Note: Descriptions are shown in the official language in which they were submitted.
2 0 09 9 1/
C,OLD SHOCK PROTEIN, GENE CODING THEREFOR, PROMOTER FOR
GENE ENCODING COLD SHOCK AND OTHER PROTEINS,
METHODS AND USES AS ANTIFREEZE PROTEIN IN
AGRICULTURE AND OTHER APPLICATIONS
This invention relates generally to the field of biotechnology, more
specifically to a novel and valuable protein which on the basis of evidence to
date,
is believed to be capable of protecting cells, e.g., plant cells against the
adverse
and injurious effects of low temperature (an antifreeze protein) and is stable
at
physiological temperatures. The invention also relates to methods of making
same.
The invention further relates to a novel promoter which controls the
expression
of the gene encoding the protein or of heterologous proteins. The invention
further relates to a cold shock structural gene the expression of which is
capable
of being regulated by a heterologous promoter. Additionally, the invention
relates
further to transformed competent hosts, contemplates transgenic plants which
can
express the antifreeze protein and to several other useful applications in
agriculture and other fields.
Damage to crops by frost is one of the leading causes of loss in
agricultural output due to the natural phenomenon of weather variability in
the
. a.., .
R A STAPtFR
Ir[ .ee
~r
rlrltc~
,/M, N I.IOt -
=.1M1.f
1
A
2009917
world. It has been estimated that from 5 to 15% of the gross world
agricultural
product may be lost to frost damage in one year. In some regional areas the
loss
may approach 100%. The yearly economic crop loss due to frost damage in the
United States has been reported to be greater than $5 billion. Most of this
damage
is induced by freezing initiated by certain species of natural ice-nucleating
bacteria, such as species of Pseudomonas, such as syringae, coronafaciens,
piai,
tabaci, or fluorescens, Xanthomonas such as translucens, or Erwinia such as
herbicola. The presence of such natural epiphytic bacteria on the plant
surface
can promote the nucleation and formation of ice crystals at temperatures
slightly
i0 below 0 C. Such ice nucleation capable ( INA') bacteria are responsible
for the
frost damage on a wide variety of important agricultural crops, such as corn,
soybeans, wheat, tomatoes, deciduous fruit trees such as pears, almond, apple,
cherry, and many subtropical plan-ts such as citrus and avocado.
The removal of ice-nucleating bacteria from frost sensitive plants has
obvious immediate economic benefits. This need had spawned a number of
technologies that might be used to prevent frost injury to crops. One
technology
is based upon the removal of the ice gene from bacteria and reintroducing
these
genetically engineered microorganisms ( GEMs ) to crops. When these GEMs
colonize
on the plants, they displace the natural ice nucleating bacteria thereby
providing
a measure of protection against frost. Some of the patents dealing with
attempts
to solve that problem are discussed further below. This invention in one of
its
important embodiments, suggests an approach to a solution to this problem.
There
is therefore, an urgent and economic need in the United States and throughout
the
world to provide the means for controlling damage to plants, and to other
biological
. e..~.
R B STAPLER
wre +ee
nrtmaM sr ~..~ r. ..aa
. ~ssu~a
- 2 -
2009 17
- t -
materials. The treatment of plants with bacterial strains is subject to
regulatory
and public response iri the United States and elsewhere, and the present
invention
suggests in one of its important embodiinents an alternative to applying non-
ice
nucleation bacterial strains. The invention, as will be described in further
detail
herein provides a protein which is thought to function on the basis of
evidence
available, as an antifreeze protein; also the invention contemplates the
transformation of plants to render them less susceptible or resistant to low
temperature by incorporating the DNA sequence carrying the gene into recipient
crop host cells which will then synthesize the antifreeze protein of the
invention,
or one of similar antifreeze properties.
There is another important area to which this invention relates.
There are known instances where proteins produced by recombinant DNA or
fermentation techniques are enzymatically degraded at physiological
temperatures
resulting in modification, diminution or destruction of the desired biological
activity of the protein. Furtliermore, there is recezit evidence (27) that
indicates
that proteins produced at normal growth temperatures for E. coli ( 37 C) can
sometimes be folded improperly resulting in a complete or partial loss of the
desired property of the proteins (e. g. , biological activity). This invention
in
another of its important embodiments, may indicate a solution to these
problems by
the production of the desired protein at temperatures below the normal growth
temperature.
Thus, the ability to control a gene encoding a protein of commercial
value such that it is produced only after the temperature has been reduced
below
the normal growth temperature, would allow the expression of the target
protein
:R A sTAPLU
km
, ..,,...~ ,.
w~. _'.'Ot
,..,,..,
- 3 -
CA 02009917 1999-09-07
to proceed at optimal temperature with no ill effects on the desired
physiological activity of the
protein.
With respect to the field of genetic engineering a considerable wealth of
literature
(including United States and foreign) has been published. When appropriate to
assist one skilled
in the art, reference shall be made to such literature either within the body
of the description or
towards the end hereof. A number of patent and literature references are noted
at the end of this
section of the description under the heading "References".
United States Patent No. 4,766,077 (1988) deals with ice-nucleation deficient
(INA-)
microorganisms which have induced non-reverting mutations within a genomic DNA
sequence
(INA gene) which encodes for polypeptide(s) responsible for ice-nucleation
activity (INA). The
INA- microorganisms disclosed are applied to a plant part so that they become
established prior
to the colonization of the plant by the INA+ microogranisms. Treatment in
accordance with the
patent, is apparently the subject of a notice of application for permission
with the United States
government to release Pseudomonas syringae pv. s n ae and Erwinia herbicola
carrying in
vitro generated deletions of all or part of the genes involved in ice-
nucleation.
U.S. Patent No. 4,375,734 (1983) also deals with an ice nucleation-inhibiting
compositions using non-phytotoxic virulent bacteriophages which are
-4-
2009917
species specific to the ice-nucleating bacteria normally present on plants. A
particularly useful strain is a virulent bacteriophage strain, Erh 1, which is
species specific to Erwinia herbicola.
U.S. Patent No. 4,464,473 (1984) provides for the isolation of DNA
segments encoding for ice nucleation activity, which DNA segments may then be
introduced into an appropriate vector. The ice-nucleating microorganisms can
be
used for preventing super cooling of water in various commercial applications.
U.S. Patent No. 4,161, 084 (1979) provides for a method for reducing
the temperature at which freezing takes place in plants to reduce frost
damage.
This is performed by the addition of non-ice-nucleating bacteria to plants
prior to
the onset of freezing temperature and preferably while the plants are in their
seedling stage.
Reference is also made to earlier U.S. Patent No. 4,045,910 (1977),
which describes the treatment of plants with Erwinia herbicola before the
onset of
freezing temperature.
It can be seen from this review of some of the United States' patent
literature that the problem of frost damage to agricultural crops has of
course been
recognized and several proposals made to alleviate this serious problem.
However,
none of these patents teach or suggest the subject matter of the present
invention.
A review of the technical literature has brought out the following
publica tions .
Publications have been noted which deal with proteins which are
synthesized in microorganisms when growing cultures are subjected to an
increase
in heat, yielding what are called "heat-shock" proteins, or to a decrease in
growing temperatures yielding what is called a "cold-shock" protein.
=M OPIIC[f
ER & $TMLEA aunc soo
o P~KMTI ST
~. .. 'O'0=
fw rVs~s
- 5 -
w 1
2009917
Where the full citation does not appear in the text herein, a numeral
in parentheses refers to a list of references at the end of this text.
NEIDHART, F.C., et al, The Genetics and Regulation of Iieat-Shock
Proteins, Ann. Rev. Genet., Vol. 18, pp. 295-329, (1984), discusses the heat-
shock response in procaryotic and eucaryotic cells . Heat-shock proteins
identified
in E. coli are des cribed .
COWLING, D.W., et al, Consensus Sequence for Escherichia coli Heat
Shock Gene Promoters, Proc. Natl. Acad. Sci., Vol. 82, pp. 2679-2683 (1985).
The article identifies the consensus sequence for the E. coli heat-shock
promoters
and the gene encoding a heat-shock protein. Transcription from each promoter
is heat-inducible in vivo, and is recognized in vitro by RNA polymerase
containing
the Q; factor encoded by rpoH(htpR) but not by RNA polymerase containing the
major E. coli 6 factor.
The induction of transcription of heat-shock proteins has been
reported to be acconiplished primarily by an alternate a subunit of RNA
polymerase
encoded by rpoH(HtpR) Grossman et al (1); Strauss et al (2).
For a review of heat-shock response in various organisms, see
Lindquist, The Heat Shock Response, Ann. Rev. Biochem., Vol. 55, pp. 151-1101
(1986); Neidhardt, et al, The Genetics and Regulation of Heat Shock Proteins,
Ann. Rev. Genet., Vol. 18, pp. 295-329 (1984).
Broeze, et al (24) report the differences in protein synthesis by
coli and P. fluorescens after a temperature shift to 5 C. In the mesophilic
E. coli ,
protein synthesis was reported to decrease for one hour and then cease. The
accumulation of 70s ribosomes that were found after such a temperature shift
has
beeri interpreted to indicate a block in initiation of translation. A shift to
10 C,
NM OII CLf
M&S7wrLER sUre sne
w .vicerTM $* iCLM.... '*'03
t.r rs~aa
- 6 -
' 2009917
on the other liand, results in a gi=owth lag of 4 hours followed by renewed
growth.
Ng, et al (4) and Jones, et al, cited above.
For additional background on antifreeze proteins, see Hew, et al (5)
and Duman, et al (6). Such proteins are low molecular weight proteins commonly
found in high concentrations in the serum of polar dwelling marine fishes and
In
the hemolymph of insects which winter in subfreezing climates.
For background information dealing generally with control of
transcription, see for instance Protein-Nucleic Acid Interactions in
Transcription:
A Molecular Analysis, Hippiel, P.H., et al, Ann. Rev. Biochem., Vol. 53, pp.
389-
440 (1984). For other publications to which reference may be made in
conjunction
with this description, see the list of references at the end hereof. For
certain
patents in the genetic engineering field which use terminology and techniques
also
referred to herein, reference may be made to U. S. Patent No. 4,624,926
entitled
"Novel Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to
Masayori
Inouye and Kenzo Nakamura, 1986; U.S. Patent No. 4,666,836 entitled "Novel
Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori
Inouye
and Kenzo Nakamura, 1987; U. S. Patent No. 4,643,969 entitled "Novel Cloning
Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and
Yoshihiro Masui, 1987; and U.S. Patent No. 4,757,013 entitled "Cloning
Vehicles
for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and
Yoshihiro
Masui, 1988.
Other publication. Recently, an article has been published which is
of interest. JONES, P. G. , et al, Induction of Proteins in Response to Low
Temperatures in Escherichia coli, The Journal of Bacteriology, Vol. 169, pp.
2092-
2095 (1987). This article discusses the synthesis of a set of proteins
involved in
.. C...C[9
an et sTAPL"
ans see
G /iTL[MIM ,t
14Mn. -. ,.07
- 7 -
200~917
transcription and translation and possibly mRNA degz-adation. Proleins are
reported to be synthesized during a growth lag when the growth temperature for
the bacteria is decreased from 37 to 10 C. About thirteen proteiris were
noted.
Twelve identified proteins are synthesized during the growth lag (after the
temperature is decreased from 37 C); and five are unidentified; one of the
cold-
shock proteins (designated F10.6) is detectably synthesized during growth at
low
temperature. There is no indication that this is a transient synthesis.
hithin the scope of the invention are provided for genetically
transforming microorganisms, particularly bacteria, to produce genotypical
capability, particularly to produce "cold-shock" or "antifreeze" and other
proteins. Also provided are segments of DNA ("promoter") that contain signals
that direct the proper binding of the RNA polymerase holoenzyme and its
subsequent activation to a form capable of initiating specific RNA
transcription.
The promoter which is described herein is cold-induced and capable of
controlling
the expression of the cspA gene which encodes a cold-shock or antifreeze or
other
proteins. Practical applications are referred to hereinafter.
Genetic systems are provided for expressing proteins called cold-
shock or antifreeze proteins, particularly a cold-shock protein of E. coli
designated cs7.4.
The invention provides a novel polypeptide which is synthesized in E.
coli in response to a decrease of the temperature below ambient, or
physiological
- 8 -
A.:,.k ,
20099 17
gruwth temperature. The polypeptide (or protein) is a 7.4 kdal protein induced
under cold-shock and has been designated as "cs7. 4" .
A noteworthy aspect of the polypeptide is that it is stable at
temperatures above the cold temperature at which it was induced.
The invention also provides the gene encoding the cs7.4 protein. The
invention provides further the cold-induced promoter which controls the
expression of the gene encoding cs7.4 and which promoter also is capable of
initiating transcription of proteins other than cs7.4 in response to a shift
in
temperature below the microorganism growth temperatures.
The invention also provides a system for expressing the gene encoding
the antifreeze protein under the direction of a promoter other than the
promoter
of the invention.
The invention further provides various DNA constructs, including
cloning vectors, e.g., plasmids which contain the promoter, the structural
gene
and other necessary functional DNA elements, and transformed hosts.
The invention also contemplates various applications of the products
of the inveiition in the field of preventing or alleviating the injurious or
lethal
effects of low temperature, e. g. , freezing of microbiological and plant
cells. It is
contemplated that the protein of the invention be used as an "antifreeze"
compound, for instance on crops; or that an innocuous microorganism
transformed
with the gene or portions thereof encoding for es7.4 protein of the invention
be
used in agricultural or other applications. It is also contemplated that DNA
containing a sequence encoding the cs7.4 protein be transferred to crop host
cells
to produce there the cs7.4 antifreeze protein. and thus protect the crop from
frost
injury.
tww WnC[s
KfR & $7MlFR
w" eoe
W -[sw+w Sr
,enn.n no~
s.s. rrswa .
- 9 -
= ,,, ~009917
~
The invention provides a cold-stiock induced promoter (the "native"
promoter) which is capable of regulating the expression of a cold-shock
induced
gene encoding ari antifreeze protein.
The invention provides further a proinoter ("native") which is capable
of controlling the expression of a gene encoding an antifreeze protein or
another
protein at temperature below physiological temperatures. Although cs7. 4 is
frequently referred to herein, it is contemplated that any protein can be
produced
by the promoter of the invention.
The invention also provides for the expression of a gene encoding an
antifreeze protein under the control of a heterologous (non-native) promoter
at
physiological temperatures.
The invention further contemplates that having further elucidated the
promoter sequence, the DNA sequence of the promoter can be generated
synthetically; such promoter will be useful to regulate the expression of
proteins
at low temperatures, i.e., temperatures below physiological temperature.
It is a noteworthy aspect of the invention that the promoter can be
"uncoupled" in the sense that it can be used without the native structural
gene
and conversely, the structural gene can be controlled by a heterologous
promoter.
Other aspects of the invention will become apparent from the
description which follows.
uw ornecs
um & SrArtm
w,c .ee
w -to- ar wpUMlll M I9I02
QIM ~i - 10
2009917
Embodiments of the invention will be described with
reference to the accompanying drawings in which:
FIG 1 shows the major cold-shock protein induction. The arrow on the
right indicates the induced major cold-shock protein, cs7.4.
FIG 2 (A and B) shows transient induction of cs7.4. The numbers
indicated are as follows: 1, pulse-labeled from 0 to 30 minutes after
temperature
shift; 2, 30 to 60 minutes; 3, 60 to 90 minutes; 4, 90 to 120 minutes; 5, 120
to 150
minutes; 6, 150 to 180 minutes. The arrows are described in FIG 1.
FIG 3 shows the stability of cs7.4. The arrow indicates cs7.4.
FIG 4 shows the 2-dimensional gel utilized in purification of cs7.4.
FIG 5 shows a Southern Blot analysis for cspA.
FIG 6A shows the DNA sequence of cspA (restriction map and
sequencing strategy).
FIG 6B shows the partial nucleotide sequence of the cloned HindIIl
fragmerit. The region encoding cspA and the corresponding amino acid sequence
of cs7.4 are shown in bold type. The underlined AGG is probably the Shine-
Delgarno sequence. Regions underlined with half an arrow indicate inverted
repeats.
FIG 7 is a schematic representation of a plasmid pJJG01 cEirrying the
cspA gene ( shown by arrow).
F'IG 8 is a schematic representation of pJJG12.
FIG 9 is a schematic representation of pJJG04.
- 11 -
.., 2009917
. ; -
Figure 1(FIG 1) - Major Cold-Shock Protein Inductioii.
Aliquots of a cell culture growing at 30 C were transferred to 420C,
30 C, 25 C, and 18 C and immediately pulse-labeled with ["S ] methionine
for 10
minutes. Samples were subjected sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and the autoradiogram is shown here. Molecular weight standard
sizes are indicated on the left in kilodaltons. The arrow on the right
indicates the
induced major cold-shock protein.
Figure 2A and 2B (FIG 2A and FIG 2B )- Transient Induction of
cs7.4.
Cell cultures growing at 370C were transferred to either 10 C or
C. Aliquots were then pulse-labeled with [ 1SS ] methionine for 30 minute time
intervals and electrophoresed as described in FIG 1. FIG 2A. Above the
autoradiogram shown here, C indicates a control where an aliquot was pulse-
15 labeled for 5 minutes at 37 C before the temperature shift. The numbers
indicated
are as follows: 1, pulse-labeled from 0 to 30 minutes after temperature shift;
2,
30 to 60 minutes; 3, 60 to 90 minutes; 4, 90 to 120 minutes; 5, 120 to 150
minutes;
6, 150 to 180 minutes. The arrows are described in FIG 1. FIG 2B. The
autoradiogram in A was subjected to scanning densitometry and the percent
methionine-labeled cs7.4 protein in the whole cell was determined for each
time
. olnccs
X & STAPLER
uR+t eoo
:.wt[.~r s. :n.=... sm
-
r sseasa ~ 12
2009917
,,.. _
iriterval. Each time point on the graph is the quarititation for the percent
methionine-labeled cs7.4 protein at the end of each thirty minute interval.
For
example, between 30 and 60 minutes (60 minute time point on the ordinate),
cs7.4
accounted for 10% of the total methionine-labeled protein in the cell at 10
C. The
0 time point accounts for the five minute pulse at 37 C, which is described in
A.
Figure 3 (FIG 3) - Stability of cs7. 4.
A cell culture growing at 370C was transferred to 15 C. After 30
minutes, the culture was pulse-labeled with ['SS] Translabel for 30 minutes.
The
culture was then chased with nonradioactive methionine and cysteine for
various
lengths of time indicated above the autoradiogram shown here. The samples were
electrophoresed as described in FIG 1. The 37 C sample was prepared as
described in FIG 2. The arrow indicates cs7.4.
Figure 4 (FIG 4) - 2-dimensional Gel Utilized in Purification
of cs7.4.
A cell culture growing at 37 C was transferred to 14 C for 4 hours.
The culture was then harvested, fractionated, and the cytoplasmic fraction was
subjected to 2-dimensional gel electrophoresis. The first dimension is
isoelectric
focusing and the second dimension is SDS-polyacrylamide gel electrophoresis.
The
gel was electroblotted onto a PVDF membrane which was stained with Coomassie
Blue dye. The arrow indicates cs7.4.
,.. a.~.
5/SER & sTAPLER WK foo
w n..ca+= n
,nourw... ~wa
It11 ~91iM1
- 13 -
. .~ 2009917
Figure 5 (FIG 5) - Southern Blot Analysis for cspA.
E. coli chromosomal DNA was digested with various restriction enzymes
and the DNA was transferred from an agarose gel to nitrocellulose paper.
Hybridization was carried out usirig the degenerate probe described in the
text,
and the autoradiogram is shown here. The restriction digests are as follows:
S,
SalI; P, PstI; B, BamHI; E, EcoRI; H, HindIII. indicates lambda DNA digested
with HindIII, which was used as a size standard. Chromosomal DNA digested with
HindI1I was also fractionated by agarose gel electrophoresis, and fractions 1
through 12 are shown.
Figure 6A and 6B (FIG 6A and 6B )- DNA Sequence of cspA.
Approximately one half of the 2.4kb HindIIl fragment from clone
pJJG01 was sequenced. FIG 6A. Shown here is the restriction map and the
sequencing strategy. The restriction enzyme sites are as follows: H, HindIII;
D,
Dral; S, SmaI; B, Bg1I; A, ApaLI; P, PvuII; X, XmnI. The thick arrow indicates
the region encoding cspA. FIG 6B. Shown here is the partial nucleotide
sequence
of the cloned Hind1II fragment. The region encoding cspA and the corresponding
amino acid sequence of cs7.4 is in bold type. The underlined AGG is the
probable
Shine-Delgarno sequence. Regions underlined with a half arrow indicate
inverted
repeats.
FIGS 7, 8 and 9 are described further below.
uw o.rlecs LSEA & STAPIER wn[ xo
p nn[[rrw ft
.p[LM.. N 110=
1tp ~1i~f] .
14
2009917
The invention provides a niethod for producing a "cold-shock"
protein, a promoter therefor and various constructs. In one embodiment that
will
be described hereinafter, the gene encoding the cold-shock protein is
expressed
under the regulation of a heterologous promoter. In another embodiment, the
cold-shock induced promoter is used to control the synthesis of a heterologous
protein in response to lowering of the growth temperature.
The method of the invention to induce and produce the es7.4 protein
of the invention comprises growing in a nutrient rich medium at an exponential
rate
an appropriate microorganism, for instance an E. coli, to a desired growth
density
at physiological growth temperature for the particular microorganism. For E.
coli
such temperature may be in the range of about 10 to about 50 C, preferably in
the range of 20 to about 40 C. Each microorganism is known to have its
optimum
growth temperature; for E. coli raising the temperature above about 40 C or
lowering it below 20 C results in progressively slower growth, until growth
ceases, at the maximum temperature of growth, about 49 C, or the minimum,
about
8 C.
When the desired degree of growth is attained (monitored by an
appropriate inethod, such as spectrophotometrically), the temperature is
rapidly
shifted to a lower temperature above abdut 10 and below about 20 C,
preferably
below about 150C and above about 8 C. Lower temperatures generally do not
sustain practical growth rates. If desirable, a shift to lower temperature but
above the temperature at which no growth of the microorganism takes place may
orrccs
A STAPLER
n[ foo
r/[[wrM ~T w..= wa
oTMaoa
- 15 -
2009917
also be performed. The culture is grown in the lower temperature range for the
appropriate period of time for optimum production of the polypeptide of the
invention. The kinetics of polypeptide induction are followed by appropriate
method such as pulse labeling with radioactive methionine, harvesting the
culture,
processing and separation by two-dimensional gel electrophoresis and
determining
by autoradiography the amount of protein synthesized.
it was found that the protein of the invention is not synthesized at
physiological growth temperature at which the microorganism normally grows, in
this case the E. coli; the polypeptide is synthesized in the lower temperature
range. Sudden induction of the synthesis of the polypeptide takes place within
approximately the first 30 minutes after temperature shift to 10 C or 15
C.
Maximal induction and rate of synthesis is temperature dependent after
temper=ature shift. After shift to 15 C, maximal synthesis is attained at 30-
60
ininutes post temperature shift; maximal rate of synthesis is approximately
13.1%
of total protein synthesis. See FIGS 2A and 2B. Shift to 10 C gives a maximal
rate of the synthesis of approximately 8.5% of total protein synthesis at 60
to 90
minutes post-shift. Adjustment of the temperature therefore allows for
adjusting
the rate of synthesis and/or yield of the polypeptide as being suited for the
objective of the invention. After the maximum total polypeptide yield lias
been
reached, the rate of synthesis thereof drops off, ultimately reaching a
fraction,
e. g. , about a fifth of tha maximum in the case of the culture shifted to 15
C and
about three-fifths of the maximum in the case of the culture shifted to 10
C.
A noteworthy characteristic of the cs7.4 protein of the invention is its
stability at temperatures above the temperature range at which it was induced
and
synthesized. Such physiological temperature may range from about above 15 C to
sEx & SrAn.eR
Nll.c !GG
10 11ITm.rM ST
XLMiI " H1G=
ttN ff3iM- 16 -
HGg9 17
about 40 C, or higher. The data in FIG 3 shows the protein to be stable after
synthesis at 15 C for 20 hours, (only about 30% of the protein degraded),
and
stable at 37 C( for at least 1.5 hours).
The stability of the protein of the invention at physiological
temperatures lias important practical applications. It permits synthesis of
the
protein at physiological temperatures with a promoter other than the promoter
of
the invention. It also facilitates applications of the protein in agricultural
formulations on crops at ambient temperatures before the protein starts
functioning
in its freezing or frost damage prevention role.
Other elements of the invention will be described hereinafter. The
promoter of the invention is believed to be located on the cloned HindIII
fragment
between nucleotides 1 and 605. The first 997 bp of the cloned HindIII fragment
contains all the necessary elements of the functiorial gene for regulated
expression
including the ribosome binding sites.
There is evidence of a promoter sequerice at -35 and -10 upstream of
the coding region, at positions 330 and 355, respectively. Another
characteristic
of the promoter is that it responds to a drop in temperature.
The promoter of the invention is activated at reduced temperature and
directs transcription of the gene of the invention.
The promoter of the invention is cold-inducible in vivo and is
recognized in vivo by RNA polymerase. Although the inventors do not wish to
be bound to any particular theory or principles of mode of action, or
function,
several hypotheses are being presently considered. The inventors believe that
there could be three possibilities (conceivably not mutually exclusive) for
the
uw orsecs .
W!f$ER & STAPLER
[Yn[ 'JOe
isC s0 ~[[MfH fI
hSYO[l/M.. r. 19102
ai~ naaa
- 17
-
2M917
inechanism of regulation of the promoter of the invention. First, the
possibility
exists that a cold activated inducer induces expression from the promoter at
lower
temperatures. Secondly, a cold serisitive repressor may be inactivated at cold
temperatures resulting in expression of the gene. Thirdly, the gene may be
coritrolled by a cold induced alternate sigma factor (other than a standard
sigma
factor like the d factor) which would allow the RNA polymerase to recognize a
novel promoter sequence upstream of the structural gene. Other mechanisms may
be postulated, especially if one considers that the transformed host need not
be
a member of the Enterobacteriaceae family.
The invention further provides a cold-induced cytoplasmic protein,
designated cs7.4 which is stable at growth temperature of a microorganism,
e.g.,
E. coli. The polypeptide has the following partial amino acid sequence
SGKMTG(X)VKWFNADKGFGFI wherein X is leucine or isoleucine. Both isoleucine
and leucine have been identified (64% and 36%, respectively). Thus, the
invention
includes either and both polypeptides. The polypeptide of the invention is a
70
amino acid residue protein. The calculated molecular weight is 7402 daltons
and
the calculated pI is 5.92. The polypeptide is very hydrophylic, containing
over
20% charged residues. Lysine residues make up 10% of the protein. No homology
was detected with any other sequence in the NBRF data base.
With respect to secondary structure determination carried out in
furtherance of the invention, the rules of Chou and Fasman (1978 )(11) did not
reveal any predominant secondary structural conformation; however, if the
amino
acid residues are plotted on a helical net 12 of the 16 charged residues were
determined to be adjacent as oppositely charged pairs. Also, folding of the
protein into an a-helix would result in juxtaposition of oppositely charged
residues
u. w.ets
OVE6ER & STAPLER wnc aoo
a so aneewrr sr
MRbO[1M11. I. 19lOi
a.snas a -
_
_ 18
20099 17
~ ..
for 12 of the 16 charged amino acid residues in the protein. These data
suggest
that a large portion or essentially all of the protein of the invention may be
in an
a-helical configuration.
A recent crystallographic study of the secondary structure of an
antifreeze polypeptide from the Fish Winter Flounder shows the molecule to be
a
single a-helix. See, Crystal Structure of an Antifreeze Polypeptide and its
Mechanistic Implications, Yang, et al, Nature, Vol. 333, 19 May 1988, pp. 232-
237 (25). A mechanism of antifreeze protein binding is proposed which is based
on the fact that all surfaces of ice crystals are densely populated with atoms
that
can hydrogen bond to the protein surface, and that due to the flexibility of
the
side chain many patterns of hydrogen bonding can exist. The mechanism
suggested requires that, after an antifreeze polypeptide induces local
ordering of
the ice lattice, the dipole moment from the helical structure dictates the
preferential alignment of the peptide to the c-axis of the ice nuclei; shifts
of the
lielical conformation can then take place and torsional movement of the side
chains
of the hydrophilic amino acids strenghtens the bonding of the protein with the
ice
surface.
Further evidence of the helical structure of the polypeptide of the
invention would clarify whether the polypeptide cs7.4 of the invention is the
first
antifreeze protein cold-induced in E. coli that can be produced by genetic
engineering methods. Work on the secondary structure of cs7. 4 would also open
other possibilities. It can be postulated for instance, that the only portion
of the
polypeptide which has a-helix configuration would be essential for the
antifreeze
function; and likewise, that only the portion of the nucleotide sequence which
,... a.~.
wF.Mlt ~ stAPl.ER
,..~ .~
sao w r.+cc.rw s.
MIOLVMI M 110=
Q19
- 19 -
CA 02009917 1999-09-07
encodes such polypeptide fraction would be essential for such antifreeze
applicatio.n.
Tlie cloned 2.4 kb HindIII fragment containing the gene for cs7.4 was
isolated from pUC9 by digesting with HindI1I and separating on a 5%
polyacrylamide
gel. The fragment was then subcloned into M13. DNA sequencing was .performeli
by the chain termination method (Sanger et al, 1977). DNA sequencing was
accomplished using [35S] dATP and the enzyme, Sequenase*, by the method
provided by the manufacturer (United States Biochemical Corporation).
The partial nucleotide sequence of the cloned HindIll fragment
includes the sequence encoding cs7.4 and the promoter therefor. The nucleotide
sequerice encoding the polypeptide of the invention cspA includes the
following
sequence of 210 nucleotides.
ATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCTGACAAAGGCTTCG
GCTTCATCACTCCTGACGATGGCTCTAAAGATGTGTTCGTACACTTCTCTGCTAT
CCAGAACGATGGTTACAAATCTCTGGACGAAGGTCAGAAAGTGTCCTTCACCP.TC
GAAAGCGGCGCTAAAGGCCCGGCAGCTGGTAACGTAACCAGCCTG
The corresponding amino acid sequence encoded by cspA is as follows.
MetSerGlyLysMetThrGlyIleValLysTrpPheAsnAlaAspLysGlyPheGlyPheIleThrPro
AspAspGlySerLysAsp Va1PheValHisPheSerAlaIleGlnAsnAspGlyTyrLysSerLeuAsp
G1uGlyGlnLysValSerPheThrIleGluSerGlyAlaLysGlyProAlaAlaGlyAsnValThrSerLeu
The sequence is shown in FIG 6B, it contains an open reading frame
beginning with an ATG codon at nucleotide 617 of the cloned HindIII fragment
and
extending for 210 nucleotides eriding with a TAA termination codon. This open
*Trade mark
-20-
_ 20~9917
.
reading frame is the coding region of the gene herein designated cspA
responsible
for es7.4 synthesis. The invention includes within its scope the nucleotide
sequence or any partial sequence thereof which codes for the polypeptide cs7.4
or
a polypeptide having the properties of cs7.4 (functional equivalent). The
invention also includes any equivalent nucleotide sequence wherein one or more
codons have been substituted by certain other codons, which equivalent
nucleotide
sequence codes for the cs7. 4 polypeptide, or a functional equivalent thereof.
In the work in connection with this invention, some evidence was
adduced that suggests to date that there may be two copies (cspA and cspB) of
the gene encoding the cold-induced polypeptide cs7.4. The evidence is further
discussed below. The invention includes within its scope such other possible
gene
which encodes the cs7.4 polypeptide or its functional equivalent. There are
examples in molecular biology of multiple genes encoding the same protein in
E.
coli, such as elongation factor Tu (tufA and tufB), and the ornithine
carbamoyltransferase, (ar~ and ar i) . If there were two genes encoding cs7.
4,
this would be the first finding of a two-gene cold-induced polypeptide.
In accordance with the invention, it is conceivable that from the 997
bp fragment of the cloned HindIII fragment, the cspA structural gene can be
removed and be replaced by a foreign gene. If necessary, the inverted repeat
at
the 3' end at 857-866 and 869-878 may be conserved; but if not, the HindIII
fragment would not need to contain the base pairs upstream of the TAA stop
codon. The foreign gene (or part thereof) would be inducible by the cold-
inciuced
promoter (or its equivalent) and be capable of encoding a target protein.
, ~.. ~.
t & s'IAPfFll ne wo
,..ccrn., sr.
MM. M t~lOi
IlM1~)
- 21 -
2009917
In another embodiment of the invention the cold-shock protein would
be expressed by the gene coding for it under the control of the promoter of
the
invention.
In yet another embodiment of the invention, a promoter other than the
native promoter can regulate expression of the cs7.4 gene at physiological
temperatures, i.e., within the temperatures range at which bacteria
exponentially
grow. Thus, in accordance with the invention, a heterologous promoter, an E.
coli lac promoter, has been used to regulate the expression of the cs7. 4
gene.
The cspA structural gene was subcloned into a high level expression vector,
pINIII (lppp'') (7). The resulting construct, pJJG12 is schematically shown in
FIG
8. Upon addition of isopropylthiogalactoside ( IPTG ), expression of the cs7.
4
protein at 37 C was detected by SDS polyacrylamide gel electrophoresis of
whole
cell lysate. The expression of the protein was 5-10 fold less than that
obtained
from expression regulated by the native promoter at 150C.
The fact, however, that expression of the protein was obtained at a
higher temperature with a promoter other than the native promoter is
significant
particularly since the protein is normally not expressed at 370C. This opens a
number of intriguing new possibilities. It can be contemplated that promoters
other than the lac promoter might be more effective in controlling expression
of the
gene. Also, the growth of cells at low temperature (15-10 C) ranges is slower
than at optimum growth temperature for the selected microorganisms, e.g., E. ~
coli. Thus, while the yield may be less at optimum growth temperature, the
faster
growth rate of the bacterium is likely to compensate for a possible lower
yield.
When a promoter stronger than the lac promoter is used to regulate the
expression
WElSEf & SrwrLEx
sunc ~ao
f]C i0 ...ecMIM s,. ~L-.- 14102
asrisassa
- 22 -
~.:=.
2009917
of the cs7.4 gene, it can be contemplated that high yields of a valuable
antifreeze
protein like cs7.4 can be obtained within satisfactory time periods on a
commercial
scale. Thus, large amounts of the antifreeze protein will be made available.
The
property described above, namely that the protein can be produced and still be
active as an aritifreeze protein at physiological temperature, is therefore
very
significant.
As the result of this teaching, one skilled in the art will appreciate
that other suitable promoters other than the lac promoter, such as the trp,
tac,
promoter, lambda pL, ompF, 2M, and other promoters may be used to regulate the
expression of the gene coding for the desired protein. When other transformed
microorganisms such as yeast are used to express the proteins, promoter like
GAL10 and others may be suitable.
Furthermore, as described briefly above, the cspA promoter of the
invention which is active at low temperatures, can be used to control the
expression of a protein other than the cs7.4 cold-shock protein. Thus, this
properly opens up yet other possibilities. This may be of particular interest
where a particular protein which would be useful but for the fact that it is
enzymatically ( e. g., proteolytically ) degraded at physiological
temperatures, could
be expressed at low temperatures at which it is less susceptible to enzyme
degradation. A like possibility exists for proteins that could be useful for
the fact
that they may be improperly folded so that they are not biologically active
when
produced at physiologically active temperature. It may be advantageous to
produce the proteins properly folded and active under the control of the cspA
promoter of the invention.
uw orsiccs
WE75FR & S7APLER wrr[ wo
zao w sr*ccr.*r n
wuot.nw. -uoa as~ssaz~z
- 23 -
CA 02009917 2003-10-27
These observations do not apply only to antifreeze proteins but to the
expression of
any proteins which heretofore could not be expressed in the desired
conformation at
physiological temperatures; these proteins, it can be visualized, could be
expressed at lower
non-injurious temperatures with the assistance of the promoter of the
invention.
In the above-described embodiment of the invention, the cspA promoter of the
invention has been used in a classic model to control the expression of B-
galactosidase. For
this purpose, a plasmid (pKM005) (21) containing the lac Z structural gene
without promoter
was compared with the plasmid containing the cspA promoter on an 806 bp
HindIIl-PvuI1
fragment (pJJG04). See FIG 9.
A second plasmid, pJJG08, was constructed which contains a smaller nucleotide
fraction of the upstream region of the csnA gene, terminating at the ApaLl
site (bp 534). The
results are shown in Table I.
TABLE I
RESULTS OF EXPRESSION IN A LAC STRAIN
TEMPERATURE AFTER SHIFT AFTER SHIFT
Plasmid 370 to 15 to 10
pKM005 6.7 4.1 3.7
pJJG04 549.0 900.0 851.0
pJJG08 40.7 45.6 56.1
Temperatures are in C; other numerals refer to "Units" of enzyme activity.
-24-
i I
CA 02009917 2002-06-05
The difference in yields between pJJG04 and pJJG05 would tend to
suggest that the promoter or other regulating elements are in the 0 to 534
base pair
fragment; the region from 534 to the start of the gene may also embody
regulatory
elements. Likewise, the region downstream of the gene to bp 878 may also
embody
regulatory elements.
The results show that the cspA promoter is capable to directing a
heterologous gene to express a selected protein.
The following examples are only illustrative of the invention; they are
not to be construed as a limitation thereof. One skilled in the art can
readily make
variations and substitutions to obtain equivalent results.
EXAMPLE 1
Cultures of E. coli SB221 (lpi) hsdR trpE5 IacY recA/F' lacl'= lac+
pro+) (7) were grown to a density of approximately 2 X 108 cells/ml in a 10 ml
culture
volume prior to temperature shift. 1.1. ml aliquots of the cell culture
growing at 30 C
were transferred to beakers at 42 C, 30 C, 25 C and 18 C containing 10 uCi of
[35S]
methionine (Amersham Corp.,>1000 Ci/mmol) or [35S] Translabel* (ICN
Radiochemicals, Irvine, CA) and pulse-labeled for 10 minutes. All samples were
collected by centrifugation and the pellets were dried by lyophilization.
Samples
were then subjected to sodium dodecyl sulfatepolyacrylamide gel
electrophoresis
(SDS-PAGE) on a 17.5% resolving gel. The gel was dried and exposed to X-ray
film.
Trade mark
zu0?917
, - _
The resultant autoradiogram indicated a protein of 8 kdal apparent
molecular weight produced only after shift to 250C. No corresponding band was
seen in the pre-shift or 43 C shifted cultures. Ttus protein is designated
cs7. 4.
EXAMPLE 2
Isolation of csp gene
In constructing the plasmid containing the cold-shock protein coding
sequence and its regulatory elements, it is necessary to first identify and
isolate
the locus. In order to prepare an oligonucleotide probe, a partial amino
terminal
sequence of the protein is obtained. A 10 ml culture of E. coli SB221 (7) was
grown to a density of approximately 2 X 10" cells / ml at 37 C and
transferred to
14 C for 4 hours. Cells were then harvested and fractionated for the soluble
fraction as previously described (9). A trace of protein pulse-labeled for 30
minutes after shift to 15 C as described above was then mixed with 250 ug of
soluble fraction protein. Two-dimensional electrophoresis was then performed
with
isoelectric focusing in the first dimension (ampholines pH 3-10, 1.5%; pH 6-8,
0.5%) and SDS-polyacrylamide gradient gel electrophoresis (10-18.4%
acrylamide,
2.7% crosslinking) in the second dimension according to the method of
O'Farrell
(15). Separated protein was electrophoretically transferred to a
polyvinylidene
difluoride (PVDF) membrane (Millipore Corp., Bedford, MA) using a semidry
blotter apparatus (Saritorius GmbH, Goettinggen, FRG) and 48mM Tris, 39mM
glycine, 1.3mM SDS, 20% (v/v) methanol pH 9.2 as the transfer buffer. The
membrane was then stained for protein with Coomassie Blue R-250, dried, and
w os.ic[s
R & SiAPLFJt
uT[ aee
n.asw. s.
11M.. N 1~\Cf ~ /1i~1]
- 26 -
200q917
subjected to autoradiography. The autoradiogram clearly identified a heavily
labeled protein at approxiunately the same molecular weight previously
observed for
cs7.4 (FIG 4). The autoradiographic spot was used to identify the cs7.4 spot
on
the stained membrane, which was then excised from the blot. Automated Edman
degradation was performed directly on the stained membrane fragment according
to the method of Matsudaira (1987) using an Applied Biosystems Model 470 gas-
phase sequenator. The amino acid sequence obtained is described above.
A mixed degenerate oligonucleotide probe for Southern blot analysis
was made to match a short region of the amino acid sequence as shown below:
...K W F N A...
5' -AA"TGGTTTAA'GC-3'
a c a
For Southern blot analysis, chromosomal DNA was prepared from
overnight cultures of E. coli SB221 (7). The cells were collected by
centrifugation
and washed with 10mM Tris-HC1 (pH 8) and lysozyme in 0.25M Tris-HCl (pH 8) was
added to a concentration of 3.3 mg/ml. The sample was then incubated at 0 C
for
minutes followed by the addition of RNaseA to a concentration of 60mM. After
5 more minutes on ice 10% SDS was added to a concentration of approximately
1%.
The sample was then mixed rapidly, and the same volume of RNaseA that was
20 added previously was again added along with pronase in 25mM Tris-HCl (pH 8)
to
a concentration of 0.1 mg/ml. The sample was then incubated at 37 C for 30
minutes followed. by phenol extraction, chloroform-isoamyl alcohol (24:1)
extraction, and ethanol precipitation. The sample was then further subjected
to
phenol extraction, ether extractions, and ethanol precipitation. Chromosomal
DNA
. O/.C[9
II& sT,VLFi a" ow
jrll M I~IOf
= .1F~iR
27 -
20917
was subjected to drop dialysis using Millipore Type VS 0.025 um filter before
restriction enzyme digestion.
Chromosomal DNA fractionation was carried out by digesting at least
50 ug DNA with HindIII, Sall, BamHI, Pstl, and EcoRl and electrophoresing on a
0.7% agarose gel.
Southern transfer of DNA from the agarose gel to nitrocellulose paper
was done by the method described in the manual by Maniatis et al (26) with the
following exceptions. Acid depurination to partially hydrolyze the DNA was
accomplished by washing the gel only once for 15 miriutes in 0.25M HCI.
IO Furthermore, the dish in which the transfer was carried out was filled with
20 X
SSC instead of 10 X SSC.
Hybridization was carried out according to Maniatis et al (26) with the
following exceptions. Both the prehybridization and hybridization solution
contained by volume/mi solution: 0.1 ml 50 X Denhardt's, 0.2 ml 30 X NET, 0.5
ml 20% Dextran Sulfate, and 0.05 ml 10% SDS. These solutioris are described in
Inouye and Inouye, (19). The oligomer that was used for the probe is shown
above. The ["P ]-labeled probe was made according to Inouye and Inouye,(19 ),
and the prehybridization and the hybridization was carried out at 32 C. The
filter
was washed and dried according to Inouye and Inouye, (19). 20 The
autoradiogram from Southern blot hybridization with the mixed
oligonucleotide probe indicated at least one distinct band in each digest. In
particular, the HindIII digest yielded one band with a size of 2.4 kb (See FIG
5). The 2.4 kb HindIII fragment was isolated in the following manner. A
HindIII digest of chromosomal DNA was fractionated on a 0.7% agarose gel. Gel
Fe[s
It sTAilFR
R[[IIIN /T
Y. /Ipt
1lJ1tt
_
_ 28
20a01917
slices were then excised at every 0.5 cm from the top of the gel.. Each gel
slice
was frozen at -20 C for at least 20 minutes and then centrifuged in an
Eppendorf
tube for 10 minutes. This was repeated three times, the last time adding some
1mM Tris, 0.1mM EDTA (pH 7.5) before freezing, and the supernatant was
collected after each centrifugation. The samples were then phenol extracted
three
times, ether extracted, and ethanol precipitated.
Each fraction was subjected to Southern blot analysis with the probe.
DNA fragments from fractions 7 and 8 clearly hybridized with probe
corresponding
well with the 2.4 kb HindIII band in the original chromosomal digest.
EXAMPLE 3
Cloning of cspA gene
pUC9 plasmid DNA was digested with HindllI and ligated with fraction
7 of the HindIII chromosomal digest (see Example 2) using T4 DNA ligase. E.
coli
strain JM83 (ara,& (lac- rp oAB ) rpsL 80 lacM15 )(13 ) was then transformed,
and
the cells screened on L-agar plates containing 50 ug/mi ampicillin spread with
25u1
of 40mg/ml xgal. White colonies were picked onto Whatman filter paper and
subjected to a colony hybridization screen as described by Inouye and Inouye,
(19). The probe used was the same one used for Southern blot analysis (see
Example 2). The hybridization temperature was 32 C. A colony which lighted
up
upon autoradiography was subjected to a second screening by colony
hybridization
to ensure that the clone had been obtained.
=osnccs '
'&$rAMFR
rre oee
FWJCprr
ww. ti ~oa .
ss~ a
- 29 -
2009?17
4 _
EXAMPLE 4
Use of csp Promoter to Direct Heterologous Protein Synthesis
The csp promoter was used to direct the synthesis of B-galactosidase
in E. coli from the plasmid pJJG04. This plasmid was constructed as follows.
The
2.4 kb HindIII fragment containing the gene was digested with PvuII. The
resultant 806 bp fragment was separated on 0. 8% agarose gel, the band excised
and
the DNA recovered by electroelution using a salt-bridge electroelution
apparatus
manufactured by IBI, Inc. as per manufacturer's instructions. This fragment
was
then ligated with T4 DNA ligase into the promoter-proving vector (pKMOO5
(Masui
et al) (21) after treatment of the vector fragment with XbaI restriction
enzyme and
Klenow fragment of DNA polymerase I. The E. coli lac deletion strain SB4288
(21)
was transformed and cells carrying the recombinant plasmid were selected as
blue
colonies on L-agar plates containing 50 ug/ml ampicillin and 40 mg/ml Xgal.
Cultures of E. coli SB4288 harboring plasmid pJJG04 were grown at
37 C and shifted to 10 C or 15 C. B-galactosidase activity before and
after the
shift using the substrate o-nitrophenyl-B-D-galactoside as described by Miller
(22). The results indicate a 64% increase in B-galactosidase activity upon
shift of
the culture to 15 C, evidencing induction of transcription from the cloned
cspA
promoter and subsequent expression of f3-galactosidase.
This example illustrates well the versatility of the,promoter sequence
of the invention.
...a..~.
Ee & srnrLEn
vu~ sm
~ .RTKwTM {1
RN..... '.'Ci
. .,,...,
- 30 -
2'00991I
EX7IMPLE 5
Expression of cs7. 4 Structural Gene at 37 C.
The cspA structural gene was subcloned into a higlr level expression
vector, pIN1II (lpp"") (23) using arr Xbal site created just upstream of tlre
structural gene using oligonucleotide directed site specific rnu lagerresis .
Upon
addition of IPTG, expression of the cs7.4 protein could be detected by SDS-
PAGE
analysis of whole cell lysates.
For vector that carr be used to clone a DNA fragment carryirrg a
promoter and to examine promoter efficacy, see Masui et al, (21).
LO It is understood that other competerrt nricroorganism lic,sls (eucaryotic
and procaryotic) can be transforrned genetically in accordance witlr the
invention.
Bacteria which are susceptible to transf'ormation, itrclude wembers of' the
Enterobacteriaceae, such as E. coli, Salmonella; Bacillaceae, such as
subtilis,
Pneumococcus; Streptococcus; yeasts strains arrd others.
l5 Of particular interest niay be the transformation of yeast cells, such
as Saccharomyces cerevisiae with the structural gene of the invention or of
all or
part of the nucleotide sequence slrown in FIG 6. Basic tectrniques of yeast
genetics, appropriate yeast cluriing arrd expression vectors aricl
lransfornration
protocols are discussed in Currerit Protocols iri Molecular Biolc~#;y,
Sulrplement 5
20 (1989 )(23) which is specifically incorporated hereirt by reference.
Likewise, vertebrate cell cultures may be trattsforined with the
structural gene of the inverttiori or part thereof or with part or all of the
nucleotide sequerrce shown in FIG 6. Otre skilled in the art will select atr
~
& STAFIBR
r[ soo
IIiClIIIM 91 IU. PA I9107
9MiM7
- 31 -
CA 02009917 1999-09-07
appropriate cell culture such as a COS-71ine of monkey fibroblasts.
Appropriate techniques for
the transfection of DNA into eucaryotic cells are described in Current
Protocols, Section 9.
Illustrated protocols are shown to work well with such cell lines as HeLa,
BLAB/c 3T3, N1H
3T3 and rat embryo fibroblasts.
Additional vectors and sources are listed in Perbal (22) (pages 277-296)
including yeast
cloning vectors, plant vectors, viral vectors, with scientific appropriate
literature references, and
cloning vectors from commercial sources.
Numerous suitable microorganisms are available from the American Type Culture
Collection, 12301 Parklawn Drive, Rockville, MD, 20852-1776.
From the teaching of this disclosure, it will have become apparent to one
skilled in the
art that the invention contemplates nucleotide sequences which encode a
protein which has
biological properties of, or similar enough to be essentially a functional
equivalent, of the protein
of the invention. Likewise, the invention contemplates a promoter sequence
which performs
essentially the same function as that described herein. The invention thus
intends to cover and
covers the functional equivalent of the functional elements described and
taught herein.
-32-
CA 02009917 2007-12-12
... ~1;'= .. ... r.r: . - . 4 :,' ' = y ., , y.,. REFERENCES
1. Grossrnran, A. h. ; I,r=icltsor-, J . W. ; .arrc.l (;ross, C. A. (1987).
'I'he 10.10i Gene
Produce of E. coli is a Sigu-a Factor for Ileat-Slrock Promoters. Cell, 38,
383-390.
2. Straus, ll.13.; Watter, W.A.; and Crosse, C.A. (1987). '1'the Ileat Stiock
Response in E. coli is Regulated by Cliariges irr the Concentration of Q" .
Nature, 329, 348-351.
3. - Bahl, H.; Echol.s, H. ; Straus, D.I3. ; Court, ll. ;(.,ruwl, lt. ; an(i
Georgopoulos, C.D. (1987). lriductiorr of the Heat Shock Resporrse of E. coli
) Through Stabilization of o" by the Phage larnbda cIII Protein. Genes &
Dev., 1, 57-64.
4. Ng, H.; Ingraham, J. L. ; and Marr, A. G.(1962) . Damage anrl llerepression
in Escherichia coli Resulting frorn Growth at Low '1'en-peratures. J.
Bacteriol. 84, 331-339.
5. Hew, C.L.; Scott, G.K.; aird llavies, P.L. (1986). Molecular Biology of
Antifreeze. In Living irr the Cold: Physiological and Biochernical
Adaptations. H.C. Heller, ed. (Elsvier Scierice Publishing Co., lnc. N.Y.),
pp. 117-123.
6. Duman, J.; and Horwath, K. (1983). '1'}re Itole of Ilemolymph Proteins in
the
) Cold Tol.eratice of lnsects. Anr-. Rev. Physiol., 45, 261-270.
7. Nakamura, K.; Masul, Y.; and lnouye, M. (1982). Use o~ Lac Promoter-
Operator Fragment as a Transcriptional. Control Switch for the Expression
of the Corrstitutive lpp Gene in Esc}rerichia coli. J. Mol. Applied Gen., 1,
289-299.
8. Vlasuk, G.P.; Inouye, S.; ito, H. ; lt.akura, K.; and Inouye, M. (1983).
Effects of Complete Removal of Basic Amino Acid Residues i'rcn the Signal
Peptide ori Secretion of .Lipuproteitr in lisclrericlricx coli. J. L'iul.
Clreru., 258,
7141-7148.
9. Lehnhardt, S.; 1'c,llitt, S.; aricl lnc~i.ayc:, M. (1987). '1'he
Uil'fore.nLial ECfect
on Two Hybritl Proteins oF lleletion Mutations within the llyc.lr=ol,trohic
lteg.icrn
of the Escherichia coli OnipA Sigrial Peptide. ~). Biol. Clr(:nr., 262, 1716-
1719.
10. lrrouye, S. ; Soberorr, X. ; Frarrcesct-irri, '1'. ; llakura, K.; rirrd
Inouye, M.
(1982). Role of Positive Cliarge at tihe Amino Ternrinal ltegion oF the
Sigrial
Peptide for Protein Secretiori Across the Mernbrane. Proc. Nat.l. Acad. Sci.
USA. , 79; 3438-3441.
cgs
TAPLER
00
[MTM fT
.. 110!
~M1
- 33 -
CA 02009917 2007-12-12
11. Chou, P.Y.; arrd Fasrnan, G.D. (1979). Ernl.rirical Pt=edicl.icis of
Protein
Conformaticrrt. Aurr. Itev. 13ioclreur., 47, 251-276.
12. Messing, J.; Crea, R.; and Seeburg, P. H. (1981.). A Systenr for Shotgun
DNA Sequetrcing. Nucleic Acids Res., 9, 309-321.
13. Yanisch-Perron, C.; Vieria, J.; artd Messing, J. (1985). Improved M13
Phage Cloning Vectors and 1-Iost Strains: Niacleotide Sequences of the
M13111p18 anct pUC19 Vectors. Cene, 33, 103-119.
14. Kreuger, J.H.; and Walker, G.C. (1984). groEL and drraK Genes of
Escherichia coli and Induced by UV Irradiation and Nalidixic Acid in a
0 - htpR"-Dependent Fashion. Proc. Nall. Acad. Sci. USA, 81, 1499-1503.
15. O'Farrell, P.11. (1975). High Resolution Two-Dirnerisional Electrophoresis
of Proteins. J. Biol. Chem., 250, 4007-4021.
16. Feeney, R. E. ; atrd Burc}raiii, 'r . S. (1986). Antifreeze Glycoproteins
from
Polar Fish Blood. Ann. Rev. Biopltys. Chem., 15, 59-78.
5 17. Inokuchi, K. ; Furukawa, Il. ; Nalcaiirura, K. ; and Mizustrirna, S.
(1984).
Characterization by Deletion Mutagertesis in Vitro of the 1'roruoter Regiort
of
oinpf, a Positively Regulated Gene of Escherichia coli. J. Mol. Bio. , 178,
653-668.
18. DeVries, A.L. (1983). Anlifreeze Peptides and Glycopeplicies irt Cold-
Water
0 Fishes. Ann. Rev. Physiol., 45, 245-60.
19. Inouye, S.; and lnouye, M. (11187). Olil;orruc:leotide-llirected Site-
Specific
Mutagenesis using Double-Strancled Plasnud DNA. ln Synthesis and
Applications of DNA and RNA Synthesis. S.A. Nararig, ed. (Academic
Press, Inc., Orlarido), pp. 181-206.
5 20. Inouye, S.; and Inouye, M.(1985 ). Up-proruoter Mutatiorrs in the jPR
gene
of Escherichia coli. Nucleic Acids Research, Vol. 13, No. 9, pp. 3101-3110.
21. Masui, Y.; Colernan, J.; and lr~ouye, M. (1983). Experirnenlal
Marlipulation
of Gene Expression, Acacleur_y Press, ed. lnouye.
22. Perbal, B. (1988) . A Pr:-c:t ic;il CkuicJc to MOlcc.ular Clonint,=. John
Wiley airrd
0 Sons, Wiley-lrrterscience, New York, NY.
23. Ausubel, F.M. et al, eds. (1987). Current Protocols in Molecular Biology
(Current 1'rol.oculs), l;ruoklyn, NY and Wiley arrcl Sorts Irrlerscietrce, New
York, NY ( Supplemertts 1-5 ) .
Cf!
STAPLEA
.oo
[M1M 11
-. 11102
IM1
- 34 -
CA 02009917 2007-12-12
$ 7-. ... . y ;y: .
' ~k.t:.t ~ hr[~.:'v'ti. '.al:=f~
24. Broeze, It.a.; ;ioIoinort, (;..I.; -tti(i I'ow!, I).II. (.15178).
I?ITqwl:; of I,uw
'1'einperalur=e on lit Vivc., .tncl Iit Vitro l'rulein Syiitltesis in
I:t;c:het.=icaria e:oli
and Pseuaottiottas fluoresce-ts. J. Lacteriol., 134, 861-874.
25. Yang, el al (.1988). Cryslal Struct+ire of an /ltttifreeze Polyl.)cl)ti(le
atrd its
Mechanistic lniplications. Nature, Vol. 333, pp. 232-237.
26. Maniatis, T. ; Fritch, E. F. ; and Sainbrouk, J. (1982). Mctleciil;tr
Cloning.
A Laboratory Manual. Cold Spring IlarVur Labor=ator_y, Col(1 Shring 11arbUr,
NY, pp. 383-389.
27. Bio/Technology, 6, pp. 291-294, Schein, C. H. ; Noteborn, M.I1.M., 1988.
co
:TAPLER
~
ewtw si
=~ n~o~
Ma
- 35
