The present invention provides a substantially pure
subtilisin-related protease derived by the replacement of at
least one amino acid residue of a precursor subtilisin-related
protease with a different amino acid, said one amino acid
residue being selected from the group of equivalent amino acid
residues of subtilisin naturally produced by Bacillus
amyloliquefaciens consisting of Tyr2l, Thr22, Ser24, Asp36,
G1y46, A1a48, Ser49, Met50, Asn77, Ser87, Lys94, Va195, Leu96,
I1e107, G1y110, Metl24, Lys170, Tyrl7l, Prol72, Asp197, Met199,
Ser204, Lys213, His67, Leu126, Leul35, G1y97, Ser101, G1y102,
G1n103, G1y127, Glyl28, Pro129, Tyr214 and G1y215.
The invention further provides a substantially pure
subtilisin-related protease having an amino acid sequence
derived from the amino acid sequence of a precursor subtilisin-
related protease by the substitution of a different amino acid
for at least a first and a second amino acid residue of said
amino acid sequence of said precursor subtilisin-related
protease, said first amino acid residue being selected from the
first group of equivalent amino acid residues of subtilisin
naturally produced by Bacillus amyloliquefaciens consisting of
Tyr2l, Thr22, Ser24, Asp36, G1y46, A1a48, Ser49, Met50, Asn77,
Ser87, Lsy94, Va195, Leu96, I1e107, G1y110, Met124, Lys170,
Tyrl7l, Pro172, Aspl97, Metl99, Ser204, Lys213, His67, Leul26,
Leul35, G1y97, Ser101, G1y102, G1n103, Leu126,
J
1341280
6a
G1y127, G1y128, Pro129, Tyr214, and G1y215 and said second
amino acid residue being selected from the group of equivalent
amino acid residues of subtilisin naturally produced by
Bacillus amyloliquefaciens consisting of Asp32, Ser33, His64,
Tyr104, Alal52, Asnl55, G1u156, Glyl66, Glyl69, Phe189, Tyr217,
and Met222.
The invention also provides a substantially pure
subtilisin-related protease derived by the replacement of at
least one amino acid residue of a precursor subtilisin-related
protease with a different amino acid, said su.btilisin-related
protease being modified in at least substrate specificity as
compared to said precursor, said at least one amino acid
residue being selected from the group of equivalent amino acid
residues of subtilisin naturally produced by Bacillus
amyloliquefaciens consisting of His67, I1e107, Leu135, G1y97
through G1n103, Leu126 through Pro129, Lys213 through G1y215,
G1y153, Asnl54, G1y157 through Va1165, Tyrl67, Pro168 and
Lys170 through Pro172.
The invention additionally provides a substantially
pure subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by a
combination of substitutions of at least two amino acid
residues in said precursor equivalent to amino acid residues of
subtilisin naturally produced by Bacillus amyloliquefaciens,
wherein said combination of substituted equivalent residues is
selected from the group consisting of Thr22/Ser87, Ser24/Ser87,
A1a45/A1a48, Ser49/Lys94, Ser49/Va195, Met50/Va195,
Met50/G1y110, Met50/Met124, Met50/Met222, Metl24/Met222,
Glul56/G1y166, G1u156/G1y169, G1y166/Met222, G1y169/Met222,
Tyr21/Thr22, Met50/Met124/Met222, Tyr21/Thr22/Ser87,
Met50/G1u156/G1y166/Tyr217, Met50/G1u156/Tyr217,
Met50/G1u156/G1y169/Tyr217, Met50/I1e107/Lys213, Ser204/Lys213,
and I1e107/Lys213.
J
1341280
6b
The invention further provides a substantially pure
subtilisin-related protease derived by the replacement of one
or more amino acid residues of a precursor subtilisin-related
protease with a different naturally occurring amino acid, said
subtilisin-related protease being altered in at least alkaline
stability as compared to said precursor, said amino acid
residues replaced being selected from the group of equivalent
amino acid residues of subtilisin naturally produced by
Bacillus amyloliquefaciens consisting of Asp36, I1e107, Lys170,
Aspl97, Ser204, Lys213, Ser24, and Met50.
The invention also provides a substantially pure
subtilisin-related protease derived by the replacement of one
or more amino acid residues of a precursor subtilisin-related
protease with a different naturally occurring amino acid, said
subtilisin-related protease being modified in. at least thermal
stability as compared to said precursor, said amino acid
residues replaced being selected from the group of equivalent
amino acid residues of subtilisin naturally produced by
Bacillus amyloliquefaciens consisting of Asp36, I1e107, Lys170,
Ser204, Lys213, Metl99 and Tyr2l.
The invention also provides a substantially pure
subtilisin-related protease derived by the replacement of one
or more amino acid residues of a precursor subtilisin-related
protease with a different naturally occurring amino acid, said
subtilisin-related protease being modified in at least
oxidative stability as compared to said precursor, said amino
acid residues replaced being selected from the group of
equivalent amino acid residues of subtilisin naturally produced
by Bacillus amyloliquefaciens consisting of Met50 and Metl24.
The invention also provides a substantially pure
subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by a
J
1341280
6c
combination of substitutions of two or more amino acid residues
in said precursor equivalent to amino acid residues of
subtilisin naturally produced by Bacillus amyloliquefaciens,
wherein said subtilisin-related protease being modified in at
least thermal stability as compared to said precursor and
wherein said combination of substitutions of two or more amino
acid residues is selected from the group consisting of
Thr22/Ser87, Ser24/Ser87 and Tyr21/Thr22/Ser87.
The invention also provides a substantially pure
subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by a
combination of substitutions of two or more amino acid residues
in said precursor equivalent to amino acid residues of
subtilisin naturally produced by Bacillus amyloliquefaciens,
said subtilisin-related protease having at least altered
oxidative stability and substrate specificity as compared to
said precursor, wherein said combination of substitutions of
two or more amino acid residues is selected from the group
consisting of Glyl66/Met222 and Glyl69/Met222.
The invention also provides a substantially pure
subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by a
combination of substitutions of two or more .amino acid residues
in said precursor equivalent to amino acid residues of
subtilisin naturally produced by Bacillus amyloliquefaciens,
said subtilisin-related protease having at least improved
enzyme performance as compared to said precursor, wherein said
combination of substitution of two or more amino acid residues
comprises Glul56 and G1y166.
The invention also provides a substantially pure
subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by a
J
1 341 28 0
6d
combination of substitutions of two or more amino acid residues
in said precursor equivalent to amino acid residues of
subtilisin naturally produced by Bacillus amyloliquefaciens,
said subtilisin-related protease having at least altered
substrate specificity and kinetics as compared to said
precursor, wherein said combination of substitutions of two or
more amino acid residues is selected from the group consisting
of G1u156/G1y169/Tyr217, Glyl56/G1y166/Tyr217 and
Glul56/Tyr217.
The invention also provides a substantially pure
subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by a
combination of substitutions of two or more amino acid residues
in said precursor equivalent to amino acid residues of
subtilisin naturally produced by Bacillus amyloliquefaciens,
said subtilisin-related protease having at least modified
alkaline or thermal stability as compared to said precursor,
wherein said combination of substitution of t:wo or more amino
acid residues is selected from the group consisting of
I1e107/Lys213, Ser204/Lys213, G1u156/G1y166,
Met50/Glul56/G1y169/Tyr217 and Met50/I1e107/Lys2,l3.
The invention also provides a substantially pure
subtilisin-related protease derived from the amino acid
sequence of a precursor subtilisin-related protease by the
deletion of one or more amino acid residues in said precursor
equivalent to amino acid residues of subtilisin naturally
produced by Bacillus amyloliquefaciens, wherein said one
deleted residue is selected from the group consisting of
Ser161, Serl62, Serl63 and Thr164.
The invention also provides a substantially pure
subtilisin-related protease derived by the replacement of one
or more amino acid residues of a precursor subtilisin-related
J
1341280
6e
protease with a different naturally occurring amino acid, said
one or more amino acid residues replaced being selected from
the group of equivalent amino acid residues of subtilisin
naturally produced by Bacillus amyloliquefaciens consisting of
Met50, I1e107, Ser204, Lys213, Metl24 + Met222, Met50 + Metl24
+ Met222, Thr22 + Ser87, Ser24 + Ser87,
Met50 + G1u156 + G1y169 + Tyr217, I1e107 + Lys213,
Ser204 + Lys213, and Met50 + I1e107 + Lys213, wherein the amino
acid substitution at position Met50 is Phe, the substitution at
position I1e107 is Val, the substitution at position Ser204 is
Cys, Leu or Arg, the substitution at position Lys213 is Arg,
the substitution at position Metl24 is Ile, the substitution at
position Met222 is any amino acid, the substitution at position
Thr22 is Cys, the substitution at position Ser87 is Cys, the
substitution at Ser24 is Cys, the substitution at position
G1u156 is Ser, the substitution at position G1y169 is Ala, and
the substitution at position Tyr217 is Leu.
Brief Description of the Drawings
Figure 1 shows the nucleotide sequence of the coding
strand, correlated with the amino acid sequence of B.
amyloliquefaciens subtilisin gene. Promoter (p) ribosome
binding site (rbs) and termination (term) regions of the DNA
sequence as well as sequences encoding the presequence (PRE)
putative prosequence (PRO) and mature form (MAT) of the
hydrolase are also shown.
Figure 2 is a schematic diagram showing the substrate
binding cleft of subtilisin together with substrate.
J
- 1~41r80
Figure 3 is a stereo view of the S-1 binding subsite of B.
amyloliquefaciens subtilisin.
Figure 4 is a schematic diagram of the active site of
subtilisin Asp32, His64 and Ser221.
Figures 5A and 5B depict the amino acid sequence of sub-
tilisin obtained from various sources. The residues directly
beneath each residue of B. amyloliquefaciens subtilisin are
equivalent residues which (1) can be mutated in a similar manner
to that described for B. amyloliquefaciens subtilisin, or (2) can
be used as a replacement amino acid residue in B. amyloliquefaciens
subtilisin. Figure 5C depicts conserved residues of B. amylolique-
faciens subtilisin when compared to other subtilisin sequences.
Figures 6A and 6B depict the inactivation of the mutants
Met222L and Met222Q when exposed to various organic oxidants.
Figure 7 depicts the ultraviolet spectrum of Met222F
subtilisin and the difference spectrum generated after inactivation
by diperdodecanoic acid (DPDA).
Figure 8 shows the pattern of cyanogen bromide digests
of untreated and DPDA oxidized subtilisin Met222F on high resolu-
?0 tion SDS-pyridine peptide gels.
134280
_g-
Figure 9 depicts a map of the cyanogen bromide
fragments of Fig. 8 and their alignment with the
sequence of subtilisin Met222F.
Figure 10 depicts the construction of mutations
between codons 45 and 50 of _B. am_yloliquefaciens
subtilisin.
Figure 11 depicts the construction of mutations
between codons 122 and 127 of B. amylolic~uefaciens
subtilisin.
Figure 12 depicts the effect of DPDA on the activity
of subtilisin mutants at positions 50 and 124 in
subtilisin Met222F.
Figure 13 depicts the construction of mutations at
codon 166 of H_. amyloliquefaciens subt:ilisin.
Figure 14 depicts the effect of hydrophobicity of the
P-1 substrate side-chain on the kinetic parameters of
wild-type ~. amYloliquefaciens subtili~sin.
Figure 15 depicts the effect of position 166
side-chain substitutions on P-1 substrate specificity.
Figure 15A shows position 166 mutant subtilisins
containing non-branched alkyl and aromatic side-chain
substitutions arranged in order of increasing
molecular volume. Figure 15B shows a series of mutant
'0 enzymes progressing through ~- and ~-branched
aliphatic side chain substitutions of increasing
molecular volume.
Figure 16 depicts the effect of position 166
'5 side-chain volumn on log kcat/Km for various P-1
substrates.
134180
Figure 17 shows the substrate specificity differences
between I1e166 and wild-type (Glyl66) B. amyl~oliquefaciens sub-
tilisin against a series of alphatic and aromatic substrates. Each
bar represents the difference in log kcat/Km for Ilel66 minus
wild-type (G1y166) subtilisin.
Figure 18 depicts the construction ~of mutations at codon
169 of B, amyloliquefaciens subtilisin.
Figure 19 depicts the construction of mutations at codon
104 of B. amyloliquefaciens subtilisin.
Figure 20 depicts the consturction of mutations at codon
152 B. amyloliquefaciens subtilisin.
Figure 21 depicts the construction of single mutations
at codon 156 and double mutations at codons 156 and 166 of B.
amyloliquefaciens subtilisin.
Figure 22 depicts the construction of mutations at codon
217 for B. amyloliquefaciens subtilisin.
Figures 23A and 23B depict the. kcat/Km versus pH profile
for specific mutations at codon 156 and/or 166 in B. amylolique-
faciens subtilisin.
Figure 24 depicts the kcat/Km versus pH profile for
mutations at codon 222 in B. amyloliquefaciens subtilisin.
- g _
~ 341 28 0
-lo-
Figure 25 depicts the constructing mutants at codons
94, 95 and 96.
Figures 26 and 27 depict substrate specificity of
various wild type and mutant subtilisins for different
substrates.
Figures 28 A, B, C and D depict the effect of charge
in the P-1 binding sites due to substitutions at codon
156 and 166.
Figures 29 A and B are a stereoview of the P-1 binding
site of subtilisin BPN' showing a lysine P-1 substrate
bound in the site in two ways. In 29A, Lysine P-1
substrate is built to form a salt bridge with a Glu at
codon 156. In 29B, Lysine P-1 substrate is built to
form a salt bridge with Glu at codon 166.
Figure 30 demonstrates residual enzyme activity versus
temperature curves for purified wild-type (Panel A),
C22/C87 (Panel B) and C24/C87 (Panel C).
Figure 31 depicts the strategy for producing point
mutations in the subtilisin coding sequence by misin-
corporation of a-thioldeoxynucleotide triphosphates.
Figure 32 depicts the autolytic stability of purified
wild type and mutant subtilisins 170E, 107V, 2138 and
107V/213R at alkaline pH.
Figure 33 depicts the autolytic stability of purified
wild type and mutant subtilisins V50, F50 and
F50/V107/R213 at alkaline pH.
134180
-11-
Figure 34 depicts the strategy far constructing
plasmids containing random cassette mutagenesis over
residues 197 through 228.
Figure 35 depicts the oligodeoxynucleotides used for
random cassette mutagenesis over residues 197 through
228.
Figure 36 depicts the construction of mutants at codon
204.
Figure 37 depicts the oligodeoxynucleotides used for
synthesizing mutants at codon 204.
petailed Description
The inventors have discovered that various single and
multiple 'fin vitro mutations involving the
substitution, deletion or insertion of one or more
amino acids within a non-human carbonyl hydrolase
amino acid sequence can confer advantageous properties
to such mutants when compared to the non-mutated
carbonyl hydrolase.
Specifically, ~. amyloliquefaciens subtilisin, an
alkaline bacterial protease, has been mutated by
modifying the DNA encoding the subtilisin to encode
the substitution of one or more amino acids at various
amino acid residues within the mature form of the
subtilisin molecule. These ~n vitro mutant
subtilisins have at least one property which is
different when compared to the same property of the
precursor subtilisin. These modified properties fall
into several categories including: oxidative
stability, substrate specificity, thermal stability,
alkaline stability, catalytic activity, pH activity
1 3~1 ~~0
-12-
profile, resistance to proteolytic degradation, Km,
kcat and Km/kcat ratio.
Carbonyl hydrolases are enzymes which hydrolyze
O
compounds containing C-X bonds in which X is oxygen or
nitrogen. They include naturally-occurring carbonyl
hydrolases and recombinant carbonyl hydrolases.
Naturally occurring carbonyl hydrolases principally
include hydrolases, e.g. lipases and peptide
hydrolases, e.g. subtilisins or metalloproteases.
Peptide hydrolases include «-aminoacylpeptide
hydrolase, peptidylamino-acid hydrol,ase, acylamino
hydrolase, serine carboxypeptidase, metallocarboxy
peptidase, thiol proteinase, carboxylproteinase and
metalloproteinase. Serine, metallo, thiol and acid
proteases are included, as well as endo and exo
proteases.
"Recombinant carbonyl hydrolase" refers to a carbonyl
hydrolase in which the DNA sequence encoding the
naturally occurring carbonyl hydrolase is modified to
produce a mutant DNA sequence which encodes the
substitution, insertion or deletion of one or more
amino acids in the carbonyl hydrolase amino acid
sequence. Suitable modification methods are disclosed
herein and in EPO Publication No. 0130756 published
January 9, 1985.
Subtilisins are bacterial carbonyl hydrolases which
generally act to cleave peptide bonds of proteins or
peptides. As used herein, "subtilisin" means a
naturally occurring subtilisin or a recombinant
subtilisin. A series of naturally occurring
subtilisins is known to be produced and often secreted
1 341 X80
-13-
by various bacterial species. Amino acid sequences of
the members of this series are not entirely
homologous. However, the subtilisins in this series
exhibit the same or similar type of proteolytic
activity. This class of serine proteases shares a
common amino acid sequence defining a catalytic triad
which distinguishes them from the chymotrypsin related
class of serine proteases. The subtilisins and
chymotrypsin related serine proteases both have a
catalytic triad comprising aspartate, histidine and
serine. In the subtilisin related proteases the
relative order of these amino acids, reading from the
amino to carboxy terminus is aspartate-histidine
serine. In the chymotrypsin related proteases the
relative order, however is histidine-aspartate-serine.
Thus, subtilisin herein refers to a serine protease
having the catalytic triad of subt:ilisin related
proteases.
"Recombinant subtilisin" refers to a subtilisin in
which the DNA sequence encoding the subtilisin is
modified to produce a mutant DNA sequence which
encodes the substitution, deletion or insertion of one
or more amino acids in the naturally occurring
subtilisin amino acid sequence. Suitable methods to
produce such modification include those disclosed
herein and in EPO Publication No. 0130756. For
example, the subtilisin multiple mutant herein
containing the substitution of methionine at amino
acid residues 50, 124 and 222 with phenylalanine,
isoleucine and glutamine, respectively, can be
considered to be derived from the recombinant
subtilisin containing the substitution of glutamine at
residue 222 (Q222) disclosed in EPO Publication No.
0130756. The multiple mutant thus is produced by the
substitution of phenylalanine for methionine at
1341280
-14-
residue 50 and isoleucine for methionine at residue
124 in the Q222 recombinant subtilisin.
"Carbonyl hydrolases" and their genes may be obtained
from many procaryotic and eucaryotic organisms.
Suitable examples of procaryotic organisms include
gram negative organisms such as ~. coli: or pseudomonas
and gram positive bacteria such as micrococcus or
bacillus. Examples of eucaryotic organisms from which
carbonyl hydrolase and their genes may be obtained
include yeast such as S. cerevisiae, fungi such as
Aspergillus sp., and non-human mammalian sources such
as, for example, Bovine sp. from which the gene
encoding the carbonyl hydrolase chymosin can be
obtained. As with subtilisins, a series of carbonyl
hydrolases can be obtained from various related
species which have amino acid sequences which are not
entirely homologous between the members of that series
but which nevertheless exhibit the same or similar
type of biological activity. Thus, non-human carbonyl
hydrolase as used herein has a functional definition
which refers to carbonyl hydrolases which are
associated, directly or indirectly, with procaryotic
and non-human eucaryotic sources.
A "carbonyl hydrolase mutant" has an amino acid
sequence which is derived from the amino acid sequence
of a non-human "precursor carbonyl hydrolase". The
precursor carbonyl hydrolases include naturally-
occurring carbonyl hydrolases and recombinant carbonyl
hydrolases. The amino acid sequence of the carbonyl
hydrolase mutant is "derived" from the precursor
hydrolase amino acid sequence by the substitution,
deletion or insertion of one or more amino acids of
the precursor amino acid sequence. Such modification
is of the "precursor DNA sequence" wraich encodes the
1341280 _
-15-
amino acid sequence of the precursor carbonyl
hydrolase rathern than manipulation of the precursor
carbonyl hydrolase per se. Suitable methods for such
manipulation of the precursor DNA sequence include
methods disclosed herein and in EPO Publication No.
0130756.
Specific residues of _B. amylolic~uefaciens subtilisin
are identified for substitution, insertion or
deletion. These amino acid position numbers refer to
those assigned to the ~. amyloliquefaciens subtilisin
sequence presented in Fig. 1. The invention, however,
is not limited to the mutation of this particular
subtilisin but extends to precursor carbonyl
hydrolases containing amino acid residues which are
''equivalent" to the particular identified residues in
B. amylolisuefaciens subtilisin.
A residue (amino acid) of a precursor carbonyl
hydrolase _is equivalent to a residue of B.
amyloliquefaciens subtilisin if it is either
homologous (i.e., corresponding in position in either
primary or tertiary structure) or analagous to a
specific residue or portion of that residue in _B.
amyloliquefaciens subtilisin (i.e., having the same or
similar functional capacity to combine, react, or
interact chemically).
In order to establish homology to primary structure,
the amino acid sequence of a precursor carbonyl
hydrolase is directly compacted to the
amvloliquefaciens subtilisin primary sequence and
particularly to a set of residues known to be
invariant in all subtilisins for which sequence is
known (Figure 5C). After aligning the conserved
residues, allowing for necessary insertions and
'!341280
-16-
deletions in order to maintain alignment (i.e.,
avoiding the elimination of conserved residues through
arbitrary deletion and insertion), the residues
equivalent to particular amino acids in the primary
sequence of _B. amyloliguefaciens subtilisin are
defined. Alignment of conserved residues preferably
should conserve 100% of such residues. However,
alignment of greater than 75% or as little as 50% of
conserved residues is also adequate to define
equivalent residues. Conservation of the catalytic
triad, Asp32/His64/Ser221 should be ma~.ntained.
For example, in Figure 5A the amino acid sequence of
subtilisin from $. amyloliguefaciens _B. subtilisin
var. I168 and $. lichenformis (carlsbergensis) are
aligned to provide the maximum amount of homology
between amino acid sequences. A comparison of these
sequences shows that there are a number of conserved
residues contained in each sequence. These residues
are identified in Fig. 5C.
These conserved residues thus may be used to define
the corresponding equivalent amino acid residues of $.
amylolic~uefaciens subtilisin in other carbonyl
hydrolases such as thermitase derived from
Thermoactinomyces. These two particular sequences are
aligned in Fig. 5B to produce the maximum homology of
conserved residues. As can be seen there are a number
of insertions and deletions in the thermitase sequence
as compared to $. amvloliquefaciens subtilisin. Thus,
in thermitase the equivalent amino acid of Tyr217 in
$. amyloliguefaciens subtilisin is the particular
lysine shown beneath Tyr217.
In Fig. 5A, the equivalent amino acid at position 217
in $. amYloliguefaciens subtilisin is Tyr. Likewise,
1341 ~~0
-17-
in ~. subtilis subtilisin position 217 is also
occupied by Tyr but in ~. licheniformis position 217
is occupied by Leu.
Thus, these particular residues in thermitase, and
subtilisin from $. subtilisin and B_. licheniformis may
be substituted by a different amino acid to produce a
mutant carbonyl hydrolase since they are equivalent in
primary structure to Tyr217 in ~. amyloliquefaciens
subtilisin. Equivalent amino acids of course are not
limited to those for Tyr217 but extend to any residue
which is equivalent to a residue in _H. amylolique-
faciens whether such residues are conserved or not.
Equivalent residues homologous at the level of
tertiary structure for a precursor carbonyl hydrolase
whose tertiary structure has been determined by x-ray
crystallography, are defined as those for which the
atomic coordinates of 2 or more of the main chain
atoms of a particular amino acid residue of the
precursor carbonyl hydrolase and _H. amyloliquefaciens
subtilisin (N on N, CA on CA, C on C, and 0 on 0) are
within 0.13nm and preferably O.lnm after alignment.
Alignment is achieved after the best model has been
oriented and positioned to give the maximum overlap of
atomic coordinates of non-hydrogen protein atoms of
the carbonyl hydrolase in question to the _B.
amyloliquefaciens subtilisin. The best model is the
crystallographic model giving the lowest R factor for
experimental diffraction data at the highest
resolution available.
E~Fo(h)~-~Fc(h)~
R factor
E Fo (h)
h
1 34~ 280
-18-
Equivalent residues which are functionally analogous
to a specific residue of ~. amyloliquefaciens
subtilisin are defined as those amino acids of the
precursor carbonyl hydrolases which may adopt a
conformation such that they either alter, modify or
contribute to protein structure, substrate binding or
catalysis in a manner defined and attributed to a
specific residue of the ~. amyloli~cuefaciens
subtilisin as described herein. Further, they are
those residues of the precursor carbonyl hydrolase
(for which a tertiary structure has been obtained by
x-ray crystallography), which occupy an analogous
position to the extent that although the main chain
atoms of the given residue may not satisfy the
criteria of equivalence on the basis of occupying a
homologous position, the atomic coordinates of at
least two of the side chain atoms of the residue lie
with 0.13nm of the corresponding side chain atoms of
am~loliquefaciens subtilisin. The three
dimensional structures would be aligned as outlined
above.
Some of the residues identified for substitution,
insertion or deletion are conserved residues whereas
others are not. In the case of residues which are not
conserved, the replacement of one or more amino acids
is limited to substitutions which produce a mutant
which has an amino acid sequence that does not
correspond to one found in nature. In the case of
conserved residues, such replacements should not
result in a naturally occurring sequence. The carbonyl
hydrolase mutants of the present invention include the
mature fonas of carbonyl hydrolase mutants as well as
the pro- and prepro-forms of such hydrolase mutants.
The prepro-forms are the preferred construction since
?~4?2~0__
-19-
this facilitates the expression, secretion and
maturation of the carbonyl hydrolase mutants.
"Expression vector" refers to a DNA construct
containing a DNA sequence which is operably linked to
a suitable control sequence capable of effecting the
expression of said DNA in a suitable host. Such
control sequences include a promoter to effect
transcription, an optional operator sequence to
control such transcription, a sequence encoding
suitable mRNA ribosome binding sites,, and sequences
which control termination of transcription and
translation. The vector may be a plasmid, a phage
particle, or simply a potential genomic insert. Once
transformed into a suitable host, the vector may
replicate and function independently of the host
genome, or may, in some instances, integrate into the
genome itself. In the present specification,
"plasmid" and "vector" are sometimes used
interchangeably as the plasmid is the most commonly
used form of vector at present. However, the
invention is intended to include such other forms of
expression vectors which serve equivalent functions
and which are, or become, known in the art.
The "host cells" used in the present invention
generally are procaryotic or eucaryot~ic hosts which
preferably have been manipulated by the methods
disclosed in EPO Publication No. 01.0756 to render
35
134120
-20-
them incapable of secreting enzymatically active
endoprotease. A preferred host cell for expressing
subtilisin is the Bacillus strain BG2036 which is
deficient in enzymatically active neutral protease and
alkaline protease (subtilisin). The construction of
strain BG2036 is described in detail in. EPO Publicatin
No. 0130756 and further described by Yang, M.Y., et
al. (1984) J. Bacteriol. ~b_0, 15-21. Other host cells
for expressing subtilisin include Bacillus subtilis
1168 (EPO Publication No. 0130756).
Host cells are transformed or transfected with vectors
constructed using recombinant DNA techniques. Such
transformed host cells are capable of either
replicating vectors encoding the carbonyl hydrolase
mutants or expressing the desired carbonyl hydrolase
mutant. In the case of vectors which encode the pre
or prepro form of the carbonyl hydrolase mutant, such
mutants, when expressed, are typically secreted from
the host cell into the host cell mediuia.
"Operably linked" when describing the relationship
between two DNA regions simply means that they are
functionally related to each other. For example, a
presequence is operably linked to a peptide if it
functions as a signal sequence, participating in the
secretion of the mature form of the protein most
probably involving cleavage of the signal sequence. A
Promoter is operably linked to a coding sequence if it
controls the transcription of the sequence; a ribosome
binding site is operably linked to a coding sequence
if it is positioned so as to permit translation.
The genes encoding the naturally-occurring precursor
carbonyl hydrolase may be obtained in accord with the
1341280_.
-21-
general methods described herein in FPO Publication
No. 0130756.
Once the carbonyl hydrolase gene has been cloned, a
number of modifications are undertaken to enhance the
use of the gene beyond synthesis of the naturally-
occurring precursor carbonyl hydrolase. Such
modifications include the production of recombinant
carbonyl hydrolases as disclosed in FPO Publication.
No. 0130756 and the production of carbonyl hydrolase
mutants described herein.
The carbonyl hydrolase mutants of the present
invention may be generated by site specific
mutagenesis (Smith, M. (1985) Ann, Rev. Genet. 423;
Zoeller, M.J., et al. (1982) Nucleic Acid Res. 10,
6487-6500), cassette mutagenesis (EPO Publication No.
0130756) or random mutagenesis (Shortle, D., et al.
(1985) Genetics, 11G, 539; Shortle, D., et al. (1986)
Proteins: Structure, Function and Genetics, 1, 81;
Shortle, D. (1986) J. Cell. Biochem, 30, 281; Alber,
T., et al. (1985) Proc. Natl. Acad. of Sci., 82, 747;
Matsumura, M., et al. (1985) J. Biochem., 260, 15298;
Liao, H., et al. (1986) Proc. Natl. Acad. of Sci., 83
576) of the cloned precursor carbonyl hydrolase.
Cassette mutagenesis and the random mut:agenesis method
disclosed herein are preferred.
The mutant carbonyl hydrolases expressed upon
transformation of suitable hosts are screened for
enzymes exhibiting one or more properties which are
substantially different from the properties of the
precursor carbonyl hydrolases, e.g., changes in
substrate specificity, oxidative stability, thermal
stability, alkaline stability, resistance to
1341280
-22-
proteolytic degradation, pH-activity profiles and the
like.
A change in substrate specificity is defined as a
difference between the kcat/Km ratio of the precursor
carbonyl hydrolase and that of the hydrolase mutant.
The kcat/Km ratio is a measure of catalytic
efficienty. Carbonyl hydrolase mutants with increased
or diminished kcat/Km ratios are described in the
examples. Generally, the objective will be to secure
a mutant having a greater (numerically large) kcat/Km
ratio for a given substrate, thereby enabling the use
of the enzyme to more efficiently act on a target
substrate. A substantial change in kcat/Km ratio is
preferably at least 2-fold increase or decrease.
However, smaller increases or decreases in the ratio
(e. g., at least 1.5-fold) are also considered
substantial. An increase in kcat/Km ratio for one
substrate may be accompanied by a reduction in kcat/Km
ratio for another substrate. This is a shift in
substrate specificity, and mutants exhibiting such
shifts have utility where the precursor hydrolase is
undesirable, e.g. to prevent undesired hydrolysis of a
particular substrate in an admixture of substrates.
~ and kcat are measured in accord with known
procedures, as described in EPO Publication No.
0130756 or as described herein.
Oxidative stability is measured either by known
procedures or by the methods described hereinafter. A
substantial change in oxidative stability is evidenced
by at least about 50% increase or decrease (preferably
decrease) in the rate of loss of enzyme activity when
exposed to various oxidizing conditions. Such
oxidizing conditions are exposure to the organic
1~41C80
-23-
oxidant diperdodecanoic acid (DPDA) under the
conditions described in the examples.
Alkaline stability is measured either by known
procedures or by the methods described herein. A
substantial change in alkaline stability is evidenced
by at least about a 5% or greater increase or decrease
(preferably increase) in the half life of the
enzymatic activity of a mutant when compared to the
precursor carbonyl hydrolase. In the case of
subtilisins, alkaline stability was measured as a
function of autoproteolytic degradation of subtilisin
at alkaline pH, e.g. for example, O.1M sodium
phosphate, pH 12 at 25° or 30°C.
Thenaal stability is measured either by known
procedures or by the methods described herein. A
substantial change in thermal stability is evidenced
bY at least about a 5% or greater increase or decrease
(preferably increase) in the half-life of the
catalytic activity of a mutant when. exposed to a
relatively high temperature and neutral. pH as compared
to the precursor carbonyl hydrolase. In the case of
s~tilisins, thermal stability is measured by the
autoproteolytic degradation of subtilisin at elevated
temperatures and neutral pH, e.g., for example 2mM
calcium chloride, 50mM MOPS pH 7.0 at °_i9°C.
The inventors have produced mutant subtilisins
containing the substitution of the amino acid residues
of ~. am~rloliquefaciens subtilisin shown in Table I.
The wild type amino acid sequence and DNA sequence of
~. am~yloliquefaciens subtilisin is shown in Fig. 1.
134~~~0
-24-
TABLE I
Residue Rep lacement Amino Acid
Tyr21 A F
Thr22 C
Ser24 C
Asp32 N Q S
Ser33 A T
Asp36 A G
G1y46 V
A1a48 E V R
Ser49 C L
Met50 C F V
Asn77 D
Ser87 C
Lys94 C
Va195 C
Leu96 D
Tyr104 A C D E F G H K L M N P Q R S T V W
I
I1e107 V
G1y110 C R
Metl24 I L
A1a152 G S
Asn155 A D H Q T
G1u156 Q S
G1y166 A C D E F H I L M N P Q R S T V W Y
K
G1y169 A C D E F H I L M N P Q R S T V W Y
K
Lys170 E R
Tyr171 F
Pro172 E Q
Phe189 A C D E G H I L M N P Q R S T V W Y
K
Asp197 R A
Met199 I
Ser204 C R L P
Lys213 R T
Tyr217 A C D E F G H K L M N P Q R S T V W
I
Ser221 A C
Met222 A C D E F G H K L N P Q R S T V W Y
I
9341280
-25-
The different amino acids substituted are represented
in Table I by the following single letter
designations:
Amino acid
or residue 3-letter 1-letter
thereof symbol symbol
Alanine Ala A
Glutamate Glu E
Glutamine Gln Q
Aspartate Asp D
Asparagine Asn N
Leucine Leu L
Glycine Gly G
Lysine Lys K
Serine Ser S
Valine Val V
Arginine Arg R
Threonine Thr T
Proline Pro P
Isoleucine Ile I
Methionine Met M
Phenylalanine Phe F
Tyrosine Tyr Y
Cysteine Cys C
Tryptophan Trp W
Histidine His H
Except where otherwise indicated by context, wild-type
amino acids are represented by the above three-letter
symbols and replaced amino acids by the above
single-letter symbols. Thus, if the methionine at
residue 50 in $. amvloliguefaciens subtilisin is
134'280
-26-
replaced by phenylalanine, this mutation (mutant) may
be designated Met50F or F50. Similar designations
are used for multiple mutants.
In addition to the amino acids used to replace the
residues disclosed in Table I, other replacements of
amino acids at these residues are expected to produce
mutant subtilisins having useful properties. These
residues and replacement amino acid~~ are shown in
Table II.
20
30
134.1280
-27-
TABLE II
Residue Replacement Amino Acids)
Tyr-21 L
Thr22 K
Ser24 A
Asp32
Ser33 G
G1y46
A1a48
Ser49
Met50 L K I V
Asn77 D
Ser87 N
Lys94 R Q
Va195 L I
Tyr104
Met124 K A
Al$152 C L I T M
Asn155
G1u156 A T M L !t
G1y166
G1y169
Tyr171 K R E Q
pro172 D N
Phe189
Tyr217
Ser221
Met222
Each of the mutant subtilisins in Table I contain the
replacement of a single residue of the
am~rlolic~uefaciens amino acid secduuence. These
particular residues were chosen to probe the influence
1341280
-28-
of such substitutions on various properties of B.
amyloliguefacien subtilisin.
Thus, the inventors have identified Met124 and Met222
as important residues which if substituted with
another amino acid produce a mutant subtilisin with
enhanced oxidative stability. For Met124, Leu and Ile
are preferred replacement amino acids. Preferred
amino acids for replacement of Met222 are disclosed in
~PO Publication No. 0130756.
Various other specific residues have also been
identified as being important with regard to substrate
specificity. These residues include Tyr104, A1a152,
G1u156, G1y166, G1y169, Phe189 and Ty:r217 for which
mutants containing the various replacement amino acids
presented in Table I have already been made, as well
as other residues presented below for which mutants
have yet to be made.
The identification of these residues, :including those
yet to be mutated, is based on the inventors' high
resolution crystal structure of ~. amyloli~uefaciens
s~tilisin to 1.8 A (see Table III) , their experience
with ~n v, itro mutagenesis of subtilisin and the
literature on subtilisin. This work and the x-ray
crystal structures of subtilisin containing covalently
bound peptide inhibitors (Robertus, J.D., et al.
(1972) Hiochemistry ~,~,, 2439-2449), product complexes
(Robertus, J.D., et ~,. (1972) B~ochemistrv 11,
4293-4303), and transition state analogs (Matthews,
D.A., Wit" al (1975) J. Hiol. Chem. X50, 7120-7126;
Poulos, T.L., ~t ~. (1976) J. Biol. Chem. 251,
.~5 1097-1103), has helped in identifying an extended
J
peptide binding cleft in subtilisin. This substrate
binding cleft together with substrate is schematically
~ 341 ~8 0
-29~
diagramemed in Fig. 2, according to the nomenclature
of Schechter, I., et ~. (1967) Biochem Bio. Res.
Commun. ~7, 157. The scissile bond in the substrate
is identified by an arrow. The P and P' designations
refer to the amino acids which are positioned
respectively toward the amino or carboxy terminus
relative to the scissle bond. T;he S and S'
designations refer to subsites in the substrate
binding cleft of subtilisin which interact with the
corresponding substrate amino acid residues.
20
30
1 34~ 280
-30-
Atomic Coordinates for the
Apoenzyme Form of $, An~rloliquefaciens
Subtilisin to 1.8AResolution
i ala r Il.131 s3.Ils -1!.751 I ala Ca 1!.111 11.17. -tl.las
I ala c 11.731 se.!s -11.32. I 1la o 11.31 sl.llT tl.lTs
I ua C tl.o!! fl.slt -11.13 t clr r 11.11 1!.a 112..1
i Gar ca 17.11! lt.eol -11..31 t GlY c 11.75 T.TOa -t.!!2
t GlY o 11.T1s ~T.1s -11.1!1 t Glr c1 ll.lts l.Tle -12.11!
t GAY cc ls.atl lT.ses -11.17 t Glr co 13.!12 1T.Tz -tz.l3o
t GW ofl l3.ot3 11.11 -2.117 : Glr rEt ll.lls 11.17 -t3.sta
! sE1 r 11.!77 lT.tos -1!.st 3 sE1 ca 1T.lse ls.ell 11!.!37
3 st1 c 11.T3s 11.11 -11.1!1 s set o ls.slo s.3s2 -IS.:t!
sE1 c1 11.s11 1s.131 -I.ea! ! sE1 oc 1t.1t ll.tlo -IT.11!
1 vw r 11.!!1 w.wa -Il.Trs a vw ca ls.l.1 11.11 -Il.l3!
4 vas c 11. I2! 11.!31 -11.:10 1 gal 0 11.113 1.171 -I.a
1 vas c1 1!.001 11.12 -to.tz a vu cGI I1.T1 1.sTt -te.Tl1
vm cct Il.o3T lt.zll -11.11 s r1o r ls.t3! t.IOa -17.331
s r1o ca ls.3t. l..ls -Il.o2T s r1o c ls.sel !!.los -1.11!
s rao 0 11.ts !1.213 -17.11 s r1o c! ll.lso 1.0 -IS.tl3
S r10 CG 13.1.1 3.15 -If.ltl f Ie0 CO 11.11 11. 17.111
l1
TTt Y 11.3x3 3l.to -1s.117 1 ttt CI 11.11 3T.o3 -IS.IIs
1 TTt c ts.3s! 3x.!75 -ls.stt 1 Ttt o ls.ttl !s.ll3 -Il.t3s
1 Trt c1 It.tv 37.33 -11.13. 1 Tt1 cc le.otl ls.l.T -IS.ess
1 TTt col 11.131 35..51 -11.36 1 TTI C0t 11.1!1 31.le1 -11.11
1 Ttt CEI I.s3s 3..110 -11.6s3 1 TTt CEt !7.115 33.5!! -I1.3T1
1 TIt C2 11.11 33.11. 15.121 1 Ttt 0h 11.31! 11.131 -ls.!!1
1 Gl1 r 11..11 !7.312 -11.130 1 Gl1 Ca 13.11 11.11 -11.171
t Glt c lz.loo 31.s3s -ls.lTO t Gm o !1.717 ls.ltl -IS.113
a vW r 12.111 3T. il.s.1 a val ca 11.777 lT.s23 -IT.131
s2!
1 vat C 1.313 31.33 -I.T3s vat 0 11.13! !5.111 -1l.lTo
~a~ C 11.T1s 31.!00 -11.57 s ~aL CGI ll.IO1 31.el3 -1!.113
1 vas cct 1.111 I!.l11 -IT.T33 1 sE1 r 13.11 31.311 -ll.TTs
! sE1 Ca l..~l! 3s.31t -1l.flt fE1 C 11.111 31.!20 -1.115
1 sE1 0 11.112 !3.111 11.!01 1 tEltC 11.11! ls.l3t -ll.so5
SEt oG 11.1? 11.7.1 to.3s1 11 6111r 11.1!1 13.17 -IT.112
11GAY Ca 13. l1. 1!.131 -li.Ta to ilk C 11.17 !1.111 -17.77
11GLY 0 lt.tls lo. -17..13 1 Glr C ll.lts 71.15 1s.11e
a.1
I Glr LG 11.1!5 11.117 -11.511 11 GlY Co 11.1 !1.111 11.111
11GLY 0E1 ll.ss. 33.11 -11.7!1 to GlY rEt ll.sst lo.!o -lt.tsl
II1~E r il.lts lt.sTS 11.17 11 IlE Ca 11.173 31.!01 -le.l2
I1ICE C Io.t01 11.71 -1!.105 11 I~E 0 1.173 11.133 -t.Io
ilIlf CI 1.132 31.111 -17.!75 il IlE CGI !.11 !1.117 -11..!
11i~E CGt 1.112 1.155 ls.lll 11 IlE C0I T.sl1 !1.111 -IT.lt3
ItWs r 11.272 3t.1s -to.tTT it lts Ca 11.311 11.11! -11.72
12lts c lo.s1 33.1x -it.stt 1t lts o lo.lTe 3.713 -3.11
12lts c1 ll.tsT lo.lla -tt.:l1 it ms cc i:.tl3 tl.l3e -11.13
12W Co lt.s.3 tl.slT -t2. IS! it lts CE 13.13 17.17 tl.Ila
s
1tlts rt 1.17 tT.llo -to.t3s 13 am r lo.le! 31.13 -tl.!!1
13ala Ca l.3ts 3s.1lt 2.131 i3 aW C 11.1 3f.T11 -3.113
13a 0 1.331 ls.lol -t..lel 13 1la c1 .s s1.1ls -:l.sls
l1r1o r 11.33 !s.ls -13.1!3 11 r1o ca il.lts ll..3e -ts.lte
11r1o c 11.1!1 ls.ssT -1.317 11 reo 0 11.77 !1..T -tT.lls
l1r1o C 13.112 ~l.sle -11.!2 i r1o CG 13.31 11.!11 -13.11!
l1r1o co 11.21 !s.l31 t:.ts1 is a~a r lI.sl1 ll.:) -11.11!
isla ca 11.37! l3.lse -17.37 is 1aa c 11.e1t !3. -tl.lu
s
isala o 1.11 13.11 t 1.111 is 1la C Il.sst !1.111 -17.12
11ltu r 1.1s !1.131 -11.11! 11 AEU Ca T.tll il.fsl -17.11
11ltu C 1.111 1f.ltf ti.stl l1 lEU a t.)1t 111.11 tl.stl
!1lEu C .111 11.13 -1.111 11 1E11CG f.t1 l3.11s -t.stt
11LE11C11 f.11 !3.=3. t1.! 11 lEU Cot 1.!1 11.1!7 -:1.13
iTHIS r 1.11s !1.111 -11.11 1T rls ca 1.111 fl.ISI -t1.s31
1Tr:s t l.sl1 !t.!1 -tl.1lo it HIS a !.lt s1.tt -!.sa
itrIS c1 .711 !.Ie -tT.lsl 1T ~ls cc !.Is 11.:11 -1.112
itrli rol .!3 !!.eT -ts.lTt it rIS ut 1.11 !1.lt. -ts.1l
l1HIS CEI .111 !1.111 -11.11 it rli rEI 1.111 71.)1 -11.31!
11.ittr 11.111 17.113 -71.11 11 itt Ca 11.11 1. t3! 11.122
1341280_
-31-
se 0sfc fe.isl tl.~:s lr.r~r se 0efa eØ1 ~e.f~: 01.0s.
0efce ft.ls~ 0s.111 -l~.ff: re 0t o: ss.s:> tI.lle 0e.e11
11 im Y ~.eeo 0s..ls f~.l.! f1 m c1 e.ee: ~.w st.0le
r :
11 tvrc t.r: el.m ss.los r1 taro I.:11 ee.W -s..tr1
r
to i ce t.x:i ss.e.1 -st.:o t1 i cc t.lls s:.ee: -si.ees
s1 iw co I.e:s si.lol -si.ts f1 iw eti e.lr1 ~r.em r...
~
s1 oarrt: t.s: so.st .se.:s1 0o i~rr t.l0s ft.t:! -st.ell
~e l1 ca I.ll1 !1.111 -1:.111 !0 1~1c .s11 ie.ll: li.eee
io t~10 .:s 01.:11 s:.:is :r tIfr 0.tet tl.eos se.tli
ti 11fc1 .m a sl.0si t1.1s tr tIfc 1.e11 e1.s: :.s:s
11fo 0..:: sl.e?. t1.111 0i IIfce s.lle el..l~ tl...s
ti 11fcc :.11s ss.l0. so.lel ;t 11 col 0.1s 0l.ss: ss.se
ti tIfcoi s.ISO s..11 -s~.le, tr tIfcci s.so1 0s.111 st.l.1
=f tIftti 1.fr 1..111 lt.111 tl 111ct =.111 ..tle 11.11
ti 11fo~ r.lo> >..t.i -s..eso t: t~fY 0.ei el.Iee tl.tel
tt t~fc1 1.:1: ~o.s:1 .tl.stl tt t~ c 0.els ~e.~tt -:Lx..
:t trfo s.:11 .s.~:s :s.s:s := 1f ce 0.rss as.lsl tl.Iii
xt f~faG1 ..111 1=.s1 t1.111 !! 1wfCGt L 411 11.lt1 tl.etl
0i1Y f.s1 ~o.tes .tl..ss t! ailc1 0.oe1 le.ICa =s.
l.:
:r cm c -o.is1 1s.si :.m a :s 0v10 s.eis I:.els es.sso
t ef r -o.o:s w .111 t,.! t. 0t c1 e.el1 ~t.~s, .te.e~t
t~ 0efc =.sr 1:.I:1 tl.el. t. 0efo -:.eis lf.0e1 te.ile
t sf c0 -o.ls ls.i:c :.s:o : 00fac o.ss ~s.Il: :.t:e
:s as.Y -s.os1 1s.11: -fl.sis is aspca ..ew I0.Ie1 -:l.ss
:s Isrc e.ois .:.01s tl.ts :s asro -L xss ~t.Ile -tl.rle
is asrc1 -0.ils ls.t:1 te.lo~ :s asrcc -..IO ~l.sle -:.s
xs asroo~ 1.s 1s.111 -si.oes is asrwa: 1.1.1 1e..li tl.sl.
_ 11~r ..111 1=.1 :.tt :1 talc1 .e1 lr.all :1.
r1!
t1 ~w c 1.1s: l:.es: -=:.s1 t ~w o -s.es1 ls.lil ::.Ie1
:1 a~ c1 s.li. lo.sos -:s.l:i :I a~ ccs l.rlo el.lo: ::.s.e
t1 em cc: s.el1 s1.s11 -tl.om t1 GIs~ -s.lio lf.Im tt.soi
:1 vIsca .irs ls.s:. t~.ils a vTfc s.es1 a:.01: ~e.es
:1 GIso -a..os 1i.01s r1.i! t1 ms ce -1.0 1s.11i .ti.i1
t~ ~Ircc 0Ø1 1.01s tt..lo t1 ifsca -.sti 11.10: tt.e:o
m ce io.sa. 10..11 ts.isl t1 ~I:Y: -1.111 ll.ess x..tl.
s
to 11~r ...eis 1s..1: -rl.:o~ t1 ~a~c1 1.1s1 :.so -r1.111
t1 vavc ..111 1s.s1 -x1.1:s x1 rm o -..xe1 ls.els -m.1~1
s1 ~a~ce -:.1:1 :.111 -r1.11: :1 ~~~cai :..I ~:.rs f L
111
:s a~ cc: -:.111 li.los fl.rls x1 w r -s.le. w.s:1 xe.lis
=1 w ca -t.11 w .sso f.IS1 t1 w c -l.lso ~..wo rs.sss
t1 a~10 ..111 1t.l.s -rs.io. t1 a~1c1 -1. r1: 1.111 -fl.fli
so vw r -..ss1 ~.osr -il.ol: 00 ~w c1 s.xl1 1..1I: .m.l~o
se w c s.s1 10..01 -fe.lli so m o -1.r01 1I. -r0.e11
L 1
eo a~ c1 .i.Ie1 ls.0io s:.i.1 eo ~a~cai e.l,e1 11.oi -re.llo
so r1ica: -r.ess .ts1 is.sol m =~tY 1.0i. w.s~s 1.11
si titc1 -s.st1 1..1.1 0.11 m titc -1. s.1 a .s .tØ1
ss tv10 -s.0:s 1s.1~1 -1.111 !~ :~tc1 -Lls~ ~s.111 0.se~
si tvtcci -t.:le ls.lol -1.1s si tm cc: -1.t11 ~l.0re -t.::s
sr titcoi .i1 lt.esl -1.111 st a1 Y ..e1 11.ss -1.a1
s: as c1 -t. w..11 L :ss 0: as c -s.elr 11.011 1.1s
e..
s: as o ..~11 ll..s1 -0.se: s: a1 ce f.I~s le.i:1 t.el:
st as cc e..s ~0.1e: I.:~! s: as eai ~.el. ~1.0s: -e.sl1
st asroa: e.el~ X1.1:1 0.sso ~! oef~ i.~li ~0.t: -0.
s1
s! osfca i.els 1e.s1 .l.0oi ~! 00fc -f. let oe.11 -s.111
11 etfa 1.101 1!.111 e.lll is ff ce 1.1111 .:i s.111
as 0efoc 0.sss 0o.o:s -..11. 0 im ~ .:.rls ee.llo 1.
e1.
s. im ca .t.:ss 0r.1:1 0.11 ~. m c s.e0s 01.1.1 -1.111
1
s. iw o -.i.. 0e. 0.11 os :~tw -ells 0:..si .ie.rer
em
a1 thec1 e.:o1 a:..s1 -io.lls 00 :~ec 0.ele 0s.s1 ~s.:s
a1 tvto -e.s:1 e..se f~.l.. s1 :vtce e.e.t 01.11 -s:.sl1
as tiecc~ e.eso 0o.eso -f:.el1 ss :~ecc: s.r.1 0f.l.i .rs.sl:
~s w coi -e.elt 1l..es rs..= 01 as r f.0s1 0..ts se.lli
t
01 ao ca 0.sse 01.er1 -fi.t0t e1 as c 0.xei es.s1 il.le:
1341280
-32-
asro s.eoa ss.a~r.s sa asrca s.t ss.~te -re.sra
s,asrcc .s s~.e~~-re.ee. sa asroor sass s~.~~, -rr.azs
saasraot s.aae s~.tm re.tm s~ sre~ ~.~ea s~.otz -rs.rrr
W sEeca s.rw st.zzr-s.. sit stec t.s se.ess -ra.s.s
sisEeo z.sas se.se~-ra.rsr m seeee -e.e~s se.ete -ia.~ee
s~sEeoc -e.ero s s.rss-i~.~ se seer s.res se.ara -ra.eer
sesfeca a.zar ss.sas-~.ae, so srec s.aaa se.~es -ra.
z
sesEeo ~.s.~ se.zsr-rs.zes srea ~.~,z ~o.a~s -i~.s~e
seseeor s.s~a ss.oas-rz.zs ss itsr s.asa st.sse -r.o,z
Hisca e. s~.s~.-is.z~r s~ rrsc a.aer sa.aer -ia.T~e
s~m o s. e ss.e -i~.aw orsce a.a ss.zo~ -ra.srs
s m
s~rrsce e.era sa.aoe-ra.ass itsror s.~~s sa.~sa -rs.sar
m m coz a. m sa.s.sis.sev itscEr ~.~~o s~.~~e -rs.rso
s
m itsrcz s.sm ss.me -m.eoe o rror ~.eo~ sa.esa -m.
set
aereoca ~.~ee sa.~~~-io.e~r to reoc a.rsa ss.zeo r~.sst
e reoo e.esz ss.e te.sie e reois ~.za~ s~.ss~ -m.rm
aoreocr m.os~ s~.aes-m.~ez ao reoco a.see st.asl -ra.T
m
aras r e..m s,.s:e-re..ss w asrooz sr.rae se.ss~ -re.~ae
arasroor re.szs si.3ss-to.azs r asrcc ie.a sr.ser -m.zm
arasrce ~. s st.z ro.zza ar asrca a.aas sz.~s~ -ie.wa
,rasrc ~.sr~ sz.r -re.e ar asro ~.~ se.s.~ -ream
vtAEUr .res sz.eo~re.sse z AEUca a.e~z st.rai -re.aaa
z veuc s.sza sz.~oi-r~.m ~ az vEUo sass sa.rss -r~.a~o
azm ce .azi sz.ise-r~.eoe t vEUcc s.iez sr.sas -rs.~w
a
z ceucor .sss sr.saa-ra.ser z m coz s.tm as.w -ra.sse
a
asms r sere sz.rss-rs.saa w s ca r.,ess sz.us -te.~zr
s DTsc e.s sz.rsa-to. ere s inso a.sea se.~ze -rs.ezo
w s cs t.ezr sz.so~-tz.ras w s cc a.~os st.asa -tz.rro
ajs co e.sse sZ.osi-ta.s s s cE -e.reo sz.sea -ts.zao
11lTSrr e.sji sr.lS1-z.ara a ~a~r -e.r~r ss.ws -r~.a~o
a w ca -i.4o~ s:.ass-re. ms a ~a~c -t.,s,r stew -rs.TSr
asw a -:.azs ss.sea-t a as, as sayce r..aeo ss.ssr -m.sw
as~m ccr -z.~z, sz.sarra.se= 4a IalcGt -e.r1 ss.rla -W.ss~
asam r -s.a~a sr.ssr-m.em as am ca -a.,am si.~m -te.ero
asam c -s. ear sz.so~-zo.esj as wa o -s.,Tw ss.ees -ze.tea
asam ce -a.e3r se.seo-tr.~e~ a em r -s.,~re sz.ssa -re.
me
asem ca -~.eez sz.em -re.oor s e~Tc -a.~t~ sz.aas -ra.s~e
asem o -s.sre sz.eo i.ws a~ em r -e.e~z si.~se -rs.
m
w ccfca -o.ora sz.zw -ra.see ai cm c -s.rts sz.sst -rs.s~z
~~c~~o -~.~ee ss.aer-ra.res o a~ar -s.zzr sz.a,~ -iz.sso
aew ca -ie.zss st.wo -rr.sez ae w c -s,.iso st.aTS -s.
we
aeua o -s.esa sr.me -s.tzs ae aaace -rr.sse sz.roo -ri.am
a~sEer -ie.rw ss.sw -seat 1 sEeCa -~.~sz s~.~ss -~.~sz
w sEec -ro.~.i sz.se~-~.~e~ as sEeo -rr.z s~.~m -~.~oe
a~sEeee - ~.o~z sa.see-~.oz~ ~ sEeoe -e.e sa.zss s.aso
serETr -ie.eas sz.ew -s.~~z se ~m ca -rr.esz si.sw -a.ma
seSETc -rr..a~ sr.~az-s.sar so ~E~o m.~~~ si.sve -z.s~s
se~c~ce -rz.erz so.ere-a.~~a se pctc~ -rr.~rz w .w -~.~e~
seaftso -rs.aao 1 ~.ee~~.zss se rm cE -~t.eov se.rrr -e.~o~
sr~w r -re.azr sz. -s.azz sr ~a~ca -~.~e ss.r~e -z.
me em
sr~a~c -re. o sa.saz-r.re~ sr ~a~o -ie.tsi ss.as~ -t.aez
srsacce -e.aas ss.rss-t. see sr tw cer -t.tsz ss.s -e.esr
sr~a~cet ~. m. sr.ers-t.soz st reor -it.etr sv.a~s -r.es~
streoca -rz.sm ss.~m -e.etr sz reoc -rr.a~e s~.izs -e.aae
szreoa -ir.r se.tzee.szs sz reoce -~s.vae ss.s~. e.zaa
s:reocc -rs.se~ sa.re~e.ees sz reoco -rz.iaa ss.aze -e.r~s
ssseer -re.aaz sa.seaa. as ss seeea -s.sse st.soz e.aez
s~sEec -e.a:e se.tas-e.sz~ ss sEeo -~.~t~ s~.zza -e.ese
s~seece -~.eea st.re~t.e ss stere -e.zss se.szr t.iz~
sacw e.tsa s~.sz~-r.s sa cw ca -r.tea st.~ae -t.azr
r
sac~u -~.~a~ s~.~e~s.~os sa c~uo -Y.s sa.z~ a.sT~
c
s.cm -a.rw s~.s~~t.ssa s. cm cc -s.ze~ s~.~s~ -e.~t~
ca
totug -..waa ss.was-1.11w t C~~~Hs1 -H.Nt t. -1.1
~w ._
1349280
-33-
s,,~r -s. see ss.ttt o.tti ss tear -o.sti so.tsi -.tas
~t
sstreca -s.a se.iti -s.aas ss t~ a -o.taa se.i -a.tts
ss~r o -sa s~.sss - t.oio ss t~ co -io.soa ss.toe -s.ief
sstreoci -sees ee.sse s.so ss trecet es.st ss.saa -.eit
s~asrr -t.aet ss.e~ -~.ti~ sa asrrot -.~~o ai.it -~.o~i
~
s~asrooi -sets so.~~t io.t sa asrcc -s.tt~ s~.~ts -s.sss
saasrce -s.o~o s~.a~a -o. tee sa asrca -s.nt seats e. tee
saasrc -~.e~t s~.e~a -e.sos sa asro s.~ea sa.e~a -t..te
stno r -a.t sa.tsi -s.tse st erocc t.sti ss.tst is.str
streoco -t.sia sa.w -ie.ttt st ~~oce a.aaa sa.~to -ie.t~s
~
streoca -s.a~s sa.tm -s.mt st eeoc -a.sw ss.eat -s.s
stn o -~.se~ sa.ite -~.~.s se r~Er -s.~~e s~.tat -~o.a~i
o
semE ca -:.tat sa.stt -si.ttt so arct -i.tst st.its -m.tss
se~rEo -o. ass st.st -ie.aeo se erscs :.s.s st.set it.ats
so~~Ecc -~.~i~ s~.~~~ -.is~ so r~Ecoi -~.ts~ ss.tee -sa.ess
se~~ecot -s.tii st. -i~.as~ st ~~Eefi ~.ttt ss.tss -ia.~to
o
s 1E Cft -a.i~a s~.o~s -za.tt~ so ~~tct -s.~as ss. -zs.esi
~
s~carr -t.eaa st.iis o.~~e s~ carca -~.i~t s~.st~ -t.s;a
s~carc -e.eot s~.ao~ t.eoo ss earo -i.~ sa.oes ~.iss
sscarce -s.et se.aae -~.ees ss etrce -r.s.t ss.tw -a.wa
ssearco -s.tso ao.ist -s.iso s~ earoEi -i.aea as. -.esa
toe
ssearret -t.sss ss.~es -..tat ao asrr o.ro ss.o~s -t.tii
~oasrca o.esi sa.t~z -a.~o. so asrc i.aai ss.tat -s.eso
aour o t.ett ss.sso -s.t ea aspce sssa ss.t.a -t.iee
~
aoasrcc t.ott st.s~e -~.~eo ~e esreos s.taa st.m -s.~se
~oasroot :.~is si.oa~ -t.eso as asrr o.~sr ss.tas -~.~so
siasrrot -i.fsa st.tat -t.~a~ st asrooi o.aas st.sw -t.ets
siasrcc -e.eae s~.m -t. s ~~ asrce o.sm sa.vei -i.tea
a
~1asrca i.sst ss.ma -t. too si asrc ttm sa.s~t -i.sae
alasro t.sis sa.oat o. sot at asrr t.tio ss.afa -t.we
atasrca t.e st.sae i.tes st asrc a.ita si.t -t..ts
atasro a.ssi ss.m -s.t~o at asrce i.tos si.m -i.ati
a a
atasrcc t.sm so.sej -east a asrooi t.am as.em -i.sw
~:asrrot t.att se.toe o.aoi a~ seer ~.~sz st.iea -~.t~i
~~sceca s.ies si.~w -a.te~ as sE~c s.eti se.ts~ -s.te~
sssEeo s.se3 s.tso -a.tas as sEres a.sts ss.sse -a.eit
assEeoe a.em se.ase -a.ase as r:sr a.tet w.ats -v.w
asitsca i.~~a ~e.ess -a.s ~. itsc ~.a ~~.ts~ -a.t~i
asm o ~.w w.w -t.ioe ~a ~:sc~ s.iea w .soi -s.
s tat
asms tc s.iaa w.oti -i.tta as r:sroi t.~ot vs.tw -. tai
~.riscot .esa ~s.i~a -~.i~s N rIScE1 t.ai~ ~f.l~ -a.esa
~aHISrEt s.ssa ~~.sto -a.e ~s eatr t.tet ~o.ate -a.set
ascm ca i.sst ve.t~a -t.om ~s cm c t.t w.~s~ -~.em
asc~~o t.tse .o.ete -so.isa as T~ar s.t s. ass -e.es:
astieto ~.eaa se.iit -.ss as t~ t s.oes as.ooe -ae.tw
asryeo s.a ve.te~ -.am T~~cs v.tw si.sm -~.wt
w Tw eci ~.m st.a:s - ~.aov w tw cct s.sw st.ete -~e.o4~
at~:sr saes ~t.a.s -~.:ta at ~~sca ~.to~ ~t.~ -~.ase
atrisc a.esi w.r.s io.ias at itso a.as vs.ase -ri.iso
~tr:sce t.soo .t.o -o. ova .t itscc o.s~s ~a.tts -e.iae
m
atr:sroi o.sso w.sot -e.tta at itscot e.soa aa.ate -e.et
~titscei ~.est w.asi -e.t~~ ~t r:srt ie.~te ~s.sia -e.~ev
e 1a~r v.e~t ~s.ta~ -1.t7~ to taito v.lat ~a.et -ie.ta
aerava s.esv a.ee -is.tao ee raao a.ma as. -tt.sis
sat
~ew co t.~~s ~a.tst - s.~ev ~e ~w cci i.~~o a~.t~e -se.ete
aeeareet s.s~s as.tes -e.oee es acar s.sts aa.eas -it.
s
c~aeaa l.eW ~c.aae W.at ~~ W c ~.'i~1 a~.sve -W..l~
~~wa a a.ete as.~i~ ~s.s~s ~~ w cs i.t at.esi -.m~
tocm r s.sae ~a.tet i~.~ia c ca a.s~s ~o.ees -ia.w
tocm c t.ea. as.m -~s.o:~ to cm o t.~ea ~s.isa -ia.m
a
t~~~e ~.tto ~a.am -ta.~~e tt tryca t.ttt W.tm -tv.aa~
r
titre a.tta at.sea -is.sai tr r~nro .e.aet ai.eti ia..ss
c
tie t.i ~t.o~o -~~.i ~~ tw ec~ o.i~i ~t.s~t -~t.o
ce
134 app
-34-
11t~1 cct 1.:11 N.se7 -17.s11 ~r eu r 1.ao 1t.1t -ls.ltt
1teat to a.tt1 :.111 1.101 1t eat c l.slt la. -1t.li
ell
ttrat o 1.7s l:.aee -le.ue tt tat ce t.s7a 1:.elt -ll.ees
tteat cel l.slt l:.lee -st.t ~t eai cc: tilt lt.7t1 -i..ttl
17ata r 1.s1. N.111 1t.11 is 1ta ca l.set 11.e11 -11.11t
11ata C 1.171 11.711 -11.7sS to la r s.et 11.111 -tl.til
1)It1 L ~.11t 11.111 11.177 71 Ita r .s1 a.t1 -11.17s
11ala Ca 1.1t1 11.s1 11.1s1 11 at C t.tle ll.HO tl.at
11ata 1 1.s1 1.10 -ties. 11 ata to Las7 1t.11 -1t.ts
tfLEU r 1.161 11.111 -11.171 1s lEU Ca l.olt 11.11 -tt.lS1
tfttu C 1.111 11.f11 -11.111 tf LEU o 11.111 le.tsl -tt.tSl
isicu t1 t.sl1 so.lli -tt.ool ss icu cc .1t7 s1.ll :z.7t1
istcu col .et1 sz.171 -tt.7eo ~s LEU cot s.e1 se.llz -tl.les
t asr r s.lt 11.107 -t. l1 11 asr rot It.7s 1a.7t -t1.7e1
toasr ool Io.so 1s.1o -tt.t1 to asr cc 11.1s la.ttl -tale:
11asr c1 11.110 11.sl -ts.lel n asr ca Ie.7s1 lt.tal -1.171
11asr c le.tl 11.e11 -ts.1l 1 asr o se.lst 1.111 -t1.a11
ttasr r 11.10 11.. -ts.etl n asr ca It.tte s1.st -ts.11
m asr c l7.tot sl.etl -ts.71 tt asr o 1.711 11.11 -ts.7ll
Ttasr c1 11.77s sz.eTS -a.llt n asr cc li.tso st.ett -11.111
11asr ool It.o7z sl.a1 -11.11 n asr roz Io.tl1 st.tll -tl.ezs
tosca r ll.lzs st.tlt -ts.l s1 sEa ca Is.sl7 sz.1 -t1.1o1
11sEa c 1s.le sz.tlt -:a.ll1 sE1 0 1a.1z s7.Tl 1:1.11
tosea c1 is.los sl.eli -ts.st t1 sc1 oe 1s.t1 s7.to -11.111
t1lic r L .s1 sz.sls -tt.stl 11 =ic ca Is.lss st.te -ti.ize
11ItE c 11.111 s1.1l -to.t7o aE o 1x.117 so.1i -to.t1
istic ce Il.tl s.l m -to.1r lic ccl it.lls sl.e7t -to.oi
t1Itc eet 11. nt ss.7to -11.111 lte coi tt.l7s ss.lt -to.iss
o ctt r 1.s sl.t1 -11.111 oe ciT to 11.1ta s1.11e -It.17
o itT t 11.111 1 1..1 11.111 Ie it1 0 If.ll1 11.11 -11.711
1 Tat r l7.sll 11.11 -1t.11o 11 Tat ca 11.111 11.111 -I.e11
11tat C It.sil 1.11 -11.111 11 Tat o It. t0 11.171 -to.
lit
11eat ca l7.eoi ll.tss -11.x11 11 rat cei 11.070 t.ee. -is.st7
1 Tat CGt 11.x)1 t.tel -1.111 a tEU 11.111 1S. -I.ti
Ns
t LEU ca 11.711 ls.e:o -te.tsl a icu c le. ll.etl -ll.sle
0
t icu o io.s1 17.7s1 -11.100 z tEU t1 l:.tea 11.:11 -11.111
t icu tc 11.10 l.s1 -:1.711 z tcu col 1e.111 v.ls~ -tl.t:~
t tcu tot Iz.ls1 lz.lts 1:1.11: 17 cir r 1.171 1.110 -11.111
IlGl1 Ca 1.177 17.711 -11.11. 17 Gtt C l.etT 1.111 -11.125
17Gt1 0 .s11 11.11 -tl.etl 1 Tat r 1.111 11.111 -11.111
1.Tat ca 1.111 71.oT -11.111 0 Tat t .111 ll.elo -ti.i.o
1.Tat o 1.111 x1.11 -tz.ll. o. Tat c1 . a 1 a1.to -11.11
e.Tat cci s.alo x1.11 -ll.ssT e. Tu cct 1.Io al. -lt.TOs
sot
s ata r s.is 1o.ta -ti.ot is ata ca 1.111 11.11. -tt.isl
esata c 1.117 11.11 -:1.711 s ua o s.tl1 l.el -tt.elo
esata co 1.1.1 11.11 11.111 a eeo r s.tlo 11.111 -zl.osl
11e1o ca s.il 1..lls -t7.tes 11 eao c 1.x11 s.7tl 1:7.1.1
I1~to o 1.111 la.los -tl.evl 11 Leo ce 1.111 11. -tl.eil
t1
e ~o cc t.elo 1.111 -t..sl1 11 Leo co 1.x11 1t.1o -11.171
t sEt r 1.611 11.11 -:.111 17 sEa ca t.le1 s.lt. -ts.szl
11sEa C l.lol ls.ilt 111.1 t sE1 a e.llt ls.sl7 ts.111
t sEa c1 t..oi 1..111 -:1.1:~ et sc1 0: 7.s1 s.il -z~.sll
11ata r l.olt 11. s1. -17.1.1 11 ata ce -0.117 l7.sio -11.11
e as ca -e.ttl 11.7s7 -:t.el. e1 ua c e.ele ls.Tit tt.llo
e ata a -e.lt. 1. tit -tz.ls e1 sE1 ~ -:.cie 1s.111 -tt.w1
11sE1 oc -..11 lt.let -t.zeo e1 sca cs -1. s7 11.117 -11.111
11sE1 ca a.eol 11.11 -tt.:z~ t1 sca c -a: i7 ll.teo -tl.tz~
11sE1 0 -a. a 1s.11 -to.tol o itu r -t.1 11.1sa -to.el~
o tcu ca -1.711 11.111 -IO.sl e itu c -7.lel 1e.17e -11.11
e itu o -7.st 1 1.10. I.:ls e icu cs -o.st le.ttl -11..11
e teu ec -e.z77 ll.osl -11.11. e iru tot -e.eta 1x.7.1 -m .111
11tcu cot 1.110 ll.sz. -It.et 11 tTa r -..111 1r.11. -11.11
1 1~~ ca -s.ts1 1e.T 11.171 11 111 c -1.17 ll.tse 11.1s
1341280
-35-
111 11.!7 1 T11 c1 -1.111 11.1 1.111
11
1 TTe -1.111 . 11.111 l t1t c1 -1.fs 1.11s tl.7ss
1 111
11
i 111 CG , . 11 i tt1 cEi 1.IS lT.s1! 11.11
1.1 -11
i T11 cot -1.11 1.tli . 11 T1t Lt -1.11 .st -1.111
11TTt cEt -e.lis 1.151 1.1z z a a r -1.1s 1.s1 -11.11,
i ttt or -a.toz le.tst -11.111 z ata c -s.ezl so.11 -li.e)
t ata ca -l.sls e.le -lz.tes t ata cs -!.1 si.tt -11.,11
z at1 0 -1.1z) se.eoe -lt.eso I at to 1.11 11.s1 -le.szs
I "at r -s.s 11.~~ -11.1:1 ! at o -1.111 1.I -l.Itz
~
1 tat c -~.~01 1.11 -t.l 1 at cci -.zil 11.11 -.tzs
) pat c1 -1.s7 aT.sss -11.11 ~ cts a -1.et sl.zt7 -.lzt
) eat ccz -1.11s 11.11 -tt.e7z 1 t1s c -1.111 1.11s -s.11.
. tts ca -1.1 sell. 1.1 1 t1s ce -1.si st.11 -1.111
. tts o -1.1s1 so..lo -s.11) 1 t1s co 111 st.sls -s.sl:
-1
tts cG -s.)~ st.lzo -s.lls 1 t1s rc ss.sll 1.111
tls
-I
, tts cE 1.11 sl.zel -1. t1 ca . 11.1s7 -I.lzo
pa 111
-1
s vat r -1.10 1.e~i -s.ez1 s t . ll.lsl -t.sei
o -l
lts
s tat c -1.111 11.1s -t.sl1 s pat . 11.sz -s.lt
cci 111
1
s tat c1 -l.te. 11.111 -1.111 s u. . 71 -t.le.
171 11
-s
s tat ccz -1.00 ll.teo -l.llz 1 tEU r . . -I.lti
c -1 sl.s5
111
11tEU Ca -1.711 1 1.11 1.111 1 tEU . 11.111 -i.s1)
c1 s1
E 1
11tEU a -1.111 si.iti -t. l)1 1 N . 11x -x.111
t tet 11
-t
s1tEU cc -).s11 11.111 -t. o7: 1 tEu CDt . . 1.11
11 1s
-1 !e
1 tEu co! -1.,1! 11.11 -l..S 17 Gtf r . . e.!s
t C )11 st.111
-1
1 Gtr ca -1.10 si.)e7 1.111 1 Gt . l.1 e.ts1
s. sI
-t
i Git o -1.11 si.l1) e.tls 1 ata r . . e.1s
s11 111
- s1
1 ata c1 -o.lz1 ss.l~1 l.slo 1 ata ca . . 1.11)
l1) zt
1 sz
1 ua c 1.111 sl.itl 1.117 e ua o . . l.isi
asr oat 111 sl.l.z
1
asr r -. so. sz.sll 1.11: 1 r cc . si.llt s.11
e1)
-t
asr ooi -t.tlo s1.et 1.11) as . st.111 L 1ss
asr ca lei
asr ce -e.1.1 st.lll s.i7s . 1 1.1:
1ls ls)
a:r c .111 soils !.)zo asr o . . t.lis
ca lll le.szi
-o
leectT r -1.1:1 1.11) t.tla l1o cm . ll 1.171
1 siz
111
leeGt1 c -i.sz1 l.lsi t.eoz l1o cit o . . f.Its
slt 11
-l 17
letsEe r -t.f.t 11.1:1 t.o tt tEt to . . l.o~
ts1 11
l 7:
lol:Et c: -l.ts 11.11 t.sm loi sEt o . . s.ze
111 1).
-1 1e
111tEt C1 -1.111 11.117 1.17 lei sEt 0G . . t.es1
11 1::
-1 11
lotGtr r -s.e:i 11.11: t.s77 lo: GL ca . . 1.1)0
11 1)t
-7 1s
1zGL c -1.111 ll.sll t.sze 11z GL o . . l.ezo
r ca sls 11.117
-la
leicir r -.)m l.IS1 1.111 le) ct . 1s.11z e.lm
111
-1
lo)ctr c -to.1) ls.tlz t.ozz lo) Gtr o . ees 1.s11
c Il1 ll
-lu
lo)Gtr c1 11.171 t.lo7 l.z71 lo) Gtr . . s.oz
c lsl 1 e.ei1
r oEt -lt
G
lo)ctr co -iz.lle .114 1.is lo) t . N .t.1 t.lst
t1f r 111
-11
lo)Gtr rEt 1).11 1. t7 1.111 111 i . w .lse e.1 m
~ c 31
-1x
te.t1t t1 -1:.111 ls.izl i.se1 11. ~ . 111 z.t1)
lsT w
-lz
le.tte o -iz.1)1 l~.zt1 -a.le7 11 tw ce . . L)~t
11 711
-1x !
lo.trt cc -it.lzs lo.sz 1.111 to. me cot . . l.to~
0 11s
I1
11.T1t coz -to.IT le.lsr i.elo lo. 111 ct 10.1 . 1.111
. ezz
!
le.T11 cEZ -.lsz le.os7 1.171 lo. t1t cc -.sl . e)
w e
s7z
lo.tw o~ -e..11 se.m ~.it1 los sEt r -il.e . .
1s lsv
ie -i
t1ssEt ca -i..om ls.lu -~.ea. 11s sEa c -i~.lm . .
1:1 l.let
1x
lossEt a -i..rss 1s.IS -t.zs1 los set c1 -is.llo . et.
11 -1
1:s
11ssEt oc -is.:e 11.1 l.lso tot ttr r -1).w . .
111 et:
11 -I
lett1r ca -lz.lzt 11.111 -1.111 101 Tt. c -1t.1s . .
zsl )ss
ll -t
111ttr a -iz.lzt 11.111 -1.zs lc1 ttr c' -11.1:1 . .
sz. o.tl.
1
111t1r cc -1 .l.s 1.111 -.ze1 111 ttr cot -11.11: . 110
1
111ter cot -to.lsl 1 .liz . set 111 ttr rct 1z.1t sl.lsl .
s71
111t1r cEZ lt.IS se.s~l l.slt te ttr cEl -.tts 1.lst .
szs
t
letter tct -11.111 st.lrl t.soo 111 ter ccl rsll sl.slt .
e lel
-c
lettt c~z -.z1) st.tt t.lss log ctc r -11.11 s.)l .
to
-1
let1tE ca -le.rls ll.zso I.IZS let tic c -li.sss ll.sl. .
s:)
-z
to7ctE o -tt.lls 11.11. s. lee let of cs -.111 11.111 .
lel
-I
iwctE cci -1.1)1 1.11. -i.!1 lei ctE ccz -.11z 11.110 .
stt
I
iwttr cei -.z.) 1z.1 -l.lzr tee tt~ r -1z.1 11.z1z .
1 3~~ X80
-36-
ieeIlE ca -14.111 ~t.lt= -1.111 Ze1 IlE c -i.aa)1 ~).1. -s.fe1
100IlE a -i..n. .~11 -~.sst ~e ttE c0 is.:al ~:.tls -6.611
te0IlE ccl -1..711 x1.11 -t.aet ie0 nE cct -11.61 t. et. -4.016
100tte col -!6.461 ~e.e.s -i.l)1 ie asr r -l4.TSi 14.160 -4.101
1
ie1asr ca -ls.te. ~a.ele -6.111 ie1 asr c -14t~t 1.07 7.01.
setasr a -1..110 ~.tT: -e.t)s 10 asr c0 -is.t0o 17.)61 -6.111
1
ie1asr cc -1!.610 7.101 -l.ss) 101 asr eel -11.66 11.116 -4.1.1
11 asr ~Dt -11.11) ae...1 -~...t 111 elT -11.16! f.le1 11.71.
ileitT ca -11.161 ~s.lm 7.016 ilo cm c -11.10 14.711 -0.011
ilocm o -11.111 14.111 -io.e). 111 tm ~ 1!1..)7111.66! -a.
t.1
islIlE ca -it. at.~)4 0.011 111 tlE c -16.61 11.61 - 1.141
lo)
illIlE a -1!.111 t.Il. -11.14 111 t1E CI -it. 11.1.1 1.)1.
t)4
illIlE CG1 -11..11 le.sel -T.isS 111 IlE Ci! -1).111 I1.T11 -1.1.1
111Ilf col !1.111 11.111 l. I)1 111 etu r -1.. 1).e7s - l.te1
e1)
iltilu ca -11.111 1).)Ta -ie.e41 sit clu c -16.71 14.).7 11.111
iltcm o -11..11 l4.lso -11.141 it: cm c0 -17.111 1).011 -1.1.1
lltFlu cc -11Ø7 1.117 -e.l)s iit clu co -10.71. 1.01. -0.106
llzc~u oEl -11Ø1 10.011 1.011 iit ctu eEt 111.!1) 1.110 1.011
117Tar ~ -16.14 f..e) 1.111 ii) Tel ca -ll.TS1 11.401 -it.
ell
il)TaI c -1..171 S.17 -17.14 il) ter o -1..)11 16.1)1 -1..))t
llsT0r c0 -1).00: 17.66) -11.4). il) tar cc -11.401 !0.661 -11.401
il)T0r col -14.1.0 11.761 -11.101 11) tar cot 11.441 x.661 -16.41)
11)Ter rEl -1).611 61.4.1 1).7t1 11) Tar cEt 11.6.6 11.71 -1..116
il)Tar cE) -11..61 11.1.6 -i).0o1 11) ter cIt -11.111 soØs -16.174
11)Ter t:~ -lo.lo ~ T.~~~-l4.oT1 il) tr cat -10.761 11.07. -i s
le)
r a~a r -m .o0s 44.001 -11.0)1 114 w to -1t.))) w.0ls -1;.01.
.
5:.aLa C -11.111 1).171 -l4.TSt 114 ala o -11.11) 1).eT. 16.!11
11.Ila Ce -11.11! 1I.11t i).l.o its IlE r -14.114 t.s4o 1..111
itsi~E to 16.11 1l.l.e -i..el7 its tlE c -16.11 lt.4eS -16.61
ilsILE o -11.17 11.1:6 -iT.OTO ils tl.Ec0 -i.00o 10Ø0 -1).111
ilsIlE ccl -16.1!0 ~1.e~1 -i).e.3 ils tlE cct 17.161 x0.110 -1..766
ilsIlE Col -ll.eo. ~l.ai1 -11.7.) ill W r 111.6). 4).611 -16.11
111ala ca -17.s1o 1..4.0 -11.0so ill am c -11.101 16.01 -IT.tTO
111ala a -17.)z) 6.166 110.6.) ill ua co -10.11 4s.slo -16.16!
111aiw a -11..11 s.llo -11.1:1 111 asr ca -14.66! S.17 -10.1)1
111asr c -1).111 14.114 -11.1). 117 asr o -11.111 s..)1 -!6.010
117asr c0 -m .ls 11.160 -17..11 117 asr cc -14.400 40.111 -11.1)1
117asp ooi -1..616 .00z -11.17) i1T air rot -14.1x1 10. -16.761
t1
110asr w -1..116 6.716 -10.11 il0 asr ca -1).710 41.1.1 -11.06:
110asr c -lt.t.o 11.4.4 -11Ø) il0 asr o -11.111 4t.so1 -te.~~z
il0asr c0 -14.1.1 t. u) -11.11 110 asr cc -ls~.T)7s.elo -11.)66
il0asr ool -il.slo 11.)11 -10.766 il0 asr rot -11.1)1 44.011 -11.16)
111rET w 11.101 4t.soo -10.TS 111 ~~T ca -i0. 1.111 -10.410
tit
tl~rET c -loots 10.1 -10.110 111 rET o -10.000 .0)0 -10.761
111rET c0 -1.011 41.411 -iT.oss 111 rET cc -1. a 46.00) -11.61:
o
111rrT so -0.100 ~..lw -17.611 111 reT e~ -1.10: 11.01 -10.116
lteasr r -0.10. x0..)7 -11.604 ito. asr ca -0.. X1.110 -:l.e~o
e1
ltoasr c -7.011 .610 -10.061 ito asr o -0.060 )7.10 -11.11
lzoasr e0 7.666 ~l.ls1 -tl.t)1 ito asr ea -e.t)T ~1.T)o -tt..s.
lteas aol -7.001 lo.7e1 -1).00. ito as ooz -1.611 01.1)6 -tt.r)~
111tal r 17.11 X1.117 -1.111 itl al ca 1!.111 60.111 -11.11
itl~~l c -1.111 )l.ss. 16.701 itl 1al o -1.10. 40.700 1s.11~
itl~av c0 -..TSS ~0.s07 -17.411 itl 1al cci ).760 )0.111 -1l..zT
itlgal cct -4.707 ~7.~11 -10Ø1 itt tlE ~ -1.)10 ~0.~70 -l..sle
lt!IlE L1 l.t.e 71.711 11).)17 itt IlE t -S.lt1 ~.t! 1!1.!11
itttlE a -~.1t1 Sl.e1! -11..11 ltt ILE CI -N.T1 ~1.11a 11..11
i!ttlE cGl -.111 1.111 -1).11 itt ilE cGt -7.111 ~l.ell -le.ls.
itt1lE cel 1.171 ~l.te 11.71) it) air r 1..111 1.111 -11.111
1t)asr ca -0.16 61.06 -1!.161 it) asr c -s.~t 10..e. -1.011
11)asr o -).700 1.111 -1.066 it) asr t0 -i.u0 ~0.aT0 -11.1~T
itsasr cc -0.111 aoØ0 -10.777 it) ass osl -0.01) s0.slo -11.111
ltsair r: -.041 X0.7.7 -1.7:0 1: ~tT r -).460 X1.10. -0.0)z
it.rET ca -).160 ~1.17~ -7..)1 it. ~Et t -1.411 X1.111 -1.11
134180
-37-
il. ~t o t.lo le.loe .efa i:. ~t ce -..e.l le.le, -a.e~l
!. ~tTcc a.~ee .e.eei t..,e it. .t l: -,.eef le..i a..so
~. ~t ce ,.e.o le.ere ,.l.i i lt ~ -i.l. .e..el -a.le:
a
sll lt c. -l.iei .e.ie, 1.,11 i:s lt c l..is ~e.~i: -.iif
it1 tt~o I.tee I.~~ -1. lee itl 1t c1 l.lii ~t.t, a.tl
et1 itelc i.. .o..e ,.s,s ii teur -i..le e.l,l l."e
w Btuca i.ei o.i~ s.le it Btuc -t..le le.el i.eo,
iil ~!uo -t. l.. ~e.~i -=.sie 1: Btuce :.,ei ax.le l..io
ito vt~cc l. lee .i., -1. lei ii ~eucox -~e.:,e vx.ss~ -i.s,e
i: veuco: ...x,e .:.~.o .v.em i:~ c~ r i.s:i le.ee: e..ei
ii, !;lc. l.ele ~,.e~i I.iri i:, 1l c -~.1, le.feo t.ee:
tt~ sw o -:... w .eic :.:io ite wr r -..i:> 1,...i t.t::
itl t~ c. ...,e l,..e ~.: iie c ~... l.eee ..ie.
ite su o -..eoi le.xee l.i,. i:o ~o r ....1i1 lees, L.o:
iie ~~cc. -..l,i l..l:e l.eee i:e ~o c -l.ixl l..eeo a.ee:
iie ~loo -.iie l:.ee, a.ios sie lo ce -..eo l..ae. ~.le
ite Leocc -...~1 la.ixo ~.i, ite ~o co -a.tie la.eo ~..se
ilo te.r ,.oes ll.ois e.exi ilo teec. l..,o l..xi a.eti
ilo t1~c -e.txl l.le. v.,:v ito ie ~ - L e.e ll.eex v.e:e
llo ltdce e.ee ~s.s~ 1. i1 i1o ft~of 1.,: !.e: l..oi
m~ om w io.ee> li.e .l.e iti su c~ -io.e:. l.::e l.e,
ill i1 c -i:.ics l.,li l.ei its ilro xt..el W.,:: a.lll
il: tt r -ii.wo le.oee t.sv. iii et ca -x...o, ll..ii l.em
i7t lt.c xl.tle l~.tos l.el i1! ileo i..lee l.t L t
il: ltece -i..leo s.e:, l.xe ii: lt~ac -i..eei l,.lie i.e,l
iie w r -i.1., l.see t.ie. r wa ca i,.eo, l..el, s.l:.
iii au.c -x,.eso l..ee l.ee, ili a~.o a~.~t l.l, -i.ei.
ilI 1~.C 11.11 !1.111 1.11 il ~ ~ i,.lle 11.111 L te.
il. auaca -x,.e~: l,.:er o.,r: il. am c il.aie 1,.111 -s.
a,.
il. W 0 -1.,el l,.lef i.Ile xl aW to -xl.ile il.eoc l.ie,
xle Btuw -xe..,e t,.:ir -i.e.l its veuc -x..ie, lt.:.. -i.ee
xie vtuc x..sle la.ooe :.,oe ile ttuo -d~.~e. l.eio l.eeo
ile vevce i~.ost 1~.~:e Ø1 ill Btuct -xx.eei l,.ilo x.
lee
iie veucoi -m .vo le..is -t.iet ils vt~co: io.le: m .eo, e.se
~l~ m ~ -x..lo1 e..ezs :.x ill tvito a..l.i ll.le, -i.esi
s
ie orsc ie.s.. li.,er ...ieo sll trsc xe.t,e ll..li -l.eos
ilv vs ce -i..eoi lt.i.i -=.xe ila v,icc iv.~.~ li.ew -l.ei
il. w co -is.om le.ef: -i.tl il mi ct il.,i te.,o, -:.
s "1
ilv vi ~: -xe.eol :e..m ..xvo it, auaw -x.,.. l.:lo -1.
e
iit w ca i,.s 1...10 -..eei il, W c i,.lie ll.los a.e.s
il, au.o s,.,ot tl.o.e .:.:ol is, w cl -ie.ee. l.e.x -a.:li
ile w k -x.1=f l.ioi -l.,ie ill w c. -il.eos l,.ax .~s
ile au c i..eoi l.e -,.s, ite au.o i.els l.e.l e.,li
ile a~.c1 -x1.11: le.l., -l.ei. ilr ~a~r -il.eso .ele -,.e:~
ile ~w c. -i:.e. le.ies ,.em ile eaic -il.lil l.iie -e.,:o
ile eauo ie.:oe l..o,o e.et ile a c1 ii.eio l..e,i -a.ele
a
ile e.ucci xo.eie ll.ee ,.e i eauc.: -ii.ew le.,eo -.ies
io ai w -i..le~ li.ee -e.itt io as ca il.i. li..eo e.etv
i.o ai c -i.e:i ~~.xer -io.oe ue al o i.eeo li.ee ix.ieo
t.o ai cl i.xe ls.lr e.iee i.r as cc .xl.lee le.e.e -,.xe
ia ai oo~ -i..i1 le..ei -,.ie: io a: oei ie.xie lo.ti: v.~:1
.i w w -i.111 s.:1 e.e:o i.x vi c -i~.~,~ le.eo ie.ee
s
ii i,ic -il. le..il -xi.e. i.x w o -i.,eo ll.i.e il.iii
> s
i.i ~: ce -xe.ele la.ie io.lie i.i i cc -ie.ee. l,.ee -is.le
ai vs cl -ie.ee le.ie, xo.liv t~ ti ce -te.l,: le.eex -ii.iso
i.i a r: s~.iie .o.ei, ie.i1 i.: au.w -il.il, le.e.e xx.e
it a~ac. -i.i,~ l.te: it.s it am c ii.ese ll.eio ii.eri
~.: w o -il. le.~1 -i.,le ii w ce -i:.e,o lv.w .i~.v.i
"o
i.i w r -xl.ee: li.lel it.ee: i~ e.uc. -m .xee si.,ee -il.leo
i.i eatc I..i. li.tee -i..e1 i.i e.lo i..i.o ll.ee -if.i~
tw eu ce -i:.lei lr.i -i:.,s. i.i eaucci ii.leo le.io -il..oi
ii eaucc: i~.~of li.xee xi.oi. i. w w -il.lex l:.eee il.e,e
i.. w ca xl.,.. li.ei. t..> >.. auac -i.e:e l:.eex il.e.i
1 34~ 2~0
-38-
w aw a s,.tle lt.tw -sv.~fs s.. w ce s,.~.t ls.saotl.,ee
s.s1sa ~ sa.so, lt.r.o ss.roa sas t: c. sa.alt 1.. sa.,o.
r1,
ss 1er c ss.aor !.. s~.etr ts !e~o -ss.rse ll.ttssl.ors
"1
ss !e~ ce s~.em la.sa sa..s. s.s 1fro~ ss. a ta.rssss.e.r
:
sw tw ~ r..sm ls.rsa s,.las saa tm ca -ss.asr ll.rrsso.a,s
s.atm c -s:.t~~ l...rs sl.ros t.a tm o ss..:e l.loa -sr.taa
s.,ray ~ st.sso ls.s.t s,.ts tvt rayca so.Im 11.1sasa.rlt
s.rray c -r.eso l..osa sa.sts s., ravo se.s,s ll.rrlss..ea
s.trw ce ss.sst la.r" ss.oor s~ rayccs r.lra t,.losss.o~o
t.,rw cc:-st.s.o t~.vss s~.tso se rw w l.sos ls.llosa.aos
s.oray ca -,..et 1.tso -sa.eos sao rayc -~.ss, l..ro,s..,o1
t.oray o a.l.o la.sst s..,lo t.e r~~co a.t l..stasa.eso
s.1ray ccss.o~e ls..os sa.tos s.1 raicct a.sro ll..stsl.tat
s.rray ~ :.tsr l..sss ss.sts s.r ravca a.rl, l..rasst.tr
s.rray c s.~oe l.tls ss.ass t rayo l. at. ts.s,sss.alr
s.rrw ce o.tt 1..lro ss.sss sat raiccs -,.lrt ls.asr-sl.eer
s.rray c~:-e..sa ls.soa -st.era sso rayr ..,lt ls.lolss..o.
feorav ca l.trt 1.eet lo.rol iso ralc l.ll1 ll.ats~.fee
s1orw o l.srt ~a. r..oo sso ratce l. t,. ls.tosss.~ss
"e
ssorav cc1o.rm l..alt ss..a1 sso raicct t.o,s t.e.t st.lel
sssa~ w t. sae ~..~.~ l.srs ss a~~ca -1. a ~s.sett.te,
s
ss1w c s.oeo ls.osa a. as, tss am o e.as1 .ler a.ro.
ss1a~a cs l.ss, ls.sro e. to, t1t aLaw l..so ls.~e,l.ltt
ssta ca l.,s. ls..se l.sst slt a~ac 1.10. la.ttoa.sss
a
ssta~~ o -e., l...aa l..a, t1t a~aco s.taa la.ao,a.tr.
t1
sssa~a ~ s.sts ll.so: l.rst sss au ca e.l.e st.tset.l.t
sstam c l.sss lt.Tts s.sss tls wa o t.ls, lt.sst-e.lsr
ss~w ce s.,so ls.ess l.s~s t1. tm ~ t.ltr ll.arss.
t
ss.tm ca =.e.t l..ts1 l.sts sl. tm c l.lsr l..eare.lso
ss.tm o a.sor ls.tar e.ss1 t1s asw l.~so 1..,11t.lao
sssasw ca l.a.. s..~e, t.os, t1s aspc l.lrr l..ts1l.aat
sssa:w o a.so1 t.ltr ..trs sss aswce a.eoe lasso t.~o.
sssasp cc s.lro la.,ot l.soo sss aswo01 a.sts la.eas-e.ss.
sssvs~ ~o:l..s. l,.ras e.ss: ssa tw w a.,ss ls.saol.a,s
ssam ca a.ast lt.ss, ..r,e ssa tw c l.ltt ls.ltel.sls
a
ssatw o l.t, lo. a.tst ssa tm ce l.tos ls.reol.seo
as,
ssam cc t..rs at...t a.lao s1a t~uco 1.1r ls.rsla.t,e
a
ssatiu oe1s.,.. l..ttt l.lst ssa w ott l.soa l...sa~.sw
a
ss,em ~ a.sor ll.os, ..tt, ss, tm ca ,.loa r.rlt v.so,
ss,m. c a.sos tl.att ..sss ss, tw o l..sa io.l.a~.eos
sssra ~ t.s, t~.,e~ l.llt sso tr cc: e.o,r ts.lral.eso
sso,~~ oc1l.,o, ts..r, a.tl, sso t cs ,.sa. :s.l.al.tra
sssr~ c. asst ta..s, o.,ot sls ~~~c a seo :a..lot.ss,
ssot~ o a..,r t,.lss t.r,~ ssr t1a~ l.lso :s...sr..r,
ssr1ta oc 1.ss ts.ro. so.sts s1r 1erce l.a~s ta.sesl.tlt
ssrsee ca ..lts ts.tso e.oss ssr s~~c ...r. 1l.,toe.
H
ssrlea o l.ssr :~.te~ l.eso sao t~ r s.l,. tt.r Less
"
saot~~ ca l..s. ts.lo. l.ors tao t c ~.a ls.o.sr.e
saotw o ..leo ts.l:a a.sss sas oe~w l.lts lo.lsel.ssa
sattea ca t.as. sr. ,.os. sa1 leic t.a " o.,eo a.~oe
",
sat1ta o e.ara to. l.lar sas teece 1.1. te.trs,.t~s
l.,
sat1ta oc s.ls. sl.eto a.oos sat lei~ s.les a Ø1r..sr
setlea c. e.sa, tt.zts r.sm sat lers o..so ts.rstl.o.o
satsee o s.s~f tt.e.o s.lr sat 1e c1 e.tss ls.aaal.t.t
satlea oc t.so :s.or1 e..oc sat leaw e.a,r ll.rtll.sr,
satlea to -o. ass t.,so l.rro sas 1tec l.a.s :a.s,ra.oss
satssa o s.ee la.s.o l.so. sat 1tato s.lro l..a.tl.tss
satlea oy s.rrt ls.,so tats sa r~ w o.loe la.rstl.es:
ta.t~ ca e.aor 1l.s.o ..1st sa. ta c l.sos lr.toal.sr
ta.ts o e..ss lo. l.t~e ta. ,~seo l.ers lo.ssoa.elo
set
sa ,~~ ocst.re la. tart sa t~~cct l.tr, =T.asoa.oe1
tot
taerat r .e1 le.,.t t.iro tar ratc e.ler 1r.lt 1.110
sasray c t.eoa ea.s.s f..r, sas r o t.rtr le.sstt.toe
a
1~4~~~0
-39-
Iettatce s.tle te.et e.ses 111 w c -s. H ~~.~s, -s.
a t t
setew cct -o.tsc t.ts -o.w s1. ~w ~ s~se ts.ets s.ste
sw ~m ca t.e.s ~t.l,es.et s1 << c -.eee ~t.em e.es,
se ~i~o ..st. tt.se.-e.te set t,.w t.ee. tt.tte e.e,e
s1tttec. -l.t:~ t..e..e.sst set t,.c -t.eet tl.tee -e.ee.
te1t,ea -e.. t.tes e.ee. sat t11ce t.111 ~.tet e.el
t.
t1tt,ecG l.te1 tt.ll.I.tee se, t,1cDi 1.111 lt.tlt t..,
f111t ceJ 1.110 tt.ll 1.1t1 11, 111ct1 l.tlt tl.etl 1.111
setttecet e.ee tows s.eo1 t1~ trec: e.e1 te.ets t.e..
sett,ee~ -e.eec tl..est.ele sae ~.ow -l.teo to..ee .s.eso
111X10cG N.1.) t.It1 t.lte 111 ~.Ot0 .ttt i1.11t t.It
set~tcce .t.e. ts.l..t.so1 see ea ca -t.st. t..tt -t.e.o
s11Leoc -e.tle ts.IS -t.tto see Leoo t.ee1 tt.tte t.est
setm ~ -s.ee. ts.sel-t.see s11 ~w c~ -..1 tt.e,1 -t.ett
s11sw c ..lst to.tost..to s11 ~m o -a.eeo =e.tts
-a.
t1
stoc1sr -t..ot so.It1i.tl1 sto ~xsc~ t.eo ~s.tl1 -s.tls
sto4,sc t.ess te.tm -t.ISe sto it10 t.toe a.te. t.t:
sto" ce e. t.. tl.te e.tt. sto ~~scc t.tes te.sel e.tt1
s
s1os,,sco e.tlo tl.se,t.ess sto w ct t.lts tt.tls t.et1
s
s1os,swt -..ts, tt..s t.tss sts ttew t.ete te.esa t.s.e
stsxw ca .Loss tl.o.s-t.el, sts t,.c e.les te.tee -t.sst
s1sx,ea -1.1.o te.,s.s.ete sts ttece e.elt to.tt. ..tlt
ststtecc -so..It to.ee t.ot s1s t,.cas -ss.llo so.tos s.ees
s,st,ecas so..l. t:.tt .~.o: sts t,ects -ss.eto ts.eas -e.
e,
s1srm ce: -so.e.s ts.oel-s.es. its w ct -ss.tte ~t.tse -e.te.
s1st,10~ -st.eoe ts.ssee.sto ttt eeow e.tet :t.te. .t.tt.
s1trecc. -e.ol1 t...s,1.s1. stt ~toc -e.tts =t.ste t.ee1
s1tyeao e.tts te.le..e.ees stt reoce -se. tt.tte -e.tss
set
sttyeacc so.loo tl.:ts.t.ee. s1t ~w co so.te. =e.lee -..ts.
ststt1~ .so.llt te.srte.ose sts /t~c. so.tto te.ese -e.tso
ststt c e.o:s tl.l,se.sl1 sts te o -e. e te.tts -se.t.t
s,sstyto ss.s:e t1.:~ -e..es ss tt oc ss.tls te.t1 -e.o1
s,.1.4w -e. s.: te.e..1.1s st. ~w c. -t.lls to.ees l.els
s,.1w c 1.11. to.sss- e.e.1 s1. Srio -test te.slt e.
t..
st.~m ce -1.e11 ts.lls~.t1 st. ,raytas t.te tt.111 .t.lsr
l1.1W cc: l.:to tt.so7t.lll she !lt~ l. ell te.tte e.eer
st1tiecv -t.1.1 tc.slvso.o:. s11 :vtc .t.ts1 to.tsl -e.w.
st1tito -t.. ts.ele-t.ess s1s m ce t.est ~e.tJ1 ss..se
so t
st1sitccs - test te.vtsst.s: sts titcc: s.vss ~e.em a s.tst
s1sseeces -t.el: to.sslst.e. st1 mr r -t.tto to.ete -t.ete
s, a~.c. s.tss ~o.sste.eto sta ma c e.sto te.tes l.tso
s11aw o e..ss tl.tsl-l.ese s11 w ce -s.ete te.ese t.t.s
st,1w r e.e. ts..sot.seo stt ~w c. t.tes ts.tl. .t.el.
st11w c t.tts ts.els-e..ls st1 ~w o t.ste tt.elt -t.tts
s 1w ce t..s, ts.eote.,os st1 ~ ccs t.et tt.eet .e.tls
" n
s1,~w cc: s.tt. tt.ss:-e.es ste tm w 1.e11 te.el. l.tle
steim c. s.sle ta.los-I.ts1 ste svrc 1.... ts.tts -e.
et.
111~l~a 1.111 t1..111.t11 11e lL w t.tlt tl...l t.tet
ste1m ca e.tss t:.ost-e.es, str al.c r.st1 ts.eel .s.t,e
stew c so.sel te..esv.,sv s,e aw ce vets tt.tls .els
seow w se.lre ts.svs- lees seo ~w cv ss.elo ~e..et l.ees
seo1w c st.e.e ts.lest.s,s seo ~m o sx.tst tt.ew .l.esr
seow ce st.ets tl.ss -e.s1 seo ~w ces ss.tts te.tss -t.ess
seo~w tct ss.e,1 to.stee.loo ses es r s.tet ts.tos .e.eoo
ses1s c. sl..ss s:.soe.1.e11 tes as c se.e.t ts.eo. -1..:
ses1s o st.tse ~s.evoe.tet Ies 1t ce s1.. ts.ets -1.1s.
ses1s cc s~.sto ~o.es..I.e,s ses asrors st.sel te.tll e.lts
ses1s oot st.lec to.tl..ee, set to.w st.ee tt.te. e.et
sette c. st.ss ts.ts -so.ses set tt~c t1.s11 ~e.es, -se..e
setteeo se.ss to..ss.ss.eto set teece se.ete tt.tss se.
settt~oc sees. t..1s se..ts ses tt ~ se.tll te.e.t -e..ss
littt~c. 11.11. 11.11 1.... set itsC tt.lll i1.1. 1.1t
sestt o s,.el1 t..st e.tlt ses teece se.tte rte.tts-e.eot
1341280
-40-
totteroc :e.oee ie.ese o.sls te ate r la.otl :o.oe. e.ees
tt.t~ ca le.s.. ot.lst .e.eeo se. atr c l..ets ta.tso e.st
to.at o u.stt :e.ttf o.et le. ate ce to.os. sa.os se.tss
te.ae~cc s..e~~ t.fee -s:.ot se. ate e~s t.too =o. -ss.stt
se.
to.ateros le.tt: :~.sso -stet. tot ttr ~ tt.e.s a.t.t t.set
sett c se.tt t.r1 e.ett sot t~~ c s..teo :t..e. e.ses
tootaro l..ste te.tsl .o.lt sot t ce tv.ow ta.ee o.ses
tettw cc se.tl tr.ss t.rs. stt tm co te.ess :r.ses -o.se1
tottw ots se.el. if.tw ..IS i11 ttw rtt tl.t 1.11 s.w.
se arc~ le.ste tr.ett ....e se aec c1 lt.ses =t.tt. -o.es
serarcc ss.teo :e.tli -:.e11 ser uc o sl.eee te.te. -t.eet
seaarcce ss.tst er.e.t -l.ss toe atc ca se.ts =t..ts s.sas
t11arGco e..t ll.st~ s..t te1 arG ~t e.er ia.lll I.ttt
so arccs e.e.s ~.tt~ s.et sot rrt r~s e.llt tt.oeo s.eee
to artr~: so. :.tss stet sot u1 r s:.te eo.ee -:.ets
e
lotW c1 l:.t: ei.o1 t.oee tet W c it.tl: io.re. e.tlt
totam o ss.stl ~o.o.~ .o.let set w ct st.s.. st.es t.
t..
soettrr slots to.tto o.o.e soe tt ca ss.ets se.se s.oae
seettrc ss.ltl ~o.e.t :..ss see a o se.t.o oo.sss s.:ss
seett co st.tt to..tv ~.vle soe ter oc s.stt ~s.o: i.e.s
set~~er so.e.t es.oso s.et se ~e c e.eet es.aee =.ISI
sev~~~c e..w a:.set s.eoe see ~~e o t.eet ~s.tt t.ess
sef.t ce e.tet o..sst :.tt see ~t cc so.sst e.ee o.ert
lof~t cas e.s.t m .ego e.sss le ~t tot ss..se ~t.ss o.ot
set~~eces e..et tt.set -s..ss see ~~t cts ls.te ~e.e.t -o.tes
set~~ecs se.te el.tel -s.tse tea ter r e.tol es.es o.~
seote ca t.a: os.eel e.tes seo ter c a.e1 ie.ses o.lse
seottro t.el oe.ees o.e seo ttr ce e.ses ~o.wo -1.
tee
seottroc t.sl1 ~a.~st :.ese tes ser r e.tee ~e.ets o.t:s
sesttrc1 ..t.s i.f1 e.eet ss tt c L :e.llo o.tsl
srs
sestt o ..t.~ :e.sle -o.eet ts ter ce t.est ~o.~ss o.ess
seste oc t.tst ts.set s.et. ses a r e.tt tt.lso o.se
a
ss ~w ca ~.st tt.et: e. s ses ~av c t.se :e.ss o.te1
sesai o s.etf tt.eet s.lee ses ~w ce .tes te.sst s.eee
m: ~w ccs .s.. :t.t:t e.tss set ~w cc: a.ast te.so. t.ee:
s1 tlt~ l.ell =.11t e.e.t t1t tl1 CI e.It1 :l.e. e..lC
settm c o.ots tt.o:~ o.eos sel im o o.seo tt.:. s.est
te.~e:r -s.o:~ :s.sef e.t:: se pro ca -s.r: :s.ets .s.ett
st.~tcc -t.stt ss.rot s.es t pro o i..os t:.s.. -..tet
te.Leoce -!.te to.te7 -i.tlo le. fro cf. t.tsi le.e:i l.llt
se.proco -s.st ts.es. e.etl see tw w .t.oss :l.tel -t.vsv
sett~uca -~.s.t =.eto -l.sts see t~u c s. te.ets -I.ett
eel
sett~uo -s.ts s.see ..el se ttu to -..t.t te.te .:..to
settw cc -..e.s ts.st -s.lt st tm co -..tst t~.wo -e.seo
st tm ets -s.sso s.wc e.set mt tm ots o.seo t..eso o.tet
servev~ -e.t:e :t.s. t.tto ser ttu c1 o.:vs te.ese .a.
se ttuc e.sse tt.st -e.ote set Btu o o.lot o..sss -a.sel
le ttuce i.e.o :t.ttf t.ee se ttu cc =. ito=e.ste -..s
te vtucos t.ttf ot.ts ..ele se Btu tot w st te.tss l.ess
tett r o.s.o :. set .t.eel 1t at cr o.el: a .tt. -e..eo
setal c slot st.tst e.oet set at o s.ett s..tl. - e.es
setat ce s.et t.tve e.ses let at cc -s.. se.lts .e.e.e
o
set1 oas s.eo. tt.sst l.tt. set at oD: e.ott :t.lst e.eee
seem ~ t.osl o.eee -e.e.. te ~w t1 t.to t.eto -se.sev
leerm c v.stt :t.no -e.ts see wt o e.tes oe.we -o.oet
them ce :.ee. tt..t1 ss.ast tee ~w ccs l.elo t.ts -ss.ott
tee11~cts t.tst te.ese ss..e ~ ~tt r ou~t1 =t.es se.esl
teerttc1 a..le :e.oo: e..re se rt c ~.o.t te.eso .se.ete
te yeto a.re1 te.sse -ss.tet sef rtt ce ~.o ot.eto e.ett
te1~ttcG t.elt s.e1 1.111 tee tt tD t.tee it...1 e.
e1
leeyetcl o.sst tt.tte .t.eet too am ~ t.te eo.e.s se.set
ieoa~1c1 t.s os.e:~ ss.eot too ail c tote ~s. .se.tts
geea~1o e.s:t et.ot. -e.eo :ec a~a ce a.els f:.ote ss.te
~ ~~+~ X80
-41-
tes 11c~ e.et1 ts..1 -se.els tes 1esc1 ss.euf ~.seo s1.t11
tes 11oc se..so f1.1t1 e.IS1 =el 11ca e.ete w .el, e.lls
tes 11oc1 u1.111 t1.1:) ss.leo !el 1tccc Is.ft ~.e.e si.l,1
tls CIOco e.l.l ~f.It1 s:..es toi cL,r se.e:o ~s.:l. I.e~s
=IS m c1 ul.,s w.lo. -t.el. :es ~m c su.elo ~.w1 e.lss
:o: ~~,o ss.)1: f,.ls ...e,l res 1~ ~ u:.esl ~l.~e~ -1.111
:es 1~ ca ss.e.1 w.vs1 -o.ts1 tel w c I.te1 tl.es, .1.11
te1 tavs .lil f,.,l1 -t. ell !ei trvtt 11.11 11.111 1.111
to) v1~ccl s1.11 ~.so1 1.s: =el m ccr sl.e,l ~.t.s .e,1
to. 111w t..lls 11.11: s.lsl te sttca sl.l,t le.tll .e,
:e cltc ss.oll 10.11 .t.l,: to1 e1 s ul.tel e.lls 11.11
:e. et1c1 u,.le, 11.1,1 ..fs1 :e It10: u,.Ist 11.111 -1.1,:
to! sit~ ul.l,s e.1s e.oo1 tos tiect ss.ell s.ts. e.:ss
te1 sitc us.:o1 ls.,l 1..11 :ol utto u!.,e 11.11 -e.1.1
:es m c1 sl.lss lo.ISS .e.11. =es tvlcps us.lel ~o.fi -e.elo
t
tos m c: uo.111 l.:Il -so..l, tos t~lcol s:.:11 ie.ls: . ms
:01 ~w r ss.lsl i.ols uo.111 :e1 ~m ca sl.:e. 1.11, se.lf.
:01 s c m .oo: 11.1,1 is.fo :01 cw o s:.11 1.111 us.l:l
tot cm cl sl..ls l..to1 -s1.11o tot cl.rct :1.111 11.u1s se.elo
sot cvrco st.tls ls.ls -so.oo, =01 carols tl.f:1 11.11 e.fss
le. cm re: sl.ssl .slo e.IS, sto, s11w st.fel 11.1. ss.:l.
:et sttca s1.:11 11.:,1 sl.elT tet fetc ss.ell le.el) -ul.tle
to, st1o ul.11 11.1s~ -ll.oo. tot s11c1 e.es1 ll.ISS 1:1.:11
:o, setoc e.els ll.osl -st.ls =ol titw so.es. 1.11. sl.asl
tot 1~1cc: o.s,s eo.s)1 sl.,s. =ee t~ oal t.e,o 11.11 -ss.sl.
:e1 ,w c1 e.l:o eo..ss ss.ssl :ol ,~1c1 ~.em ee.els -s:.sls
:e1 T~1c e.sl1 eo..el -solos tot t~1o e.l:s le.eo, se.l.l
!ol Btu~ e.s1 el.sf ue.l:1 :el vtuca .11: a:.ls1 e.ISI
tol vtuc e.l,s ss.le -e.:: tel veuo e.ulo ~.:s1 se.::s
te1 revc1 so.fss es.ll: -t.ese tot ieucc ue.eol fe.ell t.11
tol ieucol ss.11 1.111 ..ts !el vtuco: e.eo1 ~o.:IS -1.11
t1C 110w t.TeO e..l)1 e.... !le 110C1 t.l,! el.esl 1.111
Ilo 1toc e.sls el.sTS -e.sl :so 11co e.les 11.11: e.le.
tso 1w c1 e.fo: sl.TSS .t.ll, tlo 1eccc e.oo1 fl.f,e e.
e..
=l0 11oco t.ss es..1 1.:I1 tls s~ w e.e,t st.1s -e.sll
:11 cm c1 e.el1 ee.,s I..lo tsl cw c ue.el el..s. -s1.11o
tll c o ss.s~1 el.ool so.tll tl: 1s~r .111 et.lle -sl.elT
"
tls sw ca solos et..:: -st.l.s tls es~.c x:.ell sl.,ls 1::.111
tl7 asp0 11.111 el.lil 1l.1t0 !tt a~,c1 es.=t1 1.111 -11..11
tl! fw Ct 11.101 11.11! 11.1 lt 11~C~1 ll.el) et.le. -slit!
:1: 1s~wo: s:.:~) el.ssl -ss.stl tss ms w is.eos el.l.l ss.:.,
els m c1 I:.ISO I..e.1 -uo.ssl tls ms c a:.e el..sl 1.111
s
tls GIso us.tls ff.oll s1.11~ tss ~,sc1 a:.t1 ~s.:ll 1.111
:ls w cc ss.sol e1.l. .1.111 :11 ms co us.:1 fl.eso -t.ss:
s
:1) m ct s.s~s sl.sll .e,o tll ~,s~s 11..1 te.tos I.esl
s
:1 111~ ss.lls s:.IOi -uo.... t11 t11c. m.lo> >1.:11 se.lss
:1. IIIC 11.11 e0.C0 1.11 tl1 1T1p .11.=11 es.l1) -I.IIT
=l. 111c1 1..1.1 10.11 -11.11 tl~ 111C: ;11.11C 1.111 11.1.1
!l. 111cal 11.11 el.l, -1:.111 11. t11CD! ~ll.s~l el.elf 1:1.11
tl. 111ctl s.:so ei..l1 :1.111 ts. t11ces s1.1 es.11 -ss.l,1
tl. tItcs s).to. et.els il.lso =s. ,110~ s:.IS1 es.111 11.111
t11 ilt~ 1..111 1e.1, 1.11 ill ti,to 11.It 11.11: t.eol
tl1 cv,c sl.lse t.stl .t.t.e tss s~,a ss.tll 11.e1t -e.l:l
t11 l1 w t..so 11.1 . ell !11 l1 t1 11.11. 11.=01 1.111
ts1 w c ss.ll: 1..1:: I.ISS ts1 ~m a ss.e.1 ls.s:, ....11
!11 ~a CI 1.111 .. If. e.el, =11 111w lt.tel II.IIt 1.1,1
=11 111C1 11.11 11.111 4.110 t11 IIIc 1:.111 ls.It1 l.
e,
t11 tttp lt.lCi s...= e.1 =s1 IIIC! 11.11) e. ell 1.111
tlt 111cc so.ls, 11.:11 l.:s =11 t,1cos ue.111 10.11 -s.:11
tl, t11cos .011 11.ss I.IIS tl, 111cll ue..ll 1t.:1, u.leo
l1, 111Llt 1.l. lT.ti1 1.111 tl, t11(t 1.111 11.11 1.11
:l1 111p~ e.1) 11.110 t.111 !s1 sw ~ 11.110 1.111 1.11
:s1 sw c1 u1.11s fl.l.s -s.t:, tll 1s~c uo.tel ~l.s1 .:.111
1 34~ X80
-42-
tsrs~ 0 1. n7 ~o.r., -s.11 tss rt t1 tt.ess Il.so t.ls.
tstat tc t..e71 sl.s t.7.t tss t ool t.ist ol.tel t..tt
tsoasr rot s.o I1... s.sls ts1 itsr l.ete Il.ss. ..ts1
tt1ilt t 1.1t II.sIt t.11 t11 eltC t.It lt.tl. -).111
ts1ill a t.t7 I.lo: -..tt tto tw w ~.sw Is.rs1 t.tls
ttotm c s.1t Is.ll. ...1t1 tto tw c ..et1 It.i.. ..s..
ttstar o ...st I.t.t -r.lss tto t~. ..ots e..os1 ..st1
ttt~f il 1.11 11..7 t..11 tt0 t~tCGt i.ti. II.il1 t.111
ttster r ..tts ts.tsl ..7c7 tts tt1c t.ls. Il.tol -t.sl1
ttstt1 c ..tvo t1..s r.sss ttl tee0 ..sst .e.to1 -t.ttt
ttlit1 ct t.sss .o.7ss ..s. tts itroc I..7s ..tst -I.s1
itt~!~ r 1.CW l1.f11 1..f tit ~!tCt i..ts .t.Ttl 1.11)
tttrtr so t.,1 ls.ssl -..11s ttt ~ttcc e.so 11.111 -r.ot
tttret c1 i.7ss .o.oss -t.tss ttt rttc. r.11 t1.to -t.71
ttt~tt c ~.ttt ts..7s -.st ttt rtto t.es It.st l.tts
tt7rl. r r.ss. tt.t. -e.1.1 tts a cr i..rs I.oto -t.tss
r
ttsrw c s.too I.e.s -l.tot tts al.o e.ls7 Is.l.s -so.ltl
ttrl. c1 r.so1 I..sot -t.lts tt. st r ..ot el.t.a - s.ts1
tt.te1 c t.tss t..ss -s. too tt styc t.rrs It.ss -ss.ssl
tt.tt1 o t.s.s t.sls st.ost tt a cs s.tos I.11s -t.os
at.tt1 oc e..lt I.s11 -l.sst tts repr t.ss Is..ss ls.ssl
ttsrra c. t.tls I1.17o 11..71 tts ~e:c I.t. It..1 -s7.t
ttsr1o a t..o Is.so s..to. tts reocs i.es7 .i.sss st.el.
ttsrrc cc ...ls .o..ot -so. m tts rigco L tIS tl.tt -so.ls
tt~its r ..t1 tt.: -ss.tll tt assca e... I.st1 s..tt
ttv~:s c ...ss Is.l.t -ss.ow tta m o ...ts ts.lol .s.tls
s
tt.ass cs r.loe t.e.r st.ts tt ~:ttc t.ts Il.ss1 s7.ISs
tt~m ros i.l.s It..s -st.lto ttv itscat e.tsl tt.sss s..sw
s
tt.its c!s l.tta w est -st.ts tta ~:tret e.tts tt.t1 -s7...s
tttval r I.sls Is.sl. .s..111 ttt valcr t.sss t.7s1 -s.ttt
tttv.l c s.a1 Is.slt ss..ts :tt wl o s.iss t..tt7 .s..le
tttw.l c1 t.sC) tt.... 11..11 ttt arttcl 1.1t It..tr s.t
ittvrl tct I.ta. It.rl1 11.111 ttt alrr l.io7 I.it -i..tf.
st1alr c. i.oss t.si1 -ss.sst tts am t e.s.s It.sss sv.w
s
ttsal. o -t.tss It..ss -st.sts tts al.ce -o.7et Is.rss -1...1
tt1il r s.tls Is.ets sr.l.s tt1 ilttr t.7st I..os -ss.tll
tt1ilt c t..to It.slt sl.lst tt1 clvo t.ss1 It. -to.7l.
Its
ttcrm w t.tss ts.lss s1.1. tso am c. t.tl. I..sos -m
.s.1
t7crlv c t..t I..soo -to.sss tto rlro t.sso I..tos .ts.7.s
t7cal. c I.tls It.t. -ss.tol tIS alrr o.7ss I..rt7 -s1.7t1
t7srl. c. s.oso I..sv -sl.t.. tm aw c -s.ts Is..ts -to.rl.
tmrl. o s.lo1 Is.ssr ts.sst ts al.c1 s.lst L .r.. .ss.s1
1strl. r -o.tts I.st -tc.tts t7t rtrtr s.ess tt.s ts.tlt
1strlr c -o.tls it.ts. -ts.ots ttt alro -o.ts tt.sol -t..sst
1stal. c -e.t.t Il.st1 ts.stt tss tiur l.lis I.tt1 11.11
tssltu ca t..st Ir.tl7 t.to1 tfs ltuc e.sts Is.sr1 t.tsc
m ltu o e.1 Is.tsl -tl.sss t7s ltuct I.o7 Is.stt -ts.lot
s
177ltu tc 1.11 ..11. 11..11 tt1 ltutel 1.111 .l.t 11.111
tIf4tu Cot ..t.i It.sl -t..IC tI. TLtr I.tlt f.i11 -t..lt
ts.tl! cos e.7o. Io.ll -ti.vst t7 ll!cil e~.s. Is.tts .tr.ses
tt.tlt cs e.sll It.os. -t7.sto sI tltcct -s.tos to. -t..sl1
loo
tstl! ca -o..o~ It.et1 t. tt =lsc s.ttl I7.slt ts..7.
tt.tl! o -s.sss It.s.. t.s.. tss Btur -t.7lc t..rs .t.
1
t~sltv c. -7. Is.ot1 -ts..ts tts ltut -s.tss Is. -t.rtt
s1 s.7
tssleu o -..so1 s.11. .tt.ssl t7s leuce ...st ts.ts t..sts
tssltu cc -s.s.o L .s11 -17.7.: t7s ltucos s. at Is.1s tt.l.s
ts~ltu tot .tst L .sss t..sto t7. 1!~~ t.el Ia.ss t..
m
ts.1!~ cr -s. It.tst :t.w~ tw seec s..11 I.tlt .tl.s..
t.
ts.te1 0 -s. .rs. 7o.tlc tt st1c' i.rst Is. .tt.tss
t. t7.
tt.it1 eG 1.111 It.sts -11.11 tIt L,tr t. l. Ii.elt -11.111
1stlvs c i. e.1 L .oss tl.ls: ttt ms c -t.sss 17.111 -7o.
t1
1stl,s o t.lts at.lsl ss.... 1st l~sc1 e.ttt I7.slt -tl.ssl
tttwt cc e..tt It.t.c -IO.ts. 1st ms co t.oto Is.sss .IO...t
1 341 28 0
-43-
111m ct l.t.s lo.tli 1111: Ift ws ~s L 11s 11.111I1.s11
s
111wll r t.ISI 11.111 11.11" 111 ~tiC1 1.111 11.11 ll.ttl
111ass c -I.sl. Is.111 11.11 ts1 wslo - L tl1 sl.se.-:1.111
ifewsi CI 1.1.1 Ie.lll 11.11 111 r1fCi 1.111 11.11111.111
1stass rDil. tot 11.111 II.IIS Ise wslcos l.lf1 tl.IS1se.sl.
Isoass 1 1.111 I Loll 11.1 110 ass~t: 1.1.1 11.11ele.sll
111IO r 1.1.1 11.111 11.11: tl1 o ca .111 ~..tt1-lo.ttl
111CIO c -e.:o. l..cs Il.sss :s1 to a -1.1.1 11.:11-1111:
111e0 CI -t.el1 11.111 11.117 111 ItDCC .11 11.11.11.111
ll1110 CD 11.11 1..11 IO.11 11e Isrr 1.111 11.11111.111
110aew C1 1.111 lt.ei 11.111 11e i~ C 1.1e1 11.11eIt.lle
11erIr o 10.110 0.110 11.:11 11o aspce l..el 11.1.1lo.sss
l.ea1r cc -1.111 Ic.111 -so.111 !1D IIwoal t.ee1 Il.sla)111.1
11oasr rost.tc ll.IO1 fo.lw =1 tIrw l.ss. 11.101-It.le
l.!ttr c l. lo. lo.ls .1l.l:c 111 ttrc l. let lo.tsl11.111
l.ittr o -1.1.1 11.11: 11.11 1.1 tt c1 -1111 11.1seIS.lt1
t.!ttr cc -.01. 11.1os 1.ss1 111 ttrcol l.slo :1.11111.111
!i ttr totx.111 11.11. -ll.llf 111 ttr~t! e.11! ll.Ia 11.1:1
1.1ttr CtI...1. 11..11 11.111 111 ttrCtl 1.et 11.1111.111
l.!ter css).11s 11.111 .11.11. 111 ttrcss -:.111 :1111 1..1.1
l.!ttr Cw!l..te 11.111 il.eel 111 twtr 1.111 11.11111.1.1
1.1Twt C1 11..f1 .111 11.11 !Z thtC 1..11 11.11111.111
i1 twt 0 1.111 :1111. 11.111 111 tt CI 11.111 11.11!11.111
ls twt oGi-1e.11t 11.111 11..11 l.s twtccl 11..1. 11.1otIS.lls
ll Ilr r -1Ø1 Io.IS1 10.11 111 esrCol -:1.111 lo.le.11.1.1
ll asw oo!111..1: 111111 -11.111 l1s sr cc l1.e11 Ills! 11.11:
l.stsr c1 l.to1 Il.sso sl.sss l.s Isrc1 .l.ISS to.tss11.1..
ll 11. c 1.111 ll.sc~ .ll.olo !.) Isro -1.111 11.111-11...e
l..twt ~ -11:11 11.11: -11.111 l.. T~tc. -~.t11 :v.ls.:111:1
l..tit C -1.611 11.f11 11.10: 1 t~110 -1111 11.11111.111
l..twt c1 l o w ll.osl -:1111. _. titoGl 11.1:1 1. -11.11.
s Its
l..twt cc:lo.sol l.svs -ll.lse 1s tw r -1. D1: 11.111Il.etl
1.1sir c1 -.11. 1.11: :1111: l.s sirc -1111 It.l:oIl.s:o
t.1sir o -11:11 111:1: 11...1 11s sm to t.sfo =.111 11.:11
l.ssir cc -1111: Is.s:~ 11.111 l.s ~~rco -1.11) 11.11)IS.1:1
l.ssir oe!1.101 11.111 -IS.tst l.s iw ~tl 1111: 11.11:.t.sto
1.1v1~ r 1.111 Il.lo. 1:.111 i1 v1~c1 -11.11 tl.o.olo.tto
1.1vw c l.os1 It..1= -11..1 111 vw o I.to1 11.1:111.e11
1.1~m c1 1..111 Io.ss1 -lo.lsl 11 vm cGl -1.11. 11.:11.le.lst
1.1vu cc:1:1:11 Il.s)1 -11.1:1 1t Itcr ..t1 1l. 11..11
l.0
l.twe c1 -..slc It.tl. 11.111 1t ttac l.tto 11.111-st.s.o
l.twe o 1.101 11.11: 11.11. 111 we c1 -l.ISS It.wt -11.1.1
l.tatG cc -1.111 11.e1s 111.1:: 1.1 we co 11.1:1 11111111.111
l.ttG rE 1.e 1.11 11.1 t.t ItCCl -1.111 11.11111.11:
l.tme r~l.t.ol. 111.1 ll.slo 11 we r~l 1:.111 I..so lo.lto
11 tt r l..IO Is.los :1.111 1.1 letc1 11.1:1 111::1111..:1
11 itt c -111:1 11.011 -11. 11 itto -1.111 I1.s1111.111
e1!
111Itt c1 s.os. Il..o1 111.:1: 1.1 seto. -1.111 Il.olc111.:1:
1.11tt r I.ICD I..IS1 .IC.111 111 1ttC1 -1. Ill 11.11.11.111
1.1tet c o.otl ts.los 11.1.o s.1 Itto : a l..tos-le.e.1
1.1Itt c1 -11:11 1:.111 -I1.o11 t1 1ttec l. see Is..l1.11.111
IIO~eu r -l.so1 1.111 s1.1o tse ~eucDl 1.11 11.11.-1111::
ssoBtu co!-o.ltl )o..s~ -lt.lo 111 ~eucc e.fss 11..1111.111
IIOBtu c1 L s11 II.ol1 lt.oes Iso veuc1 1.111 ll.ost:1.111
Iso~u c l.ols 1:111. -11.111 Iso Btuc 1.111 Is..:!-lt.ols
Islm r I.ol1 Is.lc1 1.11. Is! svrrES -l.tso ::1111-:11:11
r
Is!sir ot!1.111 Il..! 11.111 111 tw Co -I.I.s 1.11e -ll.el
Islm cc 11.:11 1..11. -:1111. Isl sw c1 11.1:1 Is.lsl1..111
r
111svr C1 1.111 11.1.1 11.1.1 111 i~~C 1.111 It.ll.1.111
le!tar o :1111 ll.ol 11:.11 t1s tsrw s.es1 =1. -11.s1c
s1.
111ir C1 1111? Il.to1 11.111 111 tlrC 1.11. 11111111.111
111vs~ o t.lo1 lo.s 11.111 t1s alrco 1.1e. :I.too1:1.11:
Issvs~ cc -1.0)1 11.1:1 111.:1: 11s 1swoo! 1.11 ll.ISS-111:1:
1349280
-44-
tsxisr ~o: t.tx 61.16. .61.11: :sx tear i.et1 tt.le6 61.1x1
t6xtm c1 ~.ts1 t:.ttt -61.:11 tIx tv c e.xlt tx.:lr -:1.111
t6xti 0 i.x.1 tx.rxx -11.1:, t6x t~.c1 ..~11 tx.it: 11.16:
sextit eci x.616 t..IS~ to..r1 t6x t~1eex x.111 11.:x1 t:.ex:
t1.tie r e.tl1 1x.11: -1:.661 ts r~ c1 i.tti tx.it: -ti.sll
t6.t~1 c t. a1 t:.tao 61.11: t1. t~~o t..ot tt.llo -tr.lls
t1.r~i c1 l.ii :x.161 -16.16: t6. tm oct 6.1:1 11.1:1 -t6.o.e
t1.tie cc: l.6xo t..st s.lo: ts6 t~~1, e..11 1x.:11 11.1:1
t6st~1 c1 I.t,l 11.61. -16.11: t6s t~1c I.iti tt.oxi 1..11.
tsst~1 0 1..x1 11.:11 sx..t. tss t.~c1 st.ela :x.166 16.11:
166tm oci sl.el: tx.tol tt.x:1 t6s t~ cct 1x.:11 t:.lt1 sl..e1
161~s r 1.01 to. -t..si. ts1 itsc1 1.x1. te.elx -tx.llo
to:
161w c so.6:: :c.xst l:.oix tsi ttso x6.11: tl.:~. -6x.11:
s
ts1its c1 I.o: sl.sla ~x.tt t1i itscc L e11 sv.lo6 11.1:1
t6iw ca xe.:l1 61.1.1 -sl.vtt t6i ws ee so.ttt s6.l.o 11.1:6
s
161its rt e.:.x 1.111 ll.os. 1st Btur se.xi: to.it. 61.1:.
tsrvtu c1 si.:~: t1.e61 -1.11) tsr ~e~c xl.tso to.txx -o.ii
t6vvt~ o x:.ol1 te.6is -1.1x1 tf~ ttue! 61.x1: t:.x.t .o.ltt
t6tveu cc 66.x6: tx.ito -se.6i1 t6r ~eucol 61.:16 t6.lex 1.111
t6tveu co: s:.it1 1x..11 -11.x:6 161 im r so.xi sl.:It e.tl1
ts1i~~ c1 so.io: 11.:1x -1.111 te1 mt c L tit sl.rox i.xrx
ts1tm o e.tl7 tl.ISi v.to: 161 1s r 1.1:. 61.x1: 6.slo
ts11s c1 T.t6t sr.111 ..611 161 1s c o.i61 x1.1.1 l.to1
161is o 1.161 to.oxl -..ti. 111 ~s ce T.IIi st.llo x.osx
1611s cc 1.111 tr.lxl t.es 161 is ool e.itt st.6:s -t.
x6.
ts1is oct r.el1 1.x11 -t.x:1 do st1r l.6io sl.iso 1.x11
do set c1 1.161 61.61, 1.6:1 do x11c i.l.i te.xlt -1.111
do x11 o x.6oc tl.les .11 do x6 e1 1.x16 61.111 -1.111
tiexte oc t.rls tr.Ixt 6...1 til I~er i.tl sl.vtl -x.
ti:
111r~t c1 1.6x1 11..11 -1.116 tii ~~tc 1.6 11.1.1 -t.
lit
tiirye o x.l.. t:.1.1 l.x: til ~~1e1 l.esx 61.:11 e.6ix
a rye ee x.6.1 tD.xxt 1.111 111 rt Cal t.xoi to.tix x.t:s
1
tiio~e ca: 1..11 tl.olo 6.666 til ~~tcei 1.1x1 te.tir 1.x16
tiieat ct: x.l.s tl.eo: 1.1.6 til ~~tcI t.ios 1:.116 x.111
tittt1 r e.111 11.:11 l.x0f tit tt C1 1.11 11.11. 1.161
tt tti C 1.110 1x.61 x.1.1 tit Tt1a l.tel :1.161 1.x11
ti:tt1 e1 t.i:: t:..s6 -1.161 tit tt1ee 1. t1 11.11: 1..6.
t1:tt1 coi 1.11. :o..i. 0.61. ti: theeo: 1.11 1:.111 e.il1
a: tt1 cei e.ol: 11.6:1 0.11: ti: tticet e.ti t=.111 6.111
titrte ct e.oi1 to.itx t.el1 ti: tteo~ 1.116 te.etl x.tos
tixtt1 1~ 1.111 tx.le 11.1:1 tit tt1c1 1.111 :x.166 i.ext
t1xtt1 c 6.i:1 tx.ilo 11.:61 tix xti0 1.v11 11.11: 1.111
tixtt1 c1 1.111 11.:11 1.111 tix ttec6 L Zt1 t6.exs 1.111
tixtt1 coi so.ol. t.e.1 11.16: tix tticot L Ioo t:.6.: -1.111
t1stt1 cti 61.1x6 tl.x:i 1.111 tix Tt1cet sl.oi: t:.i.o -..111
titvt1 c: 11.6x1 :x.111 6.io1 tix tt10~ st.ei6 16.1.1 11.61
ti.i~t r 1.111 :7.111 1.611 ti. yt c1 x.xoi tx.el. -1.11:
t1.i~t t x.11 :1.111 1.111 t1. ilt0 ..it Il.It. i.xif
ti6~.tsr 1..x1 t:.ltt 11.16. tis itsc1 x.lx. 11.:11 -10.1,1
ti!1tt c e.111 1:.1x1 :1.411 tit ~tt0 1.11. 1:.117 1::.x11
111ktt c1 1.166 tt.e~l -xt.e.1 tIS ltt~c p.llC 11.61: 11.x0!
t1s'ts co o.,io to. -lt.otl tis itsct -e.il: 11..11 1::.x11
s.1
116uts rt -s.ite ta.vsT 11:..11 tit cv ~ x.161 1x.1:1 -1o.11t
111i~t C1 1.110 1x.11: ll.xtf 111 catc 1.166 tf.ett 11.111
t1 ilt a .117 16.11 11.11 tit ltUr 1.li! :6.x11 :.110
tit1!u c1 t..It ti.iio t7.oW tit Btuc t.le. 11.1:1 11...x1
ti,~u o r.ISx ts.lot 61.:11 t1v vtuc1 sa.eio :1.166 -1x.11.
tit~eu ee se..6: tl.ole t.es1 tw Btueoi s l :1.1x1 tx.tse
ew
titc6u eoe 61.1:. tt.l:1 -l.x:~ tit tutr x.el. 1:.111 11..16:
titt~ e1 i.o1 tl.oxs -16.1.. tit x~ec x..ti 11.1.1 -tt.els
ti tit o e.6x1 11.11 1:1.11! 111 ZLtc1 e.6i1 tl.:ie 16.111
tiet.t cci i.el1 xo.s.i -11.11: tit titcc: 1.111 tl.l:s -1..11,
tittie toi 1.x11 xi.,w 111.:1: 111 1srr 1.111 11.1.x -tl.:st
134180
-45-
ot asp ca toes lr.trf -ss..f
t1t 1f~C .ft ll.ff.tl..ef
1141i~ 0 e.f.f t.T: te.t! t1 1f~Cf . aft le.If111.11
S1 ei~ tG f.ili ll.fa -li.tlc tat 1f~171 l.ttl ~T.t1 il.fti
tet1:~ wo: so.ol! tf.Tt tl..,j tr: ~w ~ a.too tt.olo-to.,s.
=TO1~ c. o.o4f 7:..se t1.11. tTe ~aLc l oft ~o.oe~:o.of.
tTO~a~ o o.etr tf.tlt tf.oT: ~,o taLco o.ef4 ~s.lfots.4::
=TO,aL cc! .o.t :.,t, -:s.of tro ~w cc: 4..:0 t.ol: -tt.ofs
t,stL~ ~ T.i:s lt.,os tf.ff: tT! iL~ca t.oef lo.t,o:..f..
tTScLr c 1.ot tT.ts -tf.of! tm t o .tss tT.oo -te.ots
tT!cL~ co t.le. tf.:to t..t4 1T1 tL~cc t..e to.lsot.off
tTScm co so.to! to.fff :e.fot t,! w ocs ss.o4f to.oTt-7T.fse
r
tTScL~ ~f: sl.,ot lo.ffs tt.f~o tT: ~~~r o.tTT tl.tttt..oos
tT:IL4 c. .t:. tf.Tl: -t..:.~ tT: aLet 4.Tas to.tfo-:..s4
tTSrm o 7.111 tf.fof -tf.oo! =r: am to .T.7 =..T.:ti.sTt
tTfaLa ~ ..l.T 14.11 -:f.sff 1T7 ILKc4 ~.o.o te.tsstt.oot
1T71~. c :.of! :T.f:f -:..eso =r7 ILro o.ott tT.lst-:4.:of
1~1 c1 l.T! t~.TT7 ll.ff t1. IL4w =.Tff 51.41.-=.T1
:T.aLa co =.tfl oo.ft! :4.:so :T. u. c. t.sef =t.s..-:o.o.T
_,.1,4 c s.T7o :o.7aT -tr.oto t T. ILro e.too :o.t.ttT.ots
=rfil~ r =.110 Il.lt. =1.11 =1f tlwt1 :.1.1 =e.ift-11.tT
trfcLr c t.s.T :.tls tt.TrT t,f caro o.te =T.ooT-tt.ts
:Tftw or s.sf7 :.f4i io.st~ t,f tm co 0.11 =o.TO.-
to.fso
tTfcL. cc o.fa! :..e4 :~...~ =Tf cw to -0.0:i t7.t7 -:T.oi!
tTfc~~ oei -s.7T :i.otf :o.Ta tTO cm rc: -s.sT7 to.4s1tl.ooo
_~~_ 1341280
The above structural studies together with the kinetic
data presented herein and elsewhere (Philipp, M., et al. (1983)
Mol. Cell. Biochem. 51, 5-32; Svendsen, I.B. (1976) Carlsberg Res.
Comm. 41, 237-291; Markland, S.F. Id; Stauffe~, D.C., et al. (1965)
J. Biol. Chem. 244, 5333-5338) indicate that the subsites in the
binding cleft of subtilisin are capable of interacting with
substrate amino acid residues from P-4 to P-2'.
The most extensively studied of the above residues are
Glyl66, G1y169 and A1a152. These amino acids were identified as
residues within the S-1 subsite. As seen in Fig. 3, which is a
stereoview of the S-1 subsite, Glyl66 and G1y169 not identified in
this figure occupy positions at the bottom of the S-1 subsite,
whereas A1a152, not identified in this figure occupies a position
near the top of S-1, close to the catalytic Ser221.
All 19 amino acid substitutions of G1y166 and G1y169
have been made. As wil:1 be indicated in the examples which
follow, the preferred replacement amino acids for Glyl66 and/or
Glyl69 will depend on the specific amino acid occupying the P-1
position of a given substrate.
The only substitutions of A1a152 presently made and
analyzed comprise the replacement of A1a152 with Gly and Ser. The
results of these substitutions on P-1 specificity will be presented
.in the examples.
In addition to those residues speci:Eically associated
with specificity for the P-1 substrate amino acid, Tyr104 has been
identified as being involved with P-4 specificity. Substitutions
at Phe189 and Tyr217,
- 46 -
X341280
-47-
however, are expected to respectively effect P-2' and
P-1' specificity.
The catalytic activity of subtilisin has also been
modified by single amino acid substitutions at Asn155.
The catalytic triad of subtilisin is shown in Fig. 4.
As can be seen, Ser221, His64 and Asp32 are positioned
to facilitate nucleophilic attach by the serine
hydoxylate on the carbonyl of the scissile peptide
bond. Crystallographic studies of subtilisin
(Robertus, et al. (1972) Biochem. ,~1, 4293-4303;
Matthews, et al. (1975) J. Biol. Chem. 250, 7120-7126;
Poulos, et al. (1976) J. Biol. Chem. 250, 1097-1103)
show that two hydrogen bonds are formed with the
oxyanion of the substrate transition state. One
hydrogen bond donor is from the catalytic serine-221
main-chain amide while the other is from one of the
NE2 protons of the asparagine-155 side chain. See
Fig. 4.
Asn155 was substituted with Ala, Asp~, His, Glu and
Thr. These substitutions were made to investigate the
the stabilization of the charged tetrahedral
intenaediate of the transition state complex by the
potential hydrogen band between the side chain of
Asn155 and the oxyanion of the intermediate. These
particular substitutions caused large decreases in
substrate turnover, kcat (200 to 4,000 fold), marginal
decreases in substrate binding Km (up to 7 fold), and
a loss in transition state stabilization energy of 2.2
to 4.7 kcal/mol. The retention of Km and the drop in
kcat will make these mutant enzymes useful as binding
proteins for specific peptide sequences, the nature of
which will be determined by the specificity of the
precursor protease.
134~~80_,
-48-
Various other amino acid residues have been identified
which affect alkaline stability. I:n some cases,
mutants having altered alkaline stability also have
altered thermal stability.
In _B am~rloliguefaciens subtilisin residues Asp36,
I1e107, Lysl70, Ser204 and Lys213 have been identified
as residues which upon substitution with a different
amino acid alter the alkaline stability of the mutated
enzyme as compared to the precursor. enzyme. The
substitution of Asp36 with Ala and the substitution of
Lys170 with Glu each resulted in a mutant enzyme
having a lower alkaline stability as compared to the
wild type subtilisin. When I1e107 was substituted
with Val, Ser204 substituted with Cys,, Arg or Leu or
Lys213 substituted with Arg, the mutant: subtilisin had
a greater alkaline stability as compaxed to the wild
type subtilisin. However, the mutant Ser204P
demonstrated a decrease in alkaline stability.
In addition, other residues, identified as being
associated with the modification of other properties
of subtilisin, also affect alkaline stability. These
residues include Ser24, Met50, G1u156, G1y166, G1y169
and Tyr217. Specifically the following particular
substitutions result in an increased alkaline
stability: Ser24C, Met50F, G1y156Q or S, G1y166A, H,
K, N or Q, G1y169S or A, and Tyr217F, K, R or L. The
mutant Met50V, on the other hand, results in a
decrease in the alkaline stability of the mutant
subtilisin as compared to wild type subtilisin.
Other residues involved in alkaline stability based on
the alkaline stability screen include Asp197 and
Met222. Particular mutants include Asp197(R or A) and
Met 222 (all other amino acids).
~34~280
-49-
Various other residues have been identified as being
involved in thermal stability as determined by the
thermal stability screen herein. These residues
include the above identified residues which effect
alkaline stability and Metl99 and Tyr27.. These latter
two residues are also believed to be important for
alkaline stability. Mutants at these residues include
I199 and F21.
The amino acid sequence of ~. amylolic~uefaciens
substilisin has also been modified by substituting two
or more amino acids of the wild-type sequence. Six
categories of multiply substituted mutant subtilisin
have been identified. The first two categories
comprise thermally and oxidatively stable mutants.
The next three other categories comprise mutants which
combine the useful properties of any of several single
mutations of ~. amyloliquefaciens subtilisin. The
last category comprises mutants which have modified
alkaline and/or thermal stability.
The first category comprises double mutants in which
two cysteine residues have been substituted at various
amino acid residue positions within the subtilisin
molecule. Formation of disulfide bridges between the
two substituted cysteine residues results in mutant
subtilisins with altered thermal stability and
catalytic activity. These mutants include A21/C22/C87
and C24/C87 which will be described in more detail in
Example 11.
The second category of multiple subtilisin mutants
comprises mutants which are stable in the presence of
various oxidizing agents such as hydrogen peroxide or
J
peracids. Examples 1 and 2 describe these mutants
1341280
-50-
which include F50/I124/Q222, F50/I124, F50/Q222,
F50/L124/Q222, I124/Q222 and L124/Q222.
The third category of multiple subtilisin mutants
comprises mutants with substitutions at position 222
combined with various substitutions at positions 166
or 169. These mutants, for example, combine the
property of oxidative stability of the A222 mutation
with the altered substrate specificity of the various
166 or 169 substitutions. Such multiple mutants
include A166/A222, A166/C222, F166/C222, K166/A222,
K166/C222, V166/A222 and V166/C222. The K166/A222
mutant subtilisin, for example, has a kcat/Km ratio
which is approximately two times greater than that of
the single A222 mutant subtilisin wher,~ compared using
a substrate with phenylalanine as the P-1 amino acid.
This category of multiple mutant is described in more
detail in Example 12.
The fourth category of multiple mutants combines
substitutions at position 156 (Glu to Q or S) with the
substitution of Lys at position 166. Either of these
single mutations improve enzyme performance upon
substrates with glutamate as the P-1 amino acid. When
these single mutations are combined, the resulting
multiple enzyme mutants perform better than either
precursor. See Example 9.
The fifth category of multiple mutants contain the
substitution of up to four amino acids of the
amyloliquefaciens subtilisin sequence. These mutants
have specific properties which are virtually identicle
to the properties of the subtilisin from
licheniformis. The subtilisin from E~. licheniformis
differs from _B. amyloliguefaciens subtilisin at 87 out
of 275 amino acids. The multiple mutant
134~2go .
-51-
F50/S156/A169/L217 was found to have similar substrate
specificity and kinetics to the licheniformis enzyme.
(See Example 13.) However, this is probably due to
only three of the mutations (S156, A169 and L217)
which are present in the substrate binding region of
the enzyme. It is quite surprising that, by making
only three changes out of the 87 different amino acids
between the sequence of the two enzymes, the _B.
amYloliquifaciens enzyme was converted into an enzyme
with properties similar to ~. licheniformis enzyme.
Other enzymes in this series include
F50/Q156/N166/L217 and F50/5156/L217.
The sixth category of multiple mutants includes the
combination of substitutions at position 107 (Ile to
V) with the substitution of Lys at position 213 with
Arg, and the combination of substitutions of position
204 (preferably Ser to C or L but also to all other
amino acids) with the substituion of Lys at position
213 with R. Other multiple mutants which have altered
alkaline stability include Q156/K166, Q156/N166,
S156/K166, 5156/N166 (previously identified as having
altered substrate specificity), and F50/S156/A169/L217
(previously identified as a mutant of $.
amyloliquifaciens subtilisin having properties similar
to subtilisin from ~. licheniformis). The mutant
F50/V107/R213 was constructed based an the observed
increase in alkaline stability for the single mutants
F50, V107 and 8213. It was determined that the
V107/R213 mutant had an increased alkaline stability
as compared to the wild type subtilisin. In this
particular mutant, the increased alkaline stability
was the result of the cumulative stability of each of
the individual mutations. Similarly, the mutant
F50/V107/R213 had an even greater alkaline stability
as compared to the V107/R213 mutant indicating that
~341~80
-52-
the increase in the alkaline stability due to the F50
mutation was also cumulative.
Table IV summarizes the multiple mutants which have
been made including those not mentioned above.
In addition, based in part on the above results,
substitution at the following residues in subtilisin
is expected to produce a multiple mutant having
increased thermal and alkaline stability: Ser24,
Met50, I1e107, G1u156, G1y166, G1y169, Ser204, Lys213,
G1y215, and Tyr217.
20
30
134180
-53-
TABLE IV
Triple, Quadruple
Double Mutants or Other Multiple
C22/C87 F50/I124/Q222
C24/C87 F50/L124/Q222
V45/V48 F50/L124/A222
C49/C94 A21/C22/C87
C49/C95 F50/S156/N166,/L217
C50/C95 F50/Q156/N166,/L217
C50/C110 F50/S156/A169/L217
F50/I124 F50/S156/L217
F50/Q222 F50/Q156/K166,/L217
I124/Q222 F50/S156/K166,/L217
Q156/D166 F50/Q156/K166,~K217
Q156/K166 F50/S 156/K166,~K217
Q156/N166 F50/V107/R213
S156/D166 [S153/S156/A158,~G159/5160/0161-
S156/K166 164/I165/S166/A169/R170]
S156/N166 L204/R213
5156/A169 R213/204A, E, Q, D, N, G, K,
A166/A222 V, R, T, P, I, M, F, Y, W
A166/C222 or H
F166/A222 V107/R213
F166/C222
K166/A222
K166/C222
V166/A222
V166/C222
A169/A222
A169/A222
A169/C222
A21/C22
In addition to the above identified amino acid
residues, other amino acid residues of subtilisin are
934180
-54-
also considered to be important with regard to
substrate specificity. Mutation of each of these
residues is expected to produce changes in the
substrate specificity of subtilisin. Moreover,
multiple mutations among these residues and among the
previously identified residues are also expected to
produce subtilisin mutants having novel substrate
specificity.
Particularly important residues are His67, I1e107,
Leu126 and Leu135. Mutation of His67 should alter the
S-1' subsite, thereby altering the specificity of the
mutant for the P-1' substrate residue. Changes at
this position could also affect the pH activity
profile of the mutant. This residue was identified
based on the inventor's substrate modeling from
product inhibitor complexes.
I1e107 is involved in P-4 binding. Mutation at this
position thus should alter specificity for the P-4
substrate residue in addition to the observed effect
on alkaline stability. I1e107 was also identified by
molecular modeling from product inhibitor complexes.
The S-2 binding site includes the Leu126 residue.
Modification at this position should therefore affect
P-2 specificity. Moreover, this residue is believed
to be important to convert subtilisin to an amino
peptidase. The pH activity profile should also be
J O
modified by appropriate substitution. These residues
were identified from inspection of the refined model,
the three dimensional structure from modeling studies.
A longer side chain is expected to preclude binding of
any side chain at the S-2 subsite. Therefore, binding
would be restricted to subsites S-1, S-1', S-2', S-3'
134T2~0
-55-
and cleavage would be forced to occur after the amino
terminal peptide.
Leu135 is in the S-4 subsite and if mutated should
alter substrate specificity for P-4 if' mutated. This
residue was identified by inspection of the
three-dimensional structure and modeling based on the
product inhibitor complex of F222.
In addition to these sites, specific amino acid
residues within the segments 97-103, 126-129 and
213-215 are also believed to be important to substrate
binding.
Segments 97-103 and 126-129 form an antiparallel beta
sheet with the main chain of substrate residues P-4
through P-2. Mutating residues in those regions
should affect the substrate orientation through main
chain (enzyme) - main chain (substrate) interactions,
since the main chain of these substrate residues do
not interact with these particular residues within the
S-4 through S-2 subsites.
Within the segment 97-103, G1y97 and Asp99 may be
mutated to alter the position of residues 101-103
within the segment. Changes at these: sites must be
compatible, however. In ~. amyloliquifaciens
subtilisin Asp99 stabilizes a turn in the main chain
tertiary folding that affects the direction of
residues 101-103. ~. licheniformis su.btilisin Asp97,
functions in an analogous manner.
In addition to G1y97 and Asp99, Ser101 interacts with
Asp99 in _B. am_yliguefaciens subtilisin to stabilize
the same main chain turn. Alterations at this residue
should alter the 101-103 main chain direction.
1341280
56
Mutations at G1n103 are also expected to affect the
101-103 main chain direction.
The side chain of G1y102 interacts with the substrate
P-3 amino acid. Side chains of substituted amino acids thus
are expected to significantly affect specificity for the P-3
substrate amino acids.
All the amino acids within the 127-129 segment are
considered important to substrate specificity. G1y127 is
positioned such that its side chain interacts with the S-1 and
S-3 subsites. Altering this residue thus should alter the
Specificity for P-1 and P-3 residues of the substrate.
The side chain of G1y128 comprises a part of both the
S-2 and S-4 subsites. Altered specificity for P-2 and P-4
therefore would be expected upon mutation. Moreover, such
mutation may convert subtilisin into an amino peptidase for the
same reasons substitutions of Leu126 would be expected to
:produce that result.
The Pro129 residue is likely to restrict the
conformational freedom of the sequence 126-133, residues which
v:nay play a major role in determining P-1 specificity.
Replacing Pro may introduce more flexibility thereby broadening
the range of binding capabilities of such mutants.
The side chain of Lys213 is located within the S-3
subsite. All of the amino acids within the 213-215 segment are
also considered to be important to substrate specificity.
Accordingly, altered P-3 substrate specificity is expected upon
mutation of this residue.
J
1341~~0
-57-
The Tyr214 residue does not interact with substrate
but is positioned such that it could affect the
conformation of the hair pin loop 204-217.
Finally, mutation of the G1y215 residue should affect
the S-3' subsite, and thereby alter P-3' specificity.
In addition to the above substitutions of amino acids,
the insertion or deletion of one or more amino acids
within the external loop comprising residues 152-172
may also affect specificity. This is because these
residues may play a role in the "secondary contact
region" described in the model of streptomyces
subtilisin inhibitor complexed with subtilisin.
girono, et al. (1984) J. Mol. Biol. 178, 389-413.
Thermitase K has a deletion in this region, which
eliminates several of these "secondary contact"
residues. In particular, deletion of residues 161
through 164 is expected to produce a mutant subtilisin
having modified substrate specificity. In addition, a
rearrangement in this area induced by the deletion
should alter the position of many residues involved in
substrate binding, predominantly at P-1. This, in
turn, should affect overall activity against
proteinaceous substrates.
The effect of deletion of residues 161 through 164 has
been shown by comparing the activity of the wild type
(WT) enzyme with a mutant enzyme containing this
deletion as well as multiple substitutions (i.e.,
S153/5156/A158/6159/S160/o161-164/I165/S166/A169/
R170). This produced the following results:
1341~~0
-58
TABLE V
kcat Km _ kcat/Km
WT 50 1.4x10 4 3.6x105
Deletion mutant 8 5.0x10 6 1.6x106
The WT has a kcat 6 times greater than the deletion.
mutant but substrate binding is 28 fold tighter by the
deletion mutant. The overall efficiency of the
deletion mutant is thus 4.4 times higher than the WT
enzyme.
All of these above identified residues which have yet
to be substituted, deleted or inserted into are
presented in Table VI.
TABLE VI
Substitution/Insertion/Deletion
His67 A1a152
Leu126 A1a153
Leu135 Glyl54
G1y97 Asnl55
Asp99 G1y156
Ser101 Gly:L57
G1y102 G1y160
G1u103 Thr:L58
Leul26 Ser:L59
G1y127 Ser:161
G1y128 Ser:l62
Pro129 Ser163
Tyr214 Thr164
G1y215 Va1165
G1y166 G1y169
Tyr167 Lys170
Pro168 Tyr171
Pro172
134180
-59-
The following disclosure is intended to serve as a
representation of embodiments herein, and should not
be construed as limiting the scope of this
application. These specific examples disclose the
construction of certain of the above identified
mutants. The construction of the other mutants,
however, is apparent from the disclosure herein and
that presented in EPO Publication No. O:I30756.
All literature citations are expressly :incorporated by
reference.
EXAMPLE 1
Identification of Peracid Oxidizable
Residues of Subtilisin Q222 and L222
As shown in Figures 6A and 6B, organic peracid
oxidants inactivate the mutant subtilisins Met222L and
Met222Q (L222 and Q222). This example describes the
identification of peracid oxidizable sites in these
mutant subtilisins.
First, the type of amino acid involved in peracid
oxidation was determined. Except under drastic
conditions (Means, G.E., et al. (1971) Chemical
Modifications of Proteins, Holden-Day, S.F., CA,
pp. 160-162), organic peracids modify only methionine
and tryptophan in subtilisin. Difference spectra of
the enzyme over the 250nm to 350nm range were
determined during an inactivation titration employing
the reagent, diperdodecanoic acid (DPDA) as oxidant.
Despite quantitative inactivation of the enzyme, no
change in absorbance over this wavelength range was
noted as shown in Figures 7A and 7B indicating that
tryptophan was not oxidized. Fontana, A., et al.
(1980) Methods in Peptide and Protein Sequence
134120
-60-
Analysis (C. Birr ed.) Elsevier, New York, p. 309.
The absence of tryptophan modification implied
oxidation of one or more of the remaining methionines
of B. amyloliquefaciens subtilisin. Seep Figure 1.
To confirm this result the recombinant subtilisin
Met222F was cleaved with cyanogen bromide (CNBr) both
before and after oxidation by DPDA. The peptides
produced by CNBr cleavage were ana7.yzed on high
resolution SDS-pyridine peptide gels (SPG).
Subtilisin Met222F (F222) was oxidized in the
following manner. Purified F222 was resuspended in
0.1 M sodium borate pH 9.5 at 10 mg/ml and was added
to a final concentration of 26 diperdodecanoic acid
(DPDA) at 26 mg/ml was added to produce an effective
active oxygen concentration of 30 ppm. The sample was
incubated for at least 30 minutes at room temperature
and then quenched with 0.1 volume of 1 M Tris pH 8.6
buffer to produce a final concentration of 0.1 M Tris
pH 8.6). 3mM phenylmethylsulfonyl fluoride (PMSF) was
added and 2.5 ml of the sample was applied to a
Pharmacia PD10 column equilibrated in 10 mM sodium
phosphate pH 6.2, 1 mM PMSF. 3.5 ml of 10 mM sodium
phosphate pH6.2, 1mM PMSF was applied and the eluant
collected.
F222 and DPDA oxidized F222 were precipitated with 9
volumes of acetone at -20°C. The samples were
resuspended at 10 mg/ml in 8M urea in 88$ formic acid
and allowed to sit for 5 minutes. An equal volume of
200 mg/ml CNBr in 88$ formic acid was added (5 mg/ml
protein) and the samples incubated for 2 hours at room
temperature in the dark. Prior to gel
electrophoresis, the samples were lyophilized and
resuspended at 2-5 mg/ml in sampl'~e buffer (1$
1341280
-61-
pyridine, 5$ NaDodS04, 5$ glycerol .and bromophenol
blue) and disassociated at 95°C for 3 minutes.
The samples were electrophoresed on discontinuous
polyacrylamide gels (Kyte, J., et al. (1983)
Anal. Bioch. 133, 515-522). The gels were stained
using the Pharmacia silver staining technique
(Sammons, D.W., et al. (1981) Electrophoresis 2
135-141).
The results of this experiment are shown in Figure 8.
As can be seen, F222 treated with CNBr only gives nine
resolved bands on SPG. However, when F222 is also
treated with DPDA prior to cleavage, bands X, 7 and 9
disappear whereas bands 5 and 6 are greatly increased
in intensity.
In order to determine which of the methionines were
effected, each of the CNBr peptides was isolated by
reversed phase HPLC and further characterized. The
buffer system in both Solvent A (aqueous) and Solvent
B (organic) for all HPLC separations was 0.05$
triethylamime/trifloroacetic acid (TEA-TFA). In all
cases unless noted, solvent A consisted of 0.05$
TEA-TFA in H20, solvent B was 0.05$ TEA-TFA in
1-propanol, and the flow rate was 0.5 ml/minute.
For HPLC analysis, two injections of 1 mg enzyme
digest were used. Three samples were acetone
precipitated, washed and dried. The dried 1 mg
samples were resuspended at 10 mg/ml in 8M urea, 88$
formic acid; an equal volume of 200 mg/ml CNBr in 88$
formic acid was added (5 mg/ml protein). After
incubation for 2 hours in the dark at room
temperature, the samples were desalted on a 0.8 cm X 7
1 341 ~$ 0
-62-
cm column of Tris Acryl GF05 coarse resin (IBF, Paris,
France) equilibrated with 40$ solvent B, 60$ solvent
A. 200 ul samples were applied at a flow rate of 1 ml
a minute and 1.0-1.2 ml collected by monitoring the
absorbance at 280nm. Prior to injection on the HPLC,
each desalted sample was diluted with 3 volumes of
solvent A. The samples were injected at 1.0 ml/min (2
minutes) and the flow then adjusted to 0.5 ml/min
(100$ A). After 2 minutes, a linear gradient to 60$ B
at 1.0$ B/min was initiated. From each. 1 mg run, the
pooled peaks were sampled (50u1) and analyzed by gel
electrophoresis as described above.
Each polypeptide isolated by reversed phase HPLC was
further analyzed for homogeneity by SPG. The position
of each peptide on the known gene serquence (Wells,
J.A., et al. (1983) Nucleic Acids Res., 11 7911-7924)
was obtained through a combination of amino acid
compositional analysis and, where needed, amino
terminal sequencing.
Prior to such analysis the following pa_ptides were to
rechromatographed.
1. CNBr peptides from F222 not treated with DPDA:
Peptide 5 was subjected to two additional reversed
phase separations. The 10 cm C4 column was
equilibrated to 80$A/ 20$B and the pooled sample
applied and washed for 2 minutes. Next an 0.5~ ml
B/min gradient was initiated. Fractions from this
separation were again rerun, this time on the 25 cm C4
column, and employing 0.05 TEA-TFA in
acetonitrile/1-propanol (1:1) for solvent B. The
gradient was identical to the one just described.
134 2~p
-63-
Peptide "X" was subjected to one additional separation
after the initial chromatography. T:he sample was
applied and washed for 2 minutes at 0.5m1/min (1008A),
and a 0.58 ml B/min gradient was initiated.
Peptides 7 and 9 were rechromatographed in a similar
manner to the first rerun of peptide 5.
Peptide 8 was purified to homogeneity after the
initial separation.
2. CNBr Peptides from DPDA Oxidized F222:
Peptides 5 and 6 from a CNBr digest of the oxidized
F222 were purified in the same manner as peptide 5
from the untreated enzyme.
Amino acid compositional analysis was obtained as
follows. Samples (-1nM each amino acid) were dried,
hydrolyzed in vacuo with 100 ul 6N HC1 at 106°C for 24
hours and then dried in a Speed Vac. T'.he samples were
analyzed on a Beckmann 6300 AA analyzer employing
ninhydrin detection.
Amino terminal sequence data was obtained as
previously described (Rodriguez, H., et al. (1984)
Anal. Biochem. 134, 538-547).
The results are shown in Table VII and Figure 9.
35
134280
-64-
TABLE VII
Amino and COOH terminii of CNBr fragments
Terminus and Method
Fragment amino, method COON, method
X l, sequence 50, composition
9 51, sequence 119, composition
7 125, sequence 199, composition
200, sequence 275, composition
Sox 1, sequence 119, composition
box 120, composition 199, composition
Peptides Sox and box refer to peptides 5 and 6
isolated from CNBr digests of the oxidized protein
where their respective levels are enhanced.
From the data in Table VII and the comparison of SPG
tracks for the oxidized and native protein digests in
Figure 8, it is apparent that (1) Met50 is oxidized
leading to the loss of peptides X and 9 and the
appearance of 5; and (2) Metl24 is also oxidized
leading to the loss of peptide 7 and the accumulation
of peptide 6. Thus oxidation of B. am~lolic~uifaciens
subtilisin with the peracid, diperdocecanoic acid
leads to the specific oxidation of methionine at
residues 50 and 124.
'0
EXAMPLE 2
Substitution at Met50 and Met124
in Subtilisin Met2220
'5 The choice of amino acid for substitution at Met50 was
based on the available sequence data for subtilisins
141280
-65-
from H. licheniformis (Smith, E.C., et al. (1968)
J. Biol. Chem. 4~3, 2184-2191), B.DY (Nedkov, P., et
al. (1983) No~pe Sayler's Z. Physiol. Chem. 364
1537-1540), B. amylosacchariticus (Markland, F.S., et
al. (1967) J. Biol. Chem. 242 5198-5211) and B.
subtilis (Stahl, M.L., et al. (1984) J. Bacteriol.
158, 411-418). In all cases, position 50 is a
phenylalanine. See Figure 5. Therefore, Phe50 was
chosen for construction.
At position 124, all known subtilisins possess a
methionine. See Figure 5. Molecular modelling of the
x-ray derived protein structure was therefore required
to determine the most probable candidates for
substitution. From all 19 candidates, isoleucine and
leucine were chosen as the best residues to employ.
In order to test whether or not modification at one
site but not both was sufficient to increase oxidative
stability, all possible combinations were built on the
Q222 backbone (F50/Q222, I124/Q222, F50/I124/Q222).
A. Construction of Mutations
Between Codons 45 and 50
All manipulations for cassette mutagenesis were
carried out on pS4.5 using methods disclosed in EPO
Publication No. 0130756 and Wells, J.A., et al, (1985)
Gene 34, 315-323. The po50 in Fig. 10, line 4,
mutations was produced using the mutagenesis primer
shown in Fig. 10, line 6, and emplo5red an approach
designated as restriction-purification which is
described below. Briefly, a M13 template containing
the subtilisin gene, M13mp11-SUET was used for
heteroduplex -synthesis (Adelman, et ~ (1983), DNA 2,
183-193). Following transfection of JM101 (ATCC
33876), the 1.5 kb coRI-BamHI fragment containing the
13412gp
-66-
subtilisin gene was subcloned from M13mp11 SUBT rf
into a recipient vector fragment of pHS42 the
construction of which is described in EPO Publication
No. 0130756. To enrich for the mutant sequence (po50,
line 4), the resulting plasmid pool was digested with
KpnI, and linear molecules were purified by
polyacrylamide gel electrophoresis. Linear molecules
were ligated back to a circular form, and transformed
into 1~. coli MM294 cells (ATCC 31446). Isolated
plasmids were screened by restriction analysis for the
KpnI site. ~nI+ plasmids were sequenced and
confirmed the po50 sequence. Asterisks in Figure 11
indicate the bases that are mutated from the wid type
sequence (line 4). po50 (line 4) was cut with StuI
and coRI and the 0.5 I~ fragment containing the 5'
half of the subtilisin gene was purified (fragment 1).
po50 (line 4) was digested with KpnI and EcoRI and the
4.0 Kb fragment containing the 3' half of the
subtilisin gene and vector sequences was purified
(fragment 2). Fragments 1 and 2 (line 5), and duplex
DNA cassettes coding for mutations desired (shaded
sequence, line 6) were mixed in a molar ratio of
1:1:10, respectively. For the particular construction
of this example the DNA cassette contained the triplet
TTT for codon 50 which encodes Phe. This plasmid was
designated pF50. The mutant subtilisin was designated
F50.
B. Construction of Mutation
Between Codons 122 and 127
The procedure of Example 2A was followed in
substantial detail except that the mutagenesis primer
of Figure 11, line 7 was used and restriction-
purification for the coRV site in po124 was used. In
addition, the DNA cassette (shaded sequence, Figure
934280
-67-
11, line 6) contained the triplet ATT for codon 124
which encodes Ile and CTT for Leu. 'Those plasmids
which contained the substitution of Ile for Met124were
designeated pI124. The mutant subtilisin was
designated I124.
C. Construction of Various
F50/I12.~JQ222 Multiple Mutants
:0
The triple mutant, F50/I124/Q222, was canstructed from
a three-way ligation in which each fragment contained
one of the three mutations. The single mutant Q222
(pQ222) was prepared by cassette mutagenesis as
described in EPO Publication No. 0130756. The F50
mutation was contained on a 2.2kb AVaII to vuII
fragment from pF50; the I124 mutation was contained on
a 260 by vuII to vaII fragment from pI124; and the
Q222 mutation was contained on 2.7 kb AvaII to AvaII
fragment from pQ222. The three fragments were ligated
together and transformed into ~. coli. MM294 cells.
Restriction analysis of plasmids from isolated
transformants confirmed the construction. To analyze
the final construction it was convenient that the
AvaII site at position 798 in the wild-type subtilisin
gene was eliminated by the 1124 construction.
The F50/Q222 and I124/Q222 mutants were constructed in
a similar manner except that the appropriate fragment
from pS4.5 was used for the final construction.
3C
D. Oxidative Stability of Q222 Mutants
The above mutants were analyzed for stability to
peracid oxidation. As shown in Fig. 12, upon
incubation with diperdodecanoic acid (protein 2mg!mL,
oxidant 75ppm[0~), both the I124/Q222 and the
1~41~80
-68-
F50/I124/Q222 are completely stable whereas the
F50/Q222 and the Q222 are inactivated. This indicates
that conversion of Met124 to I124 in subtilisin Q222
is sufficient to confer resistance to organic peracid
oxidants.
EXAMPLE 3
Subtilisin Mutants Having Altered
Substrate Specificity-Hydrophobic
Substitutions at Residues 166
Subtilisin contains an extended binding cleft which is
hydrophobic in character. A conserved glycine at
residue 166 was replaced with twelve non-ionic amino
acids which can project their side-chains into the S-1
subsite. These mutants were constructed to determine
the effect of changes in size and hydrophobicity on
the binding of various substrates.
A. Kinetics for Hydrolysis of Substrates
Having Altered P-1 Amino Acids by
Subtilisin from B Amyloliauefaciens
Wild-type subtilisin was purified from _H. subtilis
culture supernatants expressing the $. amylolique-
faciens subtilisin gene (Wells, J.A., et al. (1983)
Nucleic Acids Res. ~, 7911-7925) as previously
described (Estell, D.A., et al. (1985) J. Biol. Chem.
260, 6518-6521). Details of the synthesis of
tetrapeptide substrates having the form
succinyl-L-AlaL-AlaL-ProL-(X]-p-nitroanilide (where X
is the P1 amino acid) are described by DelMar, E.G.,
et ,ate. (1979) anal. Biochem. 99, 316-320. Kinetic
parameters, Km(M) and kcat(s 1) were measured using a
modified progress curve analysis (Estel.l, D.A., et al.
(1985) J. Hiol. Chem. X60_, 6518-6521). Briefly, plots
134 ~~0
-69-
of rate versus product concentration were fit to the
differential form of the rate equation using a
nor.-linear regression algorithm. Errors in kcat and
Km for all values reported are less than five percent.
The various substrates in Table VIII are ranged in
order of decreasing hydrophobicity. Nozaki, Y.
(1971), J. Piol. Chem. 246, 2211-2217; Tanford C.
(1978) Science 200, 1012).
1
'0
TABLE VIII
P1 substrate kcat/Km
Amino Acid kcat(S 1) 1/Km(M 1) (s-1M-1)
15
Phe 50 7,100 360,000
Tyr 28 40,000 1,100,000
Leu 24 3,100 75,000
Met 13 9,400 120,000
20 His 7.9 1,600 13,000
Ala 1 . 9 5, 500 11, 000
Gly 0.003 8,300 21
Gln 3. 2 2, 200 7, 100
Ser 2.8 1,500 4,200
25 Glu 0.54 32 16
The ratio of kcat/Km (also referred to as catalytic
efficienty) is the apparent second order rate constant
30 for the conversion of free enzyme plus substrate (E+S)
to enzyme plus products (E+p) (Jencks, W.P., Catalysis
in Chemistry and Enzymology (McGraw-Hill, 1969) pp.
321-436; Fersht, A., Enzyme Structure and Mechanism
(Freeman, San Francisco, 1977) pp. 226-287). The log
35 (kcat/Km) is proportional to transition state binding
~34~~80
-70-
energy, oGT. A plot of the log kcat/Km versus the
hydrophobicity of the P1 side-chain (Figure 14) shows
a strong correlation (r = 0.98), with t:he exception of
the glycine substrate which shows evidence for
non-productive binding. These data Shaw that relative
differences between transition-state binding energies
can be accounted for by differences in P-1 side-chain
hydrophobicity. When the transition-state binding
energies are calculated for these substrates and
plotted versus their respective side-chain
hydrophobicities, the line slope is 1.2 (not shown).
A slope greater than unity, as is also the case for
chymotrypsin (Fersht, A., Enzyme Structure and
Mechanism (Freeman, San Francisco, 1977) pp. 226-287;
Harper, J.W., et ~. (1984) Biochemistry, 23,
2995-3002), suggests that the P1 binding cleft is more
hydrophobic than ethanol or dioxane so:Lvents that were
used to empirically determine the hydrophobicity of
amino acids (Nozaki, Y., et al. J. Biol. Chem. (1971)
246, 2211-2217: Tanford, C. (1978) Science 200, 1012).
For amide hydrolysis by subtilisin, kcat can be
interpreted as the acylation rate constant and Km as
the dissociation constant, for the Mi.chaelis complex
(E~S), -Ks. Gutfreund, H., et a~ (1956) Biochem. J. 63,
656. The fact that the log kcat, as well as log 1/Km,
correlates with substrate hydrophobicity is consistent
with proposals (Robertus, J.D., bet al. (1972)
Biochemistry ~l, 2439-2449; Robertus, J.D., et al.
(1972) Hiochemistry ~1, 4293-4303) that during the
acylation step the P-1 side-chain moves deeper into
the hydrophobic cleft as the substrate advances from
the Michaelis complex (E~S) to the tetrahedral
transition-state complex (E~S~). However, these data
can also be interpreted as the hydrophobicity of the
P1 side-chain effecting the orientatian, and thus the
134 280
-71-
susceptibility of the scissile peptide bond to
nucleophilic attack by the hydroxyl group of the
catalytic Ser221.
The dependence of kcat/Km on P-1 Bide chain
hydrophobicity suggested that the kcat/Km for
hydrophobic substrates may be increased by increasing
the hydrophobicity of the S-1 binding subsite. To
test this hypothesis, hydrophobic amino acid
s~stitutions of Glyl66 were produced.
Since hydrophobicity of aliphatic ide-chains is
directly proportional to side-chain surface area
(Rose, G.D., et al. (1985) Science 229, 834-838;
Reynolds, J.A., et al. (1974) Proc. Natl. Acad. Sci.
USA 71, 2825-2927), increasing the hydrophobicity in
the S-1 subsite may also sterically hinder binding of
larger substrates. Because of difficulties in
predicting the relative importance of these two
opposing effects, we elected to generate twelve
non-charged mutations at position 166 to determine the
resulting specificities against non-charged substrates
of varied size and hydrophobicity.
B. Cassette Mutagenesis of
the P1 Bindinq_Cleft
The preparation of mutant subtilisims containing the
substitution of the hydrophobic amino acids Ala, Val
and Phe into residue 166 has been described in EPO
Publication No. 0130756. The same method was used to
produce the remaining hydrophobic mutants at residue
166. In applying this method, two unique and silent
restriction sites were introduced in the subtilisin
genes to closely flank the target codon 166. As can
be seen in Figure 13, the wild type sequence (line 1)
1341~gp
-72-
was altered by site-directed mutagenesis in M13 using
the indicated 37mer mutagenesis primer, to introduce a
13 by delection (dashedline) and unique S~cI and XmaI
sites (underlined sequences) that closely flank codon
166. The subtilisin gene fragment was subcloned back
into the ~. coli - _H. subtilis shuttle plasmid, pBS42,
giving the plasmid po166 (Figure 13, line 2). po166
was cut open with SacI and ~na,I, and gapped linear
molecules were purified (Figure 13, line 3). Pools of
synthetic oligonucleotides containing the mutation of
interest were annealed to give duplex DNA cassettes
that were ligated into gapped po166 (underlined and
overlined sequences in Figure 13, line 4). This
construction restored the coding sequence except over
position 166(NNN; line 4). Mutant sequences were
confirmed by dideoxy sequencing. Asterisks denote
sequence changes from the wild type sequence.
Plasmids containing each mutant ~. am_yloliguefaciens
subtilisin gene Were expressed at roughly equivalent
levels in a protease deficient strain of _B. subtilis,
BG2036 as previously described. EPO Publication No.
0130756: Yang, M., g~ al. (1984) J. Hacteriol. X60,
15-21; Estell, D.A., et ~1_ (1985) J. Hiol. Chem. 260,
6518-6521.
C. Narrowing Substrate Specificity
by Steric Hindrance
To probe the change in substrate specificity caused by
steric alterations in the S-1 subsite, position 166
mutants were kinetically analyzed versus Pl substrates
of increasing size (i.e., Ala, Met, Phe and Tyr).
Ratios of kcat/Km are presented in log form in
Figure 15 to allow direct comparisons of transition
state binding energies between various enzyme-
substrate pairs.
1~341C80
-73-
According to transition state theory, the free enery
difference between the free enzyme plus substrate
(E + S) and the transition state complex (E~S~) can be
calculated from equation (1),
(1) °GT = -RT In kcat/Km + RT In ~kT/h
in which kcat is the turnover number, Km is the
Michaelis constant, R is the gas constant, T is the
temperature, k is Boltzmann's constant, and h is
Planck's constant. Specificity differences are
ezpressed quantitatively as differences between
transition state binding energies (i.e., °°Gt), and
can be calculated from equation (2).
(2) °°GT = -RT In (kcat/Km)A/(kcat/Km)B
A and B represent either two different substrates
assayed againt the same enzyme, or two mutant enzymes
assayed against the same substrate.
As can be seen from Figure 15A, as the size of the
side-chain at position 166 increases the substrate
preference shifts from large to small P'-1 side-chains.
Enlarging the side-chain at position 166 causes
kcat/Km to decrease in proportion to t:he size of the
P-1 substrate side-chain (e. g., from G1y166
(wild-type) through W166, the kcat/Km for the Tyr
substrate is decreased most followed in order by the
Phe, Met and Ala P-1 substrates).
Specific steric changes in the position 166
side-chain, such as he presence of a ~-hydroxyl group,
p- or -y-aliphatic branching, cause large decreases in
kcat/Km for larger P1 substrates. Introducing a
'S ~-hydroxyl group in going from A166 (Figure 15A) to
1 341 ~g p
-74-
5166 (Figure 15B), causes an 8 fold and 4 fold
reduction in kcat/Km for Phe and Tyr substrates,
respectively, while the values for Ala and Met
substrates are unchanged. Producing a p-branched
structure, in going from S166 to T166, results in a
drop of 14 and 4 fold in kcat/Km for Phe and Tyr,
respectively. These differences are slightly
magnified for V166 which is slightly larger and
isosteric with T166. Enlarging the ~-branched
substituents from V166 to I166 causes a lowering of
kcat/Km between two and six fold toward Met, Phe and
Tyr substrates. Inserting a y-branched structure, by
replacing M166 (Figure 15A) with L166 (Figure 158),
produces a 5 fold and 18 fold decrease in kcat/Km for
Phe and Tyr substrates, respectively. Aliphatic
~-branched appears to induce less steric hindrance
toward the Phe P-1 substrate than ,9-branching, as
evidenced by the 100 fold decrease in kcat/Km for the
Phe substrate in going from L166 to I166.
Reductions in kcat/Km resulting from increases in side
chain size in the S-1 subsite, or specific structural
features such as ~- and y-branching, are quantita
tively illustrated in Figure 16. The kcat/Km values
for the position 166 mutants determined for the Ala,
Met, Phe, and Tyr P-1 substrates (top panel through
bottom panel, respectively), are plotted versus the
position 166 side-chain volumes (Chothia, C. (1984)
Ann. Rev. Biochem. 53, 537-572). Catalytic efficiency
for the Ala substrate reaches a maximum for I166, and
for the Met substrate it reaches a maximum between
V166 and L166. The Phe substrate shows a broad
kcat/Km peak but is optimal with A166. Here, the
p-branched position 166 substitutions form a line that
is parallel to, but roughly 50 fold lower in kcat/Km
than side-chains of similar size [i.e., C166 versus
134~,~8p
-75-
T166, L166 versus I166]. The Tyr substrate is most
efficiently utilized by wild type enzyme (G1y166), and
there is a steady decrease as one proceeds to large
position 166 side-chains. The ~9-branched and
7-branched substitutions form a parallel line below
the other non-charged substitutions of similar
molecular volume.
The optimal substitution at position 1.66 decreases in
volume with increasing volume of the P1 substrate
[i.e., I166/Ala substrate, L166/Met substrate,
A166/Phe substrate, G1y166/Tyr substrate]. The
combined volumes for these optimal pairs may
approximate the volume for productive binding in the
S-1 subsite. For the optimal pairs, Glyl66/Tyr
substrate, A166/Phe substrate, L166,iMet substrate,
V166/Met substrate, and I166/Ala substrate, the
combined volumes are 266,295,313,33! and 261 A3,
respectively. Subtracting the volume of the peptide
backbone from each pair (i.e., two times the volume of
glycine), an average side-chain volume of 160~32A3 for
productive binding can be calculated.
The effect of volume, in excess to the productive
binding volume, on the drop in transition-state
binding energy can be estimated from the Tyr substrate
curve (bottom panel, Figure 16), because these data,
and modeling studies (Figure 2), suggest that any
substitution beyond glycine causes steric repulsion.
A best-fit line drawn to all the data (r = 0.87) gives
a slope indicating a loss of roughly 3 kcal/mol in
transition state binding energy per 100A3 of excess
volume. (100A3 is approximately the size of a leucyl
side-chain.)
1 341 X80
-76-
D. Enhanced Catalytic Efficiency
Correlates with Increasing Hydrophobicity
of the Position 166 Substitution
Substantial increases in kcat/Km occur with
enlargement of the position 166 hide-chain, except for
the Tyr P-1 substrate (Figure 16). For example,
kcat/Km increases in progressing from G1y166 to I166
for the Ala substrate (net of ten-fold), from G1y166
to L166 for the Met substrate (net of ten-fold) and
from Glyl66 to A166 for the Phe substrate (net of
two-fold). The increases in kcat/Km cannot be
entirely explained by the attractive terms in the van
der Waals potential energy function because of their
strong distance dependence (1/r6) and because of the
weak nature of these attractive forces (Jencks, W.P.,
Catalvsis in Chemistry and Enzymoloay (McGraw-Hill,
1969) pp. 321-436: Fersht, A., enzyme Structure and
Mechanism (Freeman, San Francisco, 197'7) pp. 226-287;
Levitt, M. (1976) J. Mol. Biol. X04, 59-107). For
example, Levitt (Levitt, M. (1976) J. Mol. Biol. 104,
59-107) has calculated that the van der Waals
attraction between two methionyl residues would
produce a maximal interaction energy of roughly -0.2
kcal/mol. This energy would translate to only 1.4
fold increase in kcat/Km.
The increases of catalytic efficiency caused by
side-chain substitutions at position 166 are better
accounted for by increases in the hydrophobicity of
the S-1 subsite. The increase kcat/F'~m observed for
the Ala and Met substrates with increasing position
166 side-chain size would be expected, because
hydrophobicity is roughly proportional to side-chain
surface area (Rose, G.D., gt ~. (1985) Science 229,
834-838: Reynolds, J.A., et ~,1_. (19T4) Proc. Natl.
Acad. Sci. USA 7~, 2825-2927).
1 341 ~~ 0
-77-
Another example that can be interpreted as a
hydrophobic effect is seen when comparing kcat/Km for
isosteric substitutions that differ in hydrophobicity
such as S166 and C166 (Figure 16). Cysteine is
considerably more hydrophobic than serine (-1.0 versus
+0.3 kcal/mol) (Nozaki, Y., et ~1_. (1971) J. Biol.
Chem. X46, 2211-2217; Tanford, C. (1978) Science 200,
1012). The difference in hydrophobicity correlates
with the observation that C166 becomes more efficient
relative to Ser166 as the hydrophobicity of the
substrates increases (i.e., Ala < Met < Tye < Phe).
Steric hindrance cannot explain these differences
because serine is considerably smaller than cysteine
(99 versus 118A3). Paul, I.C., Chemistry of the -SH
Group (ed. S. Patai, Wiley Interscience, New York,
1974) pp. 111-149.
E. Production of an Elastase-Like
SQecificitv in Subtilisin
The I166 mutation illustrates particularly well that
large changes in specificity can be produced by
altering the structure and hydrophobic:ity of the S-1
subsite by a single mutation (Figure 17). Progressing
through the small hydrophobic substrates, a maximal
specificity improvement over wild type occurs for the
Val substrate (16 fold in kcat/Km). As the substrate
side chain size increases, these enhancements shrink
to near unity (i.e., Leu and His substrates). The
1166 enzyme becomes poorer against :larger aromatic
substrates of increasing size (e. g., I166 is over
1,000 fold worse against the Tyr substrate than is
G1y166). We interpret the increase in catalytic
efficiency toward the small hydrophobic; substrates for
1166 compared to G1y166 to the greater hydrophobicity
of isoluecine (i.e., -1.8 kcal/mol versus 0). Nozaki,
1341280
_78_
Y., et al. (1971) J. Hiol. hem. '~, 2211-2217;
Tanford, C. (1978) Science X00, 1012. The decrease in
catalytic efficiency toward the very large substrates
for I166 versus G1y166 is attributed to steric
S
repulsion.
The specificity differences between Glyl66 and I166
are similar to the specificity differences between
chymotrypsin and the evolutionary relative, elastase
(Harper, J.W., et ~ (1984) Biochemistry 23,
2995-3002). In elastase, the bulky amino acids, Thr
and Val, block access to the P-1 binding site for
large hydrophobic substrates that are preferred by
chymotrypsin. In addition, the catalytic efficiencies
toward small hydrophobic substrates are greater for
elastase than for chymotrypsin as we obeseve for I166
versus Glyl66 in subtilisin.
EXAMPLE 4
Substitution of Ionic Amino
Acids for Glyl66
The construction of subtilisin mutants containing the
substitution of the ionic amino acids Asp, Asn, Gln,
Lys and Ang are disclosed in EPO Publication No.
0130756. The present example describes the
construction of the mutant subtilisin. containing Glu
at position 166 (E166) and presents substrate
specificity data on these mutants. Further data on
position 166 and 156 single and double mutants is
presented infra.
po166, described in Example 3, was digested with SacI
and XmaI. The double strand DNA cassette (underlined
and overlined) of line 4 in Figure 1.3 contained the
134~,~gp
-79-
triplet GAA for the codon 166 to encode the
replacement of Glu for Glyl66. This mutant plasmid
designated pQ166 was propagated i.n BG2036 as
described. This mutant subtilisin, together with the
other mutants containing ionic substituent amino acids
at residue 166, were isolated as described and further
analyzed for variations in substrate specificity.
Each of these mutants was analyzed with the
tetrapeptide substrates, succinyl-L-AlaL-AlaProL-X-
-p-nitroanilide, where X was Phe, Ala and Glu.
The results of this analysis are shown .in Table IX.
TABLE IX
P-1 Substrate
(kcat/Km x 10 4)
Position 166 Phe Ala Glu
Gly (wild type) 36.0 1.4 0.002
Asp (D) 0.5 0.4 <0.001
Glu (E) 3.5 0.4 <0.001
Asn (N) 18.0 1.2 0.004
Gln (Q) 57.0 2.6 0.002
Lys (K) 52.0 2.8 1.2
Arg (R) 42.0 5.0 0.08
These results indicate that charged amino acid
substitutions at G1y166 have improved catalytic
efficiencies (kcat/Km) for oppositely charged P-1
substrates (as much as 500 fold) and poorer catalytic
efficiency for like charged P-1 substrates.
1341$0
-so-
EXAMPLE 5
Substitution of Glycine at Position 169
The substitution of Glyl69 in ~. amyloliquefaciens
subtilisin with Ala and Ser is described in EPO
Publication No. 0130756. The same method was used to
make the remaining 17 mutants containing all other
substituent amino acids for position 16.9.
The construction protocol is summarized in Figure 18.
The overscored and underscored double stranded DNA
cassettes used contained the following triplet
encoding the substitution of the indicated amino acid
at residue 169.
GCT A ATG M
TGT C AAC N
GAT D CCT P
GAA E CAA Q
TTC F AGA R
GGC G AGC S
CAC H ACA T
ATC I GTT V
AAA K TGG W
CTT L TAC Y
Each of the plasmids containing a substituted G1y169
was designated pX169, where X represents the
substituent amino acid. The mutant subtilisins were
simialrly designated.
Two of the above mutant subtilisins, A169 and 5169,
were analyzed for substrate specificity against
synthetic substrates containing Phe, Leu, Ala and Arg
in the P-1 position. The following results are shown
in Table X.
1 341 ~g 0
-81-
TABLE X
Effect of Serine and Alanine Mutations
at Position 169 on P-1 Substrate Specificity
~?-1 Substrate LkcatJKm x 10-4)
Position 169 ~_e Leu ~a_ Ara
Gly (wild type) 40 10 1 0.4
A169 120 20 1 0.9
5169 50 10 1 0.6
These results indicate that substitutions of Ala and
Ser at Glyl69 have remarkably similar catalytic
efficiencies against a range of P-1 substrates
compared to their position 166 counterparts. This is
probably because position 169 is at the bottom of the
P-1 specificity subsite.
EXAMPLE 6
Substitution at Position 104
,~5 Tyr104 has been substituted with Ala, His, Leu, Met
and Ser. The method used was a modification of the
site directed mutagenesis method. According to the
protocol of Figure 19, a primer (shaded in line 4)
introduced a unique HindIII site and a frame shift
mutation at codon 104. Restriction-purification for
the unique HindIII site facilitated the isolation of
the mutant sequence (line 4). Restriction-selection
against this HindIII site using pimers in line 5 was
used to obtain position 104 mutants.
134128~
_s2_
The following triplets were used in the primers of
Figure 19, line 5 for the 104 codon which substituted
the following amino acids.
GCT A TTC F
ATG M CCT P
CTT L ACA T
AGC S TGG W
CAC H TAC Y
CAA Q GTT V
GAA E AGA R
GGC G AAC N
ATC I GAT D
AAA K TGT C
The substrates in Table XI were used to analyze the
substrate specificity of these mutants. The results
obtained fo H104 subtilisin are shown in Table XI.
TABLE XI
30
kcat Km Kcat/Km
SubstrateWT H104 WT H104 WT H104
sAAPFpNA 50.0 22.0 1.4x10 7.1x10 3.6x1053.1x104
4 4
sAAPApNA 3.2 2.0 2.3x10 1.9x10 7!.4x1041x103
4 3
sFAPFpNA 26.0 38.0 1.8x10 4.1x10 1.5x1059.1x104
4 4
sFAPApNA 0.32 2.4 7.3x10 1.5x,10 4.4x1031.6x104
5 4
From these data it is clear that the substitution of
His for Tyr at position 104 produces .an enzyme which
is more efficient (higher kcat/Km) when Phe is at the
P-4 substrate position than when Ala is at the P-4
substrate position.
-83- 1 3 4 1 2 8 0
EXAMPLE ?
Substitution of A1a152
A1a152 has been substituted by Gl.y and Ser to
determine the effect of such substitutions on
substrate specificity.
The wild type DNA sequence was mutated by the
V152/P153 primer (Figure 20, line 4) using the above
restriction-purification approach for. the new KDnI
site. Other mutant primers (shaded sequences Figure
20; 5152, line 5 and 6152, line 6) mutated the new
K~anI site away and such mutants were isolated using
the restriction-selection procedure as described above
for loss of the KpnI site.
The results of these substitutions for the above
synthetic substrates containing the P-1 amino acids
phe, Leu and Ala are shown in Table XII.
TABLE XII
p-1 Substrate
(kcat/KmxlO 4)
Position 152 Phe Leu Ala
Gly (G) 0.2 0.4 <0.04
Ala (wild type) 40.0 10.0 1.0
Ser (S) 1.0 0.5 0.2
These results indicate that, in contrast to positions
166 and 169, replacement of A1a152 with Ser or Gly
causes a dramatic reduction in catalytic efficiencies
~ 34' 28 0_
-84-
across all substrates tested. This suggests A1a152,
at the top of the S-1 subsite, may be the optimal
amino acid because Ser and Gly are homologous Ala
substitutes.
EXAMPLE 8
Substitution at Position 156
Mutants containing the substitution of Ser and Gln for
G1u156 have been constructed according to the overall
method depicted in Figure 21. This method was
designed to facilitate the construcit.on of multiple
mutants at position 156 and 166 as will be described
hereinafter. However, by regenerating the wild type
G1y166, single mutations at G1u156 were obtained.
The plasmid po166 is already depicted in line 2 of
Figure 13. The synthetic oligonucleotides at the top
right of Figure 21 represent the same DNA cassettes
depicted in line 4 of Figure 13. The plasmid p166 in
Figure 21 thus represents the mutant plasmids of
Examples 3 and 4. In this particular example, p166
contains the wild type G1y166.
Construction of position 156 single mutants were
prepared by ligation of the three fragments (1-3)
indicated at the bottom of Figure 21. Fragment 3,
containing the carboxy-terminal partion of the
subtilisin gene including the wild ty~,pe position 166
codon, was isolated as a 610 by acI-HamHI fragment.
Fragment 1 contained the vector sequences, as well as
the amino-terminal sequences of the subtilisin gene
through codon 151. To produce fragment 1, a unique
KDnI site at codon 152 was introduced into the wild
type subtilisin sequence from pS4.5. Site-directed
1341~~p
-85-
mutagenesis in M13 employed a primer having the
sequence 5'-TA-GTC-GTT-GCG-GTA-CCC-GGT-AAC-GAA-3' to
produce the mutation. Enrichment for the mutant
sequence was accomplished by restriction with t~nI,
purification and self ligation. The mutant sequence
containing the ~Cp_nI site was confirmed by direct
plasmid sequencing to give pV152. pV152 (-1 gig) was
digested with C nI and treated with 2 units of DNA
polymerise I large fragment (Klenow fragment from
Boeringer-Mannheim) plus 50 ~M deoxynucleotide
triphosphates at 37'C for 30 min. 'This created a
blunt end that terminated with codon 151. The DNA was
extracted with 1:1 volumes phenol and CHC13 and DNA in
the aqueous phase was precipitated by addition of 0.1
volumes 5M ammonium acetate and two volumes ethanol.
After centrifugation and washing the DNA pellet with
70% ethanol, the DNA was lyophilized. DNA was
digested with BamHI and the 4.6kb piece (fragment 1)
was purified by acrylamide gel electrophoresis
followed by electroelution. Fragment 2 was a duplex
synthetic DNA cassette which when ligated with
fragments 1 and 3 properly restored the coding
sequence except at codon 156. The top strand was
synthesized to contain a glutamine codon, and the
complementary bottom strand coded for serine at 156.
Ligation of heterophosphorylated cassettes leads to a
large and favorable bias for the phosphorylated over
the non-phosphorylated oligonucleotide sequence in the
final segrated plasmid product. Therefore, to obtain
Q156 the top strand was phosphorylated, and annealed
to the non-phosphorylated bottom strand prior to
ligation. Similarly, to obtain S156 the bottom strand
was phosphorylated and annealed to the
non-phosphorylated top strand. Mutant sequences were
isolated after ligation and transformation, and were
confirmed by restriction analysis and DNA sequencing
~34~280
-86-
as before. To express variant subtil:isins, plasmids
were transformed into a subtilisin-neutral protease
deletion mutant of _H. subtilis, BG2036, as previously
described. Cultures were fermented in shake flasks
for 24 h at 37'C in LB media containing 12.5 mg/mL
chloramphenicol and subtilisin was purified from
culture supernatants as described. Purity of
subtilisin was greater than 95% as judged by SDS PAGE.
These mutant plasmids designated pS156 and pQ156 and
mutant subtilisins designated 5156 and Q156 were
analyzed with the above synthetic substrates where P-1
comprised the amino acids Glu, Gln, Met and Lys. The
results of this analyses are presented in Example 9.
EXAMPLE 9
Multiple Mutants With Altered
Substrate Specificity - Substitution
at Positions 156 and 166
Single substitutions of position 166 are described in
Examples 3 and 4. Example 8 describes single
substitutions at position 156 as well as the protocol
of Figure 21 whereby various double mutants comprising
the substitution of various amino acids at positions
156 and 166 can be made. This example describes the
construction and substrate specificity of subtilisin
containing substitutions at position 156 and 166 and
summarizes some of the data for single and double
mutants at positions 156 and 166 with various
substrates.
K166 is a common replacement amino acid in the 156/166
mutants described herein. The replacement of Lys for
1341~~a
-87-
G1y166 was achieved by using the synthetic DNA
cassette at the top right of Figure 21 which contained
the triplet AAA for NNN. This produced fragment 2
with Lys substituting for G1y166.
The 156 substituents were Gln and Ser. The Gln and
Ser substitutions at Glyl56 are contained within
fragment 3 (bottom right Figure 21).
The multiple mutants were produced by combining
fragments 1, 2 and 3 as described in Example 8: The
mutants Q156/K166 and S156/K166 were selectively
generated by differential phosphorylation as
described. Alternatively, the double 156/166 mutants,
c.f. Q156/K166 and 5156/K166, were prepared by
ligation of the 4.6kb SacI-BamHI fragment from the
relevant p156 plasmid containing the G.6kb SacI-BamHI
fragment from the relevant p166 plasmid.
These mutants, the single mutant K166, and the S156
and Q156 mutants of Example 8 were analyzed for
substitute specificity against synthetic polypeptides
containing Phe or Glu as the P-1 substrate residue.
The results are presented in Table XIII.
30
134280_
ro
y
3
E _
E
x -- ~ o a~o c~o o c. .-~
w ..., '.,. u, . o . o . . .
r.
x +.r -- .-1r~ c .-iero N ~o M
ro M .-,
y v
rox
U
x
x u, ~ ~r,~ ~oc ~o a ~r,N toc.~
0 0 0 0 0 0 0 0 0 0 0 0
rox x x x ~cx x x x x x x
U ~D ~DN N ~DO 10 ~DM r1 .-~1I'
. . . . . .
M r-1111.-1r-1lf1r-1.-~('~.-I'-1N
sT N 1f1tffU1 tf1111if1U1M 1f1
I I I (~"1
I I 1 1 1 I I I
O O O O O O O O O O I
O
O
'-1 rirl r-1e-1r-1ri rlr1r-1r-1
ri
H x x x x x x x x x x x x
x
H Q' ~ O 1001 ~ CO O~f'~W II1
M
E..~
M el'U1r-1M r-iM Q'~ ~'
M
W
(~
1J O st'O O O O O O O O O
O
ro O u'1O t'~O ~DO 10O ~' O
O'i
U
~ 0
x o 0 0 0 0 .-o o c o 0
0
u'1 N M M M sr
CJ
ro a
.-,ro v a v a v a v a v a v
a
y.l I .t"..r-1.L r-I,T:.-1,i'..r-I.4~ .L:
rl r-1
~n w a.~ ~ w c,~w c~w ~ w ~ w
~n c.~
.n v
a x
.a
w H
3
ro
E
O
U 7.
m c W o vo
w
vo x x
w w
N rl ~O ~O ~D ~O ~D
C a ~O ~I1 t!1 tf1 ~1
W ri ri r-i .-~ .-1 r-i
C7 x a C!7 tn W
1341$0
-89-
As can be seen in Table XIV, either of these single
mutations improve enzyme performance upon substrates
with glutamate at the P-1 enzyme binding site. When
these single mutations were combined, the resulting
multiple enzyme mutants are better than either parent.
These single or multiple mutations also alter the
relative pH activity profiles of the enzymes as shown
in Figure 23.
To isolate the contribution of electrostatics to
s~strate specificity from other chemical binding
forces, these various single and double mutants were
analyzed for their ability to bind and cleave
synthetic substrates containing Glu, Gln, Met and Lys
as the P-1 substrate amino acid. This permitted
comparisons between side-chains that were more
sterically similar but differed in charge (e.g., Glu
versus Gln, Lys versus Met). Similarly, mutant
enzymes were assayed against homologous P-1 substrates
that were most sterically similar but differed in
charge (Table XIV).
30
,341280
O O~OO vf1N I~01 erM N ~T ~ C)O M )I1'V' O
O 1DC1D.-1N O C~ N ri 00t'~I~Ct)00 tJ11~OD
.
t~ M M N M M M M M M N N N N N N N N
,.....r. .........., ._. . ..._,_.~ .. _..
. .
.. .
U M oou~ o ..aa o o o vovo m a)o~ M M M
N ~ .-i.-m0' N t~ ~ 1p f'~d' I~\L)~ N N t~ M
E ~ ~f~ ~ et'sr~' sr~T M M M ~~1M d' M M .-i
x
ct'ODtf1~DI~ ODM v0f~ .-1~!otDQ'N tf1ODO
Q r N OD M 00 W OJ sTOW D u1 1D1~N d' ~DO'v N
N M M arM M ~' d'M ~'t1'e!'d'a? d' C'er N
.........~ ~ ....r.....................r..~ ............ ._.
E ~
cn x M ~DO~ M e!'~ Q' 1f~f~ t"~.-~01f~iN lf1I~10
u~ w o, aoo~ sr'o, m o voo twc r r M .-,o~.-, M
w y.~ . . . . . . , , ~
O .
u~ ro ~, M a' u~er d'vr,u~~n umn u~~rmr,~o ui~o
+~
.n U
ro
--~ x
s~
.~
y
+~
cn
,ca 0 ~ ,-,c a'00 0~a n ~n r-,W o ~~0 00 00
,L1
r-I tf1CW-1 ~DO O .-itoM 00~O r CGN CD ~D01 et'
v C N N M M M M M M M M M M tr1M M M M '-i
v0 1~ r-~ ..............~ .~..,r..~~ .....~....."..~......r.r ...
r-1
~a~ ro ~
Y-1 N vDu1 tDO ~--1C' Wi't,nM Ov ~-~I~10 O e~'tr
1~ L~ O O OJ M ~!'~!'CD M 00 1nO 1f1Lf1N tw o 00 00
H ~p N . . .
C
ll1 ,L7 M M M ~'M M M d'M C'C' C b'et''' Q'
v
W v tJ~
a c
w
_ _ _ _ _ _ _ _ _ _ _ _ _ _
a7O
w
r~ ( N N C1 M O I~ 00M N O O tf1O O
r1
Ea+~ C~ N r-1t~ rlM et ?'I',f~f~M N ~f1et' O
D
fn ~ N N ~ N N .-iN N N C~IM sr er~ M
la
O ~ v .~~ ...... ..~~ ....~ ~.r..,.r....
O
G~ C~
w
N O O M O O N .-ncr.-W 01 O H
1
w ~ 'WO N M N N b N srM O O'vOv O t'~N II1
'L3
.r, C" [.,"'-ir-~.-1.-Ie-1.('.,.-1N N N '-1N V' V'~' M
U1
r~
U
E
~I
~.1
~
v
vw
c
v
~
a
x
v
_
v N N ~ H 'i ~ m i .-iO O O C)O O H ..~ E
l.r
z ~ i i i i i i i i + + x
ro
w
U v '-'
U
G b~
v O
N '-'
w
+~ w E
ro 3 ~ x
.... .r .~ .,
c voa, ~ ~ ~ a n.a.~ro>. >.>, ~ c;~ N u~~n .u
v vou~ .~cn ~ u~ N v ,-,~ .-,r, u~u~~r >. >,>. E ro
o
a c~a c~a a ~ a c~ c~~ a a:a a a a ~ x
r.i
.o~ a a ~ G ~ ~ ~ ~ c s~ ~ isa ~ c s~ x o~
w ~r,~ ...,~ .-a.-~v ~ .-,.-a,-,v ,-rv .-,.-a,-~v ro o
o
w .-,c~ c~c~ ~ c~ cnC~ c~c~ C~v~ C~viC~ C~ c~
-91- 1 3 4 1 2 8 0
Footnotes to Table XIV:
(a) _B. subtilis, BG 2036, expressing indicated
variant subtilisin were fermented and enzymes purified
as previously described (Estell, et ~,. (1985) J.
Hiol. Chem. 2~ 60, 6518-6521) . Wild type subtilisin is
indicated (wt) containing Glul56 and G1y166.
(b)
Net charge in the P-1 binding site is defined as
the sum of charges from positions 156 and 166 at pH
8.6.
(c) Values for kcat(s 1) and Km(M) were measured i~
O.1M Tris pH 8.6 at 25'C as previously described
against P-1 substrates having the form
succinyl-L-AlaL-AlaL-ProL-[X]-p-nitroanilide, where X
is the indicated P-1 amino acid. Values for log 1/Km
are shown inside parentheses. All errors in
determination of kcat/Km and 1/Km are below 5%.
(d) Because values for G1u156/Asp166(D166) are too
small to determine accurately, the maximum difference
taken for Glue-1 substrate is limited to a charge
range of +1 to -1 charge change.
n.d. = not determined
The kcat/Km ratios shown are the second order rate
constants for the conversion of substrate to product,
and represent the catalytic efficiency of the enzyme.
These ratios are presented in logarithmic form to
scale the data, and because log kcat/Km is
proportional to the lowering of transition-state
activation energy (oGT). Mutations at position 156
and 166 produce changes in catalytic efficiency toward
Glu, Gln, Met and Lys P-1 substrates of 3100, 60, 200
and 20 fold, respectively. Making the P-1
binding-site more positively charged [e. g., compare
G1n156/Lys166 (Q156/K166) versus G1u156/Met166
(G1u156/M166)] dramatically increased kcat/Km toward
the Glu P-1 substrate (up to 3100 fold), and decreased
the catalytic efficiency toward the Lys P-1 substrate
(up to 10 fold). In addition, the results show that
the catalytic efficiency of wild type enzyme can be
1341~~0
-92-
greatly improved toward any of the four P-1 substrates
by mutagenesis of the P-1 binding site.
The changes in kcat/Km are caused predominantly by
changes in 1/Km. Because 1/Km is approximately equal
to 1/Ks, the enzyme-substrate association constant,
the mutations primarily cause a change in substrate
binding. These mutations produce sma7.ler effects on
kcat that run parallel to the effects on 1/Km. The
changes in kcat suggest either an alteration in
binding in the P-1 binding site in going from the
Michaelis-complex E~S) to the transition-state complex
(E-S~) as previously proposed (Robertus, J.D., et al.
(1972) Biochemistry ~l_, 2439-2449: Robertus, J.D., et
al. (1972) Biochemistr~r ~, 4293-4303), or change in
the position of the scissile peptide bond over the
catalytic serine in the E~S complex.
Changes in substrate preference that arise from
changes in the net charge in the P-1 binding site show
trends that are best accounted for by electrostatic
effects (Figure 28). As the P-1 binding cleft becomes
more positively charged, the average catalytic
efficiency increases much more for the Glu P-1
substrate than for its neutral and isosteric P-1
homolog, Gln (Figure 28A). Furthermore, at the
positive extreme both substrates have nearly identical
catalytic efficiencies.
In contrast, as the P-1 site becomes more positively
charged the catalytic efficiency toward the Lys P-1
substrate decreases, and diverges sharply from its
neutral and isosteric homolog, Met (Figure 28B). The
similar and parallel upward trend seen with increasing
positive charge for the Met and Glu P-1 substrates
probably results from the fact that all the substrates
1341280
-93-
are succinylated on their amino-terminal end, and thus
carry a formal negative charge.
The trends observed in log kcat/Km are dominated by
changes in the Km term (Figures 28C and 28D). As the
pocket becomes more positively charged, the log 1/Km
values converge for Glu and Gln P-1 substrates (Figure
28C), and diverge for Lys and Met P-1 substrates
(Figure 28D). Although less pronounced effects are
seen in log kcat, the effects of P-1 charge on log
kcat parallel those seen in log 1/Km a:nd become larger
as the P-1 pocket becomes more positively charged.
This may result from the fact that the transition-
state is a tetrahedral anion, and a net positive
charge in the enzyme may serve to provide some added
stabilization to the transition-state.
The effect of the change in P-1 binding-site charge on
substrate preference can be estimated from the
differences in slopes between the charged and neutral
isosteric P-1 substrates (Figure 28B). The average
change in substrate preference (olog kcat/Km) between
charged and neutral isosteric substrates increases
roughly 10-fold as the complementary charge or the
enzyme increases (Table XV). When comparing Glu
versus Lys, this difference is 100-fold and the change
in substrate preference appears predominantly in the
Km term .
35
1341280
-94-
Differential Effect on Binding Site
Charge on log kcat/Km or (log 1/Km)
for P-1 Substrates that Differ in Charge(a)
Change in P-1 Binding flog kcat/Km (flog 1/Km)
Site Charge(b) GluGln MetLys GluLys
-2 to -1 n.d. 1.2 (1.2) n.d.
-1 to 0 0.7 (0.6) 1.3 (0.8) 2.1 (1.4)
0 to +1 1.5 (1.3) 0.5 (0.3) 2.0 (1.5)
Avg. change in
log kcat/K or
(log 1/Km)mper
unit charge change 1.1 (1.0) 1.0 (0.8) 2.1 (1.5)
(a) The difference in the slopes of curves were taken
between the P-1 substrates over the charge interval
given for log (kcat/Km) (Figure 28A, B) and (log 1/Km)
(Figure 28C, D). Values represent the differential
effect a charge change has in distinguishing the
substrates that are compared.
(b) Charge in P-1 binding site is defined as the sum
of charges from positions 156 and 166.
30
1341280
-95-
The free energy of electrostatic interactions in the
structure and energetics of salt-bridge formation
depends on the distance between the charges and the
microscopic dielectric of the media. 7.'o dissect these
structural and microenvironmental effects, the
energies involved in specific salt-bridges were
evaluated. In addition to the possible salt-bridges
shown (Figures 29A and 29B), reasonable salt-bridges
can be built between a Lys P-1 substrate and Asp at
position 166, and between a Glu P-1 substrate and a
Lys at position 166 (not shown). Although only one of
these structures is confirmed by X-ray crystalography
(Poulos, T.L., et ~. (1976) J. Mol. Biol. 257
1097-1103), all models have favorable torsion angles
(Sielecki, A.R., et al. (1979) J. Mol. Biol. 134,
781-804), and do not introduce unfavorable van der
Waals contacts.
2p The change in charged P-1 substrate preference brought
about by formation of the model salt-bridges above are
shown in Table XVI.
JO
E
M M
.u a;
~. 0
ro a 0
+~
cu N -
c ro
O~N N +i +i
v U
C tn 1
Li
.~
ro ,ra r.,M o M N o a m .-~.-wo 0
c~
~-
.C a oo N ~ w .-i .- m uwo o r
w
f.l O v-1.-iO r-1 r~1 .-1.-i.-1N
~
C. Ll.i
r~
rr G
d
x x
\ \
M ero a ro ~r M crv a~ ro
T7 E m o .-ic~ U oo M o o ~ U
-- vx N x x
v U O N N N "' O .-~<VN N
\
1~ :; I 1 I 1 1 1 I I I
1~
rovro
v i~r 0 O
f-.i
U
+~ v -- m -.,
x
U7 4-I G G
~
N .LI O 'a't' N 4 O N M M M d
'~' v
N ~ ~ M a~cr ov M vo m am o
w U cn r~ ~ . . . . ~ . . . . . v
o
.-i o 0 0 ~ ~ 0 0 0 0 0 >
v G + 1 1 1 a + + 1 I i a
v
v v
3
v
v s~v b
c~ a.+~ v
ro ~ .u +~+~ +~ +~ .v .vr~ c
s; v .-~ v v v v v v v v
s~
ro
0
roa, u~ U7 U1tl)U7 N N VIU7
W
1~ S-1.ta ~, ? W, ?, 7, ?~ ?,7,
O
x ro ~ as a a a a a a ~~a
w
a o
ascv ~n
a v o
~o
H v ~ ~ .~
v
tr a.~"~ w o ~o ~o vo vc ~~c~o vo
b N ri Ln U'1tn tn t0 lD ~.OlD ~D
~
..I ~ ~ m .-,.-~.-.,r.,
ro
o w o~
C7 CL U
v
ro
ro
w .c~ w e ~c vc vo vo ~,cvo va
o w e ~o~c ~c ~o ~ ~~ovo vo
a s;
U ~O fn fl).-1~., U7 r-ItnU7
v c N a a c~ a a a a a
w ro.C~ \ \ \ \ ~. \ '\\ \
W '~' t0 \O~D ~D l0 ~D 10~O ~O
w Tf ll1U1Lf1tf1 tf1 Lf1LC7tI11n
~ rir1 r-i '-i r-1r1ri r~1
ro ~ .~r, ~ .--~.-~,-~v
C~ c~a c7 c~ a a cn c~
0
V
~n ~o ~ ~o ~o ~c ~o ~ ~o ~o
v ~o w ~o ~ ~ ~o ~o~o ~o
a. ~ ~, ~, n, a a~a ~n
N fn fn.-1tl! tO .-1V7N ?,
a a c~ a a ~ a a a
w ', \ \ \ \ \ '\ \ \
r,
a a ~ a a c~ a ~
1 34 a 2s o
Footnotes to Table XVI:
(a) Molecular modeling shows it is possible to form a
salt bridge between the indicated charged P-1
substrate and a complementary charge in the P-1
binding site of the enzyme at the indicated position
changed.
(b) Enzymes compared have sterically similar amino
acid substitutions that differ in charge at the
indicated position.
(c) The P-1 substrates compared are structurally
similar but differ in charge. The charged P-1
substrate is complementary to the charge change at the
position indicated between enzymes 1 and 2.
(d) Date from Table XIV was used to compute the
difference in log (kcat/Km) between the charged and
the non-charged P-1 substrate (i.e., the substrate
preference). The substrate preference is shown
separately for enzyme 1 and 2.
(e) The difference in substrate preference between
enzyme 1 (more highly charged) and enzyme 2 (more
neutral) represents the rate change accompanying the
electrostatic interaction.
The difference between catalytic efficiencies (i.e.,
olog kcat/Km) for the charged and neutral P-1
substrates (e. g., Lys minus Met or Glu minus Gln) give
the substrate preference for each enzyme. The change
in substrate preference (oolog kcat/I~m) between the
charged and more neutral enzyme homologs (e. g.,
Glul56/Glyl66 minus G1n156(Q156)/G1y166) reflects the
change in catalytic efficiency that may be attributed
solely to electrostatic effects.
These results show that the average change in
substrate preference is considerably greater when
electrostatic substitutions are produced at position
166 (50-fold in kcat/Km) versus position 156 (12-fold
in kcat/Km). From these oolog kcat/Km values, an
average change in transition-state stabilization
energy can be calculated of -1.5 and -2.4 kcal/mol for
'134280
-98-
substitutions at positions 156 and 166, respectively.
This should represent the stabilization energy
contributed from a favorable electrostatic interaction
for the binding of free enzyme and substrate to form
the transition-state complex.
EXAMPLE 10
Substitutions at Position 217
Tyr217 has been substituted by all other 19 amino
acids. Cassette mutagenesis as de~~cribed in EPO
publication No. 0130756 was used according to the
protocol of Figure 22. The EcoRV restriction site was
used for restriction-purification of pG217.
Since this position is involved in substrate binding,
mutations here effect kinetic parameters of the
enzyme. An example is the substitution of Leu for Tyr
at position 217. For the substrate sAAPFpNa, this
mutant has a kcat of 277 5' and a Km o~f 4.7x10 4 with
a kcat/Km ratio of 6x105. This represents a 5.5-fold
increase in kcat with a 3-fold increase in Km over the
wild type enzyme.
In addition, replacement of Tyr217 by hys, Arg, Phe or
Leu results in mutant enzymes which are more stable at
pHs of about 9-11 than the WT enzyme. Conversely,
replacement of Tyr217 by Asp, Glu, Gly or Pro results
in enzymes which are less stable at pHs of about 9-11
than the WT enzyme.
1 34~ 280
-99-
EXAMPLE 11
Multiple Mutants Having
Altered Thermal Stabilitv
_H. amyloliguefacien subtilisin does not contain any
cysteine residues. Thus, any attempt to produce
thermal stability by Cys cross-linkage required the
substitution of more than one amino acid in subtilisin
with Cys. The following subtilisin residues were
multiply substituted with cysteine:
Thr22/Ser87
Ser24/Ser87
Mutagenesis of Ser24 to Cys was carried out with a 5'
phosphorylated oligonucleotide primer having the
sequence
**
5'-pC-TAC-ACT-GGATGC-AAT-GTT-AAA-G-3'.
(Asterisks show the location of mismatches and the
underlined sequence shows the position of the altered
Sau3A site.) The ~. amyloliquefaciens subtilisin gene
on a 1.5 kb EcoRI-BAMHI fragment from pS4.5 was cloned
into M13mp11 and single stranded DNA was isolated.
This template (M13mp11SUBT) was double primed with the
5' phosphorylated M13 universal sequencing primer and
the mutagenesis primer. Adelman, et al. (1983) DNA 2_,
183-193. The heteroduplex was transfected into
competent JM101 cells and plaques were probed for the
mutant sequence (Zoller, M.J., et al. (1982) Nucleic
Acid Res. ~, 6487-6500: Wallace, et al. (1981)
Nucleic Acid Res. ~, 3647-3656) using a
tetramethylammonium chloride hybridization protocol
(Wood, et ~. (1985) Proc. Natl. Acad. Sci. USA 82,
1585-1588). The Ser87 to Cys mutation was prepared in
1341280
-loo-
a similar fashion using a 5' phospho:rylated primer
having the sequence
5'-pGGC-GTT-GCG-CCA-TGC-GCA-TCA-CT-3'.
(The asterisk indicates the position of the mismatch
and the underlined sequence shows the position of a
new MstI site.) The C24 and C87 mutations were
obtained at a frequency of one and two percent,
respectively. Mutant sequences were confirmed by
dideoxy sequencing in M13.
Mutagenesis of Tyr21/Thr22 to A21/C22 was carried out
with a 5' phosphorylated oligonucleotide primer having
the sequence
5'-pAC-TCT-CAA-GGC-GCT-TGT-GGC-TCA-AAT-GTT-3'.
(The asterisks show mismatches to the wild type
sequence and the underlined sequence shows the
position of an altered Sau3A site.) Manipulations for
heteroduplex synthesis were identical to those
described for C24. Because direct cloning of the
heteroduplex DNA fragment can yield increased
frequencies of mutagenesis, the EcoRI-BamHI subtilisin
fragment was purified and ligated into pBS42. E_. coli
MM 294 cells were transfonaed with the ligation
mixture and plasmid DNA was purified from isolated
transformants. Plasmid DNA was screened for the loss
of the Sau3A site at codon 23 that was eliminated by
the mutagenesis primer. Two out of 16 plasmid
preparations had lost the wild type Sau3A site. The
mutant sequence was confirmed by dideoxy sequencing in
M13.
X3412$0
-lol-
Double mutants, C22/C87 and C24/C87, were constructed
by ligating fragments sharing a common C aI site that
separated the single parent cystine codons.
Specifically, the 500 by coRI-ClaI fragment
containing the 5' portion of the subtilisin gene
(including codons 22 and 24) was ligated with the 4.7
kb ClaI-EcoRI fragment that contained the 3' portion
of the subtilisin gene (including codon 87) plus pBS42
vector sequence. E_. coli MM 294 was transformed with
ligation mixtures and plasmid DNA was purified from
individual transformants. Double-cysteine plasmid
constructions were identified by restriction site
markers originating from the parent cysteine mutants
(i.e., C22 and C24, Sau3A minus: Cys87, MstI plus).
Plasmids from ~. poli were transformed into
subtilis BG2036. The thermal stability of these
mutants as compared to wild type subtilisin are
presented in Figure 30 and Tables XVII and XVIII.
25
35
9341~~0
-l02-
TABLE XVII
Effect of DTT on the Half-Time of
Autolytic Inactivation of Wild-Type
and Disulfide Mutants of Subtilisin*
S
t~
Enzyme -DDT +DTT -DTT/+DTT
min
Wild-type 95 85 1.1
C22/C87 44 25 1.8
C24/C87 92 62 1.5
(*) Purified enzymes were either treated or not
treated with 25mM DTT and dialyzed with or without
lOmM DTT in 2mM CaCl2, 50mM Tris (pH 7.5) for 14 hr.
at 4°C. Enzyme concentrations were adjusted to 80u1
aliquots were quenched on ice and assayed for residual
activity. Half-times for autolytic inactivation were
determined from semi-log plots of l.ogl0 (residual
activity) versus time. These plots were linear for
over 90$ of the inactivation.
30
1341280
-103-
TABLE XVIII
Effect of Mutations in Subtilisin
on the Half-Time of Autolytic
Inactivation at 58'C*
Enzyme
min
Wild-type 120
C22 22
C24 120
C87 104
C22/C87 43
C24/C87 115
(*) Half-times for autolytic inactivation were
determined for wild-type and mutant subtilisins as
described in the legend to Table III. Unpurified and
non-reduced enzymes were used directly from _B.
subtilis culture supernatants.
The disulfides introduced into subtilisin did not
improve the autolytic stability of the mutant enzymes
when compared to the wild-type enzyme. However, the
disulfide bonds did provide a margin of autolytic
stability when compared to their corresponding reduced
double-cysteine enzyme. Inspection of a highly
refined x-ray structure of wild-type _B. amylolique-
faciens subtilisin reveals a hydrogen bond between
Thr22 and Ser87. Because cysteine is a poor hydrogen
donor or acceptor (Paul, I.C. (1974) in Chemistry of
the -SH Group (Patai, S., ed.) pp. 111-149, Wiley
Interscience, New York) weakening of 22/87 hydrogen
bond may explain why the C22 and C87 single-cysteine
mutant proteins are less autolytica:lly stable than
either C24 or wild-type (Table XVIII). The fact that
C22 is less autolytically stable than C87 may be the
result of the Tyr2lA mutation (Table XVIII). Indeed,
~ 341 28 0
-104-
construction and analysis of Tyr21/'C22 shows the
mutant protein has an autolytic stability closer to
that of C87. In summary, the C22 and C87 of
single-cysteine mutations destabilize the protein
toward autolysis, and disulfide bond formation
increases the stability to a level less than or equal
to that of wild-type enzyme.
EXAMPLE 12
Multiple Mutants Containing Substitutians
at Position 222 and Position 166 or 169
Double mutants 166/222 and 169/222 were prepared by
ligating together (1) the 2.3kb AcaII fragment from
pS4.5 which contains the 5' portion of the subtilisin
gene and vector sequences, (2) the 200bp AvaII
fragment which contains the relevant 166 or 169
mutations from the respective 166 or 169 plasmids, and
(3) the 2.2kb vaII fragment which contains the
relevant 222 mutation 3' and of the subtilisin genes
and vector sequence from the respective p222 plasmid.
Although mutations at position 222 improve oxidation
stability they also tend to increase the Km. An
example is shown in Table XIX. In this case the A222
mutation was combined with the K166 mutation to give
an enzyme with kcat and Km intermediate between the
two parent enzymes.
35
1341 X80
-105-
TABLE XIX
kcat Km
WT 50 1.4x10 4
A222 42 9.9x10 4
K166 21 3.7x10 5
K166/A222 29 2.0x10 4
substrate sAAPFpNa
EXAMPLE 13
Multiple Mutants Containing
Substitutions at Positions 50, 156,
166 217 and Combinations Thereof
The double mutant 5156/A169 was prepared by ligation
of two fragments, each containing one of the relevant
mutations. The plasmid pS156 was cut. with XmaI and
treated with S1 nuclease to create a blunt end at
codon 167. After removal of the nuclease by
phenol/chloroform extraction and ethanol precipita
tion, the DNA was digested with BamHI and the
approximately 4kb fragment containing the vector plus
the 5' portion of the subtilisin gene through codon
167 was purified.
The pA169 plasmid was digested with RpnI and treated
with DNA polymerise Klenow fragment plus 50 uM dNTPs
to create a blunt end codon at codon 168. The Klenow
was removed by phenol/chloroform extraction and
ethanol precipitation. The DNA was digested with
BamHI and the 590bp fragment including codon 168
through the carboxy terminus of the subtilisin gene
1 34~ 280
-106-
was isolated. The two fragments were then ligated to
give S156/A169.
Triple and quadruple mutants were prepared by ligating
together (1) the 220bp PvuII/HaeII fragment containing
S the relevant 156, 166 and/or 169 mutations from the
respective p156, p166 and/or p169 double of single
mutant plasmid, (2) the 550bp HaeII/BamHI fragment
containing the relevant 217 mutant from the respective
p217 plasmid, and (3) the 3.9kb PvuII/BamHI fragment
containing the F50 mutation and vector sequences.
The multiple mutant F50/S156/A169/L217, as well as B.
amyloliquefaciens subtilisin, B. lichenformis
subtilisin and the single mutant L217 were analyzed
with the above synthetic polypeptides where the P-1
amino acid in the substrate was Lys, His, Ala, Gln,
Tyr, Phe, Met and Leu. These results. are shown in
Figures 26 and 27.
These results show that the F50/5156/A7.69/L217 mutant
has substrate specificity similar to that of the B.
licheniformis enzyme and differs dramatically from the
wild type enzyme. Although only data for the L217
mutant are shown, none of the single mutants (e. g.,
F50, S156 or A169) showed this effect. Although B.
licheniformis differs in 88 residue positions from B.
amyloliauefaciens, the combination. of only these four
mutations accounts for most of the differences in
substrate specificity between the two enzymes.
JO
EXAMPLE 14
Subtilisin Mutants Having
Altered Alkaline Stability
A random mutagenesis technique was used to generate
J
single and multiple mutations within the B.
1341280
-l07-
amylolic~uefaciens subtilisin gene. Such mutants were
screened for altered alkaline stability. Clones
having increased (positive) alkaline stability and
decreased (negative) alkaline stability were isolated
and sequenced to identify the mutations within the
subtilisin gene. Among the positive clones, the
mutants V107 and 8213 were identified. These single
mutants were subsequently combined to produce the
mutant V107/R213.
One of the negative clones (V50) from the random
mutagenesis experiments resulted in a marked decrease
in alkaline stability. Another mutant (P50) was
analyzed for alkaline stability to determine the
effect of a different substitution at position 50.
The F50 mutant was found to have a greater alkaline
stability than wild type subtilisin and when combined
with the double mutant V107/R213 resulted in a mutant
having an alkaline stability which reflected the
aggregate of the alkaline stabilities for each of the
individual mutants.
The single mutant 8204 and double mutant C204/R213
were identified by alkaline screening after random
cassette mutagenesis over the region from position 197
to 228. The C204/R213 mutant was thereafter modified
to produce mutants containing the individual mutations
C204 and 8213 to determine the contribution of each of
the individual mutations. Cassette mutagenesis using
pooled oligonucleotides to substitute all amino acids
at position 204, was utilized to determine which
substitution at position 204 would maximize the
increase in alkaline stability. The mutation from
Lys213 to Arg was maintained constant for each of
these substitutions at position 204.
1341?80
-l08-
A. Construction of pB0180, an
E. coli-B. subtilis Shuttle Plasmi<:
The 2.9 kb EcoRI-BamHI fragment from pBR327
(Covarrubias, L., et al. (1981) Gene 13, 25-35) was
ligated to the 3.7kb EcoRI-BamHI fragment of pBD64
(Gryczan, T., et al. (1980) J. Bac:teriol., 141,
246-253) to give the recombinant plasmid pB0153. The
unique EcoRI recognition sequence in pBD64 was
eliminated by digestion with EcoRI followed by
treatment with Klenow and deoxynucleotide
triphosphates (Maniatis, T., et al. (eds.) (1982) in
Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.). Blunt
end ligation and transformation yielded pB0154. The
unique AvaI recognition sequence in pB0154 was
eliminated in a similar manner to yield pB0171.
pB0171 was digested with BamHI and PvuII and treated
with Klenow and deoxynucleotide tr:iphosphates to
create blunt ends. The 6.4 kb fragment was purified,
ligated and transformed into LE392 cells (Enquest,
L.W., et al. (1977) J. Mol. Biol. 111, 97-120), to
yield pB0172 which retains the unique BamHI site. To
facilitate subcloning of subtilisin mui:ants, a unique
and silent K~nI site starting at codon 166 was
introduced into the subtilisin gene from pS4.5 (Wells,
J.A., et al. (1983) Nucleic Acids Res., 11, 7911-7925)
by site-directed mutagenesis. The K~mI+ plasmid was
digested with EcoRI and treated with Klenow and
deoxynucleotide triphosphates to create a blunt end.
The Klenow was inactivated by heating for 20 min at
68°C, and the DNA was digested with BamHI. The 1.5 kb
blunt EcoRI-BamHI fragment containing the entire
subtilisin was ligated with the 5.8 kb NruI-BamHI from
pB0172 to yield pB0180. The ligation of the blunt
NruI end to the blunt EcoRI end recreated an EcoRI
~~4~~80
-109-
site. Proceeding clockwise around pB0180 from the
EcoRI site at the 5' end of the subtilisin gene is the
unique BamHI site at the 3' end of the subtilisin
gene, the chloramphenicol and neomycin resistance
genes and UB110 gram positive replication origin
derived from pBD64, the ampicillin resistance gene and
gram negative replication origin derived from pBR327.
B' Construction of Random Mutagenesis Library
The 1.5 kb EcoRI-BamHI fragment containing the B.
amyloliquefaciens subtilisin gene (Wel:Ls et al., 1983)
from pB0180 was cloned into M13mp11 to give M13mp11
SUBT essentially as previously described (Wells, J.A.,
et al. (1986) J. Biol. Chem., 261,6564-6570).
Deoxyuridine containing template DNA was prepared
according to Kunkel (Kunkel, T.A. (1985) Proc. Natl.
Acad. Sci. USA, 82 488-492). Uridine containing
template DNA (Kunkel, 1985) was purified by CsCl
density gradients (Maniatis, T. et al. (eds.) (1982)
in Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.). A
primer (AvaI ) having the sequence
5'GAAAAAAGACCCTAGCGTCGCTTA
ending at colon -11, was used to alter the unique AvaI
recognition sequence within the subtilisin gene. (The
asterisk denates the mismatches from the wild-type
sequence and underlined is the altered AvaI site.)
The 5' phosphorylated AvaI primer (--320 pmol) and -40
pmol (-120ug) of uridine containing M13mp11 SUBT
template in 1.88 ml of 53 mM NaCl, 7.4 mM MgCl2 and
7.4 mM Tris.HCl (pH 7.5) were annealed by heating to
134120
-llo-
90°C for 2 min. and cooling 15 min at 24°C (Fig. 31).
Primer extension at 24°C was initiated by addition of
100uL containing 1 mM in all four deoxynucleotide
triphosphates, and 20,1 Klenew fragmer.~t (5 units/1).
The extension reaction was stopped every 15 seconds
over ten min by addition of 10u1 0.25 M EDTA (pH 8) to
50,.1 aliquots of the reaction mixture.. Samples were
pooled, phenol chlorophorm extracted and DNA was
precipitated twice by addition of 2.5 vol 100$
ethanol, and washed twice with 70$ ethanol. The
pellet was dried, and redissolved in 0.4 ml 1 mM EDTA,
10 mM Tris (pH 8).
Misincorporation of a-thiodeoxynucleotides onto the 3'
ends of the pool of randomly terminated template was
carried out by incubating four 0.2 ml solutions each
containing one-fourth of the randomly terminated
template mixture (-20ug), 0.25 mM of a given
a-thiodeoxynucleotide triphosphate, :100 units AMV
Polymerase, 50 mM KCL, 10 mM MgCl2, 0.4 mM
dithiothreitol, and 50 mM Tris (pH F3.3) (Champoux,
J.J. (1984) Genetics, 2, 454-464). After incubation
at 37°C for 90 minutes, misincorporation reactions
were sealed by incubation for five minutes at 37°C
with 50 mM all four deoxynucleotide triphosphates (pH
8), and 50 units AMV polymerase. Reactions were
stopped by addition of 25 mM EDTA (final), and heated
at 68°C for ten min to inactivate AMV polymerase.
After ethanol precipitation and resuspension,
synthesis of closed circular hete:roduplexes was
carried out for two days at 14°C under the same
conditions used for the timed extension reactions
above, except the reactions also contained 1000 units
T4 DNA ligase, 0.5 mM ATP and 1 mM s-mercaptoethanol.
Simultaneous restriction of each het:eroduplex pool
with K~nI, BamHI, and EcoRI confirmed that the
1341280
-111-
extension reactions were nearly quantitative.
Heteroduplex DNA in each reaction mixture was
methylated by incubation with 80uM.
S-adenosylmethionine and 150 units dam methylase for 1
hour at 37°C. Methylation reactions were stopped by
heating at 68°C for 15 min.
One-half of each of the four methylated heteroduplex
reactions were transformed into 2.5 ml competent E.
coli JM101 (Messing, J. (1979) Recombinant DNA Tech.
Bull., 2, 43-48). The number of independent
transformants from each of the four transformations
ranged from 0.4-2.0 x 105. After growing out phage
pools, RF DNA from each of the four transformations
was isolated and purified by centrifugation through
CsCl density gradients. Approximately tug of RF DNA
from. each of the four pools was digested with EcoRI,
BamHI and AvaI. The 1.5 kb EcoRI--BamHI fragment
(i.e., AvaI resistant) was purified on low gel
temperature agarose and ligated into the 5.5 kb
EcoRI-BamHI vector fragment of pB0180. The total
number of independent transformants from each
a-thiodeoxynucleotide misincorporation plasmid library
ranged from 1.2-2.4 x 104. The pool of plasmids from
each of the four transformations was grown out in 200
ml LB media containing 12.5ug/ml cmp and plasmid DNA
was purified by centrifugation through CsCl density
gradients.
C. Expression and Screening
of Subtilisin Point Mutants
Plasmid DNA from each of the four misincorporation
pools was transformed (Anagnostopoulos, C., et al.
(1967), J. Bacteriol., 81, 741-746) into BG2036. For
each transformation, 5ug of DNA produced approximately
1 341 2p 0
-112-
2.5 x 105 independent BG2036 transformants, and liquid
culture aliquots from the four libraries were stored
in 10% glycerol at 70'C. Thawed aliquots of frozen
cultures were plated on LH/5~g/ml cmp,/1.6% skim milk
plates (Wells, J.A., et al. (1983) Nucleic Acids Res.,
7911-7925), and fresh colonies were arrayed onto
96-well microtiter plates containing 150 1 per well LB
media plus 12.5ug/ml cmp. After 1 h at room
temperature, a replica was stamped (using a matched 96
prong stamp) onto a 132 mm BA 85 nitrocellulose filter
(Schleicher and Scheull) which was layered on a 140 mm
diameter LB/cmp/skim milk plate. Cells were grown
about 16 h at 30°C until halos of proteolysis were
roughly 5-7 mm in diameter and filters were
transferred directly to a freshly prepared agar plate
at 37°C containing only 1.6% skim milk and 50 mM
sodium phosphate pH 11.5. Filters were incubated on
plates for 3-6 h at 37°C to produce halos of about 5
mm for wild-type subtilisin and were discarded. The
Plates were stained for 10 min at 24'C with Coomassie
blue solution (0.25% Coomassie blue (R-250) 25%
ethanol) and destained with 25% ethanol, 10% acetic
acid for 20 min. Zones of proteolysis appeared as
blue halos on a white background on the underside of
the plate and were compared to the original growth
plate that was similarly stained and destained as a
control. Clones were considered positive that
produced proportionately larger zones of proteolysis
on the high pH plates relative to the original growth
plate. Negative clones gave smaller halos under
alkaline conditions. Positive and negative clones
were restreaked to colony purify and screened again in
triplicate to confirm alkaline pH results.
1341280
-113-
D. Identification and Analysis
of Mutant Subtilisins
Plasmid DNA from 5 ml overnight cultures of more
alkaline active B.subtilis clones was prepared
according to Birnboim and Doly (Birnboim, H.C., et al.
(1979) Nucleic Acid Res. 7, 1513) except that
incubation with 2 mg/ml lysozyme proceeded for 5 min
at 37°C to ensure cell lysis and an additional
phenol/CHC13 extraction was employed to remove
contaminants. The 1.5 kb EcoRI-E3amHI fragment
containing the subtilisin gene was ligated into
M13mp11 and template DNA was prepared for DNA
sequencing (Messing, J., et al. (1982) Gene, 19
269-276). Three DNA sequencing primers ending at codon
26, +95, and +155 were synthesized to match the
subtilisin coding sequence. For preliminary sequence
identification a single track of DNA sequence,
corresponding to the dNTPaS misincorporation library
from which the mutant came, was app?lied over the
entire mature protein coding sequence (i.e., a single
dideoxyguanosine sequence track was applied to
identify a mutant from the dGTPas library). A
complete four track of DNA sequence was performed 200
by over the site of mutagenesis t.o confirm and
identify the mutant sequence (Sanger, F., et al.,
(1980) J. Mol. Biol., 143, 161-178). Confirmed
positive and negative bacilli clones were cultured in
LB media containing l2.Sug/mL cmp and purified from
culture supernatants as previously described (Estell,
D.A., et al. (I985) J. Biol. Chem., 260, 6518-6521).
Enzymes were greater than 98$ pure as analyzed by
SDS-polyacrylamide gel electrophoresis (Laemmli, U.K.
(1970), Nature, 227, 680-685), and protein
concentrations were calculated from the absorbance at
280 nm, E~8~$ - 1.17 (Maturbara, H., et. al. (1965), J.
-
Biol. Chem, 240, 1125-1130).
134120
-114-
Enzyme activity was measured 'with 200~g/mL
succinyl-L-AlaL-AlaL-ProL-Phep-nitroanilide (Sigma) in
O.1M Tris pH 8.6 or 0.1 M CAPS pH 10.8 at 25'C.
Specific activity (~ moles product/min-mg) was
calculated from the change in absorbance at 410 nm
from production of p-nitroaniline with time per mg of
enzyme (E410 = 8,480 M-lcm-l; Del Man, E.G., et al.
(1979), Anal. Biochem., 99, 316-320). Alkaline
autolytic stability studies were performed on purified
enzymes (200~g/mL) in 0.1 M potassium phosphate (pH
12.0) at 37'C. At various times aliquats were assayed
for residual enzyme activity (Wells, J.A., et al.
(1986) J. Biol. Chem., ~, 6564-6570)..
E. Results
1. Optimization and analysis
of mutagenesis frequency
A set of primer-template molecules that were randomly
3~-terminated over the subtilisin gene (Fig. 31) was
produced by variable extension from a fixed 5'-primer
(The primer mutated a unique AvaI site at codon 11 in
the subtilisin gene). This was achieved by stopping
polymerase reactions with EDTA after various times of
extension. The extent and distribution of duplex
formation over the 1 kb subtilisin gene fragment was
assessed by multiple restriction digestion (not
shown). For example, production of new HinfI
fragments identified when polymerase extension had
proceeded past I1e110, Leu233, and Asp259 in the
subtilisin gene.
Misincorporation of each dNTPas at randomly terminated
3' ends by AMV reverse transcriptase (Zakour, R.A., et
al. (1982), Nature, ~9 , 708-710; Zakour, R.A., et al.
(1984), Nucleic Acids Res., ~?, 6615-6628) used
134~,~8p
-115-
conditions previously described (Champoux, J.J.,
(1984), Genetics, ~, 454-464). The efficiency of each
misincorporation reaction was estimated to be greater
than 80% by the addition of each dNTPas to the AvaI
restriction primer, and analysis by polyacrylamide gel
electrophoresis. Misincorporations were sealed by
polymerization with all four dNTP's and closed
circular DNA was produced by reaction with DNA ligase.
Several manipulations were employed to maximize the
yield of the mutant sequences in the heteroduplex.
These included the use of a deoxyuri.dine containing
template (Kunkel, T.A. (1985), Proc. Natl. Acad. Sci.
USA, 82 488-492; Pukkila, P.J. et al. (1983),
Genetics, X04, 571-582), ~_n vi ro methylation of the
mutagenic strand (Kramer, W. et al. (1982) Nucleic
Acids Res., ~0 6475-6485), and the use of AvaI
restriction-selection against the wild-type template
strand which contained a unique AvaI site. The
separate contribution of each of these enrichment
procedures to the final mutagenesis frequency was not
determined, except that prior to vaI restriction-
selection roughly one-third of the segregated clones
in each of the four pools still retained a wild-type
AvaI site within the subtilisin gene. After AvaI
restriction-selection greater than 98% of the plasmids
lacked the wild-type AvaI site.
The 1.5 kb coRI-HamHI subtilisin gene fragment that
was resistant to vaI restriction digestion, from each
of the four CsCl purified M13 RF pools was isolated on
low melting agarose. The fragment was ligated Win, situ
from the agarose with a similarly cut ~. coli-H.
subtilis shuttle vector, p80180, and transformed
directly into ~ coli LE392. Such direct ligation and
transformation of DNA isolated from agarose avoided
1 34 ~ 2~ p
-116-
loses and allowed large numbers of recombinants to be
obtained (>100,000 per ug equivalent of input M13
pool) .
The frequency of mutagenesis for each of the four
dNTPas misincorporation reactions was estimated from
the frequency that unique restriction sites were
eliminated (Table XX). The unique restriction sites
chosen for this analysis, ClaI, PvuII, and K~nI, were
distributed over the subtilisin gene starting at
codons 35, 104, and 166, respectively. As a control,
the mutagenesis frequency was determined at the PstI
site located in the S lactamase gene which was outside
the window of mutagenesis. Because the absolute
mutagenesis frequency was close to the' percentage of
undigested plasmid DNA, two rounds of restriction-
selection were necessary to reduce the' background of
surviving uncut wild-type plasmid DNA below the mutant
plasmid (Table XX). The background of surviving
plasmid from wild-type DNA probably represents the sum
total of spontaneous mutations, uncut wild-type
plasmid, plus the efficiency with which linear DNA can
transform E. coli. Subtracting the frequency for
unmutagenized DNA (background) from the frequency for
mutant DNA, and normalizing for i:he window of
mutagenesis sampled by a given restriction analysis
(4-6 bp) provides an estimate of t:he mutagenesis
efficiency over the entire coding sequence (-1000 bp).
JO
13~~ 280
-117-
a-thiol
Restriction$ clonesc$ :resistant~
resistant
~
misincor- Site 1st 2nd clones overts
per
poratsd(b)Selection roundroundTotal Ba~kgroundd10.
OObpe
None PstI 0.32 0.7 0.002 0 -
G PstI 0.33 1.0 0.003 0.001 0.2
T PstI 0.32 <0.5 <0.002 0 0
C PstI 0.43 3.0 0.013 0.011 3
None ClaI 0.28 5 0.014 0 -
G ClaI 2.26 85 1.92 1.91 380
T ClaI 0.48 31 0.15 0.14 35
C ClaI 0.55 15 0.08 0.066 17
None PvuII 0.08 29 0.023 0 -
G PvuII 0.41 90 0.37 0.35 88
T PvuII 0.10 67 0.067 0.044 9
C PvuII 0.76 53 0.40 0.38 95
None K~nI 0.41 3 0.012 0 -
G K~~nI 0.98 35 0.34 0.33 83
T K~nI 0.36 15 0.054 0.042 8
C K~nI 1.47 26 0.38 0.37 93
(a) Mutagenesis frequency is estimated from the
frequency for obtaining mutations theft alter unique
restriction sites within the mutagenized subtilisin
gene (i.e., ClaI, PvuII, or KpnI) compared to mutation
frequencies of the Pstl site, that is outside the
window of n~utagenesis.
(b) Plasmid DNA was from wild-type (none) or
mutagenized by dNTPas misincorporation as described.
(c) Percentage of resistant clones was calculated
from the fraction of clones obtained after three fold
or greater over-digestion of the plasmid with the
indicated restriction enzyme compared to a
~ 341 28 0
-118-
non-digested control. Restriction-resistant plasmid
DNA from the first round was subjected to a second
round of restriction-selection. The total represents
the product of the fractions of resistant clones
obtained from both rounds of selection and gives
percentage off' restriction-site mutant clones in the
original starting pool. Frequencies were derived from
counting at least 20 colonies and usually greater than
100.
(d) Percent resistant clones was calculated by
subtracting the percentage of restriction-resistant
clones obtained for wild-type DNA (i,.e., none) from
that obtained for mutant DNA.
(e) This extrapolates from the frequency of mutation
over each restriction site to the entire subtilisin
gene (-1 kb). This has been normalized to the number
of possible bases (4-6 bp) within each restriction
site that can be mutagenized by a given
misincorporation event.
From this analysis, the average percentage of
subtilisin genes containing mutations that result from
dGTPas, dCTPas, or dTTPas misincorporation was
estimated to be 90, 70, and 20 percent, respectively.
These high mutagenesis frequencies were generally
quite variable depending upon the dNTPas and
misincorporation efficiencies at this site.
Misincorporation efficiency has been reported to be
both dependent on the kind of mismatch, and the
context of primer (Champoux, J.J., (1984); Skinner,
J.A., et al. (1986) Nucleic Acids Res., 14,
6945-6964). Biased misincorporation efficiency of
dGTPas and dCTPas over dTTPas has been previously
observed (Shortle, D., et al. (1985), Genetics, 110,
539-555). Unlike the dGTPas, dCTPas, and dTTPas
libraries the efficiency of mutagenesis for the dATPas
1341280
-119-
misincorporation library could not be accurately
assessed because 90$ of the restriction-resistant
plasmids analyzed simply lacked the aubtilisin gene
insert. This problem probably arose from
self-ligation of the vector when the dATPas
mutagenized subtilisin gene was subcloned from M13
into pB0180. Correcting for the vector background, we
estimate the mutagenesis frequency around 20 percent
in the dATPas misincorporation library. In a separate
experiment (not shown), the mutagenesis efficiencies
for dGTPas and dTTPas misincorporation were estimated
to be around 50 and 30 percent, respectively, based on
the frequency of reversion of an inactivating mutation
at codon 169.
The location and identity of each mutation was
determined by a single track of DNA sequencing
corresponding to the misincorporated athiodeoxy-
nucleotide over the entire gene followed by a complete
four track of DNA sequencing focused over the site of
mutation. Of 14 mutants identified, the distribution
was similar to that reported by Shortle and Lin (1985)
except we did not observe nucleotide insertion or
deletion mutations. The proportion of AG mutations
was highest in the G misincorporation library, and
some unexpected point mutations appeared in the dTTPas
and dCTPas libraries.
2. Screening and Identification of
Alkaline Stabilitv Mutants of Subtilisin
It is possible to screen colonies producing subtilisin
by halos of casein digestion (Wells, J.A. et al.
(1983) Nucleic Acids Res., 11, 7911-7925). However,
two problems were posed by screening colonies under
high alkaline conditions (>pH ll). First, B, subtilis
141280
-120-
will not grow at high pH, and we have been unable to
transform an alkylophilic strain of bacillus. This
problem was overcome by adopting a replica plating
strategy in which colonies were grown on filters at
neutral pH to produce subtilisin and filters
subsequently transferred to casein plates at pH 11.5
to assay subtilisin activity. However,, at pH 11.5 the
casein micelle no longer formed a turbid background
and thus prevented a clear observation of proteolysis
halos. The problem was overcome by briefly staining
the plate with Coomassie blue to amplify proteolysis
zones and acidifying the plates to develop casein
micell turbidity. By comparison of the halo size
produced on the reference growth plate (pH 7) to the
high pH plate (pH 11.5), it was possible to identify
mutant subtilisins that had increased (positives) or
decreased (negatives) stability under alkaline
conditions.
Roughly 1000 colonies were screened from each of the
four misincorporation libraries. The percentage of
colonies showing a differential loss of activity at pH
11.5 versus pH 7 represented 1.4, 1.8, 1.4, and 0.6%
of the total colonies screened from the thiol dGTPas,
dATPas, dTTPas, and dCTPas libraries, respectively.
Several of these negative clones were sequenced and
all were found to contain a single base change as
expected from the misincorporation library from which
they came. Negative mutants included A36, E170 and
V50. Two positive mutants were identified as V107 and
8213. The ratio of negatives to positives was roughly
50:1.
~~41280
-121-
3. Stability and Activity of
Subtilisin Mutants at Alkaline pH
Subtilisin mutants were purified and their autolytic
stabilities were measured by the time course of
inactivation at pH 12.0 (Figs. 32 and 33). Positive
mutants identified from the screen (i.e., V107 and
8213) were more resistant to alkaline induced
autolytic inactivation compared to wild-type; negative
mutants (i.e., E170 and V50) were less resistant. We
had advantageously produced another mutant at position
50 (F50) by site-directed mutagenesis. This mutant
was more stable than wild-type enzyme to alkaline
autolytic inactivation (Fig. 33) At the termination
of the autolysis study, SDS-PAGE analysis confirmed
that each subtilisin variant had autolyzed to an
extent consistent with the remaining enzyme activity.
The stabilizing effects of V107, 8213, and F50 are
cumulative. See Table XXI. The double mutant,
V107/R213 (made by subcloning the 920 by EcoRI-K~nI
fragment of pB0180V107 into the 6.6 kb EcoRI-K~.nI
fragment of pB0180R213), is more stable than either
single mutant. The triple mutant, F50/V107/R213 (made
by subcloning the 735 by coRI-PvuII fragment of pF50
(Example 2) into the 6.8 kb coRI-PvuII fragment of
pH0180/V107, is more stable than the double mutant
V107/R213 or F50. The inactivation curves show a
biphasic character that becomes more pronounced the
more stable the mutant analyzed. This may result from
some destablizing chemical modifications) (eg.,
deamidation) during the autolysis study and/or reduced
stabilization caused by complete digestion of larger
autolysis peptides. These alkaline autolysis studies
have been repeated on separately purified enzyme
batches with essentially the same results. Rates of
autolysis should depend both on the conformational
'134180
-122-
stability as well as the specific activity of the
subtilisin -variant (Wells, J.A., et al. (1986), J.
Biol. Chem., X61, 6564-6570). It was therefore
possible that the decreases in autolytic inactivation
rates may result from decreases in specific activity
of the more stable mutant under alkaline conditions.
In general the opposite appears to be the case. The
more stable mutants, if anything, have a relatively
higher specific activity than wild-type under alkaline
conditions and the less stable mutants have a
relatively lower specific activity. These subtle
effects on specific activity for V107/R213 and
F50/V107/R213 are cumulative at both pH 8.6 and 10.8.
The changes in specific activity may reflect slight
differences in substrate specificity, however, it is
noteworthy that only positions 170 and 107 are within
6A of a bound model substrate (Robertus, J.D., et al.
(1972), Biochemistry 1~, 2438-2449).
25
35
134'e80
-123-
TABLE XXI
Relationship between relative specific acitivity
at pH 8 6 or 10.8 and alkaline autolytic stabilitv
Alkaline
Relative ecific activitw autolysis
sp
half-time
En2~rme ~H 8 . 6 pH 10 . 8 _ (mint' b
Wild-type 1001 1003 86
Q170 461 282 13
V107 1263 995 102
8213 971 1021 115
V107/R213 1162 1063 130
V50 664 611 58
F50 12313 1577 131
F50/V107/
8213 1262 1523 168
~a~ Relative specific activity was t:he average from
triplicate activity determinations divided by the
wild-type value at the same pH. The .average specific
activity of wild-type enzyme at pH 8.6 and 10.8 was
70~moles/min-mg and 37~moles/min-mg, respectively.
~b~ Time to reach 50% activity was taken from
Figs. 32 and 33.
35
1~4~~80__
-124-
F. Random Cassette Mutagenesis
of Residues 197 throuclh 228
Plasmid pe222 (Wells, et al. (1985) en ~, 315-323)
was digested with ~stI and ~amHI and the 0.4 kb
PstI/BamHI fragment (fragment 1, see Fig. 34) purified
from a polyacrylamide gel by electroelution.
The 1.5 kb coRI/BamIiI fragment from pS4.5 was cloned
into M13mp9. Site directed mutagenesis was performed
to create the A197 mutant and simultaneously insert a
silent SstI site over codons 195-196. The mutant
EcoRI/BamHI fragment was cloned back into pBS42. The
pA197 plasmid was digested with $amFiI and Sstl and the
5.3 kb BamFiI/SstI fragment (fragment 2) was purified
from low melting agarose.
Complimentary oligonucleotides were synthesized to
span the region from SstI (codons 195-196) to PstI
(codons 228-230). These oligodeoxynucleotides were
designed to (1) restore codon 197 to the wild type,
(2) re-create a silent KpnI site present in po222 at
codons 219-220, (3) create a silent SmaI site over
codons 210-211, and (4) eliminate the ~stI site over
codons 228-230 (see Fig. 35). Oligodeoxynucleotides
were synthesized with 2% contaminating nucleotides at
each cycle of synthesis, e.g., dATP reagent was spiked
with 2% dCTP, 2% dGTP, and 2% dTTP. Far 97-mers, this
2% poisoning should give the following percentages of
non-mutant, single mutants and double or higher
mutants per strand with two or more misincorporations
per complimentary strand: 14% non-mutant, 28% single
mutant, and 57% with a2 mutations, according to the
general formula
n
f
n!
1341280
-125-
where ~ is the average number of mutations and n is a
number class of mutations and f is the fraction of the
total having that number of mutations., Complimentary
oligodeoxynucleotide pools were phosphorylated and
annealed (fragment 3) and then ligated at 2-fold molar
excess over fragments 1 and 2 in a three-way ligation.
coli I~i294 was transformed with the ligation
reaction, the transformation pool grown up over night
and the pooled plasmid DNA was isolated. This pool
represented 3.4 x 104 independent transformants. This
plasmid pool was digested with ~I and then used to
retransform ,~. co i. A second plasmid pool was
prepared and used to transform ~. subtilis (BG2036).
Approximately 40% of the BG2036 transformants actively
expressed subtilisin as judged by halo-clearing on
casein plates. Several of the non-expressing
transformants were sequenced and found to have
insertions or deletions in the synthetic cassettes.
Ey~pressing BG2036 mutants were arrayed in microtiter
dishes with 1501 of LB/12.5~g/mL chloramphenicol
(cmp) per well, incubated at 37'C for 3-4 hours and
then stamped in duplicate onto nitrocellulose filters
laid on LB 1.5% skim milk/5~g/mL cmp plates and
incubated overnight at 33'C (until halos were
approximately 4-8 mm in diameter). Filters were then
lifted to stacks of filter paper saturated with
1 x Tide commercial grade detergent, 50 mM Na2C03, pH
11.5 and incubated at 65'C for 90 min. Overnight
growth plates were Commassie stained and destained to
establish basal levels of expression. After this
treatment, filters were returned to pIi7/skim
milk/20~g/mL tetracycline plates and incubated at 37'C
for 4 hours to overnight.
1341280
-126-
Mutants identified by the high pH stability screen to
be more alkaline stable were purified and analyzed for
autolytic stability at high pH or high temperature.
The double mutant C204/R213 was more stable than wild
type at either high pH or high temperature (Table
XXII).
This mutant was dissected into single mutant parents
(C204 and 8213) by cutting at the unique SmaI
restriction site (Fig. 35) and either ligating wild
type sequence 3' to the m~I site to create the single
C204 mutant or ligating wild type sequence 5' to the
SmaI site to create the single 8213 mutant. Of the
two single parents, C204 was nearly as alkaline stable
as the parent double mutant (C04/R213) and slightly
more thenaally stable. See Table x:XII. The 8213
mutant was only slightly more stable than wild type
under both conditions (not shown).
Another mutant identified from the screen of the 197
to 228 random cassette mutagenesis was 8204. This
mutant was more stable than wild type at both high pH
and high temperature but less stable than C204.
'0
J
-127-
TABLE XXII
Stabili~ of subtilisin variants
Purified enzymes (200~g/mL) were incubated in O.1M
phosphate, pH 12 at 30'C for alkaline autolysis, or in
2mM CaCl2, 50mM MOPS, pH 7.0 at 62'C for thermal
autolysis. At various times samples were assayed for
residual enzyme activity. Inactivations were roughly
pseudo-first order, and t 1/2 gives the time it took
to reach 50% of the starting activity in two separate
experiments.
t 1/2 t 1/2
(alkaline (thermal
autolysis) autolysis)
Exp. Exp. Exp. Exp.
Subtilisin variant ~1 ~2 ~1 ~2
wild type 30 25 20 23
F50/V107/R213 49 41 18 23
8204 35 32 24 27
C204 43 46 38 40
C204/R213 50 52 32 36
L204/R213 32 30 20 21
G. Random Mutagenesis at Codon 204
Based on the above results, codon 204 was targeted for
random mutagenesis. Mutagenic DNA cassettes (for
codon at 204) all contained a fixed 8213 mutation
which was found to slightly augment the stability of
the C204 mutant.
1341280
-128-
Plasmid DNA encoding the subtilisin mutant C204/R213
was digested with ~stl and coRI and a 1.0 kb
EcoRI/SstI fragment was isolated by electro-elution
from polyacrylamide gel (fragment 1, see Fig. 35).
C204/R213 was also digested with ma7: and coRI and
the large 4.7 kb fragment, including vector sequences
and the 3' portion of coding region, was isolated from
low melting agarose (fragment 2, see Fig. 36).
Fragments 1 and 2 were combined in. four separate
three-way legations with heterophosphorylated
fragments 3 (see Figs. 36 and 37). This hetero-
phosphorylation of synthetic duplexes should
preferentially drive the phosphorylated strand into
the plasmid legation product. Four plasmid pools,
corresponding to the four legations, were restricted
with SmaI in order to linearize any single cut
C204/R213 present from fragment 2 isolation, thus
reducing the background of C204/R213. E_. coli was
then re-transformed with SmaI-restricted plasmid pools
to yield a second set of plasmid pools which are
essentially free of C204/R213 and any non-segregated
heterduplex material.
These second enriched plasmid pools were then used to
transfona ~. subtilis (BG2036) and the resulting four
mutant pools were screened for clones expressing
subtilisin resistant to high pFi/temperature
inactivation. Mutants found positive by such a screen
were further characterized and identified by
sequencing.
The mutant L204/R213 was found to be slightly more
stable than the wild type subtilisin. See Table XXII.
1341280
-129-
Having described the preferred embodiments of the
present invention, it will appear to those ordinarily
skilled in the art that various modifications may be
made to the disclosed embodiments, and that such
modifications are intended to be within the scope of
the present invention.
15
25
35
