Note: Descriptions are shown in the official language in which they were submitted.
WO 91/02071 ~ ~ r~ (~ ~ PCT/US90/04462
~'':i
t\~~.
-1.
METHODS AND COMPOSITIONS FOR THE
PROD1JCTION OF STAHLX TRANSFORMED,
FERTILE MONOCOT PLANTS AND CELLS THEREOF
FIELD OF THE INVENTION
The present invention relates to reproducible
systems for genetically transforming monocotyledonous
plants such as maize, to methods of selecting stable
genetic transformants from suspensions of transformed
cells, and to methods of producing fertile plants from
the transformed cells. Exemplary transformation methods
include the use of microprojectile bombardment to
introduce nucleic acids into cells, and selectable and/or
screenable marker systems, for example, genes which
confer resistance (e.g., antibiotic, herbicide, etc.), or
which contain an otherwise phenotypically observable
trait. In other aspects, the invention relates to the
production of stably transformed and fertile monocot
plants, gametes and offspring from '..he transgenic plants.
DESCRIPTION OF THE RELATED ART
Ever since the human species emerged from the
hunting~gathering phase of its existence, and entered an
agricultural phase, a major goal of human ingenuity and
invention has been to improve crop yield and to alter and
improve the characteristics of plants. In particular ,
man has sought to alter the characteristics of plants to
make them more tasty and/or nutritious, to produce
increased crop yield or render plants more adaptable to
specific environments.
Up until recent times, crop and plant improvements
WO 91/02071 , PCT/US90/04452
2
depended on selective breeding of plants with desirable
characteristics. Initial breeding success was probably
accidental, resulting from observation of a plant with
desirable characteristics, and use of that plant to
propagate the next generation. However, because such
plants had within them heterogenous genetic complements,
it was unlikely that progeny identical to the parents)
with the desirable traits would emerge. Nonetheless,
advances in controlled breeding have resulted from both
l0 increasing knowledge of the mechanisms operative in
hereditary transmission, and by empirical observations of
results of making various parental plant crosses.
Recent advances in molecular biology have
dramatically expanded man's ability to manipulate the
germplasm of animals and plants. Genes controlling
specific phenotypes, for example specific polypeptides
that lend antibiotic or herbicide resistance, have been
located within certain germplasm and isolated from it.
Even more important has been the ability to take the
genes which have been isolated from one organism and to
introduce them into another organism. This
transformation may be accomplished even where the
recipient organism is from a different phylum, genus or
species from that which donated the gene (heterologous
transformation).
Attempts have been made to genetically engineer
desired traits into plant genomes by introduction of
exogenous genes using genetic engineering techniques.
These techniques have been successfully applied in some
plant systems, principally in dicotyledonous species.
The uptake of new DNA by recipient plant cells has been
accomplished by various means, including Agrobac~terium
infection (32), polyethylene glycol (PEG)-mediated DNA
uptake (25), electroporation of protoplasts (17) and
microprojectile bombardment (23). Unfortunately, the
:: WO 91 /02071 "~'~ ~~' ~. ~o ~ ~. P~/US90/04462
asH,:.°~
3
introduction of exogenous DNA into monocotyledonous
species and subsequent regeneration of transformed plants
has proven much more difficult than transformation and
regeneration in dicotyledonous plants. Moreover, reports
of methods for the transformation of monocotyledons such
as maize, and subsequent production of fertile maize
plants, have not been forthcoming. Consequently, success
has not been achieved in this area and commercial
implementation of transformation by production of fertile
transgenic plants has not been achieved. This failure
has been particularly unfortunate in the case of maize,
where there is a particularly great need for methods for
improving genetic characteristics.
Problems in the development of genetically
transformed monocotyledonous species have arisen in a
variety of general areas. For example, there is
generally a lack of methods which allow one to introduce
nucleic acids into cells and yet permit efficient cell
culture and eventual regeneration of fertile plants.
Only limited successes have been noted. In rice, for
example, DNA transfer has only recently been reported
using protoplast electroporation and subsequent
regeneration of transgenic plants (41). Furthermore, in
maize, transformation using protoplast electroporation
has also been reported (see, e.g., 17).
However, recovery of stably transformed plants has
not been reproducible. A particularly serious failure is
that the few transgenic plants produced in the case of
maize have not been fertile (38). While regeneration of
fertile corn plants from protoplasts has been reported
(37, 39), these reported methods have been limited to the
use of non-transformed protoplasts. Moreover,
regeneration of plants from protoplasts is a technique
which carries its own set of significant drawbacks.
Even with vigorous attempts to achieve fertile,
WO 9i/02071 PCT/US90/04462
,-.
~?U6'~~~~~6.1
transformed maize plants, reports of success in this
regard have not been forthcoming.
A transformation technique that circumvents the need
to use protoplasts is microprojectile bombardment.
Although transient expression of a reporter gene was
detected in bombarded tobacco pollen (47), stable
transformation by microprojectile bombardment of pollen
has not been reported for any plant species. Bombardment
of soybean apical meristems with DNA-coated gold
particles resulted in chimeric plants containing
transgenic sectors. Progeny containing the introduced
gene were obtained at a low frequency (27). Bombardment
of shoot meristems of immature maize embryos resulted in
sectors of tissue expressing a visible marker,
anthocyanin, the synthesis of which was triggered by the
introduction of a regulatory gene (46). An analysis of
cell lineage patterns in maize (28) suggests that
germline transformation of maize by such an approach may
be difficult.
A second major problem in achieving successful
monocot transformation has resulted from the lack of
efficient marker gene systems which have been employed to
identify stably transformed cells. Marker gene systems
are those which allow the selection of, and/or screening
for, expression products of DNA. For use as assays for
transformed cells, the selectable or screenable products
should be those from genetic constructs introduced into
the recipient cells. Hence, such marker genes can be
used to identify stable transformants.
Of the more commonly used marker gene systems are
gene systems which confer resistance to aminoglycosides
such as kanamycin. While kanamycin resistance has been
used successfully in both rice (51) and corn protoplast
systems (38), it remains a very difficult selective agent
1fO 91/02071 ~~ ~ ' PCT/US90/04462
~~;~'~
to use in monocots due to high endogenous resistance
(19). Many monocot species, maize, in particular,
possess high endogenous levels of resistance to
aminoglycosides. Consequently, this class of compounds
5 cannot be used reproducibly to distinguish transformed
from non-transformed tissue. New methods for
reproducible selection of or screening for transformed
plant cells are therefore needed.
Accordingly, it is clear that improved methods
and/or approaches to the genetic transformation of
monocotyledonous species would represent a great advance
in the art. Furthermore, it would be of particular
significance to provide novel approaches to monocot
transformation, such as tray.formation of. maize cells,
which would allow fox the production of stably
transformed, fertile corn plants and progeny :into which
desired exogenous genes have been introduced.
Furthermore, the identification of marker gene systems
applicable to monocot systems such as maize would provide
a useful means for applying such techniques generally.
Thus, the development of these and other techniques for
the preparation of stable genetically transformed
monocots such as maize could potentially revolutionize
approaches to monocot breeding.
SUMMARY OF THE IN'7ENTION
The present invention addresses one or more of the
foregoing or other shortcomings in the prior art by
providing methods and compositions for the preparation of
stably transformed, monocotylc ~nous cells and subsequent
regeneration of fertile, transgenic plants and progeny,
particularly maize.
It is therefore a particular object of the present
invention to provide techniques that will allow one to
WO 91 /02071 PCT/U590/04462
f ~~~~~~i.~ ''
6
prepare transgenic, fertile monocots such as maize which
are preferrably diploid and which have been stably
transformed through the introduction of a desired gene
into its genome.
The present invention thus relates generally to
methods for the production of transgenic plants. As used
herein, the term transgenic plants is intended to refer
to plants that have incorporated exogenous genes or DNA
sequences, including but not limited to genes or DNA
sequences which are perhaps not normally present, genes
not normally transcribed and translated ("expressed") in
a given cell type, or any other genes of DNA sequences
which one desires to introduce into the non-transformed
plant, such as genes which may normally be present in the
non-transformed plant but which one desires to have
altered expression.
Exemplary genes which may be introduced include, for
example, DNA sequences or genes from another species, or
even genes or sequences which originate with or are
present in the same species, but are incorporated into
recipient cells by genetic engineering methods rather
than classical reproduction or breeding techniques.
However, the term exogenous, is also intended to refer to
genes which are not normally present in the cell being
transformed, or perhaps simply not present in the form,
structure, etc., as found in the transforming DNA segment
or gene, or genes which are normally present yet which
one desires, e.g., to have overexpressed. Thus, the term
"exogenous" gene or DNA is intended to refer to any gene
or DNA segment that is introduced into a recipient cell,
regardless of whether a similar gene may already be
present in such a cell.
An initial step in the production of fertile
transgenic plants is the obtaining of a DNA composition,
WO 91/02071 ~' ~ ~ ~ v PCT/US90/04462
7
e.g., vectors, plasmids, linear DNA fragments, and the
like, a component of which is to be delivered to
recipient monocotyledonous cells. DNA segments for use
in transforming such cells will, of course, generally
comprise the gene or genes which one desires to introduce
into the cells. These genes can further include
structures such as promoters, enhancers, polylinkers, or
even regulatory genes as desired.
The construction of vectors which may be employed in
practicing the present invention is generally within the
skill of the art. (See generally, refs 79, 80).
Preferred constructs will generally include a plant
promoter such as the CaMV 35S promoter (68), or others
such as CaMV 19S (69), nos (70), Adh (71), sucrose
synthase (72), those associated with the R gene complex
(55), or even tissue specific promoters such as root cell
promoters (73) and tissue specific enhancers (74).
Constructs will also include the gene of interest along
with a 3' end such as that from Tr7 or nos (75), or the
like. Regulatory elements such as Adh intron 1 (76),
sucrose synthase intron (77) or TMV omega element (78),
may further be included where desired.
Certain elements may find utility when incorporated
into genomes, even without an associated expressible
gene. For example, transposons such as Ac, Ds or Mu are
elements which can insert themselves into genes and cause
unstable mutations. This instability apparently results
from subsequent excision of the element from the mutant
locus during plant or seed development. For a re'°iew
covering the use of transposon elements, see references
56 and 57. These elements, particularly Ac, may be
introduced in order to inactivate (or activate) and
thereby "tag" a particular trait. Once tagged, the gene
with this trait may be cloned, e.g., using the transposon
sequence as a PCR primer together with PCR gene cloning
WO 91/02071 PCf/US90/04462
1
~.,~j~~
C~ ~ ~? ~ 1r~ ~) .~. 8
techniques (58,59). Once identified, the entire genes)
for the particular trait, including control or regulatory
regions where desired, may be isolated, cloned and
manipulated as desired prior to re-introduction.
The generation and use of recipient cells is
believed to be an important aspect of the invention. As
used herein, the term "recipient cell" is intended to
refer to monocot cells that are receptive to
transformation and subsequent regeneration into stably
transformed, fertile monocot plants. The inventors thus
propose that not all cells present in a population of
cells subjected to transforming events will be
"recipient" to successful transformation and
regeneration. However, it is proposed that through the
application of the techniques disclosed herein, one will
be enabled to obtain populations which contain sufficient
numbers of recipient cells to allow for successful stable
transformation and regeneration.
Certain techniques are disclosed which may enrich
for recipient cells. For example, it is believed that
. Type II callus development, followed by manual selection
and culture of friable,.embryogenic tissue, results in an
enrichment of recipient cells. Suspension culturing,
particularly using the media disclosed in Table I herein,
may also improve the ratio of recipient to non-recipient
cells in any given population.
The frequency of occurrence of cells receiving DNA
is believed to be low. Moreover, it is most likely that
not all recipient cells receiving DNA segments will
result in a transformed cell wherein the DNA is stably
integrated into the plant genome and~or expressed. Some
may show only initial and transient gene expression.
However, it is proposed that certain cells from virtually
any monocot species may be stably transformed through the
WO 91/02071 ~ ~~ ~7 ~ PCT/US90/04462
r..::
~" f
application of the techniques disclosed herein.
The most preferred monocot will be the cereals such
as maize. With respect to maize, the inventors propose
that many of the techniques of the invention will be
applicable to maize varieties in general, whether inbred,
elite inbred or hybrid varieties. It should be pointed
out, though, that not all cell lines developed out of a
particular variety or cross will necessarily show the
same degree of stable transformability. For example, the
present invention is exemplified through the use of A188
x B73 cell lines developed by standard techniques out of
an A188 x B73 cross. The lines identified as SC716 and
SC82 are examples of cells lines which were developed
from an A188 x B73 cross as described hereinbelow.
However, a number of other cell lines developed from the
same cross have not as yet proven to be stably
transformable. Thus, stable transformability may not be
immediately apparent with some lines even from the same
cross. (2 out of about 12 A188 x B73 lines have proved
to be stably transformable and yield fertile transgenic
plants; about 16% of the linesj. Thus, where one desires
to prepare transformants to a particular cross or
variety, it will generally be desireable to develop
several cell lines from the particular cross or variety
(e.g., 8 to 10), and subject all o~ the lines so
developed to the transformation protocols hereof.
In order to improve the ability to identify
transformants, one may desire to employ a selectable or
screenable marker gene as, or in addition to, the
expressible gene of interest. Marker genes code for
phenotypes that allow cells which express the marker gene
to be distinguished from cells that do not have the
marker. Such genes may encode either a selectable or
screenable marker, depending on whether the marker
confers a trait which one can select for by chemical
WO 91/02071 PCf/US90/04462
to
means, i.e., through the use of a selective agent (e. g.,
an herbicide, antibiotic, or the like), or whether it is
simply a trait that one can identify through observation
or testing (e. g., the R-locus trait). Of course, many
examples of suitable marker genes are known to the art
and can be employed in the practice of the invention.
Possible selectable markers for use in. connection
with the present invention include but are not limited to
a neo gene (82) which codes for kanamycin resistance and
can be selected for using kanamycin, 6418, etc.; a bar
gene which codes for bialaphos resistance; a mutant EPSP
synthase gene (67) which encodes glyphosate resistance; a
nitrilase gene which confers resistance to bromoxynil
(83); a mutant acetolactate synthase gene (ALS) which
confers imidazolinone or sulphonylurea resistance (60);
or a methotrexate resistant DHFR gene (61). Where a
mutant EPSP synthase gene is employed, additional benefit
may be realized through the incorporation of a suitable
chloroplast transit peptide (CTP; see ref. 62).
Exemplary screenable markers include a /~-
glucuronidase or uidA gene (GUS) which encodes an enzyme
for which various chromogenic substrates are known or an
Rrlocus gene, which encodes a product that regulates the
production of anthocyanin pigments (red color) in plant
tissues (59).
Tncluded within the terms "selectable or screenable
marker genes" are also genes which encode a secretable
marker whose secretion can be detected as a means of
identifying or selecting for transformed cells. Examples
include markers which encode a secretable antigen that
can be identified by antibody interaction, or even
35. secretable enzymes which can be detected catalytically.
Secretable proteins fall into a number of classes,
including small, diffusible proteins detectable, e.g., by
WO 91 /020 i 1 PGT/US90/04462
a~~~:;
11
ELISA, small active enzymes detectable in extracellular
solution, or proteins which .:re inserted or trapped in
the cell wall.
Of course, in light of this disclosure, numerous
other possible selectable and/or screenable marker genes
will be apparent to those of skill in the art.
Therefore, the foregoing discussion is intended to be
exemplary rather than exhaustive. Although the present
disclosure is exemplified in detail through the use of
the bar and/or GUS genes, the applicable techniques for
making and using any other screenable or selectable
marker gene will be within the skill in the art in light
of the present disclosure.
An illustrative embodiment of marker genes capable
of being used in systems to select transfo~mants is the
bar gene from Streptomyaes, such as from the
hygroscopicus species. The bar gene codes for
phosphinothricin acetyl transferase (PAT) that
inactivates the active ingredient in the herbicide
bialaphos, phosphinothricin (PPT). PPT inhibits
glutamine synthetase, (29, 47) causing rapid accumulation
of ammonia and cell death. Success in use of this
selective system in the case of monocots was unexpected
because cf the major difficulties which have been
encountered in transformation of cereals (36).
Where one desires to employ a bialaphos resistance
gene in the practice of the invention, the inventors have
discovered that a particularly useful gene for this
purpose is the 'gar gene obtainable from species of
Streptomyces (ACC No. 21,705). The cloning of the bar
gene has been described (29, 45) as has the use of the
bar gene in the context of plants other than monocots
(10, 11). However, in light of the techniques disclosed
herein and the general recombinant techniques which are
WO 91/02071
w ~ ~ '~ ,.~ ~'~ : , , ' . . 1 PCT/US90/04462 ",
(, .
12
known in the art, the introduction and use of any of the
foregoing or other genes is now possible.
The use of a gene from the maize R gene complex is
proposed as a particularly useful screenable marker. The
R gene complex in maize encodes a protein that acts to
regulate the production of anthocyanin pigments in most
seed and plant tissue. Maize strains can have one or as
many as four R alleles which combine to regulate
pigmentation in a developmental and tissue specific
manner. The present inventors have applied a gene from
the R gene complex to maize transformation because it is
viable, it is a naturally occurring product in maize, and
it is visualized without the need for additional assays.
Thus, an R gene.introduced into such cells will cause the
expression of a red pigment and, if stably incorporated,
can be visually scored as a red sector. If a maize line
is dominant for the enzymatic intermediates in the
anthocyanin biosynthetic pathway (C2, A1, A2, Bzl and
Bz2), but recessive at the R locus, any cell from that
line can be employed as a recipient for transformation.
Exemplary lines include rg-Stadler in Wisconsin 22 and
TR112, a K55 derivative which is r-g, b, P1.
The inventors further propose that R gene regulatory
regions may be employed in chimeric constructs in order
to provide mechanisms for controlling the expression of
chimeric genes. More diversity of phenotypic expression
is known at the R locus than at any other locus (63). It
is contemplated that regulatory regions obtained from
regions 5' to the structural R gene could be very
valuable in directing the expression of genes for, e.g.,
insect resistance, herbicide tolerance or other protein
coding regions. For the purposes of the present
invention, it is believed that any of the various R gene
family members may be successfully employed (e.g., P, S,
Lc, etc.). However, the most preferred will generally be
WO 91/02071 ~ r, , PC'I'/US90/04462
6
13
Sn (particularly Sn:bol3). Sn is a dominant member of
the R gene complex and is functionally similar to the R
and B loci in that Sn controls the tissue specific
deposition of anthocyanin pigments in certain seedling
and plant cells. Thus, its phenotype is similar to R.
The choice of the particular DNA segments to be
delivered to the recipient cells will often depend on the
purpose of the transformation. One of the major purposes
of transformation of crop plants is to add some
commercially desirable, agronomically important tr:=is to
the plant. Such traits include, but are not limited to,
herbicide resistance, increased yields, insect and
disease resistance, physical appearance, food content and
makeup, etc. For example, one may desire to incorporate
one or more genes encoding herbicide resistance. The bar
and glyphosate tolerant SP synthase genes are good
examF?_ps. A potential insect resistance gene which can
be introduced includes the Bacillus thuringiensis crystal
toxin gene (86), which may provide resistance to pests
such as lepidopteran or coleopteran.
Genes encoding proteins characterized as having
potential insecticidal activity, such as the cowpea
trypsin inhibitor (CpTI; 88) may find use as a rootworm
deterrent; genes encoding vermectin (84,85) may prove
particularly useful as a corn rootworm deterent.
Furthermore, genes encoding lectins may confer
insecticide properties (e. g., barley, wheat gerr-
agglutinin, rice lectins, see ref. 81), while others may
confer antifungal properties (e. g., hevein, chitinase,
see, e.g., ref. 65).
It is proposed that benefits may be realized in
terms of increased resistance to cold temperatures
through the introduction of an "antifreeze" protein such
as that of the Winder Flounder (87).
WO 91/02071 , . PCT/US90/04462
Mri , ,.F.t..
isv~
14
Ultimately, the most desirable "traits" for intro-
duction into a monocot genome may be homologous genes or
gene families which encode a desired trait (e. g.,
increased yield per acre) and which are introduced under
the control of novel promoters or enhancers, etc., or
perhaps even homologous or tissue specific (e. g., root
specific) promoters or control elements.
The invention thus contemplates that particular
benefits may be realized by the transformation of plant
cells with any expressible gene, and is not intended to
be limited to the use of marker genes. As used herein,
an "expressible gene" is any gene that is capable of
being translated into a protein, expressed as a trait of
interest, or the like, etc., and is not limited to
selectable, screenable or non-selectable marker genes.
The invention also contemplates that, where both an.
expressible gene that is not necessarily a marker gene is
employed in combination with a marker gene, one may
employ the separate genes on either the same or different
DNA segments for transformation. In the latter case, the
different vectors are delivered concurrently to recipient
cells to maximize cotransformation.
In certain embodiments, recipient cells are selected
following growth in culture. Where employed, cultured
cells will preferably be grown either on solid supports
or in the form of liquid suspensions. In either
instance, nutrients may be provided to the cells in the
form of media, and environmental conditions. controlled.
There are many types of tissue culture media comprising
amino acids, salts, sugars, hormones and vitamins. Most
of the media employed in the practice of the invention
will have some similar components (see, e.g., Table 1
herein below), the media differ in the composition and
proportions of their ingredients depending on the
WO 91/02071 ~ ~ ~j ;~ ~ ~ ,~, PCf/US90/04462
>~:a~ i5
particular application envisioned. For example, carious
cell types usually grow in more khan one type of :=iia,
but will exhibit different growth rates and different
morphologies, depending on the growth media. In some
5 media, cells survive but do not divide.
Various types of media suitable for culture of plant
cells have been previously described. Examples of these
media include, but are not limited to the N6 medium
10 described by Chu, et al. (5) and the MS media (30). In
an exemplary embodiment for preparation of recipient
cells, the inventors have modified these media (see,
Table 1). A preferred hormone for such purposes is
dicamba or 2,4-D. I~owever, other hormones may be
-15 employed, including NAA or NAA + 2,4-D. Modifications of
these~and other basic media may facilitate growth of
recipient cells at specific developmental stages.
An exemplary embodiment for culturing recipient corn
.<-20 cells in suspension cultures includes using embryogenic
cells in Type II callus, selecting for small (10-30
isodiametric, cytoplasmically dense cells, growing the
cells in suspension cultures with hormone containing
media, subculturing into a progression of media to
x~25 facilitate development of shoots and roots, and finally,
hardening the plant and readying it metabolically for
growth in soil. For use in transformation, suspension
culture cells may be cryopreserved and stored for periods
of time, thawed, then used as recipient cells far
30 transformation.
An illustrative embodiment of cryopreservation
methods comprises the steps of slowly adding
cryoprotectants to suspension cultures to give a final
v'35 concentration of 10% dimethyl sulfoxide, 10% polyethylene
glycol (6000MW), 0.23 M proline, and 0.23 M glucose. The
mixture. is then cooled to -35°C at 0.5°C per minute.
.. .
WO 91!02071 ~ ,-. ~, ~ ~ PCT/US90/04462
'.
16
After an isothermal period of 45 minutes, samples are
placed in liquid Nz. (Modification of methods of Withers
and King (49); and Finkle, et al.(15)). To reinitiate
suspension cultures from cryopreserved material, cells
may be thawed rapidly and pipetted onto feeder plates
similar to those described by Rhodes, et al. (38).
One embodiment of cultured plant cells that can
serve as recipient cells for transforming with desired
DNA segments, such as those which comprise expressible
genes, includes corn cells, more specifically, cells from
Zea mays L. Somatic cells are of various types.
Embryogenic cells are one example of somatic cells which
may be induced to regenerate a plant through embryo
formation. Non-embryogenic cells are those which will
typically not respond in such a fashion. An example of
non-embryogenic cells are certain Black Mexican Sweet
(BMS) corn cells, and these have been successfully
transformed by microprojectile bombardment using the neo
gene followed by selection with the aminoglycoside,
kanamycin (22). However, this BMS culture was not found
to be regenerable, and general use of kanamycin may be
hampered by endogenous resistance of maize (19).
Other recipient cell targets include, but are not
limited to, meristem cells, Type I and II calli and
gametic cells such as ~nicrospores and pollen. Pollen, as
well as its precursor cells, micropsores; may be capable
of functioning as recipient cells for genetic
transformation, or as vectors to carry foreign DNA for
incorporation during fertilization. Direct pollen
transformation would obviate the need for cell culture.
Meristematic cells (i.e:, plant cells capable of
continual cell division and characterized by an
undiffexer~tiated cytological appearance, normally found
at growing points or tissues in plants such as root tips,
stem apices, lateral buds, etc.) may represent another
CA 02064761 2000-OS-15
17
type of recipient plant cell. Because of their undiffer-
entiated growth and capacity for organ differentiation
and totipotency, a single transformed meristematic cell
could be recovered as a whole transformed plant. In
fact, it is proposed that embryogenic suspension cultures
may be an in vitro meristematic cell system, retaining an
ability for continued cell division in an
undifferentiated state, controlled by the media
environment.
to
The development of embryogenic maize calli and
suspension cultures useful in the context of the present
invention, e.g., as recipient cells for transformation,
has been described.
There are many methods for introducing transforming
DNA segments into cells, but not all are suitable for
delivering DNA to plant cells. Suitable methods are
believed to include virtually any method by which DNA can
be introduced into a cell, such as by Agrobacterium
infection or direct delivery of DNA such as, for example,
by PEG-mediated transformation, by electroporation or by
acceleration of DNA coated particles, etc. Acceleration
methods are generally preferred and include, for example,
microprojectile bombardment and the like.
Electroporation has been used to transform corn
protoplasts (17).
An example of a method for delivering transforming
DNA segments to plant cells is microprojectile
bombardment. In this method, non-biological particles
may be coated With nucleic acids and delivered into cells
by a propelling force. Exemplary particles include those
comprised of tungsten, gold, platinum, and the like.
A particular advantage of microprojectile
WO 91/02071 . . PCT/US90/04462
~~~'v'
18
bombardment, in addition to it being an effective means
of reproducibly stably transforming monocots, is that
neither the isolation of protoplasts (8) nor the
susceptibility of Agrobacterium infection is required.
An illustrative embodiment of a method for delivering DNA
into maize cells by acceleration is a Biolistics Particle
Delivery System, which can be used to propel particles
coated with DNA through a screen, such as a stainless
steel or Nytex screen, onto a filter surface covered with
corn cells cultured in suspension.
For the bombardment, cells in suspension are
preferably concentrated on filters. Filters containing
' the cells to be bombarded are positioned at an
. 15 appropriate distance below the macroprojectile stopping
plate. If desired, one or more screens are also
positioned between the gun and the cells to be bombarded.
Through the use of techniques set forth herein one may
obtain up to 1000 or more clusters of cells transiently
expressing a marker gene ("foci") on the bombarded
filter. The number of cells in a focus which express the
exogenous gene product 48 hours post-bombardment often
range from 1 to 10 and average 2 to 3.
After effecting delivery of exogenous DNA to
recipient cells by any of the methods discussed above, a
preferred step is to identify the transformed cells for
further culturing and plant regeneration. This step may
include assaying cultures directly for a screenable trait
or by exposing the bombarded cultures to a selective
agent or agents.
An example of a screenable marker trait is the red
pigment produced under the control of the R-locus in
,'~ 35 maize. This pigment may be detected by culturing cells
on a solid support containing nutrient media capable of
supporting growth at this stage, incubating the cells at
WO 91/02071 ~ ~ ~ ~ ~ '~ PCT/US90/04462
19
e.g., 18° C. and greater than 180 ELF m~2 sec-1, and
selecting cells from colonies (vis.~~le aggregates of
cells) that are pigmented. These cells may be cultured
further, either in suspension or on solid media.
An exemplary embodiment of methods for identifying
transformed cells involves exposing the bombarded
cultures to a selective agent, such as a metabolic
inhibitor, an antibiotic, herbicide or the like. Cells
which have been transformed and have stably integrated a
marker gene conferring resistance to the selective agent
used, will grow and divide in culture. Sensitive cells
will not be amenable to further culturing.
To use the bar-bialaphos selective system, bombarded
cells on filters are resuspended in nonselective liquid
medium, cultured (e.g., for one to two weeks) and
transferred to filters overlaying solid medium containing
from 1-3 mg/1 bialaphos. While ranges of 1-3 mg/1 will
typically be preferred, it is proposed that ranges of
0.1-50 mg/1 will find utility in the practice of the
invention. The type of filter for use in bombardment is
not believed to be particularly crucial, and can comprise
any solid, porous, inert support.
Cells that survive the exposure to the selective
agent may be cultured in media that supports regeneration
of plants. An example of suitable media is a
modification of MS media (Table 1). Tissue is maintained
on a basic media with hormones for about 2-4 weeks, then
transferred to media with no hormones. After 2-4 weeks,
shoot development will signal the time to transfer w
another vdia.
35~ Regeneration typically requires a progression of
media whose composition has been modified to pravide the
appropriate nutrients and hormonal signals during
WO 91/OZ071 FCT/US90/044b2
~~',~3
sequential developmental stages from the transformed
callus to the more mature plant. Developing plantlets
are transferred to soil, and hardened, e.g., in an
environmentally controlled chamber at about 85% relative
5 humidity, 600 ppm CO2, and 250 microeinsteins m Z~s-1 of
light. Plants are preferably matured either in a growth
chamber or greenhouse. Regeneration will typically take
about 3-12 weeks. During regeneration, cells are grown
. on solid media in tissue culture vessels. An
10 illustrative embodiment of such a vessel is a petri dish.
Regenerating plants are preferably grown at about 19 to
28°C. After the regenerating plants have reached the
stage of shoot and root development, they may be
. transferred to a greenhouse for further growth and
. 15 testing.
To confirm the presence in the regenerating plants
of traits delivered to the recipient cells through the
application of exogenous DNA, alone or in conjunction
20 with marker genes, assays for expression of said genes
may be performed, e.g., by testing parts of the
regenerated plants. Exemplary parts which may be assayed
are leaves. A typical transformant assay includes
contacting regenerating plants or extracts of plants with
a substrate that is acted upon by the transforming gene
product. At this stage of development, the plants will
not be lethally affected by such an assay. Removal of
small portions of the plants does not cause their death
or interfere with further development.
In one study, Ro plants were regenerated from trans-
formants of an A188 x B73 suspension culture line (SC82)
transformants, and these plants exhibited a phenotype
expected of the genotype of hybrid A188 X B73 from which
the callus and culture were derived. The plants were
similar in height to seed-derived A188 plants (:3-5 ft
tall) but had B73 traits such as anthocyanin accumulation
WO 91/02071 ~' ~ ~ .~ PCT/US90/04462
~."~'.
21
in stalks and prop roots, and the presence of upright
leaves. It would also be expected that some traits in
the transformed plants would differ from their source,
and indeed some variation will likely occur.
In an exemplary embodiment, the proportion of
regenerating plants derived from transformed callus that
successfully grew and reached maturity after transfer to
the greenhouse was 97% (73 of 76). Tn one example, at
least 50 viable progeny were recovered from Ro plants. Ro
plants in the greenhouse were tested for fertility by
backcrossing the transformed plants with seed-derived
plants by pollinating the Ro ears with pollen from seed
derived B73 plants and this resulted in kernel
development. Note, however, that kernels on transformed
plants may require embryo rescue due to cessation of
kernel development and premature senescence of plants.
To rescue developing embryos, they are excised from
2o surface-disinfected kernels 10-20 days post-pollination
and cultured. An embodiment of media used for culture at
this stage comprises MS salts, 2% sucrose, and 5.5 g/1
agarose. In an illustrative embodiment of embryo rescue,
large embryos (defined as greater than 3 mm in length)
are germinated directly on an appropriate media. Embryos
smaller than that were cultured for one week on media
containing the above ingredients along with 10-SM abscisic
acid and then transferred to hormone-free medium for
germination.
Progeny may be recovered from the transformed plants
and tested for expression of the exogenous expressible
gene by localized application of an appr.priate substrate
to plant parts such as leaves. In the case of bar
transformed plants, it was found that transformed
parental plants (Ro) and their progeny (R1) exhibited no
bialaphos-related necrosis after localized applicatirn of
CVO 91/02071 PC1'/US90/04462
~ '~' ~ (..y;':
22
the herbicide Baste to leaves, if there was functional
PAT activity in the plants as assessed by an in vitro
enzymatic assay. In one study, of 28 progeny (R1) plants
tested, 50% (N=14) had PAT activity. All PAT positive
progeny tested contained bar, confirming that the
presence of the enzyme and the resistance to bialaphos
were associated with the transmission through the
germline of the marker gene. The nonchimeric nature
of
the callus and the parental transformants (Ro) was
suggested by germline transmission and the identical
Southern blot hybridization patterns and intensities
of
the transforming DNA in callus, Ro plants and R1 progeny
that segregated for the transformed gene.
Genomic DNA may be isolated from callus cell lines
and plants to determine the presence of the exogenous
gene through the use of techniques well known to those
skilled in the art. Note, that intact sequences will
not
always be present, presumably due to rearrangement or
deletion of sequences in the cell.
.a
The inventors have been successful in producing
fertile transgenic monocot plants (maize) where Qthers
have failed. Aspects of the methods of the present
invention for producing the fertile, transgenic corn
plants comprise, but are not limited to, development
of
suspension cultures of recipient cells using media
conducive to specific growth patterns, choice of
selective systems that permit efficient detection of
transformation; modifications of acceleration methods
to
introduce genetic vectors with exogenous DNA into cells;
invention of methods to regenerate plants from
transformed cells at a high frequency; and the production
of fertile transgenic plants capable of surviving and
reproducing.
WO 91/02071 PCI'/US90/04462
23
Callus - Proliferating mass of cells or tissue ".p vitro.
Type I - A compact, slow growing, heteromorphic
callus (embryogenic/organogenic) which retains
meristematic activity in regians of organized
tissue.
Type II - A friable, fast growing embryogenic
callus composed of aggregates of small
isodiametric cells with dense cytoplasm. Often
contains small embryoids attached to the
underlying callus by a suspensor.
Embryogenic Callus - A type of callus capable of
differentiating into somatic embryos.
Germinal Cells (Gametes - Cells of an organism which are
capable of transferring their genetic information to the
next generation.
Genotype - The genetic complement of an organism.
Heteroloq_ous DNA - DNA from a source different than that
of the recipient cell.
Homoloctous DNA - DNA from the same source as that of the
recipient cell.
Hybrid - Progeny resulting from a cross between parental
lines.
Tnbred Lines - Organisms that are genetically homogeneous
(homozygous) resulting from many generations of self
crossing.
In Vitro - In the laboratory.
In Vivo - In the living organism.
Monocot - Plants having a single cotyledon (the first
leaf of the embryo of seed plants); examples include
cereals such as maize, rice, wheat, oats and barley.
Non-Embryogrenic Callus - A type of callus composed of
undifferentiated, often highly vacuolated cells which are
unable to be induced to form embryos.
Phenotype - Traits exhibited by an organism resulting
from the interaction of genotype and environment.
Protoplast - Plant cells exclusive of the cell walls.
Somatic Cells - Body cells of an organism, exclusive of
WO 91/02071 . PCT/US90/044b2
2~64'~~~
24
germinal cells.
Transformation - Acquisition of new genetic coding
sequences by the incorporation of added (exogenous) DNA.
Trans eg nic - Organisms (plants or. animals) into which new
DNA sequences are integrated.
BRTEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Schematic representation of plasmids
!vectors) used in bombardment experiments. The plasmids
have been named (A) pDPG165 which contains bar, and (B)
pDPG208 which contains uidA (the gene which encodes Q-
glucuronidase (GUS)). Letters designate the locations of
various restriction sites, locations which may be cleaved
by restriction endonucleases, E, EcoRI; H, HindIII; B,
BamHI; S, SmaI. A more detailed map of pDPG165 is shown
in (C), of pDPG208 in (D). In (E) is shown a restriction
map of pAGUSI, also known as pDPG141, in which a the 5'-
noncoding and 5'-coding sequences were modified to
incorporate the Kozak consensus sequence and a HindIII
restriction site. In (F) is shown a restriction map of
pDPG237, a plasmid which contains Sn:bol3 cDNA, and in
(G) is shown a map of pDPG232, a plasmid which
incorporates Rsn cDNA along with a 35S promoter and a Tr7
3' end.
FIG. 2. ADpearance of cell colonies which emerge
on selection plates with bialaphos. Such colonies appear
6-7 weeks after bombardment. (A) SC82 bialaphos-
resistant colony selected on 1 mg/1 bialaphos. (B)
Embryogenic SC82 bialaphos-resistant callus selected and
maintained on 1 mg/1 bialaphos.
FIG. 3. Phosphinothricin acetyl transferase (PATZ
activity in embrvoaenic SC82 callus transformants
designated E1-E11 and a nonselected control (EO). 25 ~Cg
WO 91!02071 ~ ~ '~ PCT/US90/044t2
of protein extract were loaded per lane. B13 is a BMS-
bar transformant. BMS is Black Mexican Sweet corn.
Activities of the different transformants varied
approximately 10 fold based on the intensities of the
5 bands.
FIG. 4. Integration of the bar Gene in bialaphos-
resistant SC82 callus isolates E1-E11. DNA gel blot of
genomic DNA (4 ~g/digest) from E1-E11 and a nonselected
10 control (EO) digested with EcoRI and HindIII. The
molecular weights in kb are shown on the left and right.
' The blot was hybridized with 3zP-labeled bar from pDPG165
. 025x106 Cerenkov cpm). Lanes designated 1 and 5 copies
refer to the diploid genome and contain 1.9 and 9.5 pg
15 respectively of the 1.9 kb bar expression unit released
from pDPG165 with EcoRI and HindIII.
FIG. 5. PAT Activity in Prote:... Extracts of R~
Plants. Extracts from one plant derived from each of the
20 four transformed regenerable callus lines from a
suspension culture of A188 x B73, SC82 (E10, E11, E2/E5,
and E3/E4/E6) were tested for PAT activity (The
designations E2/E5 and E3/E4/E6 represent transformed
cell lines with identical DNA gel blot hybridization
25 patterns; the isolates were most likely separated during
the culturing and selection process.) Protein extracts
from a.nontransformed B73 plant and a Black Mexican Sweet
(BMS) cell culture bar transformant were included as
controls. Approximately 50 micrograms of total protein
was used per reaction.
FIG. 6. DNA Gel Blot Analysis of Genomic DNA .'rom
Transformed Callus and Corresponding R Plants Probed
with bar. Genomic DNA was digested with EcoRI and
HindIII, which released the 1.9 kb bar expression unit
(CaMV 35S promoter-bar-Tr7 3'-end) from pDPG165, the
plasmid used for micr~~projectile bombardment
a
WO 91/02071 ~ ~ ~ ~~ ~ ~ PCT/US90/04462
~'::::'J
26
transformation of SC82 cells, and hybridized to bar. The
molecular weights in kb are shown on the left and right.
Lanes designated E3/E4/E6, E11, E2/E5, and E10 contained
5 ~.g of either callus (C) or Ro plant DNA. The control
lane contained DNA from a nontransformed A188 X B73
plant. The lane designated "1 copy" contained 2.3 pg of
the 1.9 kb EcoRI/HindIII fragment from pDPG165
representing one copy per diploid genome.
FIG. 7. PAT Activity and DNA Gel Blot Analysis of
Segreca~ tin_,~roaen~r of E2JE5 Ro Plants. (A) Analysis of
PAT activity in ten progeny (lanes a-j) and a
nontransformed control plant (lane k). Lanes designated
a, b-h, i, and j contained protein extracts from progeny
of separate parental Ro plants. The lane designated
callus contained protein extract from E2/E5 callus.
Approximately 25 micrograms of total protein were used
per reaction. (B) DNA gel blot analysis of genomic DNA
isolated from the ten progeny analyzed in A. Genomic DNA
(5 ~g/lane) was digested with SmaI, which releases a 0.6
kb fragment containing bar from pDPG165, and hybridized
with bar probe. The lane designated Ro contained DNA
from the Ro parent of progeny a. The lane designated 1
copy contained pDFG165 digested with SmaI to represent
approximately 1 copy of the 0.6 kb fragment per diploid
genome (0.8 pg).
FIG. 8. Histochemical determination of GUS
activity in bar-transformed SC82 callus line Y13. This
' 30 bialaphos-resistant callus line, Y13, which contained
intact GUS coding sequences was tested for GUS activity
three months post-bombardment. In this figure,
differential staining of the callus was observed.
FIG. 9. Integration of exogenous genes in
bialaphos-resistant SC716 isolates R1-R21. (A) DNA gel
blot of genomic DNA (6 ~Cg/digest) from transformants
WO 91 /02071
rcr/us9o/oaa62
.,.a
27
isolated from suspension culture of A188 x B73 (SC716),
designated R1-R21, were digested with EcoRI and HindIII
and hybridized to 32P-labeled bar probe (--10x106 Cerenkov
' cpm). Molecular weight markers in kb are shown on the
left and right. Two copies of the bar expression unit
per diploid genome is 5.7 pg of the 1.9 kb EcoRI/Hind
fragment from pDPG165. (B) The blot from A was washed
and hybridized with 32P-labelled GUS probe (-35x106
Cerenkov cpm). Two copies of the 2.1 kb GUS-containing
EcoRI/HindIII fragment from pDPG208 is 6.3 pg.
FIG. 10. Functional Expression of Introduced Genes
in Transformed R and R1 Plants. (A) BastaR resistance in
transformed Ro plants. A BastaR solution was applied to a
large area (about 4 x 8 cm) in the center of leaves of
nontransformed A188 x B73 plant (left) and a transgenic
Ro E3/E4/E6 plant (right). (B) BastaR resistance in
transformed R1 plants. BastaR was also applied to leaves
of four R1 plants; two plants without bar (left) and two
plants containing bar (right). The herbicide was applied
to R1 plants in 1 cm circles to four locations on each
leaf, two on each side of the midrib. Photographs were
taken six days after application. (C) GUS activity in
leaf tissue of a transgenic Ro plant. Histochemical
determination of GUS activity in leaf tissue of a plant
regenerated from cotransformed callus line Y13 (right)
and a nontransformed tissue culture derived plant (left).
Bar = 1 cm. (D) Light micrograph of the leaf segment
from a Y13 plant shown in (C), observed in surface view
under bright field optics. GUS activity was observed in
many cell types throughout the leaf tissue (magnification
230X). (E) Light micrograph as in (D) of control
- leaf .
FIG. il. Mature R_ Plant, Developina Kernels and
Proqe ~. (A) Mature transgenic R~ plant regenerated
.' from an E2/E5 callus. (B) Progeny derived from an E2/E5
WO 91/02071 , ', ~ PCT/US90/04462
~b ~,v ,
i
28
plant by embryo rescue; segregant bearing the resistance
gene on the right, and lacking the gene on the left. (C)
Using pollen from transformed R1 plants to pollinate B73
ears, large numbers of seed have been recovered. (D) A
transformed ear from an R1 plant crossed with pollen from
a non-transformed inbred plant.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
For the first time, fertile transgenic maize plants
have been produced, opening the door to new vistas of
crop improvement based on in vitro genetic
transformation. The inventors have succeeded where
others have failed by combining and modifying numerous
steps in the overall process leading from somatic cell to
transgenic plant. Although the methods disclosed herein
are part of a unified process, for illustrative purposes
they may be subdivided into: culturing cells to be
recipients for exogenous DNA; cryopreserving-recipient
cells; constructing vectors to deliver the DNA to cells;
delivering DNA to cells; assaying for successful
transformations; using selective agents if necessary to
isolate stable transformants; regenerating plants from
transformants; assaying those plants for gene expression
~r 25 and for identification of the exogenous DNA sequences;
determining whether the transgenic plants are fertile;
and producing offspring of the transgenic plants. The
invention also relates to transformed maize cells,
transgenic plants and pollen produced by said plants.
A. Tissue Culture
Tissue culture requires media and controlled
j environments. "Media" refers to the numerous nutrient
mixtures that are used to grow cells in vitro, that is,
outside of the intact living organism. The medium is
usually a suspension of various categories of ingredients
WO 91/02071 1PCT/US90/04462
29
salts, amino acids, hormones, sugars, buffers) that are
required for growth of most ce _ types. However, each
specific cell type requires a specific range of
ingredient proportions for growth, and an even more
specific range of formulas for optimum growth. Rate of
cell growth will also vary among cultures initiated with
the array of media that permit growth of that cell type.
Nutrient media is prepared as a liquid, but this may
be solidified by adding the liquid to materials capable
of providing a solid support. Agar is most commonly used
for this purpose. Bactoagar and Gelgro are specific
types of solid support that are suitable for growth of
plant cells in tissue culture.
Some cell types will grow and divide either in
liquid suspension or on solid media. As disclosed
herein, maize cells will grow in suspension, but
regeneration of plants requires transfer from liquid to
2p solid media at some point in development. The type and
extent of differentiation of cells in culture will be
affected not only by the type of media used and by the
environment, for example, pH, but also by whether media
is solid or liquid. Table 1 illustrates the composition
of various media useful for creation of recipient cells
and for plant regeneration.
Bo Culturing Cells in suspension to
be Recipients for Transformation
It is believed by the inventors that the ability to
prepare and cryopreserve suspension cultures of maize
cells _s an important aspect of the present invention, in
that it provides a means for reproducibly and
successfully preparing cells for transformation. The
studies described below set forth techniques which have
been successfully applied by the inventors to generate
transformable and renegerable suspension cultures of
WO 91/02071 , ~ PCT/US90/04462
;i;-i'
maize cells. A variety of different types of media have
been developed by the inventors and employed in carrying
out various aspects of the invention, including in
particular, the development of suspension cultures. The
5 following table, Table 1, sets forth the composition of
the media preferred by the inventors for carrying out
these aspects of the invention.
WO 91/02071 ~ ~ ~ ~ a ~ ~ PC1'/US90/04462
31
Ta ble Illustrative Embodiments of Tissue Culture
1:
Media Which
are Used
for Type
II C llus
Development, Development of Susper~.ion
Cultures and Regeneration of Plant Cells
(Specifically
Maize Cells)
Medium
Id. Optimal Other
Number MS* N6 Sucrose pH Components**
52 + - 2% 6.0 0.25 mg thiamine
1 m~ 2,4-D
10 M ABA
Bactoagar
101 + - 3% 6.0 100 mg myo-inositol
v Bactoagar
142 + - 6% 6.0 5 mg BAP
v 0.186 mg NAA
0.175 mg IAA
0.403 mg 2-IP
200 mg myo-inositol
Bactoagar
163 + - 3% 6.0 3.3 mg dicamba
v l00 mg myo-inositol
Bactoagar
171 + - 3% 6.0 0.25 mg 2,4-D
v 10 mg BAP
100 mg myo-inositol
Bactoagar
173 + - 6% 6.0 5 mg BAP
v 0.186 mg NAA
0.175 mg IAA
403 mg 2-IP
0.
_
10 5M ABA
200 mg myo-inositol
Bactoagar
177 + - 3% 6.0 0.25 mg 2,4-D
v l0 mg BAP
10-5M ABA
100 mg myo-inositol
Bactoagar
201 - + 2% 5.8 25 mM proline
v 1 mg 2,4-D
100 mg casein
hydrolysate
GelgroR
WO 91102071 ~ ~ ~ ; PCT/US90/04462
. .,.
32
205 - + 2% 5.8 25 mM proline
v 0.5 mg 2,4-D
100 mg casein
hydrolysate
GelgroR
227 - + 2% 5.8 25 mM proline
v 13.2 mg dicamba
l0 100 mg casein
hydrolysate
GelgroR
401 + - 3% 6.0 0.25 mg thiamine
1 mg 2,4-D
. 2 mg NAA
200 mg casein
hydrolysate
500 mg K sulfate
100 mg myo-inositol
400 mg K phosphate
(monobasic)
402 + - 3a 6.0 0.25 mg thiamine
25 mM proline
1 mg 2,4D
200 mg casein
hydrolysate
500 mg K sulfate
400 mg K phosphate
(monobasic)
100 mg myo-inositol
40~ + - 3% 6.0 0.25 mg thiamine
.y35 25 mM proline
10 mg dicamba
200 mg casein
hydrolysate
500 mg K sulfate
A
400 mg K phosphate
(monobasic)
100 mg myo-inositol
501 - - 20 5.7 Clark's ***
145 GelgroR
* Basic MS medium described reference 30. The
in
medium described in ref. is typically modified
30 by
decreasing the NH4N03 from
1.64 g/1 to 1.55 g/1,
and
omitting the pyridoxine nicotinic acid, myo-
HC1,
inositol and glycine.
~55 + = present; - - absent; itamins
v=v
WO 91/02071 ~ ~ ~ ~ ;~ ~ ~ PCT/US90/04462
33
** NAA = Napthol Acetic Acid
IAA = Indole Acetic Acid
2-IP = 2, isopentyl adenine
2,4-D = 2, 4-Dichlorophenoxyacetic Acid
BAP = 6-benzyl aminopurine
ABA = abscisic acid
*** Basic medium described in reference 6
WO 91/02071 ' ' : PCT/US90/04462
'' 3 4
Example 1: Initiation of the Suspension Culture
GII(A188XB79)716 (designated SC716)
for Use in Transformation
This Example describes the development of a maize
suspension culture, designated SC716, which was employed
in various of the transformation studies described
hereinbelow. The Type II tissue used to initiate the
l0 cell suspension was derived from immature embryos of A188
x B73 plated onto N6-based medium with 1 mg/ml 2,4-D
(201; see Table 1). A Type II callus was initiated by
visual selection of fast growing, friable embryogenic
cells. The suspension was initiated within 6 months
after callus initiation. Tissue chosen from the callus
to initiate the suspension consisted of very
undifferentiated Type II callus, the characteristics of
this undifferentiated tissue are the earliest stages of
embryo development along with the soft, friable,
undifferentiated tissue underlying it.
Approximately one gram of tissue was added to 20 mls
.:of liquid medium. In this example, the liquid medium was
medium 402 to which different slow-release hormone
capsule treatments were added (see Example 12 below).
These capsule treatments included 2,4-D, NAA, 2,4-D plus
NAA, and 2 NAA capsules. One flask was initiated for
each of the different 402 media plus hormone
combinations. Every 7 days each culture was subcultured
into fresh medium by transferring a small portion of the
cellular suspension to a new flask. This involved
swirling the original flask to suspend the cells (which
tend to settle to the bottom of the culture vessel),
tilting the flask on its side and allowing the denser
cells and cell aggregates to settle slightly. One ml of
packed cells was then drawn off from this pool of settled
cells together with 4 mls of conditioned medium. A
sterile ten ml, wide tip, pipet was used for this
WO 91/02071 PGT/US90/04462
transfer (Falcon 7304). Any very large aggregates ~.f
cells which would not pass easily througr~ the pipet tip
were excluded. If a hormone capsule was; present, it was
also transferred to the new flask.
5
After approximately 7 weeks, the loose embryogenic
cell aggregates began to predominate and fragment in each:
of the cultures, reaching a state referred to as
"dispersed." The treatment which yielded the highest
': proportion of embryogenic clusters was the 402 medium
plus a NAA capsule. After the cultures became dispersed
and were growing at a fast rate, doubling approximately
every two to three days as determined by increase in
packed call volume, a one ml packed cell inoculum from
15 each culture was transferred into 401 medium using a ten
ml narrow tip pipet (Falcon 7551). These transfers were
performed about every 3'~ days. An inoculum from the 402
plus 2,4-D plus NAA capsules culture was also used to
initiate a culture in 409 medium (402 minus 2,4-D and
20 plus lOmg/1 dicamba) either with or without 1 ml coconut
water (Gibco 670-8130AG).
The most dispersed cultures were cryopreserved after
2 weeks, 2 months or 5 months.
The culture grown on 409 with coconut. water was
brought out of cryopreservation eight months later and
thawed, cultured for two weeks on solid 201 culture
medium using BMS as a feeder layer (38) and transferred
to media 409 without coconut water. The culture was
maintained by subculturing twice weekly, using 409 media,
by t. method described above.
Example 2: Initiation of the Suspension Culture
(A1.88 X B73)82 (designated SC82) for
Use in Transformation
This Example describes the development of another
WO 91/02071 PCT/US90/04462
'~ui~'>
36
cell line employed in various of the transformation
studies set forth. below, termed SC82. In the development
of SC82, inoculum for suspension culture initiation was
visually selected from a Type II callus that was derived
from immature embryos plated on a N6-based medium
containing 13.2 mg/1 dicamba (227) (Table 1). The
suspension culture was initiated within 3 months of
initiation of the Type II callus. Small amounts (50-100
mg) of ca~.lus distinguishable by visual inspection
because of its highly proembryonic morphology, were
isolated from more mature or organized structures and
inoculated into a 50 m1 flask containing 5 mls of filter-
sterilized conditioned medium from the various GII (A188
x B73) 716 suspension cultures (402 medium with four
types of capsule treatments and 409 medium).
After one week, this 5 ml culture was sieved through
a 710 micron mesh and used to inoculate 20 mls of
corresponding fresh and filter-sterilized conditioned
medium from the established GII (A188 x B73) 716 cultures
in 150 ml flasks. After one week or mare of growth, two
mls of packed cells were subcultured to fresh media by
the method described above. The suspension culture
maintained on 409 by this method was then cryopreserved
within 3 months. The original cell line, which was
maintained on 409 (not a reinoculated cryopreserved
culture) was used in experiments 1 and 2 months later
which resulted in stable transformation and selection
(see Table 2 below). The cryopreserved culture was used
- 30 for experiment 6 (see Table 2 below).
C. Slow Release Plant Hormone Capsules
Studies following the fate of radioactively labelled
plant hormones (2,4-D and NAA) showed that within two
days corn cells absorb most of the auxins present in
suspension culture media. This problem of hormone
WO 91/02071 PC('/US90/04462
~~%c
37
depletion can be overcome by spiking the cultures with a
small amount of auxin every other day. However, spiking
cultures is very time consuming when done on a large
scale and also increases the risk of contamination as the
culture vessels must be opened frequently. Slow release
plant hormone capsules were developed to overcome these
problems. In summary, these capsules comprise a plant
hormone, usually in a crystalline state, encapsulated in
a silicone matrix surrounded by a silicone limiting
membrane. The rate of hormone release is controlled by
the : ~e of the diffusible area and the thickness of the
membrane. They have the advantages of 1) supplying
hormones at an acceptable and predictable rate (e. g.,
- 100 ~.g/20 ml culture media/day, 2) they are of a
15 convenient size (e.g., 0.5 - I.5 .:m in length) for use in
liquid or solid culture medium, 3) they are very durable
and easily sterilized by autoclaving, and 4) they can be
stored dry until needed.
20 The present formulation involves the controlled
release of a plant hormone or selective agent for a plant
tissue culture from an inner matrix containing crystals
of the desired agent through an outer diffusion limiting
membrane. A preferred embodiment of the formulation is
to mix 30o dry crystals of the desired agent with 70%
(w/w) room temperature vulcanizing (RTV) silicone which
is then injected into silicone tubing having an
appropriate diameter and wall thickness for the desired
release rate of the desired agent. (The preferred agents
for employing in connection with the slow release
capsules are 2,4-D and NAA, and the preferred dimensions
are 0.062" ID x 0.125" OD).
The RTV silicone is then polymerized at room
temperature or at a higher temperature to accelerate the
vulcanization process. Following vulcanization of the
. inner matrix, the tubing is cut to desired lengths and
WO 91/02071 , PCT/US90/04462
c. .., .r ~.i
~e~ rs~ . 3~
l0
the ends sealed with RTV silicone. The preferred lengths
for use in connection with the present invention are
about 0.5 cm. After the end seals have polymerized, the
resulting capsules can either be stored, as is, or
autoclaved for 15 minutes on a fast exhaust cycle and
stored indefinitely in a sterile form. Prior to use the
capsules may be equilibrated to establish a stable
diffusion gradient across the membrane, or used directly
without equilibration.
Another formulation for a much lower release rate is
to enclose crystals of 'a desired substance suspended in a
liquid such as water or silicone oil in a relatively
nonpermeable tubing such as Nylon-11. The release rate
from this reservoir can then be regulated by drilling
various size holes in the tubing and glueing a silicone
window over the hole with silicone medical adhesive.
once again the capsules can be sterilized by autoclaving
and stored dry until use.
An exemplary technique employed by the inventors for
preparing slow release hormone capsules is as follows:
1. Two grams of Dow Corning MDX-4-4210 medical
grade elastomer and 0.2 grams of Dow Corning
MDX-4-4210 curing agent were weighed into a 10
ml syringe, the bottom of which was capped with
a plastic cap.
2. Six-hundred mg of 2,4-D (or NAA), from which
lumps have been removed by sieving through a
411~C stainless steel sieve, was added to the
same syringe and thoroughly mixed with the
elastomer and curing agent.
3. The 10 ml syringe and its contents were then
degassed for 1/2 hr in a vacuum centrifuge to
WO 91/02071 PCT/US90/04462
39
remove bubbles.
4. Dow Corning Silastic medical grade silicone
tubing (0.062" ID x 0.125" OD) of medium
durometer (50 Shore A) was preswelled 10 to 30
minutes by soaking in acetone.
5. The plastic cap was removed from the end of the
ml syringe and the degassed silicone-2,4-D
10 mixture was extruded into the preswollen tubing
from which excess acetone had been removed by
blowing a stream of air briefly through it.
6. Both ends of the filled tubing were then
clamped shut and the tubing heated at 50
degrees (the boiling point of acetone = 56.5
degrees) overnight to accelerate the
polymerization.
7. The tubing was then cut into 0.5 cm lengths.
8. The ends of the tubing sections were sealed
with Dow Corning Type A medical adhesive and
allowed to dry for 24 hr.
9. The finished capsules are autoclaved dry fox
15-20 min and stored dry until use.
10. Before use the capsules may be preequilibrated
for 48 hr by shaking in 25 ml of sterile 1. to
ZO mM KHCO~, or added to cultures without
equilibration.
D. Cryopreservation Methods
Cryopreservation is important because it allows one
WO 91/02071 ~ ~ ~' ~ PCT/US90/04462
to maintain and preserve a cell culture for future use.
Cell suspensions were cryopreserved using
modifications of methods previously reported (15,49). The
5 cryopreservation protocol comprised adding a pre-cooled
(0°C) concentrated cryoprotectant mixture dropwise over a
period of one hour while stirring the cell suspension,
which was also maintained at 0°C during this period. The
volume of added cryoprotectant was equal to the initial
10 volume of the cell suspension (1:1 addition), and the
final concentration of cryoprotectant additives was 10%
dimethyl sulfoxide, 10% polyethylene glycol (6000 MW),
0.23 M proline and 0.23 M glucose. The mixture was
allowed to equilibrate at 0°C for 30 minutes, during
15 which time the cell suspension/ cryoprotectant mixture
was divided into 1.5 ml aliquot (0.5 ml packed cell
volume) in 2 ml polyethylene cryo-vials. The tubes were
cooled at 0.5°C/minute to -8°C and held at this
temperature for ice nucleation.
Once extracellular ice formation had been visually
confirmed, the tubes were cooled at 0.5°C/minute from -8
to -35°C. They were held at this temperature for 45
minutes (to insure uniform freeze-induced dehydration
throughout the cell clusters). At this point, the cells
had lost the majority of their osmotic volume (i.e. there
is little free water left in the cells), and they could
be safely plunged into liquid nitrogen for storage. The
paucity of, free water remaining in the cells in
conjunction with the rapid cooling rates from -35 to -
196°C prevented large organized ice crystals from forming
in the cells. The cells are stored in liquid nitrogen,
which effectively immobilizes the cells and slows
metabolic processes to the point where long-term starage
should not be detrimental.
Thawing of the extracellular solution was
." \ WO 91 /02071 ~ ~ ~ ' .~. f CT/US90/044162
E~.:.
41
accomplished by removing the cryo-tube from liquid
nitrogen and swirling it in stArile 42°C water for
approximately 2 minutes. The tube was removed from the
heat immediately after the last ice crystals had melted
to prevent heating the tissue. The cell suspension
(still in the cryoprotectant mixture) was pipetted onto a
filter, resting on a layer of agarose-immobilized BMS
cells (the feeder layer which provided a nurse effect
during recovery). Dilution of the cryoprotectant
occurred ::lowly as the solutes diffused away through the
filter and nutrients diffused upward to the recovering
cells. Once subsequent growth of the thawed cells was
noted, the growing tissue was transferred to fresh
culture medium. ThP cell clusters were transferred back
into liquid suspension medium as soon as sufficient cell
mass had been regained (usually within 1 to 2 weeks).
After the culture was reestablished in liquid (within 1
to 2 additional weeks), it was used for transformation
experiments. When necessary, previously cryopreserved
cultures may be frozen again for storage.
E. DNA Segments Comprising Exogenous Genes
As mentioned previously, there are several methods
to construct the DNA segments carrying DNA into a host
cell that are well known to those skilled in the art..
The general construct of the vectors used herein are
plasmids comprising a promoter, other regulatory regions,
structural genes, and a 3' end.
DNA segments encoding the bar gene were constructed
into a plasmid, termed pDPG165, which was used to
introduce the bialaphos resistance gene into recipient
cells (see Figures lA and C). The bar gene was cloned
from Streptomyces hygroscopicus (53) and exists as a 559-
bn Sma I fragment in plasmid pIJ4101. The sequence of
_ coding region of this gene is identical to that
WO 91/02071 ~ PCT/US90/OA462
~~~~1~~
42
published (45). To create plasmid pDPG165, the Sma I
fragment from pIJ4104 was ligated into a pUCl9-based
vector containing the Cauliflower Mosaic Virus (CaMV) 35S
promoter (derived from pBI221.1. provided by R.
Jefferson, Plant Breeding Institute, Cambridge, England),
a polylinker, and the transcript 7 (Tr7) 3' end from
Agrobacterium tumefaciens (3' end provided by D. Stalker,
Calgene, Inc., Davis, CA).
An additional vector encoding GUS, pDPG208, (Figures
1B and D) was used in these experiments. It was
constructed using a 2.1 kb BamHI/EcoRI fragment from
pAGUSl (provided by J. Skuzeski, University of Utah, Salt
Lake City, UT) containing the coding sequence for GUS and
the nos 3'-end from Agrobacterium tumefaciens. In pAGUSI
the 5'-noncoding and 5'-coding sequences for GUS were
modified to incorporate the Kozak consensus sequence (24)
and to introduce a new HindIII restriction site 6 by into
the coding region of the gene (see Figure lE). The 2.1
kb BamHI/EcoRI fragment from pAGUSl was ligated into a
3.6 kb BamHI/EcoRI fragment of a pUCl9-based vector pCEV1
(provided by Calgene, Inc., Davis, CA). The 3.6 kb
fragment from pCEVl contains pUCl9 and a 430 by 35S
promoter from cauliflower mosaic virus adjacent to the
first intron from maize Adhl.
In terms of an R gene complex for use in connection
with the present invention, the most preferred vectors
contain the 35S promoter from Cauliflower mosaic virus,
the first intron from maize Adhl, the Kozak consensus
sequence, Sn:bol3 cDNA, and the transcript 7 3° end from
Agrobacterium tumefaciens. One such vector prepared by
the inventors is termed pDPG237. To prepare pDPG237 (see
Figure 1F), the cDNA clone of Sn:bol3 was obtained from
S. Dellaporta (Yale University, USA). A genomic clone of
Sn was isolated from genomic DNA of Sn:bol3 which had
been digested to completion with HindIII, ligated to
WO 91/02071 w ~ ~ ~ ~ ,~. PCT/US90/04462
";v: jy' ,
43
lambda arms and packaged in vitro. Plaques hybridizing
to two regions of cloned R alleles, R-nj and R-sc (54)
were analyzed by restriction digest. A 2 kb Sst-HincII
fragment from the pSn7.0 was used to screen a cDNA
library established in lambda from RNA of light-
irradiated scutellar nodes of Sn:bol3. The sequence and
a restriction map of the cDNA clone was established.
The cDNA clone was inserted into the same plant
expression vector described for pDPG165, the bar
expression vector (see above), and contains the 35S
Cauliflower mosaic virus promoter, a polylinker and the
transcript 7 3° end from Agrobacterium tumefaciens. This
plasmid, pPDG232, was made by inserting the cDNA clone
into the polylinker region; a restriction map of pDPG232
is shown in Figure 1G. The preferred vector, pDPG237,
was made by removing the cDNA clone and Tr7 3' end from
pDPG232, with AvaI and EcoRI and ligating it with a
BamHI/EcoRI fragment from pDPG208. The ligation was done
in the presence of a BamHI linker as follows:
GATCCGTCGACCATGGCGCTTCAAGCTTC
GCA~CTGGTACCGCGAAGTTCGAAGGGCT
The final construct ~f pDPG237 contained a Califlower
mosaic virus 35S promoter, the first intron of Adhl,
Kozak conscensus sequence, the BamHI linker, cDNA of
Sn:Bol3, and the Tr7 3' end and is shown in Figure 1F.
Additional vectors have been prepared using standard
genetic engineering techniques. For example, a vector,
designated pDPG128, has been constructed to include the
neo coding sequence (neomycin phosphotransferase
(APH(3')-II)). Plasmid pDPG128 contains the 35S promoter
from CaMV, the neomycin phosphotransferase gene from Tn5
(66) and the Tr7 terminator from Agrobacterium
tumefaciens. Another vector, pDPG154, incorporates the
WO 91/02071 PGT/US90/04462
~~~i~ Iv.~.
44
crystal toxin gene and was also prepared by standard
techniques. Plasmid pDPG154 contains the 35S promoter,
the entire coding region of the crystal toxin protein of
Bacillus thuringiensis var. kurstaki HD 263, and the Tr7
promoter.
Various tandem vectors have also been prepared. For
example, a bar/aroA tandem vector was constructed by
ligating a blunt-ended 3.2 kb DNA fragment containing a
mutant EPSP synthase aroA expression unit (64) to NdeI-
cut pDPG165 that had been blunted and dephosphorylated
(NdeI introduces a unique restriction cut approximately
200 by downstream of the Tr7 3'-end of the bar expression
unit). Transformants having aroA in both orientations
relative to bar were identified.
F. Preferred Methods of Delivering DNA to Cells
A preferred DNA delivery system that does not
require protoplast isolation or introduction of
Agrobacterium DNA is microprojectile bombardment (8,23).
There are several potential cellular targets for
microprojectile bombardment to produce fertile transgenic
plants: pollen, microspores, meristems, and cultured
embryogenic cells are but a few examples. Germline
transformation in maize has npt been previously reported
by bombardment of any of these types.
One of the newly emerging techniques for the
introduction of exogenous DNA constructs into plant cells
involves the use of microprojectile bombardment. The
details of this technique and its use to introduce
exogenous DNA into various plant cells are discussed in
Klein, 1989, Wang, et al., 1988 and Christou, et al.,
1988 (22,50,8). One method of determining the efficiency
of DNA delivery into the cells via microprojectile
bombardment employs detection of transient expression of
,, WO 91/02071 ~ ~ ~ ~,,~ ~ ~, f~'I'/US90/04462
the enzyme p-glucuronidase (GUS) in bombarded cells. For
this method, plant cells are bombarded with a D" .
construct which directs the synthesis of the GUS enzyme.
5 Apparati are available which perform microprojectile
. bombardment. A commercially available source is an
apparatus made by Biolistics, Inc. (now DuPont), but
other microprojectile or acceleration methods are within
the scope of this invention. Of course, other "gene
l0 guns" may be used to introduce DNA into cells.
Several modifications of the miceoprojectile
bombardment method were made by the inventors. For
example, stainless steel mesh screens were introduced
15 below the stop plate of the bombardment apparatus, i.e.,
between the gun and the cells. Furthermore,
modifications to e;:isting techniques were developed
by
the inventors for precipitating DNA onto the
microprojectiles.
20
Example 3: MirroproLeatile Bombardment
..
For bombardment, friable, embryogenic Type-II callus
25 (1) was initiated from immature embryos essentially
as
set forth above in Examples 1 and 2. The callus was
initiated and maintained on N6 medium (5) containing
2
mg/1 glycine, 2.9 g/1 L-proline, 100 mg/1 casein
hydrolysate, 13.2 mg/1 dicamba or 1 mg/1 2,4-D, 20 g/1
30 sucrose, pH 5.8, solidified with 2 g/1 Gelgro (ICN
Biochemicals). Suspension cultures initiated from these
callus cultures were used for bombardment.
In the case of SC82, suspension culture SC82 was
35 initiated from Type-II callus maintained in culture
for 3
months. SC82 cells (see Example 1) were grown in liquid
medium for approximately 4 months prior to bombardment
r ..
WO 91/02071 PCT/US90/04462
46
(see Table 2, experiments #1 and #2). SC82 cells were
also cryopreserved 5 months after suspension culture
initiation, stored frozen for 5 months, thawed and used
for bombardment (experiment #6).
In the case of suspension culture SC716 (see Example
2), it was initiated from Type-II callus maintained 5
months in culture, SC716 cells were cultured in liquid
medium for 5 months, cryopreserved for 8 months, thawed,
and used two months later in bombardment experiments #4
and #5. SC94 was initiated from 10 month old Type-II
callus; and cultured in liquid medium for 5 months prior
to bombardment (experiment #3).
Prior to bombardment, recently subcultured
suspension culture cells were sieved through 1000 um
stainless steel mesh. From the fraction of cell clusters
passing through the sieve, approximately 0.5 ml packed
cell volume (PCV) was pipetted onto 5 cm filters (Whatman
#4) and vacuum-filtered in a Buchner funnel. The filters
were transferred to petri dishes containing three 7 cm
filters (Whatman #4) moistened with 2.5 ml suspension
culture medium.
t25 The dish containing the filters with the immobilized
~:r=; cell suspensions was positioned 6 cm below the Texan
plate used to stop the nylon macroprojectile. With
respect to the DNA, when more than a single plasmid was
used, plasmid DNA was precipitated in an equimolar ratio
onto tungsten particles (average diameter approximately
1.2 um, GTE Sylvania) using a modification of the
protocol described by Klein, et al. (1987). In the
modified procedure, tungsten was incubated in ethanol at
65 degrees C. for 12 hours prior to being used for
precipitation. The precipitation mixture included 1.25
mg tungsten particles, 25 ~g plasmid DNA, 1.1 M CaCl2 and
8.7 mM spermidine in a total volume of 575 ul. After
WO 91/02071 ~ ~ ~~ ~ ~J ~ ~~ PCT/US90/044b2
47
adding the components in the above order, the mixture was
vortexed at 4° C for 10 min, centrifuged (500 X G) for 5
min and 550 ~1 of supernatant was decanted. From the
remaining 25 ~,1 of suspension, 1 ~.1 aliquots were
pipetted onto the macroprojectile for bombardment.
Each plate of suspension cells was bombarded twice
at a vacuum of 28 inches Hg. In bombarding the
embryogenic suspensions of A188 X B73 and A188 X 884, 100
~cm or 1000 ~cm stainless steel screens were placed about
2.5 cm below the stop plate in order to increase the
number of foci while decreasing their size and also to
ameliorate injury to the bombarded tissue. After
bombardment, the suspension cells and the supporting
filter were transferred onto solid medium or the cells
were scraped from the filter and resuspended in liquid
culture medium.
Cells from embryogenic suspension cultures of maize
were bombarded with the bar-containing plasmid pDPG165
alone or in combination with a plasmid encoding GUS,
pDPG208 (Fig. 1). In experiments in which a GUS plasmid
was included, two of the filters containing bombarded
cells were histochemically stained 48h post-bombardment.
The total number of foci (clusters of cells) per filter
transiently expressing GUS was at least 1000. In two
separate studies designed to quantitate transiently
expressing cells (using an SC82 (A188 x B73) suspension
culture), the mean number and standard deviation of GUS-
staining foci per filter was 1472 +/- 211 and 2930 +/-
(n=3 and 4, respectively). The number of cells in
individual foci that expressed GUS averaged 2-3 (range
1-
10). Although histochemical staining can be used to
'" detect cells transformed with the gene encoding GUS,
35. those cells will no longer grow and divide after
staining. For detecting stable transformants and growing
them further, e.g., into plants, selective systems
WO 91/02071 PCT/1US90/04462
"fir
~;.;a~l
48
compatible with viability are required.
G. Methods of Identifyinq Transformed Cells
It is believed that DNA is introduced into only a
small percentage of cells in any one experiment. In
order to provide a more efficient system for
identification of those cells receiving DNA and
integrating it into their genomes, therefore, one may
l0 desire to employ a means for selecting those cells that
are stably transformed. One exemplary embodiment of such
a method is to introduce into the host cell, a marker
gene which confers resistance to some agent, e.g. an
antibiotic or herbicide. The potentially transformed
cells are then exposed to the agent. In the population
of surviving cells are those cells wherein generally the
resistance-conferring gene has been integrated and
expressed at sufficient levels to survive. Cells may be
tested further to confirm stable integration of the
exogenous DNA. Using embryogenic suspension cultures,
stable transformants are recovered at a frequency of
approximately 1 per 1000 transiently expressing foci. A
specific embodiment of this procedure is shown in Example
5.
One of the difficulties in cereal transformation,
e.g., corn, has been the lack of an effective selective
agent for transformed cells, from totipotent cultures
(36). Stable transformants were recovered from bombarded
nonembrvo eg nic Black Mexican Sweet (BMS) maize suspension
culture cells, using the neo gene and selection with the
aminoglycoside, kanamycin (22). This approach is limited
because many monocots are insensitive to high
concentrations of aminoglycosides (12,19). The stage of
cell growth, duration of exposure and concentration of
the antibiotic, may be critical to the successful use of
aminoglycosides as selective agents to identify
WO 91/02071 ~ ~ ~ 1~ '~ ~ ~ PCT/US90/04a62
t:i~.'.:~,
-..,;.
49
transformants (26,51,52). In addition, use of the
aminoglycosides, kanamycin or 6418, to select stable
transformants from embryogenic maize cultures, in the
inventors' experience, often results in the isolation of
resistant calli that do not contain the neo gene.
One herbicide which has been suggested in resistance
studies is the broad spectrum herbicide bialaphos.
Bialaphos is a tripeptide antibiotic produced by
l0 Streptomyces hygroscopicus and is composed of
phosphinothricin (PPT), an analogue of L-glutamic acid,
and two L-alanine residues. Upon removal of the L-
alanine residues by intracellular peptidases, the PPT is
released and is a potent inhibitor of glutamine
synthetase (GS), a pivotal enzyme involved in ammonia
assimilation and nitrogen metabolism (33). Inhibition of
GS in plants by PPT causes the rapid accumulation of
ammonia and death of the plant cells.
The organism producing bialaphos also synthesizes an
enzyme phosphinothricin acetyl transferase (PAT) which is
encoded by the bar gene. The use of the herbicide
resistance gene encoding phosphinothricin acetyl
transferase (PAT) is referred to in DE 3642 8~9 A wherein
the gene is iso?ated from Streptomyces viridochromogenes.
This enzyme acE;.ylates the free amino group of PPT
preventing auto-toxicity (45). The bar gene has been
cloned (29,45) and expressed in transgenic tobacco,
tomato and potato plaits (10) and Brassica (il). In
previous reports, some transgenic plants which expressed
the resistance gene were completely resistant to
commerc_..1 PPT and bialaphos in greenhouses.
PCT Application No. WO 87/00141 refers to the use of
a process for protecting plant cells and plants against
the action of glutamine synthetase inhibitors. This
application als:, refers to the use of such of a process
WU 91/02071 PC1'/1JS90/04462
y D
to develop herbicide resistance in determined plants.
The gene encoding resistance to the herbicide BASTA
(Hoechst phosphinothricin) or Herbiace (Meiji Seika
bialaphos) was said to be introduced by Agrobacterium
5 infection into tobacco (Nicotiana tabacum cv Petit Havan
SR1), potato (Solanum tuberosum cv Benolima) and tomato
(Lycopersicum esculentum) and conferred on plants
resistance to application of herbicides.
10 An exemplary embodiment of vectors capable of
delivering DNA to plant host cells is the plasmid,
pDPG165. This plasmid is illustrated in Fig. 1A and 1C.
A very important component of this plasmid for purposes
of genetic transformation is the bar gene which acts as a
15 marker for selection of transformed cells.
Example 4: Selection of bar Transformants Using
>3ialaph~s
The suspension culture (designated SC82) used in the
initial experiments (see Example 3) was derived from
embryogenic Type-II callus of A188 X B73. Following
bombardment (see Example 3), cells on filters were
resuspended in nonselective liquid medium, cultured for 1
to 2 weeks and transferred to filters overlaying solid
medium containing 1 or 3 mg/1 bialaphos. The degree of
inhibition of tissue growth during selection was
dependent upon the density of the cells on the filter and
on the concentration of bialaphos used. At the density
plated (0.5 PCV/filter), the growth of the cells cultured
on 1 mg/1 bialaphos was only partially inhibited (30-
50% of nonselected growth) and after 3 to 4 weeks much of
this tissue was transferred as discrete clumps (-5 mm in
diameter) to identical medium. On medium containing 3
mg/1 bialaphos, the growth of cells on the original
selection filter was severely inhibited (~10% of
nonselected growth) and selection was carried out without
.,; , WO 91 /02071 ~ ~ PCT/US90/04462
51
removing the tissue from the original filter.
Using either selection protocol (1 or 3 mg/1
bialaphos), resistant cell colonies emerged on the
selection plates of SC82 bombarded with pDPG165
approximately 6 to 7 weeks after bombardment (Fig. 2A).
Bialaphos-resistant calli were maintained and expanded on
selection medium. Much of this tissue was embryogenic
(Fig. 2B). No colony growth occurred on plates to which
cells were added from suspension cultures on which no
transforming attempts were made. These are controls
which confirm the prediction that cells without the bar
gene are not resistant to bialaphos.
Colonies on solid supports are visible groups of
cells formed by growth and division of cells plated on
such support. Colonies can be seen in Fig. 2A on a petri
dish. In this figure, the cells capable of growth are
those that are resistant to the presence of the herbicide
bialaphos, said resistance resulting from integration and
expression of the bar gene. Exposure of cells was to 1
mg/1 bialaphos. Figure 2B is a magnification showing the
morphology of one bialaphos-resistant culture maintained
on selection media indicating that growth is embryogenic.
As a confirmation that the cells forming the
colonies shown in Fig. 2 had indeed incorporated the bar
gene and were expressing it, bialaphos-resistant callus
lines ware analyzed for activity of the bar gene product,
phosphinothricin acetyl transferase (PAT), by thin-layer
chromatography. Protein extracts from eleven callus
lines (E1-11) isolated from SC82 bombardment eacperiments
contained PAT activity as shown in Figure 3 anti activity
levels varied approximately 10-fold among the isolates.
Still further and more direct confirmation of the
presence of the bar gene was obtained by analysis of the
WO 91/02071 ~ PCT/U590/04s162
rf !! ,JL 5 2
genomic DNA of potential transformants by DNA gel blots
(Figure 4). The sources of DNA which were
electrophoresed through the gel were the bialaphos-
resistant callus lines designated E1-E11 and a non-
selected control, E0. (Fig. 1 indicates the cleavage
sites of those enzymes within the bar gene plasmid.)
After the DNA was electrophoresed through the gel and
transferred to nylon membranes, the resulting blot was
hybridized with a 32P-labeled bar gene sequence from the
plasmid pDPG165. The radioactivity used per blot was
approximately 25 X 106 Cerenkov cpm. The lane in Figure
4 designated "1" and "5" copies contain 1.9 and 9.5 pg
respectively of the 1.9 kb bar expression unit released
from the plasmid pDPG165 by application of the EcoRI and
HindIII enzymes; these amounts represent about 1 and 5
copies per diploid genome.
Genomic DNA from all eleven bialaphos-resistant
isolates contained bar-hybridizing sequences as shown in
Figure 4. The hybridization in all isolates to a
fragment migrating slightly larger than 2 kb may be due
to contaminating pUCl9 sequences contained in this bar
probe preparation; no such hybridization occurred in
subsequent experiments using the same genomic DNA and a
different preparation of the bar probe. Hybridization to
a 1.9 kb fragment in eight of the eleven isolates
indicated that these isolates contained intact copies of
the 1.9 kb bar expression unit. The estimated copy
numbers of the intact unit ranged from one or two (E1,
E7, E8, E10, E11) to approximately 20 (E3, E4, E6).
Hybridization with the bar probe in isolates E2 and E5
. occurred only to a single, higher molecular weight
fragment (-3 kb).
To establish that the PAT coding sequence was intact
- in isolates E2 and E5, genomic DNA was digested with
SmaI, which releases a 559 by fragment containing the PAT
WO 91/02071 ~ ~ ~ ~ ~ ~ ~ PCI'/US90/04462
~~'>.;'-
53
structural gene (Figure lA), and subjected to DNA gel
b_ t analysis using 32P-labeled bar. This analysis
cc:nfirmed the presence of a single intact copy of bar.
Expression of PAT in these isolates may not be dependent
on the 35S promoter or the Tr7 3' end. The hybridization
patterns of some of the isolates were identical (E2 and
E5; E7 and E8; E3, E4, and E6); therefore, it is probable
that some isolates did not arise from independent
transformation events but represent transformants that
were separated during selection.
Seven hybridization patterns were unique, likely
representing seven independent single-cell transfo~ .ation
events. The patterns and intensities of hybridization
for the seven transformants were unchanged during four
months in culture, providing evidence for the stability
of the integrated sequences. The seven independent
transformants were derived from two separate bombardment
experiments. Four independent transformants representing
isolates E2/E5, E3/E4/E6, E1 and E7/E8, were recovered
from a total of four original filters from bombardment
experiment #1 and the three additional independent
transformants, E9, E10, and E11, were selected from
tissue originating from six bombarded filters in
experiment #2. These data are summarized in Table 2.
WO 91/02071 , , PCT/US90/04462
/
a
a
G M
N ~ ~ h
~ ~ ~
k, N
-,
N w .
Uw
a
o\
.o
0 0 0
~s
. ~w
'o w
U
M ~ M t~
.~ .3 a .y
~ '~ a
v
w a
L' ~ . ~ C cC cC cU '~ ~D M Q N
N ~--~ .-~ M C
'~,0~,,'~ ~ ~ C G G
~ .
3Uv~
N
o.
H H .c ....
U
'3 Y a M N va oo ~r t~ o
~ ~
~ .~ " ~ v o
a. ~
O L
~ H
y
. O
t 'O ~ ~ U
/~ ~ > ~t M GO ~ I~ ~ ~ ~ O
O D N O
U
p U a~
~
,~ ~ ~ a
a
z
A
0 ~ ~f t0 O 00 00 ch ~ U
~w
a d
:
m .
T3
O
. "O
t.
_~ ~ N N
'O o o ~
U o 0 0 ~ U U U
~ U
~, .
n
Cq v~ vo
U
X
~i
~
W ~~ N M ~ V7 ~J * c
WO 91/02071
PC1'/US90/OA462
Studies with other embryogenic suspension cultures
~.t~oduced similar results. Using either an SC82 culture
that was reinitiated from cryopreserved cells (experiment
#6) or an A188 x B84 (SC94) suspension culture
5 (experiment #3j, numerous independent transformants were
recovered (19 and 18 respectively; Table 2). All
transformants contained the bar gene and expressed PAT.
The copy number of bar-hybridizing sequences and levels
of PAT expression were comparable to the studies
10 described above.
Example 5: Integration of the Bar Gene into Cell
Lines Derived from the SC716 Suspension
culture
Bombardment studies and subsequent analyses were
also performed on the A188xB73 suspension culture, termed
SC716 (see Example 1). The resultant transformed plant
cells were analyzed for integration of bar genes. To
.'20 carry out this analysis, genomic DNA was obtained from
R1-R21 isolates; 6 ~g of DNA was digested with the
restriction endonucleases EcoRI and HindIII, and DNA gel
blot analysis was performed using the bar gene as probe.
In Fig. 9, molecular weights in kb are shown to the right
':'25 and left. The untransformed control is .designated "RO,"
and the last column to the right contains the equivalent
of two copies of the bar gene expression unit per diploid
genome. For the DNA load used, two copies the bar
expression unit per diploid genome is 5.7 pg of the 1.9
.,30 kb EcoRI/Hind fragment from the plasmid pDPG165. The DNA
separated on the gel blot was hybridized to a 3aP-labeled
bar probe. The label activity in the hybridization was
approximately 10 X 106 Cerenkov~cpm. In A, the presence
of an intact bar expression unit is inferred from the
'35 hybridization of the bar probe to a 1.9 kb band in the
gel.
5
WO 91/02071 PCT/US90/04462
(~"'a
~."r:.;
i~~~~ ~~
56
Example 6: Assays for Integration
and Expression of GUS
SC716 transformants discussed in Example 5, were
further analyzed for integration and expression of the
gene encoding GUS. As determined by histochemical assay,
four of the SC716 transformants (R5, R7, R16, and R21)
had detectable GUS activity 3 months post-bombardment.
Expression patterns observed in the four coexpressing
callus lines varied. The number of cells with. GUS
activity within any given transformant sampled ranged
from -5% to --90% and, in addition, the level of GUS
activity within those cells varied. The cointegration
frequency was determined by washing the genomic blot
hybridized with bar (Figure 9A) and probing with 32P-
labeled GUS sequence as shown in Figure 9B. EcoRI and
HindIII, which excise the bar expression unit from
pDPG165, also release from pDPG208 a 2:1 kb fragment
containing the GUS coding sequence and the nos 3' end
(Figure 1B).
Seventeen of the independent bar transformants
contained sequences that hybridized to the GUS probe;
three, R2, R14 and R19 did not. Transformants in which
GUS activity was detected (R5, R7, R16 and R21) had
intact copies of the 2.1 kb EcoRIJHindIII fragment
containing the GUS structural gene (Figure 9B).
Transformants that contained large numbers of fragments
that hybridized to bar (R1, R5, R21) also contained
comparable number of fragments that hybridized to the
gene encoding GUS (Figures 9A and B). This observation
is consistent with. those reported using independent
plasmids in PEG-mediated transformation of A188 X BMS
protoplasts (Lyznik, et al., 1989) and in studies
conducted by the inventors involving bombardment-mediated
,
,. transformation of BMS suspension cells.
:;
wo 9WOZOW ~ PCT/US90/0446z
n,
a~';4
~~ ~ r~.~ .
57
H. Co-Transformation
Co-transformation may be achieved using a vector
containing the marker and another gene or genes of
interest. Alternatively, different vectors, e.g.,
plasmids, may contain the different genes of interest,
and the plasmids may be concurrently delivered to the
recipient cells. Using this method, the assumption is
made that a certain percentage of cells in which the
marker has been introduced, have also received the other
genes) of interest. As can be seen in the following
examples, not all cells selected by means of the marker,
will express the other genes of interest which had been
presented to the cells concurrently. For instance, in
Example 7, successful cotransformation occurred in 17/20
independent transfor:::ants (see Table 2), coexpression
occurre~' in 4/20. In some transformants, there was
variable expression among transformed cells.
Example 7: Co-Integration and Co-Expression of the
Bar Gene and the GUS Gene to Cell Lines
Derived from the SC82 Suspension Culture
Of the bialaphos-resistant isolates selected from a
reinitiation of cryopreserved SC82 cells transformed
with
separate plasmids (as described for SC716), nineteen
independent transformants were selected in this
experiment (experiment ~6, Table 2). The frequency of
cointegration and coexpression in those isolates was
similar to that described for SC716 isolates (Table
2).
The pattern of GUS staining in these transformants varied
in a manner similar to that described for coexpressing
SC716 transformants. A transformant, Y13, which w
contained intact GUS coding sequence, exhibited varying
levels of GUS activity as shown in Figure 8. 'his type
of expression pattern has been described previously
in
cotransformed BMS cells (Klein, et al., 1989). Variable
WO 91/02071 , PCI'/US90/04462
T ~0 1
f
58
activity detected in the cells from a single transformant
may be attributed to unequal penetration of the GUS
substrate, or differential expression, methylation, or
the absence of the gene in some cells.
These results show that both the bar gene and the
GUS gene are present in some of the cells bombarded with
the two plasmids containing these genes. Co-
transformation has occurred. In the cotransformation
l0 examples described herein and summarized in Table 2,
cotransformation frequency of the non-selected gene was
77%; coexpression frequency was 18%.
I. Regeneration of Plants From Transformed Cells
For use in agriculture, transformation of cells in
vitro is only one step toward commercial utilization of
r these new methods. Plants must be regenerated from the
transformed cells, and the regenerated plants must be
developed into full plants capable of growing crops in
open fields. For this purpose, fertile corn plants are
required. The invention disclosed herein is the first
successful production of fertile maize plants (e.g., see
., Figure 11A) from transformed cells.
One efficient regeneration system involves transfer
of embryogenic callus to MS (Murashige and Skoog, 1962)
medium containing 0.25 mg/1 2,4-dichlorophenoxyacetic
acid and 10.0 mg/1 6-benzyl-aminopurine. Tissue was
maintained on this medium for approximately 2 ~aeeks and
subsequently transferred to MS medium without hormones
(Shillito, et al., 1989). Shoots that developed after 2-
4 weeks on hormone-free medium were transferred to MS
medium containing 1% sucrose and solidified with 2 g/1
GelgroR in Plant ConR containers where rooting occurred.
Another successful regeneration scheme involved
WO 91/02071 ~~ ~ ~ ~ ~ ~ PCT/US90/04462
:'uc~s,,
59
transfer of embryogenic callus to N6 (Chu, et al., 1975)
medium containing 6% sucrose and no hormones (Armstrong
and Green, 1985) for two weeks followed by transfer to MS
medium without hormones as described above. Regeneration
was performed at 25°C under fluorescent lights (250
microeinsteins~m-2~s-1). After approximately 2 weeks
developing plantlets were transferred to soil, hardened
off in a growth chamber (85% relative humidity, 600 ppm
COa, 250 microeinsteins~m-2~s-1), and grown to maturity
either in a growth chamber or the greenhouse.
Regeneration of plants from transformed cells
requires careful attention to details of tissue c lture
techniques. One of the major factors is the choice of
tissue culture media. There are many media which will
support growth of plant cells in suspension cultures, but
some media give better growth than others at different
stages of development. Moreover, different cell lines
respond to specific media in different ways. A further
complication is that treatment of cells from callus
initiation through transformation and ultimately to the
greenhouse as plants, requires a multivariate approach.
A progression consisting of various media types,
representing sequential use of different media, is needed
to optimize the proportion of transformed plants that
result from each cell line. Table 3 illustrates
sequential application of combinations of tissue culture
media to cells at different stages of development.
Successful progress is ascertained by the total number of
plants regenerated.
WO 91 /02071 PC1'/1JS90/044f 2
2~b~'~
i i ' ~ ~ so I I
H
a ~ . . . .
D et O O N ~t M e! ~ ~ O O O a~ O Ov
t~ O O Cv
~ M '~'-~ 00 N et r1 ar ~H ,.., .~ eY
~
V7
E"~ N N N O
O
~r
~r
O
O
.a .a CG
h ,.~ ~C~S
~ o
N N ~C ~C SCSC ~C ~'C ~C O O O O O O ~' ~
O C ,1~' C O
O
\\
- 04
0.0
,~C ,yC','~C'~C' ,'~C' ,5C' DC O O N ,~,' ~
N ,'~t,' ,5C' ,yC' O N
DC ,y~ N
N y,
r.'
_
~ O ~ '~ '~O O ..i O O O ~ O O ~( ~ ~C N
O ...i O O 'y~ ~ N
,., ~
..1
N
II
II
~
ix N O ~C k ~'O O .r .-~ O O O ,'it,' N ,yc,'
P O ,y~ ',~' O O ,k' N
N ~ N
~
G~ N N
N
0
~N O 5C r'~C DC~C ~C "'~ ~C ~ O O ,'~,' ~ '~"~
.h~ DC ~C 'n ~C ~C' N
o.~ N
,
,
N N
0
d
GEC N ~ N h O~~ ,'a~ -y~ M Its .-~ O Ov Ov
O O O ~G .r O Cv
~ ~ 00
N N N N ~ N ~ h N h
z O
O
N N ~iC DC '~CO O O O .-~ O O ',~t,' '"'q 'C
~ w10 ''C ~'C O O 'iC' w
rl
N
r~
N ~ ~! ~ ~,'O O C O h O ~ O O ,( O h ,y~
~ ~ O ~ h
h
.:'p~ ~ N
U
0
a N ~ ~ ~ ~ o o ~t o ~ o o y~ o ~ ~ ~ ~ ~
h, o ~ ~ ~ :.:
o
'
~
N
y
s.l ~ y
~!
'"' ~C~C SGSG~t~~SCoooy~~C~Go~yG ""'
o
eie
'~
a :r
o .o
v a
N ~ 'et h ~ ,'y(' N V Ov ~ Ov 'b
~ N Oi0 h N O O O '~ A h O V
O ..H
- h
~ O~
N r .
N . ..
Vp
,
a
E
~ c 4C yC ~C>C >C 5C yC St 5C ~C St N y~ ~
N >C ~C N 5C ~C N ,
N
,..i
'~.e N . . ' .y
,' 'b
O
A
O
O V
W W ~
,; y
'
ar
~ ~ ~
c
a w ~ ,
C
d O .., O ~ N M ~ ~n h oo av o Z O ~ ~
.. a .-m on e~ a ~ ,.,~ o
.
.
.,
f
P
P
I
~ ~ ~Q ~ ~ ~
~~~~ ~
;~~
te,
V
V
V
VN
,.a H U U E Z U U U U U U U U U U H ~ z z
.,U U U H
0o O ~ cooooooooo~~oo O O O~O II
a
U U a d E~E, Q Q' Q Q ~ d' .d' ~ E-~U U E-~ St
d' ~ d Q Q E'' #
fb
WO 91 /02071
PCT/US90/04462
61
It can be seen that using the same group of media,
cell lines will vary in their success rates (number of
plants) (Table 3). There was also variation in overall
success rate, line A01-15 yielding the greatest number of
plants overall. (It should be noted, however, that
because tissue was limiting not all combinations of media
were used on all lines, therefore, overall comparisons
are limited.)
A preferrred embodiment for use on cell lines in
general, at least initially, is the combination shown in
the second column under the regeneration media
progression (media 227, 171, 101, 501). Media 227 is a
goad media for the selective part of the experiments, for
example, to use for growth of callus in the presence of
bialaphos. This media contains the hormone dicamba. NAA
and 2,4-D are hormones~~in other media. In liquid media,
these are usually encapsulated for controlled release
(see Example 12 hereinbelow).
Thus, it can be seen from Table 1 that the various
media are modified so as to make them particularly
applicable to the development of the transformed plant at
the various stages of the transformation process. For
example, subculture of cells in media 171 after applying
the selective agent, yields very small embryos.
Moreover, it is believed that the presence of BAP in the
media facilitates development of shoots. Myo-inositol is
believed to be useful in cell wall synthesis. Shoot
elongation and root development proceeds after transfer
to media 101. 101 and 501 do not contain the hormones
that are required for earlier stages of regeneration.
Transfer of regenerating plants is preferably
completed in an agar-solidified media adapted from a
nutrient solution developed by Clark (1982; ref. 6),
media 501. The composition of this media facilitates the
WO 91 /02071 PCT/US90/044b2
,;;
~:r a v,1 v.:.~~ : v ~ 6 2
hardening of the developing plants so that they can be
transferred to the greenhouse for final growth as a
plant. The salt concentration of this media is
significantly different from that of the three media used
in the earlier stages, forcing the plant to develop its
own metabolic pathways. These steps toward independent
growth are required before plants can be transferred from
tissue culture vessels (e.g. petri dishes, plant cans) to
the greenhouse.
Approximately 50% of transformed callus lines
derived from the initial SC82 and SC716 experiments were
regenerable by the routes tested. Transgenic plants were
regenerated from four of seven independent SC82
transformants and ten of twenty independent SC716
transformants.
Regeneration of thirteen independently, transformed
cell lines and two control lines of SC716 was pursued.
' 20 Regeneration was successful from ten of thirteen
transformants. Although a total of 458 plantlets were
regenerated, due to time and space constraints only 219
transformed plants (representing approximately 48% of the
total number of regenerants) were transferred to a
soilless mix (see below). Approximately 185 plants
survived. Twelve regeneration protocols were
investigated and the number of plants regenerated from
each route has been quantified (Table 3). There appeared
to be no significant advantage to maturing the tissues on
201, 52, 163, or 205 (see Table 1 for media codes) prior
to transfer to medium 171 or 173. The majority of the
plants were generated by subculturing embryogenic callus
directly from 227 to either 171 or 173. These plantlets
developed roots without addition of exogenous auxins, and
plantlets were then transferred to a soilless mix, as was
' necessary for many of the transformants regenerated from
SC82.
WO 91/02071 ~ ~ ~ PCT/US90/04462
,~ ~:v.;:,
63
The soilless mix employed comprised Pro Mix,
Micromax, Osmocote 14-14-14 and vermiculite. Pro Mix is
a commercial product used to increase fertility and
porosity as well as reduce the weight of the mixture.
This is the bulk material in the mixture. Osmocote is
another commercial product that is a slow release
fertilizer with a nitrogen-phosphorus-potassium ratio of
14:14:14. Micromax is another commercial fertilizer that
contains all of the essential micronutrients. The ratio
used to prepare the soilless mix was: 3 bales (3 ft3
each) Pro Mix; 10 gallons (vol.) vermiculite; 7 pounds
Osmocote; 46 ml Micromax. The soilless mix may be
supplemented with one or two applications of soluble Fe
to reduce interveinal chlorosis during early seedling and
plant growth.
Regeneration of transformed SC82 selected cell lines
yielded 76 plants transferred to the soilless mix, and 73
survived. The plants were regenerated from six
bialaphos-resistant isolates, representing four of seven
clonally independent transformants. Eighteen protocols
were used successfully to regenerate the seventy six
plants (Table 4). Differences in morphology between cell
lines deemed some protocols more suitable than others for
regeneration.
WO 91/02071 ~ PCT/LJS90/04462
64 r~~"'t;;.
I
r~
N O~ O~ .-~ O O O P
O O N ~D
~
N ~ r-~ H
P
"'
.-.. SCSC~--~>C~CSC~CDCSC~C>C.-
,v
,
NN
N O "'~ ~
O O
N N ..i .-r 9C it DC 5C 5C 5C .
en DC k' 'YC 'k' .-r
P ~ .~
N N N ~ ~ iC .~i ~'C rC 'iC
~ D'C 'iC SC b'C r'~C
"rC
~
P P r-1 ..r
N ~ ~ ~ ~n e5C ~C DC ~C D'C ~D
e5C ~C ~C .-r DC
'
N N N ~ ~ ~C .~I DC DC
~ dC >C DC >'C eyC iC
yC
~
P 04 .-~
.-r
n v>>C~C~C~C>C>CDC>'C~CD'Cm
N~
~~
y
P ~ M ~ ~
~ C ' ~"
~ C
~ yC '
O ' '
N C '
' '
'
'
'
i Y N 7
f n G
~i ~
~ ~
~C r
JC
~C N aC
n
.:i
P '
~ '
'
'
-~ ~ ~ ~ ~C DC ~D
l . ~C r f;
N P ~C 5C
'dC DC ~D
~C DC DC
x.,
~ O
P N H H r-~ "
~
O N '~' .P.a N DC DC DC yC DC DC rt
,.., V~1 >C >C aC eyC w.
H
CO v
N'~'~..,VO1 DCSC~JCDCDCS'C'rC~CyCN~M
1;
~ ~P M H ra ~
N ,N,~ ..~'.1.-WC ~C 5C DC SC 5C M
~n DC ~C N ~C
x cd
o ~ O
N e-~ ~ ~ ~ .-W ~. e~ e~ eJ'~ ~ p,
~ e~C ~ ~ M r~
~
~ n
'
e~~,., ~CDC~CSC~CSCSC~iC>'C
n 5'Cet
~~
NN
, e i~
..
=
...~ ry .er
$ r
NN ~CDC>'C..,D'C~iC~C'SC~t~iC~'C
~~
~
~ O
'
'
e
e
~ JC..1 N
NNN~v ~'C5'C~CD'C>C
iC
JC~'C.~
H
N ,.P, ..Or ..'~'.~ ~ DC ~C JC N ~ wo q
u'7 D'C ~G >C yC ,.M~ E
fit'
0
~ ~
M H H '" ~ .C
N .Pi ., 5C >C DC DC ~C e5C .>r
vn ~C >C ~C ., M
~ N ,~ ., ..i ~C ~C DC 5C JC ~ ~
' D'C DC >C DC 5C N N
O O H
N ~!
N ~ ~ ~
et Ov tWO M N ~ N rl ~ ~ II
~ N ~ II
a a a a a a a a a
a a
~ e! et ~!' eP '~
V tt M M M H ~ m
P., ~ ., r., .., .,
~ ., .. .,
a a a a a a o a a 11 11 P
~ a a O P
.i MMMMMMMMMMM NN
W,.
U r.~ fxl CCt CG GG ixi E'~ * yC N
CO ~ CG C4 Ci xi N
CA 02064761 2000-OS-15
Prior to regeneration, the callus was transferred to
either a) an N6-based medium containing either dicamba or
2,4-D or b) an MS-based medium containing 2,4-~. These
steps allowed further embryoid development prior to
5 maturation. Most of the maturation media contained high
BAP levels (5-lOmg/1) to enhance shoot development and
cause proliferation. An MS-based medium with low 2,4-D
(0.25 mg/1) and high BAP (10 mg/1), as described by
Shillito, et al., 1989, was found to be quite effective
10 for regeneration.
Likewise, an MS-based medium containing lam NAA, 1
~m IAA, 2 um 2-IP, and 5 mg/1 BAP (modified from Cougar,
ec al., 1987) also promoted plant regeneration of these
15 transformants. After plantlets recovered by any of the
regenerative protocols had grown to five cm, they were
transferred to a nutrient solution described by Clark,
1982, which was solidified with Gelgro~. Plantlets which
were slow to develop roots were treated with 3 ~1
20 droplets of 0.3% IBA at the base of the shoot to
stimulate rooting. Plants with well developed root
systems were transferred to a soilless mix and grown in
controlled environmental chambers from 5-10 days, prior
to transfer to the greenhouse.
J. Assays for Integration of Exogenous
DNA and Expression of DNA in R_ Rl Plants
Studies were undertaken to determine the expression
of the transformed genes) in transgenic Ro and R1 plants.
Functional activity of PAT was assessed by localized
application of a commercial herbicide formulation
containing PPT to leaves of SC82 Ro and R1 plants. No
necrosis was observed on leaves of Ro plants containing
either high levels (E2/E5), or low levels (E3/E4) of PAT.
Herbicide-treated E3/E4/E6 and control leaves are shown
in Figure 10A. Herbicide was also applied to leaves of
WO 91/02071 PCT/US90/04462
E2/E5 progeny segregating for bar. As demonstrated in
Figure lOB, leaves of R1 plants expressing bar exhibited
no necrosis six days after application of the herbicide
while R1 plants without bar developed necrotic lesions.
No necrosis was observed on transformed leaves up to 30
days post-application.
Twenty-one Ro plants, representing each of the four
regenerable transformed SC82 callus lines, were also
analyzed for expression of the bar gene product, PAT, by
thin-layer chromatographic techniques. Protein extracts
from the leaves of the plants were tested. PAT activity
of one plant regenerated from each callus line is shown
in Fig. 5.
All 21 plants tested contained PAT activity.
Furthermore, activity levels were comparable to levels in
the callus lines from which the plants were regenerated.
The nontransformed plant showed no PAT activity (no band
X20 is in the expected position for acetylated PPT in the
autoradiograph from the PAT chromatogram). A band
appears in the BMS lane that is not in lanes containing
protein extracts from the plant leaves. This extra band
was believed to be an artifact.
As another method of confirming that genes had been
delivered to cells and integrated, genomic (chromosomal)
DNA was isolated from a nontransformed plant, the four
regenerable callus lines and from two Ro plants derived
~r30 from each callus line. Figure 6 illustrates results of
gel blot analysis of genomic DNA from the four
transformed calli (C) and the Ro plants derived from
them. The transformed callus and all plants regenerated
from transformed callus contained sequences that
-35~ hybridized to the bar probe, indicating the presence of
DNA sequences that were complementary to bar.
Furthermore, in all instances, hybridization patterns
WO 91/02071 ~ ~ ,~. PC'T/US90/04~162
Wf :J'1
67
observed in plant DNA were identical in pattern and
intensit ~ to the hybridizatior rofiles of the
corresponding callus DNA.
DNA from E3/E4/E6 callus and the desired Ro plants.
contained approximately twenty intact copies of the 1.9
kb bar expression unit (Cauliflower Mosaic Virus 35S
promoter-bar-Aaro~~.: ~terium transcript 7 3'-end) as well
as numerous other .r-hybridizing fragments. E11 callus
l0 and plant DNA contained 1-2 copies of the intact
expression unit and 5-6 additional non-intact hybridizing
fragments. E10 callus and plants contained 1-2 copies of
the intact bar expression unit. E2/E5 DNA contained a
single fragment of approximately 3 kb that hybridized to
the probe. To confirm that the hybridizing sequence
observed in all plants were integrated into the
chromosomal DNA, undigested genomic DNA from one plant
derived from each independent transformant was analyzed
by DNA gel blot hybridization. Hybridization to bar was
observed only in high molecular weight DNA providing
evidence for the integration of bar into the maize
genome.
Plants were regenerated from the coexpressing callus
line, Y13, shown in Figure 8. Plants regenerated from
Y13 (experiment #6, Table 2) were assayed for GUS
activity and histochemically s~ained leaf tissue from one
plant is shown in Figures lOC, D, E. Numerous cell types
including epidermal, guard, mesophyll and bundle sheath
cells stained positive for GUS activity. Staining
intensity was greatest in the vascular bundles. Although
all leaf samples from the regenerated plants tasted (5/5)
expressed the nonselected gene, some non-expressing leaf
sectors were also observed. Leaf tissue extracts from
three Y13 and three control plants were also assayed for
GUS activity by flu~rometric analysis (Jefferson, 1987).
Activity detected in two opposing leaves from each of
WO 91/02071 , , , PCT/US90/04462
'~ ~ b ~'~~ ~ ~.
68
three Y13 plants tested was at least 100-fold higher than
that in control leaves.
Example 8: General Methods for Assays
A method to detect the presence of phosphinothricin
acetyl transferase (PAT) activity is to use thin layer
chromatography.
An example of such detection is shown in Fig. 5
wherein various protein extracts prepared from
homogenates of potentially transformed cells, and from
control cells that have neither been transformed nor
exposed to bialaphos selection, are assayed by incubation
with PPT and 14C-Acetyl Coenzyme A. 25 ~g of protein
extract were loaded per lane. The source in lanes E1-
E11 were SC82 transformants; B13 is a BMS (Black Mexican
Sweet corn nonembryogenic) bar transformant. EO is a
nonselected, nontransformed control.
As can be seen at the position indicated by the
arrow (the position expected for the mobility of 1~C-N-
AcPPT), all lanes except the nontransformed control have
activities with the appropriate mobility. Variation in
''25 activity among the transformants was approximately 10
fold, as demonstrated by the relative intensity of the
bands. The results of this assay provide confirmation of
the expression of the bar gene which codes for PAT. For
analysis of PAT activity in plant tissue, 100-20o mg of
leaf tissue was extracted in sintered glass homogenizers
and assayed as described previously.
:r
GUS activity wa,s assessed histochemically as
described using 5-bromo-4-chloro-3-indolyl glucuronide
X35 (Jefferson, 1987); tissue was scored for blue cells 18-
24 h after addition of substrate. Fluorometric analysis
was performed as described by Jefferson (1987) using 4-
WO 91/02071 ~sly',2')~:~ fl'1.''~'~.. PCT/US90/04462
..
69
methyl umbelliferyl glucuronide.
DNA gel blot analysis was performed as follows.
Genomic DNA was isolated using a procedure modified from
Shure, et al., 1983. Approximately 1 gm callus t._ssue
was ground to a fine powder in liquid N2 using a mortar
and pestle. Powdered tissue was mixed thoroughly wi;.h 4
ml extraction buffer (7.0 M urea, 0.35 M NaCl, 0.05 M
Tris-HC1 pH 8.0, 0.01 M EDTA, 1% sarcosine).
Tissue/buffer homogenate was extracted wit 4 ml phenol/
chloroform. The aqueous phase was separatE,~ by
centrifugation, passed through Miracloth, and
precipitated twice using 1/10 volume of 4.4 M ammonium
acetate, pH 5.2 and an equal volume of isopropanol. The
precipitate was washed with 70% ethanol and resuspended
in 200-500 ul TE (0.01 M Tris-HC1, 0.001 M EDTA, pH 8.0).
P:pint tissue may also be emplc-~~d for the isolation of
DNA using the foregoing procedure.
Genomic DN~~ was digested with a 3-fold excess of
restriction enzymes, electrophoresed through 0.8% agarose
(FMC), and transferred (Southern, 1975) to Nytran
(Schleicher and Schuell) using lOX SCP (20X SCP: 2 M
NaCl, 0.6 M disodium phosphate, 0.02 M disodium EDTA).
Filters were prehybridized at 65°C in 6X SCP, loo dextran
sulfate, 2% sarcosine, and 500 ~,g/ml heparin (Chomet, et
al., 1987) for 15 min. Filters were hybridized overnight
at 65°C in 6X SCP containing 100 ~Cg/ml denatured salmon
sperm DNA and 32P-labeled probe. The 0.6 kb Smal fragment
from pDPG165 and the 1.8 kb BamHI/EcoRI fragment from
pCEVS were used in random priming reactions (Feinberg and
Vogelstein, 1983; Boehringer~ ~nnheim) to generate
labeler probes for detectin; =quences encoding PAT or
GUS, respectively. Filters were washed in 2X SCP, 1% SDS
at 65°C for 30 min. and visualized by autoradiography
using Kodak XAR5 film. Prior tr rehybridization with a
second probe, the filters were bailed for 10 min. in
WO 91/02071 , . , PCT/US90/04~l62
distilled H20 to remove the first probe and then
prehybridized as described above.
Example 9: Herbicide Application
The herbicide formulation used, Basta TXR, contains
200 g/1 glufosinate, the ammonium salt of
phosphinothricin. Young leaves were painted with a 2%
Basta solution (v/v) containing 0.1% (v/v) Tween-20. The
prescribed application rate for this formulation is 0.5-
1%.
0
In Figure 10A, BastaR solution was applied to a
large area (about 4 x 8 cm) in the center of leaves of a
nontransformed A188 X B73 plant (left) arid a transgenic
Ro E3/E4/E6 plant (right). In Figure lOB, Basta was also
v applied to leaves of four R1 plants; two plants without
bar and two plants containing bar. The herbicide was
applied to R1 plants in 1 cm circles to four locations on
each leaf, two on each side of the midrib. Photographs
:were taken six days after application.
R. Fertility of Transdenic Plants
To recover progeny the regenerated, genetically
transformed maize plants (designated Ro), were
backcrossed with pollen collected from nontransformed
plants derived from seeds, and progeny (designated R1)
that contained and expressed bar were recovered.
An important aspect of this invention is ttae
production for the first time of fertile, genetically
transformed maize plants (Ro) and progeny (R1). These
were regenerated from embryogenic cells that were
transformed. Rl plants are those resulting from
WO 91/02071 ~ PCT/US90/04462
2.~~~~~~:~.
,.~,;:~:
71 .
backcrossing of Ro plants.
Pollination of transgenic Ro ears with non
transformed B73 pollen resulted in kernel development.
In addition, kernels developed from pistillate flowers on
male inflorescences that were pollinated with non-
transformed B73 pollen. Kernels on transformed Ro plants
from SC82 developed normally for approximately 10-14 days
post-pollination but after this period the kernels ceased
development and often collapsed. Most plants exhibited
premature senescence at this time. A total of 153
kernels developed sporadically on numerous plants (see
Table 5): 8 of 37 E2/E5 plants, 2 of 22 E10 plants, and
3 of 6 E11 plants. Viable progeny were recovered by
embryo rescue from 11 E2/E5 plants and one E10 plant.
WO 91/02071 PCl'/LJS90/04462
,:,
I 72 I
o G o ~~ 0 0
... ...
.n
a~
...
m 0 0
~ ~ ~
~ ~ o
~ U
O .D N N ~ O O
~' p,
d
bD
b0
~ G
~ O O
~ ~ ~ ~
~2
.. w
O ~ C ~D ov
~ ~l ~
f~ ~ N N
b
CC
t~
b
r r
~ ~ ~ N
~ N N ~ U
~ C .....
c~f
U an
C'.
tx E~
~ .n
'i _ _N '"'
-
y,, ~ C~ CS3
'~ ,.d
p N CO ~
b
C N ~
~
~
C3, vi
DO
U
N
r.' ~ O
C4
4
G. .
C..y"
~
N ~ sh N ~ in
U ~ U U
art O,
a~ W
~ N
W ~Y
WO 91/02071 ~g r~~ ~ PCT/US90/04462
f;.: N
~::L ;.,,
73
SC716 Ro plants were also backcrossed with seed-
derived ''3 plants. To date, from the : mature SC716 Ro
plants nine plants (representing four independent callus
lines) yielded 51 kernels, 31 of which produced vigorous
Rl seedlings (Table 5). Most kernels that developed on
SC716 plants did not require embryo rescue. Kernels
often developed for 30-40 days on the plant and some were
germinated in soil. The remaining seed was germinated on
MS-based medium to monitor germination and transferred to
soil after a few days. In addition to the improved
kernel development observed on SC716 Ro plants relative
to SC82 Ro plants, pollen dehisced from anthers of
several SC716 plants and some of this pollen germinated
in vitro (Pfahler 1967). Transmission of the foreign
gene has occurred both through SC716 R1 ears and using
SC716 R1-derived pollen on non-transformed ears.
Pollen obtained from transformed R1 plants has now
been successfully employed to pollinate B73 ears and a
large number of seeds have been recovered (see Figure
11C). Moreover, a transformed ear from an Ri plant
crossed with pollen from a non-trans.'ormed inbred plant
is shown in Figure 11D. The fertility characteristics of
the R1 generation has been confirmed both from a
standpoint of the pollen's ability to fertilize non-
transformed ears, and the ability of R1 ears to be
fertilized by pollen from non-transformed plants.
Example 10: Analysis of Paogeny (R1) of
Transformed R Plants for PAT and bar
~_ total of 40 progeny of E2/E5 Ro plants were
analyzed for PAT activity, ten o'' which are shown in
Figure 7A. Of 36 progeny which were assayed, 18 had PAT
activity. Genomic DNA from the same ten progeny analyzed
for PAT activity was analyzed by DNA gel blot
hybridization for the presence of bar as shown in Figure
WO 91/02071 ~ PCT/US90/04462
~~~i4'~b'~ 74
7B. The six progeny tested that expressed PAT contained
a single copy of bar identical in mobility to that
detected in callus and Ro plants; the four PAT-negative
progeny tested did not contain bar-hybridizing sequences.
In one series of assays, the presence of the bar gene
product in 18 of 36 progeny indicates a 1:1 segregation
of the single copy of bar found in E2/E5 Ro plants and is
consistent with inheritance of PAT expression as a single
dominant trait. A dominant pattern of inheritance would
indicate the presence in the plant of at least one copy
of the gene coding for PAT. The single progeny recovered
from an El0 Ro plant tested positive for PAT activity.
It was determined that the methods disclosed in this
invention resulted in transformed Ro and Rl plants that
produced functionally active PAT. This was determined by
applying Basta (PPT)-to the leaves of plants and
determining whether necrosis (tissue destruction)'
." resulted from this application. If functionally active
PAT is produced by the plants, the leaf tissue is
protected from necrosis. No necrosis was observed on Ro
plants expressing high levels of PAT (E2/E5) or on plants
expressing low levels (E3/E4/E6) (Fig. l0A).
Herbicide was also applied to leaves of R1 progeny
segregating for bar. In these studies, no necrosis was
observed on R1 plants containing and expressing bar,
however, necrosis was observed on those R1 plants lacking
the bar gene. This is shown in Fig lOB.
Segregation of bar did not correlate with 'the
variability in phenotypic characteristics of R~ plants
such as plant height and tassel morphology. In Figure
9B, the plant on the right contains bar, the plant on the
left does not. In addition, most of the R1 plants were
more vigorous than the Ro plants.
-::i
WO 91/02071 '~ PCT/1JS90/04A62
Of the 23 R1 seedlings recovered to date fz-om the
SC716 transformants, ten of 16 had PAT activity PAT
activity was detected in four of ten progeny from Ro
plants representing callus line R18 and six of six
5 progeny from Ro plants representing callus line R9.
L. Embryo Rescue
10 In cases where embryo rescue was required,
developing embryos were excised from surface disinfected
kernels 10-20 days post-pollination and cultured on
medium containing MS salts, 2% sucrose and 5.5 g/1 Seakem
agarose. Large embryos (>3 mm) were germinated directly
15 on the medium described above. Smaller embryos were
cultured for approximately 1 week on the above medium
containing 10-5M abscisic acid and transferred to hormone-
free medium for germination. Several embryos became
bacterially contaminated; these embryos were transferred
20 to medium containing 300 ~.g/ml cefoxitin. Developing
plants were subsequently handled as described for
regeneration of Ro plants.
Example 11: Embryo Rescue
Viable progeny, recovered from seven SC82 E2/E5
plants and one SC82 E10 plant, were sustained by embryo
rescue. This method consisted of excising embryos from
kernels that developed on Ro plants. Embryos ranged in
size from about 0.5 to 4 mm in length. Small embryos
were cultured on maturation medium containing abscisic
acid while larger embryos were :ltured directly on
germination medium. Two of the approximately forty
viable progeny thus far recovered from SC82 Ro plants are
shown in Figure ilB.
WO 91/02071 PCT/US90/04462
2i~~!~~~~.
76
M. Phenotype of Transctenic Plants
Most of the Ro plants regenerated from SC82
transformants exhibited an A188 X B73 hybrid phenotype.
Plants were similar in height to seed derived A188 plants
(3-5 feet) but had B73 traits such as anthocyanin
accumulation in stalks and prop roots, and the presence
of upright leaves. Many plants, regardless of the callus
line from which they were regenerated, exhibited
phenotypic abnormalities including leaf splitting, forked
leaves, multiple ears per node, and coarse silk.
Although many of the phenotypic characteristics were
common to all Ro plants, some characteristics were unique
to plants regenerated from specific callus lines. Such
characteristics were exhibited regardless of regeneration
route and the time spent in culture during regeneration.
Nontransformed control plants were not regenerated
from this culture and, therefore, cannot be compared
phenotypically. Pistillate flowers developed on tassels
of one E11 (1/6), several E10 (3/22) and almost one°third
of the E2/E5 (12/37) plants with a range of three to
approximately twenty owles per tassel. Primary and
secondary ears developed frequently on most E2/E5, E10,
and E11 plants; a mature E2/E5 plant is shown in Figure
11A. Anthers rarely extruded from the tassels of plants
regenerated from SC82 transformants and the limited
number of anthers which were extruded did not dehisce
pollen. Some phenotypic characteristics observed were
unique to plants regenerated from a specific callus line
such as the lack of ears on E3/E4/E6 plants and a
"grassy" phenotype (up to 21 lone narrow leaves)
exhibited by all E11 plants.
All SC82 plants senesced prematurely; leaf necrosis
began approximately two weeks after anthesis. The Ro
plants regenerated from SC82 transformed cell lines have
WO 91/02071 ,',,~ ~ ~j ~',~ PCT/US90/04462
i':r,' r
. .. .
77
tended to senesce prematurely; typically before the
developing kernels were mature. This has necessitated
the use of embryo rescue to recover progeny (R1
generation). Segregation of bar in the R1 generation.
does not correlate with the variability in phenotypic
characteristics of R1 plants such as plant height and
tassel morphology. In Figure 11B, the plant on the right
contains bar, the plant on the left does not. In
addition, most of the R1 plants are more vigorous than
l0 the Ro plants. Transformed progeny (R1) have now also
begun to yield kernels and R2 plantlets have been
recovered.
Of 219 plants regenerated from 10 independent SC716
transformants, approximately 35 have reached maturity
(Table 5). The SC716 plants did not exhibit the
phenotypic differences which characterized the individual
callus lines of SC82. These plants were more uniform and
abnormalities less frequent. The phenov ~pe of these
plants closely resembled that of control plants
regenerated from a SC716 cryopreserved culture which was
not bombarded. Plant height ranged from three to six
feet with the majority of the plants between five and six
feet. Most mature plants produced large, multi-branched
tassels and primary and secondary ears. Pistillate
flowers also developed on tassels of several SC716
plants. Although anther extrusion occurred at
approximately the same low frequency as in the SC82
plants, a small amount of pollen dehisced from some
extruded anthers. For most of the SC716 plants that
reached maturity, senescence did not commence until at
least 30 days after anthesis. The improved
characteristics of SC716 plants over SC82 plants indicate
that differences between the suspension cultures may be
responsible.
* * *
WO 91/02071 PGT/US90/04462
y ;i~:
,.;u~~i
78
While the invention is susceptible to various
modifications and alternative forms, specific embodiments
thereof have been shown by way of example in the drawings
and herein be described in detail. It should be
understood, however, that it is not intended to limit the
invention to the particular forms disclosed, but on the
contrary, the intention is to cover all modifications,
equivalents, and alternatives falling within the spirit
and scope of the invention as defined by the appended
claims.
CA 02064761 2002-11-28
79
REFERENCES
The references listed below supplement, explain, provide a
background for, or teach methodology, techniques, and/or compositions
employed herein.
Reference 1. Armstrong C.L., Green C.E. (1985). Planta
164:207-214.
Reference 2. Bottino P.J., (1975). Botany 15:1-16.
Reference 3. Carlsson J., Drevin H., Axen R. (1978).
Eiochem J. 173:723.
Reference 4. Chomet P.S., Wessler S., Dellaporta S.L.
(1978). EM30 J 6:295-302.
Reference 5. Chu C.C., Wang C.C., Sun C.S., Hsu C., Yin
2p K.C., Chu C.Y., Bi F.Y. (1975). Scientia
Sinica 18:659-668.
Reference 6. Clark, R. (1982). J. of Plant Nutrition
5:1039.
Reference 7. Comai L., Gacciotti D., Hiatt W.R.,
Thompson G., Rose R.E., Stalker D. (1985).
Nature 317:741-744; Conger, B.V., Novak,
F.J., Afza, R., Erdelsky, K. (1987), Plant
Cel1 Rep 6:345-347
Reference 8. Cristou P., McCabe D.E., Swain W.F.
(1988). Plant Physiol 87:671-674.
Reference 9. DE 3642 B29 A
Reference 10. De Block, M., Botterman J., Vandiwiele M.,
WO 91/02071 PCT/US90/04462
-'Icy i
Dockx J., Thoen C., Gossele V, Mowa N.R.,
Thompson C., Van Montagu M., Leemans J.
(1987). EMBO J. 6:2513-2518; see also PCT
Publication number WO 87/05629, published
5 9/24/87.
Reference 11. De Block, M., Botterman J., Vandiwiele M.,
Dockx J., Thoen C., Gossele V, Mowa N.R.,
Thompson C., Van Montagu M., Leemans J.
10 (1989). Plant Physiol 91:694-701.
Reference 12. Dekeyser R., Claes B., Marichal M., Van
Montagu M., Caplan A. (1989). Plant
Physiol 90:217-223.
Reference 13. Delannay X., LaVallee B.J., Proksch R.K.,
Fuchs R.L., Sims S.R., Greenplate J.R.,
Marrone P.G., Dodson R.B., Augustine J.J.,
Layton J.G., Fischhoff D.A. (1989).
Bio/Technol 7:1265-1269.
.S'
Reference 14. Feinberg A.P., Vogelstein B. (1983). Anal
Biochem 132:6-13.
Reference 15. Finkle B.J., Ulrich,J.M., Rains W.,
Savarek S.J. (1985). Plant Sci 42:133-
y
140.
Reference 16. Fischhoff D.A., Bowdish K.S., Perlak F.J.,
Marrone P.G., McCormick S.M., Niedermeyer
J.G., Dean D.A., Kusano-Kretzmer K., Mayer
E.M., Rochester D:E., Rogers S.G., Fraley
R.T. B.io/Techr~ol 5:807-813.
Reference 17. Fromm M.E., Taylor L.F., Walbot V. (1986).
Nature 312:791-793.
WO 91/02071 ~ ~ ~ ;~ '~ ~ ~ PCT/US90/04462
i='::~a
81
Reference 18. Haughn G.W., Smith J., Mazur B.,
Somerville, C. (1988). Mol Gen Genet
211:266-271.
Reference 19. Hauptmann R.M., Vasil V., Ozias-Aikins P.,
Tabaeizadeh Z., Rogers S.G., Fraley R.T.,
Horsch R.B., Vasil I.K. (1988). Plant
Physiol 86:602-606.
Reference 20. IPRF European Patent Application No.
90033A
Reference 21. Jefferson R.A. (1987). P.2 Mo1 Bio1 Repr
5:387-405.
Reference 22. Klein T.M., Kornstein L., Sanford J.C.,
Fromm M.E. (1989). Plant Physiol 91:440-
444.
Reference 23. Klein T..:., Kornstein L., Sanford J.C.,
Fromm M.E. (1987). Nature 327:70-73.
Reference 24. Kozak M. (1984). Nuc1 Acids Res 12:857-
872.
Reference 25. Lorz H., Baker B., Schell J. (1985). Mo1
Gen Genet 199:178-182.
Reference 26. Lyznik L.A., Ryan R.D., Ritchie S.W.,
Hodges T.K. (1989). Plant Mo1 Bio1
13 : :.~1-16.
Reference 27. McCabe D.E., Swain W.F., Martinell B.J.,
Cristou P. (1988). Bio/Technol 6:923-
926.
Reference 28. McDaniel C.N., Poethig R.S. (1988).
WO 91/02071 , PCT/US90/04462
v: ~,~ . , y.,;,.
~:,~.:
82
Planta 175:13-22.
Reference 29. Murakami T., Anzai H., Imai S., Satoh A.,
Nagaoka K., Thompson C.J. (1986). Mo1 Gen
Genet 205:42-50.
Reference 3Q. Murashige T., Skoog F. (1962). Physiol
Plant 15:473-497.
Reference 31. Nelson R.S., McCormick S.M., Delannay X.,
Dube P., Layton J., Anderson E.J.,
Kaniewska M., Proksch R.K., Horsch R.B.,
Rogers S.G., Fraley R.T. Beachy R.N.
(1988). Bio/Technol 6:403-409.
Reference 32. Nester, E.W. et al., (1984). Ann. Rev.
Plant Physiol 35:387-413.
Reference 33. Ogawa, Y. et al (1973). Sci. Rep., Meija
Seika 13:42-48.
Reference 3A. PCT No. WO 87/-00141
Reference 35. Pfahler P.L. (1967). Can J. Bot 45:836-
845.
Reference 36. Potrykus I. (1989) Trends Biotechnol
7:269-273.
Reference 37. Prioli L.M., Sondahl M.R. (1989).
Bio/Technol 7:589-594.
Refereaoe 38. Rhodes C.A., Pierce D.A., Mettler I.J.,
Mascarenhas D., Detmer J.J. (1988).
Science 240:204-207.
Reference 39. Shillito R.D., Carswell G.K., Johnson
WO 91/02071 ~ PCT/US90/04462
i,.~
83
C.M., DiMaio J.J., Harms C.T. (1989).
Bio/Technol 7:581-587.
Reference 40. Shah D.M., Horsch R.B., Klee H.J., Kishore
G.M., Winter J.A., Tumer N.E., Hironaka
C.M., Sanders P.R., Gasser C.S., Aykent
S., Siegel N.R., Rogers S.G., Fraley R.T.
(1986). Science 233:478-481.
LO Reference 41. Shimamoto K., Terada R., Izawa T.,
Fujimoto H. (1989). Nature 338:274°276.
L5
>.0
Reference 42. Shure M., Wesler S., Federoff, N. (1983).
Cell 35:225-233.
Reference 43. Southern E.M. (1975). J Mol Biol 98:503-
517.
Reference 44. Szoka, U.S. Patent 4,394,448
Reference 45. Thompson C.K., Movva N.R., Tizard R.,
Crameri R., Davies J.E., Lauwereys M.,
Botterman J. (1987). EMBO J 6:251.9-2623.
?5 Reference 46. Tomes D. (1990). Annual Meting
Proceedings, 26th Annual Corn Breeders
School, University of Illinois, February
26-27, PP~ 7-9.
30 Reference 47. Twell D., Klein T.M., Fromm M.E.,
McCormick S. (1989). Plant Physiol
91:1270-1274.
Reference 48. Vaeck M:, Reynaerts A., Hofte H., Jansens
35 S., De Beuckeleer M., Dean C., Zabeau M.,
Van Montagu M., Leemans J. (1987). Nature
328:33-37.
WO 91/02071 PCT/US90/04462
~ ~'ay;~'
'~ !~~ Ld .~ 8 4
Reference 49. Withers L.A., King P.J. (1979). Plant
Physiol 64:675-678.
Reference 50. along, Y.C. et al. (1988). Plant Mo1 Bio1
11:433-439.
Reference 51. Yang H., Zhang M.H., Davey M.R., Mulligan
B.J., Cocking E.C. (1988). Plant Cell Rep
7:421-425.
Reference 52. Zhang M.H., Yang H., Rech E.L., Golds
T.J., David A.S., Mulligan B.J., Cocking
E.C., Davey E.R. (1988). Plant Cell Rep
L5 7:379-384.
Reference 53. White, J., Chang, S.P., Bibb, M.J., Bibb,
M.J. (1990), Nuc1 Acids Res, 18:1062.
Reference 54. Dellaporta, S., Greenblatt, I., Kermicle,
J., Hicks, J.B., Wessler, S. (1988) in
Chromosome Structure and Function: Impact
of New Concepts, lgth Stadler Genetics
Symposium; J.P. Gustafson and R. Appels,
:?5 eds (New York: Plenum Press), pp. 263-
282.
Reference 55. Chandler, V.L., Radicella, J.P., Bobbins,
P.P., Chen, J., Turks, D. (1989), The
'~r0 Plant Cell 1:1175-1183
Reference 56. boring, H.P. and Starlinger (1986), Ann.
Rev. Genet. 20:175-200
:15 . Reference 57. Federoff, N. (1989), "Maize Transposable
Elements'°, in Mobile DNA. Wowe, M.M. and
Berg, D.E., eds., Amer. Soc. Microbiol.,
WO 91/02071
PCf/US90/04462
~,. ,~<
Wash., D.C., pp. 377-411.
Reference 58. Shapiro, J.A. (1983), Mobile Genetic
Elements, Academic Press, N.Y.
5
Reference 59. Dellaporta, S.L., Greenblatt, I.M.,
Kermicle, J., Hicks, J.B., and Wessler, S.
(1988), Stadler Symposium 11:263-282.
10 Reference 60. European Patent Application 154,204
(9/11/85).
Reference 61. Thillet, J., Absil, J., Stone, S.R.,
Pictet, R. (1988), J Bio1 Chem .263:12500-
j 15 12508
Reference 62. European Patent Application. publication
number 0218571 A2, published April 15,
1987.
Reference 63. Coe, E.H., Neuffer, M.G., and Hoisington,
D.A. (1988), in Corn and Corn Improvement,
Sprague, G.F. and Dudley, J.W., eds., pp.
81-258
Reference 64. Comai, L., U.S. Patent 4,535,060; and ATCC
deposit 39256.
Reference 65. Barkai-Golan, R., Mirelman, D., Sharon, N.
<30 (1978) Arch. Microbiol 126:119-124
,, ~ference 66. Berg, D.E., Egner, C., Hirschel, B.J.,
sward, J., Jorgensen, R., and Tisty, T.D.
'" (1980) Cold Spring Harbor Symposium
:;
'35 45:448-465
Reference 67. Hinchee, M.A.W., Connor-Ward, D.V.,
WO 91/02071 PCT/US90/04462
86
Newell, C.A., McDonell, R.E., Sato, S.J.,
Gasser, C.S., Fischhoff, D.A., Re, C.B.,
Fraley, R.T., Horsch, R.B. (1988)
Bio/technol 6:915-922.
Reference 68. Odell, J.T., Nagy, F., Chua, N.H. (1985)
Nature 313:810-812.
Reference 69. Lawton, M.A., Tierney, M.A., Nakamura, I.,
Anderson, E., Komeda, Y., Dube, P.,
Hoffman, N., Fraley, R.T., Beachy, R.N.
(1987), Plant Mol. Biol. 9:315-324.
Reference 70. Ebert, P.R., Ha, S.B., An. G. (1987), PNAS
84:5745-5749.
Reference 71. Walker, J.C., Howard, E.A., Dennis, E.S.,
Peacock, W.J. (1987), PN~1S 84:6624-6628.
Reference 72. Yang, N.S., Russell, D. (1990), PNAS
87:4144-4148.
Reference 73. Conkling, M.A., Cheng, C.L., Yamamoto,
Y.T., Goodman, H.M. (1990), Plant Physiol.
93:1203-1211.
Reference 74. Fromm, H., Katagiri, F., Chua, N.H.
(1989), The Plant Cell 1:977-984.
Reference 75. Ingelbrecht, I.L.W., Herman, L.M.F.,
Dekeyser, R.A., Van Montagu, M.C.,
Depicker, A.G. (1989), The Plant Cell
1:671-680; Bevan, M., Barnes, W.M.,
Chilton, M.D. (1983), Nucleic Acid Res.
11:369-385.
Reference 76. Callis, J., Fromm, M., Walbot, V. (1987),
wo 9uozom ~ ~ ~ I~ ~ ~ ~ Pcrius9oioaas2
~~ ,:\~1
87
Genes and Develop. 1:1...E;.:-1200.
Reference 77. Vasil, V., Clancy, M., Ferl, R.J., Vasil,
I.K., Hannah, L.C. (1989), Plant Physiol.
91:1575-1579.
Reference 78. Gallie, D.R., Lucas, W.J., Walbot, V.
(1989), The Plant Cell 1:301-311.
Reference 79. Sambrook, J., Fritsch, E.F., and Maniatus,
T. (1989), Molecular Cloning, A Laboratory
Manual 2nd ed.
Reference 80. Gelvin, S.B., Schilperoort, R.A., Varma,
D.P.S., eds. Plant Molecular Biology
Manual (1990).
Reference 81. Gatehouse, A.M., Dewey, F.M., Dove, J.,
Fenton, K.A., Dusztai, A. (1984), J Sci
Food Agric 35:373-380
Reference 82. Potrykus, I., Saul, M.W., Petruska, J.,
Paszkowski, J., Shillito, R.D. (1985), Mo1
Gen Genet 199:183-188
Reference 83. Stalker, D.M., Malyj, L.D., McBride, K.E.
(1988), J Bio1 Chem 263:6310-6314
Reference 84. Ikeda, H., Kotaki, H., Omura, S. (1987), J
Bacteriol 169:5615-5621.
Reference 85. Avermectin and Abamectin. (1989) W.C.
Campbell, ed.
Reference 86. Watrud, L.S., Perlak, F.J., Tran, M.-T.,
Kusano, K., Mayer, E.J., Miller--Widemann,
M.A., Obukowicz, M.G., Nelson, D.R.,
WO 91/02071 ~ ~ ~ ~ ~ ~ ~ PCf/US90/04462
1
88
Kreitinger, J.P., and Kaufman, R.J.
(1985), in Engineered Organisms and the
Environment, H.O. Halvorson et al., eds.,
Am. Soc. Microbiol., Washington, D.C.
Reference 87. Cutler, A.J., Saleem, M., Kendell, E.,
Gusta, L.V., Georges, F., Fletcher, G.L.
(1989), J Plant Physicl 135:351-354.
Reference 88. Hilder, V.A., Gatehouse, A.M.R., Sheerman,
S.E., Barker, R.F., Boulter, D. (1987)
Nature 330:160-163.
