Note: Descriptions are shown in the official language in which they were submitted.
~ .f~90/14360 ~ PCT/US90~02753
, .
TI88~-DERIV~D ~UNOR GRO~T~ ~N~TBITOR8, ME~ODB OF
PR~PARATION AND ~8~8 T~ER~OF
This application is a continuation-in-part of U.S.
Serial No. 183,224, filed April 20, 1988, which was a
continuation in part of U.S. Serial No. 111,022, filed
October 20, lg87 which was a continuation-in-part of
U.S. Serial No. 992,121, filed October 20, 1986, now
abandoned, which was a continuation-in-part of U.S.
Serial No. 847,931, filed April 7, 1986, now abandoned,
which was a continuation-in-part of U.S. Serial No.
725,003, filed April 19, 1985, now abandoned, the
contents of each are hereby incorporated by reference
into the present application.
Backqround of the Invention
Throughout this application, various publications are
referenced. The disclosures of these publications in
their entireties are hereby incorporated by reference
into this application in order to more fully describe
the state of the art as known to those skilled therein
as of the date of the invention described and claimed
herein.
Bichel [Bichel, Nature 231: 449-450 (1971)] reported
that removing most of the tumor from mice hearing as-
cites tumor~ at a plateau of tumor growth, was followed
by a marked increase in the growth sf the remaining
tumor cells. Injection of cell-free ascites, obtained
from mice bearing fully developed ascites tumors, into
mice with growing ascites tumors, resulted in a pro-
nounced inhibition of ascites growth. Bichel, suPra,
also observed that two surgically joined mice (para-
` :
.; .
WO90~t~360 2 ~ ~ 6 -9 8 1 PCT/VS90/02753 ~
-- 2
biotic), one mouse with an advanced tumor and the other
with an early tumor, resulted in a pronounced inhlbi-
tion of growth of the earl~ tumor. Based upon these
observations, [Bichel, Europ. J. Cancer 6: 291-296
(1970) and Bichel,~supra] the existence of a diffus-
ible inhibitory principle which circulated through the
peritoneum of parabiotic mice and was present in the
cell-free ascites fluid produced by the fully devel-
oped ascites tumors was postulated. The nature of this
inhibiting principle was not characterize~, but it was
speculated that the rate of growth of ascites tumors
was dependent upon the amount of tumor tissue present
in the mouse and that the amount of tumor tissue was
determined by the amount inhibitory principle produced.
Substances having tumor growth in~ibitory activity have
been described. McMahon, et al. tProc. Natl. Acad.
Sci. USA 79, 456-460 (1982)] have purified from rat
liver a 26,000 dalton substance which inhibits the
proliferation of nonmalignant rat liver cells, but does
not inhibit the proliferation of malignant rat liver
cells. Other growth inhibitory substances have been
identified in cultured chicken spinal cord cells [Kage,
et al., Experimental Neurology 58: 347-360 (1970);
Harrington, et al., Proc. Natl. Acad. Sci. USA 77: 423-
427 (1980) and Steck, et al., J. Cell Biol. 83: 562-575
(1979)~.
Holley et al., [Proc. Natl. Acad. Sci. 77: 5989 (1980)
and Cell Biol. Int. Reports 7: 525-526 (1983)] reported
that a substance isolated from African green monkey
BSC-l cells inhibited the growth of BSC-l cells, human
mammary tumor cells and normal human mammary cells.
More recently, biochemical characterization of this
inhibitory substance rTucker, et al., Science 226: 705-
: '. ' . -' '`' - :' ,'~ " '.'' . '; '. '
' ~
.
. , . - .
- , . .
90/~4360 ~ ~ PCT~US90/017~3
3 --
707 ~1984); Roberts, et al. Proc. Natl. Acad. Sci. 82:
119-123 (1985)~ showed it to be identical, or highly
related, to a 25,000 dalton two chain human platelet-
derived polypeptide designated TGF-~ [Assoian, et al.,
J. Biol. Chem 258: 7155-7160 (1983)]. TGF-~ derived
from either human platelets [Sporn and ~oberts, inter-
national patent number WO 84/01106) or from human pla-
centa [Frolik et al., (1983) PNAS 80 3676-3680; Sporn
and Roberts (WO84/01106)] induces anchorage indepen-
dent colony growth in soft agar of non-neoplastic rat
kidney fibroblasts and other cells in the presence of
transforming growth factor alpha or epidermal growth
factor.
More recently, the bifunctional nature of this molecule
as a regulator of cellular growth has been confirmed by
Roberts et al. [proc~ Natl. Acad. Sci. 82: 119-123
(1985)~. Iwata et al., [J. Cellular Biochem. Suppl. 5:
401 (1982)] previously d scribed a microtiter plate
system for assaying growth stimulation and growth inhi-
bition activity. Todaro et al., [Todaro et al., in
Tumor Cell Heteroqeneitv, Oriqins and ImPlicatio~s,
Bristol-Myers Cancer Symposia, Volume 4, Owens, A.H.,
Coffey, D~S., and Baylin, S.B., Eds. (Academic Press,
1982), pp. 205-224)] and Iwata et al., [Fed. Proc. Fed.
Am. Soc. Exp. Biol. 42: 1833 (1983)] reported the iso-
lation of tumor inhibitory activity from tissue culture
fluids of human tumor cells propagated in culture. The
observations described in these reports were prelimi-
nary and little detail was provided.
on April 20, 1984, a patent application was filed with
the Vnited States Patent and Trademark Office under
U.S. Serial No. 602,520, entitled "Substantially Puri-
fied Tumor Growth Inhibitory Factor (TIF)" on which one
.
`
' ' '
WO 90tl43~0 2 0 ~ ~ ~ 8 1 PCT/US90/027~3 ~
of us, Kenneth K. Iwata, is named as coinventor. This
application concerns the preliminary identification of
a not well-defined substance or substances present in,
and derived from, human tumor cells propagated in cul-
ture. This substance or substances resembles the tumor
inhibitory activity previously reported. [Todaro, et
al., in Tumor Cell Hetero~eneitY; Oriqins and _m~lica-
tions, Bristol-Myers Cancer Symposia, Volume 4, Owens,
A.H., D.S., and Baylin, S.B., Eds. (Academic Press,
1982), pp. 205-224; Iwata, et al., Fed. Proc. Fed. Am.
Soc. Exp. Biol. 42: 1833 (1983).]
Todaro [Todaro, G.J. in EPiqeneti-c Requlation of Can-
cer, Terry Fox Cancer Research Conference (University
of British Columbia; Vancouver, B.C., Canada) Abs. 1~
(1984)] subsequently reported two factors with tumor
cell growth inhibitory properties which were reportedly
sequenced and shown to consist of 70 and 90 amino acid
residues, respectively. However, Todaro failed to
report the source of the factors, their tissue type,
the species the factors were derived from or the meth-
od of the factor purification.
' j . . ., ' . " , . . !
: ' ;. , , ' ' ' ' . : ' . : ,,
' : ' , . ' ' ' ' ' ~:
. . ' ' . . , , , ' '
2 ~ g ~
90/14360 PCT/US90/02753
Summary of the Invention
This invention provides a protein having tumor growth
- inhibitory activity comprising the 112 amino acids
shown in Figure 29 beginning with alanine at position 1
and ending with serine at position 112. The protein
may also comprise the 412 amino acids shown in Figure
41 beginning with methionine at nucleotide position
263 and ending with serine at nucleotide position 1496.
Thus, this 412 amino acid sequence contalns the
complete precursor sequence of the protein having
tumor growth inhibitory activity as well as the
complete sequence of the mature protein shown in Figure
29 beginning with alanine at position 1 and ending with
serine at position 112. Finally, the invention
provides a protein comprising the 411 amino acids shown
in Figure 41 beginning with lysine at nucleotide
position 266 and ending with serine at nucleotide
position 1496.
2 ~
W O 90/14360 PC~r/US90/027~3
- 6 -
Brie~ Description of the Fiqures
Figure 1 shows gel filtration chromatography at 23C.
Elution pattern of gel filtration chromatography at
23 C of crude acidified, ethanol extract from human
umbilical cords. ~wo grams of acidified, ethanol ex-
tract in 150 ml of 1.0 M acetic acid was applied to a
14 x 100 cm colu~n (A~icon; #86012) containing Bio-Gel0
P10 and eluted at a flow rate of 7 ml/min. One liter
fractions were collected on a SuperRac~ (LK~ 2211)
equipped with a type C collection rack (LKB). One ml
aliquots of each fraction (1 liter/fraction) were
transferred to 12 x 75 mm sterile snap top tuhes (Fal-
con 20~8). TGI activity was determined as described in
Materials and Methods. Inhibition of A549 human lung
carcino~a cells is shown by triangles and mink lung
(CCL 64) cells by circles. Absorbance at 280 nm
t ~ ) was detected by a Uvicord S~ (LKB 2138)
with a full scale absorbance range of 1.~ AUFS and a
single channel chart recorder (LKB 2210) with a chart
speed of 1 mm/min.
Figure 2 shows gel filtration chromatography at 4~C.
Elution pattern of gel filtration chromatography at 4 C
of crude acidified, ethanol extract from human umbili-
~5 cal cords-. Two grams of acidified, ethanol extract in
150 ml of 1.0 M acetic acid was applied to a 14 x 100
cm column (Amicon; #R6012) containing Bio-~el2 P10 and
eluted at a flow rate of 7 ml/min. one liter fractions
were collected on a SuperRac~ (LXB 2211) equipped with
a type C collection rack (LKB). One ml aliquots of
each fractilon (l liter/fraction) were transferred to 12
x 75 mm sterile snap top tubes (Falcon 10583. Tumor
growth inhibitory activity was determined as described
in Materials and Methods. Inhibition of A549 human
,. . .
.
- . - ~
;~90/14360 2 ~ 3 ~ PCT/US90/02753
lung~carcinoma cells is shown by open triangles and
mink lung (CCL 64) cells by open circles. Absorbance
of 280 nm ( - ) was detected by a Uvicord S~
(LKB 2138) with a full scale absorbance range of 1.0
AUFS and a sinqle channel chart recorder (LKB 2210)
with a chart speed of 1 mm/min.
Figure ~ shows cell growth inhibition and normal human
cell stimulation by fractions from gel filtration chro-
matography at 4~C. Elution pattern of gel filtration
chromato~raphy at 4'C of crude acidified, ethanol ex-
tract in 150 ml of 1.0 M acetic acid was applied to a
14 x 100 cm column (Amicon; #8601Z) containinq Bio-
Gel~ P10 and eluted at a flow rate of 7 ml/min. One
liter fractions were collected on a SuperRac~ (LKB
2211) equipped with a type C collection rack (LKB).
One ml aliquots of each fraction (1 liter/fraction)
were transferred to 12 x 75 mm sterile snap top tubes
(Falcon 2058). Tumor growth inhibitory activity was
determined as described in Materials and Methods.
Inhi~ition of AS49 human lung carcinoma cells is shown
by open triangles and mink lung (CCL 64) cells by open
circles. Stimulation of normal human fibroblasts is
shown by open squares. Absorbance of 280 nm (
was detected by Uvicord sX (LRB 2138) with a full scale
absorbance range of 1.0 AUFS and a single channel chart
recorder (LXB 2210) with a chart speed of 1 mm/min.
Figure 4 shows reverse phase high performance liquid
chromatography (HPLC) of an active fraction from gel
filtration chromatography. Fraction 4 derived from gel
filtration chromatography on Bio-Gel~ P10 of human
umbilical cord acidified, ethanol extract (65.8 mg
protein) was lyophilized and resuspended in 10 ml of
0.05~ trifluoroacetic acid (TFA). Fraction 4 was the
W090~14360 ~ PCT/USgO/027~3
firs~ fraction followinq the major peaks of absorbance
at 280 nm (Figure 2). The sample was centrifuged on a
Beckman table top centrifuge (Beckman TJ-6) at 3000
rpm for 20 minutes to remove insoluble material.
Three separate injections of the supernatant were made
through a Water's U6K injector equipped with a 2 ml
sample loop. The sample was then loaded onto a ~BOND-
APAX~ C18 column (0.78 x 30 cm) (Waters #84176). The
flow rate was 2 ml/min. and the effluent monitored
at 206 nm ( ------ ) with a Waters u.v. detector (Wa-
ters Model 481) at a sensitivity of 2.0 AUFS. Elution
was achieved with a linear 30 min gradient from 0-25%
of increasing concentrations of acetonitrile containing
0.05% trifluoroacetic acid (TFA), followed by a linear
240 min gradient of 25-45% acetonitrile containing
0.05% TFA, followed by a linear 30 min gradient of 45-
100% acet~nitrile containing 0.05% TFA. A SuperRacX
(LRB 2211) was used to collect 12 ml fractions. One
ml aiiquots of each fraction were transferred to 12 x
75 mm polystyrene tubes (Falcon 2058) containing 50
microliters of 1.0 M acetic acid and 50 micrograms of
bovine seru~ albumin (Sigma A6003) and assayed for
tumor growth inhibitory activity as described in Mate-
rials and Methods. Inhibition of A549 human lung car-
cinoma cell~ is shown by open triangles and of mink
lung (CCL 64) by open circles. The solvent gradient is
hown by large dashes ( ~
Figure 5 shows HPLC rechromatography of pooled TGI
activity from HPLC (TGI-l). Pooled fractions of tumor
growth inhibitory activity (1.5 mg) eluting between
28-34% acetonitrile (fractions 13-22) by HPLC chroma-
tography (Figure 4) were lyophilized and resuspended
in 2 ml of 0.05~ trifluoroacetic acid (TFA). The sam-
ple was centrifuged on a Beckman table top centrifuge
: - - ' : . .; - -
: . -
: .
~` ? 90/14360 2 ~ ~ ~ 9 ~ ~ Pcr/usgo/02753
(Bec~man TJ-6) at 3000 rpm for 20 minutes to remove
insoluble material. Two separate injections of the
supernatant were made through a Water's U6X injector
equipped with a 2 ml sample loop. The sample was load-
ed onto a ~ONDAPAK~ C18 column (0.39 x 30 cm) (Waters
#27324). The flow rate was 1 ml/min. and the effluent
monitored at 206 nm ( ) with a Waters u.v. de-
tector (Waters Model 481) at a sensitivity of 2.0 AUFS.
Elution was achieved with a linear 20 min gradient from
0-15% of increasing concentrations of 2-propanol con-
taining 0.05% TFA, followed by a linear 120 min gradi-
ent of 15-35% 2-propanol containing 0.05% TFA. A
SuperRac (LXB 2211) was used to collect 4 ml frac-
tions. One ml aliquots of each fraction were trans-
ferred to 12 x 75 mm polystyrene tubes (Falcon 2058)
containing 50 microliters of 1.0 M acetic acid and 5C
micrograms of bovine serum albumin (Sigma A-6003) and
assayed for tumor growth inhibitory activity as de-
scribed in Materials and Methods. Inhibition of A549
human lung carcinoma cells is shown by open triangles
and of mink lung (CCL 64) cells by open circles. The
solvent gradient is shown by large dashes ( - -
)~
Figure 6 shows reverse phase HPLC rechromatography of25 pooled activity from HPLC (TGI-2). Pooled fractions of
tu~or growth inhibitory activity (O.8 mg) eluting be-
tween 35-39% acetonitrile (fractions 25-31) by HPLC
chromatography (Figure 4) were lyophili~ed and resus-
pended in 2 ml of 0.05% trifluoracetic acid (TFA). The
sample was centrifuged on a Beckman tabletop centri-
fuge (Beckman TJ-6) at 3000 rpm for 30 min to remove
insoluble material. Two separate injections of the
supernata~t were made through a Water's U6X injector
equipped with a 2 ml sample loop. The sample was load-
..
:' ~ '': '"' '
W09n/143fiO PCT/US90/02753 ~
-- 10 --
ed onto a ~BONDAPAK~ C18 column (0.39 x 30 cm) (Waters
27324). The flow rate was 1 ml/min and the effluent
monitored at 206 nm ( ) with a Waters u.v. de-
tector (Waters Model 481) at a sensitivity of 1.0 AUFS.
Elution was achieved with a linear 20 min gradient from
0-15% of increasing concentrations of 2-propanol con-
taining 0.05% TFA, followed by a linear 120 min gradi-
ent of 15-35~ 2-propanol containing 0.05% TFA. A Sup-
erRac~ (LKB 2211) was used to collect 4 ml fractions.
One ml aliquots of each fraction were transferred to
12 x 75 mm polystyrene tubes (Falcon 2058) containing
50 microliters of 1.0 M acetic acid and 50 micrograms
of bovine serum albumin- (Sigma A-6003) and assayed for
tumor growth inhibitory activity as described in Mate-
rials and Methods. Inhibition of A549 human lung car-
cinoma cells is shown by open triangles and of mink
lung (CCL 64) cells by open circles. The solvent gra-
dient is shown by large dashes ( ~
Figure 7 shows cation exchange chromatography of human
umbilical cord extracts. CM-TRISACRYLX was resuspended
in an equal volume of O.1 M ammonium acetate, pH 4.0,
containing 1.0 M NaCl. The resin was allowed to equil-
ibrate for 3 hours and degassed at 4C. Twenty ml of
resin was packed into a 1.6 x 40 cm column (Pharmacia;
#19-0362-01) and washed with 2 column volumes of 1.0 M
ammonimum acetate pH 4.0, followed by O.01 M ammonium
acetate. The column was washed until the effluent
matched the conductivity and the pH of the equilibrat-
ing buffer (0.01 M ammonium acetate pH 4.0). One gram
of human u~bilical cord acidified, ethanol extract was
resuspended in 50 ml of 1.0 M acetic acid and dialyzed
against the column equilibration buffer at 4-C until
the pH and the conductivity matched that of the equili-
bration buffer. The dialyzed acidified, ethanol ex-
.. .. ....
, . .: ... ' ~ :-
, .
,
2 ~ 3 ~
?9o/14360 PCT/US90~0?753
traCt was applied to the column at a flow rate of 1
ml/min at 4-C and the column was washed with the equil-
ibrating buffer until the absorbance ( -- ), A280,
as monitored by a Uvicord~ S (LXB 2138) with a sensi-
tivity of 1.0 AUFS, was at its lowest point. This was
followed by 200 ml of an ascending molarity linear
gradient from 0.01 to 1.0 M ammonium acetate, pH 4.0,
which was applied using a gradient mixer (Pharmacia GM-
1, #19-0495-01). At the end of the gradient, an addi-
tional 30 ml of 1.0 M ammonium acetate, pH 4.0, were
passed through the column. Two ml fractions were col-
lected in 12 x 100 mm polystyrene tubes (Columbia Di-
agnostics 8-2564) in a SuperRac~ fraction collector
(LKB 2211). One ml aliquots from each fraction were
transferred to 12 x 75 mm tubes (Falcon 2058) contain--
ing 50 microliters 1.0 M acetic acid and 50 micrograms
bovine serum albumin (Sigma A6003), lyophilized, and
assayed for tumor growth inhibitory activity as de-
scribed in Materials and Methods. Inhibition of A549
human lung carcinoma cells is shown by open triangles
and of mink lung (CCL 64) cells by open circles. The
salt gradient is shown by large dashes
Figure 8 shows rechromatography of a pooled fraction
from cation exchange chromatography. CM-TRISACRYL0 was
prepared as described in Figure 9. The material from
fractions containing CM III and CM IV were pooled,
lyophilized, resuspended in 50 ml of 0.1 M acetic acid
and dialyzed against the column equilibration buffer
at 4 C until the pH and the conductivity matched that
of the equilibration buffer. The sample was applied to
the column at a flow rate of l ml/min at 4'C and the
column was washed with 120 ml of the equilibrating
buffer. Absorbance ( ) (280nm) was monitored
.
.. .
' ' :
. .
WO90/l43~0 2 0 ~ ~ 3 '~ 1 PCT/US9OtO2753
- 12 -
by ar Uvicord S (LXB 2138) with a sensitivity of 1.0
AUFS. one hundred ml of an ascending molarity linear
gradient from O.Ol to 1-0 M ammonium acetate, pH 4.0,
was applied using a gradient mixer (Pharmacia; GM-l,
#19-049S-Ol). At the end of the gradient, an addi-
tional 30 ml of 1.0 M ammonium acetate, pH 4.0, was
passed thr~ugh the column. Two ml fractions were col-
lected in 12 x 100 mm polystyrene tubes (Columbia ~iag-
nostics B2564) in a SuperRac~ fraction collector (LKB
2211). One ml aliquots from each fraction were trans-
ferred to 12 x 75 mm tubes (Falcon 2058) containing 50
microliters 1.0 M acetic acid and 50 micrograms bovine
serum albumin (Sigma A6003), lyophilized, and assayed
for tumor growth inhibitory activity as described in ~-
Materials and Methods. Inhibition of A549 human lung
carcinoma cells is shown by open triangles and mink
lung (CCL 64) cells by open circles. The salt gradient
is shown by large dashes ( ~
~ . :
Figure 9 shows the fractionation of TGI by cation ex-
change chromatography at 4 C. 1.65 mg of protein ex-
tract prepared as described in the Second Series of
Experiments was dialyzed extensively against 20mM ammo-
nium acetate (pH 4.5) and applied to a 5 ml (1 x 6.3
cm) column of CM-TRISACRYI~ previously equilibrated in
20 ~ ammonium acetate (pH 4.5) and 1.65 ml fractions
(12 x 100 mm polystyrene tubes~ were collected. Fol-
lowin~ sample application, the column was washed with
20 mM a~monium acetate, pH 4.5, until the absorbance at
280 nm ( - ) returned to baseline values (less than
3~ 0.003) as determined with a Bausch and Lomb 1001 spec-
trophotometer using a 1 cm light path quartz cuvet. A
linear salt gradient (0-1.0 M NaCl in 20 mM ammonium
acetate, pH 4.5) was applied and the absorbance at 280
nm of the 1.~5 ml fractions was determined as de-
- . - . ,
. ~
.
- : . .
-.' '': ~ . : : ` . :.
.:
.
:
2 ~
r~ 90/l4360 PCT/US90/02753
- 13 -
scri*ed above. 10 microliter aliquots of the indicat-
ed fractions were transferred to 12 x 75 mm tubes con-
taining 50 ul 1.0 M acetic acid and 50 micrograms bo-
vine serum albumin (Sigma A6003), lyophilized, and
assayed for ir..:.bitory activity ( V - - - 9 ) against
A549 human lung carcinoma cells as described under
Materials and Methods. The NaCl gradient ( - -
- ) was determined by measuring the conductivity (YSI
Model 32 Conductance Meter) of suitable samples dilut-
ed 100-fold in H20.
Figure lO shows the fractionation of TGI by anion ex-
change chromatography at 4 C. 1.65 mg of protein ex-
tract prepared as described in the Second Series of
Experiments was dialyzed extensively against 20 mM
Tris-HCl (pH 8.0) and clarified by centrifugation at
3,000 x g for 15 minutes. DEAE-TRISACRYL~ was pre-
pared by suspending the resin first in 20 mM Tris-HC1
(pH 8.0) containing 1.0 M NaCl for 3 hours and secondly
in 0.5 M Tris-HCl (pH 8.0) for 1 hour. The sedimented
resin was washed on a Buchner funnel with lO00 ml H~O
and finally resuspended in 20 mM Tris-HCl (pH 8.0),
degassed and poured into a 5 ml column (1 x 6.3 cm) and
the resin equilibrated with 20 mM Tris, HCl (pH 8 . 0) .
The clarified sample was applied to the column and
absor~ance at 280 nm( ), inhibitory activity
against mink lung cells (0-0), and the NaCl gradient
~ ) was determined as described in Figure 9
and under Materials and Methods. The linear NaC1 gra-
dient in 20 mM Tris-HCl (pH 8 . 0) ranged from 0 to 1.0
M NaCl.
Figure 11 shows the fractionation of TGI by cation
exc~ange chromatography at 4'C. CM-TRISACRYL~ was
prepared as described in Figure 7 with the exception
WO90/14360 -2 ~ ~ ~ 9 ~`i PCT/US90/~2753 ~
- 14 -
that_the final equilibration buffer was 20 mM ammonium
acetate, pH 4.5. Protein extract (9.9 mg) pr~pared as
above was dialyzed extensively against 20 mM ammonium
acetate (pH 4.5) and applied to a 15 ml (1.5 x 8.5 cm)
column of CM-TRISACRYL~ in 20 mM ammonium acetate (pH
4.5). Absorbance at 280 nM (-) and inhibitory activi-
ty ( - O - - o - - ) against A549 human lung carcinoma
cells were determined as described in Figure 7. The
volume of the linear 0-1.0 M NaCl gradient was 150 ml.
Volume of each fraction was 3.7 ml.
Figure 12 shows the reverse phase high performance
liquid chromatography (HPLC) of active fractions from
cation exchange chromatography. Fractions 59 thru 78
derived from cation exchange chromato~raphy on CM-TRI-
SACRYL~ of human umbilical cord described in Figure 11
were pooled, lyophilized, and resuspended in 10 ml of
0.05% trifluoracetic acid (TFA). A total of twenty
percent of dialyzed material containing 240 micrograms
protein was injected in three separate injections
through a Water's U6X injector equipped with a 2 ml
sample loop. The sample was then applied onto a ~BOND-
APAK~ C18 column (0.39 x 30 cm) (Waters 27324). The
flow rate was 1 ml/min and the effluent was monitored
at 206 nm ( ) with a waters u.v. detector (Wa-
ter~ Model 481) at a sensitivity of 0.5 AUFS. Elution
wa~ achi~ved with a linear 5 min gradient from 0-25% of
increasing concentrations of acetonitrile containing
0.05% TFA, followed by a linear 15 min gradient of 25-
45% acetonitrile containing 0.05% TFA, followed by a
linear 15 min gradient of 45-80% acetonitrile contain-
ing 0.05% TFA, followed by a linear 5 min gradient of
80-100% acetonitrile containing 0.05% TFA. A Super-
Rac- (LKB 2211) was used to collect 1 ml fractions.
Five hundred microliter aliquots of every other frac-
.
~/t4360 2 ~ PCT/US90~027~3
- 15 -
tion-were transferred to 12 x 75 mm polystyren~ tubes
(Falcon 2058) containing 50 microliters of 1.0 M ace-
tic acid and 50 micrograms of bovine serum albumin
(Sigma A0281) and assayed for tumor growth inhibitory
activity as described under Materials and Methods.
Inhibition of A549 human lung carcinoma cells is shown
by open triangles and of mink lung (CCL 64) cells by
open circles. The solvent gradient is shown by large
dashes ( ~
Figure 13 shows the hydrophobic interaction chromatog-
raphy phenyl-Sepharose. Phenyl-Sepharose (Pharmacia)
was equilibrated with 4.0 M ammonium acetate, pH 4.5
and 15 ml of resin poured into a 1.5 x 20cm column
(Pharmacia). Thirty-one mg of ether ethanol precipi-
tated TGI in 36.0 ml which was equilibrated by dialysis
in Spectropor~ 3 (molecular weight cutoff 3,500) in 4.0
M ammonium acetate, was applied to the column at a flow
rate of 1.0 ml/min. After the absorbance at OD280
reached zero, a gradient containing a descending con-
centration of 4.0 M to 0.04 M ammonium acetate (short
broken lines) and an ascending concentration of
ethylene glycol (Mallinkrodt) from 0-50% (long broken
lines), pH 4.5 was applied through a flow adaptor
(Pha~acia ACl6). The total volume of the gradient was
150 ml and 1.9 ml fractions were collected by a Redi-
rac- fraction collector (LXB). Thirty microliters of
every other fraction was transferred to a sterile plas-
tic 12 x 7S mm snap-top tubes (Falcon) containing 50
micrograms of bovine serum albumin (Sigma A0281) in l.0
M acetic acid. Tumor growth inhibitory activity was
determ~ned for both CC~ 64 mink lung cells and A549
cells as described in the initial procedure. Activity
against A549 cells is not shown because the activity
profiles were similar. Tumor growth inhibitory activ-
. .
:'' ' ~' '`' ' :' .
., ' . . ,~ .
WO90/14360 ~ PCT/US90/02753
ity ~s plotted as percent inhibition and is illustratedby closed circles. The peak of growth inhibitory ac-
tivity was eluted at l.18 M ammonium acetate, 42% eth-
ylene glycol. Protein concentration is indicated as
absorbance at 280 nm and was determined using a spec-
trophotometer (Baush ~ Lomb, Spectronic~ l00l).
Biologically active fractions 90-l00 were pooled and
dialyzed against 0.l M acetic acid. The protein con-
centration of the pooled fractions was determined by
absorbance at OD280. The recovered protein was l.4 mg
(see Table 7). The quantity of inhibitory units ap-
plied was l.56 x 106 in 30.9 mg and the amount recov-
ered was l.5 x 106 in l.4 mg.
-15 Flgure 14A shows reverse phase high pressure liquid
chromatography (HPLC) (~Bondpak~ Cl8). One mg of lyoph-
ilized TGI derived from the stromal component of umbil-
ical cord tissue (dissected) and obtained from the
pooled biologically active fractions resulting from
phenyl-Sepharose chromatography, was diluted in 2.0 ml
of 0.05% trifluoroacetic acid (TFA) containing 10%
acetonitrile. The amount of protein used for RPHPLC at
this step represents 50% of the total biologically
active proteins obtained following chromatography using
phQnyl-Sepharose. The protein solution was sonicated
for two minutes (Branson B-220 Sonicator) and particu-
late ~atter removed by centrifugation (Beckman Model
TJ6) at 3,000 rpm for 5 minutes prior to injection into
a (~BONDAPAX- Cl8) column (0.39 x 30 cm~. The protein
was eluted at a flow rate of l.0 ml per minute using a
stepwise gradient. The concentration of acetonitrile
was initially increased to 25% in fifteen minutes and
elution was continued at 25~ for lO minutes; the con-
centration was then increased to 27% in two minutes and
- . . ,: ~
- .
.. -: .
'', - ~, ' .
. - : . ~ . , . ~ . .
~ !~90~t4360 2 Q ~ ~ ~ 3 ~ PCT/US9OtU2753
- 17 -
elu~on was continued at 27% for ten minutes; the con-
centration increased to 28~ in 2 minutes continued at
28% for 10 minutes, and finally the concentration was
increased to 100% in lo minutes. The fractions were
collected into siliconized glass tubes. The solvent
6 gradient is illustrated by short dashes. Absorbance of
protein was monitored at 210 nm ( ). Each frac-
tion volume contained 1.0 ml. The equipment used for
RPHPLC was exactly as described in Figure 12. Five
microliter aliquots from every other tube were removed
to assess tumor growth inhibitory activity against CCL
64 and A549 as previously described. Activity against
the CCL 64 cell line is indicated by closed circles. -
Fractions 47-51 were pooled separately for electro-
phoresis by SDS-PAGE (mar~ed by arrows). 350,000 in-
hibitory units were applied in this chromagtographic
procedure and the recovered units in the pooled frac-
tions were: 150,000 in fractions 39-58; 14,850 in
fractions 59-71 (Total 164,850). The growth inhibitory
activity eluted at 27% and 28-30% acetonitrile.
Figure 14B-~ws the reverse phase high pressure li~uid
chromatography (HPLC) (~BONDAPA~0 C18). Three hundred
and forty-five micrograms of TGI derived from the stro-
mal co~ponent of dissected human umbilical cord tissue
and obtained from pooled biologically active fractions
re~ulting from phenyl-Sepharose chromatography were
diluted in 2.0 ~1 of 0.05% trifluoracetic acid (TFA)
and 10% acetonitrile. The protein was prepared and
chromatographed exactly as described in Figure 14A.
Ten microliters from each 1.0 ml sample were used to
test for inhibitory activity. This sample represented
30% of the total biologically active pooled fractions
derived from phenyl-Sepharose chromatography. The
number of inhibitory units applied to the column was
~.
. ' . . ,' . . !, . . .
.. . ~' ' , . '.
,
' ' '' "" ~,' ',
W090~14360 2 ~ 8 ~ PCT/US90/02753
18 - !
',.' :
312~500. The recovered units were 62,500 in fractions
46-50, 50,000 units in fraction 51-55, and 9o,000
units in fractions 56-72 (Total 202,500 units recov-
ered).
5Figure 15 shows Sodium Dodecyl Sulfate Polyacrylamide
Slab Sel Electrophoresis (SDS-PAGE). The lyophilized
pool of biologically active protein, as marked by ar- -
rows, in Figure 14A from chromatography by ~BONDAPAK~
C18 from two identical chromatographic procedures were
10pooled and prepared for gel electrophoresis. Samples
were diluted in 100 microliter sample buffer contain-
ing 0.1 M Tris-HCl, pH 6.8 (Sigma), 15% glycerol
(Kodak), and 2% sodium dodecyl sulfate (SDS). The
samples were boiled for two minutes to remove protein
15which may have adhered to the glass (siliconized) and
50 microliters transferred to 50 microliters of sample
buffer containing 10% ~-mercaptoethanol (BioRad~) for
reduction of disulfide bonds. These samples were
boiled for 2 minutes and both the unreduced and reduced
20samples were applied to two separate 1.5 mm wide slab
gels (marked as lane 2) and electrophoresed through a
10-20% acrylamide gradient in a vertical electrophore-
sis cell (BioRad, Model 155) under constant current at
30 milliamps (mA) per gel for 4.5 hours (Hoeffer power
25supply PS 1200 DC). Molecular weight standards (Phar-
cia) both reduced by 5% B-mercaPtoethanol and non-
reduced are marked with their corresponding molecular
weights. They are as follows, phosphorylase A, 96 kDa;
bovine serum albumin, 68 kDa; ovalbumin, 43 kDa; car-
30bonic anhydrase, 30 ~Da; soybean trypsin inhibitor, 21
kDa; and lysozyme 14.4 kDa. Fifty nanograms (50 ng) of
a purified platelet derived TGF-~ supplied by ~r.
Bruce Magun was diluted in sample buffer and electro-
phoresed under non-reducing conditions (a) and reducing
.
- . . , .~
. . .
- . . .
~ 90/]4360 2 ~ 1 PCT/US90/02753
-- 19 --
conditions (b) shown in lane 1. The gels were stained
with 0.125% Coomassie Blue R-250 (BioRad) in 5.7% ace-
tic acid 47~ methanol for ten minutes (to fix the pro-
tein in the gel), and destained overnight in the same
solution without Coomassie Blue. The gels were re-
stained by a silver technique as described by Merril
(BioRad silver staining kit #161-0443) Lane l (TGF~)
contains approximately 1,000-1,500 (50 ng) units of
growth inhibitory activity, and lane 2 contains ap-
proximately 8,000-20,000 units of growth inhibitory
activitY-
Figure 16 shows reverse phase high pressure liquid
chromatography (HPLC) (yBONDAPAX~ CN) of active frac-
tions from the previous HPLC procedure (14B) which were
combined from two separate chromatographic runs. The
lyophilized material from individual tubes (siliconized
glass 13 x 100 mm tubes) was suspended in 4.0 ml of
0.1% trifluoracetic acid (TFA) containing 10~ propanol,
sonicated for two minutes and injected onto a ~ONDAPAX0
CN column (0.39 x 30 cm) at 1.O ml/minute. Elution of
the protein was achieved by increasing the concentra-
tion of 2 propanol containing 0.05~ TFA from 10% to 20%
in 10 minutes, the concentration was then increased
from 20 to 50% in 50 minutes (0.6~ per minute), and
finally the concentration was increased to 100% in
twenty minutes. The solvent gradient is shown as
short dashes. Absorbance of the eluted protein was
monitored at 210 nm ( ~ ). The equipment used
for RPHPLC was exactly as described in Figure 12.
Each fraction volume was 1.0 ml and an aliquot of two
hundred microliters was then removed from every other
tube to assess biological activity (closed circles).
The inhibitory activity eluted from the column between
approximately ~0-45% 2-propanol. Twelve thousand units
. .,
' '
~: .
.
WO90/14360 ~ PCT/US90/02753
- 20 -
(12r~00) of activity were applied to this column. The
following fraction~ were lyophilized, iodinated and
electrophoresed by SDS-PAGE (Fig. 17). The total num-
ber of units contained in these fractions were: Frac-
tion #56 (0 units), #58 (488 units), #59-65 (11,750
units)~ and #66-68 (185 units).
Figure 17 shows SDS polyacrylamide slab gel electro-
phoresis and autoradiography. Lyophilized samples from
specific active and inactive fractions from chromatog-
raphy on a ~BONDAPAK~ CN column illustrated in Figure 16
were iodinated as described in the text. Samples were
dissolved in both non-reducing and reducing sample
buffer as described for Figure 15 and electrophoresed
using a 5-20~ acrylamide gradient to resolve protein
bands and remove free-radioactive iodine. The gels
were stained and destained until the radioactive label
disappeared from the destain solution. The gels were
dried using a gel dryer (Hoeffer) and subjected to
autoradiogr~phy using type XAR film tKodak) for 1 week.
Non-radioactive standards were also electrophoresed and
are marked at the left of the gel. The number of cal-
culated inhibitory units applied to this gel were:
from Figure 16, fraction #58 (189 units), lane 1; #59-
65 (2,068 units), lane 2; #66-68 (46 units), lane 3;
#56 (0 units), lane 4; active fraction of undissected
human umbilical cord following chromatography on a
~BONDAPAX~ CN column as described in Figure 18
chromatogram, (408 units), lane 5; inactive fractions
from same stromal/vascular preparation, lane 6; plate-
let-deri~ed TGF-~ purified by Bruce ~agun (256 units,
approximately 0.4 ng), l~ne 7.
Figure 18 shows reverse phase high pressure liquid
chromatography (HPLC) (~BONDAPAK2 CN). Active frac-
:
- , ~ .
. .
.
,
~90/14360 ~ L PCT/US90/02753
- 21 -
tions from a previous HPLC procedure of undissected
umbilical cord (similar to Figures 14A & 14B), which
eluted at 27% acetonitrile (Pool I) from a ~BONDAPAK2
C18 column were pooled, lyophilized to 1.0 ml volume in
a siliconized glass tube (16 x 100 mm) and diluted to a
final concentration of 0.1~ trifluoracetic acid (TFAJ
and 20% 2-propanol. The sample was sonicated for 2
minutes and injected onto a ~BONDAPAK~ CN column (0.39 x
30cm) at 1 ml per minute. Elution of the protein was
achieved by increasing the concentration of 2-propanol
containing a. 1% TFA from 20% to 35% in 5 minutes fol-
lowed by 35% to 50% in 50 minutes (0.375% per minute),
and 50% to 100% in 5 minutes. The solvent gradient is
shown as short dashes. An aliquot of 10 microliters
was removed from each 1.0 ml sample to test for biolog-
ical activity (closed circles). The equipment used for
RPHPLC is as described in Figure 14. The active frac-
tions eluted between 39 to 43% with the peak of activi-
ty eluting at 40-41%. The number of calculated inhibi-
tory units applied to the column was 37,000. Protein
concentrations could not be determined. Absorbance at
210 nm is shown by the solid line.
Figure 19 shows Reverse Phase High Pressure Liquid
Chromatography (~PLC) (~BONDAPAR CN). Active fractions
from a previous HPLC procedure (the same chromatograph-
i~ run a3 Figure 18 was derived) which eluted at 28-30%
acetonitrile (Pool II) from a C18 resin pooled and
applied to a ~BONDAPAX~ C~ column as described in Figure
18. Gradient elution and equipment are as described
for Figure 18. Aliquots of 100 microliters were re-
moved from every tube to test biological activity
(closed circles). Biological activity eluted from 44%
to 46% with the peak of activity at 44%. The number of
growth inhibitory units applied to the column was
. ~ :
'
- - ,
.
- : -, ,
9 ~ ~
~'090~14360 ~ PCT/US90/027~3
- 22 -
21,000. Protein concentration could not be deter-
mined.
Figure 20 shows the Reverse Phase High Liquid Chroma-
tography (HPLC) (~BONDAPAKX CN). The elution profiles
reflecting biological activity (peaks only) from Figure
18 (Pool I) and Figure l9 (Pool II) have been traced
onto a separate chromatogram for comparison. Pool I
eluted at 40-41% and Pool II at 44%.
Figure 21 shows the Reverse Phase HPLC of A431 Condi-
tioned Media. Lyophilized conditioned media from 4 x
108 A431 cells (llO ml) was processed, as described in
the text, for the effect of DTT on tumor growth inhibi-
tory activity derived from tumor cell conditioned
media. Lyophilized conditioned media from A431 cells
was resuspended in 5 ml 4 mM HCl and centrifuged toremove insoluble material (RC5B-Sorvall~ SA600 rotor)
for 15 minutes at 3,5000 RPM at 4 C. The supernatant
was transferred to i.5 ml microfuge tubes and centri-
fuged ir ?~ Eppendorf microfuge for 15 min at 4 C.
Protein atration was determined by absorbance at
280 nm. An aliquot of 0.2 ml containing 680 micrograms
protein was added to 1.8 ml 0.1 M ammonium bicarbo~-
ate. The samples were incubated at room temperature
for 2 hours, lyophilized, and resuspended in 2 ml of
0.05% trifluoroacetic acid. The material t2.Oml) wasinjected onto a reverse phase semipreparative
~BONDAPAX- Cl8 column at 1.0 ml/min and 2.0 ml frac-
tions were collected at the start of the linear aceto-
3~ nitrile from 0-50% in 50 min. An ali~uot of 1.0 ml
gradient from each fraction was assayed for tumor
growth inhibitory activity against mink cell line (CCL
64) ( --0--0--0-- )and human tumor cell line (A549)
~ -- ) as previously described. Absorbance at
3S
90tl4360 ~ &~ ~g ~ ~ PCT/US90/02753
- 23 -
206 ~m is indicated by the solid line.
Figure 22 shows the Reverse-phase HPLC of A431 Condi-
tioned Media Treated with DTT. Lyophilized conditioned
media from 4 x 108 A431 cells (110 ml) was processed,
as previously described, for the effect of DTT on tumor
growth inhibitory activity in tumor cell conditioned
media. Lyophilized conditioned media from A431 cells
was resuspended in 5 ml 4 mM HCl and centrifuged to
remove insoluble material (RC5B-Sorvall~ SA 600 rotor)
for 15 minutes at 3,500 RPM at 4C. The supernatant
was transferred to 1.5 ~l microfuge tubes and centri-
fuged in an Eppendorf~ microfuge for 15 min. at 4~C.
Protein concentration was determined by absorbance at
280 nm. An aliquot of 0.2 ml containing 680 ~icrograms
protein was added to 1.8 ml 0.1 M ammonium bicarbonate
containing a final concentration of 65 mM DTT. The
samples were incubated at room temperature for 2 h.,
lyophilized, and resuspended in 2 ml of 0.05% tri-
fluoroacetic acid. The material (1.0 ml) was injected
onto a reverse phase semipreparative ~BONDAPAK~ C18
column, and 2.0 ml fractions were collected at the
- start of a linear gradient and assayed for growth in~
hibitory activity against mink lung cell line (CC~ 64)
( --O--O-- ) and human tumor cell line (A549) ( --D--
~-- ) as previously described. Absorbance at 206 nm
i~ indicated by the solid line.
Figure 23 in a schematic representation of trpE: :TGF-
~1 plasmid constructs using pATH 11 and pKS-1 expres-
sion vectors for the production of TGF-~l polypeptide
in bacteria.
Fiyure 24 shows a Southern blot analysis of human tumor
DNAs hybridized with a Pvu II-Pvu II TGF-~l cDNA probe.
.. .. ..
..
- ~ ' " ' ' ~ '
WO90/14360 2 0 ~ PCT/US90/02753 ~^
SCC is standard saline-citrate buffer, which consists
of : 0.15M sodium chloride and 0.15M sodium citrate.
(p~ 7.0).
Figure 25 shows a restriction map of the phage sub-
clone that hybridized to the TGF-~l CDNA probe at high
stringency wash. The clone corresponds to TGF-~l
genomic locus. The Sal I-Sal I fragment of the phage
clone was subcloned into pUC. Abreviations for re-
striction enzyme sites are: S-Sal I; K-KpnI; E-Eco RI;
H-Hind III: B-Bam HI; Bg-Bgl II.
Figure 26 shows a res'riction map of the phage sub-
clone that hybridized to the TGF-~l cDNA probe only
under conditions of low stringency.
Figure 27 shows a comparison of the nucleotide sequence
and the predicted amino acid sequence of TGF-~l and the
related gene encoding the protein with tumor inhibitory
activity. Indentical amino acids are boxed. (A) cor-
responds to the gene encoding the protein having tumor
growth inhibitory activity.
Figure 28 shows a restriction map of the Bam HI frag-
ment of the related gene encoding the protein having
tumor growth inhibitory activity subcloned into pUC.
Th~ position of the repeat free fragment (BamHI-TaqI)
is indicated with a bar.
Figure 29 shows a partial nucleotide sequence of the
l.7 kb cDNA encoding the protein having tumor growth
inhibitory activity and its corresponding amino acid
sequence.
.. . "
'-'- . '. : . , ' ~ :
J ~
90/14360 PCT/U~90/02753
- 25 -
Figu~e 30 shows the restriction map of the l.7 kb Eco
RI subclone of the TGF-~l related gene encoding the
protein having tumor growth inhibitory activity.
Figure 31 shows a ~ucleotide and predicted amino acid
sequence comparison of the gene encoding the protein
having tumor growth inhibitory activity with TGF-~l and
TGF-~2. ~A) corresponds to the gene encoding the pro-
tein having tumor growth inhibitory activity.
tO Figure 32 shows a Northern blot analysis of A673, A549,
and A498 cell lines using an Eco RI-Bgl II l.7 kb cDNA
fragment of the gene encoding the protein having tumor
growth inhibitory activity as a probe.
Figure 33 shows a Northern blot analysis of A67~, A549,
and A498 cell lines using a Pvu II-Taq I probe from
genomlc sequences of the gene related to TGF-Bl and
encoding the protein having tumor inhibitory activity.
Figure 34 shows a Northern blot analysis of A673, A549,
and A498 cell lines using a Pst I-Bal I TGF-~l probe.
Figure 35 shows a Northern blot analysis of A673, A549
and A498 cell lines-using TGF-~l cDNA containing the
complete coding sequence of TGF-~l precursor as a
probe.
Figure 36 shows a Northern blot analysis of mRNA from
umbilical cord and A673 cell line usi~g an Eco RI - Bgl
II cDNA fragment of the gene encoding the protein hav-
ing tumor growth inhibitory activity as a probe.
Figure 37 shows the production of trpE::protein having
tumor growth inhibitory activity fusion protein of
: ~ , '. ' .'. , .: . ,
: .
WO90/l4360 2 ~ i PCT/U~90/02753
thre~ lysates by SDS polyacrylamide gel electrophore-
sis. (A) corresponds to the gene encoding the protein
having tumor growth inhibitory activity.
Figure 38 shows a Western blot analysis of an antibody
recognizing a fusion protein of the proteLn having
tumor growth inhibitory activity. (A) represents the
polypeptide sequences corresponding to the last 150
amino acids of the protein having tumor growth inhibi-
tory activity.
Figure 39 shows whole cell bacterial lysates containing
trpE::TGF-Bl fusion proteins (lanes 1 and 4), trpE::(A)
fusion proteins (lanes 2 and 5), and the TGF-~l protein
(purchased from ~ & D Systems) (lanes 3 and 6) were
separated on a 12.5% SDS-polyacrylamide gel. The pro-
teins were electrophoretically transferred to a nitro-
cellulose filter (1 ~m pore size) and incubated with lO0
ug of affinity purified anti-peptide antibody either
in the abs2nce (lanes 1, 2 and 3) or presence of a 300
fold molar excess of the antigenic peptide (lanes 4, 5,
and 6). The antibodies were detected using alkaline
phosphatase conjugated to goat anti-rabbit antibody
(Promega) according to the manufacturer's instruc-
tions.
Figure 40 shows a schematic diagram of mRNA encoding
the protein having tumor growth inhibitory activity
with the coding sequence boxed. The relative extension
of the cDNA inserts obtained from placenta (1.7 kb),
umbilical cord (l.9 kb) and A673 (1.7 kb) libraries is
indicated. The dashed part of the box represents the
C-terminal region showing high homology to TG~-~s. The
5' Eco~I-Bg II restriction fragment of the placenta
cDNA is indicated by a bar.
- -: . :. :
- -: .
.: ~ :
. .
090/~4360 2 ~ PCT/US90/02753
- 27 -
Figure 41 shows the nucleotide sequence encoding the
protein having tumor growth inhibitory activity and its
deduced amino acid se~uence. Putative glycosylation
sites and polyadenylation signal are underlined. The
start of the mature protein is marked by an asterisk at
position 1164.
Figure 42 shows a comparison of the nucleotide sequence
and predicted amino acid sequence of the gene encoding
the protein having tumor growth inhibitory activity
with TGF-~l and TGF-~2. Identical amino acids are
boxed. The mature amino acid sequences start at posi-
tion 315. (A) corresponds to the gene encoding the
protein having tumor growth inhibitory activity.
Figure 43 shows a homology matrix plot between the gene
encoding the protein having tumor growth inhibitory
activity and TGF-~1 and TGF-~2.
Figure 44 is a schematic representation of the
construction of the pCMV-TGF-~3 expression plasmid from
pORFX and p~lue-TGF-~3 plasmids.
Fiqure 45 shows the level of TGF-~3 mRNA expression,
determined by Northern hybridization using a TGF-~3
sp~cific probe, of parental CHO cells (lane 1), CHO
cells transfected with TGF-~3 cDNA (CHO 6.35) (lane 2)
and CHO 6.35 amplified with 20nM Mtx (CHO 6.35/20nM)
~lane 3)
Figure 46A shows the dose response of mink cell growth
inhibition using purified TGF-~l. Cell growth was
quantitated by the metabolism of MTT (3-[4,5-
Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide;
.
i ' , ~ ' ' .~' :, '
. . .
WO90/14360 2 ~J~ ~ i PCT/US9~/027S3
- 28 -
Thi2zolyl blue) (Mossman, T- (1983) J. Immunol. Methods
65, 55-65).
Figure 46B hows the dose response of mink cell growth
inhibition usin~ acid activation serum free
supernatants CH0 6.35/20nM transfectant and CH0 6.35
transfectant. Cell growth was quantitated by the
metabolism of MTT.
Figure 47 shows the relative location of the various
TGF-~3 peptides used as antigens.
Figure 48A shows the immunoblot of TGF-~3 from
conditioned media of CHO 6.35/20nM transfectant using
~3III and ~3V antibodies for detection from gels under
reducing conditions.
Figure 48B shows the immunoblot of TGF-~3 from
conditioned media of CHO 6.35/20nM transfectant using
~3III and ~3V antibodies for detection from gels under
non-reducing conditions.
Figure 49 shows a Western blot of cell extract (49A)
and conditioned media (49B1 of the CHO 6.35/20nM
transfectant using ~3V antibody for detection.
Fisure S0 shows the immunoprecipitation of native
recombinant TGF-~3 protein by ~V antibody.
Figure 51 shows the staining to paraffin sections of
human umbilical cord by ~V antibody (Figure 51 A,C) and
control antibody (51~, D).
Figure 52 shows a silver stained gel of purified TGF-~3
and TGF~
'": .
90/14360 ~ PCT~US~0/02753
- 29 -
Figure 53 shows antibody neutralization of TGF-~3
inhibition of mink cell growth.
, , - , .: . ;
:
,- . . , ~
,
WO90/14360 20~6~g ~ PCT/US90/02753 ~
30 -
Detailed DescriPtion of the Invention
This invention provides a protein having tumor growth
inhibitory activity comprising the 112 amino acids
shown in Figure 29 beginning with alanine at position 1
and ending with serine at position 112. Preferably,
this protein may be a purified protein having 112
amino acids beginning with alanine at position 1 and
ending with serine at position 112 as shown in Figure
29. This 112 amino acid protein is the mature form of
the protein having tumor growth inhibitory activity.
A biologically aetive derivative of a protein having
the tumor growth inhibitory activity is also provided,
wherein the derivative has substantially the same amino
t5 acid sequence shown in Figure 29 beginning with alanine
at position 1 and ending with serine at position 112.
The protein may also comprise the 412 amino acids shown
in Figure 41 beginning with methionine at nucleotide
position 263 and ending with serine at nucleotide
position 1496. Thus, this 412 amino acid sequence
contains the complete precursor se~uence of the protein
having tumor growth inhibitory activity as well as the
co~plete sequence of the mature protein.
Further, a biologically active derivative of the
proteiA comprising the 412 amino acids shown in Figure
41 is provided. The biologically active derivative has
~ubstantially the same amino acid sequence as shown in
Figure 41 beginning with methionine at nucleotide
position 263 and ending with serine at nucleotide
position 1496. Further provided is a protein
comprising the 411 amino acids shown in Figure 41
beginning with lysine at nucleotide position 266 and
. . .
, . , ~ ' - '' -
,
` ~90/14360 ~ PCT/~S90/027~3
ending with serine at nucleotide position 1496.
This invention further provides a n~cleic acid molecule
encoding the protein having tumor growth lnhibitory
activity comprising the 112 amino acids shown in Fig-
ure 29 beginning with alanine at position 1 and ending
with serine at position 112. The nucleic acid molecule
may encode the entire protein shown in Figure 41 begin-
ning with methionine at nucleotide position 263 and
ending with serine at nucleotide position 1496. Alter-
natively, the nucleic acid molecule may encode only
the 112 amino acids found in the functional protein
shown in Figure 29 beginning with alanine at position 1
and ending with serine at position 112. These nucleic
acid molecules may be cDNA, genomic DNA, or mRNA and
may also comprise the entire nucleotide sequence set
forth in Figure 41 begining with cytosine at position 1
and ending with guanine at position 2529 or only the
112 amino acid sequence of the mature protein shown in
Figure 29 beginning with guanine of the codon at
position 1 and ending with cytosine of the codon at
position 112.
It would be clear to one skilled in the art that
certain amino acids as well as the nucleic acids encod-
ing these amino acids may be varied, thus producin~
biologically active derivatives, e.g. mutants, without
changing the function of the protein~ This invention
encompasses all variations of the amino acid and
nucleotide sequence which produce a functional
protein.
This invention also provides a plasmid which comprises
the nucleic acid molecules of this invention as well as
a host vector system comprising the plasmid in a suit-
W090~14360 ~V~ PCT/US90/027~3
- 32 -
able-host cell. Thls host vector system comprises any
plasmid and vector known in the art which are suitable
for producing the proteins of this invention. The
suitable host cell may be a bacteria oell or a eucaryo-
tic cell.
This invention further provides a method for producing
a protein comprising growing the host vector system of
this invention so as to produce the protein having
tumor growth inhibitory activity in the host and recov-
ering the protein so produced.
Additionally, the invention provides a polypeptidederived from the protPin having tumor growth inhibitory
activity. The polypeptide comprises the 20 amino acids
shown i~ Figure 29 beginning with arginine at position
9 and ending with leucine at position 28. The
invention further provides an antibody which
specifically binds to an epitope contained within the
protein having tumor growth inhibitory activity. The
antibody may be monoclonal or polyclonal.
This invention also provides an antibody which specifi-
cally binds to an epitope contained w~thin the
polypeptide comprising the 20 amino acids shown in
Figure 29 beginning with arginine at position 9 and
ending with leucine at position 28. The antibody may
be ~nonoclonal or a polyclonal.
A method for diagnosing a tumor is also provided in the
~ invention. The method comprises contacting a sample
from a human subjeot with an antibody of the invention
under suitable conditions so as to form a complex
between the antibody and an epitope contained with the
protein and detecting the complex so formed, thereby
~ 9Ot14360 2 0 ~ 6 9 ~ ~ PCT/US90~02753
- 33 -
diag~osing a tumor. By suitable conditions applicants
contemplate any conditions which would be conducive to
the formation of a complex which are known in the art.
This invention provides a pharmaceutical composition
comprising the antibodies of this invention and a phar-
maceutically acceptable carrier. A pharmaceutically
acceptable carrier includes all carriers known in the
art. Merely by way of example, the carrier may be sa-
line.
This invention further provides a method of treating a
tumor which comprises administering to the subject an
effective tumor treating amount of the pharmaceutical
composition. This invention also provides a m thod of
treating a proliferative type disorder which comprises
administering to the subject an effective
proliferative type disorder treating amount of the
pharmaceutical composition. The composition may be
used to treat various types of proliferative type dis-
orders. Examples of proliferative type disorders of
which the composition may be effective include arte-
riosclerosis, inflammation, and psoriasis.
Tho protein having tumor growth inhibitory activity may
b~ used in a pharmaceutical composition which comprise
an e~fective amount of the protein having tumor growth
inhi~itory activity, or a biologically active
derivative thereof, together with a suitable phar-
maceutical carrier. Effective amounts may vary among
the various tumor growth inhibitors depending on the
indication to be treated, the patient or the stage of
tumor development, by methods well known to those
skilled in the art Similarly, suitable carriers such
as saline or other aqueous solutions, gels, creams and
-
- , . .- . .
,: , , :
,: , , . .~ ::
: :. : , . ;
WO90/14360 ~ 5 6 ~ 1 PCT/US90/027~3
- 34 -
the ~ike are well known to those skilled in the art.
The protein having tumor growth inhibitory activity may
be used in a method to inhibit the growth of human
tumor cells, e.g., carcinoma, melanoma or leukemia
cells, by contacting the cells with an ef~ective tumor
growth inhibiting amount of thQ pharmaceutical
composition which includes the protein having tumor
qrowth inhibitory activity. The protein having tumor
growth inhïbitory activity may also be used in a
10 method to treat burns or to facilitate the healing of
wounds by contacting the burn or wound with a
pharmaceutical composition which includes an effective
amount of the protein having tumor growth inhibitory
activity and a suitable pharmaceutical carrier.
This invention also provides a method of treatinq a
proliferative type disorder in a subject which compris-
es administering to the subject an effective amount of
the composition which includes the protein having tumor
20 growth inhibitory activity comprising the 112 amino
acids shown in Figure 29 beginning with alanine at
position 1 and ending with serine at position 112 in a
suitable phar~aceutical carrier effective to treat the
proliferative type disorder. Various proliferative
25 type disorders may be treated using the proteins of
tbe invention. Examples of proliferative type
disorders include arteriosclerosis, infla~mation, and
psoria~is. ~he various proteins of this invention may
further be used as an immune modulator.
Further provided in the invention is a pharmaceutical
co~position comprising an effective amount of the
protein comprising the 412 amino acids shown in Figure
41, or a biologically active derivative thereof, in a
~:
,
90/l4360 2 03 ~7~S i PCT/US90/02753
- 35 -
suit~ble pharmaceutical carrier. The pharmaceutical
composition may be used in a method of inhibiting the
growth of human tumor cPlls. The method comprises
contacting the cells with an effective tumor growth-
inhibiting amount of the pharmaceutical composition.
A method of treating a proliferative type disorder with
the pharmaceutical composition comprising the 412 amino
acid protein is also disclosed. The method comprises
administrating to a subject an amount of the
pharmaceutical composition effective to treat the
proliferative disorder.
Further, the pharmaceutical composition comprising the
412 amino acid protein may also be used in a method for
treating a burn or healing a wound. The method
comprises contacting the burn or wound with an
effective amount of the pharmaceutical composition.
A method for detecting the presence of a tumor is dis-
closed. The method comprises quantitatively determin-
ing the amount of the protein having tumor growthinhbitory acti~ity present in a sample, e.g., blood,
amniotic fluid, peritoneal fluid, ascites fluid, cere-
brospinal fluid or urine, from a subject and comparing
the amount so determined with the amount present in a
~ample ~rom a normal subject, the presence of a sig- -
nificantly different amount, e.g. a significantly
higher amount, indicating the presence of a tumor. -
.,
Another method for detecting the presence of a tumor is
disclosed. The method comprises separàtely quantita-
tively determining both the amount of the protein
having tumor growth inhibitory activity and of
transforming growth factor alpha (TGF-alpha) present in
.... . . . . . -- - , :. - .: ~. .
:. ~' ' ' . - ' . ~
,
. .
.:
W090/14360 2 ~ 5 ~ ~ g ~ PCT/USgO/02753 ~i
- 36 -
a sample from a subject, d2termining the ratio of the
amount of the protein having tumor growth inhibitory
activity present in the sample to the amount of TGF-
alpha present in the sample from a subject, determining
the ratio of the amount of the protein having tumor
growth inhibitory activity present in the sample,
determining the comparable ratio for a sa~ple from a
normal subject and comparing the ratio for the sample
from the subject to the ratio for the sample from the
normal subject, a significant variation in the ratio
indicating the presence of a tumor.
A method for typing tumors is disclosed which comprises
quantitatively determining for a sample from a subject
with a tumor the amount of each of TGI-l, TGI, TGI-2,
the protein having tumor growth inhibitory activity,
CM-I, or the polypeptide recoverable from conditioned
media of A431 cells present in the sample, the presence
of specific amounts or relative amounts thereof, e.g, a
significant increase in the amount of TGI or a signif-
~ icant variation in a ratio such as the ratio of TGI-l
to CM-I, being indicative of a specific tumor type.
This invention further provides a method of inhibiting
the activity, for example, immunosuppressive activity,
o~ the protein having tumor growth inhibitory activity,
or any biologically active fragment thereof, which
comprises contacting the cells with an effective amount
of the antibody which specifi~ally binds to an epitope
contained with the protein having tumor growth
inhibitory activity comprisi~g the 112 amino acids
shown in figure 29 beginning with alanine at position 1
and ending with serine at position 112.
.
90/14360 ~ ~ ~ b ~ o ~ PCTJUS90/02753
- 37 -
Fina~ly, another method of inhibiting the activity, for
example immunosuppressor activity, of the protein
having tumor growth inhibitory activity, or any
biologically active fragment thereof, is disclosed.
~he method comprises contacting the cells with an
effective amount of the antibody which specifically
binds to an epitope contained within the 20 amino acid
polypeptide shown in Figure 29 beginning with arginine
at position 9 and ending with leucine at position 28.
This invention is illustrated in the Experimental
Details section which follows. Thls section is set
forth to aid in an understanding of the invention but
is not intended to, and should not be construed to,
limit in any way the invention as set forth in the
claims which follow. ~:
`
: . - '
W090/14360 2 ~ ~ S 9 g ~ PCTt~S90~02753 ~
- 37A -
This invention further provides a method of producing ~GF-
B3 which comprises:
(a) preparing DNA encoding a precursor of TGF-B3
and having a nucleotide cequence
substantially identical to the nucleotide
sequence shown in Figure 4l be~inning with
nucleotide 263 and ending with nucleotide
1498;
(b) inserting the DNA so prepared into an
expression vector 80 positioned with respect
to a suita~le promoter a~ to permit
expression of the DNA in a suitable host
cell;
(c) transforming the host cell with the
expression vector under conditions
permitting expression of the DNA;
(d) culturing the host cell so transformed in a
suitable medium under conditions such that
the DNA is expressed, the precursor of TGF-
B3 is produced, and the precursor TGF-B3 so
produced is secreted into the medium;
(e) treating the mediu~ containing the secreted
precursor of TGF-B3 with an activati~g agent
so as to convert the precursor into TGF-B3;
and
(f) recovering the TGF-B3 so produced.
The foregoing method is particularly intended for use with
a eucaryotic host cell, preferably a mammalian host cell.
Presently a CHO cell, e.g. a DHFR C~O cell, is particularly
preferred.
In the practice of this method, various promoters may be
used as is well known to those s~illed in the art.
Presently, the preferred promoter is an inducible promoter,
e.~. a promoter associated with the dhfr ~ene.
' : , : '
-
.
90/14360 2 ~ PCT~US90/02753
- 37~ -
Finall~, in order to convert the precursor of TGF-B3 to
mature TGF-B3, a activating agent, such as an acid, is
employed. Those skilled in the art will readily appreclate
the types of acids which may be so employed.
11) -
' '
,
,
-~5
... . ....... . . . .
-~ :. - -
.: :. .: :. . . .
'
W090~143~ 2 ~ i PCT/US90/02753
- 38 -
EXPE~IMENTAL DETAILS
Four sets of experiments are discussed below. Each
series of experiments comprises a means of isolatin~
proteins exhibiting tumor yrowth inhibitory activity.
In the first series of experiments six discrete pro-
teins are purified that demonstrated tumor growth in-
hibitory activity. These proteins were designated TGI,
TGI-l, TGI-2 and CM I-IV. The second and third series
of experiments are improvements of the purification
process resulting in more purified proteins demonstrat-
ing tumor growth inhibitory activity. In the fourth
series of experiments TGF-~l was cloned and used to
isolate a related gene encoding a protein having tumor
growth inhibitory activity. Although it has not yet
been determined which of TGI-l or TGI-2 corresponds to
the protein having tumor growth inhibitory activity,
one skilled in the art would understand that such a
correspondence exists although the exact nature of this
correspondence remains to be clarified.
First Series of ExPeriments
.
Materials and Methods
Isolation of Tissue-Derived Tumor Growth Inhibitors
(TGIs ) Fro~ Tissue Extracts
Human umbilical cord or placenta tissues were extracted
using a modification of the acid/ethanol extraction
procedure described by Davoren et al (Biochem. Bio-
phys. Acta. 63:1S0 (1962) and Roberts et al, Proc.
Natl. Acad. Sci. USA. 77: 3494 ( 1980).
, . :
..
' ' -
O90/14360 2 ~ PCT/US90/02753
- 39 -
The buffer for extraction consisted of 375 ml of 95%
(v/v) ethanol tpunctilious~ 190 proof, U.S. Industrial
Chemicals, #UN1170), 7.5 ml of concentrated ~Cl, 33 mg
of phenylmethylsulfonyl fluoride (PMSF) (Sigma P-7627)
and 1 ml of Aprotinin (Sigma A6012 with 19.8 Trypsin
inhibitor units per ml in 0.9% NaCl and 0.9~ benzyl
alcohol) mixed with 192 ml of distilled water at 4-C.
Four hundred to six hundred grams of frozen human um-
bilical cords or placentas (Advanced Biotechnologies)
(stored at -80 C) were thawed at 4 C for six hours.
The thawed tissue was placed in a 4-C chilled Cuisinart
food processor (Model DLC-7-PRo) and suspended in 200
ml of 4'C extraction buffer. The suspended tissue was
homogenized by the food processor. After the first
minute of homogenization, the suspension became creamy
white. Another 200 ml of 4 C extraction buffer was
added to this white suspension. The suspension changed
to a dark coffee brown color. The tissue suspension
was homogenized for a total of 10 min. at 4-C. Extrac-
tion buffer was added to this homogenized tissue mix-
ture to a final volume of 6 ml per gram of tissue homo-
genate.
The homogenized tissue suspension was transferred to a
large 4 liter beaker with a 3 inch stir bar and stirred
at half of the maximum stirring capacity of a Lab-line
Multimagnestir multi-mixer, Model #1278. After over-
night extraction with stirring at 4-C, the homogenate
was transferred to 1 liter centrifuge bottles
(Sorvall) and centrifuged at 3500 rpm (RCF=3So) for 30
minutes at 4C in a Sorvall RC-3B centri~uge equipped
with a Sorval H-6000A rotor. The supernatant was
transferred to a large 4 liter beaker and adjusted to
pH 5~0 with the slow addition of concentrated ammonium
hydroxide. With increasing p~, the color of the super-
, ., ~ - .
.
- '
WO90/l4360 ~a~ 9 ~ l PCT/US90/0~7~3
- 40 -
natant changed from brown to an orange solution. The
solution was precipitated following the addition of 2.0
M ammonium acetate, pH 5.2, added at an amount of 1% of
the total volume. This precipitate was removed follow-
ing centrifugation at 4500 rpm (RCF=5900) for 4 hours
in a Sorvàll RC-3B at 4'C. The supernatant was trans-
ferred to large 6 liter flasks to which four volumes
of anhydrous ether (-20 C) (Baker 9244-3) and two vol-
umes of 95% ethanol (4 C) were added The mixture was
allowed to stand undisturbed at -22C for 48 hours to
allow the resulting precipitate to settle.
At the end of the 48 hr precipitation, the etherized
material was brought to ambient temperature in a fume-
hood. ~arming of the acidified, ethanol extract to
ambient temperature enhances the aggregation of the
precipitate. The clear organic phase of ether and
ethanol was removed by a water aspirator and the pre-
cipitate was left in the fume hood for several hours to
allow the residual organic phase to evaporate. The
"dried" precipitate was dissolved in 1.0 M acetic acid
and dialyzed extensively against 1.0 M acetic acid
(Baker #9507-5) using dialysis membranes with a molecu-
lar cutoff of 3500 (Spectropor ~, Spectrum Medical
Industries, Los Angeles, CA). The dialyzed acidified
ethanol extract was lyophilized in 250 ml Corning coni-
cal centrifuge tubes (Corning 25350) and stored as
crude acidified, ethanol extract.
An alternative procedure for precipitating TGIs from
the acidified, ethanol extract replaces the addition of
four volumes of ether and two of ethanol witA the addi-
tion of only the two volumes of ethanol at 4-C. The
advantage of eliminating ether from the acidified,
ethanol extract precipitation step was the elimination
.
, ~; . . . : ,
: . . :
f'~ 90tl4360 2 ~ 5 u ~ ~ ~ PCr/VS90/027~3
-- 41 --
of a step requiring the use of a highly fla~mable sol-
vent which makes the procedure and any scale-up of the
processing of large amounts of materials difficult.
Gel Filtration ChromatoqraPhY ;.
Lyophilized crude acidified, ethanol extract was re-
suspended in 1.0 M acetic acid (10-30 mg/ml) and clari~
fied by centrifugation at 3500 rpm for 30 min at 4DC in
a Sorval RC-3B centrifuge equipped with a Sorvall H-
6000A rotor before sample application to the column.
Sample volumes of one hundred to 150 ml were chroma-
tographed on Bio Gel~ P10, 100~200 mesh (Bio-Rad; 150-
1040) in 1.0 M acetic acid at either 23- or 4 C.
The column (14 x 100 cm) (Amicon; #86012) contained
13.8 liters of equilibrated and degassed Bio-Gel~ P10
in 1.0 M acetic acid at either 23-C or 4 C. The void
volume was determined by the addition of 50 ml of blue
dextran (Sigma #D5751) at 2 mg/ml in 1.0 M acetic acid.
After calibration, the column was "conditioned" with
100 ml of bovine serum albumin (Sig~a #A-4503) at 100
mg/ml in 1.0 M acetic acid followed by extensive wash-
ing with 1.0 M acetic acid.
Follow~ng sample application, 1 liter fractions were
collected using a SuperRac~ (LKB 2211) equipped with a
type C collection rac~, at a flow rate of 7 ml/min into
2 liter plastic tissue culture roller bottles (Falcon;
3207). Fractions were monitored by a Uvicord~ ~ (LXB
2138) at 280 nm set at an absorbance range of 2.0 AUFS
and recorded by a single channel chart recorder (LKB
2210). One ml aliquots were removed from each frac-
tion, lyophilized and assayed for tumor growth inhibi-
tory activity as described. The remainder of each
.
, ~
,
. .
.
-. , : . :
.
., . : : . -
WO9Q/14360 2 0 ~ o ~ `1 i PCT/VS9~/02753
- 42 -
fraction was lyophilized in 2 liter lyophilization
jars (Virtis~ #6503-20S0) using a Virtis fre~ze-model
24.
Hiqh Performance liquid chromatoqraphy (HPLC)
Individual fractions containing TGI activity from the
Bio-Gel~ P-10 column were lyophilized and resuspended
in 1 to 10 ml of 0.05% trif-uoracetic acid (TFA)
(Pierce #28901) depending upon the amount of protein in
each fraction. Water used for HPLC was generated using
a Milli-Q water purification system. Starting buffer
in all HPLC chromatography runs consisted of Milli-Q
water containing 0.05% TFA. Prior to injection, the
sample was centrifuged in a Beckman tabletop centrifuge
(Beckman TJ-6) at 3000 rpm for 20 min to remove insol-
uble material. The supernatant was injected into ei-
ther a Waters uBondapak~ analytical C18 column (0.39 x
30 cm) (Waters PN27324) or semipreparative column (0.78
x 30 cm) (Watars PN84176) as specified in individual
experiments. A Waters automated gradient controller
(Waters Mod~l 510) was utilized for column elution
monitored by a variable wavelength u.v. detectors (Wa-
ters Lambda-Max, Model 481) set at 206 nm. The solvent
used for elution was either acetonitrile (Baker 9017-3~
or 2-propanol (Fisher, A452) containing 0.05% TFA.
Fractions were collected by a SuperRac~ (LKB 2211)
equipped with a type B collection rack into siliconized
(Pierce, Aguasil #42799) 13 x 100 mm or 16 x 100 mm
test tubes. Aliquots from each collected fraction were
assayed for tumor growth inhibitory activitiy as de-
scribed below.
.,
'~ .
~ ~ ~ r~ , J
~ 90/14360 PCT/US90/027~3
, .
- 43 -
,
Ion exchan~e chromatoqraPhy
Both the lyophilized material from the acidified, etha-
nol and ether extractions and various lyophilized frac-
tions derived from the Bio-Gel~ P-lO gel filtration
chromatography were separately subjected to ion ex-
change chromatography. CM, SP, and DEAE-TRISACRYL~
(LKB) ion exchange resins were used in these proce-
dures~ The samples for chromatograp~y were diluted to
a final concentration of approximately 20 mg/ml in l.o
M acetic acid. The samples were dialyzed at ~ C until
both the pH and conductivity were equal to the starting
(equilibration) buffer. All ion exchange chromato-
graphic procedures were perfor~ed at 4-C.
a. Chromatography using C~- and SP-TRISACRYL~ ion
exchanqe results.
The resins, as aqueous suspensions, were suspended in
an equal volume of O.l M ammonium acetate, pH 4.0, con-
taining l.O M NaCl. The resin was allowed to equili-
brate for at least 3 hours and was degassed at 4-C.
Twenty ml of resin was packed into a l.6 x 20 cm column
(Pharmacia; #19-0362-Olj and washed with 2 column vol-
umes of l.O ammonium acetate, pH 4.0, followed by O.Ol
M ammonium acetate, pH 4Ø The column was washed
until the effluent exactly matched the conductivity of
the equilibrating buffer ti.e., O.OlM ammonium acetate,
Fisher A637), pH 4 . 0 . The sample was applied to the
resin (l gm/20 ml resin) at a flow rate of 1 ml~min,
the column was washed with equilibration buffer until
the optical density leveled (e.g., approaching zero
optical density) and 200 ml of an ascending molarity
linear gradient (Pharmacia gradient mixer GM-l, #l9-
0495-Ol) was applied through a column flow adaptor of
.,,. ' ' ' :
W090/l4360 ~ ~ PCT/US90/02753
concentrations o.Ol to 1.O M ammonium acetate, pH 4Ø
In certain experiments, a second gradient was applied
to the same column. This second gradient ranged from
1.O M ammonium acetate, pH 4.0, to 50% acetonitrile in
1.O M ammonium acetate, pH 4Ø Two ml fractions were
collected in polystyrene tubes, 13 x lOOmm, (Columbia
Diagnostics; B2S64) in a SuperRac~ Fraction collector
(LKB 2211), equipped with an A type collection rack.
All column chromatography was performed with the aid of
a Vvicord S with a 280 nm filter (LXB 2138) and a sin-
gle channel recorder (LKB 2210). Fractions were ali-
quoted based upon optical density ranging from lOOul to1 ml, and assayed for tumor growth inhibitory activity.
b. ChromatoqraDhV usinq DEAE-TRISACRYL
~he chromatographic resin preparation and procedure was
performe~ exactly as described for CM- and SP-
TRISACRYL5 chromatography, except the equilibration
bùffer used was 0.1 M ammonium acetate, pH 6.0, the
gradient elution ranged from 0.1 M to l.o M ammonium
acetate, p~ 6.0, and the sample was equilibrated in the
above mentioned equilibration buffer.
~ er assav_for tumor qrowth inhibitorY activitY
Te~t cells were sub-cul~ured on 96-well tissue culture
plates ~Nunc 167008) in 50 ul of Dulbecco's modified
Eagle's medium (Whittaker M.A. Bioproducts 12-6143)
containing 10% fetal bovine serum (Whittaker M.A. Bio-
products 14-SOlB~, 2% L-glutamine (Whittaker M.A. Bio-
products 17-605-A~, 1% penicillin and 1% streptomycin.
~uman lung carcinoma cells, A549, and normal human
fibroblasts (HuF~ required a seeding density of 5 x 103
cells per well. Mink cells (ATCC: CCL 64) required a
.
. .
~Otl4360 2 ~ PCTtUS9OtO2753
- 45 -
seed~ng density of 4.5 x 10 cells per well.
Aliquots from column fractions to be assayed for tumor
growth inhibitory activity were transferred to sterile
12 x 75 mm tubes (Falcon 2058) containing 50 of micro-
liters lmg/ml solution of bovine serum albumin (BSA;
Sigma A-6003) in 1 M acetic acid and lyophilized.
Immediatetly prior to the assay, the lyophilized sample
wa~ resuspended in 400 ~1, for each cell type tested.
One hundred microliters aliquots of the resuspended
sample were added to wells containing test cells. Each
sample was assayed in txiplicate. The cells were incu-
bated for 72 hours at 37 in a humidified 5~ co2/9s%
air atmosphere. At the end of the incubation period,
each well was pulsed with 100 microliters of complete
medium containing 1 ~Ci/ml 5-[125I]Iodo-2'deoxyuridine
(12SIUdR) (New England Nuclear; NEX-072) for 24 hours.
The msnolayers were washed once with wash buf f er A
(Dulbecco's phosphate buf f ered saline, with 10 mM
MgC12, containing 1 mg/ml BSA, pH 6.8), fixed for 10
minutes in methanol (Fisher A452), and air dried for 15
ninutes. ~he 1251VdR incorporated by the cells was
solubilized with 200 microliters of 1.0 N NaOH and the
plates incubated for 20 minutes at 60 C. Solubilized
125IUdR was collected using the Titertek Supernatant
Collection System- (Skatron Inc., 7072). The a~ount of
cell growth is approximated by the extent of 125 IUdR
incorporated into the DNA of cells in t~e log phase of
growth. ~efore the assay was harvested each well was
observed using a Zeiss- inverted microscope to visually
note the amount of cell growth. Inhibition or stimula-
tion of growth was expressed as a ratio of 125IUdR
incorporated by test cells (e.g. human tumor cells)
containing the test aliquots relative to 125IUdR incor-
porated by the untreated control cells. The inhibition
..
. . .
', ,~ '
.
WO90/14360 20 ~ ~ J~ ~ PCT/US90/027~3
- 4fi -
or ~timulation observed by microscopie examination of
treated cells corresponded well with decreased or in-
creased incorporation of 1 5IUdR, respectively.
Characterization of TGI activities
a. Heat Treatment
One ml aliquots from fractions 2, 4, and 6 obtained
from gel filtration chromatography on Bio-Gel~ P-10,
were lyophilized in 12 x 75 mm polystyrene tubes (Fal-
con 20~4) and resuspended in 1 ml of 1.0 M acetic acid.
The samples were heated for 3 minutes in a boiling
water ~ath, lyophilized, and assayed for tumor growth
inhibitory activity as described above.
SDS-Polyacrylamide sla~ qel electrophoresis
Aliquots from samples from each chromatographic proce-
dure were lyophilized for electrophoresis. Samples
were diluted in 80 microliters of sample buffer con-
taining 0.1 M Tris-HCl (Sigma: T-1503), pH 6.8, 15%
glycerol (Xodak; 114-9939), 2% sodium dodecyl sulfate
tSDS) Bio-Rad; 116-0302), and 5% 2-mercaptoethanol
(Bio-Rad; 161-0710), and electrophoressed on a 5-20%
acrylamide linear gradient essentially as described
(~aem~li, U.K. (1970) Nature 227, 680-685). The sam-
ples were boiled for 2 minutes prior to application to
a 1.5 mm wide s}a~ gel in a Bio-Rad Model 155 Vertical
Electrophoresis Cell (BioRad~ 165-1420) under contant
current at 30 mA per gel for 4 hours tHoeffer power
supply; PS 1200 DC) at 9 C. Constant temperature was
maintained by a water-bath circulator (Haake, A81).
Gels were stained with 0.5% Coomassie Blue R250 (Bio-
Rad #16-0400) in 5.7% acetic acid and 47% methanol
:
- : : . ,. . . :
.. . :
: ~ -
2 ~
9~/14360 PCT/US9OtO2753
overnight and destained in the same solution without
stain. Specific gels demonstrating low concentrations
of proteins were restained by a silver technique as
described by Merril (Merril, C.R., Goldman, D., Sedman,
S. and Ebert, M.H. (1981) 211:1437-1438), (Bio-Rad
silver staining kit; #161-0443).
Results
Comparison of tumor qrowth inhibitorY activities from
10el filtration _ hromatoqraPhy on Bio-Gel P10 at room
temperature and at 4-C. The growth inhibitory activity
derived from acidified, ethanol extracts of human um-
bilical cords eluted by gel filtration chromatography
using Bio-Gel~ P10 resin with apparent molecular
15weights ranging from 5,000-16,000 daltons. Occasional-
ly, another peak of activity has been observed at mo-
lecular weights ranging from 3000-500~ daltons. The
molecular weight calculations are based on the elution
profiles of molecular weight standards (i.e., carbonic
20anhydrase - 29,000; ~Nase - 14,400; insulin - 6,000)
chromatographed on 1 liter of resin in a column of 4 x
100 cm. The elution profile derived from the column
and from the large 14 x 100 cm column were superimpos-
able. Acidified, ethanol extracts from human placenta
identically chromatographed demonstrated elution pro-
file~ very similar to the umbilical cord extracts.
Fractions 1 to 3 from the umbilical cord acidified,
ethanol extract are a very intense brown color; the
color gradually disappears as the fractions progress.
Fortunately, although (TGI) eluted in fractions 1, 2,
and 3 containing the highest protein concentrations,
the majority of activity extends past the observed
protein peaks as is clearly demonstrated in Figures 1
'"' ,'''' ' . . ~ -
- - . -. . ~ .. . ..
WO90/14360 2 ~ 3~l~ 3 i PCT/US90/02753
- 48 -
and ~. Extracts from human placental material showed a
greater overlap of TGI with the major protein peaks
than was observed with material from human umbilical
cords ~data not shown). Aliquots of identical volumes
from gel filtration chromakography electrophoresed by
5 SDS-PAGE on a 5-20~ polyacrylamide gradient also il-
lustrated that by fraction 4, considerably less protein
is found than in fractions l to 3. In fractions 5 an
6, major protein bands of 5,600 and 14,000 band are
observed and by fraction 7 very little protein remains,
although inhibitory activity extends into fraction l0
as shown in Figure 2. The obvious advantage of the
majority of activity eluting in regions of less protein
is that it facilitates further purification of TGIs.
A co~parison of Bio-Gel~ P-l0 chromatograms performed
at room temperature and 4'C, illustrated in Figures l
and 2, respectively, clearly indicate that inhibitory
activity is better preserved at 4-C. At 23-C, no ac-
tivity is observed past ~raction 6 (Figure l), while
at 4 C, activity is extended for 4 more fractions to
fraction l0. Most importantly, the net amount of ac-
tivity recovered is at least two-fold higher when ex-
tracts are chromatographed at 4 C, since 80% or more
tumor growth inhibitory activity is obtained in 7 frac-
tions at 4 C (Figure 2) and in only 3 fractions at23-C. This was not due to a concentration of the same
quantity of activity eluting in 3 fractions (23-C)
rather then being spread over 7 fractions (4 C), but
apparently to actual increase in the yield of tumor
growth inhibitory activity. One ml aliquots of frac-
tion 5 from both columns separately and dilutions of
these fractions to l/5 to l/125 were tested on both the
human lung adenocarcinoma (A549) and minX lung cells
(CCL 64) (Table l). The tumor growth inhibitory activ-
.. . . ...
. .
., - ~ ' ` ~ ,
~ 090~14360 2 ~ ~ b ~ ~ ~ PCT/US90/02753
- 49 -
ity ~f the undiluted fraction was 2-fold higher in the
fraction 5 obtained from chromatography at 4 C. More-
over, a 25-fold dilution of fraction 5 from chromatog-
raphy at 4-C continued to yield maximum tumor growth
inhibitory activity against the human tumor cell line.
A fraction of equivalent dilution from chromatography
at 23-C showed no detectable activity. A similar ob-
servation was made with the mink cell line. This in-
formation was not based on activities observed in Fig-
ures l and 2 but from two separate columns which demon-
strated equivalent TGI activities in their respectivefifth fraction.
,,
comparison of the effects of TGIs on normal human fi-
broblasts (HuFs) and transformed human lun~ carcinoma
cells_ (A549). Aliquots of fractions obtained from
human umbilical cord acidified, ethanol extracts chro-
matographed on a Bio-Gel~ P-lO resin, (4 C), were test-
ed for tumor growth inhibitory activity on human normal
and transformed cells as described in Materials and
Methods. As illustrated in Figure 3, tumor growth
inhibitory activity against human A549 cells (open
triangles) ranged from fractions 3 to 12, while these
same fractions induced as much as an 85% inorease in
growth stimulation of the normal human fibroblasts.
Thu~, the inhibitory activity is specific for human
tumor cell This observed inhibitory activity is not
due to cytotoxicity, as demonstrated by light micro-
scopic studies and indirectly by its stimulatory ef-
fect on normal human fibroblasts. The TGI's have pre-
viously been tested on "normal" epithelial derivedcells and simlar results were observed.
,
..
WO90/14360 2~ PCT/US90/02753
-- 50 --
TABLE 1
EFFECT OF TEMPERATURE ON THE REcOVERY
OF TUMOR GROWTH INHI~ITORY ACTIVITY FROM GEL
FILTRATION C~ROMATOGRAPHY
PERCENT INHIBITION
OF THE TEST CELL
TEMPERATURE OF COLUMN RUN 4-C 23-C
TEST CELL LINE
A549 (Human Carcinoma)
Undiluted 57 30
l/5 62 25
l/25 54 o
l/125 15 7
Mink lung tCCl 64)
Undiluted 9l 43
l/5 90 13 -:
l/25 70
l/125 ~l 2
One ml aliquots from gel filtration on fraction 5 (Fig-
ures l & 2) containing 120 micrograms were used to
as~ay.TGI activity.
Hlqh Performance liquid_chromatoqr~E~ (HPLC). TGIs
from acid ethanol extracts of hu~an umiblical cords
partially purified by gel filtration on a Bio-Gel~ P-lO
column followed by further purification using reverse
, .
.~.'~?90/t4360 2 ~ PCT/US90/02753
- 51 -
phas~ HPLC (yBONDAPAK0 C18 resin) inhibited the growth
of both A549 human carci~oma and an established mink
lung cell line, CCL 64, but did not inhibit the growth
of normal human fibroblasts. Figure 4 illustrates an
elution profile of the tumor growth inhibitory activity
obtained by HPLC using a linear acetonitrile gradient
of lyophilized fraction 4 (19.8 mg/3ml 0.05% triflur-
oacetic acid) derived from the Bio-Gel~ P-10 chromato-
graphic step.
Evidence of two distinct peaks of growth inhibitory
activities against both the A549 human carcinoma and
the mink cells were observed. The fractions eluting
between 28-34% (fractions 13-22~ acetonitrile and 35-
39% (fractions 25-31) acetonitrile were pooled sepa-
rately and rechromatographed on a C18 ~BONDAPAK~ column
using a linear gradient of 2-propa~ol.
The first peak of tumor growth inhibitory activity was
designated TGI-1 and the second 'r&I-2. Figure 5 demon-
strates the elution profile and tumor growth inhibitory
activity of TGI-l (Figure 4). The concentration of
injected material was 1.5 mg/1.5 ml of 0.05% trifluro-
acetic acid (TFA). TGI-l activity elutes between 17-
23% using a linear gradient of 2-propanol (Figure 5).
Similarly, Figure 6 indicates that TGI-2 (0.8 mg/1~8 ml
0.05% TFA) rechromatographed between 23-27% (fraction
17-23) using a linear gradient of 2-propanol. The
tumor growth inhibitory activity presented in Figures
4 and 5 are consistently 20% higher against the min~
cells than against the A549 human carcinoma cells.
Acid ethanol extracts of human placenta contained TGI
activities which, following a gel filtration chromato-
graphic step, also eluted between 26-34% acetonitrile
:
'~
WO90/1436~ 2 ~ PCT/US90/02753
of ~ Cl8 column using a linear acetonitrile gradient
containing 0.05~ TFA.
Ion exchanqe chromatoqraPhV. One ~ram of a lyophilyzed
acidified, ethanol extract of human umbilical cords was
directly subjected to ion exchange chromatography on
CM-TRISACRYL~ in 0.0l M ammonium acetate, pH 4Ø A
linear gradient was applied from 0.0l to l.0 M ammonium
acetate, pH 4Ø Figure 7 demonstrates at least 4
separate tumor growth inhibitory activities designated
CM-I, CM-II, CM-II, and CM-IV. CM-I was presently
inhibited only the A549 human carcinoma cells at 60%
inhibition (Table 2~. CM peaks II and III have similar
levels of growth inhibiting activity against both A549
human carcinoma (80 and 63%, respectively) and mink
cells (61 and 76%, respectively). The last peak of
activity (CM-IV) demonstrates a specificity in activi-
ty against mink (i.e. mink cells were more inhibited
(95%) than were the A549 human carcinoma cells (69%)).
CM-I was not retained and CM-II was slightly retarded
by the negatively charged resin since they both were
eluted before the gradient was sthrte~ ~y 0.0l M ammo-
nium acetate, pH 4Ø
Although all the proteins that have inhibitory activity
ara acidic proteins, since they are soluble at pH 4.0
and b~nd -to a negatively charged resin, peaks CM-III
~nd IV are probably slightly more basic since t~ey ~ind
more tightly to the CM-TRISACRY~ resin (eluting at
greater than 0.5M ammonium acetate). This is substanti-
ated by the fact that no TGI activity was retained by a
;
,. i .
: - :
- . . . : : ,
- . .
,~' ?90/14360 2 ~ PCT/~S90/02753
- 53 -
TABLE 2
TGI ACTIVITY FROM CATION EXCHANGE CHROMATOGRAPHY
PEAK OF TGI PERCENT INHIBITION
~CTIVITY OF T~E TEST_ CELL
A549 Mink
CM I 60 o
CM II 80 . 61
CM III 63 76
CM XV 69 95
Protein concentrations for the fractions tested for TGI
activity ranged from 15-300 ~g.
,
.
-,
.
WO90/14360 2 ~ 3~ 3 ~ i ~CT/US90/02753
- 54 -
posi~ively charged resin (i.e. DEAE-TRISACRYL~) (data
not shown). The ~ore acidic inhibitory factors appear
to be more specific for the A549 human carcinoma cells
in their respective activities. These 4 peaks of TGI
activities (CM-I, CM-II, CM-III, and CM-IV) have been
repeatedly observed (6 separate chromatographic proce-
dures with CM-TRISACRYL) To ensure that the tumor
growth inhibitory activities observed in CM-III and
CM-IY would not yield material that could be eluted
earlier from the column, and also to provide support
for the notion that each peak of activity is a separate
entity, material from CM-III and CM-IV was pooled,
lyophilized, and rechromatographed using CM-TRISACRYL~
under the same conditions as the column from which it
was derived. CM-III and CM-IV eluted (greater than 0.5
t5 M ammonium acetate) in exactly the same position as did
the original column fractions from which they were
derived (Figure lO). The higher tumor growth inhibito-
ry inhibitory activity against mink cells was preserved
and the di~ference between the inhibitory activity
against the two cell lines remained exactly the same at
2s-30~ around the peak of activity.
Physical and bioloqical characterization of tissue
derived tu~or cell qrowth inhibitor~ activitY (TGIs).
~5
Fractions 2, 4 and 6 derived from gel filtration chro-
matograpAy by Bio-Gel~ P-lO were either heat treated
(Table 3). All fractions tested retained tumor growth
inhibitory activity following either heat or acid
treatment (see Table 4). Fractions 2, 4 and 6 were
found to inhibit human cancer cell growth and stimulate
normal human cell growth.
. , . , .. . ~ . ,
', ';
. , ' . , .
-
O/14360 2t~i3~ PCTtUS90/n2753
- 55 -
TABLE 3
EFFECT OF HEAT TREATMENT ON TGI ACTIVITY
OF FRACTIONS FROM GEL FILTRATION CHROMATOGRAPHY
A549 MINK
. . _ . .
CONTROL AFTER HEAT CONTROL AFT~R
COLUMN PERCENT TREATMENT PERCENT HEAT
FRACTION INHIBITION PERCENT INHIBITION TREAT-
INHIBITION MENT
PERCENT
INHIBI-
TION
2 16 32 54 68
4 63 . 65 78 80
6 70 63 82 71
Protein concentrations for the fractions tested from
TGI activity ranged from 15-300 ~g.
Z5
-' , . .
. ' ", , ' ,: ,
.
WO90/1~360 ~ i PCT/US90/02753 ~!
- 56 -
TABLE 4
PHYSICAL AND BIOLOGICAL PROPERTIES OF TISSUE-
DERIVE~ TUMOR CELL GROWTH INHIBITORY ACTIVITY
(TGI)
Column Fraction
::
Fraction Fraction Fraction
Stable to l.0 M 2 4 6
acetic acid + + +
Stable to boiling at
100'C + + +
Inhibits human
cancer cells + + +
Inhibits ~ormal
human cells
~5
:
.-
~'~,,?90/14360 ~/~JU3~ L Pcr/usso/02753
- 57 -
Seco~d Series of ~xPeriments
Materials and Methods
Isolation of Tissue-Derived Tu~or Growth Inhibitors
(TGIs) From Tissue Extracts Depleted of Blood, Veins,
and Arteries
Veins and arteries were removed from human umbilical
cord tissues and thè remaining tissues were extensively
washed to remove blood prior to acid/ethanol extraction
as described under First Series of Experiments.
The buffer for washing and homogenizing the tissue
(PBS PA) consisted of 2 liters of water containing 16
gm NaCl, 2.5 gm Na2HP04.H20, 0.4 gm NaH2P04 7H20, 116
mg phenylmethylsulfonyl fluoride (PMSF) (Sigma P7627)
and 3.3 ml Aprotinin (Sigma A6012 with 19.8 units Try-
psin inhibitor per ml in 0.9~ NaCl and 0.9% benzyl
alcohol), adjusted to pH 7.4 with HCl and NaOH. The
extraction buffer consisted of 375 ml of 95~ (v/v)
ethanol (punctilious, 190 proof, U.S. Industrical Chem-
icals, #UN1170), 7.5 ml of concentrated HCl, 33 mg of
phenylmethylsulfonyl fluoride (PMSF) ~Sigma P-7627) and
1 ml of Aprotinin (Sigma A6012) mixed with 192 ml of
distilled water at 4 C. Eight hundred to one thousand
grams of frozen human umbilical cords (Advanced Bio-
technologie~-; stored at -80 C) were thawed by immer-
sion in PBS-P~ for two hours at 4-C. Individual umbil-
ical cords were removed and rinsed with P3S-PA. Veins
and arteries were removed from the umbilical cords by
dissection at 4-C. The dissected umbilical cord was
washed with fresh PBS-PA to remove residual blood and
vascular debris.
WO90/1436~ 2 ~ i PCT/US90/02753
- 58 -
The _tissue was placed in a 4-C chilled Cuisinart food
processor (Model DLC-7-PR0) and suspended in 200 ml of
4 C P~S-PA. The suspended tissue was homogenized by
the food processor. After the first minute of homoge-
nization, an additional 200 ml of 4C P~S-PA was added.
The tissue suspension was homogenized for a total of 10
min. at 4 C. The homogenate was transferred to 200 ml
centrifuge bottles (Sorvall) and centrifuged at 9000
rpm (RCF=13,000) for 5 minutes at 4'c in a Sorvall RC5B
centrifuge equipped with a Sorvall GSA rotor. The
supernatant fluid was removed and discarded and the
pellet resuspended to the original homogenate volume
with fresh PBS-PA.
The pellet was washed by repeated centrifugation and
resuspension as described until the supernatant fluid
was clear with no tint of red from contaminating hlood
or blood products. The resulting washed pellet was
white. The wa~hed pellet was resuspended in the buff-
er for extraction to a final volume of ~ ml per gram of
original dissected tissue. The homogenate was trans-
ferred to a large 4 liter beaker with a 3 inch stir ~ar
and stirred at half of the maximum stirring capacity
of a LAB-line Multimagnestir~ multimixer, Model #1278.
After o~ernight extraction with stirring at 4 C, the
ho~ogenate was transferred to 1 liter centrifuge bot-
tl~s (Sorvall) and centrifuged at 3500 rpm (RCF=3570)
for 30 minutes at 4-C in a Sorvall RC-3B centrifuge
equipped with a Sorvall H-6000A rotor. The supernatant
was transferred to a large 4 liter beaker and adjusted
to pH 5.0 with the slow addition of concentrated ammo-
nium hydroxide. With increasing pH, the supernatant
remained clear with a slight yellowish tint. A 2.0 M
solution of ammonium acetate, pH 5.2, was added in an
amount 1% of the total volume. Any precipitate formed
':
. :' -- : . . - .
090/14360 2 ~ 5 ~ PCT/US90/02753
- 59 -
by this step was removed by centrifugation at 4500 rpm
(RCF=5900) for 4 hours in a SorYall~ RC-3B at 4 C. The
supernatant was transferred to large 6 liter flasks to
which four volumes of anhydrous ether (-20 C) (Baker
#9244-3) and two volumes of 95~ ethanol (4'C) were
added. The mixture was allowed to stand undisturbed
at -20 C for 48 hours to allow the resu~ting precipi-
tate to settle.
At the end of the 48 hr precipitation, the material was
brought to a~bient temper~ture in a fumehood. Warming
of the acidified, ethanol extract to ambient temp~ra-
ture enhances the aggregation of the precipitate. The
clear organic phase of ether and ethanol was removed by
a water aspirator and the precipitate remained in the
fume hood for several hours to allow the residual or-
ganic phase to evaporate. A gentle stream of dried
nitrogen gas over the extract accelerated the evapora-
tion of the remaining organic solvent present with the
precipitate. The ~Idried~ precipitate was dissolved in
l.0 ~ acetic acid and dialyzed extensively against l.0
M acetic acid ~Baker #9507-5) using dialysis membranes
with a molecular weight cutoff of 3500 (Spectropor 3~,
Spectrum Medical Industries, Los Angeles, CA). The
dialyzed acidi~ied extract was lyophilized in 250 ml
Corning conical centrifuge tubes (Corning 25350~ and
stored as crude acidified, ethanol extract or dialyzed
extensively against 20 mM NH402C H , pH 4 5
Compari~on o~ tumor growth inhibitory activity in the
initial acid/ethanol extract from tissue prepared as
described in the First Series of Experiments with tis-
sue ~re~ared as described above.
WO90/l4360 2 ~ ~ ~ 9 ~ 1 PCT/US9~/02753
- 60 -
The _improvement in the specific activity and total
recovered activity seen when the tissue was prepared as
described above is shown in Table 5- The table com-
pares the yields of protein and tumor growth inhibitory
activity from frozen umbilical cord when it was pro-
cessed according to the procedures d~tailed in the
First Series of Experiment (hereinafter "initial pro-
cedure") and when it was processed as describe above
thereinafter "modified procedure").
There are several obvlous dlfferences in the two proce-
dures which are of importance for the subsequent puri-
fication of TGI. For example, based on the wet weight
of the tissue, acidified ethanol extraction by the
initial procedure resulted in the recovery of 0.33~ as
protein (3.~ g from lO00 g tissue) whereas only 0.015%
as protein (0.05 g from 340 g tissue) was extracted
when following the modified procedure. ~ecause the
yield of activity was 50~ greater (3.3 x lO6 units) by
the modified procedure than in the initial procedure (2
x lO6 units) from 66% less tissue (340g vs lO00~) the
overall efficiency of extraction was improved. The
initial procedure yielded 2000 units of tumor growth
inhibitory activity per gram of umbilical cord (wet
weight). The modified procedure yielded 9700 units of
tumor growth inhibitory activity per gram of umbilical
cord (wet weight). The overall efficiency of extrac-
tion was i~proved 5-fold by the modified procedure.
Furthermore, since less protein was extracted by acid-
ified ethanol, the volumes of ether and ethanol30 required to precipitate the extracted proteins are
less. Finally, the amounts of protein and the numbers
of different proteins extracted by the mod~fied proce-
dure are fewer and therefore the subsequent purifica-
tion procedures to be employed will require less chro-
.
', ~ , . -,
.
- - -, ',: .; ' ' '
'O90/14360 2 ~ L PCT/US90/02753
- 61 -
matographic materials, shorter processing times and
fewer steps to obtain a pure product.
Fractionation of TGI extracted usin~ the modified pro-
cedure on the cation exchange resin CM-TRISACRYL~ was
resolved as a single peak from the bulk of the applied
protein when the bound material was eluted by a linear
salt gradient from 0-1.0 M NaCl. Figure 9 shows that
following application of TGI to a CM-TRISACRYL column
no inhibitory activity was detectable from material not
bound to the resin (i.e., fractions 1-24). The linear
addition of increasing amounts of NaCl (- -) removed
the majority of protein bound to the resin (fractions
25-38) prior to the removal of significant amounts of
inhibitory activity ( - - - - - ) fractions 39-49).
The ~aCl concentration most effective in removing bound
TGI was approximately 0.6 M (fraction 44). Comparison
of Figure 9 with Figure 8 suggests that the inhibitory
activity eluted in the experiment of Figure 9 most
closely corresponds to the elution of CM-III and CM-IV
from the CM-TRISACRYL resin as depicted in Figure 7
since the salt concentrations (NaCl, Figure 9; NH402-
C2H3, Figure 8) for elution are similar ~0.6 M, Figure
- 11; 0.6-0.7 M, Figure 8). The above information also
suggests that treatment of the tissue by the modified
procedure allows the preferential isolation of a sin-
gle peak of ~GI, thus improving subsequent character-
ization of the factor.
Another property of the TGI extracted from the tissue
by ~he modified procedure is its failure to bind to
anion exchange resin. Figure 10 shows that following
adjustment of the pH to 8.0 as described in the figure
legend and application of the extract (an identical
amount to that used in Figure 9) to the anion exchange
. ,' . , ~
- .
WO90/14360 2 ~3 ~ ~ l PCT~US90/027~3
- 62 -
resin DEAE-TRISACRYL~ resulted in the majority of in-
hibitory activity associating with nonbinding material
(fractions 1-30), whereas the bulk of the applied pro-
tein (as determined by absorbance at 280 nm,
( -------- ) bound to the column resin. These results
show that under the conditions of Figure 10, contami-
nating proteins can be removed from TGI and, there-
fore, that it is a useful procedure for purification of
TGI. In addition, these results show that at pH 8.0,
TrI is a cation since it does not bind the anion ex-
change resin. Finally, the results of Figure lo show
that TGI as extracted by the modified procedure issimilar in ionic character to those polypeptides (TGI-
1, TGI-2, CM-I, CM-II, CM-III and CM-IV) extracted by
ion exchange resin in the initial procedure since none
of these bound to the anion exchange resin.
Large amounts of sample can be reproducibly fractionat-
ed by C~-TRISACRYL~, thus furnishing more TGI for sub-
sequent purification procedures. In Figure ll, 9.9 mg
of tissue extract were applied to a CM-TRISACRYL~ col-
umn (15 ml) under the same chromatographic conditionsas shown in Figure 10 for a smaller sample size ~2.65
mg protein) on a smaller CM-TRISACRYL~ column (5 ml).
Resolution of tumor growth inhibitory activity from the
~a~ority of proteinaceous material by a linear gradi-
ent of NaCl was essentially the same in both experi-
~ents.
Figure 12 shows fractionation of pooled`samples from a
CM-TRISACRYL column by HPLC on a ~BONDAP~K~ Cl8 column.
Following application of the ~ample, no significant
inhibitory activity was observed by linearly increasing
acetonitrile concentrations from 0-25%. However, tu-
mor growth inhibitory activity against both A549 (human
. : - ,
.
' -'. ' ` ' : ' : '
,
.. : ,
~ go/14360 2 0 ~ ~ 9 ,~ ~ PCT~US9OtO2753
~ 63 -
lung_carcinoma) and CCL 64 (mink lung, 0-0) eluted in a
single peak between 28-34% acetonitrile tfractions 21-
31) while the majority of material absorbing at 206 nm
was eluted at lower (fractions 11-19) and at higher
(fractions 37-50) acetonitrile concentrations.
An apparent molecular weight of TGI (ter~ed TGI-1 and
CM-III and CM-IV in the initial procedure) was deter-
mined by gel filtration chromatography (Sephadex G-50,
data not shown) using suitable protein standards of
known molecular weights. Thus, in the absence of cer-
tain interfering proteins (e.g., hemoglobin) the appar-
ent molecular weight of TGI has been determined to be
between 20 kDa and 30 kDa under nondenaturing condi-
tions.
The modified procedure detailed herein describes a
powerful and simple procedure for removing inert or
interferi~g compounds from the TGI extracts prepared
as described in the initial procedure. Furthermore,
the modified procedure improves the efficacy of the
various chromatographic steps employed in the isolation
of TGI by reducing the amount of chromatographic mate-
rials required thus reducing the preparation time of
TGI. In addition, and as shown, extraction of TGI
fro~ the umbilical cord as described herein allows TGI
and other protei~s to chromatograph more reproducibly
th~n in the procedure previously descri~ed.
TGI isolated according to the modified procedure has
been characterized with raspect to the chromatoqraphic
features on both reverse phase high perfor~ance liquid
chromatography and CM-TRISACRYL~ ion exchange chroma-
tography. TGI has been found to behave similarly to or
identically with TGI-l (compare Figures 5 and 12) by
. :- , . :
W09Ot1~360 2a~9'~ PCTJUS90/02753
- 64 -
RPHP~C, and thus has similar or identical hydrophobicproperties and is shown also to behave similarly to or
identically with CM-III and CM-IV (compare Figures 9
and ll) on a cation exchange resin, thus having similar
or identical ionic properties. It is therefore con-
cluded that TGI as isolated in the modified procedureand TGI-l and CM-III and CM-IV are si~ilar or identical
compounds having similar or identical ionic and hydro-
phobic properties and thus are of similar or identical
composition. Therefore, the modified procedure de-
scribed herein provides a more efficacious method ofobtaining a purer form of TGI for further analysis and
characterization.
Third Series of Experime~ts
. :
Material~ and Methods
Acidified ethanol extraction and ether/ethanol Precipi-
tation
The buffers and equipment used were exactly as de- ~ :
scribed in the second series of experiments, for each
relevant step in the procedure. Two hundred to four
hundred grams (200-400 gr.) of human umbilical cord,
e~ther di~sected free of vasculature or left intact and
chopped into l/2 inch pieces were washed free of the
majority of blood in PBS-PA at 4-C. The cord was
drained by gravity through a sieve and transferred to a
chilled food processor at 4-C for homogenization in a
maximu~ volume of 200 ml of PBS-PA. The tissue was
homogenized for fifteen minutes and washed free of
blood by repeated centrifugation in 200 ml plastic
bottles at 5,000 rpm using an RC-5B centrifuge
(Sorvall) equipped with a GSA rotor (Sorvall) for ten
' ''' ' ' : - , . ~ :
: -
~, . . . .
090/14360 ~ PCT/US90/0~753
- 65 -
minutes with PBS-PA, until the optical density at 280
nm was less than 0.05 and the pellet obtained, was
essentially white in color. The pellet was trans-
ferred to a 2 liter glass beakPr and suspended in ex-
traction buffer, as described in the first series of
experiments, at a final volume of 3 ml per gram of the
original wet weiqht of tissue and stirred for twenty-
four hours at 4C. The suspension was centrifuged in a
1.0 liter plastic centrifuge bottle using a RC-3B cen-
trifuge (Sorvall) equipped with a H6000A rotor
(Sorvall) for 30 minutes at 3,500 rpm. The resulting
supernatant was transferred to a 2 liter beaker and the
pH adjusted first to 5.0 with concentrated ammonium
hydroxide, and then to 5.2 by the addition of 2 M ammo-
nium acetate to a final concentration of 1% of the
total volume. The solution retained-- a clear or very
slightly yellow tinted appearance.
Following ether/ethanol precipitation, as described
previously, the supernatant was siphoned from the flask
to withi~ 3/4 of an inch above the bottom of the flask
containing the flocculent precipitate. The precipitate
and remaining ether/ethanol solution was centrifuged in
a GSA rotor at 5,000 rpm for 20 minutes in 250 ml plas-
tic conical bottles (Corning #25350) in a Sorvall RC-5B
centrifuge. This step in the procedure was designed to
decr~ase the loss of TGl's from the ether/ethanol su-
pernatants immediately above the precipitate. The
resulting pellet was suspended in 1.0 M acetic acid and
the flask containing the ether/ethanol precipitate was
also washed with 1.0 M acetic acid to remove any TGI
protein remaining on the wall of the f~as~. The opti-
cal density at 280 nm was between 0.5 and 1.0 and the
final volume did not exceed lOo ml for each prepara-
tion. The TGI containing protein solution was dialyzed
-. . . , :: . . .
- , - . . :~
WO90/14360 2 ~ S ~ PCT/VS90/02753
~ 66 -
for one day against 1.0 M acetic acid and for one to
two days against two changes of 4.0 M ammonium acetate,
pH 4.5 using dialysis mem~ranes with a molecular weight
cutoff of 3,soo (Spectropor 3).
It should be noted that tumor growth inhibitory activi-
ty can also be o~tained from acidified ethanol extrac-
tion of the tissue with omission of the ether-ethanol
precipitation step. However, the specific activity of
these preparations is 50~ less and the total yield of
activity 10-30~ less than "standard" preparation uti-
lizing the ether-ethanol precipitation.
HYdro~hobic Interaction Chromato~raphv
The dialyzed protein was subjected to hydrophobic in-
teraction chromatography using phenyl-Sepharose~ (Phar-
macia) as the chromatographic resin. The phenyl-Sepha-
rose- was equilibrated with 4.0 M ammonium acetate, pH
4.5. Following dialysis (at least 24 to 48 hours), the
conductivity and p~ of the protein solution was mea-
sured and dialysis terminated when the conductivity ofthe dialysate and equilibration buffer were the same.
The protein was pumped onto (Microperplex~ pump #2132 -
LRB) the resin contained in a 1.6 x 2.0 cm chromatogra-
phy column (K-20-Phar~acia) using 1 ml of resin per
2.0 mg of protein, at l.0 ml per minute. The column
was washed until the OD280 was zero and tumor growth
inhibitory activity eluted from the co}umn using a
decreasing gradient from 4.0 M to 0.04 M ammonium ace-
tate, pH 4.5 containing an increasing concentration ofethylene glycol (~allinkrodt~ from 0 to 50~. The total
volume of the eluting gradient was lO times the total
volume of the resin used for each individual prepara-
tion. The bound protein was eluted over approximately
' ', .
90/l43~0 2 ~ PCT/US90/02753
- 67 _
fift~ fractions. Ten microliters of sample were trans-
ferred to a plastic tube (polystyrene) containing 50
micrograms of BSA, for assay of inhibitory activity
against both the mink CCL 64 and A549 cell lines, as
described in the first series of experiments.
As seen in Figure #13, the tumor growth inhibitory
activity began eluting from the column at 1.5 M ammoni-
um acetate, 31% ethylene glycol and was completely
eluted from the column by 40 mM ammonium acetate and
50~ ethylene glycol. The biologically active fractions
were pooled, dialyzed against 0.1 M acetic acid, and
lyophilized in a polypropylene 50 ml tube (Scientific
Products #C2390-50) or siliconized glass lyophilization
flask (Virtis).
Reverse Phase Hi~h Pressure Liquid Chromatoqraphy
The lyophilized bioloqically active material was dilut-
ed in 1.0 to 3.0 ml of 0.05% trifluoracetic acid (TFA)
containing 10% acetonitrile, placed in a 16 x 100 mm
siliconized disposable glass tube, sonicated for two
minutes, centrifuged at 3,000 rpm for 10 minutes (Beck-
man Model TJ-6) to remove insoluble material, and sub-
jacted to reverse phase, high pressure liquid chro-
matography (RP~PLC) using a ~80ndapak0 C18 resin (Waters
Assoc. 0.39 x 30 cm, P~ 27324). No more than 1 mg of
TGI was applied to each column such that the number of
column procedures necessary for each preparation de-
pended on the total protein concentration of the active
fraction obtained following chromatography by phenyl-
SQpharose. This amount was approximated at OD280 usinga value of 1.0 optical density units equal to 1.0 mg/ml
of protein. The protein was eluted from the column, at
1.0 ml per minute in a stepwise, gradient fashion us-
.
. . ,. -
,' ,
.~; , ': . '
.
--
WO ~/14360 ~ Q ~ PCTtUS90/02753
- 68 -
ing -100% acetonitrile containing 0.05% TFA as the
eluting mobile phase. The gradient was increased to
25% acetonitrile (cH3CN) in 15 minutes, eluted for 10
minutes at 25% (CH3CN), increased to 27% in two min-
utes, 17% for 10 minutes, increased to 28% in two min-
utes, 28~ for 10 minutes, increased to 30~ over 10
minutes, resulting to 44% in 10 minut~s, and to 100% in
10 minutes. The absorbance of protein was monitored at
210 nm and 0.005 ml aliquots were removed from every
other 1.0 ml fraction to assay for tu~or growth inhibi-
tory activity against both CCL 64 and A549 cell lines.
Tumor growth inhi~itory activity eluted initially at27% acetonitrile and continued to elute at 28-30% ace-
tonitrile as shown in Figure #14A & 14B. At every step
in the purification, the biologically active fractions
were pooled and subsequently assayed for total tumor
growth inhibitory activity by removing an aliquot and
multiplying the activity obtained in the assay by the
appropriate dilution factor. The quantity of tumor
growth inhibitory activity present in the pool was
compared to an aliquot of starting material. Thus,
column recoveries of activity and protein (where mea-
surable) could be obtained.
The area designated with arrows (fractions 47-51) in
F$gure 14A derived from two seP-arate C18 chromatograph-
ic procedures (derived from one phenyl-Sepharose col-
u~n, from one isolation) was pooled and subjected to
SDS-PAGE both under non-reducing conditions (Figure
15A) and in the presence of 0.5% ~-Mercaptoethanol
(reducing conditions) tFigure 15B). This area of the
chro~atogram (Figure 14A) de~onstrated the highest
biological activity and lowest amount of contaminating
proteins (highest specific activity and lowest absor-
bance at 210 nm). Experimental ~etails of SDS-PAGE are
.
.
.
:; :
' - ; .: ': .,
90/l4360 PCT/US90/027~3
- 69 -
repQrted in Figure #15. In lane 2, under non-reducing
conditions (Figure 15A), the biologically active frac-
tions are shown to contain at least 4 major proteins
bands. Lanè 1 contains a purified preparation of TGF-~
derived from platelets (provided by Bruce Magun, Oregon
State Health Science University, Portland, Oregon).
The bioloqical activity that has been ascribed to this
protein is the ability to confer anchorage independent
growth to normal rat kidney cells (NRK) in a soft agar
assay, only in the presence of a growth factor, such as
EGF at 2.0-2.5 ng/ml. ~hus, its growth promoting ac-
tivity is directly dependent on other bioactive pro-
teins (Roberts et al., Cold Spring Harbor Conf. Cell
Proliferation, 9: 319-332 tl982)); Anzano et al., Anal.
Biochem. 125: 217-224 (1982); cancer Research 42:
4776-4778 (1982).
In our assay for tumor growth inhibitory activity, TGF-
was shown to posses 1-30 units of inhibitory activity
per ng of protein. By comparison it appears that one
of the protein bands in the TGI preparation Figure 15A
(lane 2) also migrated in the same position of approxi-
mately Mr ~ 25 kDa as the TGF-~ , (lane 1). The same
samples electrophoresed in the presence of 5% ~-
morcaptoethanol, showed that the protein band that had
migrated at Mr 26 kDa disappeared and a new band was
evident at approximately 12.5 kDa Figure 15B (lane 2).
TGF-~ Figure 15B (lane 1 also changed its migratory
po~ition to 13 kDa following reduction. All other
proteins in the TGI containing sample remained in the
same position of migration and thus were insensitive to
reduction. The units of inhibitory activity applied to
the gel for each sample was approximately l,Ooo-1,500
(50 ng) for TGF-~ in lane 1 and 10,000 to 20,000 for
TGI in lane 2 (Figure 15A & B).
.
`' ' ' ' ' ' ` ' : ~
WO~0/14360 2 o r3~ ~ ~ i PCT/US90/02753 ~
-- 70 --
Further purification of the TGI biologically active
fractions derived from the RPHPLC C18 chromatographic
procedure was accomplished by RPHPLC using a CN
~BONDAPAK~ column (0.39 x 30 cm Waters PN 84042) (Figure
#16)~ The biologically active fractions were lyophi-
lized in 16 x 100 mm siliconized glass tubes, dissolved
in 1.0-3.0 ml 0.05% TFA containing 10% propanol and
applied to the column. Column elution was achieved at
1.0 ml/minute by using a linear gradient of 2-propanol
from 10 to 20% in ten minutes, followed by 20 to 50% in
fifteen minutes (0.6% /min.), and finally from 50-100%
in 20 minutes.
Iodination of BioloqicallY Active Fractions for AnalY-
sis by SDS-PAGE
Active, lyophilized fractions 56, 58, 59-65, 66-68,
illustrated in Figure #18, and approximately 4 ng of
TGF-~ were iodinated by the chloramine T method
(McConahey, P.J. and Dixon, F.J. (196~) Int. Arch. of
Allergy 29, 185-189). Each fraction was resuspended in
100 microliters of 0.1 M acetic acid, and 3 microliters
of 1.5 M Tris, pH 8 . 8 was added to adjust the pH to
7Ø Ten microcuries of carrier-free sodium iodide
I125 Na was added, followed by 2 microliters of chlora-
mine T (Sigman #C9887) at 1.0 mg/ml. The tube wasrocked for one ~inute and the reaction term~nated by
t~e addition of 2 microliters of sodium metabisulfite
(Sigma #S9000l at 1.0 mg/ml. After two minutes 0.05 ml
of each sample was transferred to a siliconized glass
tube (10 x 75 mm) containing 0.05 ml of twice concen-
trated sample buffer plus 5% ~-mercaptoethanol for SDS-
PAGE slab gel electrophoresis.
, . ~, ,. ' ,~
.
.
2 ~
~O90/~4360 PCT~US90/02753
~ .~
- 71 - :
The ~emainder of the sample was diluted in 0.05 ml of
twice concentrated sample buffer and approximately
200,000 TCA precipitable radioactive counts were ap-
plied to individual lanes for SDS-PAGE, Figure #17).
The gel was stained with 0.125% Coomassie Blue for 10
minutes to fix the protein in the gel, and exhaustively
destained to remove free radioactive iodine. When the
destain solution did not contain detectable label as
judged by counting 1.0 ml of destain solution in a
gamma counter (Beckman, Riagamma #1294), the gel was
dried using a gel dryer (Hoeffer-SE1150) and exposed to
x-ray film (Kodak-XAR) for autoradiography (one week).
All lanes to which biologically active TGI was added
contained a faint band of protein migrating at Mr 24
kDA. This protein band also migrated directly in a
horizontal plane with the Mr 26 kDa band in lane 7
containing 256 inhibitory units of TGF-~ derived from
platelets (Figure #17, lane 7 arrow).
In lanes 1, 2, 3 and 5 containing approximately 180,
2,000, 46 and 408 units of tumor growth inhibitory
activity respectively, the Mr 25 kDa band was observed
while lanes 4 and 6, which did not possess tumor growth
inhibitory activity, did not contain this protein band.
LanQ 2, which contained the most active fractions (from
Figure 16), showed two faint bands at Mr 26 kDa and 30
kDa. Lane 3 appears to have only one band of Mr 26
kDa.
Following the last step of purification of TGI, protein
concentration could not be measured because it was
below the detection level using standard means of mea-
surement. There~ore, the bands migrating at Mr 26 kDa
(from lanes 2, 3 and 7) were excised from the dried gel
,..
WO90/14360 2 ~ PCT/US90/027~3
- 72 -
and eounted in a gamma counter in order to extrapolate
the protein concentrations applied in lanes 2 and 3.
Since it was known that 0.4 ng of TGF-~ was applied to
the gel which had 5,593 cpm at Mr 26 kDa, then 362
(lane 2) and 195 (lane 3) cpm at the position of 26 kDa
equals 26pg and 14pg, respectively. These calculations
assume that the number of tyrosines and extent of iodi-
nation of each tyorsine were the same.
Although the presence of the Mr 26 kDa band was consis-
tent with the presence of tumor growth inhibitory ac-
tivity (Figure 17), the quantity (units) of activity,
especially in lane 2, did not correlate with the amount
of TGF-~ protein, as judged by the intensity of iodina-
ted protein applied to the gel (0.4 ng). Thus, TGI
demonstrated at least one log more inhibitory activity
than TGF-~.
Since a broad peak of activity was o~tained by RPHPLC
C18~ chromatography, Figure 14A; and in Figure 14B it
appeared that there may be two peaks of activity, one
at 27% and at 28-30~, the area designated by these
separate peaks were pooled and chromatographed sepa-
rately by RPHPLC using a CN column. The slope of the
propanol gradient was changed so that the increase in
increments of 2-propanol was 0.375% per minute, instead
of 0O6% per minute. The shallow gradient was devised
to ac~ieve a better separation of active proteins elut-
ing between 40-45% 2-propanol.
Flgure #18 illustrates the elution profile of the CN
column of active fractions pooled at 27% acetonitrile
(Pool I) from the previous C18 column. The most active
fraction (fraction #14) eluted at 40-41% 2-propanol. A
lower amount of activity was seen eluting after this
- . ''~' ~ . ' '
90/14360 2 0 ~ ` i PCT/US90/027~3
- 73 -
pe~k~ as a double peak at approximately 44% 2-propanol.
Similarly, rechromatography of the active material
derived from the peak of activity pooled at 28-30
acetonitrile (Pool II) from the C18 column, demo~strat-
ed pea~ of activity corresponding to the elution from
the CN colu~n at 44~ 2-propanol (Figure #19). The
first pool (Pool I) of activity eluting at 27% acetoni-
trile contained some active material from Pool II elut-
ing at 28-30~ acetonitrile, thus a small quantity of
this peak of activity was reveal~d in the chromatogram
of Pool I at 40-41~ 2-propanol (Figure #18). Most
significantly the further purification of TGI has per-
mitted resolution of two major peaks of TGI activity,
eluting at 40-41% for Pool I and 44% for Pool II.
Pool I from the C18 column contained 82% more total
inhibitory activity than Pool II.
Figure #20 is a tracing of the peaks of activity fro~
the two separate chromatographs Figures 20 (Poo~
and 21 (Pool II). This figure (#20) illustrates two
distinct peaks of inhibitory activity as the different
active fractions from the C18 column Pool I and Pool
o II.
2S It wa~ found that preservation of TGI biological activ-
ity ~ollowing chromatography through the C18 column wasbetter achieved if the active fractions were not lyoph-
ilized prior to CN chromatography. Therefore, the
sampleR were concentrated by partial lyophilization
(not to completion) and stored at -20-C.
- . .
- ' . ~ ~ ' ' .
,
WO90/14360 2 ~ i PCT/US90/02753
- 74 -
II. Tumor Growth Inhibito~y~ r~ r~m~ ~e Con-
ditioned Media of Varlous Tumor Cell Lines
Effect of ~ithiothreitol on TGI Activity from Tumor
Cell Conditioned Media
S
Human tumor A431 (epidermoid carcinoma), A673
(rhabdomyosarcoma) and T24 (bladder carcinoma) cells
were grown to confluence on T150 (150 cm2) flasks in 20
ml of complete growth medium containing DMEM supple-
mented with 10% fetal bovine serum. The confluent
monolayers were rinsed twice with Dulbecco's phosphate
buffered saline and incubated in 10-12 ml serum-free
DM~M per flask for 24 h. Conditioned media (100-115
ml) was collected from 1-4 x 108 cells.
An erythroleukemia cell line, K562, was grown in sus-
pension to a cell density of 106 c~lls per ml and one
liter of serum-free conditioned media was collected.
Cellular debris was removed from the conditioned media
(RC-5~ GSA rotor-Sorvall) by centrifugation at 800 rpm
for 60 min. at 4 C. The supernatant was treated with 1
ml of 1 M acetic acid per 100 ml of conditioned media,
extensively dialyzed in Spectropor 3 dialysis tubing
(Spectrum Medical Laboratories) aqainst multiple chang-
es of 1 M acetic acid, and lyophilized. The lyophi-
liz~d, acid-treated conditioned media was resuspend~d
in 4 mm HCl at a volume of 5.0 ml for A431, A673 and
T24, and 1.5 ml for K562 derived media. Insoluble
material was removed by centrifugation in a RC-5B cen-
trifuge (Sorvall, SA 600 rotor) at 3400 rpm for 15 min.
at 4-~ ~nd the supernatants transferred to 1.5 ml
microfuge tubes. Following centrifuga~ion in an
Eppendorf microfuge for 15 min. at 4 C, the superna-
tants were transferred to 1.5 ml microfuge tubes for
~. .. . ,,
- :
.~
~, .- , .. .. . ..
090/14360 ~ PCT/US90/027~3
- 75 -
sto~ge at -20-C. Protein concentration was determined
by absorbance at 280 nm. The tumor growth inhibitory
activity of individual samples was tested for sensitiv-
ity to reduction by dithiothreitol (DTT). An aliquot
each of 0.5 ml was transferred to two tubes contalning
4.5 ml of 0.l M N~4~C03. One tube received a final
concentration of 65 mM DTT, and both tubes were incu-
bated for 2 hours at room temperature. The incubated
mixture was then transferred to Spectropor 6 dialysis
tubing and dialyzed against 1 M acetic acid for 2 days
to remove DTT. The dialyzed samples were then assayed
for tumor growth inhibitory activity as described in
initial procedures. The effect of DTT on TGI activity
derived from conditioned media from the A43l, A673,
R562 and T24 cell lines using min~ cells, CCL 64, and
A54g cells as target cells is summarized in Tables 6
and 7, respectively. The table shows the tumor growth
inhi~itory activity from conditioned media from A673,
K562, and T24 against both mink and A549 cells was lost
following reduction (Table 6), whereas the tumor growth
inhibitory activity from the cond~tioned media of A431
cells, which showed preferential inhibitory activity
against A549 cell, was o~ly slightly reduced following
reduction (First column, Table 7).
., .
- '
W090/l4360 2 ~ ~3~ ~ 8 ~ PCT~US90/02753
- 76 -
ReveEse Phase HPLC of A431 Conditioned Media
Lyophilized conditioned media from 4 x 108 A431 cells
(110 ml) was processed as previously described, except
5.0 ml of 4 mM HCl was used to solu~i~ize the lyophi-
lized material. The insoluble precipitate was removedby centrifugation as described and protein concentra-
tion determined. An aliquot of 0.2 ml (680 ~g protein)
was added to 1.8 ml of 0.1 M ammonium bicarbonate or
this same buffer containing 65 m~ DTT. Following incu-
bation for 2 hours at room temperature, both the re-
duced and non-reduced samples were lyophilized and
resuspended in 2.0 ml of O.OS% trifluoroacetic (TFA)
for RPHPLC. Following injection onto a C18 semi-pre-
parative column, the proteins were eluted at 1.0 ml
per minute using a linear gradient of acetonitrile from
0-50% in 50 minutes. An aliquot of 1.0 ml was removed
from each 2.0 ml fraction to assay for growth inhibito-
ry activity against both mink and AS49 cell lines as
described in the initial procedures. Figure #21 illus-
trates that there are two peaks of inhibitory activity,
one that elutes at 25~ acetonitrile, which inhi~itsboth CCL 64 and A549 cells, and one that elutes at 30-
36~ acetonitrile, which shows preferential inhibitory
activity toward the A549 cell line. Following DTT
2S treat~ent (Figure 22), the first peak of activity (25%
acetonitrile) is no longer present, while the activity
that is selective for A549 cells retained activity.
Conclusions frcm the "Third Series of ExPeriments"
I. It was already demonstrated by the Second Se-
ries of Experiments referred to as the "modification
procedure" that removal of blood and vasculature from
umbilical cord yielded approximately a 100-fold in-
.,
~.
: ~90/l4360 2 Q ~ ~ 3 3 ~ PCT~US90/02753
77 -
crease in specific activity of the TGI over First Se-
ries of Experiments (Table 5). In the Third Series of
Experiments, referred to as "alternate procedure", it
was shown that onlY removal of blood, but not the vas-
culature was necessary to o~tain TGI with the same
average degree of specific activity as indicated by the
Second Series of Experiments. In fact, the vascular
tissue from umbilical cord, dissected free form the
stromal tissue, demonstrated tumor growth inhibitory
activity of similar activity to the umbilical stromal
tissue alone (data not shown). It was further shown
that tumor growth inhibitory activity could be
recovered without ether/ethanol precipitation of the
extracted material.
The volume of acidified ethanol per gram of tissue used
for extraction was 50% less than described for both the
initial procedure and modified procedure. Thus, the
total volume of extracted protein was less, therefore
requiring l/2 the amount of ether and ethanol used for
precipitation. This minimized the amount of protein
that would remain on the flask walls. Moreover, the
amount of l.0 M acetic acid necessary to dissolve the
precipitate and wash the flask was smaller so that
final volu~es were kept to a minimum. The obvious
advantage is the minimization of protein/activity loss,
thereby creating a more efficient method of extraction,
including l~ss reagents required. Also, choppi~g
whole cord rather than dissecting cord shortened the
tedious preparation time considerably. The average
specific activity of the final preparation derived
from 200-400 grams of umbilical cord (wet weight) prior
to further purification by chromatographic techniques
was approximately 1-3.0 x 106 units~40-So mg (see Table
8).
- . .....
:
W090~14360 2 ~ r ~ ~ ~ i PCT/US9OtO2753
- 78 -
Thes~ results are within the range of the experimental
results reported for the "modified procedure" and
therefore, represent the same range of improvement in
protein recoveries and specific activities compared to
the initial procedure (Table 5 ) . Thus, the overall
efficiency of extraction was improved approximately 5-
fold as reported in the "modified procedure".
Table 8 summarizes the current procedure utilized to
obtain active TGI from human umbilical cord. Between
60 to 100% recovery of units af activity was observed
through the first two steps of purification (HIC and
RPHPLC on C18). This represents a 40,000 increase in
specific activity of 1. x 106 units/microgram. (2.3 x
10~ total units from 300 g wet umbilical cord~. It was
observed that contaminating proteins probably aided in
the stabilization of biological activity of TGI, be-
cause as the purification ensued, activity became more
labile. The greatest loss of recovery occurred follow-
ing lyophilization of the active fraction obtained
2~ after RPHPLC on the C18 column. This greatly reduced
the total number of units applied to the CN column in
the final step of purification. This loss was amelio-
rated by concentrating the acti~e fractions by lyophi-
lization, but not to completion. ~he recovery of units
from this final step of purification was between 60-
100%.
Previously in the "initial procedure", chromatograms
varied foremost of the preparations, thus, causing
difficulty in devising subsequent steps for improve-
ment. The current methodology descri~ed in both themodified and alternate procedure demonstrate reproduc-
ibility of all chromatograms, yields of proteins, and
yields of activity at each step, utilizing material
: ' - : ;:' -
, . . .
,: . : -
~.
90Jl4360 PCT/~S9~/02753
- 79 -
derived from individual umbilical cord preparations.
This improvement is a direct result of the removal of
hemoglobin (denatured), before acidified, ethanol ex-
traction, and the more efficient removal of other con-
taminating proteins during the first chromatographic
step using phenyl-Sepharose.
~he use of hydrophobic interaction chromatography (HIC)
using phenyl-Sepharose as the first chromatographic
step in the purification procedure proved to be a major
improvement in overall yield of activity ttotal units)
and specific activity (units/mg). Following ion ex-
change chromatography by CM-Trisacryl~, a specific ac-
tivity of 4.2 x 104 units per mg was ~btained, while
phenyl-Sepharose chromatography produced TGI with a
specific activity of 1.07 x 106 u/mg. At this step,
phenyl-Sepharose chromatography introduced approximate-
ly a 20-fold purification into the procedure. However,
the TGI containing protein obtained by phenyl-Sepharose
chromatography demonstrated 26 times greater specific
activity than TGI containing material derived from CM-
Trisacryl chromatography.
Experiments have been devised to improve the overall
yield (inhibitory units) and specific activity of the
TGI-containing protein so that there would be adequate
biologically active material present to subject the
protein to as ~any steps necessary for purification to
ho~ogeneity. Both the removal of blood in the "modifi-
cation procedure" and the use of phenyl-Sepharose chro-
matography in the "alternate procedure" have aidedgreatly in accomplishment of this goal. T~e introduc
tion of phenyl-Sepharose chromatography into the puri-
fication procedurè has provided material wi~h higher
specific activity (1-2 x 105 units/microgram) which
,
,
WO90/14360 2 ~ 3 ~ ~ 3 i PCTtUS90/02753
- ao -
per$~tted further purification of a minimal amount of
starting material (wet tissue weight) and requiring
less steps toward the final purification to homogene-
ity. One peak of TGI activity, eluting at 1.5 M ammo-
nium acetate, 37~ ethylene glycol, was obtained follow-
ing phenyl-Sepharose chromatography (Figure 13). This
was also a major improvement in the isolation of TGI in
the "modification procedure" using CM Trisacryl0, com-
pared to the initial procedure (Figure 7).
Another improvement introduced into the purification of
TGI's by the "alternate procedure" was the use of a
stepwise elution by acetonitrile from C18 ~P~HPLC (Fig-
ure 14A ~ 14B) rather than a linear gradient used in
the "initial and modification procedures" (Figure 12).
Elution of the column in this fashion allows approxi-
mately 90% of the biologically inactive contaminants to
be separateq from the major peak of activity. Of most
significance is that two hundred to four hundred grams
of wet cord material provides sufficiently less protein
following chromatography on phenyl-Sepharose, to apply
the entire preparation to a maximum of three and a
minimum of two RPHPLC C18 and analytical columns using
no more than 1.0 mg for each (Figure 14A ~ 148).
me ability to obtain larger quantities of a more high-
ly puri~ied biologically active protein following
RPHPLC on a C18 resin is directly related to the isola-
tion of tumor growth inhibitory activity of hi~h spe-
cific activity from phenyl-Sepharose chromatography.
Following chromatography by C~-Trisacryl0 (modification
procedure), only 20% of the total biologically active
fraction could be subjected to one RP~PLC (C18), while
generally 50% of the total biologically active, pooled
fraction from phenyl Sepharose chromatography could be
, -. . . ,, :
,~
:, - . .
90/14360 ~ 3 ~ PCT/US90/02753
- 81 -
applied at one time to a C18 column. In these individ-
ual comparative experiments, the starting material for
chromatography using CM TRISACRYL~ was 9.9 mg and for
phenyl-Sepharose was 4~ mg, thus if the same amount of
starting material was used for CM-TRISACRYL~, only 4.7%
5 of the total preparation could have been utilized in
the following C18 ctep. Because a greater amount of
inhibitory activity could be applied to the C18 column,
100 times less sample (0.005 ml compared to 0.5 ml),
was used to achieve the same degree of inhibitory ac-
tivity. At this point in the procedure, the most bio-
logically active fractions were resolved into six major
protein bands by SDS-PAGE using silver stain.
Following HPLC on the C18 column, protein concentration
5 could not be determined because the amount of avail-
able protein was below the resolution of standard tech~
niques (OD280 or Lowry). Thus, it was assumed that
protein concentration was less than 20 micrograms/ml.
To further purify TGI, the active fractions were
pooled, lyophilized and applied to a RPHPLC CN column.
Using a 2-propanol gradient of 0.6% increase in solven~
per minute, the activity was shown to be displaced to
the right of most of the protein (Figure 16). Various
active fractions were iodinated and separated by SDS-
PAGE. The fractions demonstrating the most biological
activity ~Figure 16, Fraction 59-65) illustrated in
lane 2, contained two isotopically labeled bands, one
of 25 kDa and one of 30 kDa and in lane 3 fractions 66-
68 contained a homogeneous band at 25 kDa. Fraction
#58 lane 7 is active but contains at least 5 bands.
Fraction #56 which is the major peak of protein and is
not biologically active contained all of the protein
bands in fraction #58 except that 26 kDa band tFigure
17, lane 1).
: ~ :
. . .
. . . : , . :
WO90/14360 2 ~ ~ ~ 9 ~ 1 PCT/US90/02753
- 82 -
Three major conclusions can be deduced from the gel
presented in Figure 17- One, a 26 kDa protein is al-
ways present in fractions containing biologically ac-
tive material and similarly it is always absent in
fractions that are not biologica~ly active. Two, the
TGI demonstrates a similar qualitative activity to an
ubiquitous protein derived from platelets and other
tissues designated as TGF-~ , in that it migrates by
SDS-PAGE as a protein of Mr 25 kDa as shown in Figures
15~ and Figure 170 Three, the active fractions demon-
strating the most biological activity in Figure 17,
lane 2, (2,068 units), does not compare intensity
(iodinated protein) to the appearance of the 25 kDa
band for TGF-~ , observed in lane 7 containing 256
units of inhibitory activity. This implies a quantita-
tive difference in specific activity.
The use of a stepwise gradient elution from the C18
column with acetonitrile resolved two peaks of activi-
ty, one eluting at 27% and one at 28-30% (Figure 14A &
14B). Following the combination of individual frac-
tions into two separate pools, Pool I (27%) and Pool
II (28-30%), from a column demonstrating a similar
profile as shown in Figures 14A & 14B, the pools were
applied to a ~PHPLC CN column using a more shallow
gr~d~ent than shown in Figure 16 (0.37%Jmin. compared
to 0.6%/min.). Pool I eluted at 40-41% 2-propanol
(Figure 18) and Pool II at 44% 2-propanol (Figure 18).
It is important to note that, as expected, the more
hydrophobic protein eluting from the Cl~ column (Pool
II) continued to elute more hydrophobically from the CN
column. Thus, two distinct peaks of growth inhibitory
activity have been obtained using the "alternate proce-
dure" of protein purification. The first peak of ac-
:
.. .... i ,
.:. -. . :
..
-,
~ ' . ' -
D90/14360 2 0 ~ o 9 $ ~ PCT/US90/02753
- 83 -
tivi~y, Pool I, contains 82~ more inhibitory units than
Pool II.
A purified protein, derived from platelets, designated
as TGF-~, is biologically active in our inhibitory
assay but consistently possesses l0-l00 fold less ac-
tivity than Pool I. Since activity in all cases, Pool
I, Pool II, and TGF-~ is consistent with presence of a
protein band of Mr 26 kDa (Figures 15 and 17), on~ can
assume that all these proteins may be similar or belong
to a family of growth inhibitory and/or growth modulat-
ing proteins. Alternatively, because of the differen-
tial elution of these proteins on both C18 and CN res-
ins, and the greater specific activity of the TGIs, the
TGIs may be entirely different than TGF-~ ~elevation of
TGF-~ profile not shown). Further biochemical charac-
terization tamino acid sequencing) should resolve this
question. In conclusion, it appears that the TGI's are
better than (inhibitor activity) and different from
(eluting position) TGF-~ derived from platelets used
for comparison by this study.
The conditioned media from A431 contained two types of
growth inhibitory activity. One TGI elutes at approxi-
mately 25~ acetonitrile and inhibits both A549 and CCl
64 mink cells. The selectivity of inhibition of this
TGl i~ similar to what is observed for TGI-l and TGI-2
in human umbilical cord extracts. The second TGI elut-
ing between 30-36% acetonitrile shows a greater speci-
ficity ~or inhibiting A549 cells over mink cells.
.'10
Applicants presently contemplate a family of discrete
entities which share certain common characteristics.
Each family member is a polypeptide dimer, bound by
disulfide bonds, with a molecular weight of 26,000
- ,. . ...... . . . ,. ,, . . --
., ;, , . . ,: , .:
.. . . ~ .. ~ ... .
W090/l4360 2~5~'3 5 PCT/US90/02753
- 84 -
daltons which demonstrates tumor growth inhibitory
activity against koth a mink lung cell line (CCL 64)
and a human carcinoma cell line (A549) in monolayer
cultures.
The family comprises the novel discrete factors TGI-l
and TGI-2 and the previously disclosed factors TIF-l
and TGF-~. It is presently contemplated that TIF-l and
TGF-~ are the same polypeptide which may be distinct
from both TGI-l and TGI-2. TGI-l and TGI-2 being
discrete cannot both be the same as TGF-~ . TGI-l and
TGI-2 each have a specific activity greater than
TGF-~ . Both TGI-l and TGI-2 elute differently from
TGF-~ on high pressure liquid chromatography on a CN
column with 2-propanol. Further, TGI-l and TGI-2 elute
5 - differently from each other on high pressure liquid
chromatography on a CN column with 2-propanol.
Two ~eparate factors CM-l and a polypeptide derived
from conditioned media of human tu~or cell line (A549)
are also disclosed. Because both have the property of
substantially inhibiting the growth of a human tumor
cell line (A549) but not of an established mink lun~
cell line (CCL 64) it is contemplated that CM-l may be
the same as the TGI derived from conditioned media from
A431 cells. It is also contemplated that CM-l may be
si~ilar to TIF-2 of an earlier patent.
,
. . : . -
- . :
2~ r!~`j L
~090/14360 PCT/US9OtO2753
- 85 -
Fourth Serles of Experiments
Isolation and Sequence Determlnat1on of a Gene Encodinq
a Proteln Havinq Tumor Growth Inhibitory Actlvitv
Cloninq of TGF-~l
The sequence of TGF-~l cDNA is published (Derynck, R.,
et al., Nature, 316, 701-705). Based on this sequence,
we synthesized a 25 mer oligonucleotide probe
(TGGTGTCCAGGGCTCGGCGGTGCCG) which was used to isolate a
TGF-~l cDNA from a commercial lambda-gtII human placen-
ta library (Clonetech~). For these, and the ~ollowing
experiments, standard molecular biological techniques
were employed (e.g., Maniatis, T., et al. (1982) Molec-
ular Cloning, a laboratory manual, Cold Spring Harbor
Lab). By restriction mapping a~d partial sequence
analyeis, the clone was shown to contain the complete
coding sequence for the 390 amino acid TGF-~l precur-
sor but to lack some untranslated sequences from both
the 5' and 3' ends (439 bp from the 5' end and approxi-
mately 200 bp ~rom the 3' end~.
Bacterial_Expressio~ of TGF~
S~gments of the TGF-~l gene were expressed in E. coli
a3 trpE::TGF-~l fusion proteins using two related in-
ducible expression vectors: pATH II (Spindler et al.
(1984) J. Virol. 49: 132-141) and pKS-l (a pAI~ 11
derivative). The pATH ll::TGF-~1 construct was made
by cloning a Bal I-Sal I fragment into the multiple
cloning site of pATH 11. The Bal I-Sal I fragment
encodes amino acid residues 249-391 of TGF-gl. The
pKS-l::TGF-~l construct was made by cloning a Nae I-Sal
I fragment into the multiple cloning site of pKSl.
3~
. .
. ~ .: '~,' " . - '. ~ '
.. , . ~
, ~, ;, ': ~ : '
-
.'" ,'" ~ . . . .
WO90/14360 2 0 ~ ~ 9 3 ~ PCT/US90/02753
- 86 -
The_Nae I-Sal I fragment encodes the TGF-~l amino acid
residues 25-391 (Figure 23).
Bacteria (E coli RRI) containing the expression
plasmids were grown overnight into l ml M9 media (for l
S liter: l0 g Na2HP04 & H20, 3 g KH2P04, 0.5 g NaCl, 1 g
NH4Cl, 5 g casamino acids, l ml MgS04, 0.2 ml 0.5 M
CaCl2, 5 ml 40% glucose, l0 ml l mg/ml thia~ine Bl)
supplemented with 50 ~g/ml ampicillin and 20 ng/ml
tryptophan. A half ml of the overnight culture was
diluted into 5 ml M9 media supplemented with ampicillin
and grown for one hour at 30-C with great aeration.
The expression of the protein was induced by adding
12.5 ~l of 2 mg/ml indole acylic acid (IAA) and grown
another 2 hours at 30-C. One ml was centrifuged (su-
pernatant is the soluble fraction) and the pellet was
resuspended in l00 ~l TEN buffer (50 mM Tris-HCl p~ 7.5,
O.S mM EDTA, ~.3 M NaCl). Then subsequently were add-
ed:
- 10 ~1 l0mg/ml lysozyme, 15 minutes on ice.
- 2 ~l 10% NP-40, l0 minutes on ice.
- 150 ~l l.5 M9 NaCl, 12 mM MgCl2 and 0.4 ~l 1.9
mg/ml DNase, l hour on ice.
Then the insoluble fraction was collected by spinning 5
25 ~inutes in a microfuge. The pellet was washed twice
wlth 100 ~1 TEN buffer and finally dissolved in 50 ~l
0.0l M Na phosphate pH 7.2, l~ B-mercaptoethanol, 1%
SDS, 6 M urea and incubated 30 minutes at 37'C.
Following standard SDS-PAGE and Coomassie Blue stain-
ing, t~e constructed expression plasmids were found to
produce fusion proteins with the predicted molecular
weights (53kd and 45kd). Both proteins in a Western
Blot (Towbin, et al. (1979) Proc Natl. Acad. Sci. 76:
1 ~ 90/14360 PCT/US90/02753
.
- 87 ~
4350-4354) reacted with a commercial (R and D Systems
Inc.) polyclonal antisera against ~GF~
Cloninq of the Gene Encodinq the Protein Havinq Tumor
Growth Inhibitorv Activity
To identify sequences with homology to TÇF-~l a Pvu II-
Pvu II probe, containing most of the mature form of the
TGF-~1 cDNA sequence, was 32P labelled and used to
screen a Southern blot (Southern, (1975) J. Mol. Biol.
98: 503-517) of total human DNAs digested with Eco RI,
Hind III or Sst I using standard methods. In each
digest, two bands were present at a low stringency wash
~2.5 x SSC, 65 C) (Figure 24). When the wash stringen-
cy was increased (O.ol x SSC, 65 C) only one hybridiz-
ing band remained in each digest (Figure 24). The
strongly hybridi2ing band is likely TGF-~l, and the
weakly hybridizing band is a related gene which also
encodes a protein having tumor growth inhi~itory ac-
tivity. The nucleotide sequence encoding this protein20 having tumor growth inhibitory activity and its amino
acid se~uence are shown in Figure 29.
To isolate the gene encoding the protein having tumor
growth inhibitory activity with homology to TGF-~l, the
Pvu II-Pvu II probe from the TGF-~l clone was used to
scree~ a human phage library constructed from the DNA
of a chronic myelocytic leuXemia cell line (K562). Two
genomic loci, which correspond to TGF-~l and the relat-
ed gene encoding a protein having tumor growth inhibi-
tory acti~ity (~igure 29), were cloned and the pUC
subclones of phages were mapped by restriction enzyme
analysis (Figure 25 and 26). Construction of the XS62
library, screening and isolation of recombinant clones
was carried out essentially according to the procedures
.. . . . .
, : ' :
:
.
W090/14360 ~ 3~ ~ PCT/US90/0~53
- 88 -
of ~rosv~ld, et al. (1981) Gene 13: 227-237.
The phage DNA clone containlng the sequence encoding
the protein related to TGF-~l and with tumor growth
inhibitory activity was cut with Sau 3A and the re-
S striction fragments cloned into M13. The recombinant
plaques were screened with the Sma I-Pvu II probe of
TGF-~l. Six hybridizing genomic clones were sequenced
by the method of Sanger, et al. (1977J Proc. Natl.
Acad. Sci. 74: 5463-5467, and a region of approximately
130 bp was found to be homologous to TGF-~1 cDNA (Fig-
ure 27). When the amino acid sequence of TGF-~1 and
the related gene cloned in these experiments were com-
pared they were found to be 82% homologous.
To obtain a repeat free probe of the related gene
encoding the protein having tumor growth inhibitory
activity, various restriction fragments from 8am HI-
Bam HI subclone of this gene were hybridized to TGF-~l
c~NA, as well as to total human D~A. A BamHI-TaqI
fragment of the gene encoding the protein having tumor
growth inhibitory activity was found to cross hy~ridize
with the TGF-~l cDNA. The position of this fragment in
the gene encoding the protPin having tumor growth
inhibitory activity is shown in Figure 28.
The Bam HI-Taq I unique probe of the sequence encoding
the protein having tumor growth inhibitory activity was
used to screen the lambda-gtII human placenta cDNA li-
brary (Clonetech-). Two strongly~hybridizing clones,
as well as four weakly hybridizing clones, were isolat-
ed. By DNA sequence analysis the weakly hybridizingclones were shown to correspond to the TGF-~1 tFigure
29). One strongly hybridizing clone was isolated and ~ -
a 1.7kb EcoRI insert was subcloned into pUC 8. The
~. . ' .
~ . ' ' ' ~
90/1436~ 3 ~ ~ ~ PCT/US90~0~753
- 89 -
restriction map of this clone is shown in Figure 30.
Restriction fragments for this clone were subcloned
into Ml3 and sequenced by the method of Sanger, et al.
~he deduced amino acid sequence of this gene exhibits
extensive homology with a family of genes (Massague, J.
(1987) Cell 49, 437-438) including TGF-~l, TGF-~2,
glioblastoma T-cell suppressor factor (G-TsF) factor,
inhibin/activin, Mullerian Inhibiting Substance (MIS)
and decapentaplegic transcript complex of Drosophila
with the six C-terminal cysteine residues being
conserved throughout. The comparison with TGF-~l and
TGF-~2 is shown in Figure 31. The cDNA sequence
(Figure 29) encoding the protein having tumor growth
inhibitory activity corresponded with the sequence
from genomic DNA (Figure 27) encoding the protein
having tumor growth inhibitory activity.
A 17 kb genomic DNA fragment containing the sequence of
the gene encoding the protein having tumor growth in-
hibitory activity has been cloned (see Figure 26).
Hybridizing 5' and 3' portions of the 1.7 k~ ~DNA clone
which encodes the protein having tumor growth inhibito-
ry activity with the genomic locus of the protein hav-
ing tumor growth inhibitory activity revealed that the
1.7 kb cDNA sequence is completely contained in the
genomic clone. Taking into account that the full
:
length message of the protein havins tumor growth in-
hibitory activity is 3.5 kb, additional 5' and 3' i
flan~ing sequences may be isolated to obtain the com-
plete gene. This i5 done by screening genomic phage
and cosmid libraries with probes ~nique to the gene -
encoding the protein having tumor growth inhibitory
activity.
- . . . . .
.
wo 90,1436n 2 0~3 ~ i PCT/~S90/02753
-- 90 --
In ~F-~l the sequence R-R (as indicated at position -l
and -2 in Figure 31) represents the prot~olytic cleav-
age site which generates the mature protein. In therelated protein having tumor growth inhibitory activi-
ty, the sequence R-K-K-~ likely represents the corre-
sponding cleavage site.
In the region N-terminal to the predicted cleavage
site, ~GF-~l and the related gene encoding the protein
having tumor growth inhibitory activity exhibit only 7%
homology. Both proteins, however, contain the se-
quence R-G-D~L in this region which may be recognized
by the fibronectin receptor.
In order to determine which cell line types express the
related gene encoding the protein having tumor growth
inhibitory activity, Northern hybridization was car-
ried out using a 5' terminal Eco RI-Bgl II probe (Fig-
ure 32). This revealed a mRNA of approximately 3.5 kb
in A673 (a rhabdomyoscarcoma), A498 (a kidney carcino-
ma~ and ~ faintly hybridizing signal in AS49 (a lungadenocarcinoma).
A genomic probe from the 3' region of the related gene
encoding the protein having tumor growth inhibitory
activity (corresponding to downstream of the presumed
3~te of proteolytic cleavage) was then used to screen
the same Northern blot. Three strong hybridization
signals were observed in both A673 and A498, corre-
sponding to TGF-~l (2.5kb), the related protein having
tumor growth inhibitory activity (3.5kb) and, another
related gene (4.2kb) (Figure 33). These results are
consistent with the fact that this probe would be pre-
dicted to cross react with sequences homologous to the
protein hav~ng tumor growth inhibitory activity.
:
: . . :
..
',090/14360 PCT/US90/02753
Northern blot analysis of A673, ~549 and A498 cell
lines using a Pst I-Bal I TGF-~l probe was then per-
formed. This probe should be highly specific for TGF-
~1 since it contains sequences corresponding to those N
terminal to the proteolytic cleavage site, a region
where TGF-~l exhibits little homology to other members
of this gene family. As predicted, based on the known
2.5 kb size of TGF-~l ~RNA, a strong hybridization to
a 2.5 kb mRNA band was observed in all three cell
lines. Several weakly hybridizing bands are also ob-
served at 4.2 kb and 3.5 kb (Figure 34).
Northern blot analysis of A673, A549 and A498 cell
lines were then screened using TGF-~l cDNA containing
the complete coding sequence of the TGF-~l precursor.
This probe is predicted to cross hybridize with homolo~
gous sequences to TGF-~l. As predicted, there was
strong hybridization to a 2.5 kb mRNA band correspond-
ing to TGF-~l and a 4.2 kb mRNA band possibly corre-
sponding to TGF-~2 (Figure 35).
-
Northern blot analysis o~ mRNA from human umbilical --
cord and A673 cell line were also screened using an Eco
RI - Bgl II cDNA fragment of the related gene encoding
thQ protein having tumor growth inhibitory activity as
a probe tFigure 36). The figure includes the result
with a a~tin probe acting as a control to normalize
mRNA levels in each lane. Normalized to actin mRNA
levels, the cord expresses the highest level of mRNA of
the gene encoding the protein having tumor growth
inhibitory activity of any source so far examined
(Figure 36). `-
- . . - . - .
. . - , :,.
~ ~ . ' ' :,: ~ : , .
- , . ...
-. ' ~ : . :' -
WO90~14360 2 9 ~ ~ 3 ~ i PCT/US90/027~3
- 92 -
Southern blot analysis was performed on a variety of
different tumor DNAs digested wlth Eco RI and hybrid-
ized with a Sma I- Ava I cDNA fragment of the TGF-~l
related gene encoding the protein having tumor growth
inhibitory activity as a probe at low (2.5 X SSC,
65 C) and high (0.3 X SSC, 65'C) stringency washes.
Southern blot analysis indicates the possible presence
of other loci related to the gene encoding the protein
having tumor growth inhibitory activity, as the probe
hybridizes with two bands (3 kb and 12 kb) which are
only observed under conditions of washing at low
stringency.
To obtain a full length cDNA clone of the gene encoding
the protein having tumor growth inhibitory activity, a
O~ayama-Berg cDNA library blot of human fibroblasts was
screened with the 5' Eco RI-~gl II probe of the l.7 kb
cDNA clone of the gene encoding the protein having
tumor growth inhibitory activity. A hybridizing band
of 3.2 kb is visible at moderate wash stringency 0.3 x
SSC, 65 C.
Production of Antibodies with Specificity for the TGF-
~l_ Re1ated Protein Havinq Tumor Growth InhibitorY
ACtiVitY
2~
Chimeric bacterial proteins have been constructed that
contain the C terminal 150 amino acids of the related
protein having tumor growth inhibitory activity fused
to a small region of the tr~E gene. Such a fusion
protein was found to be recognized by an antibody that
was produced against a peptide derived fro~ a~ino acid
numbers 9 to 28 of the mature form of the protein hav-
ing tumor growth inhibitory activity. The antibody
recognizes the trP::protein having tumor growth in-
.~5
- .
90/14360 ~ )i PCT/US9OJ02753
- 93 -
hibi~ory activity fusion protein to a much higher de-
gree than a trP::TGF-~ fu5ion protein and the peptide
specifically competes with the protein having tumor
growth inhi~itory activity for the binding of the anti-
body.
DNA sequences that code for the the TGF-gl related
protein having tumor growth inhibitory activity were
cloned into a pKS vector. This vector is a pATH II
derivative that contains the inducible trP promoter
and a multiple cloning site. The resulting constructs
produce a chimeric protein consisting of the first 22
amino acids of the trPE gene, the C-terminal 150 amino
acids of the protein having tumor growth inhibitory
activity. Transformants containing these clones were
screened primarily by restriction endonuclease analysis
and ultimately for production of the chimeric protein
by SDS polyacrylamide gel electrophoresis. The protein
products of 3 clones, pll6, pl34, and pl35, are shown
in Figure 37. These cells were grown in defined media
until they reached early log phase and then incubated
for 3 hours either in the presence or absence of the
trPE inducer indoleacrylic acid (IAA). The cells were
then collected, lysed and their proteins electro-
phoresed on a l2.5~ SDS polyacrylamide gel. Figure 37
- Z5 i8 a photograph of one such gel that had been stained
with Coomassie blue. As can be seen, lysates pl}6 and
pl35 produce a protein of about 19,000 Dalton molecular
weight whose relative abundance increases in the pres-
ence of IAA. In contrast, pl34 does not produce this
protein species. Both pll6 and pl35 contain pl~smids
that, by restriction analysis, have the se~uences of
the protein having tumor growth inhibitory activity
cloned in the orientation that should produce a 19,500
Dalton molecular weight fusion protein. The pl34
- . ......... .
: - , ' :. , .- :, ":::, " . ';
'~ '"' . .
WOgn/14360 ~ 3 ~ 1 PCT/US90/02753
- 94 -
pla6mid was found to have the sequences of the protein
ha~ing tumor growth inhibitory activity in the opposite
orientation.
The trPE::protein having tu~or growth inhibitory activ-
ity fusion protein was used to test t~e specificity of
an antibody that used a peptide homologous to part of
the protein having tumor growth inhi~itory activity as
an antigen. A polypeptlde was synthesized correspond-
ing to residues 9 through 28 of the ~ature protein
having tumor growth inhibitory activity, except that
residu~ 9 in the sequence, arginine, was replaced by
serine. The peptide was purified by RP~PLC and cou-
pled to keyhole limpet hæmocyanin for use as an
imm~nogen in rabbits.
Thirty-three days following the first injection (500~g),
the anti~era were screened by standard ELISA using
l00ng of peptide per well. One rabbit de~onstrated a
signal of l.0 OD units at a 1: 25 dilution of the anti-
body. 'ren ~ay~ after this rabbit was first bled, a
boost or 250~q of coupled antigen was given. The fol-
lowing blsed 20 days after the first bleed showed a 20-
fold incra~se in antibody response to the pepttde anti-
gen. Forty days after the initial bleed (3rd bleed) a
~lgnal o~ l.O O~ unit was achieved at a 1:8000 dilution
~ th~ antisera, a 16-fold increase in antibody titer
over the second bleed. This antibody showed little
cross-rcactlvity with a ho~ologous peptide derived from
TGF-Bl sequencesO Th~ TGF-~l derived peptide
con~i~ted o2 amino dcid numbers 4 to l9 of the mature
~GF-~l pro~ein. Of ths ll com~on amino acids, residues
9-13, ~ aro con~erved betw~en the protein having tumor
growth inhibitory activity and TGF~
.,.
' , ,
~9Ot14360 2~ g 1 ` PCT/USgO/02753
-
~o d~termine i~ the pep~ide reco~nizing antibody could
r~cognize the protein havin~ tumor ~rowth inhibitory
activity, the antlbody was used in Western blot analy-
sis aqainst a fusion protein of the protein having
tumor gr~wth in~ibitory activity and a TGF-~l fusion.
As ~een in Figure 3B, the anti-peptide antibody react~d
strongly with the fusion protein of the protein having
tumor growth inhibitory activity while it reacted only
weakly with a tr~::TGF-~l fusion protein. Both fusion
protein~ were recognized ~y a co~mercially available
anti-TGF-~1 antibody (R and D ~ystems) (Figure 38~.
As can b~ sQen in Figure 38, t~e anti-peptide antibody
recognizing the protein having tumor growth inhibitory
activity also ha~ a high level o~ bacXground reactivity
to baeterial protoins. To reduce this cross reactivi-
ty, we purified the anti~ody on a CNBr-Sepharose column
containing the original peptide used as an antigen.
Tho antibody rstained its high titer to the peptide of
the protein having tumor growth inhibitory activity and
low cross reactivity to the ho~ologous peptide TGF~
(data not ~hown)~ The purified peptide antibody was
then t~sted by Western blot analysis for its cross-
reactivity with TGF-~l. The results are shown in Fig
ur~ 39. The purified antibody reacts very stronqly
with t~e fusion protein of the protein having tumor
gro~th inhibitory activity (lane 2)and with a higher
~ol~cular weiqht protein spQcies, while the hybridiza-
tion to othor bact~rial prot~ins was found to be
gr~a~ly r~duc~d comp~red to the unpurified antibody
(Flgur~ 38). The purifled antibody exhibits negligible
re~ctivity with ~ither the TGF-~l fusion protein (lane
1) or puri~i~d, ~GF-~l obtain~d co~mercially (R and D
~y~t~m~) tlane~ 3 and 6). A compe~ition experiment was
al30 p~rformed where the purified antibody was
WO90/]4360 2 ~ i PCT/US90/02753
- 96 -
proincubated with a 300 fold molar excess of the
p~ptide (lanes 4, 5 and 6)- Prelncu~ation of the anti-
body with excass peptide for 60 minutes at room temper-
at~re considQrably reducQd hybridization to the fusion
protein of the protein having tumor growth inhibitory
activity (lan~ 5) but not to trace background reactivi-
ty exhibit~d against the TGF-~l fusion protein or to
other bacterial prot~in~ flan~ 4j. Thus the anti-
pQptide antibody spscifically recognizes proteins con-
taining sequences of the protein having tumor growth
inhibitory activity.
Eucarvotic Ex~r~ssion of TGF~ Fu~ed With The Proteln
Havin~ Tumor Growth InhibitorY ActivitY
Human recombinant TGF-~l has been expres~ed in monkey
COS cells. Sequences encoding the complete precursor
o~ t~e TGF-~l cDNA were cloned down strea~ from a SV40
promoter using tbe pSVL~ eukaryotic expression vector
(obtained from Pharmacia). This construct wa~ trans~
fected into cas cell5 usinq a standard calcium phos-
phats precipitation method, Graham and van der Eb
(1973) Virology 52, 456-467. After transfection, ap-
proximat~ly 4xlO6 cells were gro~n in serum free me~ia
~or two days. The conditioned media was then collect-
d, acidified and tested ~or biological activity.
Condition~d redia from TGF-~l transfected cells was
found to inhibit the growth of a monolayer mink lung
t~t cell line (CCL 64) by 59% as compared to condi-
tionod mcdia fro~ COS cells tranfected with the pSV~
v~ctor alono which lnhibited growth of CCL 64 cells by
only 32~.
Since a ~ull length clo~e for the sequences encoding
the protein having tumor growth inhibitory activity is
,
.
,. . , : .
: .
,:
. .
9Otl~360 2 a5 ~ ~3.l PCT/US90/02753
- 97 -
not currently available for expression analysis, a
chi~eric TGF~ :protein having tumor growth inhiblto-
ry acti~ity fusion construct was made by substituting
3' sequ~nces of the TGF-~l precur50r with sequences
encoding the protein having tumor growth inhi~itory
activity. Given the homology ~etween these two pro-
tein and the conserved position of their cysteine
re~idues, when such a construct is transfected into COS
cells the novel fusion protei~ may be processed into
th~ biologically acti~e mature protein ha~ing tumor
growth in~ibitory activity. Additional constructs,
which consist o~ the trp E::gene encoding the protein -
havinq tumor growth inhibitory activity fusion cloned
under the regulatory sequences o~ either the SV40 pro-
moter or the long ter~inal repeat of the mouse mammary
t5 tumor virus (MMTV) have been made and may be te~ted for
biological activity in transient tranfection experi-
ments.
Conclusion from the Fourth Series of ExPeriments
In th~ ~ourth Serie3 of Experiments TGF-~l was cloned
and u~ed to isolate a related gene encoding a protein
having tumor growth inhibitory activity. Although it
h~ not yst been determined which of TGI-l or TG~-2
corr sponds to the protein related to TGF-~l and having
tuaor growth inhibitory activity, one skilled in the
~rt would undorstand that such a correspondenc~ exists
althouq~ tha exact nature of thi~ corresponding remains
to bQ cl~rifi~d.
3~
.. . . . . .. . . .
,: . . . :; ~ -, .,
: . . . .
: , . . . .
- . ~ . ~- -
. - , .
.
wo9n/l43~o 2~3~ ~ PCT/US90/02753
- 98 -
Flfth Serie of ExPeriments
Further sequence determination of a qen~ encodin~ the
protein havinq tumor qrowth lnhibitor~ activity
Screening a lambda gtll human placenta cDNA library
~C~ontech 1.2 x 10 independent clones) with a repeat
free probe, as described at page ~7, lin~s 15-18, and
figure 28, of the gene encoding the protein havinq
tumor growth inhibitory activity, resulted in the iso-
lation of a 1.7 kb cDNA clone. On Norther~ analysis,
the mRNA $~r the protein having tumor growth inhibitory
activity was found to be approximately 3.5 kb, indicat-
ing that we had not obtained a full length cDNA.
To obtain additional S' sequence lnfor~ation, we
screened a lambda gtll hum~n umbilical cord cDNA li-
~rary (Clontech, 1.5 x 106 independent clones) with a
5' EcoRI-Bgl II restriction fragment (Fig. 40! indicat-
ed a~ E-~) derived from the placenta cDNA clone. This
resulted in the isolation of a 1.9 kb cDNA (Fig. 40~.
se~uencq analysis revealed this clone cont~ined an
additional 180 nucleatides of 5' se~uence infor~atio~.
The isolation of this cDNA from an umbilical cord li-
brary ag~in confirms that this gene is actively tran-
2 scribed in this tissue.
To obtain fu~ther cDNA sequence information for the
g~no encoding th~ protein having tumor growth inhibito-
ry activity, ~RNA was isolated from A673 cells and a30 cDNA library prepared. Starting wi~h 5 ~g poly (A)
RNA, a random pri~ed cDNA library o~ approximately 2 x
106 clones wa~ constructed in lambda gtlO, using the
Amercham cDNA synthesi~ ~ystem plu~ according to the
manu~acturer's procedures. Approximately 0.7 x 106
.
~ 90/1~360 2 ~ ~ ~ 3 '-~ ~ PCT/US90/02753
_ 99 _
una~pli~ied cDNA clones were screened with a 25-mer
olLgonucleotide probe (5'-A T A T A G C G C T G T T T G
G C A A T G T G C T -3') corresponding to a sequence
near the 5' end of the 1.9 kb cDNA clone and a single
positive clone containing a 1.7 kb insert was
identified.
Analysis of th~ three overlapping cDNAs (Fig. 41) re-
vealed a sequence of 2529 bases, with the largest open
reading frame being 1236 bases. We found no sequence
differences in the overlapping cDNAs indicating they
were derived from transcripts of the same gene. our
sequence contains a complete 3' untranslated region of
1031 bp with a polyadenylation signal 25 bp upstream
from t~e poly (A~ tract. The 5' untranslated region
comprises 262 bp but lac~s approximately 1 kb, as
judged from the size of the ~RNA estimated by Northern
analysis. The predicted a~ino acid sequence of the
gene encoding ~he protein having tumor growth inhibito-
ry activity shows extensive homology to TGF-Bl and ~2
~Fig. 42) (Derync~, et al. (1985) Nature 316, 701-705~
do Martin, et al. (1987) EM130 J. 6, ~673-3677; Madisen,
et al. (1988) DNA 7, 1-8).
TGF-~l and TGF-~2 are produced in precursor forms of
390 and 414 a~ino acid residues respectively (Derynck,
ot ~1. (1985) Nature 316, 701-705; de Martin, et al.
~1987) EMBO J. 6, 3673-3677). The cONA sequence we
havQ obtained for th~ gene encoding the protein ha~ing
tumor growth inhibitory activity (Fig. 41) contains an
open roading ~ramQ coding for 412 amino acids, with the
first ATG pr~c~ded by a stop codon, 162 nucl~otides
upstream. As found with TGF-~l (Derynck, ~t al. (1985)
Nature 316, 701-705) and TGF-~2 (de Martin, et al. E~B0
J. 6, 36~3-3677),- the predicted initiating codon for
.
.. ..
. ., .. , - . , .
WO~0/14360 ~ PCT/US90/02753 ~
-- 100 --
the protein having tu~or inhibitory activity does not
fo~m part o~ a Kozak consensus sequence (Kozak (1986)
Cell 44, 283-292). Interestingly, six nucleotides
downstream there is a second ATG, with an A at posi-
tion -3, which aligns with the initiating codon in TGF-
~2 (de Martin, et al. (1987) EMB0 J~ 61 3573-3677)o
Homodimers of the C-termin~l 112 residues of TGF-~l and
~2 reprQsent the biologically active forms of these
proteins. Preceeding the site of clea~age to their
mature ~orms, TGF-~l and -~2 have stretches of 4 and 5
basic rQ~idu~s rQ~pectiv~ly. In th~ gen~ encoding the
protein having tumor growth inhibitory acti~ity, there
ar~ 5 basic residues preceeding th~ predicted cleavage
Rite marked by the asteri~k (Fig. 41). The mature
for~s of TGF-~l and -~2 share 80~112 identical resi-
due~. The corresponding 112 C-terminal amino acids in
this gen~ exhibit 86/112 and 89/112 identical residues
compared to TGF-~l and -~2 respectively (Fig. 42).
Many of the remaining differences represent conserva-
tive sub~titutions. All three proteins show a strict
conservation o~ the cysteine residues in this region.
The N-termin~l domain of the precursor portion of the
gQne encoding the protein having tumor growth inhibito-
ry activity exhibits approximate~y 35% homol~gy to TGF-
~1 and 45$ homology to TGF-~2. By comparison, the
corrospond~ng s~quences of the ~GF-Bl and -B2 precur-
~or~ ~av~ 33% sequence homology (Fig. 42) (Derync~, et
al. (1985) Nature 316, 701-705: de Martin, et al.
(198~) ~MBO ~. 6, 3673-3677). A ho~ology matrix plot
cle~rly illuatrates the gr~at~r si~ilarity between the
gene encoding the prot~in having tu~or growth inhibito-
ry activity and ~GF-~2, compared to ~GF-~l (Fig. 43).
Four pot~ntial glycosylation sites are contained in the
N-terminal part o~ the gene encodin~ the protein having
tumor growth inhibitory activity, one of which is con-
'
~90~14360 2 ~ PCT~US9D/02753
v ~ .
-- 101 --
~erved i~ all three proteing- All t~ree proteins also
pos~es hydrophobic N-termini which may represent
presecretory signal peptide sequences (Perlman and
Halvorsan (1983) J. Mol Biol- 107, 391-409). Interest-
ingly, both ~GF-~l and t~e gene encoding the protein
5 having tumor growth inhi~itory activity (but not ~GF-
~2) contain the fibronectin binding sequence RGD
(Ruoslahti and Pierschbacher (1986) Cell 44, 517-518).
By analogy to TGF-~l and -~2, the protein havinq tumor
growth inhibitory activity i~ liXely to be synthesized
10 as a 412 amino acid precur~or which ~ndergoes
proteolytic cleavage to produce the ~ature polypeptide.
Based on the functional and structural homology to
TGF-~l and -~2, the protein having tumor growth inhibi-
tory activity likely has therapeutic activity in can-
15 cer therapy, wound healing and im~ osuppression.
~0
',
WO90/14360 2 0 ~ 6 ~ ~ i PCT/US90/027S3
- 102 -
Th~ Sixth Series of ExPeriments
Note on Nomenclature
Given the extensive sequence identity of the protein
having tumor growth inhibitory activity with TGF-~l and
~GF-B2, we have hereafter termed ~he protein ~aving
tumor growt~ inhibitory activity as TGF-~3.
TGF-~3 Expression construct
A 1500 bp Alul-Hgal restriction fragment of TGF-~3 cDN~
tsites are indicated in Figure 41) which encodes the
complete TGF-~3 protein was cloned into the Bluescript
plasmid (strategene/ La Jolla, CA), to yield the
plasmid pBlue-TGF-~3. ~he fl intergenic region of this
vector allows the production of single stranded DNA via
infection of its host bacteria with fl helper phage.
The predicted initiatisn codon of TGF-~3 doec n~t form
part of a Rozak consensus sequence (CCACC~ATG3G; Xozak,
Cell 44:283-292, 1986), which has been shown to
influence the efficiency of translation. In order to
promote high yields o~ the recombinant TGF-~3 protein,
W9 mutagenized the flanking sequence of the initiation
codon to a more efficient transla~ion sequence by
changing ~A~AC~ATG~A into CCACC[ATG)A using the method
o~ Na~aye and Eckstein (Nucleic Acids Res. l4: 9673-
9698, 1986). Mutagenesi~ was ronfirmed ~y sequence
analy~is. Subsequently, the mutagenized pBlue-TGF-~3
was cut with Kpnl and SpeI, two polylinker xestriction
sites flanking the cDNA insert. This fragment was
clone~ into the eukaryotic expression vector pORFEX
(~ernard, et al., EMBO J. 6:283-292, 198~) cut with
KpnI and Xb~I. In this construct (pCMV:TGF-~3) the
.
,. ::
.
~ , ?
-' : ' '
2 ~ Pcr/usgo~o27s~
90/14360
~ ,~
- 103 --
TGF-~3 cDNA sequence ls transcriptionally regulated by
th~. cytomegaloviruS immediate early promoter (see
Figure 44).
DNA Transfecei~n and Gene AmPlification
Stable transformant~ expressing TGF-~3 were obtained by
cotransfecting the pCMV-TGF-93 constr~ct (Figure 44)
with the dihydrofolate reductase (DHFR) gene (the
pDC~IP plasmid containing hamster DHFR minigene driven
by its own promoter) i~to Chinese ~a~ster Ovary (CHo)
cells, which lacX the DHFR gene ~Urlaub a~d Chasin,
Proc. Natl. Acad. S~ SA 77:4216-4220, 1980).
A standard CaP04.DNA precipitation method (Graham and
~5 van der Ep, Virology 52:456-457, 1973) was used for DNA
transfection. pCMV:TGF-3 ~5.7 kb) and pDCXIP (2.5 kb)
were coprecipitated with CaP04 in a ratio of lO~g to
50ng respectively and the precipitate added to 0.5 X
106 CHO (DHFR )cells. Selection of transformants with
a D~FR phenotypa was performed in alpha MEM (Gi~coi
Grand ~sland, NY) supplemented with 10% dialyzed fetal
calf serum. The colonies that appeared after culturing
for 10-14 days in selection ~edium were isolated by
standard methods and expanded.
For g~ne ampli~ication, the primary transfectants were
~ub~sctRd to stepwise selection with increasing
concQntrations of ~ethotr~xate (Mtx; Sigma Chemical
Co., St. Louis, MO). The first round of selection was
carried out at 20nM Mtx. TGF-~3 expression levels were
maa~ured by RNA cytodot hybridization normalizing ~he
expression of TGF-~3 mRNA to that of actin. Two of the
three clone~ with initial high expression (clones C~O
6.35 and C~O 9.1) showed increased TGF-~3 mRNA
wo 90/~J360 2 ~ 5 6 " ~ ~ PCr/US90/0~7s3
- 104 -
expre~sion at 20 nM Mtx concentration (Figure 4s).
Total RNA (75 ~q) from C~ cell~ (lane l), CH0 6.35
(lane 2), and CHo 6.35/20 nM (lane 3), were
fractionated on a 1.2% agarose-crmaldehyde gel,
blotted onto nitrocellulose and probed with a TGF-~3
specific probe (EcoRI-SmaI cDNA restriction fragment of
t~e umbilical cord clone) (see Fi~ure 40). C~0 6.35/20
nM (pri~ary transfectant CH0 clone 6.35 at 20nM Mtx),
which had the highest level of expression, was chosen
for initial protein purification fro~ conditionPd media
and for further gene amplification.
Bioloq~cal A~say of Conditioned Media
Conditioned media was treated with acetic acid to a
fin~l concentration of 0.1 M and serial dilutions
tested for biological activi~y. CCL 64, a cell line
derived from Mink lung (American Type Culture
Collection, Rockville, MD), was found to be extremely
3ensitive to the naturally occurring TGF-~3 isolated
from umbilic~1 cord. This cell line was initially
choson, t~erefore, to test conditioned media for
biological aetivity of the recombinant TGF-~3 pr~tein
according to the method of lwata et al., Cancer ~es.
45: 2689-2694, 19~5 . Growth inhibition of CCL 64 mink
lung c~ produced by TGF-~l (purified) or TGF-~3
trro~ condLtioned media) is shown in Figure 46. Figure
46A ~hows a dose response of qrowth inhibition using
purlfi-d ~GF-~l (Calbiochem): a 50% inhibition was
obtained with 0.1 ng TGF-~l. An increase in mink cell
growth inhibitory activity was found comparing
conditioned ~edia from the transfectant selected at
20nM Mtx ver~us madia fro~ the parental transfectant.
Figure 46B shows the biological activity of acid
activated serum free su~ernatants of CH0 6.35~20 nM
3~
.. ~ .... . :. ..
:
. .
'; . ...
2 ~
90/14~0 pcT/us9o~a27~3
- 105 -
tran-~fectant (closed circles) and cHO 6.3s transfectant
(open circles); 50~ inhibi~ion was obtained equivalent
to 30 and 5 ng/ml TGF-~l activity, respectively,
Conditioned medium from parental CHO (DHFR ) possessed
much lower gr~wth inhibition than either transfectant
(data not shown). ~hQse results clearly suggest that
the TGF-~3 cDNA is transcribed and that TGF-~3 mRNA is
translated and produce~ bio~ogically active protein.
In th~ prasence of EGF, acidified conditioned media
from CH0 6.35, containing ~GF-~3 was able to promote
soft agar growth of NRX cells. Growt~ of NRX cells in
soft agar has been shown to be inducible by stimulating
the production of extr~cellular matrix proteins, an
important parameter in wound healing. -~
Immunodetection
Peptides corresponding to various partial amino acid
soquences of the TGF-~3 protein were synthesized on an
Applied ~iosystems peptide synthesizer (Model 43~A~
u~in~ t~oc chemistry (sea Figure 47), Peptides were
coupl~d to keyholQ limpet hemocyanin with
glutaraldehyde and used for immunization of rabbits.
Enzy~e-linked immunosorbent assays were used initially
to characterize the antibody titers (see Tahle gl, For
th~J, and the following immunological experiments,
rtandard techniques were employed as described by
Narlow and Lan~, 1988, in Antibodies, A ~aboratory
Manual. High titRr anti~er~ ~rom immunized rabbit~
in~ected with ~3V or ~3III pRptides were purified using
an a~n~ty matrix compos~d of the respective peptide
~3 antig~n conjugated to Affi-prep lO tBio Rad,
~ichmond, CA).
. ~5
,,..
:
WO90/14360 2 ~ ~ ~ 9 ~ 1 PCT/US90~02753
- 106 -
TABT E 9
Peptide Sequence Elisa Titer
I EEMHGEREEGCTQENTESEY l:6,00O
IIL GDILENIHEVMEIKFX~YDNEDD l:lO,000
I~g GDILENIHEVMEIX 1:19,000
III DTNYCFRNLEENC
~:26, aoo
IV CVRPLYIDFRQDLGWKWVHEPKGYYANFC l:l9,000
V YLRSAOTTHSTVLGLYNTLNPEASASY 1:26,000
VI CVPQDLEPLTILYYVGRTPKVEQLSNMVYXSC l: 4, 000
:
~0 '
,
90/14360 2 o ~ PCT/US90/02753
- 107 -
~ho a~finity purified ~3III antisera exhibits greater
than 300 fold specificity for the ~3III peptide
compared to the cognate peptide sequences from either
the TGF-~l or -B2- Furthermore, no signiicant cross
reactivity of this antisera has been observed against
either the TGF-~l or -~2 proteins. However, this
anti~ody shows only a very limited ability to
immunoprecipitate the native recombinant TG~-g3 protein
from conditioned media. T~e af~inity purified ~3V
antisera exhibits at least a 400-fold selectivity for
the B3V paptide compared to the correspondi~g peptide
sequence from TGF-~l. This antibody can also
efficiently immunoprecipitate the native TGF-33 protein
(Qee figure 50). However, this polyclonal sera appear~
to contain a significant population o~ antibodies
(approximately 30-50%) which react with both the TGF-~2
cognate peptide sequ~nce and the TGF-~2 protein.
Figure 48 shows an immunoblot of TGF-~3 in conditioned
media produced by the CH0 6.15/20 nM transfectant using
~3III and ~3V antibodies for detection. For peptide
blocking experi~ents, the anti~ody was prei~cubated
with 80-fold molar excess of. peptide prior to
incub~tion with the blot. Por detection, alkaline
pho~phatase (Zymed, San Francisco, CA) conjugated to
goat anti-rabbit IqG was used as a second antibody.
P~gure 48A shows a western blot of a gel where the
sa~plQ wa~ subject to reduction prior to
elec~rophore~is w~ile Figure 48a shows the Western blot
of th~ ~ample under non-reducing conditions. In each
Sigure, l~n~ 3 and 4-6 correspond~ to conditioned
m~dia immunoblotted with ~3V and ~III antisera,
r~spectively, lAnes 2 and 5 i~munoblots carri~d out in
th~ pr~ence of excess cognate peptide, while lanes 3
and 6 represent immunoblots in the presence of an
~: -
,
W09Q/14360 2 ~ ` ~! ) I PCT~US90/02753
- 108 -
~xce~s unrelated peptide sequence- western bl~tting of
conditioned media from CH0 6.35/20 m~ cells under
reducing conditions, using affinity purified ~3III and
~3V antisera, detected a 50 kDa and 2 12 kDa band. we
believe these bands corre5pond to a precursor and
mature for~ of TGF-~3, by analogy to the processinq of
TGF-~l and ~GF-~2 previously described by Gentry et
al., Mol. Cell. ~iol. 7, 3418-3427 (I987) and Madison
et al. DNA 8, 205-212 (1989) ~Figure 48). Under non-
reducing conditions, a 100 kDa and 24 kDa band were
observed, which we believe to correspond to homodimeric
forms of the precursor and mature forms of TGF-~3. The
apparent precursor appears as a broad band,
characterist~c of some glycosylated proteins.
Following cleavage of the signal peptide sequence of
the precursor form of TGF-~3, one would expect a
protein with MW of 43 XDa (~nder reduced conditions).
Based on the primary sequence of TGF-B3, there are four
N-linked glycosylation sites, further indicating that
the detected precursor protein may be glycosylated.
Figure 49 shows a Western blot of cell extract (Fig.
49A) and conditioned media ~Fig. 498) of the CHo
6.35/20 nM transfectant using ~3V antibady for
detection. For preparation of cell extracts, cells
ware first washed with phosphate buffered saline with
~nd th~n lysed directly with SDS-9 mercapthoethanol
prior to gel eleotrophore~is. For peptide blocking
(lan~is 2 and 4), the antibody was incubated ~ith a 100-
fold molar excess of speci~ic peptide prior to
incub~tion with the blot. (I125 protein A was used for
detection). In cell extracts o~ CH0 6.35/2onM under
reduci~g conditions, only the 50 kDa hand corresponding
to a potential precursor form ii~ detected ~Figure 49).
The speci~icity of the antisera was de~onstated by
preabsorbinq the antibodies with peptide immunogen
,
: .
- .::
- ,
,
.
2~5~8~
? gO/14360 Pcr/usso/027s3
-- 109 --
prior to Western blotting (Figures 48 and 49). As
exp~cted, ba~ed on mRNA and b~ological activity data,
the antisera did not detect a~y TGF-~3 protein in
conditioned media of the parental CH0
~DHFR ) cells.
~oth antisera were also tested for immunoprecipitation
of native recombinant TGF-~3 protein (Figure So). CHo
6 35/20nM w~r~ grown to confluency and labeled with
~ S] methionine or 24 hours in methionine-free DMEM
in the presence of 5% dialyzed plus 5~ non-dialyzed
fetal calf serum. The medium was collected and
immmunoprecipitated with lO~gJml affinity purified
antibody and 2o~l/m~ 2 dilution~ protein A agarose,
for 2 hours at 4 C. Separation of the
immunoprecipitated proteins on a 12 . 5% SDS
polyacrylamide gel revealed two proteins migrating
identically to the mature (12 kDa) and precursor form
(50 kDA) o~ TGF-~3, as detected by Western blotting
(Figure 50). However, ona extra immunoprecipitated
protein wa~ found at 43 kD. This protein may
correspond to either the non-glycosylated precursor or
a proteolytic breakdown product. The ~3V antibody
proved to b~ much more efficient in immunoprecipitation
o~ TGF-~3 protein than the ~3III antibody. The
~p-cirlcity o~ the immunoprecipitation was determined
by praincubating the antibody with a 80-fold molar
exc03s of ei~her the cognate peptide or an unrelated
p~ptid~ ~Qguenc-. The specific peptide showed complete
compQtitio~ of all t~ree bands whereas the unrelated
30 poptide did not. A~ expected, based on the amino acid
composition and distribution of methionines in the TGF-
~3 protein, th~ 50 kDa contains significantly more S35
label.
3~
.::
.
: ' :
.
, ~ :
.
. .
. . :
WO90/14360 2 ~ ~ ~ 9 ~ 1 PCTtUS90/02753
- ~la -
Tha ~v affinitY puri~ied antibody was also used in
pa~dffin sections of human umbilical cord (see Fi~ure
51). Fibroblasts and epithelial cells stained (Fig.
51A) as did the smoot~ muscle fi~er~ of the cord
vasculature (Fig. 51C) wherea~ neither :he connective
tissue nor the extracellular matrix stained with this
antisera. A control rabbit polyclonal antisera (Ig
against p2l0Ph~/abl:osI catalog #PC02) showed no
staining (Fiqs. 51B and D). The strong staining in
thi~ tis~ue is in agreement with earlier data in which
we showed extract~ from umbilical cord possessed high
lev~ls of tissue derived tumor growth inhibitors, wit~
similar to identical physico-chemical properties to
recombinant TGF-~3 protein. Also, umbilical cord was
found to express the highest level of TGF-~3 mRNA. -
Protein Purification
Conditioned m~dia was prepared ~rom CHO 6~35/2onM cells
grown to confluence in the presence of 20nM
methotrex~te. The cell~ were washed with phosphate
buffered ~aline and incubated with serum free medium
for 2 hours to ~liminate carryover of serum proteins.
Condition~d m~dia was derived from cells incubated with
fr-sh ~eru~-free media for 48 hours. The conditioned
m~d~a w~ centrifuged, acidified and dialyzed in
~8p~ctr~por 3 ~embran~ (3.500 MW, cut of~) Thomas
~hll~delaphia, PA~ against 1 M acetic acid and
~u~sequently lyophiliz~d. Tho acid-soluble material
w~8 appli~d to a ~ioCel P-60 column (4 x 100 cm),
2guilibratsd with 1 M acetic acid. ~ractions
containing 10 ml were collected an~ aliquots of
s~lected column ~ractions analyzed by Wes~ern ~lot
an~lysi~ u3ing the ~3III antibody for detection. Two
pe~ks of cros~-reactive bands were found which
..
. . . .
'
,
~J a ~ ~ ~ pCT/US90/0~7~3
90/14360
- 111 --
correspond to preCursOr and mature forms of TGF-~3,
respectively. Fractions containing the mature TGF-
~protein were pooled and partlally lyophilized. This
pool was neutralized with 2M Tris to pH 7 and passed
through an affinity column of ~3V antibody coupled to
protein A agarose with dimethylpimelimidate using
standard procedures as described by Harlsw and Lane
(Antibodies, A La~oratory Manual, Cold Spring ~ar~or
~aboratory, Cold Sprinq Harbor, ~988). After extensive
washi~g with buffer A (0.1 M Tri~ ~CL pH 7.5, 10 mM
tO EGTA, 1 mM PMSF, 1% Triton) and burfer A ~1~ NaCl, and
finally with 20 mM Tris-HCl pH 7.5, the T~F-~3 protein
was eluted with 50 mM glycine -HCl pH 2Ø Figure 52
shows a silver stain of purified TGF-~3 and TGF-~l
(Calbiochem). TGF-~3 (lO0 ng) (lanes 1 and 3) and TGF-
~l (lanes 2 and 4) were ele~trophoresed on 12 0 5%
polyacryla~ide gels treat~ng the samples in the absenee
(lane 1 and 3) or presence (lanes 2 and 4) of 1~ ~M
DTT in the loading buffer. Fractions were analyzed by
silver stain and Western blot analysis and peak
2n fractions pooled. The silver stained gel showed asin~le band of 12kDa and 24 kDa under reducing and non-
reducing conditions, respectively (Figure 52). The
detection of a single silver staining band indica~es
t~at the preparation is greater than 90% homo~eneous.
E~focts o~ Reco~binant TGF-~3 on the Growth of Cell
Lin~ in Culture
The e~fect of TGF-~3 on the growth of Yariou~ cell
line3 is shown in ~able lO. Growth was determined
using a modification of the monolayer assay for tu~or
growth inhibitory activity de~c~ibed in the Materials
and Hethods section of the "First Series of
Experiments~. Cells were subcultured on 96-well tissue
-' ' ,
WO90/14360 ~ ~ 3 'j ~ PCT/US90/02753
- 112 -
culture plates in 100 ~1 of media at a seeding density
of-2 x 10 cells per well. Except for MCF-7, the
above-identified cells we~e maintained and assayed in
Dulbecco's modified Eagle's medium containing 10% feta1
bovine serum and 2% L-glutamine- MCF-7 was maintained
in Dulbecco'~ modified Eagle's medium containinq 10~
fetal bovine serum, 2S L-glutamine and 1% sodium
pyruvate. Cells were treated with 25 ng/ml of TGF-~3,
labeled 24 hours with 5~ odo-2'deoxyuridine when
cells in the untreated control wells were 90% confluent
and harvested as described.
In Ta~le 10, it is observed that recombinant TGF-~3 has
only mini~al effect on normal human fibroblasts while
significantly inhibiting mink lung cells (CC~ 64) and
hum~n tumor cells from lung, skin, colon and breast
tumor tis~ue.
Antibodies Whl~h Neutralize TGF-Q3 ActivitY
2n Purified recombinant TGF-~3, at concentrations from
3.125 to 0.049 ng/ml, was incubated with S ug/ ml of
af~inity puriried polyclonal rabbit antibodies (B3III
and B3V antisera) for 3 hours at 37~C. Contrcl TGF-~3
wa~ incubatad without antibodies. Growth inhibition of
uink cells by antibody treated and control untreated
TGr-~3 wa~ datermined as descr~ed above. Figure 53
~how~ that the ~3V antisQra (clo~ed squares ) dècreases
t~e growth inhibitory ac~ivity of TGFo~3 on mink cells
relativ~ to thQ growth inhibitory activity of identical
concentrations o~ TGF-~3 in either the ab~ence of
antibody tclosed circle~) or tre~ted with ~3III
antisera (open sguares). Neither antisera had any
si~nificant effect on the growth of CCL 64 cell~ in the
absenca o~ TGF-~3. Antibodie5 against the TGF-~3
,- - , , ~:
.
,. . .
, . - .. . .
.. ~ . . . .
~> 90/~4361) 2 ~ PCI/US90/02753
-- 113 --
peptide 3V are apparently neutralizing the gro~th
inhibitory activity of TGF-~3.
,. . .. . . .
.
.
