Note: Descriptions are shown in the official language in which they were submitted.
~~~~i~r~J ,
R~co~zNANx° v;acc~N~ FoR ~R~v~NTxoN ANn~o~ TR~ATM~T of
PLEUROPNEUMIONIA INFECTIONS
Fiel f van 3 n
Tha prasanb iswsr~ti8r: is is the vateris~ary field. More $paaifieally,
the invenbioa relabes to the prophylaxis and therapy of pleuroprieumorsia in
pigs.
Background of the invention
Pleuropneumonia is a mayor respiratory disease in pigs and causes
severe eeenemic losses in pig farming in many countries including the
1u um tad atates ana uanaae. whe ossease as causeu oy the t~aetermm ecz~zno-
bacillus pleuropneumoniae {previously also referred to as HaemaphiZus
pleuropneaamontae) and is considered to be one of the moat important
disorders of the bronchial tubes in pigs. Frequently, the disease is fatal.
Actinobacillus pleuropneumonfae is mown to exist in twelve infective
serotypee.
Since pleuropneumonia can be induced by znoC~a~.ating pigs with
3teriXe culture supernatants of A. pEeuropneumonlae, extraoellular toxic
proteins are assumed to be involved in the development of the pneumonic
lesions. There is growing evidence that cgualitative ar quantitative
differences in toxic activities exist between the twelve serotypes of A.
pleuropneumoniae. ~temolytic and cytotoxic activities have been reviewed by
T.A. Bertam., Can. J. Vet. Rea. 54: S53-S56 (1990). Two different hemolytic
activities were reported by Frey and Nicolet, J. Clin. Pllcz~ob~Got. 28:
232-236 (1990), whereas four antigenically different activities were
distinguished by Kamp and Van Leengoed, J. Clan. MicrobioZ. 2': 118-2191
(19$9). Whether such activiCies are functions of one or more molecules is
not known.
Vaccines proposed thus far for preventing infections by Actino
bacllZus pleusopneumontae are mostly based on whole live cells, attenuated
cells, lysates, culture supernatants, or extracts of A, pleuz~opneumonlae.
WO-A-$0,02113 (or Canadian Patent 1,189,780) teaches a vaccine for
controlling pleuropneumonia in pigs, containing A. pleuropneumoniae cells,
cell fragments etc. and, as an adjuvarrt, material derived from Boxdetella
peztussls. EP-A~420,'743 proposes a vaccine containing inactivated toxin of
serotype 1 and opt:iona2ly an inactivated toxin of another serotype of
A. pteuropneumontae; it provides protection against serotype 1 and pastiaa
pruLeat3orr abairtst other serotypes, EP-A-354,528 disc~.oses a universal
vaccine against A, pZeux~opneumorttae, which contains extrac~llular proteins
from two different serotypes, and is effective against all A. pleuro~
pneumontae serotypes. Although these known vaccines provide protection
~~~~~~~9
against some or even all of the field strains of A, pleuxopneumoniae, the
active compounds are not known, As a result, control, verification, and
standardisation of vaccines is difficult. since the ratio between active
components cannot be optimized and inactive and sometimes adverse
components are always present in the vaccines.
Summary of the invention
The present 3.nvention, in one aspect, provides a vaccine for the
prevention and/or the treatment of infection by AetinobaCtlxus pZeuxo-
pneumontae containing at least an iraanunogenic part of at least one
polypeptide selected from the group consisting of cytolytic proteins of A.
p~euxopneumontae produced by recombinacit DNA technology, and detoxified
derivatives thereof.
.1t has been found according to the i,nventi.on that Ac~~nobaciZlus
pleuropneumon~ae produces three hemolytic and/or cytotoxic proteins'
(toxins), hereinafter referred to as cytolytic proteins: Cytolysins I, xx
and III (ClyI, ClyII and CIyIII). Where the term "Cytolysin" (Cly) is used
in the present specification, this shall thus be understood to comprise any
extracellular protein produced by any strain of A. pZeuz~opnemnoniae and
producing anv adverse effect (be it hemolytic, cytotoxic or other or both)
ZO on cells or tissues of an infected animal; where appropriate it shall be
understood also to comprise immunogenically active parts of these proteins
or derivatives thereof .having diminished adverse effects. Protection
against infections by any of the known serotypes of A, pleuxopneumoniae is
conferred to wn animal by administering an effective amount of all three
cytolysins, and partial or complete protection against specific serotypes
is conferred by administering one or two of the Cytolysins, depending on
the servtyp8 Car serotypes in question.
Thus, the vaccine of the invention contains at least one of the
three cytolysins I, II and III, preferably two, and mare preferably three.
The cytolysins may be present an the vaccine as the naturally occurring
proteins, or they may be present as derivatives containing at least an
immunogenic part of the proteins, or as a detoxified equivalent.
Detoxification shall be understood to mean that the toxic activity of the
proteins has been removed to a sufficient degree or for a sufficient number
of the protein molecules to provide a vaccine which does not produce an
unacceptable toxic reaction in the producing host and/or in the vaccinated
animal, whereas it provides a sufficient immune response. Detox~.fiCation
can be brought about by chemical, physical or enzymatic treatment of the
proteins or by substitution, insertion or deletion of one or more
nucleotides in the cytolysin genes resulting in the substitution, insertion
or deletion of one or more amino acids in the protein. Detoxification can
also be achieved by expression of the toxin gene in the absence 'of the
activator gene.
It was found that the cytolysins are encoded by operons wherein the
structural toxin gene is flanked at the 5' end by a gene encoding a peptide
required to activate the toxin, hereinevfter referred to as the activator
protein. The cytolysins may be present in the vaccine in the activated or
non-activated form.
The cytolysins or their derivatives present in the vaccine are
preferably obtained by expression of recombinant DIVA encoding the proteins
mentioned above. The detoxified cytolysins constitute a further embodiment
of the present invention.
In another aspect of the invention a process for producing a
cytolytic protein of ActinobacitZus pteuz~opneumon~ae or an immunogenic
and/or detoxified derivative thereof is provided, which process comprises
the steps of:
a) selecting at least one nucleotide sequence coding for at least
an immunogenic past of said cytolytic protein,(toxin} optionally including
an activator protein, or a derivative thereof;
b} inserting the nucleotide sequenca(s) selected in step a} in a
vector or an expression v~ctor;
c} transforming a host cell, preferably a host eel.I that is capable
of secreting said cytolytic protein, with the vector obtained in step b);
d) cultivating the host cell of step c) to express the nucleotide
~5 sequence(s) of step a};
e) recovering and optionally purifying the protein from the culture;
f) ciptionally modifying the protein to produce a detoxified protein.
In yet another aspect, the invention is concerned with a process of
producing a vaccine wherein at least one, and preferably two, and more
~0 preferably three, of the cytolysins or immunogeni,c parts thereof, thus
produced, are combined with an immunologically acceptable carrier and
optionally a suitable ad~uvant.
The host cell referred to in the process of producing the cytolysins
or their derivat~.ves raay be a microorganism, preferably a non-pathogenic
35 microorganism capable o.f expressing at least one nucleotide sequence
encoding the cytolysi.ns by having a strong prosaoter inducing high
expression levels or by allowing the introduction of an exogenous promoter
system to induce such high expression levels. A suitable host cell is
~schez~icYafa co~i.
1f0 In a further aspect, the invention provides a nucleotide sequence
4
encoding at least an immunogenic part of a polypeptide selected from
cytolytic proteins of Acttnobac~LZua pZeuropneumontae optionally including
activator protPin~s rind trengnort proteins, the latter ones being prot~in$
that assist in the secz°Etion of the cytolytic proteins to the
per~.plasma or
the medium. The invention also relates to a system that expresses and
secretes said nucleotide sequence and to a vector containing at least one
of esnid ryucleotide sequences each one preferably operdzlveiy "liai~ceii 'to
a
promoter and optionally an enhancer.
In yet another aspect the invention relates to a host Cell
containing at least one nucleotide sequence encoding the cytolytic proteins
or their derivatives, and capable of expressing them, the nucleotide
sequences) either being contained as such or as said vector and being'
either present in the host cell in the genome of the host or as a plasmid.
Preferably, the host cell. contains nucleotid~ sequences encoding at least
two of the cytolysins, and more preferably it contains the sequences
encoding all three cytolysiris. Z'he host cell is preferably deriv~d from g.
coZi.
The invention also provides a vaccine for prophylaxis and therapy
of infections by A. pteuTOpneumontae containing a microorganism carryinf;
one or more nucleotide sequences encoding at least an immunogenic part of
at least one cytolytic proteins of' A.~pZeuaopneumontae or a detoxified
derivative thereof. fine microorganism may be an attenuated microorganism
such as an attenuated virus or a bacterium. Administration of the vaccine
results in multiplication of the microorganism arid thus an production of
the immunogen,
T'he invention further relates to diagnostic means for det~cting
Infection by A. pZeuxopneumontae. Specifically, the invention is concerned
with an antibody, preferably a monoclonal antibody, raised against one of
the native cytolysins and useful as a component of a diagnostic kit for
detecting infection by A. pleuxopneumoniae; antibodies raised against
modified cytolysins are useful for determining protection by these modified
cotylysins. Antibodies raised against native or modified cytoxysins can
also be used for passive immunisation of infected animals.
In another aspect, the invention provides a nNAYprobe comprising at
least a part of a nucleotide sequenc~ encoding a cytolysin of Aetino
bacitZus pZeuropnewnonirxe which may be used iri a diagnostic method and a
diagnostic kit for detecting infection by A. pZeuropneumontqe. Another
method of diagnosing an A. pZeuropneumontae infection is to determine the
presence of A. pLeuropneumontae cytolysins in a subject whereby protein
pattern is indicative of the infective serotype or group of serotypes.
CA 02045950 2003-06-03
brief description of the dras~in~rs
In the appended drawings, which form a part of the present
disclosure.
Figure 1 shows the nucleotide sequence of the cytolysin I gene and
5 its activator gene of Acttnobacfttus pteuropneumonfae serotype 9 (reference
strain CVI 13261) and the corresponding sequence of amino acid residues;
Figure 2 shows the nucleotide sequence of the cytolysin II gene and
its activator gene of Actinobacillus pLeuropneumoniae strain
serotype 9 (reference strain CVI 13261), and the corresponding sequence of
amino acid residues;
Figure 3 shows the preliminary nucleotide sequence of the cytolysin
III gene of ActtnobaefZZus pteuropneumonfae serotype 8 (reference strain
CVI 405), and the corresponding sequence of amino acid residues;
Figure 4 schematically shows a RTX-toxin operon comprising the toxin
gene (A), the activator gent: (C), and the transporter genes (8. D) as well
as the operation of the gene products thereof;
Figure 5 shows the ctyIICA determinant of A. pteuropneumoniae
serotype 9 and PCR amplification products;
Figure 6 schematically shows the amplification and cloning of the
etyIICA 3' flanking sequence by inverse PCR;
Figure ~ shows the CIyII determinant organization of the A.
pteuropneumonfae serotypes i-12;
Figure 8 shows the Clyl determinant organization of the A.
pZeuropneumonfae serotypes 1-12; and
Figure 9 illustrates the expression and secretion of cytolysins I,
II, and III in recombinant ~,", cots.
stained description of the,~vgntion
According to the invention it has been found that pathogenesis of
Actfnobacillus pteuropneumc~nfQe infections can be attributed to three
extracellular proteins. 'Ihe:,e proteins have approximate molecular weights
of 105.000. 103,000, and 120,000 respectively. The 105,000 and 103,000
dalton proteins are immunolcrg.ica7lly related to each other. These proteins
found to be excellent tools for providing protection of animals, in
particular pigs, against A. pteuropneumonfae infections of any serotype.
Although factors that were thought to be responsible for the pathogenicity
of A. pteuropneumonfae were referred to in the prior art as hemolysins and
cytotoxins, it has been found now that both cytotoxic and hemolytic
activities can result from s single molecule, and hence these proteins are
denoted herein as cytolysins (Cly's): the 105 kDa protein as CIyI, the 103
kDa protein as ClyII, and the 120 kDa pratein as CIyIII. The nucleotide
seguence of the eZyl and cZNII genes and the preliminary seguence of cZbIIl
is given in Figures 1, 2 and 3, respectively.
In figure 1 the amine acid sequences of the CIyI C protein
(activator), CIyI R protein {cytolytic protein CIyI), CIyI B protein
(transport protein), and Clyl D protein {transport protein) are indicated
below the nucleotide sequence.
In Figure 2 the amine acid sequences of the CIyII C protein
{activator) and ClyII A protein (cytolytic protef.n CIyII), are indicated
below the nucleotide sequence.
In Fi~'e 3 the amino acid sequence of the CIyIxI A protein
{cytolytic protein ClyII) is indicated below the ttueleotide sequence.
For the cloning and characterixation of the genetic determinants for
these proteins three different screening techniques were used:
hybridization with an Zkt IiNA probe, selection far hemolytic activity, and
reacion with monoclonal antibodies. On the basis of the reaction pattern
with a set of MAbs it was concluded that CIyII is responsible for what has
been described by others as HlyII activity (Fret', J., and J. Nicolet (1990)
J. CZin. Microb. 28: 232-236). CIyI is identical to HIyI. Since we found no
differences between the CIyII amino acid sequence of serotype 9 and that of
an RTX toxin identified in serotype 5, the latter else Must be respons3.ble
for HlyII activity and not for HlyI as has been suggested by others (Chang,
Y. et al. {1989) DNA, 8: 635-647; MaCInTteBo J. I. et al. (1990) J.
BacterioZ. 172: 4587-4592) . For CIyII we now have shown, for the first
time, that both a (weak) heatolytic activity as tvell as a (moderate)
cytotoxic activity are clearly eonfined in a single protein.
Clyl, ClyII and CIyIII are members of the RTX cytotoxin family. This
finding is .not only based on immunological data .bur also on the
similarities between primary sequences,, hydrapsthy profiles and the
Secretion of active toxin by the hZyBD genes of M, coZZ. The sequenced
areas of the Clyl, Clylx and ClyIII encoding operons possess all the
general.characteristics of other RTX toxin operons (cf. Strathdee, C. A.,
and R. Y. C. Lo. (1989) J. BactertoZ. 171: 916-92$).
With respect to th~ genetic organization of the Clylx operon we
found a striking difference with other RTX operons. The CIyII operon does
not contain secretion genes contiguous to the toxfn gene. Sequence
al;LAmment stud3ee suggested that in an ancestral c2tJII operon a
recombination event occured at position 3490 thereby disrupting the
ancestral cZbxlB gene. Intact secretion genes are, however, present
elsewhere in the genomes of A, pZaurapnQ~on2ae serotypes, These secretion
~~~~~U
genes. however, belong to intact (serotypes 1, 5, 9. 10, 11) or disrupted
(serotypes 2, 4,'7, 8, 12) ClyI operons. This is based on sequence data and
on the observation that a 7.4 kb NstI/HindIII DNA fragment covering the
ct~B gene and approximately 4.5 kb of upstream sequences of serotype g
encodes a 105 kDa protein indistinguishable Prom CIyI. This means that the
ancestral etgIIBD genes have bEen lost from the serotype g gsnome. In
addition these data indicate that secretion of both CIyI and CIyII is
dependent on only a single set of secretion genes. Since these secretion
genes belong to the CIyI operon, these genes are referred to herein as
et~rlBD. ThreQ extra nucleotides are present in front of ctHISD In a region
which forms a rho-independenC transcription termination signal in other RTX
determinants (cf. Strathdee, C. A., and R. Y. C. Lo. (l.g8g) J. Bact~z~iot.
171- 5955-5962). Furthermore the row of seven T residues which is present
in these signals has been changed in ctHI to the sequence TTTATT'f, These
nucleotide changes m~.ght affect the efficiency of transcription termination
or the regulation of this process leading to another level of ctbDD
expression.
Tha finding that the primary amino acid sequence of the serotype 9
ClyII is completely identical to the serotype 5 hemolysin and also the
finding that (almost) completely ,identical ctyIICA genes are present in
serotypes 1, z, 3, 4, 7, $, 11 and 12, suggests an important role for ClyII
in pathogenesis. The observation that ClyII is produced in all serotypss
except serotype IO and that ClyII ig the only extracellular cytolysin of
serotypes 6, ~, and 12, supports this view.
The CIyII. determinant of the reference strains of alI twelve
A. pteuropneu~npniae serotypes were studied and it was dembnstrated, by
southern hybridization, that ctyIICA sequences are present in all
serotypes. except I0. This is in agreement with the observation that
serotype 20 is the only serotype not secreting ClyII. PCR amplification of
the cZ~IZCA aequenees of the serotypes carrying these genes resulted in
equally sized products for all serotypes, except b. The eZyIICA genes of
the serotypea I, 2, 3, 4, 5. 7, $, 9, II and 12, giving equally sized PCR
fragments, were compared by extensive RFLP studies. For these studies we
used four different restriction enzymes, which together have 57 recognition
sites in the ctyIICA sequence of serotype 9 and axe therefore very suitable
for a detailed comparative study. These studies showed very similar
restriction patterns of cIyIICA for the ten serotypes examined. These
results give ,strong evidence that the ctyIICA genes of the serotypes 1, 2,
3~ ~~ 5. 7, 8. 9. ;E1 and 12 have a very similar primary structure. Only
0 three differences among the ctNIICA genes of the 10 ssrotypes were found in
s
these RFLP studies, and this low number is illustrative for the high degree
of similarity between the cZ~II genes. Compared to the sea~otype g seguence
additional sites were found for Saic3AI in seiotype 5 at position -94, and
for Rsal in aerotype ~ close to position 281$ or 3143. Furthermore a small
deletion between position 520 and 690 was found in serotype $ by HZn,~TT
digestion. Sequence comparison of the aesotype 5 and 9 cZ~IICA sequences
showed this additional Sau3Al site in serotype 5. From this comparison it
was also expected that in serotype 5 an additional HpaIZ site at position
209, a three basepais deletion at position 51 and a single base-pair
deletion at position 44 would be present. No evidence was found either for
the additional HpaII Bite, when analysing the cZXIICA fragments of serotype
5 and 9, after digestion with this enayme, or for the deletions when
analysing the sizes of the restriction fragments generated by AZuz. X~r~II,
Rsal or Sau3AI. T'he absence of these sequence differences shows that the
serotype 5 and 9 cZyIICA sequences are even more similar to each other than
expected from the published DNA secZuences.
Intact transporter genes, cZ~IIBD, contiguous with the eZXIICA genes
were not found among the twelve serotypes. Hybridization of the proposed
etyIBD seguencea of serotype 9 to genomic DNA of the twelve serotypes
showed hybridisation to all serotypes, excluding 3 and 6. This indicates
that all serotypss, but 3 and 6, do contain the eZyIBD transporter genes.
'The translation products of these genes may act in txans and account for
the transmembrane transport of CIyII. The transporter proteins for ClyII of
aerotypea 3 and 6 however remain to be identified. To our knowledge the
proposed complementation of the RT3S transporter genes,of two RTX operons is
the first evidence that Chess transporter gEnes are exchangeable in a
naturally occurring organs~m.
The fact that most serotypes secrete CIyII, and that serotype ~ and
22 secrete ClyIZ as the only cytolysin illustrates the role of this toxin
is porcine pleuropneumonia. Immunization with CIyII will induce antibodies
directed against CIyII of all serotypea. Furthermore, the very similar
eZyIICA genes may be the targets of choice for diagnosis of ~1. pZeuro-
pneumoniae ~.nfsction, sizrce th~ir sequences are present and highly similar
in alI serotypes, except serotype 10. There is good evidence that field
strains of most, if not all, serotypes produce the same cytolytic
activities as the reference strains.
Table A shows the extracellular protein pattern and their hemolytic
and cytotoxic activity for the various serotypes of ActtnobactZZus
pZeuropneumontae. Table B shows the same protein and activity pattern
wherein the immuno:logically related aerotypes are grouped together.
TABLE A
Strain 1 2 3 4 5 6 ~ 8 ~ 10 11 ~,2
12o kDa = clyxxl . . ~ w
105 kDa = ClyI ~ . ~ ~ ..
103 llDn ~ ClyII w w w _ w s w su en w x~
Hemolytic s w w w s N w w s s s w
Cytotoxic S S S S S N M S S S S
S = strong activity; M = moderate activity; W = sneak activity; N = none
~ $ protein band is rresent
TABLE 8
Serotype 1 5 g 11 2 3 ~ 8 7 12 10
120 kDa = CIyIII ,~ ,~
105 kDa =.Clyl . . . _
103 kDa = CIyII ~ . v _ - - p
Hemolytic S S S S W W W W W W S
Cytotoxic S S S S S S S S M M g
S = strong.activity; M = moderate activity; W ~ weak activity; N = none
o a protein band is present
A vaccine containing Clylx or an immunogenic part thereof or s
detoxified derivative thereof will provide protQCtion against infections by
Ac~inobact2Zus pteuz~opneumoratae serotypes '7 and 12, whereas it might
provide partial protection against other serotypes except 10. Similarly, a
vaccine containing CIyI or an effective part or derivative thereof tai.ll
provide protection against serotype 10 and partial protection against
serotypes 1, 5, g and 11, whereas a vaccine containing CIyIII or an
effective part or derivative thsr~of will provide partial protection
against serotypes 2, 3, 1!, 6 and 8. Farther a vaccine containing CIyII and
CIyI or effective parts or derivatives thereof will provide protection
against infection by serotypes 1, 5, '~, 9, 10, 11 and 1Z, and partial
protECtion against the other serotypes; a vaccine Containing CIyII and
10
CIyIII or effective parts or derivatives thereof will provide protection
against infection by serotypes 2, 3, $, 6, ~, 8 and 12, and partial
protection against the other serotypes except 10; a vaccine containing CIyY
and CIyIIT or effective parts or derivatives thereof provide psotection
against infection by serotypes 10, and partial protection against the other
serotypes except 7 and 12. A preferred foa~o of the vaccine contains CIyI,
ClyII and CIyITI ar immogenic parts or detoxified derivatives thereof, and
is effective against all known and probably also against any still unknown
serotype of A, pZeuxopraeumont~ze.
The vaccine of the invention contains the polypeptide or polypeptide
derivatives in immunogenically effective amounts, far example between 0.1
and 1000 ug, more particularly between 1 and 100 pg of protein per dosage
unit. An important advantage of the invention is that both the absolute &nd
the relative amounts of the immunogens can be adjusted according to the
intended use. In contrast, all prier art vaccines contain immunogenic
factors in fixed ratios, since they were produced b~~ live A. pZeuna-
pneumontae cells, and separation of the factors was net contemplated and
hardly possible. The optimum levels and ratios depend on the nature of the
infection against which protect is required, the characteristics of the
animals to be protected and other factors known to the skilled person. The
vaccine may be administered in a conventional way, such as intravenously,
intramuscularly, subautaneously, intraperitoneally, 3ntranasally or orally.
In addition to the cytolysis or part or derivative th~reof, the
vaccine may comprise an immunologically acceptable carrier, such as aqueous
~5 diluents, suspending aids, buffers; furthermore, axcipients and adjuvarsts
known in the art may be present. Suitable adjuvants include aluminum
hydroxide, Freund's adjuvant (complete or incomplete), bacteria such as
BoTdet.ella p2rtuussis ar E, coZZ or bacterium derived matter, ~.mmurie
stimulating complex (iscom), oil, saponin, oligopeptides or other adjuvants
known to those skilled in the art. The protein may also be coupled to an
acceptable. carrier molecule, particularly a natural or synthetic polymer
such as polypeptides, polysaccharides, polystyrene, etc. The vaccine may
also contain other immunogens related to other diseases in a prophylacti-
cally or therapeutically effective amount, to obtain a multivalent vaccine.
The cytolysis or part or derivative thereof may also be fused to
another polypeptide; such other polypeptide may be a carrier po7.ypept3de
or, advantageously, a second and possibly a third cytolysis or part or
derivative thereof. In a prefErred embodiment, the vaccine contains a fused
polypeptide comprising im~aunogenic parts Of two or three cytolysina. Such
~f0 a fused polypeptide may be prepared by coupling of the relevant poly-
~11 ~~~~J~J~
peptides, or by fusing the nucleotide sequences encoding said polypeptides
followed by suitable expression of th~ fused nucleotide sequence.
In the process of producing a cytolytic protein of A, pleuro
pneumantae or a part or a derivative thereof, suitable for use in the
vaccine as described above, in step a) a nucleotide sequence encoding a
cytolys~tn is selected and optionally modified by insertion, substitution or
deletion of nucleotides to obtain a sequence encoding an immunvgenically
active and/or a detoxified protein. 'The selection of the nucleotide
sequence may be performed by screening the gene library of A. pleura-
pneumontae using established methods, as illustrated in the examples to the
present specification. The nucleotide sequence may then be Cloned and
isolated; alternatively, the nucleotide sequence may be synthesizes. The
sequence preferably comprises the sequence encoding an act3.vatoa~ protein
for the cyto~ysin, which may be the activator of the cytolysis itself; in
the latter case for example, the nucleotide sequence u~ay comprise the
cIyIICA gene.
Tha nucleotide sequence is then inserted in a suitable vector in
step b). Such a vector may or may not comprise a promoter and optionally an
enhancgr. The promoter can be selcted to obtain the desired level of
expression. Modification of the nucleotide sequence may be performed in the
vector, instead of before insertion as explained above. Suitable vectors
are art-known.
Step c) can be carried out using standard techniques {see for
example: Maniatis, T. et al, {1g82) Molecular Cloning, A Laboratory Manual,
Cold Spring Harbor Laboratory). The host cell in which the vector
containing the nucleotide sequence is transferred preferably also produces
transport proteins allowing the cytolysis or part or derivative thereof to
pass the host cell.mestbrane and even be screted into the medium, and thus
to be easily harvested. The transport proteins may be derived from A.
pleuropneumontae or from the host cell or from another organism. The host
cell is advantageously E. toll.
The nucleotide sequence to be used fox producing the cytolysis can
be derived from the sequence shown in figures 1, ~ and ~, xelating to the
clyl, ctbIl, and cldIII genes respectively. Th~ nucleotide sequence can
comprise the entire gene, or part thereof encoding at least an epitope of
the protein. The nucleotide sequence can be modified by del~tions,
substitutions or insertions, in particular those which result in a sequence
encoding a detoxified derivative of the eytolysin, or those which result in
a sequence which, although modified, still encodes the amino acid sequence
~0 of the cytolysis or derivative thereof.
12 ~~~)~ i~
Another ady~t~geqqs tvgP of vttrn9n~ ~rnsrir~~ri by tha prooont
invention is a vaccine which does not contain the immunogenic protein or
proteins as described above, but which contains a recombinant expression
system such as a microorganism, carrying a nucleotide sequence encoding
said immunogenic protein, for example integrated in its genome or present
as en expression vector. lmmttniaation is then induced by administration of
the vaccine containing trim expression system and subsequent replication
and expression in the vaccinated animal. Faxamples of microorganisms that
can be used for this purpose include bacteria such a~ BaZmoneZZa or E,
colt, bacteriophages, and viruses, such as vaccinia virus. adenovirus,
h~rhlln~rirug, SU~dO retrovisua, hegrabitia D ~l~~ua rmd pbeudorabies wsrus;
Qther Pxr~mpl~fi tarp cells whioh huvo boon brar~afarmar~ ~dLl~ m,a ~F these
viruses or with other vectors and cell$ wherein these viruses replicate.
These recombinant expression systems constitute an aspect of the present
invention.
Monoclonal antibodies to the cytolysins or immunogenic parts or
derivative$ thereof spay be produced in a known manner, e.g. by immunizing
s suitable animal with the cytolysin or an appropriate epitope thereof,
fusing the resulting cells producing the antibody to the cytolysin with
myeloma cells, .selecting and cloning the resulting hybridoma cells to
Droduce the antibody. The antibodies to cytalyain I, xI r~md IIZ or to parts
of these proteins can be used in a diagnostic method for assaying an
infection with A, pZeuropneumonta2. The antibodies may be employed in an
-_____ rigg).lt?:i~a.t'tnn.. asg.a~. ~,x~3ym.~,~! gt~ tt~tv3bGd;y'~ niray iac
cvupleo Lo a sOlau
~5 particle, The antibodies may be labeled by an enzyme, a luminescent
substance, a radioactive isotope, a complexing agent, or by other known
means; they may be used in a sandwich assay with a second antibody, one of
the two being laheled. The antibodies may be a part of a diagnostic kit,
which further contains conventional components for carrying out an
3~ immunoassay.
T'he antibodies are also useful as a means of passive immunization
of an animal against A, pZeuropnawnon~cae wherein the antibody inhibite the
activity of cytolysins that are introduced by infection. A vaccine to be
used for this purpose comprises antibodies to one or more, preferably three
35 different, cytolysins, optionally together with suitable carriers and
adjuvants.
The nucleotide sequences illustrated in figures 1, 2 and 3 or in
particular suitable pasts thereof are also useful as diagnostic.tools. Such
DNA probes can be used for determining the presence of ~1. pZeuropneumontae
in biological samples of animals. The DNA probes of the invention are used
13 ~~~~~j~~i~
according to known techniques for sampling, hybridization, possible
amplification and detection. The DNA probes can be part of a diagnostic
kit, which may further contain usual components, such as filters, labeling
substances, diluents, amplification or detection aids, etc.
EXAMPLE 1
a -nips and iden~3ficatiQn of Cyto:Lvs3ns I. and 'Lr
Materials and Methods:
Bacterial strains., plasmids and cloning vectors.
The reference strain CVI 13261 of A. pZeuropr:eumontae serotype 9 was used
as DNA source. The gene library was made in bacteriophage lambda Qemll
(Promega) and prapagated in E. coZ3 LE 392 (Sambrook, J., E. F. fritsch,
and T. Maniatis. (189}. Molecular cloning. A laboratory manual. Second
edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor. New
York). Specific DNA fragments were (sub)cloned in p~C~JN plasmid vectors
(Konings, R. N. H., et al. (1987) Methods EnsPmoZ. 153: 12-34) and
transformed into L. eoZf JM101 (Sambrook, supra). Plasmid pLKT 52,
containing the RTX determinant of P. haemotyttca, was prepared by Dr. R. Lo
(Strathdee, C. A., and R. Y. C. Lo. (1989) J. .~ac~ertoZ. 171: 916-92$).
Plasmid pLG575, a pACYC184 based plastnid containing the ~tZ~B and T~tyD
secretion genes of E, eo~t was prepared by Dr. C. Hughes (Gygi, D., C.
Hughes, et al (1990) Mot. ~Jicrobtr~Z. 4: 123-1.2$),
Construction and screening of the DNA library.
high molecular weight DNA was isolated by SDS/proteinase K lysis,
phenol and phenol/chloroform extractions, and precipitation with ethanol
(Sambrook, supra). With this DNA a library was constructed in lambda Geml1
according to the methods recommended by the supplier of the vector arms
{Promega). Plaque lifts from this library were hybridized with appropriate
restriction fragments which were labelled in advance with [32P)dATP
(Amersham) using the nick translation kit of Hoehringer, Mannheim. Plaques
that hybridized were vi&uaZazed by exposurA tn X-ray fi'~m (East.man Kodak}.
I'he'library was also screened for the presence of hemolytic plaques. Far
that purpose plaques, grown at 37°C on a Lur3a broth agarplate, were
overlaid with 0.8x agarose containaLng 5~ sheep erythrocytes, lOx Serum Plus
(Hazelton) and 0.5 times Eagle's minimal essential medium (Flow
laboratories, Irvin, England} in phosphate buffered saline. The plates were
incubated at 37°C for 6 to 22 hr. Selected plaques w~re purified to
homogenicity by at least two cycles of plating and screening.
DNA manipulation and sequence analys3,s.
DNAs were digested tQ completion with restriction enzymes according
14
to the specifications of the enzyme supplier (Pharmacia LKB, Sweden). The
resulting fragments were separated by electrophoresis on 0.8x agarose gels.
Desired fragments were electrophoretically eluted from gel slices and
further purified by extractions with phenol and chloroform and precipi-
tation with ethanol. Fragments were (sub)cloned in pKUN plasmid vectors
(Konings, supra) by standard molecular biological techniques (Sambrook,
supra). Progressive unidirectional deletions were ~ade with the Erase-a-
-ba.;e"system from Promega. Nucleotide sequences were determined by the
dideoxy chain tereination method (Sanger, F. et al (1977) Proc. NatL. Acad.
rM
Sct. USA. 'j4: 5463-5467), The sequences were analyzed using the PCGENE
(Intel ligenetics Corp., Mountain View, CA) and Wisconsin GCG~(University
of Wisconsin) analysis software packages.
Gene Screen Plus~''nylon membranes (Du Pont NEN) were used for
Southern blot analysis. The blots were hybridized with DNA probes, labelled
as described above, according to the instructions of the membrane supplier.
Before exposure the blots were washed a final time with 0.1 x SSC, 0.1x SDS
for 30 min at 65°C for homologous probes and with 1 x SSC, O.lx SDS for
30
min at 50°C for heterologous probes. All other DNA manipulations were
done
with standard molecular biological techniques (Sambrook, supra).
Immunoblotting, monoclonal antibodies (MAbs) and toxin bioassays.
Proteins present in recombinant plaques, cells or supernatants of
stationary growth cultures were electrophoresed through reducing and
denaturing 6x polyacrylamide gels (Laemmli, U. K. (1970) Nature jLondon)
227: 680-685). The separated proteins were stained with silver or blotted
onto nitrocellulose with a semidry blotting apparatus {Bio-rad Laboratories
Inc.). The blots were incubated according to the method of Towbin (Towbin,
H., et al (1979) Proc. Natt.. Acad. Sci. USA. 76: 4350-4354) with
convalescent swine serum derived from an A. pleuropneumoniae serotype 9
infected pig or with MAbs specific for ClyI and/or ClyII. MAb CVI-ApCly 9.1
and ~i.2 recognize Clyl, MAb CVI-ApCly 9.3 ClyII, and MAb CVI-ApCly 9.4
reacts with ClyI and ClyII (see example 3). Bound antibodies were detected
with an anti mouse or anti swine immunoglobulin G-alkaline phosphatase
conjugate (Zymed Laboratories Inc.) and color development with the
substrates nitroblue tetrazolium (Merck) and 5-bromo-4-chloro-3-indolyl
phoa~~'~ate (Boehringer Mannheim).
Recombinant toxin, isolated from logarithmic growing cultures, was
testerd for hemolytic and cytotoxic activity as described earlier (Kamp, E.
M., and L. A. M. G. 4~an Leengoed (1989) J. CZin. MicrobioZ. 27: 11$'7-1191).
Hemolytic and cytotoxic titers were expressed as the reciprocal of the
highest dilution showing at least 50x lysis of the target cells.
CA 02045950 2001-12-04
RESULTS
Gene cloning.
To determine whether A. pleuropneumontae serotype 9 encoded for
toxins related to the RTX cytotoxin family, a 3~7 kilobasepairs (kb)
PvuI/SaZI DNA fragment derived from the Ieukatoxin (lkt) detera~inant oP
P, haemotpttca (Stathdee, C. A, and R. Y. C. Lo. (1987) TTti'eet. Tm~rt. 55:
3233-3236) and containing lk~tA, the 3'-end of tktC end the 5'-end of tkt8
(ZktCAH) was hybridized to genomic DNA. Three specific DNA fragments were
found to be homologous to the probe. The tktCAB probe was then used to
screen a library of the A. pleura~eumaretce serotype 9 DNA which was
prepared in the vector lambda Gemll. Forty recombinants reacted as strongly
positive. To determine whether recombinants with cytolytic activity but
without any detectable hoa~ology to Zkt DNA existed, the library was also
screened for the presence of recombinants capable of hemolysis of sheep red
blood cells. Three recombinant plaques showed clear hemolytic activity.
These hemolytic clones hybridized however with the tktCAB probe, indicating
that they shared i,denti,cal sequences with the clones that were Found to be
positive with the lkt probe. 'The hemolytic clones expressed a 103 kDa
protein that was absent in non-hemolytic clones. This 103 kDa protein
reacted with MAbs specific for ClyII and not with MAbs specific for ClyI
(see below). These data indicated that we had cloned the CIyII gene.
To localize the CIyII gene in the 9 - 21 kb long inserts of the
selected recombinants, we digested the DNA of Z3 positive clones, including
the hea~olytic ones, with the restriction enzyme HindIII. The resulting
fragments were electrvphoreaed, blotted onto nylon membranes and hybridized
with the ZktCAB probe. All recombinants contained a 2.4 kb fragment
homologous to the probe. Several recoa~binants also contained a 4.4 kb
fragment that hybridized. Others contained a hybridizing fraga~ent of
variable length in addition to the 2.4 kb fragment. Apparently only a part
of the 4.4 kb XfndIII fragment is present in the latter clones and has been
ligated to one of the vector arms. These data provided a location far the
ClyII gene (cZyIIA).
Although the tktCAB probe used for screening contained approximately
300 by of the tktB secretion gene, it appeared that none of the g - 21 kb
inserts of the selected clones contained intact $ and/or D genes. To
investigate whether such sequences were present elsewhere in the genome, s
1.2 and a 0.7 kb EeoRV DNA fragment, covering both the 3' end of the IktB
gene and the 5' end of the lktD gene of P, haeraoZ~tfca (lktBD, 24), were
hybridized with genomic DNA. A 4.3 kb HfndIII fragment hybridized. This
fragment was absent from the three hemolytic clones and all the clones that
l6 ~o~~o~o
went aela~ctad with tha tktOAD praBa. tram ~baae data wo aanoludnd that tho
genome of A. pteuropr~eumortiae does co»taia sequences related to the RTX B
and D secretion genes but that these sequences are not contiguous~to the
ClyII toxin gene.
xn order to clone the RTX B arid D related DNA, HindIII digested and
size fractionated gennmie, TINA of btrwin CST 1.3261 wars ligel;r~d L~ta a
ItdndIII diaestcd pKUN plaamid. lifter tranoformation into ~'. oati and oolong
hybridization with tktBD we were able to isolate a clone that contained the
4.3 kb HindIII fragao-ent. Us~Lng this fragment we also isolated a 7.0 kb
BgnII/EcoRV fragment that overlapped the 4.3 kb tlindIII fragment at the,
5'-end, and a 4.2 kb Ba~nHI fragxoent. that overlapped the 4.3 kb HindIII
fragment at the 3'~end. Restriction analysis and Southern hybridization
provided a location for the postulated secretion geenes etyBD.
Nucleotide sequence analysis.
The ctyIICA loCUB and the ctyBD locus were subjected to nucleotide
sequence analysis. The established sequences and the derived amino acid
sequences of the major open reading frames are shown in Fig. 2. Both loci
contained two major open reading frames; these were named ctbIIC, ctyIIA,
clbB and ctyD (see also Fig. 1 and Fig. 2). The maps of restriction sites
deduced from the seguences correlated well with the maps of restriction
sites as determined from the cloned DNA and the genomic DNA (data not
shown). Thus no detectable rearrangements had occurred during the cloning
procedure. The sequences were numbered starting at -231 (etyxXCA locus) and
-592 (etyHD locus) to correspond to the orientation and location of the
major open read3,ng frames. In ctyIICA the open reading frame from 1 to 4'77
(ctyIIC) codes for a polypeptide of 159 amino acids (18.5 kDa) and the
frame from 519 to 3386 (etyIIA) far a polypeptide of 956 amino acids (IOZ.5
kDa'). The xatter protein is the CIyII toxin and, as other RTX toxins,
contains glycine rich repeats near the carboxy terminus. In ctyBD the frame
from 1 to 2133 {ety8) codes for a polypeptide of X11 aaai.no ac~Lds (80.2 kDa)
and the frame from 2142 to 35T5 (ctyD) far a polypeptide of 4'7$ amino acids
(54.9 kDa).
These protein sequences were very similar to the protein sequences
of the RTX determinants of E. cots, P. haemotytica and A. pteuroponewnoniae
serotype 5. Their mutual hydrapathy profiles {Kyte, J. and R. Doolittle
(1982) J. blot. Blot. 157: 105-132) were also quite similar. The CIyIIC and
CIyIIA proteins were more homologous to the LktC and LktA proteins of
P. haemotytica than to the HlyC and HlyA proteins of E, cott (Stathdee, C.
A. and R. Y. C. Lo (1987) In,~ect. Immu;~. 55: 3233-3236)~ In addition the
CIyIIA toxin was identical to the 105 kDa toxin identified by Chang et al.
1.~ ~~~~~~~c~
in serotype 5 (Chang, Y. et al (1989) DNA 8: 635-64'). The ClyTIC protein
differed however from its counterpart in serotype 5 at three positions; at
amino acid position 5 (extra residue), between residues X11 and 4'7
(frameshift due to an insertion and deletion of nucleotide residues at
positions 125 and 138) and around amino acid position 65 (nucleotide
sequence of TGGGCC in serotype 9 and TCCCGG in aerotype 5).
The seduence of clyIrCA was highly homologous to that of other RTX
sequences up to position 3490. This position corresponded to amine acid
residue 12/23 of .known RTX H secretion proteins. Instead of RTX $ protein
related sequences we found an open reading frame in the opposite DNA strand
downstream this position. This f3,nding confirmed that in serotype 9 no
RTX-B related sequences were contiguous with the toxin gene. Probably a
recombination occured at position 3490 (amino acid position 12/13 of the
truncat~d RTX~B homolgue) in the eZlIII operon.
Identification and secretion of CIyII.
A 2.~ kb DNA fragment extending from the 5° end of the insert of
one
of the selected recombinants up to the Kpnl site downstream cZyIIA was
ligated into pUCl8 DNA. E. coZ~' cexls that contained this plasmid produced
a 103 kDa protein, xh~.s protein s~acted with a convalescent swine serum,
with MAbs specific for ClyII, and not with iHAbs specific far CIyI. To
provide add~,tional evidence that cZyIIA encodes for the 103 kDa ClyII, ws
slectrophoresed the proteins present in eZNIICA containing E. colt celxs
and the proteins present in culture supernatants of serotype g alongside a
mixture of both preparations. The data clearly indicated that the c~~IIA
Z5 encoded protean comigrates with CIyII.
To assess whether th~ ClyIT toxin also shared functional related-
ness with the enterobacterial RTX cytolysins, E, colt cells carrying the
cByIICA genes were cotransformed with a compatible plasmid coding for the
E. colt hZ~BD secretion proteins. The intra- and extracellular proteins of
these cells and also of cells that contained either one of these plasmids
were assayed For the presence of C7.yII. ClyII was only secreted from the
cells when the secretion genes were present i~ traps. These data therefare
demonstrated hlyBD mediated export of CIyII across E. colt membranes and a
functional relatidnsl~:Lp lyGt,w~~l, ClyIT tu~d tlne ~ifX toxin family.
To study the biological activity of ClyTT, culture supernatants and
call lyFa,t,Qg of t;llP samR spr, of r~P71 ~ ~,~pra tested for h~molytic and
cytotoxic activity. The Cytolyta.c activities in these supernatants and cell
extracts perfectly matched with th~ presence of~ the C7.y:CI protein among
these preparations. These data also indicated that CIyII had two
activities: a moderate cytotoxic activity and a weak hemolytic activity.
I8 ~~4~~~0
ThARp ~rtivitiprc r~rA ~tnhAmfltirr~lly r~rPSPntfl~1 in TmhlPS A Anrl Ft,
Identification of Clyl.
A '7.4 kb Natl/HtredIII DNA frago~snt containing the cty8 gene and
approxl.mately 4.5 kbp of upstream sequences (Fig. 1) was ligated into
p~ICl8 DNA. The p>'ntPi ns1 prn~la~Pd by rP11 ~ thsfi rnnt;r~inP~i thi ~ n1
fl~mi ri wPrP
oicatrophoroe~cd in parallel with culture supernateat of A. pteuropneur~eniae
serotype 9 and of ClyII secreting E. colt cells. After blotting we screened
for the presence of ClyII, Glyl and CIyII+Clyl. The data demonstrated that
the 7.4 kb Nstl/HtredIII fragment encodes a 105 kDa protein which is
lull~,t,3usulal~aLlG Pa~uuu CIyI cold wlrich ;Lei clearly different frow
ClyII. This
ClyI protein could also be secreted from E. cell cells when they C~3nta~ned
the, ln,trnn rs~rr~tinn gr~r~~y Ill ~ t~uYaa . F'av.r~u Lh~r~wlalr w~
cw~clwlwtl i.laW . i.lm
etbBD genes form part of an RTX operon that codes~for CIyI. Since the
secretion gEli~B Lrl~irg Lu !:he Clyl operon, these genes are now referrer! to
ir, a,~ ,: ZyIDD. 'fhe upstream :~ayuar5,:.~ or ~ I~IHD wuLniu~u~ U~cs c:
tdICA aG.~e~s w~
sequenced as described before. The sequence is shown fig. 1. The genomic
organiaaL~an oz ~e wy1 dC~erf~al~a~rt wee eicterminea liar the 1~ Sa;L~~Cy~ta
~l'
Acttnobactttus pZeuroprceumontae and is dep:tcted in Figure 8.
C~lonin,~of 1~"y"gene encoding C~rIII
Genomic DNA of ~lctinobaetttus pteuropneumontae serotype $ wag
partially digested with the restiction enzyme Sau3A to fragments with an
average size of about 1000 basepairs. These fragments weir partially filled
in using Klenow DNA polymerase end dG~' arid dATF. The plasmid expression
vector pUEX2 (Bressan, G.M. and K.K. Stanley (1987) Hucl. Acid Res. 15:
?5 lllllSF) wHS digQStod with the restriction enzyme SaII and pux~tially
filled
in using Klenow DNA polymerase and DCTP and dTTP. The modified fragments
were ligated into the linearized vector and E. colt strain LR392 was
trt~ngfrarmad with this l3gatiori mixturo_ Approximately X0,000 indepcadcnt
recombinants were grown at 37'C and after two hours of induction of the
synthesis of ~~galaatociduao fusion pr4toino at ~l3'C, the pretairia present
in the recombinants were bound to nitrocellulose membranes. The membranes
were screened with MAb 2.2 (see example 3), and immunorea~ctive clones were
visualized using rabbit anti mouse seru~a conjugated with alkaline
phoephataco. Throe immunoreactivc clerea~ warn found, ~.4, 5.4, eu::l ~.~.
Clones 3.4 and 7.4 contained a 400 base-pair fragment of A, pteuro-
yli8ti7pQ»~f7P. RPrntyt?P ~, r1 nnP 5 , ~ , rnntfli n~ri 11 1 f_iM by fragment
. Since thoeo
fragarents cross-hybridized, they contained similar DNA s~;quences. Sequence
ana7.ysis of one of these fragments demonstrated that it did not Contain the
complete CCyll.t gene. 1'0 obtain the complete eZyIII gene, genomic DNA of A.
pEeuropneumon~ae serotype 8 was digested to completion with the restriction
19
enzyme HindIII. The resulting fragments were separated on a 0.75 x agarose
gel and after transfer to nitrocellulose they were hybridized with the DNA
fragment present in clone 7.4 which had been labeled with 32P. A 3200 by
fragment hybridized. This fragment was eluted from the gel and cloned into
HindIII restricted plasmid pGEM7Z(~) (Promega) by standard molecular
biological techniques. One of the resulting clones, clone 5.2, was shown to
harbor the 3200 by fragment. The nucleotide sequence of this fragment was
determined and analysis of the sequence revealed an open reading frame of a
distal part of a gene coding for a protein homologous to the E. colt a-
hemolysin, and the proximal part of a gene coding for a protein homologous
to Hly B of E, colt. It was concluded that the 3200 by fragment of clone
5.2 comprises sequences of an RTX-toxin operon and hence that CIyIII is a
member of the RTX-toxin family. Thus clone 5.2 contained the distal part of
an RTX A-gene (toxin gene) and the proximal part of an RTX B-gene (coding
for a transport proten). The full length sequence of the putative eZyIII
gene was obtained by the cloning and sequencing of a 4200 by NsiI/XbaI
fragment (clone 6.1) that hybridized with a 1200 by HtndIII/XbaI fragment
of clone 5.2 and overlapped with the 5'-end of the fragment in clone 5.2.
The nucleotide sequence showed the open reading frame of a gene coding for
the proximal part of a RTX A protein and a complete RTX C protein.
For expression purposes we constructed a plasmid that contained an
XbaI/XboI fragment made by combining the 4200 by NsiI/XbaI insert of clone
6.1 with a 1300 by XbaI/XhoI fragment of clone 5.2. E. colt cells that
contained this plasmid produced a protein with a molecular weight of about
120,000 dalton that reacted w:th the CIyIII specific MAb 2.2. This
demonstrated that we had cloned .he gene encoding CIyIII.
Cotransformation of these cells with plasmid pLG575, carrying the
Hly B and D transport proteins of the E. coZi hemolysin determinant,
resulted in the secretion of the 120,000 dalton protein. The secreted
protein had s strong cytatoxic activity for porcine lung macrophages. It
did not show any hemalytic activity to sheep erythrocytes.
In conclusion, the 120,000 dalton protein is demonstrated to be the
CIyIII protein since it has the same size, the same immunol~ogical
properties, and the same biological activity as the CIyIII protein of A.
pleuropneumontae. Furthermore from hybridization studies we know that
sequences homologous to the CIyIII coding gene are only present in the
serotypes 2, 3, 4, and 8, the only serotypes that produce CIyIII.
The nucleotide se:3uence of the ClyIII gene was determined
essentially as described above. The sequence is shown in Fig. 3.
EXAMPLE 2
CA 02045950 2001-12-04
20
dig f A
dour eumonfae sero~~es
Materials and methods
Bacterial strains, genomic DNA, plasmids and oligonucleotides.
The reference strains for the twelve serotypes of A. pZeuro-
pnau~«r~tae were used as source of genomic DNA. The reference strains for
tire serotypes 1 to 12 were respectively S404~, 1536, 1421, M62, K17, Femo,
WF83, 405, 13261, D13039, 56153 and 8329. High molecular weight DNA was
is.lated by proteinase K/SDS lysis, phenol/chloroform extractions and
precipitation with ethanol (Maniatis, T. et e1 (1982) Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor Laboratory). DNA fragments were
cloned with the plasmid pGEM7Zf(~) {Promega Corporation, Madison, WI) in E.
colt strain JM101, using standard molecular biology techniques (Maniatis,
supra). Sequences of oligonucleotides used for the PCR are given. Their
position in serotype 9 elyIICA is indicated between brackets. Position 1 is
the first base of the ctyIIC reading frame (see Example 1).
Oligo 283: CCATTACAGAACGTTGG'TAC {-232 to -208) ,
Oligo 284: ATTAATGCGGCCGCAGGACCAG (1414 to 1435),
Oligo 285: ACAAAAGCGGCCGCATCTTACA (1356 fo 1377),
Oligo 286: CTACAGCTAAACCAAAGATCC,'T (3473 to 3493),
Oligo 158: CGTAGGTG'ITGCCCC {2033 to 2052),
Oligo 322: ATTCAATAAGCTTGAGCCGC (3366 to 3385).
Underlined sequences are recognition sites for the restriction enzymes
HindIII in oligonucleotide 322 and NotI in 284 and 2$5. 'These sites were
introduced for cloning purposes (NotI was not used in this study) by the
modification of one (322), two <;285} or three (284) bases of the original
serot;ype 9 eZyIICA sequence.
Southern blots and dot-blots.
Southern blots of restriction fragments of genomic DNA, separated
on 0.8x agarose gel and dot-blots of high molecular weight genomic DNA were
made '»kith Genescreen plus membranes (NEN Research Products, Boston, MA).
For the Southern blots 1 ug of DNA per lane was used, and for the dotblots
50 ng per dot. The blots were hybridized overnight in a Hybaid
hybridization oven at 65°C DNA with n32P dCTP (Amersham, UK) labeled
DNA
prep2r2d by random prime labeling {Random Primed DNA labeling kit,
Boehr.inger Mannheim, Mannheim, FRG}. The blots were washed with a final
stringency of 0.2 SSC (lx SSC is 0.15 M sodium chloride, 0.015 M sodium
cit~a~e) and lx Sodium Dodecyl. Sulphate (SDS) for 15 min at 65°C.
Radioactivity was detected by autoradiography using intensifying screens on
X-omat AR film (East:man Kodak, Rochester, NY).
CA 02045950 2001-12-04
21
Amplification and radiolabeling of DNA by the PCR.
The cZyIICA sequences were amplified by the PCR using genomic DNA
from the A. pZeuropneumontae reference strains as a template. The PCR was
done in a volume of 50 ml containing approximately 100 ng template DNA, 1
l.iM of each of two specific oligonucleotides, 1 U Taq DNA polymerase (Perkin
Elmer Cetus, Norwalk, CT), 0.2 mM of each of four deoxynucleotide
triphosphates (dNTP), 25mM Tris/HC1, pH 8.7, 2.5 mM MgCl2 and 0.05
gelatin. The reaction mixture was covered with a drop of mineral oil to
prevent evaporation and subjected to 30 PCR cycles of 1 min at 92°C, 1
min
at 55°C and 3 min at '74°C in a Thermal Cycler (Perkin Elmer
Cetus).
Amplified DNA fragments were separated by agarose gel electrophoresis and
extracted from the gel with GeneClean (Bio 101 LaJolIe, Calif). Two to four
nanogrammes of the purified DNA fragments were radiolabeled in a successive
PCR with a dNTP concentration of 0.05 mM each, and 5 mCi a32P dCTP.
Unincorporated dNTPs were removed by precipitating the radiolabeled DNA
from the phenol/chloroform extracted reaction mixture with ethanol in the
presence of 2.5 M ammonium acetate. The relatively high concentration of
unlabeled dNTPs used in this PCR will decrease the specific activity of the
synthesized DNA, but will favor the fidelity and complete extension of the
PCR products, desirable for RFLP studies (Jansen, R. and F. D. Ledley
(1989) Gene Anal. Te~hn. 6: 79-83).
Inverse PCR, cloning and sequence analysis.
Inverse PCR (0chman, H. et: al (1988) Genetics 120: E~21-625) was done
under the same conditions as the PCR described above, except that the
extension reaction was 90 sec at 74°C. The template DNA for the inverse
PCR
was prepared as follows: HindIII digested genomic DNA was size fractionated
by agarose gel electrophoresis and extracted from the gel with GeneClean~''
These fragments were circularized by self-ligation with T4 ligase in a
volume of 50 u1 containing approximately 100 ng of DNA fragments. One tenth
of the ligation product was used as a template in the inverse PCR. The
inverse PCR resulted in a high background of aspecific products. The
desired amplification products were size fractionated by agarose gel
electrophoreses and extracted from the gel with GeneClean. Reamplification
of these fragments was done in a subsequent PCR using the same oligo-
nucleotides and reaction conditions. The resulting fragments were cloned
into pGEM7Zf(~), using the HindIII site resulting from the circularization
reaction and an artificial HindIII site in oligonucleotide 322. Sequence
analysis of the cloned fra~en~S was done with the T7 sequencing kit
(Pharmacia, Uppsala, Sweden) by using oligonucleotides specific for the SP6
and T7 promotors (Promega).
CA 02045950 2001-12-04
22
Restriction fragment analysis.
Radiolabeled DNA fragments were separately digested with the
restriction enzymes AZuI, Sau3AI, RsaI and Ht~nfIl, I'he resulting DNA
fragments were separated on a vertical 5~ polyacrylamide (acryl:bisacryl is
1g:1) gel with dimensions of 400x500x1.5mm, buffered with 0. i8 M Tris/boric
acid (pH 7.8), 0.5 mM EDTA (TRE). The d~,gestion products were visualized by
autoradiography of the dried gel.
RESULTS
Presence of cZ~IICA in the serofi:ypes 1--i2 and comparison of their
sequences. The presence of eZyxICA sequr~nees in the genomic D~iA of the
twelve A. pZeuropneurrronZcae serotypes was detected by using dot-blot
hybridization with serotype 9 eZFIICA sequences as a probe. This probe,
comprising bases 315 to 3233, hybridised to the DNA of all sesotypes,
except serotype 10. Genosnic DNA of the twelve serotypes was subs~cted to
PCR using four oligonucleotides derived From the serotype g cZyIICA genes.
Figure 5A shows the position of these oligomers in the two contiguous
genes. Set 283/284 was used for amplification of the 5' region, 2$5/2$6 for
the 3' region and 283/286 for amplification of full length eZFTICA. The PCR
on the DNA of the sexotypes 1, 2, 3, 4, 5, 7, $, 1i and 12 ;resulted for
each primer set in amplification products of the same size as obtained with
serotype g DNA (1750bp far set 283/284, 2050 by for set 285/286 and 3200 by
for the set 2$3/286). The 3.2 kb full length fragments of the serotypes
1.2.3.x.5.7.8,21 and 12, generated by using set 283/286, showed identical
restriction maps for the enzymes HindIII, Xba I and Pst I as serotype g
cZyIICA. Serotype 6 gave an identically sized amplification product as
serotype g for set 285/286, but amplification products which were
approximately 1800 by longer for the sets 283/284 and 283/286, Serotype 10
did not give visible amplification products using either set of oligo-
nucleotides.
The degree of similarity between the eZyIICA genes of the serotypes
1. 2. 3. 4. 5. 7, 8, 9. 1l, and 12 was studied by RFLP analysis of th~ full
length ctyIICA sequences, generated in the PCR with the oligonucleotide set
283/286. The DNA fragments were labeled with tx3~p dCTY and digested with the
restriction enzymes AZuI,IY~n,~II, Rsal or.Sau3AI. The obtained restriction
fragments were analyzed by gel electrophoresis and autoradiography. For
each of the four restriction enzymes, the number and sizes of the DNA
fragments obtained from cZyIICA of the serotypes 1, 2, 3, ~, 5, 7, $, g,
11, and 12 appeared to be very similaz°. The RFLP studies on the
serotype 12
clbIICA sequences were done in separate experiments.
Cloning and analysis of the sequences ad3acent to cZFIIA.
23 ~~r~~~ 3~
The proximal part of a putative cZyIIB gene was found adjacent to
cIyIIA of seratype 5 and 9 (see example I). In seratype 5 this sequence
extended to at least 108 bases, but in serotype g it was truncated after 3~
bases. To study the presence of this putative c2~rIIB gene in the .other
sssotypes we cloned the sequences distal of cZyIIA 3' by inverse PCR as
outlined in figure 6. We chose HindIII digestion of the genomic DNA. since
the genomie HtndIII fragments of most serotypes containing these sequences
have a workable size for inverse pCR ac~l~lification, and an unique FttndIII
site is present in cZbIICA of all serotypes at base 2008, The probe used in
this analysis comprised bases 2008 to 3~i~3 of serotype 9 cZbIICA. Among the
twelve serotypes, four differently sized HtndIII fragm~nts hybridized to
this probe. A 2.8 kb ZIIndIII fragment in the serotypes 2, 3, 5, 7, and 8,
a 2.3 kb fragment in the serotypes I, 9, I1, and 12. a 10 kb fragment in
serotype 4 and a ~i.3 kb fragment in serotype 6. Inverse PCR.using these
HIndIII fragments is expected to result in amplification products,
approximately 1300 bases smaller (the number of bases between the oligo»
nucleotides 158 and 322) than the hybridizing HIndIII fragments. T'he
inverse PCR resulted in the desired amplification products for all
serotypes, except 4 and 6. The failure to get amplification products for
serotypes ~i and 6 was probably due to the large sizes of the HIndIII
fragments, exceding the range of inverse PCR amplification in this system.
We cloned the inverse PCR products of the serotypes 1, 2, 3. 5. 7. $. 9.
11, and 12 into pGEM'Zf(+) ~,d determined their nucleotide sequences. All
these serotypes appeared to have a truncated ct~IIB adjacent of et~IZA, and
two different truncstibn points were identified, at base 3'7 and at base
501. We identified two ma~ar types of sequences downstream of eZ~IIB. Type
I, present in the serotypes 1,'J, 9, 11, and 12, and type TI present in the
serotypes 2, 3, 5, and 8. A subtype of type I was identified in serotype 7
and I2, since both had seven additional bases, AACCACT, at position 3664.
The sequence of type I was illustrated in example 1 as part (base 3~ø~0 to
4499} of the serotype 9 cZ~IICA sequence. The protein sequence derived from
the 501 bases truncated ctPIIB has a similarity of '71,'C to the serotype g
cZyIB {.14), and 64x to the P. hcaemoZy~tca 2kt8. The type I and Ix sequences
did not show any similarity with each other or with RTX-CABD sequences.
Figure 7 shows a schematic presentat3an of the genom3c structure of the
cZyIICA and the tru,racated cZyIIH genes of the twelve serotypes. The type I
sequences are represented by hatched boxes and type Iz sequences by dotted
boxes. None of the twelve aerotypes contained a eta~Zl operon with intact
genes far the B and D transporter proteins {see also example 1).
Hybridization experiments demonstrated however the presence of ctyIBD
24
seguencea in all servtypes except 3.
ExAMPLE 3
I~intificr~fi~ion of ~Temol~tic and Cvto~toxic Proteins o~g +a~,~hnna~7,~e
Z?~Bd.!?' dp21e2d~1011tQ~' bV m0110 ~n~~~ s~r~tihnrli~
iHaterial$ and Methods
Bacterial strains. The sources .and designations of the reference
strains for A, pleuropneumoniae serotypes 1 to 12 sere those mentioned in
example 2. The field strain CVI 12946 was isolated in the Netherlands from
the lung of a pig that died from p,leuropneumonia..Thia strain was typed as
serotype 2 by slide agglutination {Kamp, E. M. et al {1987) Vet. MtarobfoZ.
13 : 2~+9-257 ) .
Preparation of culture filtrates. ActtnobacfZZu,~ pZeurapneumorttt~e
strains were cultured in Eagle minimal essential medium plus Earle salts
{Flow Laboratories, Irving, UK) and ip~ Serum Plus (Hazelton Research
Products, Lexena. Ken.) as described eari3er {Kamp E. b1. and A. M. Q. van
Leengoed {1889) J. CZin. MfcrobfoZ. 2'~ 11$7-1181). Cultures were
centrifuged for 30 min at 10,000 x g, and the supernatants were sterilized
by passing them through membrane filters of 0.2 pm pare size (Gelman
Sciences Inc., Ann Arbor,l~t;Lch.). Culture filtrates were stored is aliguots
at -20°C until further use.
Swine sera. Specific-pathogen-free 4-week-old pigs were endo-
bronchially inoculated with 103 colony forming units of A, p2eurapneumonfae
153 (genotype 2) or 13261 (serotype 9). Blood samples were collected 2
months after inoculation. Blood was allowed to clot overnight at ~°C,
serum
was collected and heated for 60 min at 60°C to inactivate complement.
Sera
were stored in aliquots at -20°C.
Monoclonal antibodies. Culture filtrates of strains CVI 12946
{serotype 2) and CVI 13261 (serotype 9) were detoxified with 0.5~ formalin
and used to immunize Balb/c mice. The immunization schedule and the
preparation of hybridoma cell lines were as described in detail by van
Zl~derveld et aI. (Irt,~ect. Imrrrun. 57: 17.92-2199) . Hybridomas were tasted
for antibody in enzyme-linked immunosorbent assays (ELISA) using microtiter
plates coated with culture medium or culture filtrates of strains CVI 12946
or CVI 13261. H~rbridomas that tested positive with a culture filtrate and
negative with the culture medium were Cloned twice by limitxn~g dilution.
The resulting monoclonal cell lines were used to produce ascites fluid in
pristane~pr3med Balb/c mice. Antibody was purified from the ascites fluid
by precipitation with 40~ ammonium sulfate and dialysis against phosphate-
-buffered saltine, pH 7.2 {PBS). The MAbs were stared in aliquots containing
25
8 mg protein/ml at -20°C. The immunoglobulin lsotype of the MAbs was
determined in immuno- diffusion tests using moues :Lsotype-specific antisera
(Nordic, Tilburg, The Netherlands).
ELISAs. The procedures for ELISA were as described in detail by Van
Zi~dsrveld et al. (supraj. We used polystyrene microdilution plates coated
with culture filtrates of either strain CVI 12946 or CVI 13261. The optimal
dilutions for coating were determined by Checkerboard titrations using the
swine sera as positive sera. Coeted plates were stored at -20°C.
Titers of the MAb preparations wex~ determined in an indirect ELISA.
Bound antibodies were detected with peroxidase labeled anti.-mouse
immunoglobulins (Dakopatts, Copenhagen, Denmark) and hydrogen peroxide
mixed Wl.th 5-aminosalicylic acid. Titers were expressed as.the logarithm pf
the reciprocal of the highest dilution giving an AuSo of 50,~ of the maximum
obtainable absorbance vales.
A competition ELISA was used to determine whether the MAbs
recognized different epitopes. I~PAbs were conjugated to horseradish
peroxidase (Boehringer, Mannheim, Federal Republic of Qermany). Serial
two-fold dilutions of 50 ml samples of non-conjugated MAhs were incubated
in coated microdilution plates for 30 min at 3'7°C. Plates were nat
washed,
and 50 ml of the optimal dilution of each of the psroxidase-conjugated MAbs
was added per well. Plates were further incubated for 1 h, washed, and then
incubated with the substrate.
Hemolysin assay. Serial five-fold dilutions of 1 ml of the culture
filtrates were tested for hemolytic activity as described by Prey and
Nicolet (1988, FENS Fltaxob~oZ. Lett. 55: 41-46); a suspens~.on of 1x sheep
erythrocytes ire Tris-buffered saline, pH ~.2, with 10 mM CaCl2 was used.
Just before the determination of the ASao~ 20 p1 0.1 N HCl was added to each
tube to change the color of the phenol red in the medium to yellow.
Hemolytic activities were expressed in hemolytic units; one hemolytic unit
was defined as the absorbance value of a solution of l part of the 1 ~
erythrocytes suspension and 3 parts distilled water.
Hemolysin inhibition assays. Inhibition of hemolytic activity was
tested in two assays. The first assay was as described by Frsy and Nicol~t
(supra); serial twofold dilutions of 1 ml samples of all culture filtrates
were incubated for 1 h at 3'7°C with 10 p1 samples of one of the MAbs,
swine
sera, or buffer. Then, 1 m1 of a suspension of 1;6 sheep erythrocytes in
Tris-buffered saline with CaClz wee added to each tube and from that point
on the test was further performed ae the hemolysin assay was. The hemolytic
activity of the culture filtrates of serotypes Z, 3, (, and $ was too weak
to determine inh~.bi~tion. Therefore, we also tested inhibition of hemolytic
activity by inoculating A, pZeuropneumontae serotypes 1 to 12 onto sheep
blood agar plates that contained 0.05x nicotinamide adenine dinucleotide
and a 1:100 dilution of one of the ~iAbs or a 1:200 dilution of the swine
sera. Plates without antibodies were used as controls. The plates had a
diameter of 5.5 cm and contained 5 ml medium each. Per serotype, one colony
of an 1$ hour old culture was suspended in l m1 PBS. Very fine capillary
tubes were used to inoculate the plates with these suspensions. After
incubating the plates overnight at 3'~'C in an atmosphere of 5% CO2,
hemolytic zones were measured and compared to those of the controls.
Inhibition was expressed as when hemolytic zones wez~e similar to those of
the controls, as + when hemolytic zones were present but were more than 50,'L
smaller than the controls, and as + When no hemolytic zones were detected.
Cytotoxin assay. The isolation of porcine alveolar macrophages and
the cytotoxin assay have been described earlier in detail (Kamp, E. M, and
L. A. M. Q. van Leengoed (19$9) J. CZtn. ~Ita2~ob~oZ. 27: 11$7-1181).
Cytotoxin inhibition assay. Serial two-fold dilutions of 50 p1
samples of all culture filtrates (except serotype 6) were made in PB$ in
flat-bottomed microdilution plates ($ rows per serotype). Either PBS
{control) or one of the MAbs or polyclonal swine sera were added to each
row {50 p1 per well). IsiAbs were used in a dilution of 1:100 and swine sera
in a dilution of 1:200. Plates were sealed, shaken, and incubated for 1 h
at 37°C. An amount of 50 u1 alveolar macrophages was added to each well
and
from this point on, the test was performed as the cytotoxin 'assay was.
Cytotoxin titers were determined end compared with the tier of the
control. Inhibition was expressed as when cytotoxin titers were the same as
the titer of the control, as a when titers were twoto fourwfold'lower than
the titer of the control, and as + when titers were more than four fold
lower than the titer of the control.
Sodium dodecyl polyacrylamide gel electrophoresis and. Western blot
0 analysis. Proteins in the culture filtrates were separated by sodium
dodecyl sulfate polyacrylamide gel electrophoresis in a Mini 'Protean II
.slab cell according to the recommendations of the manufactures (Bio~Rad,
Richmond, Calif.). We used a 4~ stacking gel with a 7.5x separating gel, an
acrylamide/bisacrylamide ratio of 19/1, 0.75 mm spacers, and GOmbs with 15
wells. Each well was loaded with 15 p1 samples and electrophoresed at 25 V
on ice. Proteins were transferred onto nitroceixulose filters electro-
phoretically according to the recommendations of the manufactur~r of the
Hlot system (Novablot, LKB, Uppsala, Sweden), The blots were probed with a
1:200 dilution of the MAbs or a 1:x+00 dilution of the swine sera. Bound
immunoglobulins were visualized by using peroxidase°labeled goat
anti~mouse
2~
or goat antiswine immunoglobulins (pakopatts) and HRP Color bevelopment
i Reagent (Sio-Rad). Control blots were probed with buffer .instead of MAb.
Results
Hemolytic and cytotoxic activities. Culture filtrates of all
serotypes except of aerotype 6 were ~;ytotaxic and hemolytic (Table A~.
Hemolytic activity of culture filtrates of aerotypes 2, 3, ~, 7, $, ~a 12
were much weaker than those of serotypea; 1, 5, g, 10, and 1l. A11 reference
strains of A. pieuropneumontae serotypes 1 to 12, including serotype (,
wer~ hemolytic on blood agar. The hemolytic zones around colonies of
serotypes 2. 3. 4. ?', 8, and 12 were pouch smaller than the zones around
serotypes 2, 5. 9. 10, and 11. Hemolysis .of serotype 6 could only be
detected after removal of the colony.
Monoclonal antibodies and swine sera. For this study we selected
five MAbs and two swine sera. lHAb CVI-Aptly 2.2 was raised against
serotype 2 and tasted in ELISA positive with serotype 2 and negative with
serotype g. MAbs Ct~I-Aptly g.1 and g.2 were raised against serotype 9 and
tested positive with serotype g and negative with serotype 2. In contrast.
the two swine sera and MAbs CVI-Aptly g.3 and 9.4, which were also raised
against serotype g, tested positive with both serotype 2 and 9. The MAbs
did not block each other in a competition ELISA, indicating that they
recognised different epitopes.
Inhibition of hemolytic and cytotoxic activity. MAbs and swine sera
were tested For inhibition of hemolytic and cytotoxic activity of serotypes
1 to 12. MAb CVI-Aptly g.1 and pig anti serotype 9 serum reduced the
hemolytic activity of culture filtrates of serotypes 1, 5, g, 10, and 11
with 80~ or mare. MAbs CVx-Aptly 9.3 ~d g.~f and the swine sera against
serotypea 2 and 9 totally reduced the hemolytic activity of the culture
filtrates of serotypes ~, ', and 12. Because the hemolytic activity of the
culture filtrates of serotypes 2, 3, 5, and $ was too weak to reliably
determine inhibition of hemolysis in the liquid assay, we also tested the
MAbs and sraine sera for their ability to inhibit hemolysis on blood agar.
The results of this test were similar to those of the liquid assay.
MAb CVI-Aptly z.Z was raised against serotype 2 and inhibited
cytotoxic activity of serotypes 2, 3, 4, and $. rifAb CVI-Aptly g.1 was
raised against serotype g and inhibited the hemolytic activity and the
cytotoxic activity of serptypes 1, 5, g, 10, and 1Z, suggesting that both
activities are funo.tions of the same protein. MAb CV:C-Aptly 9.2 was also
raised against serotype g and inhibited the cytotox3,C but not the hemolytic
activity of serotypes 1, 5, g, 10, ~d ~,1. In contrast, MAbs CVI-Aptly g.3
~d 9~~, which were also raised against serotype g, did not inhibit
2$ ~~~~~5~
hemolytic or cytotoxic activity of these serotypes. surprisingly, these two
MAbs inhibited the hemolytic activity and cytotoxic activity of serotypes
7 and 12. This suggests that the hemolytic and cytotvxic activity of these
serotypes are functions of the same protein. In addition, MAbs CVl-Apcly
9.3 and 9.4 inhibited the hemolytic but not the cytotoxic activity of
serotypes 2, 3, 4. and 8.
Pig serum raised against serotype 2 inhibited the hemolytic and
cytotoxic activity of serotypes 2, 3, 4, 6. 7, $, and 12, wherea,; pig set
raised against serotype 9 inhibited the h~smolytic and eytotvxic activity of
serotypes 1, 5, ~, ~, 9, 10, 11, and 12 and the hemolytic but not the
cytotoxic activity of serotypes 2, 3, 4, and $,
~lestern blot analysis. The selected MAbs and.swine sera were used
to probe Glesterra blots of the eultur~ filtrates of serotypes 1 to 12. MAb
CVI-Apcly 2.2 reacted with a protein of approximately 120 kDa in filtrates
of servtypes 2, 3, 4. and 8. MAbs CVI-Apcly g.1 and 9.2 reacted with a
protein ~f approximately 105 kDa in filtrates of serotypes 1, 5, <j, 10, and
11 and IHAb CVIwApcly 9.3 reacted with a protein also of approximately 105
kDa fn filtrates of all serotypes except sesotype 10. The reaction of MAb
CVIApcly 9,3 with the proteins of serotypes 3, 6, and 8 was very weak and
not always visible.
To teat whether MAbs CVI-Apcly 2.2, 9.1, g.2, axed 'S.3 recognized
different proteins, we probed a blot with one MAb, washed the blot
thoroughly, and then tested it with another MAb. This procedure was
repeated until all four MAbs were tested. Three proteins became visible.
One protein of approximately 120 kDa was detected by MAb CVI-Apcly 2.2 in
serotypes 2, 3, 4, and $; a second protein of approx#,mately 105 kDa was
detected by MAbs CVI-Apcly 9.1 and g.2 in serotypes 1, 5. 9. 14, and 11;
and a third protein of approximately 103 kDa was detected by l~Ab CVI-Apcly
9.3 in all serotypes except s~rotype 10 (Table A).
iKAb CVx-Apcly 9.4 reacted with the 105 kDa protein and.the 103 kDa
protein, indicating that these two proteins have epitopes in common.
Western blot analysis using the swine sera confirmed the
distribution of the three proteins among the 12 serotypes. Pig serum raised
against serotype 2 recogniLed a protein of approximately I20 kDa in
serotypes 2, 3, 4, and $ and a protein of approximately 103 kDa in all
serotypes except serotype 10. Pig serum rail~d serotype 9 recognized .a
protein of approximately 105 kDa in serotypes 1, 5, <j, 10, and 11, and a
protean of approximately 103 kDa in all serotypes except serotype 10.
~g ~~~~~5~~
EXAMPLE ~1
Production of cytolvs~ns and preoara.ion of a rerombinant~n
Cells of ,E. colt strain LE 3g2 that contained plasmid pLG 5'~g (Gygi,
D. et a1. (lgg0) MoZ. MtcrobtvZ. 4: 123-128) were transformed with plasmids
that contained ClyI, CIyII, or CIyIII encoding genes. These cells were
grown at 3T°C in Luria Broth medium, supglemented with the appropriate
antibiotics and preferably with 10~ feutal Calf Serum, for about 6-8 h to
an optical density at 6Z0 manometer of ~spproxlmately O.a. The culture was
centrifuged, the supernatant was sterilized by treat~uent with a bacterioM
staticum and stored. The proteins present in the culture supernatants and
that reacted with a mixture of Mabs g.l, 9.3 and 2.2 are shown in fig. g.
The purified Cly proteins from those supernatants, or preferably the crude
supernatants, are mixed in a predetermined ratio and subsequently mixed
with an appsopriste ad~uvant and used for vaccination.
Figure g is a diagrammatic representation of a t~estex°n blot
showing
expression and secretion of CIyIIZ (lanes 1-~), CIyII (lanes 5, 6) and CIyI
(lanes T,8) by recombinant E. coZi cells that contain the cytolysin gene in
question together with transport genes of E, colt itself. The proteins were
electrophoresed on SDS-PA~B, blotted on nitrocellulose axad visualized with
MAb 2.2, 9.1 and g.3.
