Note: Descriptions are shown in the official language in which they were submitted.
WO90/l~W3 2 ~ ~ 7 3 2 3 PCT/US90/02890
CO-EXPRESSION OF HETEROMERIC RECEPTORS
BACKGROUND OF THE INVENTION
Many biologically important molecules are proteins,
which are composed of linear arrays of amino acid subunits.
Proteins can function as enzymes, antibodies or structural
proteins, among other things. Proteins whose function is
binding other protein, or non-protein molecules, and
thereby effect a chemical reaction are termed receptors.
When expressed in a living cell the functional
characteristics of proteins are determined by the sequence
of their amino acids that are, in turn, encoded by DNA
sequences termed genes. While many proteins are single
molecules encoded by a single gene, other proteins are
composed of two or more separate polypeptides which
associate spatially to form an active protein, each
polypeptide being encoded by a separate gene. Such
proteins are termed heteromers. Where such proteins
function as receptors, they are thus heteromeric receptors.
A particular category of protein, as defined by either
its characteristic structure or function, exhibits
variations in its function, which reflect differences in
the particular amino acid sequence. For example, in color
vision the receptors for the three different primary colors
are the three different rhodopsin- molecules which are
structurally related but functionally different.
Structural differences can also be important in diseases.
For example, the hemoglobin of most healthy people and the
hemoglobin of individuals with sickle cell anemia diffex by
a single amino acid. Some categories of proteins in fact
,exhibit immense variability. Such variability is important
because of the particular function of the protein.
Many proteins have multiple structural and functional
: . : - . -
- . . .
Uogo/14W~ ~r3 ~ )3 PCT/US90/02890
domains. In some cases the two different types of domains
can coincide. Antibodies are an example of a category of
proteins with two well defined structural and functional
domains which coincide. one of these domains which bind
antigen is functionally diverse and the other, the effector
domain, is function restricted. Antibodies are protein
comprising four associated polypeptides, two so-called
heavy chains, and two light Chains. The four polypeptides
associate to form a structure which can be thought of as
resembling a "Y", with the tip of the two arms being
binding sites which are able to selectively recognize. and
bind to molecules called antigens, which the body
recognizes as foreign. ~he binding site of the heavy chain
is termed VH, while the binding site of the light chain is
termed VL. Each arm of the "Y" is called a Fab fragment
because it contains the antigen binding functional domain.
Such binding is important in order to effect the removal of
deleterious foreign materials, for example viruses or
bacteria. Because of the vast array of different antigens
which an organism may encounter, a vast array of different
antibodies are necessary. Such an array, or repertoire, is
achieved by an individual having many genes encoding
portions of the Vh and VL binding regions. In cells of the
immune system, random combinations of these various VH and
VL encoding genes can randomly associate in order to allow
the expression of upwards of 10 7 different antibody
molecules. This possibility arises because the VL and the
VH struc.ural domains are smaller -than the binding
functional -domain which is shared between these two
structural -domains. When a great diversity of
functionality can result from the combination of structural
~domains, the specific function of the-combination of any
two specific :structural domains --is ~ not predictable.
Therefore, there has been a longstanding problem in protein
engineering that combinations of s~ructural domains of
proteins which results in predictable function can only
generate limited functional diversity, whereas combination
.
..
: : `
~V090~14W3 2 ~ ~ 7 ~ 2 3 PCT/US90~02890
of structural domains which generate the diverse functions
are u~ually unpredictable. ~herefore, unpredictability has
hampered the construction of protein molecules with highl~
diverse potential functions. One approach to this problem
has been to attempt to increase the predictability of
protein design by the rational design of proteins using 3D
protein structures and computer algorithms. This approach
has not been generally successful. A radically different
approach to dealing with the unpredictability would be to
construct a very large number of proteins each of which
potentially have a desired function. When the
unpredictability is matched by the number of potentially
correct polypeptides which can be constructed and assayed
for a desired function then the problem of unpredictability
can be overcome. This has fundamental implications for
gene cloning and the design of proteins with predetermined
properties.
In the last 15 years, method have been developed in
order to produce by expression polypeptide-encoding genes
in bacteria, or other cells. This process, which is termed
gene cloning, provides the tremendous advantage of allowing
the production of large amounts of a particular protein.
Genes must be cloned on the basis of their sequence
structure or on the basis of the function of the expressed
protein. However, until recently it has only been possible
to identify single gene clones from a gene library in E.
coli, when the cloned genes are to be identified by the
function of the expressed protein.~'Thus it has~not`been
possible to, for example, reproduce 'the' variety of
different forms of functions in E. coli. Moreover, even
hybridoma technology, which results-in''large -amounts of a
single antibody species, suffers ~from~thè-inàbility to
recreate the vast repertoire:-of antibody species which can
be made even by a single organism, much less those which
could be generated within or between species. The ability
to generate and screen large repertoires of heteromers in
.. . . . . . . . .
- - :,
. '' ~' - ' ~ .
WO ~/l4W3 ~ 9 ~ 3 PCT/~S90/02890
." ~
vitro would potentially allow the selection of particular
heteromers having a particular desired function.
There thus exists a long-felt need for a method which
can produce vast repertoires of heteromers composed of a
plurality of polypeptides each encoded by separate DNA
sequences. ~he present invention satisfies this need and
provides related advantages as well.
,
10SUMMARY OF THE INVENTION
The invention provides a composition of matter
comprising' a plurality of procaryotic cells''containing
diverse combinations of first and second DNA sequences
15 encoding first and second polypeptides that can be ~;.
expressed and which form heteromeric receptors and at least
one of the plurality of procaryotic cells expressing a
heteromer exhibiting binding activity towards a preselected
molecule.
20The invention further provides a kit for the
preparation of vectors useful for the coexpression of two
or more DNA sequences, comprising two vectors, a first
. vector having a first combining site on a defined side of
a cloning site which defines orientation and a second
vector with a second combining site and a cloning site of
orientation asymmetric to that of the first vector, wherein
one ~or both of the .-vectors contains'~a promoter for
expressing polypeptides which form~heteromeric receptors
- encoded by DNA sequences inserted in the cloning sites~ ''
- , . . . ......... .. ~ . . .
30 ~;.. ,.. The invention still further provides a method of ~ :
constructing a-diverse population of vectors having first
. and.,second DNA sequences encoding ''first and second
.~ polypeptides which associate to form heteromeric receptors,
comprising the steps of
. (a) operationally linking a diverse population
.... . . . ~ ~ , .
WO90/l4W3 2 ~ 5 7 ~ 2 3 PCT/US90t~2890
of first dna sequences encoding the first polypeptides to
a first vector having a combining site and a cloning site
in a defined orientation;
(b) operationally linking a diverse population
of second dna sequences encoding the second polypeptides to
a second vector having a combining site compatible with the
combining site on the first vector and a cloning site in an
asymmetric orientation to that of the first vector:
~c) combining the vector products of step (a)
with the vector products of step (b) under conditions to
permit their combination into a combined vector having the
first and second dna sequences operationally linked
thereon. The combining can be accomplished for example, by
restriction endonuclease cleavage of the vectors of step
(a) and (b) and combining the cleaved vectors of step (a)
and (b) with DNA ligase or combining by Flp recombinase.
BRIEF DESCRIPTION OF THE DRAWINGS
- ::
Figure 1 shows a schematic diagram of the light chain
vector (lambda LCl), the heavy chain vector (lambda Hc2)
and the combinatorial vector.
Figure 2 shows nucleotide sequences of the synthetic
olig,onucleotides inserted into lambda Zap II to create the
(A) light chain vector (lambda Lcl) and (B) heavy chain
vector (lambda Hc2) of Figure 1.
Figure 3 shows autoradiographs of library screens for
the combinatorial (A and B), the heavy chain (E and F) and
for the light chain (G and H) libraries. Filter C and D
~represent the cored positive from a primary filter A.
.. ... . .
Figure 4 shows the specificity of antigen binding by
3S competitive inhibition.
Figure 5 is a schematic diagram representing the
: - , :: : : ... ... . , . ::
- ~ ;~ . :: . :
~ . , : - . .,
. :: ' - .'':
.
: ~ , . . . ~ .
WOg0/l~W3 2 ~ ~ 7 ~ 2 3 PCT/US90/02890
6 -
plasmids which can be excised from the combinatorial
vector.
Figure 6 shows the characterization of an antigen
binding protein derived from the combinatorial library.
Figure 7 shows the construction of a vector system for
a combinatorial vector using the Flp recognition sequence
as the combining site.
DETAILED DESCRIPTION OF THE INVENTION
As used herein "diverse combinations" means that a
substantial number of the possible nucleic acids encoding
the first polypeptide are combined with a substantial
number of the possible nucleic acids encoding the second
polypeptide. Thus, a substantial number of the possible
combinations are represented.
- ~s - used herein "heteromeric receptors" means a
polypeptide comprised of at least two polypeptides, at
least one of which is encoded on a different DNA. Thus,
heteromer is composed of two or more polypeptides which
associate and exhibit a common function. Receptor refers
toi a polypeptide which is capable of binding any ligand.
Therefore, receptor also includes a protein which when
bound to its ligand can affect a second process. Examples
of heteromeric receptors which can be formed include
antibodies, T-cell receptors, integrins, hormone receptors
and transmitter receptors.
. . .
As used herein "binding activity" means the heteromer
exhibits an affinity for a molecule. This affinity can be
specific for the molecule and can be used, for example, to
detect or affect a function on the molecule.
As used herein "preselected molecule" means a
Wogo/l4W3 PCT/US90/02890
2~792~
particular molecule to which binding activity is desired.
Since practically any molecule can be bound, this molecule
is selected from the group of all possible molecules.
Specific heteromers can be created which specifically bind
5 ~this molecule and allow for detection or to affect the
molecule's function.
As used herein "first and second polypeptides which
can associate" means the polypeptides encoded by the first
and second nucleotide sequences are chemically or
physically attracted to each other and form a heteromer.
.
As used herein "combining site" means a nucleotide
sequence which can be cleaved and joined with another
nucleotide sequence. Such cleavage and joining results in
a nucleic acid having both sequences in proper orientation
to allow translation of the desired polypeptide.
.
As used herein "asymmetric" means a non-identical or
a non-correspondence in form, size or arrangement of parts
on opposite sides of a boundary such as a dividing line or
around an axis. For example, the arrangement of 2
different restriction sites with respect to the 5' and 3'
ends of a DNA sequence are asymmetric if they are arranged
in one vector in the opposite orientation as that for a
second vector.
;As used herein "transfect" or "transform" refers to
introducing nucleic acids into a livinq cell such that the
. .
nucleic acid is fully separated from extracellular fluids
by a lipid membrane.
3 . As used herein as it relates to combinatorial gene
- expression, the term "in vitro" refers to performing the
process in a system in which a particular expression does
not natur~lly occur, thus, in vitro can refer both to
expression in procaryotic cells as well as eucaryotic
.
.. .
WO90/l4~3 2 ~ PCT/~S90/02890
8 ! ~
cells, provided the latter does not naturally express the
gene combination.
The invention provides a composition of matter
comprising a plurality of procaryotic cells containing
diverse combinations of first and second DNA sequences
encoding first and second polypeptides that can be
expressed and which form heteromeric receptors and at least
one of the plurality of pxocaryotic cells expressing a
heteromer exhibiting binding activity towards a preselected
molecule. -: -
The procaryotic cells are preferably E. coli, howeverany suitable procaryotic cell can be utilized. Suitable
alternative cells would be selected by reviewing the
literature to determine which vector and cells could be
adapted by the methods taught herein. Therefore,
alternative cells require compatible vectors capable of
expressing first and second DNA sequences in the selected
host cell. Alternatively, eucaryotic cells could be used.
Such use would simply require subst'ituting eucaryotic
control and expression elements which function in a
compatible eucaryotic host. Therefore, for procaryotic and
eucaryotic systems, compatibility means that the
vector/host combination contains all necessary signals and
factors to perform the desired function.
; For this invention, including cells, vectors, and
methods utilizing the vectors, the first and second DNA
sequences which encode functional portions of heteromeric
receptors can for example be antibodies, T cell receptors,
integrins, hormone receptors and transmitter receptors.
Thus, the first and second DNA sequences can encode
functional portions of the variable heaYy and variable
light chains of an antibody including''Fab, F'ab and the
like. In fact, any heteromer which is formed from a
diverse combination or repertoire of alternative coding
.. ~ . ~ . . ~ ,
.
; ~ . ,
. . ' ;
WO90/14~3 2 ~ ~ 7 ~ 2 3 PCT/US90/02890
9 " ' `
sequences can be made by the methods of this invention.
For example, specific hormone and transmitter receptors can
be made by combination of alpha and beta subunits. Thus,
the invention is easily applicable to any later discovered
alternative-type, diverse combination heteromers.
The invention also provides a composition of matter
comprising a plurality of procaryotic cells containing
various combinations of diverse first and second DNA
sequences encoding first and second polypeptides which can
associate to form heteromeric receptors exhibiting binding
activity towards preselected molecules, the diversity of
first DNA sequence being-greater than about lO0 different
sequences and the diversity of the second DNA sequence
being greater than about lOOO different sequences. The
invention is effective with such diversity since the upper
limit is greater than a billion combinations.
The invention further provides a kit for the
preparation of vectors useful for the coexpression of two
or more DNA sequences, comprising two vectors, a first
vector having a first combining site on a defined side of
a cloning site which defines orientation and a second
vector with a second combining site and a cloning site of
orientation asymmetric to that of the first vector, wherein
one or both of the vectors contains a promoter for
expressing polypeptides which form heteromeric receptors
encoded by DNA sequences inserted in the cloning sites.
The vectors can be in a virus. Suitable virus can include
mammalian as well as bacteriophages. One would apply the
teachings set forth herein to utilize such vectors.
- Alternatively, the vectors can be a plasmid.
: . . . , j ~
The first and second combining sites of the vectors
of the invention are of many possible types. The specific
sites utilized herein are EcoRI-EcoRI, and NotI-NotI and
the specific cloning site was selected from the group
': . - . .
. . .
W090/14~3 c PCT/US90/02890
2 ~ 1 o
consisting of XhoI-SpeI, SacI-XbaI, and SacI-SpeI.
Additionally, the first and second combining sites can be
site specific recombination sites, especially Flp
; recombination sites. Alternative sites can be practiced
S based on the disclosure of this invention.
The invention also provides a vector, capable of
expressing a heteromer exhibiting binding activity towards
a preselected molecule when combined with a second vector,
having a first combining site on a defined side of a
cloning site which defines orientation and which can be
combined witn a second vector with a second combining site
and a cloning site of orientation asymmetric to that of the
first vector, wherein one or both of the vectors contains
a promoter for expressing polypeptides which form
heteromers encoded by DNA sequences inserted in the cloning
sites.
The invention still further provides a cloning system
for the coexpression of two DNA sequences encoding
polypeptides which associate to form a heteromer,
comprising a set of uniform first-vectors having a diverse
population of first DNA sequences and a set of uniform
second vectors having a diverse population of second DNA
sequences, the first and second vectors having compatible
co~bining sites so as to allow the operational combination
of the first and second DNA sequences.
~ . . .
The invention also provides a plurality of expression
vectors containing a plurality of possible first and second
DNA sequences, wherein each of the expression vectors has
operationally linked thereon a first DNA sequence and a
second DNA sequence, and wherein substantially each of the
vectors contains a different combination of first and
second DNA sequence.
The-invention still further provides a method of
-,
. ,, .: . ~ ~ :
. ; .
WO90/1~W3 2 ~ ~ 7 ~ 2 3 PCT/US9~/02890
constructing a diverse population of vectors having first
and second DNA sequences encoding first and second
polypeptides which associate to form heteromeric receptors,
comprising the steps of
(a) operationally linking a diverse population
sf first DNA sequences encoding the first polypeptides to
a first vector having a combining site and a cloning site
in a defined orientation;
(b) operationally linking a diverse population
of second DNA sequences encoding the second polypeptides to
a second vector having a combining site compatible with the
combining site on the first vector and a cloning site in an
asymmetric orientation to that of the first vector,
(c) combining the vector products of step (a)
with the vector products of step (b) under conditions to
permit their combination into a combined vector havi~g the
first and second DNA sequences operationally linked
thereon. ~he combining can be accomplished for example, by
restriction endonuclease cleavage of the vectors of step
(a) and (b) and combining the cleaved vectors of step (a)
and (b) with DNA ligase or combining by Flp recombinase.
A method of selecting a procaryotic cell which
expresses a heteromer specific for a preselected molecule
is also provided. The method comprises randomly combining
first vectors having a diverse population of DNA sequences
encoding polypeptides with second vectors having different
diverse populations of DNA sequences which encode
- polypeptides and which form heteromeric'receptors-'with the
polypeptides encoded by the first vector, transfecting a
sufficient number of the randomly combined sequences into
the procaryotic cells, screening the cells to determine the
cell expressing a heteromex specific for'the preselected
molecule. In this method the combining can be accomplished
with restriction endonuclease clea~age of the first and
second vectors and ligating the cleaved first and second
vectors or utilizing Flp recombinase. Additionally, the
WO90/l~W3 ~ ~ 5 7 9 2 3 PCT/~S90/02890
12
number of randomly combined sequences can be sufficiently
equivalent to the possible combinations of the populations
of the first and second DNAs in order to reasonably assure
obtaining the desired heteromer.
.
Finally, a method- is provided for identifying
functional heteromeric receptors composed of a plurality
of polypeptides, comprising coexpressing random
combinations of first and second-DNA:homolsgs which encode
polypeptides which associate to form heteromeric receptors
so as to form a diverse population of the first and second
DNA homologs, the diversity being at least enough that at
least one heteromer formed by the polypeptidss resulting
from the coexpression has a desired functional property
and restricted so that the heteromeric receptors can be
screened for a predetermined function.
In the methods utilized herein, random combination in
vitro or in vivo can be accomplished using two expression
vectors distinguished from one another by the location of
an endonuclease recognition site common to both.
Preferably the vectors are linear double stranded DNA, such
as a-lambda ZapT~ derived vector as described herein which
are symmetric with respect to the protein expression
elements. Preferably, in one of the vectors the
recognition site is located 5' terminal to the coding
sequence of at least one of the complementary determining
regions (CDR's). ~In-~he.second vector-the recognition site
is located 3'~to at -least one of the CDR's. For example,
the recognition site in one vector can be located between
a ribosome binding site and-a RNA polymerase promoter site
and in the second vector the restriction is located 3' to
a cloning site.
.. .. ~ , . .
: .. , , . ; . :.:: . .
The recognition site can be a restriction endonuclease
. . .
recognition site, a recombinase recognition site such as a
Flp site, or other equivalent site. In one preferred
:,
WO9o/l4~3 ~ ~ ~ 7 ~ 2 3 PCT/US90/02890
13
embodiment of the invention, each of the vectors defines a
nucleotide sequence coding for a ribosome binding site and
a leader, the sequence being located between the promoter
and the polylinker, but downstream (3' terminal from a
shared restriction site if that site is between the
promoter and the polylinker). Also preferred are vectors
containing a stop codon downstream from the polylinker.
The first and/or second vector can also define a nucleotide
sequence coding for a polypeptide which can function as a
tag. Examples of such a tag include (1) a short peptide
sequence, (2) a sequence that encodes a protein, which
binds to a receptor such as another predetermined antibody
or protein G, such as a CHl domain of an antibody, (3) a
protein that can function as an enzyme (such as beta-
galactosidase or alkaline phosphatase) or (4) a phage coatprotein that causes the phage to become attached to the
coat of the phage. The taq sequence is typically downstream
from the polylinker but upstream of any stop codon that may
be present. In the preferred embodiments, the vectors
contain selectable markers such that the presence of a
portion of that vector, i.e. a particular lambda arm, can
be selected for or selected against.
~ ypical selectable markers are well known to those
skilled in the art. Examples of such markers are
antibiotic resistance genes, genetically selectable
markers, suppressible mutations, such as amber mutations,
and the like. The selectable markers are typically located
upstream and/or downstream of the promoter or-polylinker.
In preferred embodiments, one selectable marker is loca~ed
upstream of the promoter on the first vector containing the
VH-coding (variable heavy chain-coding) DN~ sequences. A
second selectable marker is located on the other side of
the combination site on the vector containing the VL-coding
(variable light chain-coding) DNA sequences. This second
selectable marker may be the same or different from the
first as long as when the VH-coding vectors and the VL-
WO90/1~W3 2 ~ 7 3 2 3 PCT/US90~02890
1~
codinq vectors are randomly combined at the combining sitethe resulting vectors containing both VH and VL can be
selected preferentially.
5Typically the polylinker is a nucleotide sequence that
defines one or more, preferably at least two, restriction
sites. The polylinker restriction sites are oriented to
permit ligation of VH- or VL-coding DNA homologs into the
vectors in the same reading frame at the lé'ader, tag,
linker, tag, or stop codon sequence present.
Random combination is accomplished by ligating VH-
coding DNA homologs into the first vector, typically at a
restriction site or sites within the polylinker.
Similarly, VL-coding DNA homologs are ligated into the
second vector, thereby creating two diverse populations of
vectors. It does not matter which type of DNA homolog,
i~e., VH or VL, is ligated to which vector, but it is
preferred, for example, that all VH coding DNA homologs are
ligated to either the first or second vector, and all of
the VL-coding DNA homologs are ligated to the other of the
first or second vector. The members of both populations
are combined at the combination site. In a preferred
embodiment where the combination site is a restriction site
and the members of both populations are then cleaved with
an appropriate restriction endonuclease. The resulting
products are two diverse populations of restriction
fragments where the members of one have cohesive termini
complementary to the cohesive termini of the membe'rs of the
other. -
---- -- -- ....................................... .
The following examples are intended to illustrate but
not limit the i~vention. ' While they are typical of''those
that might be used,-other procedures known to those-skilled
in the art may be alternatively employed.
~ :
WO90/1~3 2 0 3 ~ PCT/US90/02890
15 '
EXAMPLE I
VECTOR CONSTRUCTION
The vectors for expression of VH~ V~, Fv (fragment of
the variable region), and Fab seauences are diagrammed'in
Figures 1 and 2. They were constructed by a modification
of lambda Zap II, (Stratagene, La Jolla, CA): Short et al.,
Nucleic Acids Res., 16:7583^(1988) which is incorporated
herein by reference, in which we inserted 'synthetic
oligonucleotides into the multiple cloning site. The
methods described here and below are known to Qne skilled
in the art and are described in detail in Maniatis et alO ~
Molecular Clonina: A _Laboratory Manual, -Cold Spring
Harbor, 1982 and Ausubel et al., and Current Protocol~s on
Molecular Biology, John Wiley and Sons, 1987, both of which
are incorporated herein by reference. The vectors were
designed to be asymmetric with respect to the Not I and Eco
RI restriction sites that flank the cloning and expression
sequences. This asymmetry in the placement of restriction
sites in a linear vector such as bacteriophage allows a
library expressing light chains to be combined with one
expressing heavy chains in order to construct combinatorial
Fab expression libraries.
The lambda Lc 1 vector was constructed for the cloning
of PCR amplified products of mRNA that code for light chain
protein, as described in Example II, by inserting the
nucleotide sequence shown in-figure 2A into the-'Sac I and
Xho I sites of lambda Zap II. The vector was prepared by
digesting lO ~g of lambda arms from the Uni ZapT~ XR Vector
Kit (Stratagene, La Jolla, CA~ with Sac I. The sequence
shown in Figure 2A was constructed from overlapping
synthetic oligonucleotides and cloned into the above Sac I
digested arms as follows. Oligonucleotides Ll through L5
and L7 - L9 (Ll, L2, L3, L4, L5, L7, L8 and L9) (shown in
Table 1) were kinased by adding 1 ~1 of each
oligonucleotide (0.1 ~g/~l) and 20 units of T
WO90/1~W3 , PCT/US90/02890
2~57~ 16
polynucleotide kinase (BRL, Gaithersburg, M~) to a solution
containing 70 mM Tris HCL at pH 7.6, O.l M KCl, lO mM MgCl2,
5 mM DTT, 1 mM adenosine triphosphate (ATP), lO mM 2 ME,
500 micrograms per ml of BSA. The solution was maintained
at 37 C for 30 minutes and the reaction stopped by
maintaining the solution at 65 C for lO minutes. The two
end oligonucleotidas L6 and LlO were added to the above
kinasing reaction solution together with l/lO volume of a
solution containing 20 mM Tris-HCL at pH 7.4, 2.0 mM MgCl2
and 50.0 mM NaCl. This solution was heated to 70-C for 5
minutes and allowed to cool slowly to room temperature.
During this time period all oligonucleotides annealed to
form the double stranded synthetic DNA insert shown in
Figure 2A. The annealed oligonucleotides were covalently
linked to each other by adding 40 ~l of the above reaction
to a solution containing 66 mM Tris-HCL at pH 7.6, 6.6 m~
MgCl2, 1 mM DTT, 1 mM ATP and lO units of T4 DNA ligase
(BRL, Gaithersburg, MD). This solution was maintained at
25 C for 30 minutes and then the T4 DNA ligase was
inactivated by heating the solution at 65C for lO minutes.
The unphosphorylated ends of the resultant oligonuleotides
were kinased by mixing 52 ~l of the above reaction, 4 ~l of
a solution containing lO ~M ATP and 5 units of T4
polynucleotide kinase. This solution was maintained at
37-C for 30 minutes and then the T4 polynucleotide kinase
was inactivated by heating the solution`at 65-C for lO
minutes. The phosphorylated synthetic DNA insert was
ligated directly into the above prepared lambda Zap II
vector arms.
:
: . . ...
,. , ~ ;,
- .
WO9Q/14~3 2 ~ ~ 7 9 2 3 PCT/US90/02890
17
TABLE 1
Ll TGAATTCTAAACTAGTCGCCAAGGAGACAG
L2 TCATAATGAAATACCTATTGCCTACGGCAG
L3 CCGCTGGATTGTTATTACTCGCTGCCCAAC
L4 CAGCCATGGCCGAGCTCGTCAGTTCTAGAG
L5 TTAAGCGGCCGCAA
L6 TCGATTGCGGCCGCTTAACTCTAGAACTGACGA
L7 GCTCGGCCATGGCTGGTTGGGCAGC~AGTA
L8 ATAACAATCCAGCGGCTGCCGTAGGCAATA
L9 GGTATTTCATTATGACTGTCTCCTTGGCGA
LlO CTAGTTTAGAATTCAAGCT
TABLE 2
Hl GGCCGCAAATTCTATTTCAAGGAGACAGTC
H2 ATAATGAAATACCTATTGCCTACGGCAGCC
H3 GCTGGATTGTTATTACTCGCTGCCCAACC
H4 AGCCATGGCCCAGGTGAAACTGCTCGAGA
. H5 TTTCTAGACTAGTTACCCGTACGACGTTCC
H6 GGACTACGGTTCTTAATAGAATTCG
H7 TCGACGAATTCTATTA
H8 AGAACC~TAGTCCGGAACGTCGTACGGG
H9 TAACTAGTCTAGAAATCTCGAGCAGTTTC
H10 ACCTGGGCCATGGCTCCTTGGGCAGCGAGT
Hll- AATAACAATCCAGCGGCTGCCGTAGGCAA
H12 TAGGTATTTCATTATGACTGTCTCCTT
, H13 GAAATAGAATTTGC
.
. The lambda Hc 2 vector was constructed for cloning PCR
amplified products coding for heavy chain Fd sequences, as
described in Example II, by inserting the nucleotide
sequence shown in Figure 2B into the Not I and Xho I sites
of lambda Zap II. As with the light chain vector, the
heavy chain vector was prepared by digesting lambda arms
from the Uni-ZapTH XR Vector Kit (Stratagene, La Jolla, CA)
with Not I. This was accomplished by digestion of 10 ~g of
: ~ - , . :
:
. , . . . . : - ::
- ~ . :
W~90/1~W3 ~ PCT/US9Ot~2890
:L8
vector in 100 ~1 reaction buffer for 1 hour at 37 C, after
digestion the DNA was extracted, precipitated and dried as
above. The inserted sequence shown in Figure 2B was
constructed from the overlapping synthetic oligonucleotides
Hl-H13 depicted in Table 2 as outlined above. Correctly
constructed vectors were confirmed by DNA sequence analysis
as described below.
The sequence of the oligonucleotides described above
include elements for construction, expression, and
secretion of Fab fragments. These oligonucleotides
introduce the asymmetric Not I and Eco RT restriction
sites; a leader peptide for the bacterial ~el B aene, which
has previously been successfully used in E. coli to secrete
Fab fragments, Better et al., Science, 240:1041 (1988);
Skerra and Pluckthun, Science, 240:1038 (1988), both of
which are incorporated herein by reference, a ribosome
binding site at the optimal distance for expression of the
cloned sequence; cloning sites for either the light or
heavy chain PCR product; and, in lambda Hc 2, a decapeptide
tag at the carboxyl terminus of the expressed heavy chain
protein fragment. The sequence of the decapeptide tag was
useful because of the availability of monoclonal antibodies
to this peptide that were used for immunoaffinity
purification of fusion proteins, Field et al. Mol. Cell
Biol., 8:2159 tl988), which is incorporated herein by
reference. The vectors were characterized by restriction
digest analysis and DNA sequencing, Sanger et al., Proc.
Natl. Acad. Sci. USA, 74:5463-5467 (1977), which is
incorporated herein by reference and using AMV Reverse
Transcriptase 35S-ATP Sequencing Kit ~Stratagene, La Jolla,
CA~.
: ,
~ .
WO90/14~3 2 ~ ~ 7 3 ~ 3 PCT/US90/02890
19
EXAMPLE II
Isolation of mRNA and PCR
Amplification of Antibody Fragments
The initial Fab expression library was constructed
from mRNA isolated from a mouse that had been immunized
with the KLH-coupled p-nitrophenyl phosphonamidate antigen
l-(NPN). NPN was coupled to keyhole limpet hemocyanin
(KLH) using the techniques described in Antibodies: A
Laboratory Manual, Harlow and Lowe, eds., Cold Spring
Harbox, New York (1988), which is incorporated herein by
reference. Briefly, 10.0 milligrams (mg) of keyhole limpet
hemocyanin and 0.5 mg of NPN with a glutaryl spacer arm N-
hydroxysuccinimide linker appendages. Coupling was
performed as in Jonda et al., Science, 241:1188 (1988),
which is incorporated herein by reference. The unbound NPN
was removed by ael filtration chromatography through
Sephadex G-25.
The KLH-NPN conjugate was prepared for injection into
mice by adding 100 ~g of the conjugate to 250 ~1 of
phosphate buffered saline (PBS~. An equal volume of
complete Freund's adjuvant was added and emulsified the
entire solution ~or 5 minutes. A 129 G~x~ mouse was injected
with 300 ~1 of the emulsion. Injections were given
subcutaneously at several sites using a 21 gauge needle.
A second immunization with KLH-NPN was given two weeks
later. This injection-was prepared as foliows: 50 ~g of
KLH-NPN were diluted in 250 ~L of PBS and an equal volume
of alum was mixed with the KLH-NPN solution. The mouse was
injected intraperitoneally with 500 ~1 of the soiution
using a 23 gauge needle. - One month later the mice were
given a final injection of 50-~g of the-KLH-NPN conjugate
diluted to 200 ~L in PBS. This injection was given
intravenously in the lateral tail vein using a 30 gauge
needle. Five days after this final injection the mice were
. - : .
. .: : - : : :~ . : . - -
:., .
:
W090/l~W3 2 0 ~ 7 ~ ~ 3 20 PCT/US90/02890
sacrificed and total cellular RNA was isolated from theirspleens.
Total RNA was isolated from the spleen of a single
S mouse i~munized as described above by the method of
Chomczynski and Sacchi, Anal. ~iochem., 162:156-159 (1987),
which is incorporated herein by reference. Briefly,
immediately after removing the spleen from the immunized
mouse, the tissue was homogenized in 10 ml of a denaturing
solution containing 4.0 M guanine isothiocyanate, 0.25 M
sodium citrate at pH 7.0, and 0.1 M 2-mercaptoethanol using
a glass homogenizer. One ml of sodium acetate at a
concentration of 2 M at pH 4.0 was mixed with the
homogenized sp~een. One ml of saturated phenol was also
mixed with the denaturing solution containing the
homogenized spleen. Two ml of a chloroform:isoamyl alcohol
(24:1 v/v) mixture was added to this homogenate. The
homogenate was mixed vigorously for ten seconds and
maintained on ice for 15 minutes. The homogenate was then
transferred to a thick-walled 50 ml polypropylene
centrifuge tube (Fisher Scientific Company, Pittsburgh,
PA). The solution was centrifuged at 10,000 x g for 20
minutes at 4-C. The upper RNA-containing aqueous layer was
transferred to a fresh 50 ml polypropylene centrifuge tube
and mixed with an equal volume of isopropyl alcohol. This
solution was maintained at -20~C for at least one hour to
precipitate the RNA. The solution containing the
precipitated RNA was centrifuged at 10,000 x g-for twenty
minutes at 4-C. The pelleted total cellular RNA was
collected and dissolved in 3 ml of the denaturing solution
described above. Thre~ ml of isopropyl alcohol was added
to the resuspended total cellular RNA and vigorously mixed.
This solution was maintained at -20 C for at least l-hour
to precipitate the RNA. The solution containing the
precipitated RNA was centrifuged at 10,000 x-g for ten
minutes at 4-C. The pelleted RNA was washed once with a
solution containing 75% ethanol. The pelleted RNA was
' `'': ~ : :
: . . .
.~ . '
WO90/1~43 20~7~23 PCI/US9U/0289U
dried under vacuum for 1~ minutes and then resuspended in
dimethyl pyrocarbonate (DEPC) treated (DEPC-H2O) H2O.
Poly A~ RNA for use in first strand cDNA synthesis was
prepared from the above isolated total RNA using methods
described by Aviv and Leder, Proc. Natl. Acad. Sci., USA,
69:1408-1412 (1972~, which is incorporated herein by
reference. Briefly, one half of the total RNA isolated
from a single immunized mouse spleen prepared as described
above was resuspended in one ml of DEPC-treated dH2O and
maintained at 65~C for five minutes. One ml of 2x high
salt loading buffer (100 mM Tris-HCL at pH 7.5, 1 M sodium
chloride,-2.0 mM disodium ethylene diamine tetraacetic acid
(~DTA) at pH 8.0, and 0.2% sodium dodecyl sulfate (SDS))
was added to the resuspended RNA and the mixture was
allowed to cool to room temperature. The mixture was then
applied to an oligo-dT (Collaborative Research Type 2 or
~ype 3) column that was previously prepared by washing the
oligo-dT with a solution containing 0.1 M sodium hydroxide
and 5 mM EDTA and then equilibrating the column with DEPC-
treated dH2O. The eluate was collected in a sterile
polypropylene tube and reapplied to the same column after
heating the eluate for 5 minutes at 65-C. The oligo dT
column was then washed with 2 ml of high salt loading
buffer consisting of 50 mM Tris-HCL at pH 7.5, 500 mM
sodium chloride, 1 mM EDTA at pH 8.0 and 0.1% SDS. The
oligo dT column was then washed with 2 ml of 1 X medium
salt buffer (50 mM Tris-HCL at pH 7.5, 100 mM sodium
chloride, 1 mN EDTA at pH 8.0 and 0.1% SDS). The mRNA was
eluted with 1 ml of buffer consisting of 10 mM Tris-HCL at
pH 7.S, 1 mM EDTA at pH 8.0 and 0.05% SDS. The messenger
RNA was ?purified by extracting this solution with
phenol/chloroform followed by a single extraction with 100%
chloroform, ethanol precipitated and resuspended in D~PC
treated dH2O.
In preparation for PCR amplification, mRNA was used as
.. . .
~, ' , . ,- '
WO90/l4~3 2 ~ 5 7 ~ 2 ~ PCT/US90/02890
22
a template for cDNA synthesis. In a typical 250 ~1
transcription reaction mixture, 5-lO~g of spleen mRNA in
water was first annealed with 500 ng (0.5 pmol) of either
the 3' V~ primer (primer 12, Table 3) or the 3' V~ primer
(primer 9, Table 4) at 65 C for 5 minutes. Subsequently,
the mixture was adjusted to contain 0.8 mM dATP, 0.8 mM
dCTP, 0.8 mM dGTP, 0.8 mM dTTP, 100 mM Tris-HCL (pH 8.6~,
10 mM MgCl2, 40 mM KCl, and 20 mM 2-ME. Moloney-Murine
Leukemia Virus (Stratagene, La Jolla, CA) Reverse
transcriptase, 26 units, was added and the solution was
incubated for 1 hour at 40C. The resultant first strand
cDNA was phenol extracted, ethanol precipitated and then
used in the polymerase chain reaction (PCR) procedures
described below for amplification of heavy and light chain
sequences.
Primers used for amplification of heavy chain Fd
fragments for construction of the lambda Hc 2 library is
shown in Table 3. Amplification was performed in eight
separate reactions, as described by-Saiki et al., Science,
239:487-491 (1988), which is incorporated herein by
reference, each reaction containing one of the 5' primers
(primers 2 to 9) and one of the 3' primers (primer 12~
listed in Table 3. The remaining 5' primers were used for
amplification in a single reaction are either a degenerate
primer (primer 1) or a primer that incorporates inosine at
four degenerate positions (primer 10). The remaining 3'
primer (primer 11) was used to construct Fv fragments. The
underlined portion of the 5' primers incorporates an Xho I
site and that of the 3' primer an Spe I restriction site
for cloning the amplified fragments into a lambda phage
vector in a predetermined reading frame for expression.
.. . . , ..... : ,
,, . . . , ... ~ .. . ,... --
.: : ~ . j : - ;
' ': : ; ' - ~ , :
- - . ~
,;,'~"' ' ' , " -." ,'" ' ', ' , ~' - ' - '-:
~ ~5 7323
WO90/l4~3 PCT/US90/02~90
23
TABLE 3
HEAVY CHAIN PRIMERS
CC G G T
1) 5'- AGGT A CT CTCGAGTC GG - 3'
GA A T A
2) 5' - AGGTCCAGCTGCTCGAGTCTGG - 3'
103) 5' - -AGGTCCAGCTGCTCGAGTCAGG - 3'
4) 5' - AGGTCCAGCTTCTCGAGTCTGG - 3'
5) 5' - AGGTCCAGCTTCTCGAGTCAGG - 3'
156) 5' - AGGTCCAACTGCTCGAGTCTGG - 3'
7) 5' - AGGTCCAACTGCTCGAGTCAGG - 3'
8) 5' - AGGTCCAACTTCTCGAGTCTGG - 3'
209) 5' - AGGTCCAACTTCTCGAGTCAGG - 3'
T
10) 5' - AGGTIIAICTICTCGAGTC GG - 3'
2511) 5' - CTATTAACTAGTAACG5TAACAGT -
GGTGCCTTGCCCCA - 3'
12) 5' - AGGCTTACTAGTACAATCCCTGG -
GCACAAT - 3'
.
Primers used for amplification of mouse kappa light
chain sequences for construction of the lambda Lc 1 library
is Fab's are shown in Table 4. These primers were chosen
to contain restriction sites which were compatible with
vector-and not present in the conserved seqùences of the
mouse light chain mRNA. Amplification was perfôrmed as
described by Saiki et al., Supra, in five separate
reactions,``each containing one of the 5' primers (primers
3 to 7)-and one of the 3' primérs (primer 9) listed in
Table 4. The remaining 3' primer (primer 8) was used to
construct Fv fragments. The underlined portion of the 5'
primers-depicts a Sac I restriction site and that of the 3'
primers an Xba I restriction site for cloning of the
amplified fragments into a lambda phage vector in a
.
.
.
2~7323
W090/l~W3 PCT/US90/02890
24
predetermined reading frame for expression.
TABLE 4
LIGHT CHAIN PRIMERS
1) 5' - CCAGTTCCGAGCTCGTTGTGACTCAGGAATCT - 3'
2~ 5' - CCAGTTCCGAGCTCGTGTTGACGCAGCCGCCC - 3'
3) 5' - CCAGTTCCGAGCTCGTGCTCACCCAGTCTCCA - 3'
4) 5' - CCAGTTCCGAGCTCCAGATGACCCAGTCTCCA - 3'
5) 5' - CCAGATGTGAGCTCGTGATGACCCAGACTCCA - 3'
6) 5' - CCAGATGTGAGCTCGTCATGACCCAGTCTCCA - 3'
7) 5' - CCAGTTCCGAGCTCGTGATGACACAGTCTCCA - 3'
8) 5' - GCAGCATTCTAGAGTTTCAGCTCCAGCTTGCC - 3'
9) 5' - GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA - 3'
PCR amplification for heavy and light chain fragments
was performed in a 100-~1 reaction mixture containing the
above described products of the reverse transcription
reaction (~5~g of the cDN~-RNA hybrid), 300 nmol of 3' VH
primer (primer 12, Table 1), and one of the 5 ' VH primers
(primers 2-9, Table 1) for heavy chain amplification, or,
300 nmol of 3' VL primer (primer 9, Table 2), and one of the
5' VL primers (primers 3-7, Table 2) for each light chain
amplification, a mixture of dNTPs at 200 mM, 50 mM KCl, 10
mM Tris-HCl (pH 8.3), 15 mM MgC12, 0.1% gelatin, and 2 units
of Thermus aquaticus DNA polymerase. The reaction mixture
was overlaid with mineral oil and subjected to 40 cycles of
amplification. Each amplification cycle involved
- denaturation at 92-C for 1 minute, annealing at 52-C for 2
minutes, and elongation at 72-C for 1.5 minutes. The
amplified samples were extracted twice with phenol/CHCl3 and
once with CHCl3, ethanol-precipitated, and stored at -70C
in 10 mM Tris-HCl, pH 7.5/1 mM EDTA.
. , - .
In preparation for cloning into the lambda Hc 2 or
lambda Vc 1 vectors equal volumes (50 ~1) of the above,
respective, PCR-amplified products were mixed, purified by
. . , - . ~ : ,
: ~ .. ~ , , ; , :
. . . .
.
2~7923
WO90/14~3 ~ PCT/US90/02890
phenol/ChCl3 extraction, ethanol precipitated and
resuspended at 1 ~g/~l in l0 mM Tris-HCl, pH 7.5/l mM EDTA.
The mixed products of heavy chain primer PCR amplification
were digested at 37-C with Xho I (125 units, Stratagene, La
Jolla, CA) and Spe I (l0 units, Stratagene, La Jolla, CA)
in 2.5 ~g/30 ~l of buffer containing 150 mM NaCl, 8 mM
Tris-HCl (pH 7.5), 6 mM MgSO4, 1 mM dithiothreitol, and
bovine serum albumin (200 ~g/ml). The mixed products of
amplification with light chain primers were digested with
200 units Sac I and 200 units Xba I in 33 mM Tris Acetate
pH 7.85, 66 mM K Acetate, l0 mM Mg Acetate, 0.5 mM DTT in
500 ~l at 37C for l hour for the light chain amplified
products and purified on a 1% agarose gel. After gel
electrophoresis of the digested PCR-amplified spleen mRNA
lS the region of the gel containing DNA fragments of 700 base
pairs (bp) was excised, electroeluted into a dialysis
membrane, ethanol-precipitated, and resuspended in l0 mM
Tris-HCl, pH 7.5/l mM EDTA to a final concentration of l0
ng/~l. These products were used in the library
constructions described in Example III.
EXAMPLE III
LIBRARY CONSTRUCTION
A combinatorial library was constructed in two steps.
In the first step, separate heavy and light chain libraries
were constructed in lambda Hc 2 and lambda Lc l vectors,
respectively (Figure l). In the second step, the two
resultant libraries were combined at the asymmetric Eco RI
sites present in each vector.
For construction of lambda Hc 2 and Lambda Lc 1
libraries, 3 molar equivalence of the gel isolated inserts
described in Example II were ligated with l molar
equivalence of vector arm, as described below overnight at
5-C to lambda Hc 2 or lambda Lc l, described in Example I.
The heavy chain inserts were ligated to lambda Hc 2 arms
W090/l4W3 ~ O ~ 7 ~ 2 ~ PCT/USg0!02890
26
previously digested with Xho I and Spe I and
dephosphorylated. The light chain inserts were ligated to
lambda Lc 1 arms previously digested with Sac I and Xba I
and dephosphorylated. Vector arms were prepared using the
techniques described in Maniatis et al., Molecular Cloninq:
A Laboratorv Manual, Cold Spring Harbor, which is
incorporated herein by reference. 10 ml of NZCYM broth
(lOg/1 NZ amine, 5g/1 yeast extract, 5g/1 NaCl, lg/l
casamino ~cids, 2g/1 MgSO4-7HzO, pH 7.5) was inoculated with
a single colony of XL1-Blue and incubated overnight with
vigorous agitation at 37-C. 1 ml of this culture was used
to inoculate four 2 liter flasks containing 500 ml
prewarmed (37C) NZCYM. These four flasks were agitated at
37~C 3 to 4 hours. Each flask then received an inoculation
of 101 pfu of the purified recombinant bacteriophage vector
prepared in Example I, and was shaken for an additional 3
to 5 hours until lysis of the host was complete. 10 ml of
chloroform was added to each flask and incubation continued
for another 10 minutes at 37 C. Cultures were treated with
1 ~g/ml each DNAsE I and RNAseA for 30 minutes at room
temperature. NaCl was added to 1 M final concentration and
the cultures were chilled on ice for 1 hour. Debris was
removed by centrifugation at ll,OOOxg for 10 minutes, and
polyethylene glycol (PEG 8000) was added to the
supernatants to a final concentration of 10% w/v.
Bacteriophage precipitated out of the suspensions after 1
hour on ice and was pelleted by centrifugation at ll,OnOxg
for 10 minutes. Phage was resuspended in SM buffer ~5.8g/1
NaCl, 2g/1 MgSO4-7 H20, 50ml/1 l M Tris-Cl pH 7.5, 5ml 2%
gelatin) and chloroform extracted to remove cell debris.
Solid cesium chloride (CsC13 was added to 0.5g/ml, and the
phage suspension was layered onto CsCl -step gradients
(1.7g/ml, 1.5g/ml, 1.45g/ml-, all in SM) and spun at 22,000
rpm for 2 hours at 4 C in a swinging bucket rotor.~~Banded
phage particles were collected and spun in 1.5g/ml:CsCi/SM
at 38,000 rpm for 24 hours at 4C. Re-banded phage was
again collected, and the suspension was dialysed in lOmM
.~
.
- ', -
.
WO90/14~3 2 0 ~~ 7 t~ 2 3 PCT/US90/02890
27
NaCl, 50mM Tris-Cl pH 8.0, lOmM MgCl~. EDTA pH 8 . O was
added to 20mM, pronase was added to 0.~mg/ml, and SDS was
added to 0.5%; incubation at 37~ for l hour was followed by
phenol extraction, chloroform extraction, and dialysis
overnight in lOmM Tris-Cl pH 8.0, lmM EDTA pH 8Ø ~Sodium
acetate was added to 0.3 M and the DNA was precipitated
with 2 volumes of ethanol. Vector DNA was recovered by
centrifugation and resuspended in lOmM Tris-Cl pH 7.6, lmM
EDTA pH 8Ø
To make Hc2 vector arms, 200 ~g purified Hc2 DNA was
cut with 600 units Xho I in 50mM Tris-Cl pH 8 . 0, lOmM
MgCl2, 50mM NaCl, at 37C for 1 hour. Cut HC2 DNA was
phenol extracted and ethanol precipitated, then re-cut with
600 units of Spe I in 20mM Tris Cl pH 7.4, 5mM MgCl2, 50mM
KCl at 37C for l hour. Double-cut Hc2 DNA was phenol
extracted and ethanol precipitated. Recovered vector DNA
was dephosphorylated with 0.5 units/~g HK phosphatase
(Epicenter, Madison, WI) in 30mM Tris Acetate pH 7.85, 30mM
KAC, 5mM CaC12, 0.5mM DTT, and lO0 ~g/ml BSA, at 30~ for 1
hour, followed by 65D for lO minutes, then phenol
extracted, ethanol precipitated and resuspended in lOmM
Tris Cl pH 7.5, 1 mM EDTA pH 8Ø
Lcl vector arms were prepared as above, except that
the first digestion was with 600 units of Xba I in 50mM
Tris-Cl pH 8.0, lOmM MgCl2, 50mM NaCl, and the second
digestion was with 600 units of Sac I-in 6mM Tris Cl pH
7.4, 20mM NaCl, 6mM MgC12, 6mM 2-ME, O.l mg/ml BSA. A
portion of each ligation mixture (l ~l) was packaged for 2
hours at xoom temperature using Gigapack Gold packaging
extract (Stratagene, La Jolla, CA~, and the packaged
material was titered and plated on XLl-Blue host cells as
.
described by the manufacturer.
Specifically, serial dilutions of the library were
made into a buffer containing lO0 mM NaCl, 50 mM Tris-HCL
, , ' ' - :
- : .
.
WO90/1~3 ~ PCT/US90/02890
28
at pH 7.5 and lO mM MgSO4. Ten ~l of each dilution was
added to 200 ~l of exponentially growing E. coli cells and
maintained at 37 C for 15 minutes to allow the phage to
absorb to the bacterial cells. Three ml of top agar
consisting of 5 g/L NaCl, 2 g/L of MgSO4, 5 g/L yeast
extract, lO g/L NZ amine (casein hydrolysate) and 0.7~
- melted, 50C agarose. The phage, the bacteria and the top
ayar were mixed and then evenly distribute across the
surface of a prewarmed bacterial agar plate (g g/L NaCl, 2
g/L MgSO4, 5 g/L yeast extract, lO g/L NZ amine (casein
~hydrolysate) and 15 g/L Difco agar. The plates were
maintained at 37C for 12 to 24 hours during which time
period the lambda plaques were counted to determine the
total number of plaque forming units per ml in the original
library.
The lambda Hc 2 primary library contained l.3 x lO6
plaque-forming units (pfu) and has been screened for the
expression of the decapeptide tag to determine the
percentage of clones expressing Fd sequences. The sequence
for this peptide is only in frame for expressisn after the
genes for an Fd (or VH) fragment have been cloned into the
vector. At least 80 percent of the clones in the library
express Fd fragments when assayed by immunodetection of the
25 decapeptide tag. `
Immunodetection was performed as follows. A volume
of the titred library that would yield 20,000 plaques per
150 millimeter plate was added to 600 ~1 of exponentially
30 growing E. coli cells and maintained at 37-C for 15 minutes ~ -
to allow the phage to absorb to the bacterial cells. Then
7.5 ml of top agar--was admixed to the solution containing
the bacterial cells and the absorbed phage and the entire
mixture distributed evenly across the surface of a
prewarmed bacterial agar plate. This process was repeated
for a sufficient number of plates to plate out a total
number of plaques at least equal to the library size.
- ' - .-. ' '.: ~ - ' .
:
:.
W090~l4W3 2 ~ 5 7 ~ 2 3 PCT/US90/02890
29
These plates were then maintained at 37 C for 5 hours. The
plates were then overlaid with nitrocellulose filters that
had been pretreated with a solution containing 10 mM
isopropyl-beta-D-thiogalactopyranoside (IPTG) and
maintained at 37 C for 4 hours. The orientation of the
nitrocellulose filters in relation to the plate were marked
by punching a hole with a needle dipped in waterproof ink
through the filter and into the bacterial plates at several
locations. The nitrocellulose filters were removed with
forceps and washed once in a TBST solution containing 20 mM
Tris-HCL at pH 7.5, 150 mM NaCl and 0.05% polyoxyethylene
soriban monolaurate (Tween-20). A second nitrocellulose
filter that had also been soaked in a solution containing
10 mM IPTG was reapplied to the bacterial plates to produce
duplicate filters. The filters were further washed in a
fresh solution of TBST for 15 minutes. Filters were then
placed in a blocking solution consisting of 20 mM Tris-HCL
at pH 7.5, 150 mM NaCl and 1% BSA and agitated for 1 hour
at room temperature. The nitrocellulose filters were
transferred to a fresh bloc~ing solution containing a 1 to
500 dilution of the primary antibody and gently agitated
for at least 1 hour at room temperature. After the filters
were agitated in the solution containing the primary
antibody the filters were washed 3 to S times in TBST for
5 minutes each time to remove any of the residual unbound
primary antibody. The filters were transferred into a
solution containing fresh ~locking solution and a 1 to 500
to a 1 to 1,000 dilution of alkaline phosphatase conjugated
secondary antibody. The filters were gently agitated in
the solution for at least 1 hour at room temperature. The
filters were washed 3 to 5 times in a solution of TBST for
at least 5 minutes each time to remove any residual unbound
secondary antibody. The filters were washed once in a
solution containing 20 mM Tris-HCL at pH 7.5 and 150 mM 35 NaCl. The filters were removed from this solution ad the
excess moisture blotted from them with filter paper.~ The
color was developed by placing the filter in a solution
- . . .
. : , .
WO90/l4~3 2 ~ ~ 7 ~ 2 3 PCT/US90/02890
containing lO0 mM Tris-HCL at pH 8.5, 100 mM NaCl, S mM
MgClz, 0.3 mg/ml of nitro Blue Tetrazolium (NBT) and 0.15
mg/ml of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) for at
least 30 minutes at room temperature. The residual color
development solution was rinsed from the filter with a
solution containing 20 mM Tris-HCL at pH 7.5 and 150 mM
NaCl. The filter was then placed in a stop solution
consisting of 20 mM Tris-HCL at pH 2.9 and 1 mM EDTA. The
development of an intense purple color indicates at
positive results. The filters are used to locate the phage
plaque that produced the desired protein. That phage
plaque is segregated and then grown up for further
analysis.
The light chain library was constructed in the same
way as the heavy chain and shown to contain 2 x Io6 members.
Plaque screening, with an antibody to mouse kappa chain,
indicated that 60 percent of the library contained
expressed light chain inserts. This relatively small
percentage of inserts probably resulted from -incomplete
dephosphorylation of the vector after cleavage with Sac I
and Xba I.
~ .
For construction of the combinatorial library, the
above two libraries were used by crossing them at the Eco
RI site as follows. DNA was first purified from each
library as described above. The light chain library was
cleaved with Mlu I restriction endonuclease, the resulting
5' ends were dephosphorylated, and the product~was digested
with Eco RI. This process cleaved the left arm of the
vector into several pieces, but the right-arm containing
the light chain sequences remained intact. The DNA of
heavy chain library was cleaved with Hind III,
,
dephosphorylated, and then cleaved with Eco RI; this
process destroyed the right arm, but the left arm
containing the heavy chain sequences remained intact. The
DNA's so prepared were then mixed and ligated. After
.
.
',. '.'., ' - :
WO90/~W3 ~ 5 7 9 ~ 3 PCT/US9OtO2890
31
ligation, only clones that resulted from combination of a
right arm of light chain-containing clones and left arm of
heavy chain-containing clones reconstituted a viable phage.
After ligation and packaging, 2.5 x 107 clones were
obtained. This is the combinatsrial Fab expression library
that was screened to identify clones having affinity for
NPN as descri~ed below in Example IV. For determining the
frequency of the phage clones that coexpress the light and
- heavy chain fragments, duplicate lifts sf the combinatorial
library for light and heavy expression were screened. In
the examination of approximately 500 recombinant phage,
approximately 60 percent coexpressed light and heavy chain
proteins.
EXAMPLE IV
ANTIGEN BINDING
All three libraries, the light chain, the heavy chain,
and Fab were screened to determine whether they contained
recombinant phage that expressed antibody fragments binding
NPN. In a typical procedure, 30,000 phage were plated and
duplicate lifts with nitrocellulose were screened as
described in Example III for binding to NPN coupled to l2sI-
labeled bovine serum albumin (BSA) (Figure 3). Duplicate
screens of 90,000 recombinant phage from the light chain
library and a similar number from the heavy chain library
did not identify any clones that bound the antigen. In
contrast, the screen of a similar number of clones from the
Fab expression library identified`many phage plaques that
bound NPN (Figure 5). ~Briefly, duplicate plaque lifts of
Fab (filters A and B), heavy chain (filters E and F), and
light chain (filters G and H) expression libraries were
screened against~ labeled BSA conjugated with NPN at a
density of approximately 30,000 plaques per plate. Filters
C and D illustrate the duplicate secondary screening of a
cored positive from a primary filter A (arrows). BSA was
labeled as described in Harlow et al., Supra, which is
- . :. , :
'' ' . . ' :: , : :
,~, . -: ~
WO90/1~W3 2 ~ ~ 7 ~ 2 ~ 32 P~T/US~0/02890
i~corporated herein by reference, and coupling reactions
were as described in Example II. Standard plaque lift
methods were used in screening as described in Example II
and in Ausubel et al., Current__Protocols in Molecular
Biolo~y, John Wiley and Sons, (1987), ~E~. Briefly,
cells (XLI blue) infected with phage were incubated on 150-
mm plates for 4 hours at 37-C, protein^ expression was
induced by overlay with nitrocellulose filters soaked in 1
mM Isopropyl-l-thio-B-D-galactoside (IPTG) and the plates
were incubated at 25-C for 8 hours. Duplicate filters were
obtained during a second incubation under the same
conditions. Filters were then blocked in a solution of 1
percent BSA in phosphate-buffered saline (PBS) for 1 hour
before incubation (with rocking) at 25~C for 1 hour with a
solution of ~2sI-labeled BSA (at 0.1 ~M) conjugated to NPN
(2 x 106 cpm/ml; approximately 15 NPN per BSA molecule3, in
1 percent BSA in PBS. Background was reduced by
preliminary centrifugation of stock 125I-labeled BSA solution
at lOO,OOOg for 15 minutes and preliminary incubation of
solutions with plaque lifts from plates containing
bacterial infected with a phage having no insert. After
labeling, filters were washed repeatedly with PBS
- containing 0.05 percent Tween 20 before the overnight
development of autoradiographs.
This observation indicates that, under conditions
where many heavy chains in combination with light chains
bind to antigen,~heavy or light chains alone do not.
Therefore, in the case of NPN, there are many heavy and
light chains that only bind antigen when they are combined
with specific light and heavy chains, respectively. This
result supports our decision to screen large~combinatorial
Fab~expression libraries. To assess our ability to screen
large numbers,of clones and obtain a more quantitative
estimate of the frequency of antigen binding clones in the
combinatorial library, we screened one million phage
plaques and identified approximately 100 clones that bound
2~ 923
WO90/l~3 PCT/US90/02890
33
to antigen. For six clones, a region of the plate
containing the positive phage plaques and approximately 20
surrounding them was "cored," replated, and screened with
duplicate lifts (Figure 33. The expression products of
approximately 1 in 20 of the phage specifically bind to
antigen. Phage which were believed to he negative on the
initial screen did not give positives on replating.
To determine the specificity of the antigen-antibody
interaction, antigen-binding was subjected to competition
with free unlabeled antigen (Figure 4). Filter lifts~from
positive plaques were exposed to 12sI-labeled BSA-NPN in the
presence of increasing concentrations of the inhibitor NPN.
A number of phages correlated with NPN-binding as in Figure
3 were spotted in duplicate (about lOo particles per spot)
directly onto a bacterial lawn. The plate was then
overlaid with an IPTG-soaked filter and incubated for 19
hours at 25C. The filters were then blocked in 1 percent
BSA in PBS before incubation in 12sI-labeled-BSA-NPN as done
previously with the inclusion of varying amounts of NPN in
the labeling solution. Other conditions and procedures
were as described for Figure 3. The results for a phage of
moder~te affinity are shown in duplicate in the figure.
Similar results were obtained for four other phages with
some differences in the effective inhibitor concentration
ranges. These studies showed that individual clones could
be distinguished on the basis of antigen affinit~. The
concentration of free -haptens required for complete
inhibition of bindinq varied between lO to 100 x 109M,
suggesting that the expressed Fab fragments had binding
constants in the nanomolar range.
In preparation for characterization of the protein
products, a plasmid containing the heavy and light chain
genes was excised with helper phage in an analogous fashion
as that for lambda Zap II (Figure 5). Briefly, M13mp8 was
used as helper phage and the excised plasmid was infected
. .. .
' ' ';'
2 ~
W090t1~W3 PCTtUS90/02890
34
into a F derivative of MC1061. The excised plasmid
contains the same constructs for antibody fragment
expression as do the parent vectors (Figure 1). These
plasmid constructs are more conveniently analyzed for
restriction pattern and protein expression of the lambda
phage clones identified and isolated on the basis of
antigen binding. The plasmid also contains an fl origin of
replication which facilitates the preparation of single-
stranded DNA for sequence analysis and n vitro
mutagenesis. Mapping of the excised plasmid demon~trated
a restriction pattern consistent with incorporation of
heavy and light chain sequences. The protein products of
one of the clones was analyzed by- enzyme-linked
immunosorbent assay (ELISA) and immunoblotting to establish
the composition of the NPN binding protein. A bacterial
supernatant after IPTG induction was concentrated and
subjected to gel filtration. Fractions in the molecular
size range 40 to 60 kD were pooled, concentrated, and
subjected to a further gel filtration separation. ELISA
analysis of the eluted fractions (Figure 6) indicated that
NPN binding was associated with a protein of a molecular
size of about 50 ~D, which contained both heavy and light
chains.
For ELISA characterization, the concentration
partially purified bacterial supernatant of an NPN binding
clone was separated by gel filtration and samples from each
fraction were applied to microtiter plates coated with BSA-
NPN. Addition of either antibody to decapeptide (---) or
antibody to X chain (-, left-hand scale) conjugated with
alkaline phosphatase was followed by color development.
The arrow indicates the position of elution of known Fab
fragment. The results show that antigen binding is a
property of a 50-kD protein containing both heavy and liyht
chains. To permit protein characterization, a single
plaque of a NPN-positive clone (Figure 3) was picked, and
the plasmid containing the heavy and light chain inserts
. ~ - , : .
.
213~79,~3
WO90/14~3 PCT/US90/02890
(Figure 5) was excised as described above. Cultures (500
ml) in L broth were inoculated with 3 ml of a saturated
culture of the clone and incubated for 4 hours at 37-C.
Protein synthesis was induced by the addition of IPTG to a
final concentration of 1 mM, and the cultures were
incubated for l0 hours at 25-C. The supernatant from 200
ml of cells was concentrated to 2 ml and applied to a TSK-
G4000 column. Microtiter plates were coated with BSA-NPN
at l ~g/ml, 50 ~l samples from the eluted fractions, were
mixed with 50 ~l of PBS-Tween 20 (0.05 percent) BSA (0.l
percent) added, and the plates were incubated for 2 hours
at 25-C. The plated material was then washed with PBS-
Tween 20-BSA and 50 ~l of appropriate concentrations of a
rabbit antibody to decapeptide or a goat antibody to mouse
K light chain (Southern Biotech, Oakridge, TN) conjugated
with alkaline phosphatase were added and incubated for 2
hours at 25 C. The plates were again washed, 50 ~l of p-
nitrophenyl phosphate (l mg/ml in 0.l tris, pH 9.5,
containing 50 mM MgCl2) was added, and the plates were
incubated for 15 to 30 minutes and the absorbance was read
at 405 nm.
An immunoblot of a concentrated bacterial supernatant
preparation under nonreducing conditions was developed with
antibody to decapeptide. This revealed a 50-kD protein
band. We have found that the antigen-binding protein can
be purified to homogeneity from bacterial supernate in two
steps involving affinity chromatography on protein G
followed by ;gel filtration. SDS-PAGE analysis of the
protein revealed a single band at approximately 50 kD under
nonreducing conditions and a doublet at approximately 25 kD
under reducing conditions. -Taken together, these résults
are -consistent with NPN-binding being:a function~of Fab
fragments in which heavy and-light chains are covaléntly
linked by a disulfide bond. - ~
.
.-
' ,:
WO90~14W3 2 ~ ~ 7 ~ 2 3 PCT/US90/02890
36
EXAMPLE V
PROPERTIES OF THE IN VIVO REPERTOIRE
COMPARED TO THE PHAGE COMBINATORIAL LIBRARY
!
A moderately restricted library was prepared only
because a limited number of primers was used for polymerase
chain reaction (PCR) amplification of Fd sequences. The
library is expected to contain only clones expressing K-
- gammal sequences. ~ However, this is not an inherent
limitation of the method since the addition of more primers
can amplify any antibody class or subclass. Despite this
restriction, a large number of clones producing antigen
binding proteins were able to be isolated.
A central issue is how the phage library compares with
the in v vo antibody repertoire in terms of size,
characteristics of diversity, and ease of access.
The size of the mammalian antibody repertoire is
difficult to judge, but a figure of the order of 106 to 1O8
different antigen specificities is often quoted. With some
of the reservations discussed below, a phage library of
this size or larger can readily be constructed by a
modification of the method described. Once an initial
combinatorial library has been constructed, heavy and light
chains can be shuffled to obtain libraries of exceptionally
large numbers.
.... .
~; .. , : ., . : . .............. . . . ........... . . .
In principle, the diversity -:characteristics of the
naive (unimmunized) in vivo repertoire and corresponding
phage library are expected to -be similar in th~t both
involve a random combination of heavy and light chains.
However,~ different~factors act to ~restrict the diversity
expressed by an~l n vivo repertoire and phage library. For
example, a physiological modification such as-tolerance
will restrict the expression of certain antigenic
specificities from the in vivo repertoire, but these
.. ,
~, ~
~ , ,: ~ . : .
WO90/14W3 2 ~ ~ ~ 9 2 3 PCT/US90/02890
37
specificities may still appear in the phage library.
However, bias in the cloning process may introduce
restrictions into the diversity of the phage library. For
example, the representation of mRNA for sequences expressed
by stimulated B cells can be expected to predominate over
those of unstimulated cells because of higher levels of
expression. In addition, the resting repertoire might
overrepresent spontaneously activated B cells whose
immunoglobulins have been suggested to be less specific.
I any event, methods exist to selectively exclude such
populations of cells. Also, the fortuitous presence of
restriction sites in the variable gene similar to those
used for cloning and combination will cause them to be
eliminated. We can circumvent some of these difficulties
by making minor changes, such as introducing amber
mutations in the vector system. Different s~urce tissues
(for example, peripheral blood, bone marrow, or regional
lymph nodes) and different PCR primers (for example, those
to amplify different antibody classes), may result in
libraries with different diversity characteristics.
Another difference between in vivo repertoire and
phage library is that antibodies isolated from the
repertoire may have benefited from affinity maturation as
a result of somatic mutations after combination of heavy
and light chains whereas the phage library randomly
combines the matured heavy and light chains. Given a large
enough~phage library derived from a particular in vivo
repertoire, the original matured heavy and liqht chains
will be recombined. However, since one of the potential
benefits of this technology is to obviat~ the need for
immunization by the generation of a single highly diverse
"generic" phage library, it would be useful to have methods
to optimize sequences to compensate for the absence of
somatic mutation and clonal selection. Three procedures
are made readily available through the vector system
presented. First, saturation mutagenesis may be performed
- ~
- ~ ' .
.
W090/14W3 2 ~ 5 7 ~ P~T/US90/02890
38
on the complementarity-determining regions (CDR's) (23) and
the resulting Fab's can be assayed for increased function.
Second, a heavy or a light chain of a clone that binds
antigen can be recombined with the entire liqht or heavy
chain libraries, respectively, in a procedure identical to
that used to construct the combinatorial library. Third,
iterative cycles of the two above procedures can be
performed to further optimize the affinity or catalytic
properties of the immunoglobulin. The last two procedures
are not permitted in B cell clonal selection, which
suggests that the methods described here may actually
increase the ability to identify optimal sequences.
Access is the third area where it is of interest to
compare the in vivo antibody repertoire and phage library.
In practical terms the phage library is much easier to
access. The screening methods used have allowed one to
survey the gene products of at least 50,000 clones per
plate so that 1O6 to 107 antibodies can be readiiy examined
in a day but the most powerful screening methods depend on
selection. In the catalytic antibody system, this may be
accomplished by incorporating into the antigen leaving
groups necessary for replication of auxotrophic`bacterial
strains or toxic substituents susceptible to catalytic
inactivation. Further advantages are related to the fact
- that the n vivo antibody repertoire can only~be accessed
via immunization, which is a selection on the basis of
binding affinity. ~The phage library is not- similarly
restricted. For example, the only general method to
identify-antibodies with catalytic properties has been by
preselection on the basis of affinity of the antibody to a
transition state analog. S~ch restrictions do not apply to
the ~a vitro library where catalysis can, in principle, be
assayed directly. - The ability to assay directly large
numbers of antibodies for function may allow selection for
catalysts in reactions where a mechanism is not well
defined or synthesis of the transition state analog is
, .. , ~. . . . .
.
W090~3 2 ~ 3 ~ 9 2 3 PCT/US90~02890
39
difficult. Assaying for catalysts directly eliminates the
bias of the screening procedure for reaction mechanisms
limited to a particular synthetic analog; therefore,
simultaneous exploration of multiple reaction pathways for
a given chemical transformation are possible.
We have described procedures for the generation of Fab
fragments that are clearly different in a number of
important respects from antibodies. There is undoubtedly
a loss of affinity in having monovalent Fab antigen
binders, but it is possible to compensate for this by
selection of suitably tight binders. For a number of
applications such as diagnostics and biosensors, monovalent
Fab fragments may be preferable. For applications
requiring Fc effector functions, the technology already
exists for extending the heavy chain gene and expressing
the glycosylated whole antibody in mammalian cells.
The data show that it is now possible to construct and
screen at least three orders of magnitude more clones with
monospecificity than~previously possible. The data also
invite speculation concerning the production of antibodies
without the use of live animals.
~.
25EXAMPLE VI
;Flp RECOMBINANCE
The lambda Lc 2 vector was constructed for the cIoning
of PCR amplified products of mRNA that code for light chain
protein, as described in Example II, by inserting the
nucleotide sequence shown in Table 3 into the Sac I and Xho
I sites of lambda Zap II. The vector was preparëd by
digesting 10 ~g of lambda arms from the Uni-ZapTM XR Vector
Kit (Stratagene, La Jolla, CA) with 30 units in 100 ~l
reaction Sac I. Overlapping synthetic oligonucleotides
were cloned into the above Sac I digested arms as follows.
Oligonucleotides L11 through L15 and Ll7 - L19 (L11, L12,
'
WO9Otl~3 2 ~ ~ 7 9 ~ 3 PCT/US90/0~890
L13, L14, L15, L17, L18 and Ll9) (shown in Table 3) were
kinased by adding 1 ~1 of each oligonucleotide (0.1 ~g/~l)
and 20 units of T4 polynucleotide kinase (8RL, Gaithersburg,
MD) to a solution containing 70 mM Tris HCL at pH 7.6, 0.1
M KCl, 10 mM MgC12, 5 mM DTT, 1 mM adenosine triphosphate
(ATP), 10 mM 2 ME, 500 micrograms per ml of BSA. The
solution was maintained at 37-C for 30 minutes and the
reaction stopped by maintaining the solution at 65-C for 10
minutes. The two end oligonucleotides L16 and LllO were
added to the above kinasing reaction solution together with
l/lO,volume of a solution containing 20 mM Tris-HCL at pH
7.4, 2.0 mM MgCl2 and 50.0 mM NaCl. This solution was
heated to 70-C for 5 minutes and allowed to cool slowly to
, room temperature. , During this time period all
oligonucleotides annealed to form the double stranded
synthetic DNA insert similar to the one shown in Figure 2A.
The annealed oligonucleotides were covalently linked to
each other by adding 40 ~1 of the above reaction to a
solution containing 66 mM Tris-HCL at pH 7.6, 6.6 mM MgC12,
1 mM DTTr 1 mM AT~ and 10 units of T4 DNA ligase (BRL,
Gaithersburg, MD). This solution was maintained at 25C
for,30 minutes and then the T4 DNA ligase was inactivated
by heating the solution at 65-C for 10 minutes. The
unphosphorylated ends of the resultant oligonuleotides were
kinased by mixing 52 ~1 of the above reaction, 4 ~1 of a
solution containing 10 mM ATP and 5 units of T4
polynucleotide kinase. This solution was maintained at
37-C~for 30 minutes and then the T4,polynucleotide kinase
was,inactivated by heating the solution-at 65-C for lO
.. . . . .
minutes. The phosphorylated synthetic DNA insert was
ligated directly into the above prepared lambda Zap II
vector arms. - ,.......... . .
. ;.. - , :. . . . . . .
.. . . .
.. .
.. . . - ,
. .
WO 90/14W3 2 ~ h ~ PCT/US90/02890
41
TABLE 5
L11 TGAATTCTAAACTAGTCGCGAAGGAGACAG
L12 TCATAATGAAATACCTATTGCCTACGGCAG
L13 CCGCTGGATTGTTATTACTCGCTGCCCAAC
L14 CAGCCATGGCCGAGCTCGTCAGTACTAGTG
L15 TTAAGCGGCCGCAA
L16 TCGATTGCGGCCGCTTAACACTAGTACTGACGA
~L17 GCTCGGCCATGGCTGGTTGGGCAGCGAGTA
L18 ATAACAATCCAGCGGCTGCCGTAGGCAATA
Ll9 GGTATTTCATTATGACTGTCT~CTTGGCGA
LllO.-CTAGTTTAGAATTCAAGCT
TABLE 6
Hll GGCCGCAAATTCTATTTCAAGGAGACAGTC
H12 ATAATGAAATACCTATTGCCTACGGCAGCC
~13 GCTGGATTGTTATTACTCGCTGCCCAACC
H14 AGCCATGGCCCAGGTGAAACTGCTCGAGA ,.
H15 TTCTAGCTAGTTACCCGTACGACGTTCC
H16 GGACTACGGTTCTTAATAGAATTCG
H17 TCGACGAATTCTATTA ::
H18 AGAACCGTAGTCCGGAACGTCGTACGGG -
Hl9 TAACTAGACTAGTAATCTCGAGCAGTTTC :~
HllO ACCTGGGCCATGGCTCCTTGGGCAGCGAGT
Hlll AATAACAATCCAGCGGCTGCCGTAGGCAA
H112 TAGGTATTTCATTATGACTGTCTCCTT-
H113- GAAATAGAATTTGC - -
Tha lambda Hc 2 vector was constructed for cloning PCR
amplified products coding for heavy chain Fd sequences, as
described in Example II, by inserting the nucleotide
sequence shown in Figure 2B into the Not I and Xho I sites
. of lambda Zap II. As with the light chain vector, the
heavy chain vector was prepared by digesting lambda arms
from the Uni-ZapTM XR Vector Kit (Stratagene, La Jolla, CA)
:-
~: -, , ~ : . . - .
, - ,, . ~ : : ~ -. . - . .. . :
: - - :, .-.. - . ..
- .- . . ~ : .
.
,
WO9Otl4~3 2 ~ 5 7 9 2 3 PCTtUS9~/02890
42
with 30 units of Not I restriction enzyme in lOo ~l
reaction buffer. The inserted sequence similar to the one
in Figure 2B was constructed from the overlapping synthetic
oligonucleotides depicted in Table H11 to Hl13 as outlined
above.
The sequence of the oligonucleotides descrihed above
include elements for construction, expression, and
secretion of Fab fragments. These oligonucleotide~
introduce the asymmetric Not I and Eco RI restriction
sites; a leader peptide for the bacterial pel B qene, which
has previously been successfully used in E. coli to secrete
Fab fragments, Better et al., Science, 240:1041 (1988);
Skerra and Pluckthun, Science, 240:1038 (1988), both of
which are incorporated herein by reference, a ribosome
binding site at the optimal distance for expression of the
cloned sequence; cloning sites for either the light or
heavy chain PCR product; and, in lambda Hc 2, a decapeptide
tag at the carboxyl terminus of the expressed heavy chain
protein fragment. The sequence of the decapeptide tag was
useful because of the availability of monoclonal antibodies
to this peptide that were used for immunoaffinity-
purification of fusion proteins, Field et al. Mol Cell
Biol., 8:2159 (1988), which is incorporated herein by
reference. The vectors were characterized by restriction
digest analysis and DNA sequencing, Sanger et al., Proc.
Natl. Acad. Sci. USA, 74:5463-546i (1977), which is
incorporated herein by reference and using AMV Reverse
Transcriptase 35S-ATP Sequencing Kit (Stratagene, La Jolla,
CA~.
.
The lambda LcRF and lambda LcLF were constructed from
lambda Lc2 by inserting the oligonucleotides F01 and F02 or
F03 and F04 into the EcoRI site of the Ia~bda Lc2 vector.
The vector was prepared-for ligation by cleaving 10 ~g of
lambda Lc2 DNA with 30 units of EcoRI restriction enzyme
(NEB Beverly Ma.) in 100 ~l of reaction buffer at 37-C for
W090~l4~3 2~ 2~ PCT/US90/02890
43
one hour. The solution was heated to 65 C for 30 minutes
and then chilled to 30 C. CaCl2 was added to a final
concentration of 5 mM and 5 units Heat-Killable (HK)
phosphatase (Epicenter, Madison, WI) was added. The
reaction was allowed to preceded for 60 minutes at 30~C.
The EcoRI digested lambda Lc2 DNA was purified by phenol
chloroform extraction and ethanol precipitation. Lambda
LcRF was constructed by ligating three molar equivalence of
phosporylated oligonucleotides F03 and F04 to 1 ~g of EcoRI
digested lambda Lc2 in a 10 ~1 reaction volume at 4C
overni~ht. A portion (1 ~1) of the ligation was packaged
with in vitro lambda phage packaging extract and plated on
a lawn of XLl-Blue bacteria. - `
,
Lambda LcLF was constructed by ligating three molar
equivalence of phosphorylated oligonucleotides FOl and F02
to 1 ~g of EcoRI digested lambda Lc2 in lO ~1 reaction
volume at 4-C overnight. A portion (1 ~1) of the ligation
mixture was packaged with in vitro lambda phage packaging
extract and plated on a lawn of XLl-Blue bacteria.
For identification of desired recombinant phage, fresh
LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl, pH
7.5) with lO ~g/ml tetracycline was inoculated with XLl-
Blue (Stratagene, La Jolla, CA) and shaken overnight at
37-C. Bacteria were pelleted by centrifugation and
resuspended in 1/2 volume of 10 mM MgSO4 lOOO pfu of
recombinant phage were mixed with lOO ~l of the XLl-Blue
suspension and incubated at 37-C`for twenty minutes. This
mixture was quickly dispersed into 7 ml melted and cooled
0.7% top agarose in LB msdium, and the slurry was plated on
warmed LB plates. `The agarose was allowed to solidify at
room temperature and then the plates were warmed at 37C
for lO to 12 hours, then chilled at 4 C for 1 more hour.
MSI Magna Nylon me~branes (Fisher Scientific, California)
were placed directly onto the agarose surfaces of the
plates for 1 minute, and then lifted off carefully. The
., : . , - ~ , ~
, ~ . ., . !.~. . . '
': ' ' ` ' ' : ' ~
': :
WO90/14~3 2 ~ PCT/US90/02890
44
plaque lifts were immersed in denaturing solution (0.5 N
NaOH, l.5 M NaCl) for 5 minutes, transferred to
neutralization solution (1.5 M NaCl, 0.5 M Tris at pH 7.4)
for 5 minutes, rinsed in 2X SSC ~0.3 M NaCl, 0.3 M sodium
citrate, pH 7.0), and air dried on paper towels. Duplicate
filters were generated from the same plates as above. All
filters were interleaved between sheets of filter paper and
baked at 80-C under constant vacuum for l hour. The
., ,
-filters were removed from the filter paper and immersed in
wash solution (5X SSC, 0.5% SDS, 1 mM EDTA pH 8.0) at 42 C
for l to 2 hours; bacterial debris was removed by gently
wiping each filter with a sponge soaked in the wash
solution. The filters were then prehybridized in
prehybridization solution (6X SSC, 0.2% Ficoll 400, 0.2%
polyvinylpyrrolidone, 0.2~ borine serum albumin (Pentax
fraction V), 0.5~ SDS, 50 mM sodium phosphate pH 6.5, and
250 ~g/ml denatured and sheared herring sperm DNA). After
2 to 14 hours at 65C, the prehybridization solution was
decanted, fresh solution was added along with the oligo
probe (see below), and the filters were shaken at room
temperature for 14 to 24 hours. The filters were washed
three ti~es for 30 minutes at 37 C with 6X SSC/0.5% SDS and
then - autoradiographed. Plaques showing positive
hybridization on both filter and duplicate were isolated
2S and checked by restxiction mapping as well as sequencing.
Oligomeric probe was prepared as followed: l0 ~g oligo was
mixed in a 50 ~l reaction volume with 50 mM Tris 7.4, l0 mM
MgCl2, 5 mM DTT, 0.l mM EDTA pH 8.0, 0.l mM spermidine, l00
~Ci [~_32p] ATP (Amersham, Arlington Heights, IL), and l0
30- y T4 polynucleotide kinase ~BRL, Gaithersburg, MD).
- Oligonucleotide LLF was used to identify lambda LcLF and
LRF was used to identify lambda LcRF.
. . _ - .
. , ., ,, . .. .. . - - ~ , , ,
~ For construction of the lambda LcF vector,-lambda I,cLF
and lambda LcRF vector were crossed at the Xba I site as
.. ..
follows. DNA was first purified from each ~ector. The
lambda LcRF was cleaved with Mlu I -restriction
: ~ -
WO90/1~3 2 ~ 5 ~ 3 2 3 PCT/US90/02890
endonuclease, the resulting 5' ends were dephosphorylated,
and the product was digested with Xba I. This process
cleaved the left arm of the vector into several pieces, but
the right arm remained intact. The DNA of lambda LcLF was
cleaved with Hind III, dephosphorylated, and then cleaved
with Xba I: this process destroyed the right arm, but the
left arm remained intact. The DNA's so prepared were then
mixed and ligated. After ligation, only clones that
resulted from combination of a right arm of light chain-
containing clones and left arm of heavy chain-containing
clones reconstituted a viable phage. After ligation and
packaging, the desired vector, lamba LcF was identified as
above by sequence analysis.
The lambda HcRF and lambda HcLF were constructed from
lambda Hc3 by inserting the oligonucleotides FOl and F02 or
F03 and F04 into the EcoRI site of the lambda Hc2 vector.
The vector was prepared for ligation by cleaving lO ~g of
lambda Hc2 DNA with 30 units of EcoRI restriction enzyme
(NEB Beverly Ma.) in lO0 ~l of reaction buffer at 37 C for
one hour. The solution was heated to 65-C for 30 minutes
and then chilled to 30-C. CaCl2 was added to a final
concentration of 5 mM and 5 units Heat-Killable (HK)
phosphatase (Epicenter, Madison, WI) was added. The
reaction was allowed to preceded for 60 minutes at 30C.
The EcoRI digested lambda Hc3 DNA was purified by phenol
chloroform extraction and ethanol precipitation. Lambda
HcRF was constructed by ligating three molar equivalence of
phosporylated oligonùcleotides F03 and F04 to l ~g of EcoRI
digested lambda Hc2 in a lO ~l reaction volume at 4-C
overnight. A portion (l ~l) of the ligation was packaged
with in vitro lambda phage packaging extract and plated on
a lawn of XLl-Blue bacteria.
Lambda HcLF was constructed by ligating three molar
equivalence o~ phosphorylated oligonucleotides FOl and F02
to l ~g of EcoRI digested lambda Hc2 in lO ~l reaction
, .
:
- -:
: .
W090/l4~3 2 ~ ~ 7 9 2 3 46 PCTIUS90/02890
volume at 4-C overnight. A portion (1 ~l) of the ligation
mixture was packaqed with ~ vitro lambda phage packaging
extract and plated on a lawn of XL1-Blue bacteria.
Oligonucleotide HLF was used to identify lambda HcLF and
LRF was used to identify lambda LcRF by hybridization, as
above.
For construction of the lambda HcF vector, lambda HcLF
and lambda HcRF vectors were crossed at the Xba I site.
DNA from the two vectors was first purified. The lambda
HcRF vector DNA was cleaved with Mlu I restriction
endonuclease, the resulting 5' ends were dephosphorylated,
and the product was digested with Eco RI. This process
cleaved the left arm of the vector into several pieces, but
the right arm remained intact. The lambda HcLF DNA was
cleaved with Hind III, dephosphorylated, and then cleaved
with Eco RI; this process destroyed the right arm, but the
left arm remained intact. The DNA's so prepared were then
mixed and ligated. After ligation, only ciones that
resulted from combination of a right arm of light chain-
containing clones and left arm of heavy chain-containing
clones reconstituted a viable phage. After ligation and
packaging the desired heavy chain vector was confirmed by
sequence analysis.
Libraries were constructed in these vectors as in
Example III except the lambda LcF was cleaved-with SacI and
SpeI instead of SacI and XbaI in preparation for cloning.
The light chain PCR inserts prepared by cleaving with SacI
and XbaI were compatible with these arms.
.
~ : :
.: . . , . . :
:
W090/1~3 2 0 ~ 7 3 ~ 3 PCT/VS90/02890
47
TABLE 7
FOl 5' AATTCGAAGTTCCTATACTTTCTAGAG 3'
F02 5' AATTCTCTAGAAAGTATAGGAACTTCG 3'
F03 5' AATTCTCTAGAGAATAGGAACTTCGGAATAGGAACTTCG-3'
FO4 5' AATTCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAG 3'
LLF 5' TTTCTAGAGAATTCTAAA ~ -
LRF 5' GGAACTTCGAATTCTAAA
HLF 5' TTTCTAGAGAATTCGTCGA
~RF 5' GGAACTTCGAATTCGTCGA
- - - EXAMPLE VII
A light chain vector was constructed that contains two
amher mutations in the left arm. The left arm was from
EMBL3A the right arm was from lambda LcF were combined to
construct lambda LcFA. DNA was prepared from each of the
two parent lambda phage vectors. lO ug of lambda EMBL3A
was digested with HindIII, dephosphorylated and digested
with KpnI. 10 ug of lambda LcF was digested with MluI then
dephosphorylated. This DNA was then digested with KpnI.
one ~g of digested DNA from each of the two parent vectors
were mixed and ligated. After packaging in vitro, ~he
phage were infected into BB4 E. coli. All phage had the
two amber mutations from EMBL and the cloning site from
lambda LcF one of these phage was named lambda LcFA.
A heavy chain vector, lambda HcFA, with an amber
mutation in the right arm was constructed from lambda zap
(Stratagene, La Jolla, CA) in a manner identical to the
construction of Lambda HcFA of example VI except Lambda
ZapI was digested with Not I and EcoRI and dephosporylated
with heat-kill phosphatase and phage vectors were grown on
E. coli BB4.
`
When heavy and light chain libraries were constructed
' ,, . ~' . ' ' ` : '
-
- . ~ :
WO90/l~3 2 ~ ~ 7 3 2 3 PCT/US90/02890
48
in these vectors as in Example VI, combination could be
performed by co-infecting the phage libraries into BB4
(Stratagene, La Jolla, CA) cells which had been transformed
with plasmid pUC19F, as described in Govinal and Jayaram,
Gene, 51:31-41 (1987), which is incorporated herein by
reference,-- and combined phage were selected by platting on
MC1061 (ATCC) E. coli. which selected against SupF amber
mutations.
Although the invention has been described with
reference to the presently preferred embodiment, it should
be understood that various modifications can be made
without departing from the spirit of the invention.
Accordingly, the invention is limited only by the following
claims.
-
. .
, . . . . .
. .
. , . -. ,
.. . .. . . ... .
.. . ..
.. . . . . .. ..
.,, . . . , ^ , . .. .
.,, . .. , . . . . .. ~ .
, ~ .. . . . .- ... ..
, .. . . .. . . .. . . .. ...
. , - . . . .. . . "
,- : ,
