Note: Descriptions are shown in the official language in which they were submitted.
2 ~ 7
-2-
BAC~GROUND OF THE INVENTION
This invention relates to recombinant gene constructs, minigene
constructs, and transgenic mice for phenotypic expression of
Alzheimer-like pathology. The invention further relates to
transgenic animal models ior Alzheimer's disease. In particular,
the present in~ention provides a variety of minigene constructs which
include all or portions of the coding sequences of the amyloid
pre~ursor proteins, and which can be expressed in a cell and tissue
in a specific manner in transgenic mice carrying the minigene
constructs.
Alzheimer's disease (AD) is the most common single cause of
dementia in late life. Individuals with AD are characterized by
progressive memory impairments, loss of language and visuospatial
skills and behavior deficits (McKhann et al., 1986, Neurology 34:
939-944). The cognitive impairment of individuals with AD is the
result of degeneration of neuronal cells located in the cerebral
cortex, hippocampus, basal forebrain and other brain regions (for
reviews, see Kemper, in Clin. Neurol. Aging, M.L. Albertj ed., pp.
9-52, Oxford University Press, New York, 1984; Price, 1986, Annu.
Rev. Neurosei. 2: 489-512). Histologic analyses of AD brains
obtsined at autopsy demonstrated the presenee of neurofibrillary
tangles (NFT) in perikarya and axons of degenerating neurons,
extracellular neuritic (senile) plaques, and amyloid plaques inside
and around some blood vessels of affected brain regions (Alzheimer,
1907, Allg. Z. Psychiat. u. Psych. Gerichtl. Med. 64: 146-148).
Neurofibrillary tangles are abnormal filamentous structures
containing fibers (about lO nm in diameter) that are paired in a
helical fashion, therefore also called paired helical filaments
(Kidd, 1963, Nature 197: 192-193; Wisniewski et al., 1976, J. Neurol.
Sci. 27: 173-181; Selkoe et al., 1982, Scienee 215: 1243-124S; Brion
et al., 1985, J. Submicrosc. Cytol. 17: 89-96; Grundke-Iqbal et al.,
1986, J. Biol. Chem. 261: 6084-6089; Wood et al., 1986, Proe. Natl.
Acad. Sci. USA 83: 4040-4043; Kosik et al., 1986, Proc. Natl. Acad.
Sei. USA 83: 4044-4048; Goedert et al., 1988, Proe. Natl. Acad. Sci.
USA 85: 4051-4055; Wischik et al., 1988a, Proc. Natl. Aead. Sci. USA
,
`` 2 ~ 7 ~
-3-
85: 4884-4888; Wischik et al., 1988b, Proc. Natl. Acad. Sci. USA 85:
4506-4510). Neuritic plaques axe located at degenerating nerve
terminals (both axonal and dendritie), and contain a eore eomposed
of amyloid protein fibers (Masters et al., 1985a, EMBO J. _: 2757-
2763; Masters et al., 1985b, Proe. Natl. Aead. ~ei. USA 82: 4245-
4249). Cerebrovaseular amyloid protein material is found in blood
vessels in the meninges and the eerebral eortex (Glenner and Wong,
1984a, Biochem. Biophys. Res. Commun. 120: 885-890; Glenner and Wong,
1984b, Biochem. Biophys. Res. Commun. 122: 1131-1135; Wong et al.,
1985, Proe. Natl. Acad. Sci. USA 82: 8729-8732).
During the past se~eral years, primary pathological markers
associated with AD have been characterized. The biochemieal analyses
of three forms of Alzheimer brain lesions (for reviews, see Kemper,
supra; Wurtman, 1985, Sci. Amer. 252: 62-74; Katzman, 1986, N. Engl.
J. Med. 314: 964-973; Priee, 1986, supra; Selkoe, 1989, Ann. Rev.
Neurosei. 12: 463-490; Muller-Hill and Beyreuther, 1989, Ann. Rev.
Bioehem. 58: 287-307), tangles, neuritie plaques, and eerebrovaseular
plaques, has revealed protein sequence information, and has
facilitated subsequent cDNA eloning and chromosomal mapping of some
of the corresponding genes. Immunological studies have identlfied
several eandidates for protein eonstituents of the paired helieal
filaments (PHF), including mierotubule-associated protein 2 (MAP-
2), tau, ubiquitin and the amyloid protein (A4). Degenerating nerve
eells express speeifie antigens sueh as A68, a 68 kDa protein. This
abnormal antigen is deteetable with the monoclonal antibody ALZ-50
(Wolozin et al., 1986, Seienee 232: 648-650; Wolozin et al., 1987,
Ann. Neurol. 22: 521-526; Wolozin et al., 1988, Proe. Natl. Acad.
Sei. USA 85: 6202-6206).
A eentral feature of the pathology of AD is the deposition of
amyloid protein within plaques. The 4 kDa amyloid protein (also
referred to as A4 (APC, ~-amyloid or BAP) ~s a truneated form of the
larger amyloid preeursor protein (APP) which is encoded by a gene
loealized on chromosome 21 (Goldgaber et al., 1987, Seienee 235:
877~880; Rang et al., 1987, Nature 325: 733-736; Jenkins et al.,
1988, Bioehem. Biophys. Res. Commun. 151: 1-8; Tanzi et al., 1987,
Science 235: 880-885). Genetie linkage analysis, using DNA probes
.
'~ :
' ' ' ' ~:
,
-4-
that detect restriction fragment-length polymorphisms (RFLPs,
Botstein et al., 1980, Am. J. Hum. Genet. 32: 314-331), has resulted
in the localization of a candidate gene (FAD, familial AD) on human
chromosome 21 in families with high frequencies of AD (St. George-
5 Hyslop et al., 1987a, Science 235: 885-890). However, the FAD locus
has not been localized precisely, ant very little is known about its
function. Initial studies of individuals with Down syndrome (DS),
caused by trisomy of part or all of chromosome 21, indicate that
these individuals develop Alzheimer-like pathology beyond the second
decade of life. However, analysis of multiple Alzheimer pedigrees
revealed that the APP gene does not segregate with familial AD (Van
Broeckhoven et al., 1987, Nature ~: 153-155; Tanzi et al., 1987,
Nature 329: 156-157). Furthermore, two recent studies with new
families demonstrated the absence of a linkage of chromosome 21
15 markers to familial AD (Schellenberg et al., 1988, Science 241: 1507-
1510; Roses et al., 1988, Neurology 38: 173).
Age, genetic elements, and possibly environDental factors
appear to contribute to cellular pathology of AD. A fundamental but
unanswered question in the pathogenesis of AD is the relationship
between abnor~alities of neurons and the deposition of amyloid.
Specifically, the cellular origin of pathological events leading to
the deposition of amyloid fibrils ad~acent to some areas of the
blood-brain barrier (cerebrovascular amyloid) and in the proximity
of nerve terminals (neuritic plaques) in specific brain regions as
well as extracellular amyloid in plaque cores is not known. Glenner
and Wong have described the purification and characterization of
meningeal amyloid from both brains of individuals with AD (Glenner
and Wong, 1984a, supra) or DS (Glenner and Wong, 1984b, su~ra) and
determined the N-terminal peptide sequences. Among 24 residues
analyzed, the two amyloid peptides showed only one difference,
namely, at amino acid position 11 (glutamine in AD amyloid versus
glutamic acid in DS amyloid) among 24 residues analyzed. Subsequent
studies of amyloid from Alzheimer brain plaque cores revealed amino
acid sequences identical to the reported DS cerebrovascular amyloid
35 data (Masters et al. 1985b, Proc. Natl. Acad. Sci. USA 82: 4245-
4249). Copy-DNA analysis of APP tran~cripts from both normal tis8ue
~' ' ' .
-s-
and Alzheimer brain material demonstrated the presence of the codon
for glutamic acid at this position (Kang et al., 1987, supra;
Goldgaber et al., 1987, supra; Robakis et al., 1987, Lancet: 384-
385; Tanzi et al., 1987, Science ~ 880-884; Zain et al., 1988,
5 Proc. Natl. Acad. Sci. USA 85: 929-933; Vitek et al., 1988, Mol.
Brain Res. _: 121-131).
The availability of protein sequence information from the
amyloid protein in Alzheimer brains enabled the design of synthetic
oligonucleotides complementary to the putative messenger RNA
transcripts. Four groups independently reported successful cloning
of cDNAs including the region of the amyloid protein sequence
(Goldgaber et al., 1987, su ra; Kang et al., 1987, su~ra; Robakis et
al., supra; Tanzi et al., 1987, supra). One gro~p (Kang et al.)
cloned the apparent full-length transcript (approximately 3.4 kb)
for APP from a human fetal brain cDNA library. The 695-residue
amyloid precursor protein (APP-695) shows typical features of a
glycosylated cell-surface transmembrane protein. The C-terminal 12
to 14 residues of the A4 protein reside in the putative transmembrane
domain of the precursor and 28 N-terminal residues are in the
"extracellular domain" (Dyrks et al., 1988, EMBO J. 7: 949-957).
Genomic mapping localized the APP gene on human chromosome 21 using
human/rodent somatic cell hybrids (Goldgaber et al., 1987, suDra;
Kang et al., 1987, suora; Tanzi et al., 1987, su~ra). Applying in
situ hybridization techniques, this gene was sublocalized to
chromosome 21q21 (Robakis et al., supra) and more recently at the
border of 21q21-22 (Blanquet et al., 1987, Ann. Genet. 30: 68-69;
Patterson et al., 1988, Proc. Natl. Acad. Sci. USA 85: 8266-8270~.
Chromosome 21 has been the subject of intensive studies because
of its involvement in DS (trisomy 21). While 95% of individuals with
DS are trisomic for the entire chromosome 21, 2-3~ are mosaics, i.e.,
trisomic in only some cells, and 3-4~ are caused by triplication
(translocation) of the distal part of the long arm (21q22) of
chromosome 21 (Crome and Stern, 1972, Patholoey of Mental
Retardation, Churchill Livingstone, Edinburgh). The occurrence of
such translocations has led to the conclusion that DS can be
attributed to trisomy of the distal part (the "pathological region~)
,
2 ~
-6-
of chromosome 21 (Summitt, 1981, in TrisomY 21 (Down Syndrome~:
Research Prospectives, de la Cruz and Gerald, eds., pp. 225-235,
University Park Press, Baltimore). To date, it is not known
precisely where the breakpoint on the q arm of chromosome 21 is
located, and it is not known whether individuals with DS, who have
partial trisomy, develop Alzheimer pathology. In this context, it
will be of particular interest to determine if the APP gene maps
within the ~pathological region" of chromosome 21. The localization
of the APP gene on the long arm of chromosome 21, together with the
apparent development of AD pathology in individuals with DS, provides
a potential mechanism for the formation of amyloid on the basis of
over-expression of a number of genes on chromosome 21, including the
APP gene and the FAD gene locus. Initial studies of genomic DNA from
sporadic (non-familial) AD cases and "karyotypically normal"
individuals with DS have implicated the presence of microduplication
of a segment of chromosome 21 including the APP gene (Delabar et al.,
1987, Science 235: 1390-1392; Schweber et al., 1987, Neurology 37:
222). However, subsequent analyses of large numbers of individuals
with AD by several laboratories has not confirmed these findings
20 (Tanzi et al., 1987c, Science ~: 666-669; St. George-Hyslop et al.,
1987b, Science 2~: 664-666; Podlisny et al., 1987, Science 238: 669-
671; Warren et al., 1987, Genomics 1: 307-312).
Chromosomal mapping experiments, using human APP probes in
human/rodent cell hybrids, have shown cross-hybridization with mouse
and hamster genomic DNA (Kang et al., 1987, su~ra; Tanzi et al.,
1987a, supra; Goldgaber et al., 1987, su~ra). Southern-blot analysis
of DNA from various species has indicated that the APP gene is highly
conserved during evolution. Comparison of the mouse APP sequence
(Yamada et al., 1987, Biochem. Biophys. Res. Commun. 158: 906-912)
30 with the sequence from rat (Shivers et al., 1988, EMB0 J. 7: 1365-
1370) shows 99% homology on the protein level; furthermore, the human
sequence is 96.8% homologous to the mouse sequence and 97.3%
homologous to the rat sequence. Based on the striking conservation
of APP proteins, Yamada et al., ~yp~_, have calculated the
evolutionary rate of changes at the amino acid level to be 0.1 x 10-
9/site/year, which is comparable to that of cytochrome C, and
2 ~ 4 ~
suggests an essential bLological function for APP proteins.
Recently, K. White and colleagues have cloned a Drosophila gene (vnd
locus) which is highly homologous to large regions of the APP
sequence. Northern-blot experiments have confirmed these data at
the level of mRNA and have demonstrated for various m = alian species
the ubiquitous expression of APP transcripts in a number of different
tissues (Manning et al., 1988, Brain Res. 427: 293-297).
Kang et al., supra, reported the presence of two distinct bands
(-3.2 kb and -3.4 kb) by Northern-blot analysis of human fetal brain
mRNA using APP cDNA as a probe. This finding suggests either
differential splicing of mRNA or alternative usage of polyadenylation
sites. Both post-transcriptional events were found to be operative
following detailed investigation by several groups. First, Kang et
al., supra, indicated a potential polyadenylation signal (AATAAA
tandem repeat) 259 bp upstream of the 3'-end of the reported APP
full-length cDNA. The analysis of eight other full-length APP cDNA
clones obtained from a human fetal brain cDNA library (Unterbeck,
1986, Dissertation, University Cologne, FRG) demonstrated in a 1:1
ratio between shorter cDNAs (-3.2 kb) using the first polyadenylation
signal versus the original cDNA forms (~3.4 kb) using the second
polyadenylation signal. Interestingly, all eight clones encoded for
695 residues of APP. The alternative use of different
polyadenylation signals in APP transcripts was confirmed by other
laboratories (Goldgaber, 1988, in The Molecular Biologv of
Alzheimer's Disease, Finch and Davis, eds., pp. 66-70, Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York; Jahnson et al.,
1988, Exp. Neurol. lQ~: 264-268). A number of groups have screened
several tumour cell-line derived cDNA libraries for the presence of
APP transcripts and identified clones encoding new APP molecules
containing an additional domain. This domain possesses striking
homology to the Kunitz family of serine protease inhibitors (Tanzi
et al., 1988, Nature 351: 528-530; Ponte et al., 1988, Nature 331:
525-527; Kitaguchi et al., 1988, Nature 331: 530-532). In particular
these cDNA sequences contain an additional 167 bp insert at residue
35 289 of the APP-695 precursor (Figure 1) which encodes a 56 amino acid
sequence of high sequence of homolo~y to aprotinin (Laskowski and
'
2 ~
-8-
Kato, 1980, Ann. Rev. Biochem. 49: 593-626), a well-characterized
inhibitor of "trypsin-like" serine proteases. The peptide sequences
flanking this region of insert are identical to the original APP-
695 clone, resulting in an open readin8 fræme of 751 residues (APP-
751). Kitaguchi et al., supra, isolated a third APP form withanother addition of a 19 amino acid domain at the C-terminal end of
the 56 amino acid "aprotinin-like" region of APP-751, thus resulting
in a larger protein of 770 residues (APP-770). Transient expression
of APP-770 in COS-l cells conferred a marked inhibition of trypsin
activity in cell lysates (Kitaguchi et al., supra). Both additional
domains have been found to be encoded by discrete exons (Kitaguchi
et al., su~ra) and all three transcripts (APP-695, APP-751, APP-
770) are generated by differential splicing of a single gene on
chromosome 21. These protease inhibitor domains have also recently
been found to be present in mouse (Yamada et al., 1989, Biochem.
Biophys. Res. Co~un. 158: 906-912) and rat (Kang and Muller-Hill,
1989, Nucleic Acids Res. 17: 2130) species.
The relationship between the three different amyloid precursor
forms and the formation of amyloid in AD is not known. In
particular, it is not known whether a specific form of APP
contributes to A4 deposition. It is possible that either an
imbalance in the relative expression levels of the three APP forms
or their over-express~on might be involved in AD pathology. Initial
i~ situ hybridization analyses using APP cDNA probes in human CNS
sections indicated that many neuronal cell types express these mRNAs
(Bahmanyar et al., 1987, Science 237: 77-79; Goedert, 1987, EMBO J.
6: 3627-3632; Cohen et al., 1988, Proc. Natl. Acad. Sci. USA 85:
1227-1231; Higgins et al., 1988, Proc. Natl. Acad. Sci. USA 85: 1297-
1301; Lewis et al., 1988, Proc. Natl. Acad. Sci. USA 85: 1691-1695;
30 Schmechel et al., 1988, Alzheimer Dis. Assoc. Disord. (US) 2: 96-
111), but because of the nature of the probes used, these studies
did not allow a differential analysis of the various APP transcripts.
Furthermore, there is little documented correlation between APP mRNA
levels, amyloid deposition and neuronal degeneration in AD. However,
it appears that high levels of APP mRNAs alone do not form a
sufficient prerequisite for cellular pathology in either the aging
~, . .. .. . .
,
.
or AD brain (Higgins et al., supra). Spscific probes which
discriminate between thP APP transcripts have been used for Northern
analysis and the results suggest a developmental and tissue-specific
pattern of expression of these mRNAs (Tanzi et al., 1988, ~E~;
Kitaguchi et al., 1988, supra; Neve et al., 1988, Neuron 1: 669-
677).
Recently, S'-end cDNA probes from full-length APP cDNA clones
(Kang et al., 1987, suDra), have been used to isolate genomic clones
containing the 5'-end of the APP gene, also referred to as precursor
of Alzheimer's Disease A4 amyloid protein (PAD) gene (Salbaum et
al., 1988, ENBO J. 7: 2807-2813; La Fauci et al., 1989, Biochem.
Biophys. Res. Commun. 159: 297-304). Approximately 3.7 kb of
sequences upstream of the strongest RNA start site have been analyzed
by Salbaum et al., 1988, supra. By a combination of primer extension
and Sl protection analyses, five putative transcription initiation
sites have been determined within a 10 bp region. This ~3.7 kb
region lacks a typical TATA box and displays a 72~ GC-rich content
in a region (-1 to -400) that confers promoter activity to a reporter
gene in an ~B vivo assay system (Salbaum et al., 1988, supra). The
absence of a typical TATA and CMT box and the presence of multiple
RNA start sites Is suggestive of its function as a housekeeping gene
but does not imply constitutive gene expression (Salbaum et al.,
1988, supra). The regulatory region contained within 400 bp upstream
of the strongest RNA start site shows a variety of typical promoter-
binding elements, including: two AP-l consensus sites (Lee et al.,
1987, Nature 325: 368-372), a single heat shock recognition consensus
element (Wu et al., 1987, Science 238: 1247-1253), and several copies
of a 9 bp-long GC-rich consensus sequence where sequence-specific
binding has been shown to occur by gel-retardation studies (Salbaum
et al., 1988, suDra). In addition, the CpG:GpC ratio in this
promoter region has been found to be 1:1 in contrast to a 1:5 ratio
found in many eucaryotic DNAs (Razin and Riggs, 1980, Science 210:
604-610); CpG dinucleotides are known to control gene expression via
DNA methylation (Doerfler, 1983, Annu. Rev. Biochem. 52: 93-124).
In addition, palindromic sequences capable of forming hairpin-like
~ ~3 ~ r~
-10-
structures are found around the RNA start sites ~La Fauci et al.,
1989, supra).
Recently, several groups of investigators have determined the
consensus binding sequence (AT rich decamer) for a number of
5 different homeobox proteins (Desplan et al., 1988, Cell 54: 1081-
1090; Hoey and Levine, 1988, Nature ~: 858-861; Ko et al., 1988,
Cell 55: 135-144; Odenwald et al., 1989, Genes Dev. 1: 482-496),
which act most likely as transcription factors in specific regions
during embryogenesis (for review, see Gehring, 1987, Science 236:
1245-1252; Holland and Hogan, 1988, Genes Dev. 2: 773-782). As yet,
target genes, which might be developmentally regulated by the
homeobox proteins have not been identified. Such genes, however,
will have an important role during embryogenesis and potentially
throughout the entire life span. The APP gene promoter contains at
least five homeobox binding sites upstream of the RNA start sites.
Preliminary experiments have shown that the homeobox protein Hox-
1.3 (Odenwald et al., 1987, Genes Dev. l: 482-496; Odenwald et al.,
1989, Genes Dev. 3: 158-172) can bind at two of these sites. Thus,
the APP gene, whose expression is developmentally regulated, appears
to be a candidate gene for homeobox protein regulation. It is not
known whether any of these putative recognition consensus elements
modulate the expression of the APP gene promoter.
Despite all that is known about the APP gene, the primary
defect leading to AD is not yet known, and specific mutations in the
APP gene or other genes which cause AD in humans have not been
defined. Uith the exception of aged primates (Price et al., 1989,
BioEssays 10: 69-74), no laboratory animal model for AD exists. The
introduction of genes into the germline of animals is an extremely
powerful technique for the generation of disease models which will
lead to a better understanding of disease mechanisms (Cuthbertson
and Klintworth, 1988, Laboratory Investigation 58: 484-501; Jaenisch,
1988, Science 240: 1468-1474; Rosenfeld et al., 1988, Ann. Rev.
Neurosci 11: 353-372), including the mechanisms of AD. Cell culture
and in vitro systems cannot duplicate the complex physiological
interactions inherent in animal systems. Transgenic animals have
been successfully generated from a number of species including mice,
2 ~ 7 ~
-11-
sheep, and pigs (Church, 1987, Trends in Biotech. 5: 13-19; Clark et
al., 1987, Trends in Biotech. 5: 20-24). The gene or genes of
interest are microinjected directly into the pronuclei of a one-
cell embryo. A high percentage of reimplanted embryos develop
S normally and, in a significant proportion of progeny, the transgene
becomes integrated into the chromosonal DNA. Usually, multiple
copies of the transgene i~ltegrate as a head-to-tail array. Although
mosaic animals can be generated, germline transmission of the
transgene usually occurs (Hogan et al., 1986, in Manipulating the
Mouse Embryo: A Laboratorv Manual, Cold Spring Harbor Laboratory,
Cold Spring Harbor, New York; DePamphilis et al., 1988, BioTechniques
6: 662-680). The generation of a transgenic mouse would be useful
in defining the role of APP in the pathology of AD. For example,
mice carrying APP transgenes which have been altered in either their
protein-coding sequences or in their expression levels, might display
dominant mutant phenotypes resembling those displayed in AD
pathology. The construction of recombinant genes and minigenes for
expression in transgenic mice is a critical step in the development
of transgenic mouse models. Particularly critical is the choice of
an appropriate gene promoter for the minigene and other regulatory
elements for the cell and tissue speciiic expression of the minigene.
A gene promoter must be utilized which will facilitate the expression
of recombinant genes with a cell and tissue specificity consistent
with the formation of amyloid plaque and perhaps with the expression
pattern of the endogenous mouse APP gene.
To date, the identification of essential regulatory elements
for many genes has not been straightforward and is, at best,
unpredictable. A number of critical factors contribute to the
complexity of this problem. Firstly, gene promoters that exext cell
specific regulation in DNA transfection experiments do not
necessarily confer cell and tissue specificity in transgenic animals.
For example, transfection experiments have revealed that important
cell specific regulatory elements reside within 400 bp upstream of
the cap site of the rat albumin gene (Ott et al., 1984, EMB0 J. 3:
2505-2510; Friedman et al., 1986, Mol. Cell Biol. 6: 3791-3797).
However, an additional enhancer, located 10 kb upstream from the
-12- ~ 7~
albumin promoter, was found to be necessary to obtain liver-specific
expression in transgenic mice (Pinkert et al., 1987, Genes Dev. 1:
268-276). While promoter sequences of the ~-fetoprotein gene confer
cell specificity in cell culture (Godbout et al., 1986, Mol. Cell
Biol. 6: 477-487; Muglia and Rothman-Denes, 1986, Proc. Natl. Acad.
Sci. USA 83: 7653-7657; Widen and Papaconstantinou, 1986, Proc. Natl.
Acad. Sci. USA 83: 8196-8200), additional enhancer elements located
between -1 kb and -7 kb, were found to be necessary for liver
specific expression in transgenic animals (Hammer et al., 1987,
Science 235: 53-58~. Sscondly, the organization of various genes
differs considerably and essential regulatory elements have been
found in numerous positions. In some cases, the necessary regulatory
elements are located within a compact region proximal to the cap
site. For example, sequences residing within nucleotide -205 to
nucleotide +8 of the rat elastase I gene are sufficient to confer an
appropriate expression pattern in transgenic mice (MacDonald et al.,
1987, Progress in Brain Research 71: 3-12). A tightly defined
regulatory region has also been identified in the human ~-crystallin
gene (Goring et al., 1987, Science 235: 456-458). The human ~-
globin gene, however, has at least four separate regulatory elements:
a positive globin specific promoter element, a negative regulatory
element, and two gene enhancers, one located within the second intron
and the other located 3' of the structural gene (Behringer et al.,
1987, Proc. Natl. Acad. Sci. USA 84: 7056-7060; Grosveld et al.,
1987, Cell 51: 975-985). Thirdly, in many cases, the site of
integration exerts a strong influence on the level and pattern of
expression of transgenes. Regions of several genes have been
identified which overcome, at least in part, these position effects.
DNase I hypersensitive sites located approximately 50 kb 5' to and
20 kb 3' of the ~-globin gene facilitate position-independent, high-
level expression of a ~-globin minigene in transgenic mice (Grosveld
et al., 1987, ~D~)- Furthermore, introns of the rat growth hormone
and mouse metallothionein genes increase transcriptional efficiency
of transgenes on average 10- to 100-fold (Brinster et al., 1988,
Proc. Natl. Acad. Sci. USA 85: 836-840). Rat growth hormone lntronic
sequences exerted a positive effect even on heterologous gene
,
`
-13- ~ 7 ~
constructions utilizing either the mstallothionein or elastase
promoters. The effect of these introns is not related to an
increased efficiency of RNA processing but is due to an actual
increase in the rate of transcription (Brinster et al., 1988, supra).
It is also possible that introns and other genomic regions contain
sequence elements which are recognized at particular stages of
development or may contain elements which influence chromatin
structure. In many cases, the inclusion of genomic elements which
diminish position effect~ ~ay be essential for a transgene to
maintain an expression level sufficient to generate a phenotype.
The identification of these elements may in some cases be a
formidable task; for example, the APP gene locus encompasses at least
50 kb (Lemaire et al., 1989, Nucleic Acids Res. 17: 517-522). The
identification of such elements would be extremely useful in the
construction of recombinant APP minigenes. These minigenes can then
be introduced into the germline of transgenic mice, thus providing
animal models for AD.
. . ~ ., ~ . . .
-14- 2 ~
SUMNARY OF T~E INVENTION
The present invention provides recombinant minigenes for the
expression of alternative forms of APP, including APP-695, APP-751,
APP-770, and a variety of mutant forms of APP. The present invention
also provides for the introduction of such functional APP minigene
constructs into the germline of mice thereby generating transgenic
animal models of AD useful $n the identification of the molecular
mechanisms of AD pathogenesis. The recombinant minigenes according
to the present invention contain essentially five different elements:
(1) gene promoter (DNA elements responsible for gene regulation), (2)
and (3) APP protein coding region (cDNA or mutated cDNA), (4) mRNA
polyadenylation signals, (5) RNA splicing signals and genomic
elements required for developmentally appropriate and cell~tissue-
specific expression of the APP-encoding DNA. The identification of
such genomic elements is highly unpredictable. The ].ocation of these
sequence elements varies from gene to gene and may be found in the
5' regions, within introns, in 3' regions, or in other locations.
It has now been unexpectedly found that an -4.6 kb EcoRI human
genomic fragment (or portions thereof), comprising ~2.8 kb 5' to the
APP in RNA start site, the first exon of the APP gene and -1.6 kb of
the first intron, is sufficient to direct cell and tissue-specific
expression of a reporter gane in transgenic mice, and in a manner
consistent with the expression pattern of the endogenous mouse APP
gene. This genomic fragment contains a promoter and perhaps other
regulatory elements that facilitate the expression of recombinant
APP minigenes with a cell and tissue specificity consistent with the
formation of amyloid plaque and the expression patterns of the APP
gene. Since the primary defect leading to AD has not yet been
determined, and specific mutations which cause AD in humans have not
been identified, transgenic mice with recombinant APP minigenes
according to the present invention provide animal models for the
disease. For example, the generation of transgenic animal models
for A4 amyloidosis is essential for defining the role of A4 in the
pathogenesis of AD. Transgenic mice, according to the present
invention, carrying APP genes altered in their protein-coding
sequences or in their expression levels, provide models for
', ' ~
-15- 2 ~
exhibition of dominant mutant phenotypes resembling some aspects of
AD pathology. As Alzheimer's pathology is restricted to specific
regions of the brain, only those minigene constructs with the
appropriate cell and tissue-specific genomic regulatory elements,
such as those provided by the present invention, will enable for the
development of transgenic mouse models of AD.
8RIFF DE~CRI~TION 0~ 5H~ ~RAWINGS
Figure 1 is the cDNA sequence of the amyloid precursor protein
(APP) cloned in pFC4.
Figure 2 is a circular map of pFC4.
Figure 3 is an illustration of the 5'-end of the APP gene.
Figure 4a is an illustration of gene products of nonmutated
forms of APP encoded in APP minigenes.
Figure 4b is an illustration of gene products of mutated forms
of APP encoded in APP minigenes.
Figure 5 is an illustration of the construction intermediates
and products: pMTI-2302, pMTI-2303, pMTI-2305 and pMTI-2304.
Figure 6a is an illustration of polylinkers in cloning vectors:
pWB16, pMTI-2110, pMTI-2300 and pMTI-2301.
Figure 6b is a circular map of pMTI-2301.
Figure 7a i9 an illustration of construction intermediates
pNTI-2306, pMTI-2307, pMTI-2311 and pMTI-2312 and minigene pMTI-
2314.
Figure 7b is a circular map of pMTI-2307.
Figure 7c is a circular map of pMTI-2312.
Figure 8a is an illustration of minigene constructs pMTI-2310,
pMTI-2314, pMTI-2319, pMTI-21320, pMTI-2321, pMTI-2322, and pMTI-
2325, encoding alternate forms of APP.
Figure 8b is a circular map of pMTI-2314.
Figure 9 is an illustration of construction intermediates pMTI-
2307, pMTI-2316, and pMTI-2317 and minigene pMTI-2318.
Figure lOa i9 an illustration of construction intermediates
pMTI-2312 and mouse metallothionein-I genomic sequences and minigenes
pMTI-2323, pMTI-2331, pMTI-2332, pMTI-2324, and pMTI-2326.
Figure lOb is a circular map of pMTI-2323.
, . ,
2 ~ 7 7
-16-
Figure lla is an illustration of construction intermediate
pMTI-2323 and minigenes pMTI-2327 and pMTI-2337.
Figure llb is a circular map of pMTI-2337.
Figure 12 shows the DNA/amino acid sequence of 5p - spacer A4
and MC-100.
Figure 13 shows the DNA/amino acid sequence of sp-spacer A4
and SP-A4.
Figure 14 is an illustration of construction intermediate pMTI-
2328, a pFC4 fragment, and minigenes pMTI-2329, pNTI-2333, pMTI-
10 2334, pMTI-2335 and pMTI-2336.
Figure 15a is an illustration of APP 3'-end genomic clone pSVl
and minigene pMTI-2339.
Figure 15b is a circular map of pMTI-2339.
Figure 16 is the DNA sequence of the 3'-end of the APP gene.
Figure 17 is a circular map of pNotSV2neo.
Figure 18a is an illustration of pNotSV2neo subclones for
minigenes pMTI-2360, pMTI-2361, pMTI-2362, pMTI-2363, pMTI-2364,
pMTI-2365, pMTI-2366, pMTI-2367, pMTI-2368, and pNTI-2369.
Figure 18b is a circular map of pMTI-2360.
Figure 19 is an illustration of pNotSV2neo and minigenes pMTI-
2339, pMTI-2369, pMTI-2342, pMTI-2343 and pMTI-2344.
Figure 20 is an illustration of the APP-lacZ reporter gene
pMTI-2402.
Figure 21(a-d) illustrates the cellular distribution of APP
mRNA in normal mouse detected by in situ hybridization with labeled
single-stranded human APP DNA probe. (a) Section of mouse cerebral
cortex. (b) Section of mouse cerebellar cortex. (c) Section of
mouse trigeminal ganglia. (d) Section of mouse liver.
Figure 22 illustrates the histochemical staining pattern of E.
coli ~-galactosidase activity in brain section of a BE803 transgenic
mouse.
Figures 23(a-d) illustrates the histochemical staining pattern
of E. coli ~-galactosidase activity in serial brain sections of a
BE803 transgenic mouse (a, b and c) and in a section of a normal
mouse brain (d).
.
.~ ' .
.
'
2 ~
-17-
Figure 24(a-d) illustrates the histochemical staining pattern
of E. coli ~-galactosidase activity in sections of cerebellar cortex
(a and b), trigeminal ganglion (c), and liver (d) from transgenic
BE803 mouse.
5Figures 25(a-d) illustrates the cellular and subcellular
distribution of E. coli ~-galactosidase in transgenic BE803 mouse
brain. Light microscopic image of histochemical staining pattern of
E. coli ~-galactosidase activity in cerebral co 'a). Normarksi
optic image of histochemical staining pattern of E. coli ~-
galactosidase activity in cerebral cortex (b and c). Immunogold
localization of E. coli ~-galactosidase in cerebral cortex section
from a BE803 transgenic mouse.
Figure 26 shows an Sl analysis of human APP RNA expression in
the brain of a series of transgenic mice.
15Figure 27 shows an Sl analysis of human APP RNA expression in
the brain of a second series of transgenic mice.
Figure 28a is a Western-blot of APP-695, APP-751 and APP-770
protein expression in the brain of a normal mouse and transgenic
mice carrying human APP minigenes using monoclonal antibody (mAb)
22C-II.
Figure 28b is a Western-blot of human APP-751 protein
expression in the brain of a normal mouse and transgenic mice
carrying human APP minigenes using mAb 56-1.
Figure 29 is a ~estern-blot (using mAb 22C-ll) of APP-695,
25APP-751 and APP-770 protein expression in COS cells transfected with
human APP minigenes.
Figure 30a illustrates circular maps of pMTI-4 and pMTI-38.
Figure 30b illuqtrates circular maps of KS Bluescript, pMTI-
41, pMTI-43 & 44 and pMTI-42.
30Figure 31 is an illustration of construction intermediates and
products pMTI-52 to pMTI-53, pMTI-57 and pMTI-58.
Figure 32 illustrates reactivities of Kunitz monoclonal
antibodies ~56-1, 56-2, 56-3) with APP proteins.
Figure 33 illustrates the primate specificity of monoclonal
antibody 56-1.
.19~
Fl~sr~ 34 ~how~ the i~rDunbcytoch~mlcal ~Snin6 o~ a ~r-in
tl~3ub 8~tlon ~ro~ transgenic ~ou~o AE301~207 ~ Airlg r~bblt
polyclonAl An~ y pAb 90-29.
~ leuro 3S ~hows the ~munocytoch~m~c~ a~nln3 of ~ br~-n
t~ u~ ~ctlon from tran6go"~4 30uso A~;301+207~5'1) u~in~ rabbSt
polyolona~ ~nt~body pAb 90-29 (hl~hsr ~gnL~lcatlon o~ ~mil~ ld
t~ r~ed in F~e~r~ 34)
6 ~bo~r- thc i~ mocy~cochemic~l ~ta~ng o~ a brc~n
tlJ4t~ ~ect~on ~rom trl~nsg~c ~ou~o AE301+207~Fl) s~tng ~bblt
po~yclonnl anelbod.y pAb 90-28 ~aE5nlf~catlon ~imllct to th~
d~crlbct ~n ~Ieure 35).
Figure 37 ~how~ thR lm~unocyto~h~mlcal staln~ng o~ ~ braln
ti~uc ~actlon ~ro~ tranYg~nIc D10U5- F~8~31~l05~1) u~ g s~
pDlyclonal ~ntlbody pAb 93-29 ~m~gni~lcatlon ~mll~r to th~t
1~ descrlb~t ln ~gur~ 35~.
Flgurc 3~a 1~ ~n olRctron ~l~rogr~ph of ~ ~h~n oactio~ o~ ~r~ln
t~eou- ~ro~ tho h~ppocampal regton of trsn~gflnl~ ~ou4a A~301~201(F2~.
F~tur- 3Bb i~ ~n clcc~ro~ ~lc~ogrJph of ~ ~h~n D~otlon o~ braln
tl~su~ ~rom th~ hlppocampal regto~ o~ t~an~g~nlc mous- ~E301~201(F2)
(t~ nt ~eld eb~n doscribed ~n Flgure 38a).
Figurc 39 ~ ~n alectron ml¢ro~r~ph of l~muno6old ~talnlnt o~
ultr~thln cryosectlon~ of braln tIuu~ ~roD~ h~o¢amp~Ll r~g1on
of ~ran~g~ntc ~OUBO ~E3al+201(F2~ w lng rabblt poly41Ona1 ant~body
~pA~) 90-29.
F~yure 40 ~ ~ c~rcular ~sp of p~TI-70.
~Ur~ B a c~rcul~r ~ap of p~T-2371.
FiB~Y~ 42 I~ ~ ~e~tonn-blot, u~n~ pAb SG369, of MC-laO p~4~n
oxpro~u~on ~n ~S-70 tr~n~focto~ oell lin~ ch~70-31, cMT170~a2,
ant cMTI70-~3, nd cQll llne~ cMT152-A~, cHT~66-B6, c~SS66-CS,
30 c~TI69~C6, ~MTI69-A4, ~nt oM~69-A5 wh~ch ~r~ Includ~d c~ n-~Ativc
¢on~role .
. .
2 ~
Figure 43 is a Western-blot, using pAb SG369, of MC-100 protein
expression induced with cadmium in transfected cell lines cMTI70-
A2, cMTI70-A3, cMTI70-A6, cMTI70-Bl, cMTI70-B2, and cMTI70-B3
(transfected with pMTI-70). Cell lines cMTI63-Bl, cMTI63-C2, and
cMTI53-Al are included as negative controls.
Figure 44a shows the immunofluorescence, using pAb SG369, of
MC-100 protein expression in transfected cell line cMTI70-A6.
Figure 44b shows the immunofluorescence, using pAb SG369, of
MC-100 protein expression in transfected cell line cMTI70-A6 (higher
magnification, different field than described in Figure 44a).
Figure 44c shows the immunofluorescence, using pAb SG369, of
control transfected cell line pMTI53-Al (same magnification as
described in Figure 44a).
Figure 45 is a Western-blot of immunoprecipitated (using pAb
SG369) MC-100 protein from cadmium-induced, pMTI-70 transfected cell
line cMTI70-A6.
Figure 46 demonstrates human APP RNA expression, using
riboprobe analysis, in the brain of a series of transgenic mice.
' :
:
-20- ~ 3~ a~ ~
DESCRIPTION OF THE PREFERRED EMBODIMENT
AD (Alzheimer, 1907, su~ra) is characterized by a widespread
functional disturbance of the human brain. Fibrillar amyloid
proteins are deposited inside neurons as neurofibrillary tangles
(Katzman, 1983, supra) and extracellularly both as amyloid plaque
cores (Katzman, 1983, su~ra) and as cerebrovascular amyloid,
(Katzman, 1983, supra). The major protein subunit (A4) of the
amyloid fibril of plaques, blood vessel deposits, and potentially of
tangles is an insoluble, highly aggregating 4~-42 residue peptide of
relative molecular mass 4,500 (Masters et al., 1985, suDra and 1985,
su~ra; and Glenner and Wong, 1984, supra). The A4 peptide which
derives from a larger amyloid precursor protein is encoded by a gene
on chromosome 21 (Kang et al., 1987, su~ra; Goldgaber et al., 1987,
su~ra; Tanzi et al., 1987, su~ra). APP mRNAs are detected in neurons
and in other tissues both within and outside the brain (Goedert,
1987, su~ra; Cohen et al., 1988, supra; Higgins et al., 1988, ~a~3).
Age, genetic elements, and, potentially, environmental factors
appear to contribute to cellular pathology in AD, but mechanisms
that lead to these brain lesions are not yet understood. A
fundamental question in the pathogenesis of AD is the relationship
between the observed neuronal abnormalities and the deposition of
amyloid.
Because the primary defect leading to AD is not yet known, and
specific mutations which cause AD in humans have not been defined,
animal models for the study of AD wou$d be especially useful. With
the exception of aged primates, no laboratory animal model for AD
exists. Due to these limitations, the generation of transgenic mouse
models for AD may bs the best approach in deiining the role APP plays
in the etiology of AD. Transgenic mice carrying APP genes which have
been altered either in their protein-coding sequences or in their
expression levels may lead to dominant mutant phenotypes resembling
those displayed by the AD pathology. The introduction of functional
minigene constructs described herein into the germline of mice has
been used to generate models of AD and to identify the molecular
mechanisms of pathogenesis.
/ - -
-21- 2~ 77
A critical step for the development of a transgenic mouse model
for AD was the design of a minigene that allows high-level expression
of a foreign gene in a predictable tissue-specific fashion.
Recombinant minigenes according to the present invention contain
essentially five different elements: gene promoter (DNA elements
responsible for gene regulation), protein coding region (cDNA), mRNA
polyadenylation signals, RNA splicing signals, and genomic elements
required for correct developmental expression of DNA that has
participated in a developmental program (the location of these
sequence elements can vary from one gene to another and can be found
within introns, 3' regions, and in other locations).
The following paragraphs and examples describe essential steps
leading to the design and construction of such minigenes for the
generation of animal models for AD. A gene promoter has been
isolated and characterized which in transgenic animals confers an
expression pattern of foreign genes that is comparable with the
pattern of expression of the endogenous mouse APP gene. A series of
minigenes comprising the APP gene promoter and a variety of different
APP gene products including mutant forms have been generated.
Transgenic animals, expressing these minigenes, are useful in the
investigation of the i~ vivo function of various APP gene products,
the regulation and expression patterns of the APP gene, and the
relationships of these processes to the formation of amyloid. The
use of various RNA splicing and polyadenylation signals in the
minigenes allows for the optimization of post-transcription
processing and stability of human APP transcripts in transgenic
animals.
Appropriate recombinan~ minigenes were generated and tested.
The minigenes were microin;ected directly into the male pronucleus
of mouse l-cell embryos. The manipulated embryos were subsequently
transferred to the oviducts of pseudopregnant females. Litters from
recipients were screened for the presence of the transferred minigene
(transgene) in their genome by polymerase chain reaction (PCR)
analysis and Southern-blot analysis of DNA derived from tail
biopsies.
2G4~Q~7
-22-
Because Alzheimer's pathology is restricted to specific regions
of the brain (Price, 1986, su~ra), the choice of an appropriate gene
promoter for minigene constructions was critical for the development
of the transgenic mouse model. A regulatory element comprising a
gene promoter and perhaps other regulatory sequences must be utilized
which will facilitate the expression of recombinant genes with a cell
and tissue specificity consistent with the formation of amyloid
plaque and the expression patterns of the APP gene. The present
invention provides such a regulatory element.
An ~4.5 kb genomic fragment described herein encompassing the
5'-end of the human APP gene (Figure 3) had sufficient sequence
information to direct cell and tissue-specific expression of thæ
protein product of a reporter gene, E. coli lacZ, in transgenic mice
(Figures 20 to 25). The expression pattern of the reporter gene
product ~-galactosidase in the central nervous system (CNS) was
strikingly consistent with the expression pattern of the endogenous
mouse APP gene and is consistent with the pattern of senile plaque
deposition characteristic of AD pat$en~s. In situ hybridizations,
using human APP cDNA as probe, revealed APP mRNA expression in
specific brain regions, including: hippocampus, dentate gyrus,
cerebral cortex, cerebellar cortex, pons, and spinal cord. ~-
galactosidase staining, in transgenic brain tissue, was restricted
to areas containing neuronal perikarya. In most cases, the ~-
galactosidase staining in the CNS of BE803 transgenic mice was
consistent with i~ situ hybridization patterns of mouse APP mRNA.
One exception was the CA3 region of the hippocampus where the ~-
galactosidase staining was not as intense as would be expected from
the observed levels of mouse APP mRNA. This difference may have
been due to a lowered expression level of the reporter gene in this
region or due to altered stability of the ~-galactosidase fusion
protein. The ma~ority of ~-galactosidase fusion protein was
looalized in secondary lysosomes within neuronal perikarya,
therefore, E. coli ~-galactosidase fusion protein may be relatively
unstable in neurons.
A variety of cDNAs encoding various forms of APP and mutants
of APP were constructed. Three alternate forms of APP exist,
: ' ` '
.
,
.
-23-
designated APP-695, APP-770 and APP-751, all of which are encoded by
a single common gene on human chromosome 21. The mRNA of the APP
gene is differentially spliced to yield thres gene products of 695
amino acids (aa), 751 aa, and 770 aa in length. The 751 aa and 770
aa forms contain an additional domain which has striking homology to
a Kunitz type serine protease inhibitor (Kitaguchi et al., 1988,
Nature ~ 530-532; Ponte et al., 1988, Nature 331: 525-527; Tanzi
et al., 1988, Nature ~1: 528-530). Expression of one or more forms
of the human APP gene products in transgenic mice provides a model
with which to test the hypothesis that over-expression or anomalous
expression of one or more forms of the gene results in Alzheimer's
pathology. This hypothesis is not inconsistent with the observation
that Alzheimer's pathology (i.e., A4 plaques in brain tissue) has
been found in individuals with DS past the age of 30-40 (Glenner and
Wong, 1984, Biochem. Biophys. Res. Commun. 122: 1131-1135). Such
individuals are trisomic for chromosome 21 which contains the APP
gene, and the levels of APP mRNA in these individuals appears to be
elevated (Tanzi et al., 1988, Science 235: 880-885).
Human APP cDNA clones corresponding to the three alternative
APP forms were isolated. Plasmid pFC4 contains the full length cDNA
for tbe 695 aa form of APP (Kang et al., supra). Using pFC4 as a
probe, a human neuroblastoma cDNA library was screened for the
presence of additional transcripts corresponding to additional forms
of human APP. An -1.8 kb cDNA was identified which contained both
additional exons found in APP-770 (167 bp plus 58 bp), and
represented a partial cDNA of the mRNA. Unique restriction sites
(AccI and BglII) were used to subclone this 1775 bp fragment into
the original pFC4 full-length clone, thus generating a full-length
cDNA clone (pFC4-770) for the 770 aa form of APP. The 751 residue
APP encoding cDNA clone (pFC4-751) was engineered by }~ vitro
mutagenesis of pFC4-770. The deletion of 58 bp (M13-looping-out)
was confirmed by DNA sequence analysis.
Using the various APP cDNAs, minigenes expressing each APP
form were constructed: pMTI-2314 for APP-695 expression, pMTI-2319
for APP-770 expression and pMTI-2320 for APP-751 expression. As an
initial step in the construction of an APP-695 minigene, the EcoRI
.:
.
2 ~ 7 1
-24-
promoter fragment of APP was inserted into the HindIII site of pMTI-
2301 by blunt-end ligatlon to produce pMTI-2307. The construction
of the APP-695 minigene was completed in a stepwise fashion. pMTI-
2311 was generated by ligating the ~3~HI fragment from pFC4 into the
~HI site of pMTI-2307. Next, the ~h~I fragment from pFC4 was
inserted into the ~h~I site of pMTI-2311 to generate pMTI-2312.
Finally, a ~hI fragment of pMTI-2304 containing the SV40 RNA
splicing and polyadenylation signals was inserted at the ~hI site
of pMTI-2312 to yield pMTI-2314. The APP-751 and APP-770 minigenes
were constructed by subcloning the AccI-~glII fragments from pFC4-
751 and pFC4-770 into the AccI/~glII sites of pMTI-2314 to generate
pMTI-2320 and pMTI-2319, respectively.
A second minigene series for expression of APP-695, APP-770
and APP-751 can be constructed using a truncated APP promoter. For
minigene, pMTI-2310 (APP-695), the -2.6 kb HindIII fragment of the
5'-end of the APP gene [Figure 3] was inserted into the HindIII site
of the pMTI-2301 to generate pMTI-2306 (Figure 7a). The minigene
expressing the 695 form of APP, pMTI-2310, was constructed in the
same manner as pMTI-2314 described above (Figure 7a). The
corresponding 751 and 770 minigenes can be generated as described
above using the -1.8 kb AccI-~glII restriction fragment.
The accumulation of A4 pep~ide in amyloid plaques may be the
result of anomalous proteolytic degradation of one or more APP forms
(695, 751, 770). Minigenes have been constructed which can directly
express either the A4 peptide or other fragments of APP that may
exist as proteolytic intermediates during n vivo generation of A4.
Such APP fragments may, if they contain the A4 region, self-
aggregate, and be further processed by the cell to alternately
generate A4. The types of minigene which were constructed and which
express such mutants are summarized in Figure 4b. Gene product IV
is devoid of a portion of the transmembrane domain and the entire
cytoplasmic domain, leaving the A4 domain intact. This mutant gene
product is expected to be secreted from the cell and perhaps further
degraded to produce the A4 peptide. The secreted protein may also
have other biological effects because at least some portion of APP
has been shown to be shed from cell surfaces. Gene product V
.
7 ~
-25-
(designated as MC-100) is translated into the membrane and,
therefore, a pre~ursor protein was constructed which contains the
17-residue signal peptide of APP at the N-terminus. If the signal
peptide is omitted, the C-100 protein (gene product VI) would be
translated into the cytoplasm and perhaps have significantly
different properties than if inserted into a membrane. Gene product
VIII in which the signal peptide is also omitted should produce
intracellular A4 directly, and which will not be inserted into a
membrane. Another construct also expressing the A4 peptide including
the APP signal peptide (gene product VII) was prepared. After the
signal peptide cleavage point, gene product VII includes 40 amino
acids encompassing the A4 peptide as well as 12 additional amino
acids N-terminal of the A4 peptide region. This protein is expected
to translocate through the cellular membrane and aggregate following
proteolytic cleavage by the cell to generate A4.
To construct mutant APP minigenes for expression of truncated
APP product, gene product IV and VII mutants, C-terminal frameshift
mutations were generated. Frameshift mutations (-1, +2) of the cDNA
sequences immediately following the A4 coding region brought a
translation 9top codon into the reading frame following the A4
peptide coding region. The resulting sequence encodes a truncated
APP species (Figure 4b, gene product IV). A frameshift mutation
(deleting nucleotide C) at the nucleotide position 2045 generated a
stop codon after 40 amino acids from the N^terminus of the A4
sequence (amino acids 38, 39 and 40 are different than the native
A4 sequence), and a +2 mutation (TG) after nucleotide position 2050
generated a stop codon after 41 amino acids from N-terminus of the
A4 sequence (the last amino acid is different than the native A4
sequence). The +2 mutation was utilized in construct pMTI-2321
(Figure 8a). The generation of these frameshift mutations is
described in co-assigned patent application U.S. Serial No. 194,053.
A third frameshift mutation, "mutant 40-1, n deleted an adenosine
nucleotide at nucleotide 2055 (APP-695 cDNA sequence; Figure 15) and
brought a translation stop codon into the reading frame directly
following the 40th codon of the A4 peptide coding region (used in
plasmids pMTI-2322, pMTI-2326, pMTI-2341, pMTI-2343, pMTI-2361).
rl r~
-26-
The frameshift mutations were inserted into pMTI-2314 (APP-695),
pMTI-2319 (APP-770), or pMTI-2320 (APP-751) by swapping sequence
domains between the unique ~glII and ClaI restriction sites (Figure
8a). The deletion mutation was also generated by site-directed
mutagenesis which placed the stop codon directly past the A4
sequellces (pMTI-26). The mutation in pMTI-26 was inserted into the
minigenes in a similar manner as described above.
To construct mutant APP minigenes for expression of gene
product VIII mu~ant, the following steps were taken. Minigene pMTI-
2318 (gene product VIII; Figure 4b) was generated in stepwise fashion
(Figure 9). A ~glII-BamHI fragment from pMTI-26 containing the 42
aa A4 peptide sequence was inserted into the BsmHI site of pMTI-
2307. Next, the BamHI to BamHI fragment of pFC4 was inserted into
the BamHI site of pMTI-2316. Finally, the SDhI fragment containing
the SV40 RNA processing signal was inserted into the ~hI site of
pMTI-2317.
Because of substantial sequence homology between mouse and
human APP gene products, it has been difficult to generate adequate
antibodies that will allow unequivocal identification of APP using
immunohistochemical analysis of tissue sections. To circumvent this
problem, a highly antigenic epitope of Chlamvdia wss inserted into
the APP-695 sequences at either the site of the Kunitz inhibitor
domain insertion or the extreme C-terminus of the protein. The
sequences were transferred into the minigenes using either the AccI
and ~glII restriction sites to generate pMTI-2325 (Figure 8a) or
pMTI-2324 (Figure lOa).
In another series of minigene constructs, alternate RNA
processing signals were used. Because minigenes utilizing RNA
processing signals derived from the human APP gene or from an
exogenous mouse gene might be expressed more efficiently in
transgenic mice than those derived from SV40, constructs were
generated which utilize RNA splicing and polyadenylation sequences
of the mouse metallothionein gene. Alternatively, a genomic fragment
from the 3'-end of the human APP gene which encompassed the APP
polyadenylation ~ignals was utilized. Minigenes expressing all of
~.
-27- 2~4~
the gene products described above and additional forms were generated
using the alternate RNA processing signals as follows.
Using the metallothionein gene body (Figure lOa) as a source
of RNA processing signals, minigenes expressing the three alternate
forms of APP (695, 770, 751) and mutant APP forms described above
were constructed. To generate minigene pMTI-2323 for expression
APP-695, the -2.2 kb BelII to EcoRI fragment from the EcoRI genomic
clone of the mouse metallothionein-I gene, pJYMMT(L), was inserted
into the ClaI ~ite of pHTI-2312 by blunt-end ligation to generate
pMTI-2323. Minigenes expressing alternates AP~ forms, APP-770 and
APP-751, were generated by switching sequence domains (AccI to ~glII
fragment) fron minigenes (expressing APP-751 or APP-770) utilizing
the SV40 polyadenylation sequence (Figure 8a) to pMTI-2323 (Figure
10) to generated pMTI-2331 and pMTI-2332. To generate a minigene
pMTI-2326 expressing an APP C-terminal frameshift mutant, the BglII
to ClaI fragment from pMTI-2322 (Figure 8a), containing mutation 40-
1, was switched with sequences between ~glII to ~l~I site of pMTI-
2312 (Figure 7a) to generated pMTI-2326a. Then, the -2.2 kb
metallothionein fragment (~glII to EcoRI fragment, see Figure lOa)
was inserted into the ClaI site of pMTI-2326a to generate pMTI-2326.
Alternatively, the ~glII to SpeI fragment of pMTI-2322 was swapped
directly into pMTI-2323 to produce pMTI-2326 (Figure lOa).
To generate minigene pMTI-2327 coding for C-100 (gene product
VI, Figure 4b), the sequences between the NruI and ~glII restriction
sites of pMTI-2323 were deleted (Figure lla). A translation
initiation codon, ATG, directly precedes the first codon of the A4
sequences. To generate minigene pMTI-2337 coding for MC-100, the
sequences between the KpnI and ~glII sites of pMTI-2323 (Figure lla)
were deleted and the clone was ligated using synthetic
oligonucleotide adaptor, sp-spacer-A4 (Figure 12). MC-100 (gene
product V, Figure 4b) required the 17 residue signal peptide of APP
to direct insertion of the translated mutant protein into the
membrane. The signal peptide should be cleaved and eliminated during
the process. The nucleotide and a~ino acid sequence of MC-100 is
presented in Figure 12.
... . .
, ~
-28-
To generate minigene pMTI-2341, a process analogous to that
used to generate pMTI-2337 (Figure lla) was used. This involved
deleting the sequences between the ~2~I and ~glII sites of pMTI-
2326 (Figure lOa) and ligating the clone uslng synthetic
oligonucleotide adaptor sp-spacer-A4 (Figure 13). Minigene pMTI-
2341 (gene product VII or sp-A4; Figure 4b) thereby generated should
express an A4 peptide linked to the APP signal peptide. The
nucleotide and amino acid sequence of sp-A4 is shown in Figure 13.
For the alternate series of the minigenes incorporating the
human APP gene-derived RNA processing signals, the 3'-end of the APP
gene was isolated in clone pVS-l. Clone pVS-l contained an -1.5 kb
EcoRI fragment of human genomic DNA which encompasses the 3'-end of
the terminal exon of human APP and the APP polyadenylation signal
inserted into the EcoRI site of pUCl9, Figure 15a. The -1.5 kb ~PP
genomic fragment was isolated from a charon 21A lambda library of
human chromosome 21 DNA (A.T.C.C. No. LA21NS01). The SmaI-SphI
(nucleotides 3102 to 3269) fragment from the APP cDNA clone, pFC4,
was labeled as probe and used to screen the lambda library for the
APP 3'-end genomic. The nucleotide sequence of the -1.5 kb APP
genomic fragment is shown in Figure 16.
The minigene construct, pMTI-2339, designed to express APP-
695 was generated by inserting the -1.3 kb SphI fragment from pVS-
1 into the ~hI site of pNTI-2312 (Figure 7a) yielding pMTI-2339
(Figure 15a). Minigenes expressing APP-751 and APP-770 and the
mutants indicated below were generated by switching sequence domains
of pNotSV2neo subclones of the APP constructs (Figure 18a). The
subclones were utilized for switching sequence domains because of
the presence of convenient restriction enzyme sites. NotI fragments
of many APP minigenes were subcloned into pNotSV2neo (see Figure
18a) so that APP expression could be determined in transient
transfections of COS cells. The construct encoding APP-770 (pMTI-
2342, Figure 19) was generated by swapping the PvuI to SpeI fragment
from pMTI-2363 (Figure 18a) to pMTI-2369 (Figure 19). A construct
which encodes APP-751, pNTI-2345, was generated in an analogous
fashion.
' ; "'
'
.
7 ~
-29-
To generate minigene pMTI-2343 expressing mutant 40-1, the
sequence domain encompassing the framashift mutant, 40-1, was
inserted into pMTI-2369 by swapying sequences between the PvuI and
Spel restriction sites from pMTI-2361 (Figure 18a) to p.~TI-2369
(Figure 19).
To generate minigene pMTI-2340 encoding mutant, MC-100, the
sequences between the KpnI and BglII sites of pMTI-2339 (Figure 15a)
were deleted and the clone ligated using synthetic oligonucleotide
linkers (sp-spacer-A4, Figure 12).
To generate minigene pMTI-2344 encoding mutant sp-A4, the sp-
A4 mutant was inserted into pMTI-2369 by swapping sequences between
the PvuI and SpeI restriction sites from pMTI-2365 (Figure 18a) to
pMTI-2369 (Figure 19).
A llumber of the APP minigenes prepared as described in the
Examples which follow were used to prepare transgenic mice expressing
an APP transgene. Such transgenic mice are useful as models for the
study of AD.
E~AMPLE 1
Elements of APP ~in~genes:
Gene Promoter and Regulator Elements for
Cell- ant Tissue-Specific Expression
A critical step in the development of a transgenic mouse model
for the pathology of AD is the isolation of an appropriate gene
promoter for minigenes to be used as transgenes. A gene promoter
and perhaps other regulatory elements must be identified that
facilitate expression of recombinant APP minigenes with a cell and
tissue specificity consistent with the formation of amyloid plaque.
As a first step, fragments containing various portions of the 5'-
end of the human APP gene from human genomic libraries were isolated.
The 5'-end of the APP gene has been shown to contain DNA sequence
elements which function as gene promoters in cell culture (Salbaum
et al., supra). The starting material for the isolation of an -2.5
kb HindIII fragment was a hu~an genomic library available from the
A.T.C.C. under accession number LL21NS02. This library was prepared
by uslng a fluore9cence-activated cell sorter to obtain a fraction
enriched for human chromosome 21. This frAction was digested with
.
-30-
HindIII and cloned into the lambda veetor Charon 21A. This HindIII
human chromosome 21 library was plated on 6 plates at an approximate
density of 5 X 104 pfu/plate. Screening of duplicate filters of the
library representative of 3 X 105 total pfu was done by conventional
S methods (Benton and Davis, 1977, Scienee ~ 180) using an -1.0 kb
cDNA probe derived from plasmid pFC4. Plasmid pFC4 (Figure 2) is
described ln Example 3. It contains an -3.3 kb cDNA insert having
the sequence shown in Figure 1. The -1.0 kb probe was obtained from
the AoaI site at nucleotide position 52 to the XhoI site at
nucleotide position 1056. A 91 bp probe was also used to confirm the
initial screen with the -1.0 kb probe. This small confirming probe
was derived from pFC4 as an ApaI (nucleotide 52) to NruI (nucleotide
144) fragment. Clones which hybridized were plaque-purified through
three subsequent cycles of screening and purification until a 100
positive hybridization response was obtained. One such plaque-
purified clone was designated ~MTI 3509 (~12A). ~MTI 3509 contained
a genomic insert of -2495 bp. This HindIII insert was subcloned into
the HindIII site of plasmid pUC18 (Yanisch-Peron et al., 1985, Gene
33: 103) and designated pMTI-3501 (pUC18/pAL12A-12). Plasmid pMTI-
3501 was found to contain -487 bp of sequence 5' to the first
nueleotide of the cDNA insert of plasmid pFC4 (shown in Figure 1).
Using an -181 bp genomic probe derived from pMTI-3501 (from
the ApaI site at -128 to ~eaI at 52), an EcoRI human genomic
chromosome 21 cell sorter-enriched library available from the
A.T.C.C. under accession number LA21NSOl was screened in a manner
similar to that described above for the ~iadIII library. One plaque-
purified clone, designated ~MTI 3522 (~pE-l) contained an insert of
-4638 bp. Thi~ -4.6 kb insert was subeloned into the EeoRI site of
plasmid pUCl9 (Yaniseh-Peron et al., supra~ and designated pMTI-
3515 (pUCl9/pE-12). Plasmid pMTI-3515 was found to cantain -2831 bp
5' to the first nueleotide of the eDNA insert of plasmid pFC4 (Figure
1) .
The genomie inserts of both pMTI-3501 and pMTI-3515 eontaining
sequenees 5' to the cDNA sequence of pFC4 interrupt the ~I site of
the eDNA insert of the pFC4 at position 207. This ~p~I site was not
present in the genomie DNA at the junetion of the boundary between
' . , ~
r~
-31-
exon 1 and intron 1, but was created at the splice site of the mRNA.
Plasmid pMTI-3501 and plasmid pMTI-3515 encode -1.6 kb and -1.4 kb
of intron 1, respectively. Plasmid pMTI-3515 was shown to contain
-2.8 kb of sequences 5' to the APP start site of transcription, along
with exon 1 (encoding amino acids 1-19 of APP) and part of the first
intron (-1.6 kb) as shown in Figure 3.
E8AMPLE 2
Elements of APP Minlgenes:
SV40-derived Polyadenylation and RNA Splicing Signals
10SV40 virion DNA (Hay and DePamphilis, 1982, Cell 28: 767-779;
also commercially available from International Biotechnologies, Inc.
(IBI) as catalog no. 33200) was digested with BamHI and BclI. The
small -0.2 kb BamHI-BclI fragment (2533 bp to 2770 bp) containing
two RNA polyadenylation signals (one in each strand) (see,
15DePamphilis and Bradley, 1986, in The Papovaviridae, Volume 1,
Salzman (ed.), Plenum Publishing Corp., NY) was "shotgun" cloned
into plasmid pUC19 as follows. The ~mHI- and ~lI-digested SV40
DNA was mixed with ~3~HI-digested pUCl9 DNA. The restriction enzymes
were removed via phenol-chloroform extractions and the DNA was
ligated overnight at 12C using T4 ligase (commercially available
from New England Biolabs (NEB) as catalog no. 202). Impurities,
including any residual phenol or chloroform were removed from the
ligated DNA by GENECLEAN (available from BI0 101 Inc., PØ Box 2284,
La Jolla, CA. 92038). This DNA was used to transform competent DH5~
E. coli cells (commercially available from Bethesda Research
Laboratories (BRL), Gaithersburg, MD 20877). The transformants were
screened by miniprep analysis using BamHI digestion and HDaI/HindIII
digestions to determine the orientation of the inserted DNA. The
desired -2.9 kb plasmid was designated pMTI-2302 (Figure 5).
30SV40-derived RNA splicing signals from plasmid pFC4 were
inserted into pMTI-2302 as follows. First, the ~I restriction
endonuclease site at nucleotide position 144 of the APP cDNA sequence
(shown in Figure l) was converted to a BglII restriction endonuclease
site using blunt-end linkers to yield plasmid pMTI-2303 (Figure 5).
3S For this conversion, pFC4 was digested with ~_I and the linear -6.4
kb DNA fragment was purified with GENECLEAN and then ligated with 0.5
. .,~, .
,
-
-32-
OD260 units of ~glII linkers (~EB catalog no. 1036) using T4 ligase
[incubation for 5 hours at 16C]. Linkers were removed by gel-
filtration using "Quick Spin Columns" (Boehringer Mannheim, catalog
no. 100408). The linear DNA was recovered using GENECLEAN and was
circularized using T4 ligase to generate pMTI-2303 [diagnostic
minipreps with ~glII and XhoI digestion revealed fragments of -0.35
kb, -1.4 kb, and -2.95 kb]. This procedure deleted APP encoding
sequences from nucleotide position 145 to the BglII site downstream
at nucleotide position 1915. An -0.3S kb fragment containing the
SV40 splicing signals could be excised from plasmid pMTI-2303 DNA by
digestion with XhoI and BglII. This XhoI-BglII fragment was gel-
purified on a 5~ polyacrylamide gel, eluted from the gel, then used
for ligation with SalI-~HI digested pNTI-2303 DNA to generate
plasmid p~TI-2305 (Figure 5). In the next step, an SphI site was
inserted into the EcoRI site of pMTI-2305 to generate plasmid pMTI-
2304 (Figure 5). Plasmid pMTI-2305 was digested with EcoRI to yield
an -3.2 kb fragment and then dephosphorylated using CIAP (calf
intestine alkaline phosphatase, reaction conditions suggested by
manufacturer, Boehringer Mannheim, catalog no. 1097075). The DNA was
extracted with phenol/chloroform/isoamylalcohol (24/24/1) and
precipitated in 2.5 M ammonium acetate and 70~ ethanol. The DNA
fragment was ligated, using T4 ligase, to an EcoRI-~I adaptor. The
adaptor is a self-annealing oligonucleotide (Sequence 5'-
AATTCCCGCATGCGGG-3'; synthesized using an Applied Biosystems
instrument and manufacturer's recommended methods, model no. 380A DNA
Synthesizer) and was annealed by heating in solution (1 mM EDTA, 10
mM Tris pH 7.6) to 65C and allowing sample to slowly cool to room
temperature. Diagnostic minipreps of pMTI-2304 with ~hI revealed
fragments of -0.6 and -2.6.
An -0.6 kb S~hI cassette containing SV40-derived splicing
signals and polyadenylation signals could be excised from pMTI-2304
DNA by digestion with SphI. This cassette was useful in the
construction of APP minigenes described in the Examples below.
:
~,
2 ~
-33-
EXA~PLE 3
Elements of APP ~inigenas:
APP-695, -770, -751 Protein Coding Regions
Plasmid pFC4 is a cDNA clone similar to clone 9-110 described
by Kang et al., 1987, Nature 325: 733-736 and contains a full-length
cDNA encoding APP-695 (Figure 2). The cDNA library described by Kang
et al., suDra, was constructed by the method of Okayama and Berg,
1983, Mol. Cell. Biol. 3: 280-289, using polyAt RNA isolated from
brain cortex of a 5-month-old aborted human fetus. This cDNA library
(~105 E. coli HB101 transformants) was originally screened using a
mixture of 64 20-mers as probes. The 20-mers had the sequence
S'-T T 2 T G A T G A T G C A C T T C A T A-3'
C G G C G G
This sequence was deduced from the amino acid sequences of residues
10-16 of the A4 peptide. Nine positive clones were obtained, and
one (clone 9-110) was selected for sequence analysis. The complete
sequence of the clone 9-110 insert encoding a full-length APP-695
sequence is shown in Figure 1 of Kang et al., su~ra. This cDNA
library was replated and screened with two different synthetic
20oligonucleotide probe mixtures of 17 and 20 nucleotides. The 17
mers had the sequence:
5'-A C G T C T T C N G C G A A G A A-3'
A C A A
where N is A, G, C or T. The 20-mers had the sequence:
255'-T T T T G G T G G T G N A C T T C G T A-3'
C A A C A
where N is A, G, C or T. Two positive clones, designated pFC4 and
pFC7, were obtained which contained identical inserts as determined
by restriction endonuclease mapping and partial DNA sequence
analysis. Clone pFC4 was selected for further analysis and contained
an -3.4 kb insert encoding the full-length APP-695 sequence shown in
Figure 1. The nucleotide sequence is identical to the sequence of
9-110 shown as Figure 1 Kang et al., supra.
A human neuroblastoma cDNA library was purchased from Clontech,
Palo Alto, CA, catalog no. HL1007a, and screened for the presence of
APP transcripts of the 751 aa and 770 aa forms of human APP. This
library was probed with an -1.4 kb BamHI fragment (nucleotide 99-
1475) of pFC4. Two positive clones (~El-bl-l and ~El-bl-3) with
,..,, ..~. ,.
.
. . .: . .
.
~. ,,, . . ~ ~
7~
-34-
identical inserts were obtained. These two clones each contained an
-2.0 kb cDNA insert comprising both of the additional exons (167 bp
and 58 bp) found in APP-770 but represented only a partial cDNA of
the full-length mRNA for APP-770. The -2.0 kb insert was subcloned
into the EcoRI site of plasmid pUCl9 to generate plasmid pMTI-3525.
A full-length cDNA for APP-770 was obtained by replacing the -1.7 kb
I-~glII fragment of pFC4 (nucleotide 207 - nucleotide 1915 of pFC4
sequence shown in Figure 1) with the -.96 kb ~eaI-~glII fragment of
pMTI-3525, generating plasmid pMTI-3521 (pFC4-770). Specifically,
pMTI-3525 was digested with KpnI and ~glII, and the -.96 kb KpnI-
~glII fragment was gel-purified. Plasmid pFC4 was similarly digested
with ~BI and B~lII, and the -4.7 kb K nI-~glII fragment was gel-
purified. The two gel-purified fragments were mixed, ligated and
used to transform E. coli DH5 cells. The resulting -6.6 kb plasmid
pMTI-3521 was the source of the APP gene fragment for the
construction of minigenes for the expression of the APP-770.
In order to obtain a full-length cDNA encoding the 751 aa form
of APP, in vitro mutagenesis of plasmid pMTI-3521 was performed to
delete the 58 bp sequence encoding the C-terminal 19 amino acids of
the 75 aa protease inhibitor domain of APP-770. This was achieved
by the M13-looping out procedure as described by Geisselsoder et
al., 1987, Biotechniques 5: 786-791. DNA sequence analysis confirmed
the successful deletion of the 58 bp seg~ent of pMTI-3521 to generate
plasmid pMTI-3524. Plasmid pMTI-3524 was the source of the APP gene
fragment for the construction of minigenes for the expression of APP-
751.
Plasmid pMTI-3524 was prepared according to the following
series of steps. First, plasmid pMTI-3522 was constructed as
follows. Plasmid pMTI-4 was partially digested with AccI, then
filled-in with the Klenow fragment of DNA polymerase (Klenow) to
remove one of the two AccI sites, ligated and used to transform ~.
coli DH5 cells to yield plasmid pMTI-3526. Plasmid pMTI-3526 was
digested with AccI and ~glII; the -3.8 kb large fragment was gel-
purified and ligated with the -1.7 kb AccI-~glII gel-purified
fragment from pMTI-3525, then used to transform E. coli DH5~ cells.
The desired transformant plasmid was designated pNTI-3522. Plasmid
,
.
7Y~
-35-
pMTI-3522 was then used to transform competent E. coli CJ236 cells
which are uracil N-glycosylase-deficient. Several transformants
were propagated and single-stranded uracil containing pMTI-3522
(phage) DNA was generated with the use of R408 helper phage
(available from Stratagene as catalog no. 200252). MUTA-l, a
synthetic 60-mer which spans the ~unction of APP-751 and APP-695 was
used to "loop out" the 57 nucleotides of pMTI-3522 to generate pMTI-
3523. MUTA-l has the sequence:
5'agtactgcatggccgtgtgtggcagcgccattcctacaacagcagccagtacccctgatg 3'
and was 5' phosphorylated and annealed to the single-stranded pMTI-
3522 DNA in the presence of Gene 32 protein which assists the enzyme
T4 DNA polymerase in copying the complementary strand. This mixture
was used to transform competent E. coli XL-l Blue Cells (available
from Stratagene as catalog no. 200268) which are uracil N-
glycosylase positive. Colorless plaques were picked for miniprepand sequence analysis. This procedure (Geisselsoder et al., 1987,
Biotechniques 5: 786-791) greatly reduced the propagation of parental
phage, thus enriching for the mutant strand. One of thesa positive
clones was designated pMTI-3523.
EXAMPLE 4
Construction of ~inigenes pMTI-2314 ant pMTI-2310
for E~pression of APP-695
A. Minigene pMTI-2314
For the first step of the construction of minigene pMTI-2314
for the expression of APP-695, an -4.6 kb EcoRI fragment derived
from plasmid pMTI-3515 (Example l; Figure 3) was inserted into the
HindIII site of plasmid pMTI-2301 (Figures 6a and 6b) by blunt-end
ligation to yield plasmid pMTI-2307 (Figures 7a and 7b). Plasmid
pMTI-2301 contains a unique HindIII cloning site, flanked by NotI
restriction endonuclease sites, and was prepared by first replacing
the EcoRI-HindIII polylinker of pUCl9 (obtained from Bethesda
Research Laboratories, Life Technologies, Inc., Gaithersburg, MD,
catalog no. 95357) with the polylinker of pWE16 (available from
Stratagene as catalog no. 251202), and then converting the ~l~dIII
~ite to sn EcoRI site u9ing adaptors. For the first step in the
construction of pMTI-2301, two oligonucleotides purchased from NEB
7 ~
-36-
(catalog nos. 1107 and 1105) were annealed to yield the following
double-stranded adaptor:
5'- MTTCGAACCCCTTCG-3' (#1105)
3'-GCTTGGGGM GCTCGA-5' (#1107)
S Then, plasmid pUC19 DNA was digested with EcoRI and ~dIII and the
-2.7 kb fragment was gel-purified (using low melt agarose), ligated
with the adaptor, and used to transform E. coli DH5~ cells. The
desired transformant was designated pMTI-2110 (Figure 6a). For the
second step in the construction of pMTI-2301, plasmid pMTI-2110 DNA
was digested with EcoRI, then treated with calf intestine alkaline
phosphatase (CIAP), then gel-purified. CIAP was obtained from
Boehringer Mannheim Biochemicals, Biochemicals Division, P.O. Box
50816, Indianapolis, IN 46250 (catalog no. 713 023). Plasmid pWE16
DNA was also digested with EcoRI. The EcoRI-digested pWE16 and gel-
purified EcoRI-digested pMTI-2110 DNAs were mixed, ligated, treated
with GENECLEAN and used to transform E. coli DH5~ cells. The desired
transformant plasmid was designated pNTI-2300. Niniprep analysis
showed that NotI linearizes the -2.7 kb plasmid. For the third step
in the construction of pMTI-2301, plasmid pMTI-2300 DNA was digested
with ~mHI and ligated to self-annealing synthetic oligonucleotide
adaptor (sequence 5'-GATCGGGAAGCTTCCC-3'; synthesized using an
Applied Biosystems instrument and manufacturers recommended methods,
model no. 380A DNA Synthesizer) in order to convert the BamHI site
to HindIII. The oligonucleotide was annealed to yield the following
double-stranded adaptor:
5'-GATCGGGMGCTTCCC-3'
5'-CCCTTCGAAGGGCTAG-5'
The ligated DNA was treated with GENECLEAN and used tD transform ~.
coli DH5~ cells. Miniprep analysis of transformant DNA was performed
using BamHI (plasmid remains uncut) and HindIII (linearizes plasmid).
The desired transformant was designated pNTI-2301.
Plasmid pMTI-2301 DNA, thus obtained, was digested with
HindIII, gel-purified, then treated with Klenow and CIAP. Then,
plasmid pNTI-3515 DNA was digested with EcoRI and an ~4.6 kb fragment
was gel-purified, treated with Klenow, and blunt-end ligated with the
pMTI-2301 DNA prepared as described above. The ligated DNA was
treated with GENECLEAN and used to transform E. coli DH5~ cells.
'' .: .
,
~ .
:. '
- .. -
- ~ :
S~ 7
-37-
Transformants were screened by miniprep analysis using EcoRI. The
desired transformant plasmid was designated pMTI-2301 and contain~d
EcoRI fragments of ~4.7 kb and -2.6 kb by miniprep analysis.
For the second step of the con-qtruction of pMTI-2314, an -1.4
kb BamHI fragment of pFC4 comprising nucleotides 100-1475 (Example
3, Figure 1) was ligated into the ~3~HI site at nucleotide position
99 of the APC cDNA sequence in plasmid pMTI-2307 to yield plasmid
pMTI-2311 (Figure 7a). Diagnostic miniprep analysis of pMTI-2311
DNA digested with Xhol and NotI revealed fragments of -3.9 kb,
-2.7 kb and -2.2 kb.
For the third step of the construction of pMTI-2314, an -2.4
kb XhoI fragment of pFC4 comprising nucleotides 1056-3353 and
including 3' sequences, poly A track and SV40 sequences found in the
Okayama and Berg vector (Okayama and Berg, 1983, supra) was ligated
into the XhoI site at nucleotide position 1056 to yield plasmid pMTI-
2312 (Figures 7a and 7c).
For the iinal step of the construction of pMTI-2314, an -0.6
kb SDh I fragment of pMTI-2304 containing SV40-derived RNA splicing
and polyadenylation signals was ligated into the ~8hI site of pMTI-
20 2312 to yield plasmid pMTI-2314 (Figures 7a and 8b). Plasmid pMTI-
2314 DNA waq used as a minigene for the construction of APP-695
expressing transgenic mice as described in Example 11 below.
B. Minigene pMTI-2310
A second minigene for the expression of APP-695, pNTI-2310
(Figure 8a), was constructed according to the same four steps as
outlined above for the construction of pMTI-2314, except that in the
first step, an -2.4 kb HindIII fragment derived from plasmid pMTI-
3501 (Example 1) was inserted into the HindIII site of pMTI-2301
(part A above) to yield plasmid pMTI-2306. Diagnostic miniprep
analysis of pMTI-2306 DNA digested with NotI and ~a~HI revealed
fragments of -2.7, -0.9 and -0.6 kb. The subsequent three steps
yielded plasmids pMTI-2308 (diagnostic minipreps with NotI and XhoI
revealed fragments of -2.6, -2.3 and -1.6 kb), pMTI-2309 (diagnostic
minipreps with HindIII to determine orientation revealed fragments
35 of -3.4, -2.9 and -2.6 kb) and pMTI-2310 (diagnostic minipreps with
EcoRI revealed fragments of -2.7, -2.4, -2.3, -l.I and -0.9 kb),
.~
.
7 ~
-38-
respectively. Plasmid pMTI-2310, containing the same APP-695 gene
as pMTI-2314 but with a truncated regulatory region, was also used
as a minigene for the construction of APP-695 expressing transgenic
mice as described in Example 11 below.
EXA~PLE 5
Construction of Minigenes pMTI-2319 and pMTI-2320
for Expression of APP-770 ant APP-751
Minigenes pMTI-2319 and pMTI-2320 (Figure 8a) for the
expression of APP-770 and APP-751, respectively, were each
constructed in a single step digestion and ligation procedure via a
simple interchange of AccI-BglII fragments. Plasmid pMTI-3521 DNA
(Example 3) encoding a full-length cDNA for APP-770 was digested
with AccI and BglII. An -1.8 kb AccI-BglII fragment of pFC4-770 was
ligated into the AccI and BelII site~ of pMTI-2314 to yield pMTI-
2319. Diagnostic miniprep analysis of pNTI-2319 DNA digested with
ScaI revealed fragments of -7.3 and -4.8 kb. A ScaI site exists in
the inhibitor encoding domains of APP-770 and APP-751. Similarly,
plasmid pMTI-3524 DNA (Example 3) encoding a full-length cDNA for
APP-751 was digested with _ç~I and ~glII. An -1.75 kb AccI -~g~II
fragment of pMTI-3524 was ligated into the AccI and ~glII sites of
pMTI-2314 to yield pMTI-2320. Diagnostic miniprep analysis of pMTI-
2320 DNA digested with ScaI revealed fragments of -7.2 and -4.8 kb.
Plasmids pMTI-2319 and pMTI-2320, containing a full-length cDNA for
APP-770 and APP-751, respectively, were used as minigenes for the
construction of APP-770 and APP-751 expressing transgenic mice as
described in Example 12 below. Thus, the inhibitor encoding domains
found in APP-770 and APP-751 may be inserted in the APP-695 sequence
of pMTI-2314 by swapping sequence domains between the unique AccI
and ~glII sites.
EXAMPLE 6
Construction of p~TI-2321 and pMTI-2322 Minigenes
for Expression of APP C-Terminal Frameshift ~utants
Minigenes pMTI-2321 and pMTI-2322 (Figure 8a) for the
expression of a truncated APP protein were constructed by making
frameshift mutations in the C-terminal region of the APP coding
,
2 ~
-39-
sequence. These frameshift mutations were made in the APP cDNA
sequences immediately following the A4 coding region so as to bring
a translation stop codon into the reading frame (i.e., in-frame
termination) following the A4 peptide ccding region. The resulting
mutated sequence codes for a truncated APP species as exemplified by
gene product IV shown in Figure 4b.
1~ vitro mutagenesis procedures described by Kunkel et al.,
1987, Methods In Enzymol. 154: 367-382, were used to generate the
frameshift mutants briefly summarized as follows. The starting
material for the mutagenesis was plasmid pMTI4 DNA. Plasmid pMTI4
is the mutagenesis vector KS Bluescript (+) available from Stratagene
into which the -2.3 kb NruI-SpeI fragment of pFC4 containing a
segment of the APP-695 cDNA has been inserted. For this
construction, pFC4 DNA was digested with NruI and SpeI, treated with
Klenow, then blunt-end ligated into the SmaI site of SmaI-digested
KS Bluescript(+) DNA to yield pMTI-4. Single-stranded pMTI4 DNA was
prepared from E. S~l~ W236 host cells, in which cells uracil
replaces thymine in DNA. The DNA was then made double-stranded by
~ vitro DNA synthesis using one of three mutagenizing synthetic
oligonucleotides described below as primer for a particular
preparation. The heteroduplex DNA (one uracil-containing normal
pMTI4 strand and one newly synthesized thymine-containing mutated
strand) was used to transform E. coli MVll90 cells, in which cells
the sequence of the thymine-containing mutated strand is selectively
propagatedbecause the uracil-containing wildtype strand is degraded.
Miniprep plasmid preparations from such transformed E. coli colonies
were screened for incorporation of the mutation by direct DNA
sequence analysis. For sequence analysis, the primer was an
oligonucleotide having the sequence from nucleotide position 1881-
30 1897 of the APP cDNA. The sequence -200 nucleotides downstream of
the primer was analyzed to confirm the mutated sequence. Those
clones having the desired mutation of the APP coding sequence were
used for preparative purification of mutant plasmid DNA by
conventional methods, for use in the construction of truncated APP
minigenes.
' ~ ' ' ~ ," '
.
-40-
Three types of mutants (a, b, c) were generated which
introduced premature translation terminat~on signals in APP mRNA to
yield truncated APP proteins. The wildtype (wt) and mutant sequences
beginning at nucleotide position 2040 are shown with the termination
codons underlined as follows:
a b c
wt GTG GGC GGT GTT GTC A~ GCG ACA GTG _TC
Val Gly Gly Val Val Ile Ala
a GTG GGG GTG TTG TCA TAG CGA CAG TGA TCG
Val Gly Val Leu Ser *
b GTG GGC GGT GTT GTG TCA TAG CGA CAG TGA
TGC
Val Gly Gly Val Val Ser *
c GTG GGC GGT GTT GTC TAG CGA CAG TGA TCG
Val Gly Gly Val Val *
The synthetic oligonucleotides used for mutagenesis were:
a 5'-CATGGTGGGGGTGTTGTCATAGC-3' [23-mer, 2036-2059]
b 5'-GGGCGGTGTTGTGTCATAGCGACAG-3' [25-mer, 2042-2064]
c 5'-GGCGGTGTTGTCTAGCGACAGTGA-3' [24-mer, 2043-2067]
For mutant-a, one nucleotide (C) that is marked above the
wildtype sequence with the letter "a", i9 deleted, generating two
in-frame termination codons. The first in-frame termination codon
in mutant-a is the codon for aa 40 of the A4 sequence. In mutant-
a, amino acids 38, 39 and 40 are different than those of the wildtype
sequence. For mutant-b, two nucleotides (TG) were inserted at the
position marked above the wildtype sequence with the letter "bn,
generating two in-frame termination codons. The first in-frame
termination codon in mutant-b is after the codon for aa 41 of the A4
sequencs. In mutant-b, aa 41 i9 different than that of the wildtype
sequence. Mutant-b (also known as the +2 mutant) was utilized in the
construction of plasmid pMTI-2321 described below. For mutant-c, one
nucleotide (A) that is marked in the wildtype sequence shown above
with the letter "c" is deleted, generating an in-frame termination
codon in the reading frame directly following the codon for aa 40 of
the A4 sequence. Mutant-c has been designated mutant 40-1, and was
utilized in the construction of plasmid pMTI-2322 described below.
2~ r~
-41 -
The portion of APP-695 cDNA that contains the A4 coding
sequence lies within an -0.7 kb B lII-ClaI fragment (corresponding
to nucleotide position 1915-2620) that can conveniently be moved
from one APP gene construct to another since BglII and ClaI each
cleave APP-695 cDNA only once. The following steps were used to
insert the mutated part of pMTI4 into another APP construct to
generate minigenes for expression of truncated APP proteins. In the
first step, mutated pMTI4 DNA was digested with ~glII and ClaI. The
~0.7kb ~glII-,ClaI fragment wa~ then isolated from a preparative
agarose gel. In the second step, DNA from the other construct was
digested with BelII and ClaI and then treated with CIAP. For the
preparation of plasmids pMTI-2321 and pMTI-2322, this other construct
was pMTI-2314 (Example 4) encoding a full-length (wildtype) cDNA for
APP-695. The small -0.7 kb BglII-ClaI fragment of pMTI-2314 was
removed from the digest by preparative agarose gel electrophoresis.
In the third step, the large -11.1 kb BglII-ClaI fragment of pMTI-
2314 remaining after removal of the -0.7 kb fragment to be replaced
(step 2) was mixed with the -0.7 kb mutated ~glII-ClaI fragment
(step 1), then ligated and,used to transform E. coli DH5~ cells.
Transformant plasmids were initially screened for appropriate inserts
by miniprep analysis. Diagnostic miniprep analysis of the plasmids
using EcoRI revealed fragments of -4.7, -2.7, -2.6, -1.1 and -0.9 kb.
Then, the integrity of each selected plasmid preparation was
confirmed by DNA sequence analysis of the mutated sequence and
sequences surrounding the mutation. The resulting selected plasmids
designated pMTI-2321 (mutant-b) and pMTI-2322 (mutant 40-1), were
used as minigenes for the construction of transgenic mice expressing
truncated APP proteins. A plasmid for the expression of mutant-a may
be constructed and selected by fragment swapping as described above
for mutant-b (pMTI-2321) and mutant 40-1 (pMTI-2322).
E~IPLE 7
Construction of Min$gene pMTI-2318
for Espression of A4 Amyloid Peptide
In order to construct plasmid pMTI-2318 (Figure 9) containing
a minigene for the expression of A4 peptide, first a portable gene
encoding the 42 aa A4 peptide sequence was prepared. This gene was
'
,
'
-42- 2~ 7 7
obtained by in vitro mutagenesis of a fragment of the cDNA for APP-
695 as described in Example 6 above. The starting material was the
same as that described in Example 6, plasmid pMTI-4. A 38-base
oligonucleotide mutagenesis primer corresponding to the A4 sequence,
S but with desired changes for the creation of an in-frame termination
(TAG) and a convenient ~mHI restriction site immediately following
the in-frame termination codon, was synthesized chemically. The
sequence of this synthetic primer was:
BamHI
5'-GGTGTTGTCATAGCGTAGGATCCGTCATCACCTTGGTG-3'
Ter
This primer was used to mutate the APP-695 sequence in pMTI4 in
substantial accordance with the procedure in Example 6 above to
create plasmid pMTI-26. The wildtype (native) and mutated sequences
are shown as follows:
BglII
wt AGATCTCTG MGTGAAGA~ GAT---GGT GTT GTC ATA GCG ACA GTG ATC-
MET asp gly val val ile ala thr val ile
BglII BamHI
mutant AGATCTCTG MGTGMG~ GAT---GGT GTT GTC ATA GCG TAGGATCCGT
MET asp gly val val ile ala ter
The newly created ~HI site ant the ~glII site preceding the ATG
codon provide convenient restriction sites for cloning the A4 gene
into other APP constructs to generate minigenes for expression of
42 aa A4 peptide. One such minigene construct was pMTI-2318,
prepared according to the following steps (Figure 9). In the first
step pMTI-26 DNA was digested with BglII and BamHI. The -150 bp
fragment was then isolated from a 5~ polyacrylamide gel by
electroelution. In the second step, DNA from another construct, for
example, pMTI-2307 (Example 4) was digested with ~3~HI, gel- purified
and treated with CIAP. In the third step, the -150 bp mutated ~glII-
BamHI fragment (step 1) was mixed with the ~HI-cut pMTI-2307 DNA
(step 2), then ligated and used to transform E. coli DH5~ cells.
Transformant plasmids were screened for appropriate inserts by
miniprep and DNA sequence analysis. For each miniprep analysis
restriction endonucleases were chosen that would allow starting and
ending materials to be distinguished and also allow determination o~
", j ~, ... . . .
-43- ~ 7 ~
desired orientation. Then, other re-qtriction endonucleases were
chosen to confirm the integrity of the construction (e.g., no
anomalous rearrangements). The resulting -7.6 kb plasmid was
designated pMTI-2316. Miniprep analysis with ~EHI and EcoRI
S revealed fragments of -6.8 and ~0.8 kb. In the next steps, pMTI-
2316 DNA was digested with ~3~HI, then mixed with and ligated to the
-2.0 kb BamHI fragment of pFC4 to yield pMTI-2317 by transformation
and selection as described above. Miniprep analysis of the -9.6 kb
pMTI-2317 DNA with HindIII revealed fragments of -7.3 and -2.2 kb.
Insertion of this ~HI fragment provided a convenient ~E_I site
along with a portion of 3' untranslated sequences so as to be a
template for a messenger RNA transcript of stable size. In the final
steps, an -0.6 kb ~E~I fragment of pMTI-2304 containing SV40 splicing
and polyadenylation signals was inserted at the ~hI site of pMTI-
2317 by appropriate restriction endonuclease digestion, ligation,transformation and selection as described above, to yield desired
plasmid pMTI-2318. Miniprep analysis of pMTI-2318 DNA with EcoRI
revealed fragments of -2.9, -2.7, -2.0, -1.1, -0.9 and -0.6 kb.
Plasmid pMTI-2318 was utilized as a minigene for the construction of
transgenic mice expressing a 42 aa A4 peptide.
EXAMPLE 8
Epitope Tagging of Recombinantly Expressed APP
Immunochemical studies of the subcellular localization and
processing of alternative forms of APP, including APP-695, APP-770
and APP-751, and mutated forms of APP, using antibodies elicited to
synthetic peptides and/or recombinant precursor proteins are
difficult for the following reasons. Firstly, the APPs are highly
conserved among species (mouse and rat 99%, human and rat 97.3~) and
are ubiquitously expressed. In order to easily obtain adequate
antibody production against a variety of APP peptides and recombinant
proteins, a highly antigenic epitope of Chlamvdia (Huguenel et al.,
1989, Intl. Soc. Sex. Trans. Dis. Res., 8th Meeting, Copenhagen,
Denmark, Abstract no. 22) was inserted into the APP sequence at
either the Kunitz inhibitor domain or the extreme C-terminus of the
protein to produce "tagged" APP cDNAs. Minigenes containing such
~ ~3 ~
-44-
tagged APP cDNA can be used to prepare transgenic mice, and the APP
translation products in such mice can be detected using antibodies
against this epitope.
The peptide sequence of the Chlamvdia epitope is TVFDVTTLNPTI.
This epitope has been shown to be very antigenic as an isolated
peptide and as part of a larger protein (Huguenel et al., supra;
Baehr et al., 1988, Proc. Natl. Acad. Sci. USA 85: 4000-4004;
Stephens et al., 1988, J. Exp. Med. ~ 817-831). Synthetic
oligonucleotides were generated for the site-directed mutagenesis
in the APP coding region to insert the sequences for the ChlamYdia
epitope by M13 "looping-in" experiments. The synthetic
oligonucleotide
5~ Aat Il
GGCTGCTGTG GCGGGEGTCTA AAT AGT TGG GTT CAG AGT GGT GAC GTC AAA
* I T P N L T T r V D F
GAC AGT GTT CTG CAT CTG CTC AAA GA 77-mer (CC-TAG)
V T N Q M Q B F F
was used to engineer pMTI-63 which carries a C-terminal addition of
sequences encoding the Chlamvdia epitope to APP695. The synthetic
oligonucleotide
5~ Aat II
G Ç~ ACT GGC TG~C TGT TGT AGG AAT AGT TGG GTT CAG AGT GGT GAC GTC
T S A A T T P I T P N L T T V D
AAA GAC AGT Q~ AAC CAC CTC TTC C 77-mer (IC-TAG)
F V T V R V V E E
was used to engineer pMTI-35 which carries an addition of the amino
acid sequences encoding the Chlamvdia epitope into the APP sequence
of amino acid residue 289, where the (Kunitz) protease inhibitor-
like domain is spliced into the APP-695 molecule.
Antibodies prepared against this Chlamydia epitope are useful
to investigate the tissue, cellular and subcellular localization of
tagged APP proteins ~ vivo, to study the biochemical properties and
processing of APP in transfected animal cells including cell-sorting
of transfectants, to study APP ~ vitro translation products and APP
transformed E. coli products on Western-blots, and to follow
processing of APP and its subcellular localization in transgenic
2 ~ 3 7 ~
-45-
animals. Such studies should permit the identification of the
functional role of APP in normal individuals and in individuals with
AD or DS. Minigenes pMTI-2324 and p.~TI-2325 (Figure 8a) for the
expression of APP-695 (IC-TAG) were each constructed in a single
step digestion and ligation procedure via a simple interchange of
AccI and ~glII fragments. Plasmid pMTI-35 DNA was digested with
AccI and BglII. An -1.6 kb AccI a-~elII fragment of pNTI-35 was
gel-purified and ligated èither into the AccI and BglII sites of the
gel-purified large DNA fragment of pMTI-2314 to generate pMTI-2325
(Figure 8a) or into the AccI and BelII sites of the gel-purified
large fragment of pMTI-2323 to generate pMTI-2324 (Example 9, Figure
lOa). Diagnostic miniprep analysis of pNTI-2324 DNA digested with
HindIII revealed fragments of ~1.3, -4.4 and -7.7 kb. Diagnostic
miniprep analysis of pNTI-2325 DNA digested with AatII revealed
fragments of -4.2, -3.3, -3.1, -0.6 and -.055 kb. In an analogous
manner, the -1.6 kb AccI-~glII fragment of pMTI-35 can be ligated
into the AccI and BglII sites of ~he gel-purified large DNA fragment
of pMTI-2329 (Example 9, Figure 14) to generate pMTI-2335.
EXAMPLE 9
APP Minigenes with Metallothionein-
Derived Regulator or Processing Sequences
A. APP Minigenes with Metallothionein-Derived RNA Processing
Si~nals
Minigenes utilizing RNA processing signals derived from an
exogenous mouse gene might be more efficiently expressed in
transgenic mice as compared with minigenes utilizing SV40-derived
~NA processing signals as described in Examples 4-8 above.
Therefore, alternate minigene constructs were generated in which RNA
splicing and polyadenylation sequences of the mouse netallothionein
gene were utilized. One source of the mouse metallothionein gene is
plasmid pJYMMT(L) (alternatively designated pCL-28 or T25). Plasmid
pJYMMT(L) is an -12.4 kb genomic clone of the metallothionein gene
described by Hamer and Walling, 1982, J. Mol. App. Gen. 1: 274-28c.
This alternate series of minigenes utilizing metallothionein RNA
signals was constructed using pJYNMT(L). Many of these alternate
-46-
minigenes were generated via fragment swaps using the minigenes
containing SV40 RNA signals described in Examples 4-8.
1. Alternate Minigenes Exp~essing APP-695. APP-770 and APP-751
A minigene utilizing mouse metallothionein-I gene RNA
processlng signals (splicing and polyadenylation) and expressing APP-
695 was constructed in a single step as follows. A Klenow- treated
~2.2 kb ~g~ EcoRI fragment of pJYMMT(L) containing all of the mouse
metallothionein-I genomic gene sequence except the promoter was
inserted by blunt-end ligation into the ClaI site of plasmid pMTI-
2312 DNA (Example 4) that had been digested with ClaI, and treated
with Klenow and CIAP to generate plasmid pMTI-2323 (Figure lOa and
lOb). Plasmid pMTI-2323 was selected in a two-step screening
procedure. First, transformant plasmids from the blunt-end ligation
were screened by colony hybridization using the insert fragment
(-2.2 kb BelII-EcoRI) of pJYMMT(L) labelled with 3ZP as probe.
Colony hybridization was used as a first step in screening a variety
of constructs disclosed herein when the background of transformant
plasmids that were vector alone (i.e., no insert) was high. In the
second screening step, the desired plasmid was selected from those
positively hybridizing colonies by miniprep analysis of restriction
endonuclease digested DNA. For pMTI-2323 (~13.3 kb), miniprep
analysis using HindIII revealed fragments of -7.7, -4.4 and -1.3 kb.
Minigenes utilizing metallothionein RNA signals and expressing
APP-770 or APP-751 can be constructed via AccI-BglII fragment
exchanges (Figure lOa) with either pMTI-3521 or pMTI-3524 (Example
3) respectively. Specifically, the -1.8 kb AccI-~glII fragment of
pMTI-3521 was inserted into the AccI-~glII sites of pMTI-2323,
replacing the -1.5 kb AccI-~glII fragment of pNTI-2323, to generate
plasmid pMTI-2331 (Figure lOa). For example, for pMTI-2331, pMTI-
2323 DNA was digested with AccI and aglII and the -11.8 kb fragment
was gel-purified, treated with CIAP and ligated with the -1.8 kb
AccI-~glII fragment that was gel-purified from pMTI-3521 DNA. The
ligation mixture was used to transform E. coli DH5~ cells. The
desired plasmid, pMTI-2331 (-13.3 kb), was identified by miniprep
analysis. Using ScaI, miniprep analysis of pMTI-2331 revealed
fragments of -9.0 and -5.0 kb.
.,
.
2 ~ 7 ~
-47-
2. Alternate Minigenes Expressing APP C-Terminal Frameshift
Mutants
A minigene utilizing metallothionein RNA signals and expressing
a truncated APP protein was constructed via a fragment swap using
minigene pMTI-2322 (Example 6, Figure 8a) containing SV40 RNA
signals. Specifically, the -0.7 kb ~lII-ClaI fragment of pNTI-
2322 containing mutation 40-1 (Example 6), was inserted into pNTI-
2312 (Example 4, Figure 7a), via ligation of the -0.7 kb fragment of
pMTI-2322 with the -10.5 kb ~glII-ClaI fragment of pMTI-2312 (that
had been gel-purified and treated with CIAP prior to ligation), to
gsnerate pMTI-2326a. Miniprep analysis of the -11.2 kb pMTI-2326a
DNA using HindIII revealed fragments of -7.8 and -3.4 kb. Then, the
-2.2 kb BglII-EcoRI metallothionein fragment of pJYMNT(L) was
inserted into the ClaI site of pMTI-2326a by blunt-end ligation to
15 generate pMTI-2326. Miniprep analysis of the -13.4 kb pMTI-2326 DNA
using ~lgdIII revealed fragments of -7.7, -4.4 and -1.3 kb.
Alternatively, plasmid pMTI-2326 can be constructed in a one-step
fragment swap. Specifically, the ~0.6 kb BglII-SpeI fragment of
pMTI-2322 (Example 6, Figure 8a) can be inserted directly into pMTI-
20 2323, replacing the -0.6 W ~ p~I fragment of pMTI-2323 to
8enerate pMTI-2326 (Figure lOa). Alternative minigenes can be
generated by analogous ~lII-S~eI fragment exchanges between pMTI-
2323 and constructs encoding alternate truncated forms of APP-695
(Examples 6 and 7).
25 3. Alternate Minigenes Ex~ressing C-100 (Plasmid pMTI-2327) and
MC-100 (Plasmid pMTI-2337) APP Mutants
A minigene utilizing metallothionein RNA signals and coding
for the ~utation designated C-100 (gene product VI, Figure 4b) was
30 generated by deleting the -1.8 kb NruI-~glII fragment of pMTI-2323
~this example, part A) with blunt-end ligation to generate plasmid
pMTI-2327 (Figure lla). Plasmid pMTI-2323 DNA was digested with
NruI and BglII; the -11.5 kb fragment was gel-purified, treated with
Klenow, ligated, and used to transform ~. coli DH5~ cells.
Transformant plasmids were screened by miniprep analysis and the
desired plasmid pMTI-2327 was selected. Miniprep analysis of pMTI-
2327 DNA using ~i~dIII revealed fragments of -7.7, -2.6 and -1.3 kb.
.
',
' `~ ' '
- . . .
.
2 ~
-48-
A translation initiation codon, ATG, directly precedes the first
codon of the A4 sequences in C-100.
A minigene for expressing the mutation designated MC-100 (gene
product V, Figure 4b) was also prepared from plasmid pMTI-2323 to
generate pMTI 2337 (Figures lla and llb). Specifically, pMTI-2337
was generated by deleting the ~1.7 kb ~ 21II fragment of pMTI-
2323 via gel purification of the ~11.6 kb fragment and ligating using
a synthetic oligonucleotide linker, sp-spacer-A4. The linker sp-
spacer-A4 was inserted between the ~e~I site at position 207 and the
BglII site at position 1915 in APP-695, and had the following
sequence:
5'-GGACGGAGGA-3' 10-mer
3'-CATGCCTGCCTCCTCTAG-5' 18-mer
The two oligonucleotide sequences that comprise sp-spacer-A4 were
synthesized (using an Applied Biosystems instrument and
manufacturer's recommended methods, model no. 380A DNA Synthesizer),
kinased and annealed according to conventional methods before
ligation with the gel-purified -11.6 kb KpnI-BglII fragment of pMTI-
2323 to generate pMTI-2337. Miniprep analysis of pMTI-2337 DNA with
HindIII revealed fragments of -7.7, -2.6 and -1.3 kb.
MC-100 requires the 17 residue signal peptide of APP to direct
translation and insertion of the mutant protein into the membrane.
The signal peptide will be clea~ed and eliminated during the membrane
insertion. The nucleotide and amino acid sequence of MC-100 is shown
in Figure 12.
4. Alternate Minigene Ex~ressing A4 Pe~tide (Plasmid pMTI-2341)
A minigene utilizing metallothionein RNA signals for expressing
the A4 peptide (gene product VII or sp-A4, Figure 4b) was prepared
by deleting the -11.6 kb KpnI-BglII fragment of plasmid pMTI-2326
(this example, part A,2) and ligating using the sp-spacer-A4 linker
(described in part A,3 above) to generate plasmid pMTI-2341.
Minigene pMTI-2341 generates sp-A4, which an A4 peptide linked to the
APP signal sequence. The nucleotide and amino acid sequence of sp-
A4 is shown in Figure 13.
.
,
. . . ;
~6~7 ~
-49-
B. APP Minigenes Uith A Metallothlo~ç~n Derived Promoter
The generation of transgenic mice which express APP (or
derivatives of APP) in cells and tissues not normally expressing the
gene may lead to dominant phenotypes. The new pheno~ypes may
facilitate a better understanding of the function of APP. To this
end, a series of minigenes was constructed which minigenes are under
the regulation of the mouse metallothionein gene promoter (Figure
14).
1. Alternate minigenes expressing APP-695~ APP-770 and APP-751
A minigene utilizing a metallothionein promoter and expressing
APP-695 was constructed as follows. Plasmid pMTI-2301 DNA (Example
4) was digested with HindlII, treated with Klenow and CIAP. Plasmid
pJYMNT(L) DNA (part A above) was digested with EcoRI. An -4.0 kb
EcoRI fragment was gel-purified, treated with Klenow and blunt-end
ligated to the pMTI-2301 DNA treated as described above. The desired
transformant plasmid was designated pMTI-2328 (-6.7 kb). In the next
step, the pMTI-2328 DNA thus obtained was digested with ~glII,
treated with Rlenow and CIAP, gel-purified and then blunt-end ligated
to an -2.8 kb gel-purified SmaI-HindlII fragment of pMTI-2314 (-11.8
kb, Example 4). Transformant plasmids were screened by miniprep
analysis and the desired plasmid pMTI-2329 (Figure 14) was selected.
Miniprep analysis of pMTI-2329 DNA using EcoRI revealed fragments of
-3.7, 3.1 and -2.7 kb.
Minigenes utilizing a metallothionein promoter from pMTI-2329
and expressing APP-770 or APP-751 are constructed via fragment swaps
with pMTI-2319 (alternatively, pMTI-2331 or pMTI-2342) or pMTI-2320
(alternatively, pMTI-2345), respectively. Specifically, an -7.4 kb
AccI-SpeI fragment is gel-purified and ligated with an -2.4 kb AccI-
SpeI fragment of pMTI-2319 or pMTI-2330 to yield pMTI-2333 for APP-
770 expression and pMTI-2334 for APP-751 expression, respectively.
2. Alternate Minigenes Expressing APP C-Terminal Frameshift
Mutants
By a similar fragment swap, a minigene utili~ing a
metallothionein promoter and expressing a truncated APP protein is
constructed. Specifically, an -2.1 kb AccI-SpeI gel-purified
fragment of pMTI-2322 (alternatively, pMTI-2343 or pNTI-2326)
!
'` ~ ' . .
~ ' . .
7 ~
so
containing mutation 40-1 (Example 6) was ligated with the -7.4 kb
AccI-SpeI gel-purified fragment of pMTI-2329 described above.
3. Alternate Minigene Expressing MC-100 APP Mutants
An alternate minigene for the expression of the ~C-100 mutation
(part A above) using a metallothionein promoter may also be prepared.
For example, the -1.7 kb ~ glII fragment of pMTI-2329 may be
deleted via digestion with ~e~I and ~elII, then gel purification of
the -7.8 kb ~nI-~glII fragment and finally ligation with the sp-
spacer-A4 (part A above). The desired plasmid i9 confirmed by
sequence analysis.
EXAMPLE 10
APP ~inigenes with Genomic APP-Derived RNA Processing Signals
APP minigenes utilizing RNA processing signals derived from
the human APP gene might be more efficiently expressed in transgenic
mice as compared with minigenes described in Examples 4-8 above
utilizing SV40 derived RNA processing signals or minigenes described
in Example 9 above utilizing metallothionein gene-derived signals.
Therefore, minigene constructs were generated in which RNA
polyadenylation signals of the human APP gene were utilized. The
source of the human APP genomic sequences for these constructs was
plasmid pVS-l. Plasmid pVS-l is an -4.3 kb genomic clone of the
human APP gene which comprises an -1.5 kb EcoRI genomic fragment
inserted into the EcoRI site of pUCl9 in the orientation shown in
Figure 15a, so that the APP polyadenylation signal can be recovered
as an -1.3 kb ~ihI fragment. The -1.5 kb EcoRI fragment encompasses
the 3'-end of the terminal exon of human APP and the APP
polyadenylation signal and was isolated as follows. A Charon 21A
lambda library of human chromosome 21 DNA (available from the
A.T.C.C. as accession no. LA21NS01) was screened for clones
containing 3'-end genomic sequences with a small SmaI-~e~I fragment
(nucleotides 3102-3269) from plasmid pFC4 labelled as a probe. The
nucleotide sequence of the -1.5 kb APP genomic fragment is shown in
Figure 16. An alternate saries of minigenes utilizing APP RNA
signals derived from pVS-l were constructed. Many of these alternate
minigene9 were generated ~ia fragment swaps using pNotSV2neo
-51- ~ 7
subclones of the APP constructs. These pNotSV2neo s~bclones were
utilized for switching sequence domains via fragment swaps because
of the presence of convenient PvuI and ~I restrlction enzyme sites.
NotI fragments of many of the APP minigenes described in Examples 4-
8 were subcloned into pNotSV2neo tsee Figures 17 and 18a) so that APP
expression could be determined in transient transfections of COS
cells (Gluzman, 1981, Cell ~: 175-182). Plasmid pNotSV2neo tFigure
17) was prepared by converting the unique ~HI site of pSV2-neo
(available from the A.T.C.C. as accession no. 37149) to a NotI site
10 using linkers (NEB catalog no. 1045). Plasmid pSV2-neo was digested
with ~HI, treated with Klenow and CIAP, and ligated to NotI linkers
as recommended by the supplier. The pNotSV2neo subclones of the APP
constructs used in the preparation of alternate Dinigenes were
prepared as summarized in Table I below and Figure 18a. The
construction of each of the APP minigenes utilizing APP genomic RNA
processing signals from pVS-l listed in Table I is described below.
- ~
~ r~ ~
.
TABLE I
pNotSV2neo APP Subclones
Subclone APP Sequence Insert in p~otSV2neoa
pMTI-2360 APP-695 -10.6 kb ~I fragment of
pMTI-2323
pMTI-2362 APP-695 -6.8 kb NotI fragment of
pMTI-2329
pMTI-2369 APP-695 -9.8 kb MotI fragment of
pMTI-2339
pMTI-2363 APP-770 -10.8 kb NotI fragment of
pMTI-2331
pMTI-2368 APP-751 -9.2 kb NotI fragment of
pMTI-2320
pMTI-2361 Mutation 40-1 -10.8 kb NotI fragment of
pMTI-2326
pMTI-2364 MC-100 ~8.0 kb NotI fragment of
pMTI-2340
pMTI-2366 MC-100 -8.8 kb NotI fragment of
pMTI-2337
pMTI-2365 Sp-A4 -8.8 kb NotI fragment of
pMTI-2341
pMTI-2367 ~-gal -8.6 kb NotI fragment of
pMTI-2402
~ For preparation of the subclones, each insert was gel-purified
and ligated into pNotSV2neo vector DNA that had been digested with
NotI, gel-purified and treated with CIAP.
A. Alternate Minigenes Expressing APP-695. APP-770 and APP-751
~Plasmids pMTI-2339. pMTI-2342 and pMTI-2345~
The minigene construct designed to express APP-695 was
generated by inserting an -1.3 kb Sphl fragment from pVS-l into the
SehI site of pMTI-2312 (Exa~ple 4) to generate pMTI-2339 (Figures
15a and 15b). Minigene pMTI-2342 expressing the APP-770 alternate
form of APP was generated by inserting the -6.9 kb PvuI-SpeI fragment
of pMTI-2363 (Table I, Figure 18a) into the PvuI-SpeI fragment of
pMTI-2369 (Figure 19). Plasmid pMTI-2369 was itself generated by
2 ~
-53-
inserting the ~9.8 kb ~I fragment of pMTI-2339 into pNotSV2neo
(Table I and Figure 19). Minigene pMTI-2345 expressing the APP-751
alternate form of APP was generated analogously by inserting the -6.9
kb PvuI-S~eI fragment of pMTI-2368 (Table I) into the -8.8 kb PwI-
SpeI fragment of pMTI-2369 (Table I).
B. Alternate Minigene~ fQ~y_~xpressing C-Terminal Frameshift
Mutants
1. Mutant 40-1 (Plasmid pMTI-2343)
Minigene pMTI-2343 expressing the 40-1 frameshift mutant was
generated by a fragment swap. The -6.7 kb PvuI-S~eI fragment of
pMTI-2361 (Table I, Figure 18a) was inserted into pMTI-2369 (Figure
19) ~
C. Alternate Minigene For MC-100 Mutant
Minigene pMTI-2340 expressing the MC-100 deletion mutant was
generated by deleting an -1.7 kb ~a~ glII fragment of pMTI-2339
(Figures 15a and 15b) and ligating using the sp-spacer-A4 synthetic
linker described in Example 9 above.
D. Alternate Mini~ene for A4 Peptide
Minigene pMTI-2344 expressing the A4 peptide was generated by
a fragment swap (Figure 19). The -5.0 kb PvuI-SpeI fragment of pMTI-
2365 (Table I, Figure 18a) was inserted into the -8.8 kb ~y_I-SpeI
fragment of pMTI-2369 (Figure 19).
E~LWPLE 11
Preparation and Analysis of Transgenic Mice
Espressing APP Minigene3
Transgenic mice are mice that contain exogenous DNA integrated
into their genomes (Gordon and Ruddle, 1981, Science 214: 1244-
1246). The DNA thereby integrated is called a transgene. APP
minigenes prepared as described in Examples 4-10 may be used to
prepare corresponding transgenic mice expressing these transgenes.
The technical aspects of the procedure for preparing transgenic mice
have been the subject of extensive review by Gordon and Ruddle, 1983,
Methods Enzymol. lOlC: 411-433, and Hogan et al., 1986, Manipulation
of the Mouse Embryo: A Laboratorv Manual, Cold Spring Harbor Lab.,
Cold Spring Harbor, NY, and are hereby incorporated by reference.
., ~ . .
-
2 ~ 'd 7
-54-
The general procedure involves gene transfer by microinjection.
Fertilized l-cell mouse embryos are dissected from superovulated
female mice [strain: Hsd:(ICR)BR] mated with male mice (strains: Hsd:
(ICR)BR or B6D2Fl/HsdBR). Transgenic mice generated from a
homozygous, or inbred, strain of mice are created using embryos from
C57BL/6NHsdBR mating partners. Embryos are cultured in vitro as
described in Hogan et al. (suDra). Microin~ections were performed
as described in DePamphilis et al., (supra). Approximately 100 to
500 copies of a linear NotI fragment (-6-11 kb in size) of an APP
minigene (listed in Table II) are loaded into a microinjection pipet
and expelled into one of the pronuclei of a l-cell mouse embryo.
Approximately 1 to 3 pl of DNA in;ection fragment solution
(approximately 5-lO ~g/ml linear DNA, 0.3 mM EDTA, and lOmM Tris pH
7.5) is injected into a pronucleus of each l-cell embryo. During
injection, mouse embryos are held in-place by a microscopic cell
holder. Surviving embryos were then surgically reimplanted into
pseudo-pregnant foster mice (strain: Hsd:(ICR)BR) as described in
DePamphilis et al. (supra) and Hogan et al. (su~ra). Progeny mice
are born approximately 19 dayq post-implantation and approximately
10-30% of the progeny are transgenic (i.e., their chromosomes carry
one or more copies of the in~ected APP minigene) and are designated
as transgenic founders. Positive transgenic mice are designated by
either Southern-blot or PCR analysis of tail-biopsy DNA (See below).
Transgenic founder mice are bred with appropriate partners, strain:
Hsd:(ICR)BR for outbred strain background, or C57BL/6NHsdBR) for
inbred strain background, to generate heterozygote Fl progeny.
Transgenic siblings (Fl) are then inbred to generate a homozygous
(for transgene) line of mice. Glass cell-holders are
constructed using borosilicate glass capillaries (l~m od. and 0.58m~
30 id.; from Sutter Instruments Co., San Rafael, CA, part #B100-58-15)
on a microfuge (de Fonbrune-type; Technical Products International
Inc., St. Louis, M0). The tips of the cell-holders are fire-
polished and have a diameter of approximately 50 microns.
Microinjection pipets are beveled and have a diameter of
approximately 2 microns at their terminus. To make microin;ection
pipets, glass capillaries (lmm od. and 0.78mm id.; from Sutter
.
2 ~ ~ ~ O I
-ss-
Instruments Co., part #B100-78-15) were pulled on a Sutter
Instruments Co. micropipet puller (model #P-80/PC) and then the tips
were beveled on a Sutter micropipet beveler (model #BV-10; bevel
angle approximately 25 to 30). Pulled pipets are siliconized by
incubation in a glass chamber saturated with hexamethyldisilazane
(HMDS; Pierce #84769) for approximately 8 hour~ at room temperature.
Microin~ections are performed on a Zeiss IM-35 inverted microscope
using Nomarski optics. Microinjection pipets and cell holders are
controlled using Narishigi (Japan) micromanipulators (model #MO-
102M and #MN-2). The flow of the injection solution in
microinjection pipets is controlled using an Eppindorf Microinjector
(model #5242). Surgical reimplantations are performed using a Zeiss
SV8 dissection microscope.
DNA in;ection fragments were isolated from vector sequences
by NotI digestion and agarose gel electrophoresis. Linear DNA
fragments were recovered from the agarose gels by electrophoresis
onto a NA45 membrane (Schleicher and Schuell, catalog no. 23410).
The NotI linear DNA fragment was recovered from the membranes
according to the manufacturer's instructions. Ethidium bromide was
extracted from the DNA solution using isopropanol (buffer saturatet,
1 mM EDTA and 10 mM Tris pH 7.6). DNA was precipitated by addition
of a half volume of 7.5 M ammonium acetate and then by 2.4 volumes
of absolute ethanol. The DNA pellet was resuspended in TE buffer (1
mM EDTA and 10 mM Tris pH 7.6) and then reprecipitated in ammonium
acetate and ethanol as described above. DNA was reprecipitated a
total of three to four times. DNA in;ection fragments were finally
resuspended in injection buffer (0.3 m~ EDTA, and 10 mM Tris pH 7.5).
DNA concentration of the fragment was estimated by ethidium bromide
staining on diagnostic agarose gels against known concentrations of
DNA as standards. Fragments obtained in this manner were diluted to
a concentration of 5 ~g/ml.
Positive transgenic mice are identified by either Southern-
blot or PCR analysis of tail-biopsy DNA. Southern-blot analysis is
performed as described in Uirak et al~, 1985, Mol. Cell Biol. 5:
35 2924-2935 and Maniatis et al. (supra). PCR analysis of tail-biopsy
DNA is described below.
-56-
Tail biopsies are performed by dissecting approximately 1 cm
of mouse tail from each mouse. Tail segments are cut into small
fragments and incubated in 1.0 ml of tail extraction buffer (0.5
mg/ml proteinase K, 0.5~ SDS, 100 mM EDTA, and 50 mM Tris pH 8.0)
at 55C for 12 to 16 hours. Samples are then extracted with 1.0 ml
phenol (equilibrated with 1 mM EDTA and 10 mM Tris pH 7.6). The
samples were further extracted with addition of 1.0 ml of CIA
(chloroform: isoamylalcohol; 24:1). Samples are centrifuged at
10,000 x g for 10 minutas at room temperature and 0.7 ml of the
aqueous phase is transferred to an Eppendorf tube. DNA is
precipitated at room temperature by addition of 0.07 ml sodium
acetate, pH 6.0, and 0.7 ml 100~ ethanol. DNA is pelleted by
centrifugation at 12,000 x g for 2 minutes at room temperature.
Ethanol is decanted and DNA pellets are washed with 1.0 ml 70%
ethanol and samples are centrifuged at 12,000 x g for 1 minute at
room temperature. DNA pellets are dried in vacuum and resuspended
in 0.05 ml TE (1 mM EDTA and 10 mM Tris pH 7.6). Samples are
incubated at 55C for 5 minutes and then refrigerated overnight to
rehydrate DNA. DNA concentrations were determined by reading
absorbance at 260 nm in a spectrophotometer.
PCR analysis of tail-biopsy DNA was performed using two sets
of oligonucleotides; one set (either oligonucleotides #11 and #12
or #40 and #41) which generates a 322 bp or 320 bp DNA fragment,
respectively. These oligonucleotides amplify DNA sequences
specifically from human APP minigenes. A second set of
oligonucleotides (oligonucleotides #6 and #7) is included with each
reaction which serves as an internal control for the PCR reaction
and which amplifies a 154 bp DNA fragment from the mouse ribosomal
protein L32 gene (Dudov and Perry, 1984, Cell 37: 457-468). The
sequences of the oligonucleotides are as follows:
oligonucleotide #6:
5'-CCTCGGCCTTTGGTGTGTGTTTTATATGACATGACCCCCTTGA-3'
oligonucleotide #7:
5'-CACCCCTGTTGTCAATGCCTCTGGGTTTCCGCCAGTTTCG-3'
oligonucleotide #11:
5'-ATGMCTTCATATCCTGAGTCCATGTCGGMTTCT-3'
,
`
- 2 ~ 7 ~J
-57-
oligonucleotide #12:
5'-GGCAACATGATTAGTGAACCAAGG-3'
oligonucleotide #40:
5'-GGAGGGTGCTCTGCTGGTCTTCAATTACC-3'
oligonucleotide #41:
5'-AAGGGTTTGTCCAGGCATGCCTTCCTCATCC-3'
The PCR reaction conditions are: 50 ~g/ml DNA, 5.0 ~g/ml of each
oligonucleotide, 25 units/ml Taq polymerase (Cetus), 0.2 mM dATP,
0.2 mM dGTP, 0.2 mM dCTP, 0.2 mM TTP, 50 mM KCl, 1.5 mN MgCl2, 0.01~
gelatin, and 10 mM Tris pH 8.3. In many cases the oligonucleotides
are end-labelled with 32p using polynucleotide kinase as described
in Example 13. The specific activity of each ollgonucleotide is
approximately 2 x 105 cpm/~g. The PCR reactions are performed in a
Perkin Elmer DNA thermal cycler using the following reaction cycles
(files): twenty-one cycles of 1 minute at 94C, then 2 minutes at
55C, then 3 minutes at 72C with an auto extension for sequence 3
of 10 seconds/cycle, followed by a cycle of 1 minute at 94C, then
2 minutes at 55C, then 12 minutes at 72C with an auto extension for
sequence 3 of 10 seconds/cycle. The samples are then maintained at
18C until removal from thermal cycler. DNA fragments are separated
by electrophoresis on a 5~ polyacrylamide gel and visualized by
either staining with ethidium bromide or by radioautography.
Table II shows a number of APP minigene constructs useful for
the preparation of transgenic mice. Table III shows a listing of
representative APP transgenic founder mice generated according to
the above-described methods. The transgenic founder mice are bred
to establish permanent strains as described above. Table III also
summarizes RNA and protein expression of APP minigenes in various
transgenic mice as described in Examples 12, 13, 14 and 15.
; ' .
-58- 2~4~7
TABLE II
APP MINIGENE CONSTR~CTS
Promoter and Splicing and/
Genomic or Poly-
Regulatory APP cDNA Adenylation
Construct Elements Sequences Signals
pMTI-2310 ~2.4kb HindIII (APP) APP-695 (pFC4) SV40
pMTI-2314 -4.6kb EcoRI (APP) APP-695 (pFC4)
pNTI-2319 APP-770 (pFC4-770)
pMTI-2320 APP-751 (pFC4-751)
pMTI-2321 APP-695 +2 frame
shift
pMTI-2322 APP-695 - mutant
40-1
pMTI-2325 APP-695 + Chlamvdia
antigen
pNTI-2318 A4
pMTI-2323 ~4.6kb ~çQRI (APP) APP-695 (pFC4) Mouse
metallo-
thionein
pMTI-2331 APP-770
pMTI-2332 APP-751
pMTI-2324 APP-695 + Chlamvdia
antigen
pMTI-2326 APP-695 - mutant
40-1
pMTI-2327 C-100
pMTI-2337 MC-100
pMTI-2341 A4
pMTI-2329 -2.2 kb EcoRI/BglII APP-695 ~pFC4) Mouse
mouse metallothionein metallo-
thionein
pMTI-2333 APP-770
pMTI-2334 APP-751
pMTI-2335 APP-695 + Chlamvdia
antigen
pMTI-2336 APP-695 - mutant
40-1
pMTI-2330 APP mutant 40 -
alternative con-
struct
. ~ .. . . . .. .
.
204~7
-59-
Promoter and Splicin~ and
Geno~ic Poly-
Regulatory APP cDNA Adenylation
Construct Elements Se~uences Si @als
pMTI-2339 -4.6kb EcoRI (APP) APP-695 APP 3'-end
pNTI-2342 APP-770
pMTI-2345 APP-751
pMTI-2343 Mutant 40-1
pMTI-2340 MC-100
10 pMTI-2344 sp-A4
- ~ ,
.
.:
:, .
:
, .
-60- 2~ 77
TABLE III
Transgenic ~ouse Strains with ~uman APP ~inigenes
Strain Transgenic Gene Exp~ession (brain)
Constructs Designation Founders RNA Protein
s
pMTI-2401 HB HB805
HB909
HB1002
pMTI-2402 BE BE803
BE1805 . +
BE3002 . +
pMTI-2310 DH DH106
DH108
DHllO
DH409
pMTI-2314 ED ED106
ED801
ED803
ED1001 +
pMTI-2318 AE AE101
AE201
AE601
AE301
AE302
pMTI-2319 JE JE711
JE1005
JE1308
pMTI-2320 IE IE205
IE206
IE301
IE302
IE504
IE505
IE508
IE602
IE606
IE608
IE801
IE803
pMTI-2321 FE FE403
FE803
FE805
FE1001 +
pMTI-2322 GE GE106
GE107
- 2~00~7
-61-
Strain Transg~nic Gene ~xpression (brain)
Constructs Designation Founders RNA Protein
pMTI-2323 DM DM101 ++
DM301
DM309
DM405
DM407
DM406 +
DM606 +
DM706
DM1007
DM1102
DM1107
DM1110
15 pMTI-2329 DL DL110
DL413
pMTI-2331 JM JM201
JM316
pMTI-2344 SA SA110
SA SA602
SA SA706
pMTI-2343 FA FA105
FA201 +
FA501
FA510
FA1001
pMTI-2340 CA CA507
CA408
CA507 +
CA1102 - .
CA3603
CA3701
CA3704
CA4402
CA4404
pMTI-2342 JA JA407 ++ +
JA1301 ++ +
JA1302
+ EXPRESSION
- EKPRESSION NOT WITH LIMITS OF DETECTION
. NOT DETERMINED
. ~.. ~- - . :
.
,
, .
.
.. ,. .. ~ : .
, ' ', ., ~,
.
' ., ~ :
.
~ r~
-62-
EXAMPLE 12
Tissue-Speclfic E~pression of APP Ninigene
in Transgenic Nice Uslng the lacZ Reporter Gene
The design of recombinant minigenes is a critical step in the
generation of a transgenic mouse model for A4-amyloidosis. An
essential element is a gene-regulatory region required for tissue-
specific gene expression. Minigene constructs should exhibit
expression patterns in transgenic animals which are consistent with
the occurrence of amyloid in AD brains and preferentially resemble
expression patterns of the endogenous mouse APP gene. For this
purpose, the human APP gene regulato~y region was isolated as
described in Example 1, and utilized for the construction of APP
minigenes. To monitor the tissue specificity of this human
regulatory element in transgenic mice, a reporter gene, E. coli lacZ,
encoding ~-galactosidase was utilized. This reporter gene allows for
the convenient histochemical localization of protein expression
regulated by the human APP gene regulatory region. Using this
reporter gene, the 5'-end sequences of the human APP gene were
demonstrated to contain sufficient information to target expression
in the CNS of transgenic animals with patterns consistent with
endogenous ~ouse APP gene expression as iollows.
The minigene pMTI-2402 (Figure 20) was constructed by fusing
the -4.6 kb EçQRI fragment tescribed in Example 1 comprising the
human APP gene regulatory region including the APP promoter, with
the lacZ reporter gene in the following steps. First, the cloning
vector pMTI-2301 was prepared. Plasmid pMTI-2301 contains a unique
HindIII cloning site, flanked by ~I restriction sites, and was
constructed as described in Example 4. Second, the ~4.6 Xb EcoRI
fragment isolated from the chromosome 21 library as described in
Example 1 encompassing the 5'-end of the human APP gene was inserted
by blunt-end ligation into the HindIII site of pMTI-2301 to generate
pMTI-2307. Finally, minigene pMTI-2402 containing the lacZ gene was
constructed by inserting an -3.9 kb HindIII-BamHI fragment from
plasmid pCH126, containing the lacZ fusion protein and SV40
polyadenylation signal, into the ~I site of pMTI-2307 by blunt-
end ligation. Plasmid pCH126 i9 identical to plasmid pCHllO
described by Hall et al., 1983, J. Mol. Appl. Gen. 2: 101-109, except
`
.
- -
7 7
-63-
that the SV40 promoter tthe uII-_i~dIII fragment. See Figure 1 in
Hall et al., 1983, J. Mol. Appl. Gen. 2: 101-109.) has been deleted
but the HindIII site remains. (Goring et al., 1987, Science 235:
456-458).
Plasmid pNTI-2402 DNA was double-purified in CsCl/ethidium
bromide equilibrium density gradients. The -8.6 kb linear DNA
fragment, encompassing the APP/lacZ reporter gene, was excised from
vector sequences using NotI and isolated from an agarose gel using
NA45 paper (Schleicher and Schuell, ~eene, NH). The DNA was
precipitated in ethanol-ammonium acetate three times and resuspended,
at a concentration of 6 ~g/ml, in filtered (0.2 ~ membrane) in~ection
buffer (10 mM Tris, pH 7.5, and 0.3 mM EDTA; Brinster et al., 1985,
Proc. Natl. Acad. Sci. USA 82: 4438-4442). Purified DNA fragments
were microinjected into l-cell embryos of Hsd:(ICR)BR female mice and
B6D2Fl/Hsd BR male mice and reimplanted into Hsd:(ICR)BR female mice
as described (DePamphilis et al, 1988, BioTechniques 6: 662-680).
Transgenic founder mice were identified by PCR analysis of tail
biopsy DNA using 30 bp oligonucleotides #15 and #16, complementary
to the E. coli lacZ gene and internal control oligonucleotides #6 and
20 #7 (described in Example 11). The sequence of oligonucleotides #15
and #16 are as follows:
#15 S'-CCTGGCGTTACCCM CTTM TCGCCTTGCAGCACAT-3'
#16 5'-AATAAATGTGAGCGAGTAACAACCCGTCGGATTCT-3'
DNA from transgenic mice was further analyzed by restriction enzyme
2~ digestion and Southern-blot analysis (Wirak et al., 1985, Mol. Cell.
Bio. 5: 2924-2935).
A. In situ bvbridization
In ~ hybridization techniques were used to establish the
cellular distribution of APP mRNA in normal mice. The distribution
of APP mRNA within the central nervous system (CNS) of other species
(humans, primates, rats) has been previously determined with the
ma~ority of the CNS APP mRNA localized to neuronal cytoplasm. For
these experiments, four-to-five-week-old mice were anesthetized and
perfused with 4~ paraformaldehyde in 0.08 N phosphate buffer, pH
7.6. The following tissues were removed and processed to paraffin
by standard procedures: cerebral hemispheres plus diencephalon,
... ., .. - , . . , :
: ,, ' ';
- .
.
' ' ' ~ ;.
'
-64-
pons, medulla, cervical and lumbar spinal cord, trigeminal nerve,
and liver. All tissues from individual mice were embedded in a
single block. Sections were cut at a thickness of 6 ~m and
hybridized according to published procedures tTrapp et al., 1987,
Proc. Natl. Acad. Sci. USA 84:7773-7777; Trapp et al., 1988, J. Neuro
Sci. 8: 3515-3521). Briefly, pre-hybridization treatment consisted
of 0.2 N HCl for 20 minutes and 25 ~g/ml protease K for 15 minutes
at 37C. Slides were hybridized at room temperature for 16 hours in
a standard buffer containing 0.2 ng/~l of single-stranded, full-
length human APP cDNA, labeled with 35S by the Klenow procedure
(specific activity, 2.3 x 109 cpm/~g). Stringency washes included
50~ formamide containing 0.3 M NaCl, 1 mM EDTA, and S mM Tris (pH
8.0) for 30 minutes at room temperature and 2 X SSC (1 X SSC - 0.3
M NaCl, 0.03 ~ sodium citrate, pH 7.4) in 1 mM EDTA for one hour at
55C. Slides were then dehydrated, air dried, dipped in emulsion
(Kodak, NTB-3), exposed for 7 days, developed for autoradiography
and counter-stained with hematoxylin. Sections were photographed
with a Zeiss Axiophot using dark-field and bright-field optics.
Specific brain regions and neuronal subpopulations were identified
according to published criteria (Sidman et al., 1971, ~tlas of the
Mou~e ~rain and Spinal Cord, Harvard University Presg, Cambridge,
MA). Silver grains, representing APP mRNA, occurred in clusters that
reflected the general distribution of neurons in all brain regions
studied (Figure 21). For example, neuronal perikarya present in the
pyramidal layer of the hippocampus and granular layer of the dentate
gyrus were labeled intensely (Figure 21a). Significantly less
hybridization signal was detected in other layers of the hippocampal
formation in subcortical white matter. The cerebral cortex contained
significant levels of APP mRNA (Figure 21a); and the labeling pattern
in ~arious cortical areas (i.e., occipital, temporal, and frontal)
reflected the distribution of neuronal perikarya in the various
layers. Layer I, which contains few neurons, had the lowest
hybridization signal in all cortical regions. In sections of
cerebellar cortex, Purkin~e and granular cells were labeled by APP
cDNA (Figure 21b). Sections of trigeminal ganglia (from peripheral
nervous system) were hybridized with APP cDNA and the neuronal
2~877
-65-
perikarya, which occur in clusters, were labeled intensely but little
hybridization signal was found in myelinated fiber tracts in the PNS
(Figure 21c). APP mRNA was not detected in sections of liver (Figure
21d), a finding consistent with Northern-blot analysis (Yamada et
al., 1989, Biochem. Biophys. Res. Commun. 158: 906-912). The
distribution of silver grains was concentrated within perinuclear
cytoplasm of neurcns (Figure 21e), Few silver grains were present
over neuronal nuclei or scattered throughout the neurophil.
B. Histochemical ~etection of ~-Galactosidase
For the light microscopic histochemical detection of ~-
galactosidase in the transgenic mice carrying the APP/lacZ reporter
gene, transgenic mice and normal mice as controls, four-to-five-
weeks of age, were anesthetized and perfused with 4~ paraformaldehyde
and 0.08 N phosphate buffer, pH 7.6. The CNS, trigeminal nerve, and
liver were removed and placed in the fixati~e overnight at 4C.
These tissues were cut into 0.5 cm thick slices that were either
stained histochemically for ~-galactosidase or sectioned at a
thickness of 20 ~m on a vibrating microtome prior to staining.
~-galactosidase activity was detected histochemically by
incubating the tissue in a reaction buffer [2.7 mM KH2PO4, 8.0 m~
Na2HPO47H20, pH 7.6, 2.7 mM KCl, 140 mM NaCl, 2 mM MgCl2, 22.5 mM
K~Fe(CN)5, 25.0 mM K3Fe(CN)5, 0.27 mg/ml sodium spermidine, 0.5 mg/ml
X-gal (20 mg/ml stock in diethylformamide), 0.02% NP-40, and 0.01
sodium deoxycholate] that was maintained at 30C for 18 to 24 hours.
Vibratome sections were infiltrated with 100~ glycerol, mounted on
glass slides, and then photographed with a Zeiss Axiophot microscope
using bright-field or Nomarski optics.
The tissue and cellular expression pattern of an APP promoter-
lacZ reporter gene in adult transgenic mice as determined by the
above-described histochemical method was strikingly similar to the
distribution of endogenous mouse and endogenous human APP mRNA.
Minigene pMTI-2402, for the expression of the reporter gene in
transgenic mice, was constructed as described above by inserting
sequences encoding a lacZ fusion protein and SV40 polyadenylation
signals into an -4.5 kb genomic fragment encompassing the 5'-end of
the human APP gene. The genomic fragment contains 2831 bp of
~ . . . ` .
.
~ .
2 ~
-66-
sequences 5' to the primary transcriptional start site, exon I, and
approximately 1.6 kb of the first intron. Three lines of transgenic
mice were identified which carried multiple head-to-tail integrations
of the intact reporter gene (Table III). Tissue distribution
analysis of the three lines showed that one line, BE803, exhibited
intense ~-galactosidase expression throughout the CNS, while two
lines (BE1805 and 8E3002) exhibited lower levels of expression.
In adult ~E803 mouse brain, staining was concentrated in
regions having high concentrations of neuronal perikarya (Figures
22 and 23a-c). Thus, cerebral cortex, dentate gyrus, basal ganglion,
thalamus, and regions of the hippocampus were stained intensely.
Prominent white matter tracts such as the corpus callosum and
internal and external capsule were not stained. Staining of brain
stem and spinal cord tissue was observed in a pattern similar to
endogenous mouse APP mRNA. ~-galactosidase was not detected in
slices of normal mouse brain, used as a control (Figure 23d).
Regions of cerebellar cortex that contain high concentrations
of neuronal perikarya were positive for ~-galactosidase (Figures 24a
and 24b) as were neuronal perikarya in the trigeminal ganglion.
White matter tracts in the cerebellum and trigeminal nerve (Figure
24c), and slices of liver (Figure 24d) from BE803 mice were negative
for ~-galactosidase. Identical ~-galactosidase staining patterns
were observed in tissue slices from several BE803 transgenic mice.
The cellular and subcellular distribution of ~-galactosidase was
determined in several brain regions by light microscopic procedures.
~-galactosidase was localized histochemically in 20-~m-thick
vibratome sections. In these sections, ~-galactosidase reaction
product occurred as small dots that were restricted to regions of
the CNS that contained neuronal perikarya. Reaction product was
detected in all layers of the cerebral cortex (Figure 25a), including
occasional deposits in Layer I. ~hen examined at higher
magnification with Nomarski optics, ~-galactosidase reaction product
was restricted to perinuclear regions of neurons (Figures 25b and
25c). ~-galactosidase was not detectable in endothelial cells and
cellular perikarya within white matter tracts. In the cerebellar
cortex, ~-galactosidase was localized in perinuclear regions of
.
; ~ , . , . . . .: ~ , .
~4~
-67-
Purkin~e cells (Figure 24b). Analysis of vibratome sections also
detected the presence of ~-galactosidase in regions of the CNS that
were not labeled intensely in the brain ~lices. For example,
consistent but weak staining of ~ome but not all neurons in CA-3
region of the hippocampus was found.
C. Immunocvtochemical Detection of ~-Galactosidase
For the electron microqcope (~H) i,,unocytochemical detection
of ~-galactosidase, transgenic mics, between four-to~five-weeks of
age, were perfused with 2.5% glutaraldehyde and 4~ paraformaldehyde
in 0.08 M phosphate buffer. The brains were removed and placed in
the fixative overnight at 4C. Segments of the cerebral cortex (2
mm2) were infiltrated with 2.3 N sucrose and 30% polyvinyl
pyrrolidon, placed on specimen stubs, and frozen in liquid nitrogen.
Ultrathin frozen sections (-120 nm-thick) were cut in a Reichert
Ultracut-FC4 ultracryomicrotome maintained at approximately -110C.
The sections were transferred to formvar and carbon-coated hexagonal
mesh grids and stained by immunogold procedures using a modification
of standard procedures. Following immunostaining, the grids were
placed in PBS containing 2.5% glutaraldehyde for 15 minutes and
rinsed. The sections were stained with neutral uranyl acetate
followed by embedding in 1.3~ methylcellulose containing 0.3% uranyl
acetate. Grids were examined in a Hitachi H600 electron microscope.
The cellular and subcellular distribution of ~-galactosidase
in the cerebral cortex and other brain regions as determined by the
immunogold procedure revealed that the majority of gold particles
in electron micrographs was localized to the perinuclear cytoplasm
of neurons (Figure 25d). Glial cells and endothelial cells were not
labeled.
The striking conclusion from the ~n situ hybridization, light
microscopic and electron microscopic detection of mouse APP and ~-
galactosidase was that the -4.5 kb genomic fragment encompassing the
5'-end of the human APP gene isolated as described in Example 1 had
sufficient sequence information to direct cell- and tissue-specific
expression of a reporter gene, E. coli lacZ, in transgenic mice. The
expression pattern of the reporter gene in the C~S was strikingly
consistent with the expression pattern of the endogenous mouse APP
.........
2 ~
-68-
gene. This -4.5 kb genomic fragment which includes the APP promoter
and perhaps other regulatory elements was incorporated in nearly all
APP minigene constructs described in Examples 4-10 above. Such
constructs are particularly useful in the preparation of transgenic
mice as described in Example 11. The identification of such an
appropriate gene promoter and other regulatory elements for minigene
constructs is a critical step for the development of transgenic mouse
models for AD, since AD pathology is restricted to specific regions
of the brain [Price, 1986, Annu. Rev. Neurosci. 9: 489-512). The
~4.5 kb genomic fragment described and characterized herein is the
type of regulatory element that must be utilized to facilitate the
expression of recombinant APP genes with a cell and tissue
specificity that is consistent with the formation of amyloid plaque
and the expression patterns of the APP gene.
EXAMPLE 13
Espression of Human APP ~RNA in Transgenic Mice
Several transgenic mouse lines express human APP mRNA in brain
tissue (Figures 26, 27, and 46). Expression of human APP mRNA in
transgenic animals was determined by nuclease Sl protection analysis
(Figures 26 and 27) and by riboprobe analysis (Figure 46).
A. Nuclease Sl Protection Analysis
Sl nuclease digests single-stranded DNA and RNA but not double-
stranded species. Therefore, specific 32P-labeled oligonucleotides
that hybridize with complementary mRNA sequences, are protected from
digestions by Sl nuclease and can be identified by denaturing
polyacrylamide gel electrophoresis (PAGE). A human specific
oligonucleotide (designated oligonucleotide #29 and described below)
will produce an approximately 70 bp-protected fragment in an Sl
digestion when annealed to human APP mRNA. A mouse-specific
oligonucleotide (designated oligonucleotide #30 and described below)
will produce an approximately 50 bp-protected fragment when annealed
to mouse APP mRNA in an Sl assay. RNA from the human cell line, Hela
(A.T.C.C. No. CCL2) was used for a positive control for human APP RNA
(Hela cells express APP; Weidemann et al., 1989, Cell 57: 115-126)
,
0 7 ~
-69-
and RNA from a control non-transgenic mouse was used for a negative
control in the assay.
Oligonucleotides complementary to eitherhuman (oligonucleotide
#29) or mouse (oligonucleotide #30) APP mRNA sequences were
synthesized using an automated Applied Biosystems oligonucleotide
synthesizer (model 380A). Oligonucleotides were generated using
reagents and protocols provided by tbe manufacturer. The sequence
of oligonucleotide #29 is:
5'-GAGATAGMTACATTACTGATGTGTGGATTMTTCAAGTTCAGGCATCTACTTGTGTTACA
GCACAGCTGGGCGTCCATA-3'
This 80 bp oligonucleotide contains a 10 bp non-homologous sequence
domain at the 3'-end so that, after Sl digestion, the protected
oligonucleotide fragment (approximately 70 bp) can be distinguished
from non-hybridized oligonucleotide probe. The actual size of the
protected fragment(s) can only be determined by experimentation
because specific single- and double-stranded nucleotide sequences
exhibit variability in their sensitivity to Sl. The sequence of
oligonucleotide #30 is:
S'-CGCGGGTGGGGCTTAGTTCTGCATTTGCTCAAAGM CTTGTAAGTTGGATAGGTTCCMG-3'
This 60 bp oligonucleotide contains a 10 bp non~homologous sequence
domain at the 3'-end so that, after Sl digestion, the protected
oligonucleotide fragment (approximately 50 bp) can be distinguished
from non-hybridized oligonucleotide probe.
The 5'-end of each oligonucleotide was labeled with 32p using
T4 polynucleotide kinase and ~gamma-32P]dATP. The reaction
conditions were as follows: 200 ng oligonucleotide,-l ~1 (10,000
units/ml) polynucleotide kinase (NEB), 1.0 mCi[gamma-3ZP]dATP (3000
Ci/nmole; Amersham PB15068), LX kinase buffer (Maniatis et al.,
supra), and incubation at 37C for 45 minutes. Unincorporated
nucleotide was removed by gel-filtration (Sephadex G-50). The
specific activity of each probe was: oligonucleotide #29, 6.04 x 108
cpm/~g; oligonucleotide #30, 5.72 x lOa cpm/~g.
RNA was extracted from mouse brain and Hela cell pellets using
a procedure described in Basic Methods in Moleçula~ Biolog~ (Davis
et al., 1986, Elsevier, New York, Amsterdam, and London; pp. 130-
135).
2~ r~ r~
-70-
Total RNA, 50 ~g/sample, was mixed with 1 x 106 cpm of each 32p
labelled oligonucleotide (oligonucleotide #29 and oligonucleotide
#30) and then dried in vacuum. The RNA/oligonucleotide pellet was
resuspended in 20 ~l of Hybridization buffer (l mM EDTA, 0.4M NaCl,
50~ formamide, and 40 mM Pipes pH 6.4). Hybridization was performed
in a Perkin Elmer Cetus DNA Temperature Cycler (model #PCR-10000).
Samples were incubated at 90C for 10 minutes and then at 70C for
20 minutes. The temperature was then lowered 1C every 18 minutes
until the temperature reached 30C. The reaction was terminated by
placing samples on ice. Sl nuclease digestion was initiated by
addition of 300 ~1 of Sl reaction buffer (0.2 M NaCl, 5 mM ZnCl2, 30
mM sodium acetate pH 4.5, and 400 units Sl) and samples were
incubated at 20C for 2 hours. Sl reaction was terminated by adding
EDTA to a final concentration of 25 mM. Samples were extracted with
equal volumes of phenol and then phenol/chloroform/isoamylalcohol
(24/24/1). The oligonucleotides in each sample were precipitated at
-70C for 1 hour by addition of 10 ~g tRNA, 175 ~l of 7.5M NH4-
acetate, and 875 ~l of absolute ethanol. The oligonucleotides were
resuspended in lO ~l of 10 mM Tris and l mM EDTA, pH 7.6. Samples
were denatured by addition of 10 ~1 of 2X Sequencing loading 8uffer
(from USB) and incubation at 90C for 3 minutes. Samples were then
transferred to ice and then loaded onto a 10% denaturing
polyacrylamide gel (lX TBE and 7M urea) that had been prerun for 20
minutes at 1600V, constant voltage. The samples were electropXoresed
at 1600 V for approximately one hour. The gel was dried and the
migration of the oligonucleotides was detected by autoradiography
using Kodak X-ray film.
Fig~re 26 demonstrates that transgenic lines AE301, AE101,
FE801, FE403, ED1001, ED801, and DHl06 express human APP RNA in brain
(i.e., have an approximately 70 bp-protected fragment after Sl
digestion). The intensity of the approximately 70 bp band of the
protected fragment in these samples was greater than the background
observed in control mouse brain RNA (lane 3). The level of human-
specific expression, however, is low compared to the endogenous mouse
APP expression level. For size markers: gel lane 1 contains
oligonucleotides 29 and 30 (9.7 x 102 and 6.1 x 102 cpm respectively)
. , . . :
'
2 ~
-71-
and lane 2 contains a 1 bp DNA sequencing ladder. Both
oligonucleotides 29 and 30 were annealed to 50 ~g of brain RNAs and
samples were digested with Sl nuclease as described below. The gel
contains the following ~NA samples: lane 3, mouse normal brain;
lane 4, Hela cell; lane 5, AE301 brain; lane 6, AE302 brain; lane 7,
AE601 brain; lane 8, AE101 brain; lane 9, FE801 brain; lane 10, FE403
brain; lane 11, ED1001 brain; lane 12, ED106 brain; lane 13, ED801
brain; lane 14, JE711 brain; lane 15, JE1005 brain; lane 16, DH106
brain; lane 17, GE107 brain.
Figure 27 demonstrates that transgenic lines IE504, IE801,
IE301, IE606, IE206, DM101, DM405, DM406, and DM606 express human
APP RNA in brain (i.e., have an approximately 70 bp-protected
fragment after Sl digestion). The intensity of the approximately 70
bp band of the protected fragment in these samples was significantly
greater than the background observed in control mouse brain RNA (lane
3). The level of human-specific expression, however, is low compared
to the endogenous mouse APP expression level. For size markers: gel
lane 1 contains oligonucleotides 29 and 30 (9.7 x 102 ar.d 6.1 x 102
cpm respectively) and lane 2 contains a 1 bp DNA sequencing ladder.
Both oligonucleotides 29 and 30 were annealed to 50 ~g of brain RNAs
and samples were digested with Sl nuclease as described below. The
gel contains the following RNA samples: lane 3, normal mouse brain;
lane 4, Hela cell; lane 5, IE602 brain; lane 6, IE504 brain; lane 7,
IE801 brain; lane 8, IE301 brain; lane 9, IE205 brain; lane 10, IE606
brain; lane 11, IE206 brain; lane 12, IE505 brain; lane 13, IE803
brain; lane 14, DM101 brain; lane 15, DM309 brain; lane 16, DM405
brain; lane 17, DM406 brain; lane 18, DM606 brain.
B. Ribo~robe Analvsis
RNase A and RNase Tl digest single-stranded RNA but not double-
stranded RNA species. Therefore, specific riboprobes (32P-labelled
anti-sense RNA) that hybridize with complementary mRNA sequences, are
protected from digestion by a cocktail of RNase A and RNase Tl and
can be identified by denaturing polyacrylamide gel electrophoresis
(PAGE). The Bluescript M13 phagemid (Stratagene, San Diego, CA)
contains a multiple restriction enzyme polylinker flanked by
promoters for T7 and T3 RNA polymerase. The promoters are positioned
.,, ... ~ .
'
'
2 ~ 7 ~
-72-
in opposite orientations and can be utilized to transcribe 32p_
labelled anti-sense RNA probes specific to any sequence inserted into
the polyl$nker region. Clone pMTI-2371 (see Example 16, part B, and
Figure 41) contains the human APP sequences encoding the MC-100 gene
product (gene product V, Figure 4b; see also Figure 12 and Example 9,
part A, section 3) inserted into Bluescript KS+. A riboprobe which
specifically hybridizes to human APP mRNA was generated using T7 RNA
polymerase and linearized pMTI-2371 (phagemid digested with HincII)
as template. The riboprobe was -408 bp in length and the portion
complementary to human APP was -373 bp. Therefore, RNase A/RNase Tl
digestion of the riboprobe, which has been hybridized with human APP
mRNA, would generate an -373 bp-protected fragment. RNase A/RNase Tl
digestion of riboprobe, which has been hybridized with mouse APP
mRNA, would result in numerous fragments which are considerably
15 smaller than 373 bp. The template was prepared and the 32p labelled
riboprobe was generated (using 60 ~Ci of 32P-rUTP [sp. act.: 800
mCi/mmol] obtained from Amersham (Arlington Heights, IL). RNA was
prepared from the Hela cell line, the brain of a normal mouse, and
the brains of individuals from the following lines of transgenic
20 mice: AE101, AE301, CA507, FA201, FE1001, FE403, IE801, JA407,
JA1301, SAllO, SA602, and SA706 using methods de~cribed in Example
13, part A. RNA samples (20 ~g) were precipitated with 1/10 volume,
3 M sodium acetate pH 5.2, and 2.5 volumes ethanol. Each RNA sample
was resuspended in 20 ~1 of lX hybridization buffer (80% formamide,
25 40 mM PIPES pH 6.4, 0.4 M NaCl, and 1 mM EDTA) and 10 ~1 of riboprobe
(2 x 105 cpm in lX hybridization buffer). Samples were incubated at
85C for 10 minutes and then incubated at 45C overnight. The RNA
samples were digested by addition of 350 ~1 of ribonuclease buffer
~10 mM Tris pH 7.5, 300 mM NaCl, and 5 mM EDTA) with 40 ~g/ml RNase
30 A and 2 ~g/ml RNase Tl and incubation at 30C for 60 minutes. To
each sample was added 20 ~1 of 10~ SDS and 2.5 ~1 of 20 mg/ml
proteinase K. Samples were incubated at 37C for 15 minutes and then
extracted with phenol/isoamylalcohol/chloroform. The samples were
precipitated by addition of lO ~g of tRNA and 1 ml of ethanol.
Samples were resuspended and electrophoresed on a denaturing
polyacrylamide/urea gel as described in Example 13, part A. The gel
2 ~
-73-
represented in Figure 46 contains the following RNA samples: lane 1,
Hela cell RNA; lane 2, normal mouse; lane 3, AE301; lane 4, AE301;
lane 5, AElOl; lane 6, CA507; lane 7, FA201; lane 8, FE1001; lane 9,
FE403; lane 10, IE801; lane 11, JA407; lane 12, JA1301; lane 13,
SAllO; lane 14, SA602; lane 15, SA706; lane 16, blank; lane 17,
riboprobe (undigested); and lane 18, riboprobe (undigested). The
protected riboprobe fragments were detected by autoradiography as
shown in Figure 46. The experiment demonstrated that the following
transgenic mouse lines express human APP RNA: AE101, AE301, CA507,
FE1001, IE801, JA407, JA1301, SA602, and SA706 (see Table III).
EXAMPLE 14
Exprossion o~ Human APP and APP Derivatives in ~ransgenic Mice
A. Ex~ression of APP-751
Transgenic mouse line IE801 (see Table III) expresses human
APP-751 protein in the brain (Figure 28a and 28b). Human APP-751
expression (Figure 28b) was detected in protein extracts of
transgenic mouse brain by Western-blot analysis using the human-
specific monoclonal antibody (mAb), mAb 56-1 (see Example 17).
Western-blots of protein extracts from transgenic mouse brains were
also stainet using mAb 22C-ll which reacts with APP-695, APP-751 and
APP-770 from both human and mouse (Figure 28a). The monoclonal
antibody, mAb 22C-ll, was a gift from Dr. Beyruether (Weidemann et
al., 1989, Cell 57: 115-126).
Figure 28a contains the following samples: lane 1, low
molecular weight protein markers; lane 2, DH106 brain lysate; lane
3, DM606 brain lysate; lane 4, JE711 brain lysate; lane 5, IE508
brain lysate; lane 6, IE801 brain lysate; lane 7, IE301 brain lysate;
lane 8, normal mouse (ICR strain) brain lysate; lane 9, media from
cell line, cMTI-53; and lane 10, high molecular weight protein
markers.
Figure 28b contains the following samples: lane 1, high
molecular weight protein markers; lane, 2, cell line cMTI-53; lane
3, normal mouse (ICR) brain lysate; lane 4, IE301 brain lysate; lane
5, IE801 brain lysate; lane 6, IE508 brain lysate; lane 7, JE711
S~ P~r~
-74-
brain lysate; lane 8, DM606 brain lysate; lane 9, DH106 brain lysate;
and lane 10, low molecular weight protein markers.
Figure 28a demonstrates that each brain extract contains
approximately equal amounts of APP protein and that APP-695 is the
predominant form of APP in ~ouse brain extracts. The extracellular
forms of APP-695 and APP-751 (or 770) have apparent molecular weights
of ~93-105 kDa and -112-125 kDa respecti~ely (Weidemann et al., 1989,
suDra and Palmert et al., 1989, Proc. Natl. Acad. Sci. USA 86: 6338-
6342) Protein from the culture ~edia of a mouse cell line (line
10 cMTI-53; see Example 16) which secretes human APP-751 was included
as control (Figure 28b, lane 2). We could not determine whether
transgenic mouse lines DM101 or DH106 expressed human APP-695 because
of the cross-reactivity of mAb 22C-ll for mouse and human APP-695.
Figure 28b demonstrates that transgenic mouse line IE801 (lane
5) expresses a protein which reacts with mAb 56-1 and has a gel
migration mobility equal to that of APP-751 secreted by the cell
line cMTI-53 (lane 2). A non-transgenic mouse (lane 3) or transgenic
mice carrying minigenes encoding human APP-695 (DMlOl and DH106) do
not exhibit immunostaining of this protein. Transgenic mouse line
20 IE508 al90 expres~ed cross-reactive proteins species. However, the
migration of the proteins doeq not correspond to human APP-751. It
is possible that human APP-751 is anomalously expressed or
metabolized in the IE301 line and no APP-770 expression was observed
in the JE711 line.
Protein was extracted from the brain of a non-transgenic
control mouse (IC~ strain) and the brains of transgenic animals from
the following lines: DH106, DM606, JE711, IE508, and IE301. Whole
brains were dissected from the animals and weighed to estimate tissue
volume. Two volumes of lysis buffer (0.2N ~aCl, 1% Triton X-100, 2
30 m~ PMSF (Sigma #P-7626), 1 mM DFP, LX protease inhibitor solution,
10 mM Tris pH 8.0) was added to each brain. Protease inhibitor
solution, lOOX, consisted of: 1 mg/ml leupeptin (Sigman #L-2884), 1
mg/ml pepstatin-A (Sigman #P-4265), 10 TIU/ml aprotinin (Sigma 3A-
6012), 0.1 mN EDTA, and 0.2N Tris pH 8Ø Brain tissue was then
35 homogenized for -1 minute with a Polytron homogenizer (model CH6010).
Each sample was centrifuged at 10,000 x g at 4C for 30 minutes and
~ 7
-75-
the supernatant (lipid layer removed), or "brain lysate," was stored
at -70C. Protein in culture media for cell line cMTI-53 was
concentrated by acid precipitation. Approximately 1.5 ml of culture
media, ice cold, was harvested and a 1.5 ml aliquot of 25~
trichloroacetic acid (TCA), ice cold, was added. Samples were
centrifuged at 15,000 x g for 10 minutes at room temperature. The
protein pellets were washed three times with 100% acetone and then
centrifuged after each wash at 15,000 x g for 10 minutes at room
temperature. The pellets were dried in a vacuum for -20 seconds,
10 resuspended in 100 ~1 of NRS8 buffer (2~ SDS, 5~ betamercaptoethanol,
5% loading dye, 10% glycerol, 0.125 M Tris pH 6.8) and boiled for 5
minutes.
The "brain lysate" proteins and cMTI-53 cell supernatants were
fractionated by polyacrylamide gel electrophoresis (10% running gel
and 4~ stacking gel) and transferred to Immobilon-P membrane by the
technique of electroblotting using a Biorad Mini-Protean II apparatus
and using procedures recommended by the manufacturer. Prior to
electrophoresis, 10 ~1 human APP-751 control cell supernatant (cell
line cMTI-53), 1 ~1 of control mouse brain lysate, and 2 ~1 aliquots
o transgenic mouse brain lysates were denatured by addition of LX
NRSB and boiling for 5 minutes. Each gel also included pre-stained
high and low molecular weight standards (BRL catalog #6041LA and
#6040SA, respectively).
Human and mouse APP proteins, transferred from the
polyacrylamide gels onto Immobilon-P membrane, were detected by
Western-blot staining. Mouse and human APP-695, APP-751 and APP-
770 proteins were detected using mAb 22C-ll. Human APP-751 was
detected using mAb 56-1; this antibody does not recognize mouse APP-
751. After protein transfer, the Immobilon membranes (12 x 12 cm)
30 were incubated with 50 ml lX blocking buffer (0.15M NaCl, 5~ non-
fat dry milk, and 10 mM Tris pH 8.0) for one hour at room
temperature. Membranes were then stained with 10 ml of "first"
antibody solution (22C~ 1:10,000 dilution of mAb stock into
blocking; or mAb 56-1: 1:100 dilution of mAb stock into blocking
buffer) for 2 hours at room temperature. Membranes are next washed
with blockin~ buffer and then stained with 15 ml of "second" antibody
.
-76-
solution [goat anti-mouse IgG conjugated with alkaline phosphatase
(Promega): 1:7500 dilution of antibody into blocking buffer] for 30
minutes at room temperature. Membranes are then washed with blocking
buffer and then with AP buffer (O.lM NaCl, 5 mM MgCl2, O.lM Tris pH
9.5). Membranes are next stained with "AP substrate~ solution (15
ml AP buffer, 99 ~1 NBT stock solution, and 49 ~1 BCIP stock
solution) for one hour at room temperature. NBT stock solution
consists of 50 mg/ml nitro blue tetrazolium (Sigma #N-6876) in 70
dimethylformamide and BCIP stock solution consists of 50 mg/ml 5-
bromo-4-chloro-3-indolyl phosphate in 100% dimethylformamide. The
AP staining reaction was determined by washing membranes in deionized
water.
B. Expression of A4 APP Peptide
Transgenic mouse line AE301 (see Table III) carries minigene
pMTI-2318 (gene product VIII, Figure 4b), which encodes the 42 amino
acid A4 peptide of APP (see Example 7 above). This line of
transgenic mice has been shown to express APP RNA in brain (see
Example 13 above). In further studies, it was shown that AE301
transgenic mice exhibit A4 aggregates in the hippoca~pus region of
the brain. This transgenic line can be used to examine the
neurotoxicity of the A4 peptide in brain tissue. In addition, the
A4 aggregates present in the transgenic mice may represent an early
stage of senile plaque formation. These transgenic mice can serve,
therefore, as a model for early pathological events occurring in
patients affected with AD. Aggregation of A4 peptide was
demonstrated by several methods, including immunocytochemical
analysis and electron microscopic (EM) analysis.
1. Immunocvtochemical Analvsis of A4 Aggregates
Rabbit polyclonal antibodies (pAb) 90-25, 90-28 and 90-29, used
for the immunocytochemical analysis, were generated by standard
methods. Subcutaneous injections of the A4 peptide (amino acid
residues 1 to 28 for pAb 90-25, and amino acids 1 to 42 for pAbs
90-28 and 90-29) were administered to rabbits using Freund's
ad~uvant. Rabbit sera were screened for immunoreactivity to the A4
peptide and several, including pAb 90-25, 90-28 and 90-29, tested
positive. These positive antibodies were further characterized by
.
2 ~ 7 ~
-77-
reaction with pathological human brain tissue from a patient with AD.
The pAb 90-25, 90-28 and 90-29 immunostain A4 amyloid plaques (senile
plaques) found in the pathological tissues.
Once the specificity of pAb 90-25, 90-28 and 90-29 with A4
peptide had been established, these antibodies were used to
immunostain cross-sections of brain tissue from uice. Light
microscopic immunochemistry was performed using paraffin tissue
sections, according to the method of Trapp et al., 1983, J.
Neurochem. 40: 47-54. The results showed immunostaining of specific
areas of the hippocampus region of the brain from an AE301 transgenic
mouse as shown in Figures 34, 35, and 36. The transgenic mouse,
designated AE301+207 (Fl), used for this immunocytochemical analysis
was a transgenic progeny of a mating between AE301(FO), the founder
mouse, and a non-transgenic female (IC2200). Transgenic progeny of
this mating were identified by PCR analysis as described in Example
11 above.
Figure 34 illustrates a cross-section of brain from mouse
AE301+207(Fl) immunostained with pAb 90-29. A4 immunoreactive
regions can be observed as dark-brown areas, are punctate in nature,
and appear in clusters in the hippocampus (Figure 34, representative
immunostained clusters are highlighted with arrows). Figure 35 is
a higher magnification of the hippocampal region of mouse
AE301+207(Fl) brain tissue stained with pAb 90-29 (representative
immunoreactive regions are highlighted with arrows). Similar
25 immunostaining in the hippocampus of AE301+207(Fl) brain tissue can
be observed with a second A4 immunoreactive antibody, pAb 90-28
(Figure 36, representative immunoreactive regions are highlighted
with arrows). A third A4 immunoreactive antibody, pAb 90-25, also
showed similar immunostaining.
This immunostaining was specific to the AE301 transgenic line
because an age-matched mouse, designated FE803+105(Fl), from
transgenic line FE803 which carries pNTI-2321 (see Example 6 and
Table II) does not exhibit immunostaining with pAb 90-29 in the
hippocampus or in other regions of the cross-section of brain (Figure
37)-
-78
2. ~l~ctron
Sr~n~lssion elact~on mlcro~copic ~n~ly8~s of ~h~n oec~lon~ o~
~lX~d ~nd ot~ln~d braln t~U4 ~a~ par~onse~ ~cco~dln~ to thQ ~ethod
~ app ~t ~1., 1982, J. Nouroacl. ~: 986^993. The tr-n~gon~c ~a4
5 u~ed ~r th~ B alactron ~croocopic cnalyoi3 W~ ~esigna~a~
A~301+201~P2) ~nd ~s the prog~ny of a mat~n~ betwesn ~301l210~F1)
and ~301~207(~ 301+210~ nd AE301l207~Fl) are ~rageny a~
~at~ng ~two~n ~E301~(F0) ~nd B non-tr-n~enic fe~A1a (IC~200).
Th~e tra~e6n~c p~ogony wara ~tentifled by PC~ n~ly~ de~cribed
lo ~n ~x~plo 11 ~bove.
~h~ r~ult~ chowet ~ctron~d~nJc a~r4~At~ ~n ~p~c~c ~re~e
of ~hfl hl~ocamp~l reg~on o~ the br~n from thle tran~nIc mouse.
T~o ol~ctron.d4noe aggrqgate~ w~re found l~ tho oa~e br~n re~iono
whic~ exh~blt~d Sm~unochem~cAl ~talnlng with pA~ 90-2~, 90-28 and
15 90-29. Sh~ ~6sr4g~te~ ~ppe~r to bo loc~ed ~Ithin tho IntrAcellular
~pcce of ne~ron dendr~tos. ~U~9 38a ~nd 38b Lllu~tr~te ~l~ctron-
donoo aggr~g~tc~ ~n thln ~ect~o~ o~ hlppocu~p~l br~n tlcoue
l~ol~t-t from tr~n~on~c mow e AR30l+20l(F2). Sho bord-~ of the
~l~ceron-den~4 ~ggreg~to3 aro h~thl~ht-d wich ~rrow~.
~0 Th~t ~loceYon-d-n~Q r~glonJ r~ ~ggrogat~ o~ the A4 yoptlde
w~ domon~tr~ted ~lnco im~unor~qtivlty wlth pAb 90-29 co-loc~ ed
with tho elactron-d-n~e ~3gr~g~tQ4 (Fl~ure 3~). Sh~ co-
loccllzation v-g ~hown u4Ing EM ~mmunocytoche~try o~ ultr~thln
cryo~-ction4 a~ po~or~od cccord~ to eho ~tho~ of ~rapp t ~
25 19~9, J, C~ll BSol. 10~: 2417-2426, The i~unorQact~Vtty of pAb 90-
29 ~a~ tetoct~d i~ th- lec~ron ~lcrographs u-lng S~uno~old
p~re~clo~ unotol~ pdreicle~ a~yo-r ~ d1sor~t~ dot~ of unl~ar~
ol~e 1D tho olectron micsosr-ph~. a~pr4~0n~-t~v- r~ion~. ~b~-
gold ~rticles Co~loc~ltz~ ~Itb the olactron-~anJo cggrag~to~, Ara
~0 lndl~ d by arro~.
'
.
;
' '
-79-
EXA~PLE 15
Expression of Human APP Gene Product3 in COS Cell Transfections
DNA transfections of COS cells (Gluzman, 1981, Cell 23: 175-
182) demonstrate that pMTI-2360, pMTI-2362, pMTI-2369, and pMTI-46
express and secrete huoan APP-695 as described below and shown in
Figure 29.
For DNA transfections, 60 mo culture dishes were seeded with
approximately 2-5 x 105 COS cells/dish t-50% confluency) in 3 ml DMEM
and 10% fetal calf serum. Cells were cultured overnight at 37C in
a 6% CO2 atmosphere. Cells were washed with PBS (no Ca~ or Ng~) and
then 2 ml of DMEM plus 10% NuSeruo (catalog #50000) was added to
each plate. Then 2 ~l of lOOOX chloroquine stock solution (0.1 M
chloroquine, Sig~a no. C-6628), 32 ~1 of DEAE dextran sulfate stock
solution (25 mg/ml DEAE dextran sulfate, Sigma no. D-9885), and 4 ~g
of DNA was added to each plate. Cells were incubated for 3.5 hours
at 37C in a 6% CO2 atmosphere. Cells washed with PBS and then
"shocked~ with 2 ml of 10% DMSO in PBS and incubated at 37C in a 6%
C02 atmosphere with DMEN plus 10% fetal calf serum for 48 hours then
washed 3 times with PBS and cells were further incubated at 37C in
20 a 6% C02 atmosphere with "Cutter" media for an additional 24 hours.
Protein in culture media from COS cells, transfected COS cells,
and huoan neuroglioma cell line H4 (A.T.T.C. no. HTB148) was
concentrated by acid precipitation. Approximately 3 ml of each
culture media, ice cold, was harvested and a 3 ml aliquot of 25%
trichloroacetic acid (TCA), ice cold, was added. Saoples were
centrifuged at 20,000 x g for 30 minutes at 4C. The protein pellets
were washed three tioes with 100% acetone and then centrifuged after
each wash at 10,000 x g for 15 minutes at 4C. The pellets were
dried in a vacuuo for -20 seconds, resuspended in 10 ~1 of NRBS
30 buffer (2~ SDS, 10% betaoercaptoethanol, 5% loading dye, 10%
glycerol, 0.125 M T-is pN 6.8), and boiled for 5 oinutes.
Cell supernatant protein was fractionated by polyacrylamide
gel electrophoresis (8% running gel and 4% stacking gel) and
transferred to Immobilon-P membrane by the technique of
electroblotting using a Biorad Mini-Protean II apparatus and using
procedures recomoended by the manufacturer. Huoan and oouse APP
i
- ' ' ~' ~
-80- 2~ 7~
proteins, transferred from the polyacrylamide gels into Immobilon-
P membranes, were detected by Western-blot staining as described in
Example 14. Mouse and human APP-695, APP-751 and APP-770 proteins
were detected using monoclonal antibody (mAb) 22C-ll.
APP protsin secreted into media from various transfected cell
cultures was detected in Western-blots using mAb 22C-ll. COS cells
express predominately APP-751 (ant/or 770) and a smaller amount of
APP-695 (Figure 29, lane 8). The secreted forms of APP-695 and APP-
751 (or 770) have apparent molecular weights of -93-105 kDa and -112-
125 kDa, respectively (Weidemann et al., 1989, supra, and Palmert et
al., 1989, su~ra). Human cerebral spinal fluid (CSF) contains
predominately APP-695 (Palmert et al., 1989, su~ra.) and is included
on the Western-blot as a control for APP-695 expression (lane 9,
Figure 29). Several DNA transfections (pMTI-2360, lane 7; pMTI-
2362, lane 6; pMTI-2369, lane 5; and pMTI-46, lane 4) exhibit
significant increases in APP-695 immunostaining relative to APP-
751(770) immunostaining (Figure 29). Therefore, these constructs
express human APP-695 in COS cells. These APP-695 encoding minigenes
are used as a "template" for construction of minigenes encoding
alternate or mutant forms of APP. Because the parent APP-695
constructs express protein, it is highly likely that the other
constructs also will express their proteins.
EXAMPLE 16
E~pression of APPs in Mammalian Cell Lines
Stable cell lines expressing the 695, 751 and 770 forms of APP,
as well as a mutated form of APP MC-100, were constructed as follows
using bovine papilloma virus- (BPV) based vectors.
A. Cell Lines for APP-695. APP-751 and APP-770
Plasmid pMTI-4 described in Example 6 was mutagenized at the
5'-end of the APP-695 cDNA to create a new SalI restriction site.
In addit~on, during the mutagenesis procedure, the bases flanking
the initiation codon, AUG, were altered to conform to the optimum
sequence for translation initiation described by Kozak (Rozak, 1989,
Cell Biol. lQ~: 229-241). The oligonucleotide primer used in the
' ~ ' .
, : .
. : ~
r
-81-
mutagenesis and map of the resulting vector, pMTI-38, are shown in
Figure 30a.
Plasmid pMTI-41 was constructed by deleting the unique KpnI
site in Bluescript KS (Stratagene; parent vector for pNTI-4).
S Bluescript KS was digested with ~paI and the overhangs were digested
with mung bean nuclease by standard methods. The digested DNA was
treated with ligase to circularize the vector and pMTI-41, lacking
the ~E~I site was isolated.
The XbaI - HindIII fragment from pMTI-38, containing the APP-
10 695 cDNA, was introduced into XbaI - HindIII digested pMTI-41 as
shown in Figure 30 to obtain pMTI-42 which has only one Kpn site
within the APP cDNA. pMTI-43 and pMTI-44 containing respectively
the 751 and 770 forms of APP were constructed by replacing the KpnI
- ~glII fragment in pMTI-42 with the corresponding fragments from
15 pFC4-751 and pFC4-770 described in Example 3.
SalI fragments containing the APP regions in pMTI-42, pMTI-43
and pMTI-44 were introduced into the XhoI site of the BPV vector
pMTI-52, placing them under the control of the mouse metallothionine
promoter illustrated in Figure 31. As shown in Figurc 31, pMTI-52
contains the colEl replicon, the ampicillin resistance gene, the
mouse metallothionine promoter a unique cloning site for cDNAs
followed directly by the polyadenylation signal of SV40.
Specifically, pMTI-52 contains ~HI and XhoI cloning sites for
introduction of cDNAs of interest. In addition, the pMTI-52 vector
contains the entire 8 kb genome of BPV. The presence of BPV
sequences allows the vector to replicate as a multicopy episome in
mouse C127 and NIH3T3 cells resulting in stably transformed cell
lines. The plasmid pMTI-52 was constructed by ligating the -237 bp
~amHI-BclI fragment (containing the viral polyadenylation signals)
from SV40 viral DNA into the unique ~HI site of pMTI-32.
Diagnostic restriction digestion of pMTI-52 with BamHI and PvuII gave
the following DNA restriction fragments: -11.5 kb, -0.55 kb, and
-0.25 kb. pMTI-32 was generated by ligating an -1.8 kb BamHI-~glII
restriction fragment from pMTI-29 (this DNA fragment contains the
mouse metallothionein gene promoter, which can be obtained from
alternative sources, for example, the -l.9 kb EcoRI-~lII fragment
-82-
from plasmid pJYMMT(L) described in Example 9 also contains an
analogous promoter fragment) into the unique BamHI restriction site
of plasmid BPV-240.7. Plasmid BPV-240.7 was used as a source of the
entire BPV genome and is a variant of the BPV vectors described and
prepared by Howley et al., 1983, in Methods of Enzvmologv, Volume
101, ~u et al., eds., Academic Press, NY, pp. 387-402. Alternative
sources of the -8 kb BPV genome may be used, in particular, any
number of the BPV vectors described by Howley et al., suvra, with
minor changes in restriction enzyme cleavage sites, can serve as a
source of the BPV genome in place of BPV 240.7 in the construction
of pMTI-52. Diagnostic restriction digestion of pMTI-32 with BamHI
and ~BdIII gave the following DNA restriction fragments: 8.0 kb and
4.1 kb. pMTI-29 was generated by inserting BglII, ~_I, and SalI
restriction sites (using a synthetic DNA linker) into the unique
EcoRI restriction site of plasmid pM~Bneo. Plasmid pMVBneo has been
described by Pavlakis et al., lg87, in Gene Transfer Vectors, Miller
and ~alos, eds., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, pp. 29-58, and was used as a source of the mouse
metallothionine gene promoter. Alternative sources of this promoter
may be used, for example, plasmid pJYMMT(L) (see Example 9).
Diagnostic restriction digestions of pMTI-29 with either SalI or XbaI
yielded a single 6.7 kb DNA restriction fragment. The BPV vectors
pMTI-53, pMTI-57 and pMTI-58 contain the 695, 751 and 770 forms of
APP, respectively.
Each BPV vector, pMTI-53, pMTI-57 or pMTI-58 was transfected
into mouse C127I cells ~a variant of C127 obtained from Dr. D.
DiMaio, Yale University) which are permissive for the high-copy-
number, episomal replication of BPV vectors (Howley et al., 1983,
Methods in Enzymol. 101 387-403). Vectors were introduced into cells
by calcium phosphate precipitation-and the trans~ormed foci were
isolated as described (Howley et al., 1983, ~y~). Alternatively,
in some cases, the vectors were co-transfected (Howley et al., 1983,
su~ra) with pSV2neo (Southern and Berg, 1982, J. Mol. Appt. Gen. 1:
327-341) which is capable of conferring resistance to the antibiotic
G418. BPV vector DNAs were mixed with pSV2neo DNA at 5- to 10-fold
molar excess (BPV vectors in excess) and transfected into C127I cells
7 7
-83-
by calcium phosphate precipitation. Colonies resistant to G418 were
isolated. The molar excess of BPV DNA over pSV2neo D~A ensured that
almost every G418 resistant colony contained the cotransfected BPV
vector.
Transfection of APP cDNAs into various cell types has shown
that the amino-terminal region of APP, including the Kunitz domain,
is released into the medium (Weidemann et al., 1989, Cell 57: 115-
126 and Palmert et al., 1989, supra. Therefore, serum-free, 24-
hour supernatants from transformed foci and the G418 resistant
colonies were screened for the appropriate form of APP by Western-
blot analysis. Proteins in 1.5 ml of supernatants from semi-
confluent to confluent 25 square cm flasks were concentrated
approximately 15-fold by precipitation with trichloroacetic acid
(TCA) prior to loading onto polyacrylamide gels. APP bands were
visualized using the mouse monoclonal antibody 22Cll (see Example
}4). Clones producing high levels of the appropriate APP form were
expanded and propagated in culture. Supernatants from these cell
lines, cMTI-53, cMTI-57 and cMTI-58 provided standards for the three
forms of human APP.
B. Cell Lines for MC-100
Further transfections of mouse C127I cells were performed using
the plasmid vector pMTI-70 (-12.9 kb, Figure 40). This plasmid was
constructed by cloning an -615 bp XhoI-PvuII fragment from the vector
pMTI-2371 (Figure 41) into the BPV vector pMTI-52. pMTI-52 was first
digested with ~mHI and then a blunt-end was generated using Klenow.
The vector was then digested with XhoI and the large restriction
fragment was gel-purified and ligated with the -615 bp ~h~I-PvuII
fragment from the vector pMTI-2371 to generate pMTI-70. Diagnostic
digestion of pMTI-70 with HindIII revealed an -3.6 kb and an -9.3 kb
restriction fragment. The pMTI-2371 plasmid was derived by cloning
the -707 bp BamHI-SpeI fragment from pHTI-2337 between the BamHI and
the XbaI sites of the Bluescript KS+ vector (see Example 6).
Construction of plasmid pMTI-2337 is described in Example 9 (part A,
section 3).
Plasmid pMTI-70 contains the sequences derived from pMTI-2337
which encode the mutation designated MC-100 (gene product V, Figure
.
84
4b, see also Figure 12). The fragment obtained from pMTI-2337 (with
pMTI-2371 as an intermediate) used for the construction of pMTI-70
encodes the C-terminal segment common to the three forms of APP (695,
751, 770), including the A4 region, preceded by the secretion signal
(i.e., signal peptide) of the APPs. Thus, translation of this APP
minigene i5 expected to result in the incorporation of the APP C-
terminus into the membrane of the cell transfected with this
minigene.
Plasmid pMTI-70 was transfected into mouse C127 cells as
described above and colonies resistant to G418 were isolated to
generate stable transfectant cell lines which included lines: cMTI70-
A2, cMTI70-A3, cMTI70-A6, cNTI70-Bl, cMTI70-B2, and cMTI70-B3. Cell
lysates of such resistant clones were analyzed by Western-blotting
using a rabbit polyclonal antibody (pAb) SG369. The pAb SG369
15 (described in Buxbaum et al., 1990, Proc. Natl. Acad. Sci. USA 87:
6003-6006 was raised by immunization of a rabbit with a synthetic
peptide corresponding to the C-terminus of human APP-695 using
standard immunization procedures and techniques (as described in
Buxbaum et al., 1990, su~ra). The synthetic peptide consisted of APP
20 amino acid residues 645-694, wherein the numbering of amino acids
corresponds to those of human APP-695 as described in Kang et al.,
1987, su~ra) and was prepared by the Yale Protein and Nucleic Acid
Chemistry Facility (New Haven, CT). Rabbit polyclonal antibodies
with similar characteristics as those of pAb SG369 have also been
generated by other laboratories using various human APP-695 C-
terminal peptides (Ishii et al., 1989, Neuropath. Appl. Neurobiol.
15: 135-147; Palmert et al., 1989, supra; and Bush et al., 1990, J.
Biol. Chem. 265: 15977-15983). Figure 42 shows the results of the
Western-blot analysis of cell lysates of pMTI-70 transfected BPV
30 cell lines cMTI70-Bl, cMTI70-B2, and cMTI70-B3. The Western-blot
shown in Figure 42 also shows the results of using cell extracts
from control BPV cell transfectants which do not express MC-100.
Cell cultures were grown to 100% confluency, washed with 1 mM EDTA
in PBS, and extracted by boiling for 10 minutes in LX SSB (2~ SDS,
35 63 mM Tris pH 6.8, and 10~ glycerol), 5~ ~-mercaptoethanol, and 5~
bromphenol blue. The Western-blot analysis was performed as
-85-
described above. The Western-blot illustrated in Figure 42 contains
the following samples: lane 1, molecular weight markers; lane 2,
cMTI52-A4 cell extract; lane 3, cMTI66-B6 cell extract; lane 4,
cMTI66-C5 cell extract; lane 5, cMTI69-C6 cell extract; lane 6,
cMTI69-A4 cell extract; lane 7, cMTI69-A5 cell extract; lane 8,
cMTI70-Bl cell extract; lane 9, cMTI70-B2 cell extract; and lane 10,
cMTI70-B3 cell extract. Polyclonal antibody SG369 was used in this
Western-blot analysis. BPV cell line cMTI52-A4 was transfected with
pMTI-52 ~BPV cloning vector); BPV cell transfectant lines cMTI66-
10 B6 and cMTI66-C5 carries BPV vector pMTI-66 which encodes the A4
peptide of human APP (gene product VIII, Figure 4b; see Example 7
above); and BPV cell transfectant lines cMTI69-C6, cMTI69-A4, and
cMTI69-A5 carry the BPV vector pMTI-69 which encodes the Sp-A4
peptide of human APP (gene product VII, Figure 4b; see Example 9A,
15 section 4). A major immunoreactive band between 14 kD and 21 kD
representing the product of the APP minigene is seen. Also present
are immunoreactive bands of higher molecular weights consistent with
their being aggregation products of the primary translation product
(indicated by arrows).
The transcription of the APP minigene in pMTI-70 is under the
control of the mouse metallothionine promoter which is inducible by
heavy metals such as cadmium (Hamer, D.H. and Welling, M.J., 1982,
J. Mol. Appl. Genet. 1: 273-288). Induction of cell lines cMTI70-
A2, cMTI70-A3, cMTI70-A6, cMTI70-Bl, cMTI70-B2, and cMTI70-B3 with
cadmium would be expected to result in increases in mRNA levels and
resultant increases in MC-100 protein levels as shown in the Western-
blot illustrated in Figure 43. Cell cultures were grown to 100~
confluency, washed with PBS, incubated with DMEM with 5 ~g/ml
cadmium chloride at 37C in 5% CO2 for 16 hours, and then extracted
by boiling for 10 minutes in LX SSB (2~ SDS, 63 mM Tris pH 6.8, and
10~ glycerol), 5% ~-mercaptoethanol, and 5~ bromophenol blue. The
Western-blot analysis was performed as described above. The Western-
blot illustrated in Figure 43 contains the following samples: lane
1, cMTI63-Bl cell extract; lane 2, cMTI63-C2 cell extract; lane 3,
molecular weight ~arkers; lane 4, cMTI53-Al cell extract; lane 5,
cMTI70-A2 cell extract; lane 6, cMTI70-A3 cell extract; lane 7,
2~1~a~7
-86-
cMTI70-A6 cell extract; lane 8, cMTI70-Bl cell extract; lane 9,
cMTI70-B2 cell extract; and lane 10, cMTI70-B3 cell extract. BPV
cell transfectant lines cMTI63-Bl and cNTI63-C2 carry BPV vector
pMTI-63 which encodes the human APP-695 with a C-terminal addition
of the Chlamvdia epitope (see Example 8) and BPV cell transfectant
line cMTI53-Al which carries BPV vector pMTI-53 which encodes human
APP-695. The higher molecular weight bands corresponding to the
aggregated molecules increase in intensity upon cadmium induction (as
indicated by arrows). This observation is consistent with the
expectation that aggregation is a concentration dependent phenomenon.
The pMTI-70 transfected and G418 selected cells were also
analyzed by immunofluorescence of stained cells and
immunoprecipitation of cell lysates using the SG369 antibody. The
results demonstrated the accumulation of the MC-100 fragment in the
transfected cells. Figures 44a and 44b show immunofluorescence
results of two representative fields where a limited number of cells
in the population of cMTI70-A6 cells show intense fluorescence.
Transfected cell line cMTI-53 (which expresses human APP 695) does
not exhibit these immunofluorescent cells (Figure 44c). Cultures of
cell line~ cMTI70-A6 (transfected with pMTI-70, see above) and
cMTI53-Al (express human APP 695) were grown to 70% confluency using
standard culture conditions, the cells were washed with PBS, and
incubated for 16 hours with DMEM supplemented with 5 ~g/ml cadmium
chloride. The induced cMTI53-Al and cMTI70-A6 cells were then washed
twice with PBS, and fixed using 4% paraformaldehyde in PBS at room
temperature for 10 minutes. The cells were permeabilized with 0.2~
Triton X-100, 10 mM Tris pH 8.0, 0.2 mM EDTA at room temperature for
5 minutes. The fixed and permeabilized cells were then incubated
with affinity purified pAb SG369 (1:200 dilution of stock) in PBS and
3% bovine serum albumin (BSA) at room temperature for 60 minutes.
The cells were washed 5 timeq with 3~ BSA in PBS and then incubated
with goat anti-rabbit IgG con~ugated with rhodamine (obtained from
Boehringer Mannheim) in PBS and 3% BSA at room temperature for 30
minutes. The cells were then washed 5 times with 3~ BSA in PBS. The
fluorescence of the cells was observed on mounted slides using a
Zeiss IM fluorescent microscope. As shown in Figure 44, the staining
.
. .
'' ' ~ .
- . : ; -
- :.
;. :,
7'~
-87-
is punctate in nature and localized at the cell periphery, away from
the site of synthesis in the endoplasmic reticulum (ER) and Golgi.
This staining pattern suggests highly localized concentrations of MC-
100 protein. Upon continued passage of the C127I/pMTI-70 transfected
S cells, it has been observed that fluorescent cells are lost from the
population with continued passage. This suggests that production of
MC-100 may confer a selective disadvantage to these cells.
Figure 45 shows a Western-blot of immunoprecipitated NC-100
from extracts from the cell line cMTI70-A6 (transfected with pMTI-
70, see above). The results indicate that the MC-100 aggregates,
observed in Figures 42 and 43, can be immunoprecipitated from cell
lysates (Figure 45, lane 6). Cultures of cell line cMTI70-A6
(transfected with pMTI-70, see above) were grown to 100% confluency
using standard culture conditions, the cells were washed with PBS,
and incubated for 16 hours with DNEM supplemented with 5 ~g/ml
cadmium chloride. The induced cMTI70-A6 cells were resuspended
twice, washed with 1 mM EDTA in PBS, and the cells were pelleted by
centrifugation (1000 x g) and resuspended in IP (lysis) buffer (100
mM Tris pH 7.4, 150 mM NaCl, 2 mM NaN3, 1% Nonidet P-40, 0.5% sodium
deoxycholate, 0.1% SDS, and 40 units/ml aprotinin). An aliquot of
this cell lysate appears in Figure 45, lane 1. The cell lysate was
incubated with a 1:50 dilution of affinity purified pAb SG369 for 2
hours at 4C. The extract was then incubated with a 1:10 dilution
of protein-G Sepharose (stock, 2 mg/ml in PBS; obtained from Sigma)
at 4C overnight with gentle agitation. The protein-G Sepharose
bead~ were then collected by centrifugation (12,000 x g for 15
seconds at 4C) and an aliquot of the supernatant appears in Figure
45, lane 2. The pellet was washed 3 times with IP (lysis) buffer.
An aliquot of each wash appears in Figure 45, lanes 3, 4, and 5. The
proteins were solubilized, boiling for 10 minutes in lX SSB (2% SDS,
63 mM Tris pH 6.8, and 10% glycerol), 5% ~-mercaptoethanol, and 5%
bromophenol blue. An aliquot of the solubilized immunoprecipitant
appears in Figure 45, lane 6. The Western-blot analysis was
performed as described above using the SG369 antibody.
The C127I/pMTI-70 clones thus provide a mammalian cell
host/vector system in which the aggregation of a segment of APP
.
2 ~ r~
-88-
containing the A4 region was observed. Since this reaction is a
critical step in amyloid formation, this host/vector system is
valuable for studying: (i) the steps in amyloid formation by
studying the aggregation process i~ vitro and (ii) methods for
intervention into this process by characterizing chemical and
physical agents that accelerate or interfere with amyloid
aggregation. In addition, the NC-100 minigene in pMTI-70 may be
expressed in other cell lines including neurons to study amyloid
formation in different cell lines.
EgAMPLE 17
Generation of Human APP-specific house ~onoclonal
Antibodiss, 56-1 and 56-2
Monoclonal antibodies reactive to the 56 and 75 amino acid
Kunitz domain inserts of APP were generated as follows:
Immunogen: The immunogen used in the immunization of mice was
the enriched pellet fraction of bacterium E. coli expressing the 75
amino acids of the Kunitz domain as a fusion to the first 36 amino
acids of E. coli recA protein (Sancar et al., 1980, Proc. Natl. Acad.
Sci. USA 77: 2611-2615). The fusion protein, which segregated into
the pellet fraction of the expressing strain, was enriched by
detergent and water washes. The resulting insoluble pellet was
solubilized in 8 M urea and the urea was removed by dialysis against
phosphate buffered saline (PBS). Dialysis caused the precipitation
of a part of the solubilized material. The emulsion resulting from
the dialysis was used to immunize mice. The recA-75 fusion
represented over 30% of the protein in the emulsion.
Immunizations. Three 8-week-old Balb/c mice were immunized
intraperitoneally with 100 ~g of immunogen emulsified with an equal
volume of complete Freunds ad~uvant. Then, 21 and 28 days later,
mice were given additional intraperitoneal in~ections of 100 ~g of
immunogen emulsified in an equal volume of incomplete Freunds
ad~uvant. After an additional seven days, the mice were boosted
intravenously with 20 ~g of immunogen. Three days later the spleens
were removed and somatic cell hybrids were prepared by the method of
Herzenberg (Nerzenberg et al., 1978, Handbook of Ex~erimental
Immunologv (D. M. Weir, ed.) Blackwell Scientific Publications,
',
'
.
7 ~
-89-
Oxford, pp. 25.1-25.7) with some modifications (Lerner et al., 1980,
J. Exp. Med. 152: 1085-1101).
ELISA assav: The enriched pellet fraction containing the recA-
75 fusion was dissolved in PBS and used in an ELISA assay. As a
negative control, similar pellet fraction prepared from an E. coli
strain expressing a fusion of the same 36 amino acids of recA (as in
recA-75) with a segment of APP-695 (which does not have the Kunitz
insert) was used.
The ELISA assay was conducted as follows. Culture fluids from
growing hybridomas were tested for the presence of specific antibody
using ELISA. 1 ~g of extracts containing recA fusion proteins was
allowed to adsorb to each well of Immunolon II EIA plates (Dynatech,
Chantilly, VA) by overnight incubation at 4C in 50 ~1 O.OlM sodium
carbonate pH 9.5. Non-specific protein binding sites in each well
were blocked by incubation with 200 ~1 PBS containing O.05~ Tween-
20 and 1~ BSA followed by washing with PBS/0.05% Tween-20. ~ells
were then sequentially incubated with 100 ~1 of hybridoma tissue
culture supernatant, washed, and 100 ~1 of a 1:1,000 dilution (in
PBS/Tween-20) of peroxidase labelled affinity purifled goat anti-
mouse IgG (Kirkegaard and Perry, Gaithersburg, MD). All incubation
steps, lasting one hour each, were done at room temperature. Bound
peroxidase labelled "second antibody" was detected using the
peroxidase substrate tetramethylabenzidine (TMB) according to the
manufacturer's instructions (Kirkegaard and Perry, Gaithersburg,
MD); optical density at 450 nanometers was then determined for each
well. Isotypes of positive hybrid culture fluids was determined
using an ELISA assay in which 1 ~g of anti-mouse Fab was adsorbed to
each well of Immunolon II EIA plates followed by sequential
incubations with culture supernatants and peroxidase labelled
antiserum specific for mouse IgGl, IgG24, Ig2b, IgG3~ and IgM-
Characterization of the monoclonal antibodies: The antibodieswere characterized on Western-blots by comparing their reactivities
against the whole recA protein and with fusions of the first 36 amino
acids of recA protein with the 56 and 75 amino acids of Kunitz
domain. These comparisons were used to eliminate antibodies directed
against the recA portion of the immunogen and to localize the
: .
:
-9o-
reacting epitopes to the 56 or the 19 amino acid regions comprising
the 75 amino acids of the Kunitz antigen. Three antibodies, 56-1,
56-2, 56-3 reacting with the 56 amino acid Kunitz domain were
isolated by this procedure. They were then tested similarly for
5 reactivity against the 695, 751 and 770 APP forms secreted from
mammalian cells described in Example 16. All three were found to
react with human APP-751 and APP-770 from transfectants but not with
the APP-695 form.
It has been observed (Weidemann et al., 1989, ~ and Palmert
et al., 1989, supra) that many cell lines in culture secrete all
three forms of APP to various extents, with the APP-751 and APP-770
forms predominating in most cases. The 56-1 and 56-2 mAbs showed no
cross-reactivity with the endogenous mouse versions of APP (Figure
32). All forms of mouse and human APPs were found to react with the
15 22Cll antibody raised against human 695 precursor. The 56-1 mAb was
further tested against supernatants of 751 and 770 transfectants
described in Example 16 and also against supernatants of mouse L-
cells and COS monkey cells. As shown in Figure 33, the 56-1 mAb
reacted strongly with supernatants of the 751 transfectant and with
the monkey APP but not against mouse APPs either endogenous in the
C127 mouse cell host or in mouse L-cells. The 22Cll mAb detected all
forms of APP from all animal species tested here. Thus, the results
in Figure~ 32 and 33 establish that the 56-1 and 56-2 mAbs are being
specific for primate (human and monkey) APPs.
,
. , ' ', ' ~ .
.
.
.
.:
