Note: Descriptions are shown in the official language in which they were submitted.
3'~8
- 1-
SOMATOTROPIN ANALOGS
FIELD OF INVENTION
This invention relates to analogs of animal somatotropins or
growth hormones. More specifLcally, the invention relates to novel
bovine growth hormone analogs, particularly with changes in amino
acid residue 99.
BACKGROUND OF THE INVENTION
Bovine somatotropin (bSt) ls a growth hormone that has been well
studied (Paladini, A.C. et al., CRC Crit. ~ev. Biochem. 15:25-56
(1983)). Somatotropins were originally discovered in pituitary gland
extracts from various animals. In general, somatotropins are
conserved molecules and similarities in amino acid sequences and
structure are found between different species of animals.
Somatostatins, including bSt, are globular proteins comprising a
single chain of about 200 amlno acids with two intramolecular
disulfide bonds. Specifically, bSt has a single 190-191 amino acid
chain, a globular structure with two intramolecular disulfide bonds
and a molecular weight of about 22,000 daltons.
Natural bSt extracted from pituitary glands is heterogeneous.
At least six major forms of the protein have been described. The
longest form has 191 amino acid residues and an ala-phe amino
terminus. The second form has 190 amino acid residues and a phe
amino terminus. The third form has 187 amino acid residues and a met
amino terminus. The remaining three forms of bSt substitute valine
for leucine at position 127. In additlon to this heterogeneity,
undefined heterogeneity of bovine somatotropin has also been describ-
ed ~Hart, I.C. et al., Biochem. J. 218:573-581 (19843; Wallace,
M. and Dickson, H.B.F., Biochem. J. 100:593-600 (1965)).
Undefined electrophoretic heterogeneity i.s seen when the n~ltlve
extracts are fractionated by anlon oxeharlge chroma~ography. It has
been shown that the de~ined forms have diEeront relative potency in
bioassays. Also, it has been shown that other undefined species of
bSt when fractionated on ion exchange columns demonstrate varying
degrees of bioactivity in rat growth models (Hart, et al. and
Wallace and Dickson, supra).
It is not known whether undefined heterogeneity exhibiting
biological variation is due to genetic variability, to in vivo post-
translational modification, to differences in phosphorylation
3'~8
(Liberti, J.P. et al., Biocheln. and Biophys. Res. Comm, 128:713-720,
1985), or to artifacts of isolation.
Bovine somatotropin produced by recombinant microorganisms
(rbSt), or extracted from pituitary gland tissue, ls important
commercially. It increases lacta~ion in dairy cattle and increases
size and meat production in beef cattle. It is estimated that
upwards to 20 mg per animal per day will be needed to effect commer-
cially acceptable improvements in production. Such a dosage will
require efficient methods of administration. Improvements in the
potency and stability of bSt such as described in this invention will
be of benefit because of resulting reductions in the amount of drug
administered to each animal per day.
Furthermore, one of the problems in preparing recombinantly-
produced bSt is that liquid processing and storage of rbSt at ac.id or
alkaline pH results in the conversion of the asparagi.ne residue at
position 99 to isoaspartic acid. The resulting rbSt is referred to
as "early eluting rbSt" because it elutes earlier than native rbSt on
reversed phase HPLC. Isoaspartate is formed when the asparagine side
chain condenses with the peptide backbone resulting in the elimina-
tion of ammonia. Chain cleavage also occurs by a condensationreaction between the peptide backbone and the asparagine residue at
position 99 of the rbSt molecule upon storage. The chain-cleaved
product is covalently held together by the disulfide bond between
cysteine residues 53 and 164 and has been called "early-early eluting
rbSt" because of its eluting position relative to native and early
eluting rbSt.
Because the instability that occurs due to the modification of
asparagine 99 leads to a loss of native rbSt during its isolation,
formulation and storage as reconstituted product, :Lt would be
advantageous to make an amino lcid substltutlon at: posl.tion 99 to
produce an rbSt nnl10g that is more stable while retaining or
enhancing i.ts biological activity.
INFORMATION DISCLOSURE
Analogs of bSt are known (see, for exa~ple, Europem patent
applications 75,444 and 103,395 and Nucleic Aci.d Res. 10(20):6487
(1982)).
G. Winter and A.R. Fersht, TIBS, 2, p. 115 (1984) review the
alteration of enzyme activity by changing amino acid composition at
;~ ~3 ~
-3-
key sequence locations.
P.Y. Chou and G.D. Fasman, Ann. ~cev. Biochem., 47, pp. 251-76
(1978~ refer to the use of amino acid sequences to predict the
secondary and tertiary structure of proteins. P.Y. Chou and G.D.
Fasman, J. Mol. Biol., 115, pp. 135-75 (1977) refer to ~-turns in
proteins. From analysis of 459 ~-turn regions in 29 proteins of
known sequence and X-ray structure, they found that the most
frequently occurring amino acids in the third position of a ~-turn
are asparagine, aspartic acid, and glycine. The residues with the
highest ~-turn potential in all positions within the turn are
proline, glycine, asparagine, aspartic acid, and serine.
SUMMARY OF THE INVENTION
This invention relates to the enhancement of bioactivity or
stability in liquid storage, or both, of bSt and analogs thereof, by
substituting different amino acids for the asparagine corresponding
to the residue at position 99 of native bSt. Similar changes can be
made in somatotropins from other animals, particularly mammals,
including porcine, fish, ovine, horse, rat, monkey, and human.
More specifically, and preferred, are those species of bSt-like
compounds wherein the asparagine located at amino acid residue 99 is
replaced with a different amino acid residue including specifically
glycine, serine, proline, aspartic acid, glutamic acid, serine-
serine or serine-aspartic acid.
More specifically, the animal somatotropin is selected from the
group consisting of bovine, porcine, fish, ovine, horse, rat, monkey,
and human somatotroplns.
Even more specifically, the animal somatotropin is bovine
somatotropin.
Also provided is a method for enhancing the growtll of an animal,
particularly a mnmmal, Ancl more pMrtl.cularly a bov;Lne, which com-
prises administering to the anLIlla:L an eectiv~ amount of n somato-
tropin of the instant invention, and, in particular, where the animal
is a bovine and the somatotropin is bSt.
Also provided is a method for increasing milk production in a
fema].e ruminant comprising administering to the female ruminant an
effective amount of an animal somatotropin of the instant invention,
and, in particular, where the animal is a bovine and the somatotropin
is bSt.
-4-
DETAILE~ DESC~IPTION
Due to the molecular heterogeneity of somatotropins, the
position numbers of amino acid residues of the various somatotropins
may differ. The term "native mammalian somatotropin" includes these
naturally occurring species. Chart 1 illustrates the specific region
of one species of bSt that corresponds to the position 99 residue
modified by this invention. The numbering for other somatotropins
may differ where other species or analogs are involved. Using the
asparagine 99 of the bSt set forth in Chart 1, those of ordinary
skill in the art can readily locate corresponding amino acids in
alternative animal somatotropins, for example, mam~alian somatotro-
pins, for e~ample, asparagine 99 of mammalian somatotropin, or their
analogs, to achieve the desired liquid storage stability, enhanced
bioactivity and uniform potency of the instant invention.
Both chemical and genetic modifications of this region are
embraced by this invention.
The preferred genetic modifications rely upon single site
specific mutation methods for insertion of various amino acid
residues in replacement of the naturally occurring asparagine.
The phrase "animal somatotropin" refers to somatotropins
originating from animals, e.g., mammals, and includes somatotropins
derived from either natural sources, e.g., pituitary gland tissue or
from microorganisms transformed by recombinant genetics to produce a
naturally-occurring form of somatotropin. When a specific mammalian
source is named such as a bovine somatotropin or a somatotropin of
bovine origin, the somatotropin includes those derived from either
natural sources or from transformed microorganisms.
The term "microorganism" is used herein to include both single
cellular prokaryotic and euknryotic organisms such ag b~ct0rin,
yeast, actinomycetes and singl0 c~ rom higher plants nnd animals
grown in cell culture.
The term "native" refers to naturally-occurring forms of
somatotropins which may have been derived from eLther natural
sources, e.g., pitultary gland tissue or from mlcroorganisms trans-
formed by recombinant genetics to produce a somatotropin having thesame amino acid sequence as the naturally-occurring form of somato-
tropin.
The mammalian somatotropins are very similar in amino acid
~0'i3'~8
-s-
sequence and physical structure. Although the processes described in
the Examples are directed toward bSt, the processes are sgually
applicable to any animal, e.g., mammalian somatotropin having the
requisite asparagine residue available for replacement particularly
wherein similar liquid processing and storage problems are en-
countered.
The high relative potency of the bSt analogs of the present
invention is readily determlned using hypophysectomized rats. Evans,
H.M. and Long J.A., Anat. Rec. 21:61, 1921. Relative increases in
1.0 total body weight are recorded using pituitary bSt, recombinant bSt
(rbSt) and various bSt analogs of the invention.
Site-Directed Mutagenesis: Several techniques for site-directed
mutagenesis have been developed for introducing specific changes in a
DNA sequence and may be used to produce the compounds of the instant
invention (Kramer, W., et al, Nucl. Acids Res., 12, pp. 9441-56
(1984); Mandecki, W., Proc. Natl. Acad. Sci. USA, 83, pp. 7177-81
(1986); Zoller, M.J. and Smith, M., Nucl. Acids Res., 10, pp. 6487-
6500 (1982); Norrander, J., et. al., Gene, 26, pp. 101-106 (1983);
Kunkel, T.A., Proc. Natl. Acad. Sci. ~SA, 82, pp. 488-92 (1985);
Schold, A., et. al., DNA, 3, pp. 469-77 (1984)). We employed the
primer directed mutagenesis technique of Schold et al for five of the
seven analogs produced, except that only one primer is used for the
initial hybridi.zation reaction and 18 ~1 of T4 gene 32 protein is
added to the extension reaction.
Colony Filter Hybridization: The screening technique of filter
hybridization is based upon the ability of a single-stranded segment
of DNA to locate its complementary sequence and hybrldize to form a
double-stranded segment, Hanahan, D. and Meselson, M., Meth. En-
zymol., 100, pp. 333-42 (1983). The therlllnl stnbility oE this
binding is dependent upon the nulllber oE mntches ~nd mismatches
contained within the double stranded region. The more mismatches it
contains, the weaker the base-pair bi.nding and the lower the tempera-
ture necessary to disrupt the DNA binding. This temperature dif-
ferential is exploited during colony fi.lter hybridizati.on, Bryan, R.,
et. al., Microbiology (1986). By constructing a mutant oligomer
which maximizes the temperature differential between the native and
mutant sequence, it is possible to hybridize at a lower temperature
allowing binding of the probe to matched and nearly matched sequen-
0 13 ~ ~ 8
-6-
ces. Upon w~shing at elevated t~mperatures, the mismatched probe-DNA
duplex beco~es unstable and disassociates while the perfectly matched
duplex remains bound. The matched duplex will then produce the
darkest signaL on an autoradiogram thus forming a detection method
for a colony containing the desired sequence. DNA from this colony
can then be isolated and sequenced.
For filter preparation, nitrocellulose filters are overlayed
onto plates and wetted. The filters and plateq are ~arked for
orientation and the filters are then carefully lifted off the plates.
The master filter plates are incubated overnight at room temperature
to allow re-growth of the colonies. The filters are denatured by
laying them one by one onto Whatman paper soaked in 0.5 M NaOH, 1.5 M
NaCl for 10 minutes and neutralized in two successive changes of
Whatman paper soaked in 1 M Tris, pH 7.4, 1.5 M NaCl, for 10 minutes
each and air dried on fresh Whatman paper for 30 minutes. They are
then baked for 2 hours at 80C in vacuum.
The kinase reaction to radiolabel the mutant oligonucleotide for
use as a probe is as follows: 2 ~g of oligo, 2 ~1 of lOX kinase
buffer, 100 ~Cl ~32-P ATP, 2 ~1 T4 kinase and 4 ~1 water are mixed
and incubated for 1 hour at 37C. A 1 ml column is packed with DEAE-
Sephacel in a 10 ml disposable column and equilibrated with 2-3 ml of
high salt buffer (1.5M NaCl in TE) and then 2-3 ml of low salt buffer
(0.2M NaCl in TE). The kinase reaction is diluted with 200 ~1 of low
salt buffer and loaded directly into the column. The column is
washed with 10 ml of low salt buffer until no further counts elute
from the column. The probe is eluted in 4 ml of high salt buffer.
To hybridize, the filters are placed in a crystallization dish
and batch pre-hybridized in 5X Denhardts (1% BSA, 1% Ficoll and 1%
PVP), 5X SSC (0.75 M NAC1, 0.075 M sodiwn cltrate) and 0,1~ SDS for 1
hour at 40C. The hybridiz~tlon solution is ch~lnged ~nd the probo is
added. The dish is covered and the hybridizstion done overnight with
gentle agitation. The filters are then rinsed wlth several changes
of 5X SSC, 0.1% SDS. The filters sit in this solution while the
water bath and wash solution (5X SSC, 0.1% SDS) is heated up to
washlng temperature (46C). The filters are transferred one by one
to a fresh crystallization dish and washed 3 x 20 minutes, changing
dishes after each wash. They are then air dried on Whatman paper,
wrapped in Saran wrap and exposed as necessary.
;~Q~rJ~t38
-7-
Vector DNA Preparatlon: GNA for sequencin~ is obtained accord-
ing to the method of L. Agellon and T. Chen, Gene Anal. Techn., 3,
pp. 86-89 (1985) except that only one combined phenol/chloroform
extraction ls performed and the DNA is not spin-dialy~ed through a
Sephadex G-50 column.
Sequencing: Double-stranded sequencing is performed accordln~
to the following protocol: 3 ~1 2N NaOH, 2 mM EDTA is added to 12 ~1
of DNA (2 ~g) and incubated for 15 minutes. 6 ~1 3 M NaOAc, 1 ~1
primer and 100 ~1 95~ ethanol are added and the DNA precipitated on
dry ice for 20-30 minuees~ The pellet is collected, washed and
vacuum dried. It Ls dissolved in 13 ~1 water and 4 ~1 RT buffer (0.3
M Tris-HCl, pH 8.3, 0.375 M NaCl, 37.5 mM MgC12, 2.5 mM DTT), 2 ~1
~32P dCTP and 1 ~1 reverse transcriptase are added. 4 ~1 of this mi~
is pipetted into 4 eppendorf tubes, each contalning 1 ~1 of G mix, A
mix, T mix or C mix. The tubes are incubated for 10 minutes at 42~C.
1 ~1 of chase mix (0.25 mM dNTPs) is added and they are incubated for
an additlonal 5 minutes. 10 ~1 stop solution (80~ formamide, 10 mM
NaOH, 1 mM EDTA, 0.1% xylene cyanol and 0.1~ bromphenol blue~ is
added, the reactions are boiled 3 minutes and 3 ~1 of each is loaded
onto a sequencing gel.
Induction Protocol and SDS-PAGE Analysis: See PCT/VS 88/00328.
Example 1
A site-directed mutagenic technique for double-stranded primer
extension is u.sed to introduce altered codons for serine and proline
at amino acid position 99 in the rbSt cDNA m4 gene (PCT patent
application PCT/US 88/00328, filed 27 January 1988 and incorporated
herein by reference). In this method, the target sequence is cloned
into a suitable plasmid and plasmid DNA is prepared. The plaslnid DNA
is denatured by treatment with NaOH whi~h causes "nicks" in the DNA
molecule deoxyribose-phosph~lte baGkbon~. 'rhis relax~s the DNA and
permits an oli~omer containing tho deslred sequence chan~es to
hybridize to the plasmld sequence containing the position 99 residue
of bSt. The 3' end of the oligomer generates a prime.r Eor the DNA
polymerase activity of the reverse transcriptase which extends the
primer, synthesizes a new DNA strand containing the mutagenic
oli~omer and displaces the normal complementary strand. The exten-
sion reaction increases the probability of the incorporation of the
oligomer-directed change. The DNA is transformed into competent
;~o~
-8-
cells and the resultant colonies are screened by colony filter
hybridization. Plasmid DNA ls isolsted and sequenced from positive
candidates.
The oligomers used to construct the position 99 serine and
proline changes in the rbSt m4 gene are produced by techniques
previously described (PCT/US 88/00328), An oligonucleotide so
produced and designated GST-88 (Chart 3) contains the change on the
DNA sequence asparagine AAC to serine TCT and another designated CST-
89 (Chart 3) contains the asparagine AAC to proline CCG change. They
are both designed with a Tm of 53C thus allowing for hybridization
at 40C and stringent washing at 46C as set forth above.
In parallel experiments the serine and proline oligomers are
hybridized to the pBR322 derived vector pTrp-BStm4, This vector
contains the trp promoter and the m4 cDNA for rbSt (PCT/US 88/00328),
After primer extension, the DNA is used to transform competent cells
of MC1000 (available in the Experiments with Gene Fusion Strain Kit,
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The
transformed cells are plated to give 100-200 colonies on ten plates.
The colonies are then transferred onto nitrocellulose, The cells are
lysed and their DNA affixed to the filter, Radiolabeled oligomer
probes are prepared from CST-88 and CST-89 by the oligomers with
kinase and 32P-ATP. Details of the colony filter hybridization
probing are set forth above,
Six candidates gave a very strong positive signal on the
autoradiogram for the serine mutagenesis, Plasmid DNA was isolated
for each candiclate and sequenced, One of the candidates was found to
contain the serine change, The mutated gene contained therein is
designated m4-99ser. For the proline mutagenesis, six positive
candidates were analyz,ed by DNA sequencing and two were found to
contain the desired change. These mutated genes ~ro clcsignflted m4-
99pro.
The m4~99ser and m4-99pro genes are excised from the parental
vector as an EcoRI-HindIII fragment and cloned into the EcoRI-HindIII
restriction sites of the pURA-m4 vector (PCT/US 88/00328). Chart 2
shows the cloning of the m4-99ser gene into the pURA-m4 vector, The
identiccal construction is carried Otlt for the m4-99pro gene. Upon
sequence confirmation of the clonings, the vectors are designated
pURA-99Ser and pURA-99Pro. These vectors are transformed into
3'i8
fermentation expression strain BST-lC (P~T/~S 88/00328).
Transformed cells from each of the clonings are induced and
samples analyzed by SDS-PAGE to assess the ability of the cells to
express the modified rbSt genes under non-optimized conditions
Results of SDS-PAGE analy~is showed that pURA-99Ser produced rbSt in
three indlvidual inductions at 13.8%, 14.6~ and 26.4% of total
cellular protein. Results of SDS-PAGE analysis showed pURA-99Pro in
four separate inductions expressed rbSt at 28.2%, 29.6~, 34.0~ and
41.9% of total cellular protein.
Because of poor mutagenic efficiency, the mutant oligomer must
be constructed so that there is at least a 5~C temperature difference
between its Tm and that o~ the native sequence. Witho~lt this
difference, effective screening of the candidates cannot be ac-
complished.
Example 2
Following the techniques of Example 1, but substituting the
appropriate oligomers encoding the desired amino acids (C-ST 90 and
C-ST 91, Chart 3), bSt analogs having aspartic acid and glutamic acid
at position 99 were also constructed.
Example 3
Analogs having two amino acids substituted in place of the
position 99 asparagine (Ser-Ser and Ser-Asp) were constructed by fol-
lowing the site~ directed protocol of Kramer et al, Nucl. Acids Res.,
12, p. 9441-56 (1984) as described in the "Site Directed Mutagenesis
Kit", commercially available from Boehringer Mannheim Biochemicals,
P0 Box 50816, Indianapolis, IN 46250 (see also, Kramer, W. and H-J
Fritz, Meth. Enz., 154, pp. 350-67 (1987)). The procedure requires
cloning the DNA sequence which is to be modified into the M13mp9
vector. This is done by digesti.ng vector pURA-m4 (PCT/US 88/00328)
with the restriction enzymes EcoRI arld BamtlI and Lsol1~1n~ 1 DNA
fragment approximately 870 bp ln .s i.z~ . 'I'his Eragment con~ains tlle E .
coli tryptophan (trp) promoter, ttle trpL rlbosome blnding site an~
the entire bSt gene sequence. This fragment is cloned into the EcoRI
and BamHI restriction sites of the M13mp9 vector using known techni-
ques (Maniatis et al, Molecular Cloning: A Laboratory Manu~l, ColdSpring Harbor Publication, Cold Spring Harbor, New York; J. Messing,
Meth. En~ym., 101, pp. 20-98 (1983)). Single stranded DNA is
isolated using the derived vector M13mp9-m4 (Messing, supra) and used
3 rj 8
-10-
in the mutagenesis procedure as previously descrlbed. Cloning of
these analogs into the pURA expression vector was done as described
in Exa~.ple 1, in which ~he double-stranded DNA of the M13 vector,
supra, is substituted for the pBR322 vector
Example 4
A position 99 analog having glycine substituted for asparagine
was also constructed using the techniques described in Example 1.
The mutagenesis oligonucleotide used is designated C-ST84 (Chart 3).
It encodes the change to glycine.
Example 5
Activity of various position 99 analogs was demonstrated. The
parameter measured was to estimate differences in 3.5~ fat corrected
milk yield (FCM) of lactating dairy cows in~ected intramuscularly
with native rbSt, the glycine-99 (Gly-99) rbSt of Example 4, the
serine-99 (Ser-99) rbSt of Example 1 and the aspartic acid-99 (Asp-
99) rbSt of Example 2. Holstein cows (45) were ranked from high to
low milk yield based on milk yield on days 3 and 2 prior to initia-
tion of rbSt injections. The cows were assigned randomly in repli-
cates, based upon milk yield, to 9 experimental groups: no injection
(Control), 5 mg and 20 mg Gly-99 rbSt daily, 5 mg and 20 mg Ser-99
rbSt daily, 5 mg and 20 mg Asp-99 rbSt daily, and 5 mg and 20 mg
native rbSt daily. Cows were in;ected imtramuscularly in the
semitendinosus muscle once daily for 21 days. Twice daily milk
weights were recorded for three days prior to initiation of injec-
tion, during the 21 days of injections, and for fi.ve days after the
last in~ection. Concentration of rbSt was expected to be 10 mg/ml.
The concentration of residual post-injection rbSt solutions,
measured by HPLC, averaged 11.5 for native rbSt, 12.1 for Asp-99
rbSt, 11.6 for Gly-99 rbSt, and 11.6 for Ser-99 rbSt. The area
percent was greater than 99~ normal rbSt for Gly-99 rbSt (by "norm~l
rbSt" is meant the amino Mcid s~cluenco Qncoded by ~ particular gene,
i.e., no degrad~tion products, otc.), for Ser-99 rbSt, and for Asp-99
rbSt, but averaged 90.5 normal rbSt for native rbSt. Native rbSt
averaged 2~ early-early eluting rbSt and 7.6~ early eluting rbSt.
Statistical analyses of the FCM among experimental groups were
based on average FCM for days 1 to 21 of in~ections using the three
days prior to initiation of injections as the covariate. Average
daily FCM (kg/day) was not statistically significantly different for
either form of rbSt (Y<.12) or dose X form o~ rbSt interaction
(P<.90). However, since the statistical signlficance was P<.12 for
form of rbSt, an attempt was made to gain additional information on
the relative potency among the forms of rbSt. Based on comparisons
among the four forms of rbSt, there was a suggestion (P<.05) that FCM
of cows injected with Ser-99 rbSt was grea~er than FCM for cows
injected with eLther Gly-99 rbSt or native rbst. There was no
suggestion of a difference in FCM of cows injected with Ser-99 rbSt
compared to cows injected with Asp-99 rbSt or among cows injected
with Gly-99 rbSt, Asp-99 rbSt, and native rbSt. FCM of cows adminis-
tered 20 mg rbSt was statist;cally significantly greater than cows
administered 5 mg.
Experimental Mean FCM Relative to Changea Percentage
15 GroupDays of Injection(kg/day) Change for Days
1-3 1 21 1-5 1-21 1-5
pre durlng post duringa postb
Control 27.6 26.1 26.1 -1.5 -5.4 0
Native 5 mg 28.2 28.0 26.8 -0.2 -0.7 -4.3
Native 20 mg 26.6 30.2 26.0 3.6 13.5 -13.5
Asp-99 5 mg 28.1 29.2 29.2 1.1 3.9 0
Asp-99 20 mg 24.5 29.0 27.0 4.5 18.4 -6.9
Gly-99 5 mg 29.3 29.4 17.2 0.1 0.3 -7.5
Gly-99 20 mg 26.4 29.8 28.6 3.4 12.9 -4.2
Ser-99 5 mg 28.8 31.0 30.4 2.2 7.6 -1.9
Ser-99 20 mg 28.9 33.5 31.6 4.6 15.9 -5.7
aDays 1 to 21 o injectlon relatlve to days 1 to 3 pre-in~oction.
bDays 1 to 5 post-ln~ectl.oll r~lntlvo to dsys 1 to 21 of lnJection.
F.x~mple 6
Activity oE other position 99 analogs was demonstrated in a
separate study from that reported in Example 5. Again, the param~ter
measured was to estimate differences in 3.5% fat corrected milk yield
(FCM) of lactatlng dairy cows injected intramuscularly with native
rbSt (clinical rbSt) that has asparagine at position 99, rbSt with
proline substituted for asparaglne at posltion 99 (Pro-99 rbSt), and
~r~r~
-12-
rbSt with glutamic acid substituted for asparagine at position 99
(Glu-99 rbSt). Holstein cows ~35) were ranked from high to low milk
yield based on milk yield on days 3 and 2 prior to initlation of rbSt
injections. The cows were assigned randomly in replicates, based
upon mllk yield, to 7 experimental groups: no injection (Control), 5
mg and 15 mg Pro-99 rbSt daily, 5 mg and 15 mg Glu-99 rbSt daily, and
5 mg and 15 mg native rbSt daily. Cows were injected imtramuscularly
in the semitendinosus muscle once daily for 7 days. Twice daily m~lk
weights were recorded for three days prior to initiation of injec-
tion, during the 7 days of injections, and for five days after thelast injection.
The dose averaged 5.04 mg, 4.88 mg, and 5.03 mg for cows
assigned to receive the 5 mg dose of Pro-99, Glu-99, and native rbSt
respectively. Cows assigned to receive 15 mg rbSt received 15.12 mg,
14.64 mg, and 15.10 mg rbSt for cows of the Pro-99, Glu-99, and
native rbSt respectively. The percentage of early-early eluting
rbSt, early eluting rbSt, oxidized rbSt, and post-oxidized rbSt
appeared to be similar for native rbSt, Glu-99 rbSt, and Pro-99 rbSt.
Statistical ana].yses of the FCM among Experimental Groups were based
upon average FCM for days 1 to 7 of injections using the three days
prior to initiation of injections as the covariate. The FCM for cows
of the native rbSt, Pro-99 rbSt, and Glu-99 rbSt groups was 28.7,
28.8, and 28.8 (P .95). Therefore there was no suggestion of a
difference of FCM for cows receiving nati~e rbSt, cows receiving rbSt
with glutamic acid substituted for asparagine at position 99, and
cows receiving rbSt with proline substituted for asparagine at
position 99. FCM was significantly greater for cows of the 15 mg
rbSt group than for cows of the 5 mg rbSt group. Upon cessation of
rbSt in~ections, FCM of rbSt previously inJocted cows d~creased at
similar rates during the 5 days after cessAtion of rbSt in~ections.
Rxample 7
Samples of rbSt and rbSt position 99 analogs were examined for
relative potency using the hypophysectomized rat growth bioassay.
Two hundred hypophysectomized fema].e Sprague Dawley rats weighing
between 75 and 150 grams were used in each experiment. They were fed
pelleted Purina Rat Chow ad libitum and watered with deionized and
rechlorinated water. Room conditions were set at a temperature of
80 F and relative humidity of 50%. Air exchange was approximately
;~0~;3'~
-13-
20 exchanges per hour and the photoperiod was 12 hours light nnd 12
hours dark, with the light cycle commencing about 6:00 a.m.
The rats were monitored for a 12-day prelimlnary period to allow
for adaptation to environmental and feeding conditions. Body weights
were obtained on four occasions between days one and twelve. Rats
that showed weight losses of one gram per day or less or weight gains
of 2 grams per day or less during the preliminary period were
selected for inJeCtion with rbSt. The rats were ranked according to
ascending magnitude of average daily galn (ADG), and seven blocks of
25 rats were created. Treatments within each block were randomly
assigned.
rbSe treatments lasted 10 days. During this time, test co~-
pounds were injected twice daily for nine days, and body weights were
monitored using a Mettler Model 3600 top loading balance equipped
with lab-Pac programming which determines the weight of the animals
while taking into account their movements.
Stock solutions of rbSt at 2 mg/ml were prepared in a buffer of
0.03 M sodium bicarbonate and 0.15 M NaCl at pH g.5. To facilitate
suspension of rbSt, the ].yophilized preparations were first dissolved
20 in this buffer at pH 10.8, then the pH was adjusted to 9.5 using 2 N
HCl and brought to final volume using the stock buffer at pH 9.5 and
filtered if necessary.
The stock solutions were diluted using stock bufEer (pH 9.5) to
solutions of 37.5, 75, 150, and 300 mg of protein/ml. The rats were
injected subcutaneously twice daily with 100 ~1 of the respective
solutions, and controls received 100 ~1 of buffer. The experiment
lasted 10 days with average daily weight gain monitored.
A statistical analysis of the relative potency for the various
test samples of rbSt was as follows: native rbSt with asparagine at
position 99 served as an analytical st~ndard and wns nssigned
relative potency vAlue o~ 1.00. 'I'hi.s sampl.c had a potency of 1.15
relative to A snmple of pltuitnry-tlerlved bovinc somatotropin. The
rbSt analogs in which aspartlc ncid, glutamic acid, glycine, proline,
serine, and serine-serine were substituted for the asparagine at
35 position 99, had relative potencies (respecti.vely) of 2.30, 3.00,
2.96, 2.50, 3.06, and 3.03 relative to rbSt control. These values are
significant at the 95~ confldence level.
;~C~ ~3'~
-14-
Example 8
The aqueous stabilities of three of the rbSt position 99
analogs, having glycine, serine, and aspartic acid substituted for
asparagine, were compared wlth that of native (asparagine at 99) rbSt
under two sets of incubation conditions. The first set of incuba-
tions was carried out in 50 mM sodium carbonate, pH 10.0 at ambient
temperature (protein concentration 20 mg/ml) to simulate conditions
similar to those encountered during the isolation and formulation of
rbSt. The second set of incubations was carried out in a pH 7.4
Ringer's solution at 37C (protein concentration 5 mg/ml) to simulate
exposure to physiological conditions. All incubation samples were
prepared aseptically. Samples were removed from the incubations over
a three week period and stored at -20C prior to analysis by iso-
electric focusing, SDS-PAGE, and reversed phase HPLC.
The glycine 99 and serine 99 rbSt analogs had IEF patterns that
were virtually indistinguishable from native rbSt prior to incubation
while the IEF pattern of native asparagine 99 rbSt was shifted
approximately 1.2 pH units lower due to the introduction of the
negative charge at position 99. The major difference noted between
the IEF patterns of incubated samples of native rbSt and the position
99 analogs was the rate at which more acidic rbSt species were
formed. The IEF pattern of native rbSt degraded into more acidic
rbSt spe~ies at a faster rate under both sets of incubation condi-
tions than did the IEF patterns of the position 99 analogs. One
additional difference between the IEF patterns of native rbSt and the
analogs was the presence in incubated native rbSt samples of IEF
bands that have been associated with a chain cleavage between
residues 99 and 100 of the rbSt molecule. These bands were not
observed in the IEF patterns of the position 99 analog~.
~en analyzed under non-reducln~ conditlons, the SDS PACE
behavior of incubat~d samples of the posLtion 99 analog~ was identi-
cal to that of native rbSt. When examined under reducing conditions,
however, the major rbSt fragment formed during the incubation of
native rbSt was found to be absent in the position 99 analogs.
Replacement of the asparagine residue at position 99 with either
glycine, serine, or aspartic acid therefore eliminated the peptide
bond cleavage between residues 99 and 100. The two peptides formed
as a result of this cleavage in native rbSt are normally held
- 1 s -
covalently intact by the disulfide bond between cysteine residues 53
and 164, thus the difference between the reduced and non-reduced
s~mples.
Reversed phase HPLC was used to measure the amount of isoaspar-
tate formation and chain cleavage which occurred at position 99 of
the rbSt molecule since these species elute earlier upon reversed
phase ~IPLC than native rbSt. rbSt which contained a chain cleavage
between positions 99 and 100 of the rbSt molecule accounted for 8.5
area percent of native rbSt at the conelusion of the pH 10.0 incuba-
tion, and for 11.1 area pereent of native rbSt at the conelusion ofthe pH 7.4 incubation. By comparison, the amount of the rbSt analogs
which eluted in this position was less than 0.5 area percent. rbSt
which eluted in the position of isoaspartic acid 99 rbSt accounted
for 35.8 area percent of native rbSt at the conclusion of the pH 10.0
incubation, and for 49.9 area percent of native rbSt at the con-
clusion of the pH 7.4 incubation. Of the position 99 rbSt analogs,
aspartic acid 99 rbSt showed the greatest formation of rbSt which
eluted in this position: 3.8 area percent at the conclusion of the
p~I 10.0 incubation and 13.9 area percent at the conclusion of the pH
7.4 incubation.
Therefore, the position 99 analogs of the instant invention show
superior aqueous stability relative to native asparagine 99 rbSt.
Example 9
Following the teachings of the preceding examples with ap-
propriate modifications, similar analogs to porcine, human, ovine,horse, rat, monkey and avian somatotropins may also be produced by
replacing the asparagine residues at position 99 (S.S. Abdel-Meguid,
et al, Proc. Natl. Aead. Sci.. USA, 84, pp. 6434-37 (1987). Because
of the close sequence homology botween mclmmall~ oln~Itotropins in
this region of the molec-I].e, tIle a~IpclrclgLlle residue corre.sponding to
bSt asparagine 99 is likely tho third residue in a ~-turn in eaeh of
these other somatotropins thus leading to isoaspartic acid formakion
and chain cleavage as with bSt. If this is Eound to be the case for
other somatotropins by analysis of the products as set forth above,
substituting an appropriate amino aeid for the asparagine 99 would
obviate the isoaspartate formation and chain cleavage.
Administration of the bSt analogs into dairy cattle is according
to known methods using any route effective to deliver the required
2Q~ 3 ~
-16-
dosage to the animal's circulatory system. Modes of administration
include oral, intramuscular in~ections, subcutaneous in3ectlons and
the use of timed-release implants. The preferred mode of administra-
tion is by subcutaneous in~ection using a timed-release implant.
Appropriate vehicles for injections include physiologically com-
patible buffers such as sodium bicarbonate, sodi~m phosphate, or
ammonium phosphate solutions. Timed-release implants are known in
the art, e.g., U.S. patent 4,333,919.
The effective dosage range is from 1.0 to 200 milligrams per
animal per day. The greater the amount of bSt given, the greater the
resulting increase in growth, lactation or numbers of mammary
parenchymal cells. Most preferably, the dosage range is from 5 to 50
milligrams per day.
Mammalian growth hormones are very similar in their amino acid
sequences and hormones originating from one animal source can enhance
the growth of other unrelated species of animals. For purposes of
increasing growth rate of animals, the analogs of the present
invention can be used to produce increased growth in the same animal
species in which native bSt has been shown to have growth-related
bioactivity such as bovines, sheep, rats, salmon and chickens. The
preferred animals are bovine used for beef cattle such as bulls,
heifers or steers.
Beef cattle are slaughtered ~ust prior to reaching full maturity
and size. The bSt analogs of the instant invention can be used to
produce increased growth rates in beef cattle by administration any
time between weaning until slaughter. The bSt are administered to
beef cattle for a minimum of 30 days and for a maximum of 450 days
depending upon desired time of slaughter. Animals used for veal are
typically slaughtered at approximately 6 months of age and 10 to 30
mg/day of the bSt Dnalog is admini~tered up until the n~o of slaugh-
ter to effectuate desired lncreasos in growth rate.
For purposes of increasing lactstion in bovines, particularly
dairy cows, the bSt analog is administered between 30 and 90 days
postpartum and continued for up to 300 days. The bSt analog will
also increase lactation in other commercial milk-producing animals
such as goats and sheep.
.
2~ 3'~8
-17-
CHART 1. Amino Acid Sequence Of Bovine Somatotropin
ala phe pro ala met ser leu ser gly leu phe ala asn ala val
leu arg ala gln his leu his gln leu ala ala asp thr phe lys
glu phe glu arg thr tyr ile pro glu gly gln arg tyr ser ile
gln asn thr gln val ala phe cys phe ser glu thr ile pro ala
pro thr gly lys asn glu ala gln gln lys ser asp leu glu leu
leu arg ile ser leu leu leu ile gln ser trp leu gly pro leu
100
25 gln phe leu ser arg val phe thr asn ser leu val phe gly thr
120
ser asp arg val tyr glu lys leu lys asp leu glu glu gly ile
leu ala leu met arg glu leu glu asp gly thr pro arg ala gly
140
gln ile leu lys gln thr tyr asp lys phe asp thr asn met arg
160
ser asp asp ala leu leu lys asn tyr gly leu leu ser cys phe
180
arg ly9 asp leu his lys thr glu thr tyr lou srg v~l m~t lys
190
cys arg arg phe gly glu ala ser cys ala phe
-18-
CH~RT 2. Clonlng of the m4-99ser gene lnto the pURA Vector
1) A plasmid contalning the m4-99ser gene ls digested with
EcoRI and HindIII to produce Fragment 1.
5EcoRI HindIII
BBBBBBBBBBBBBBBBB ¦ ~--------------
ori Ampr
Fragment 1
EcoRI HindIII
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
2) Plasmid pURA-m4 is digested with EcoRI and HindIII to
produce Fragment 2.
EcoRI HindIII
* I ,,__. l l l l I ,
cop cop rep ori ori Ampr
B A A 322
Fragment 2
HindIII EcoRI
5
cop cop rep ori ori Ampr
B A A 322
3) Fragments 1 and 2 are then lignted togeth~r to protl~lc~
0 plnsmid pURA-99ser.
HindIII EcoRI
* ---~ I *
BBBBBBBBBBBBBBB
cop cop rep ori ori Ampr
B A A 322
B ~ bSt m4-99ser gene
~05;~
- 19 -
CHART 3. Ollgonucleotides Used for Constructing rbSt Analogs
C-ST 84 (gly) 5'-GTCTTCACCGGTAGCTTGGTG
C-ST 88 (ser) 5'-GTCTTCACCTCTAGCTTGGTG
C-ST 89 (pro) 5'-GTCTTCACCCCGAGCTTGGTG
C^ST 90 (asp) 5'-GAGTCTTCACTGATAGCTTGGTG
C-ST 91 (glu) 5'-GAGTCTTCACTGAAAGCTTGGTG
JM 23 (ser-ser) 5'- AGCAGAGTCTTCACCTCTTCCTCTTTGGTGTTTGGCACC
JM 57 (ser-asp) 5'-TCAGCAGAGTCTTCACCTCTGACTCCTTGGTGTTTGGCACCTCGG
