Note: Descriptions are shown in the official language in which they were submitted.
WO 91/027~ 2 0 ~ 4 8 1 8 PCT/US90/04662
FIBULIN
BACXGROUND OF THE INVENTION
This invention relates generally to cell adhesion
systems, and more specifically, to a protein which
interacts with the cytoplasmic domain of certain adhesion
receptors.
Multicellular organisms, such as man, have some 10l4
cells whlch may be divided into a minimum of fifty types,
such as blood cells and nerve cells, etc. During the
course of growth and development, cells adhere to other
cells, or to extra-cellular materials, in specific and
orderly ways. Although the interactions of cells with one
another and with extracellular matrices are not well
understood, they play an important role in the life of the
cell. The adhesion of cells to other cells or
Pxtracellular substrates appears to be mediated by specific
cell surface receptors which bind to specific ligands.
The fibronectin receptor is a heterodimer of two
transmembranous subunits, ~ and B. Of these, the ~ subunit
is unique to the fibronectin receptor while the ~ subunit,
designated B1, is shared among a subfamily of adhesion
receptors that includes the receptors for laminin,
collagens and tenascin. These receptors have been termed
integrins. As each of the subunits has a cytoplasmic
domain, both subunits possess the potential to interact
separately or in combination with cytoplasmic proteins.
While not homologous with one another, the sequences of
each of the subunit cytoplasmic domains have been shown to
be highly conserved through evolution. For example,
comparison of the sequence of the human fibronectin
receptor ~ subunit with that of mouse shows that the
cytoplasmic domains are identical. The cytoplasmic domains
of the human, chicken and mouse B1 subunits are also
' ' '''' '.
. , . : . ~ , . . . .
wosl/o275~ 2 0 6 4 8 1 8 PCT/US90/04662
identical. Furthermore, it has been shown that an
antiserum against a synthetic peptide corresponding to the
cytoplasmic domain of the chicken ~ subunit cross reacts
with cell surface molecules from a number of evolutionarily
lower species, including fungi. Such a high degree of
conservation implies that these domains serve common roles
from one species to another which are essential to receptor
function.
lo It is believed that the fibronectin receptor and the
other integrins function in integrating the extracellular
matrix with the cytoskeletal framework. Indeed, the
fibronectin receptor can be found in membrane-substratum
adhesion sltes colocalizing with intracellular
cytoskeletal proteins and extracellular fibronectin
fibrils. However, the nature of the interaction between
cytoplasmic domains of the integrins and other proteins has
thus far remained elusive.
Because of the critical role which the integrins play
in cell adhesion processes, there thus exists a need to
identify the proteins that interact with these receptors
and other components of the extracellular matrix so as to
permit manipulation of these processes. The present
invention satisfies this need and provides related
advantages as well.
SUMMARY OF THE INVENTION
The invention is directed to a substantially purified
protein, hereinafter termed "Fibulin," that interacts with
the cytoplasmic domain of the B subunits shared by the
fibronectin receptor and some other integrins. Fibulin has
a molecular weight of about 100 kD under reducing
conditions and binds to a peptide corresponding to the
c~to~a~,mic domain of the fibronectin receptor in a
divalent cation dependent and EDTA reversible manner.
.. . . ~ . .
- . - -, , ~ ' . '
WO91/02755 2 0~ ~ 8 ~/US90/04662
Human Fibulin has substantially the partial amino-terminal
sequence D-V-L-L-E-A-C-C-A-D-G-H-R-M-A, and can have the
amino acid sequences shown in Figures 3, 4 or 5.
This invention is further directed to isolates of
nucleic aciq encoding Fibulin and to expression vectors
harboring such nucleic acid in expressible form, to
microorganism strains or cell cultures transformed with the
vectors and to recombinantly produced Fibulin obtainable
via expression of DNA encoding Fibulin in a transfected
recombinant host system. Still further, the invention is
directed towards antibodies reactive with Fibulin, be they
monoclonal or polyclonal, and to nucleotide sequences
capable of specifically hybridizing with nucleic acids
encoding Fibulin.
BRIEF DESCRIPTION OF THE FIGURES
Figure l. Affinity chromatography of human placental
extract on synthetic fibronectin receptor B subunit
cytoplas~ic domain peptide-Sepharose. Lanes 1-8 represent
SDS-PAGE analysis of fractions eluted from the affinity
column using a cation free-buffer containing 20 mM EDTA.
Aliquots from each l/4 column volume fraction were
-;25 electrophoresed on a 10% polyacrylamide gel in the presence
;of the reducing agent B-mercaptoethanol. Following
electrophoresis the gel was stained with Coomassie Blue.
Molecular weight markers are indicated on the right in
kilodaltons.
, . .
Figure 2. Binding of fibronectin receptor to Fibulin.
In A, varying concentrations of fibronectin receptor were
incubated with microtiter wells coated with Fibulin (closed
circles) bovine cardiac ~-actinin (open triangles) and
bovine serum albumin (open circles). In B, the effect of
EDTA on fibronectin receptor binding to Fibulin was
examined. Bound receptor was detected by ELISA using a
.
.~ . . .
WO9l/OZ7~ ~ 0 6 ~ 8 1 ~ 4 PCT/US90/04662
rabbit anti-fibronectin receptor serum. The data in each
graph is representative of three experiments, each done in
duplicate.
Figure 3 shows the complete nucleotide and predicted
amino acid sequence for the A form of Fibulin. The
putative signal peptide cleavage site is indicated by an
arrow pointing upward. Protein sequences of the amino-
terminus and of three tryptic peptides of Fibulin are
indicated by solid lines. Amino acid residues beneath the
predicted amino acid sequence indicate differences between
the cDNA deduced sequence and those determined form protein
sequencing. Potential N-linked carbohydrate attachment
sites are indicated by solid squares. The site where the
three types of Fibulin cDNAs diverge is indicated by an
arrow pointing downward between nucleotides 1707 and 1708.
Figure 4 shows the sequence of the alternatively
spliced segments from Fibulin B beginning at nucleotide
1708. Sequences of B that overlap with those of form A
(bases 1-1707) are not shown. Putative polyadenylation
signal sequences are boxed.
Figure 5 shows the sequence of the alternatively
spliced segments from Fibulin C beginning at nucleotide
1708. Sequences of C that overlap with those of form A
(bases 1-1707) are not shown. Putative polyadenylation
signal sequences are boxed.
30 DETAILED DESCRIPTION OF THE INVENTION
A novel protein that binds to an affinity matrix
prepared from a synthetic peptide corresponding to the
cytoplasmic domain of the fibronectin receptor B1 subunit
has been isolated and characterized. This protein, which
is termed "Fibulin," is a component of the extracellular
. . . ~: :
.~ ..
. ; ~
WO91/0275~ 2 ~ ~ ~ 8 ~ ~ PCT/US90/04662
matrix and participates in cell adhesion processes. Such
adhesion processes include interactions with the
fibronectin receptor and other adhesion receptors that
share the B~ subunit.
Fibulin exhibits the following features: 1) it binds
to an affinity matrix made from a integrin receptor B1
subunit cytoplasmic domain coupled to a solid support, such
as Sepharose and is specifically eluted with the peptide or
with EDTA; 2) it does not detectably bind to a column made
with an ~ subunit cytoplasmic peptide, nor is it eluted
from the B1 subunit column with the ~ subunit peptide; 3)
native fibronectin receptor interacts with Fibulin in a
concentration-dependent manner in an ln vitro binding
assay; and 4) indirect immunofluorescent staining of
cultured cells grown on fibronectin reveals that Fibulin
colocalizPs with the fibronectin receptor ~ subunit in
focal contact-like sites as well as areas of extended
substrate contact.
.
As used herein, the term "Fibulin" refers to a protein
having substantially the amino-terminal amino acid sequence
in humans presented in Example V and the additional amino
acid sequence encoded by the nucleic acid sequence of
Figures 3, 4 or 5. Fibulin binds to synthetic peptides
corresponding to the cytoplasmic domains of the Bl subunit
of integrins and the cytoplasmic domains of the B2 and B3
subunits as well, and to the native fibronectin receptor,
according to the binding described herein below. Fibulin
refers both to protein native to mammalian tissue as well
as to proteins produced by cell culture or recombinant
methods. It will be understood that Fibulin includes the
encoded polypeptide chain, post-translational modifications
to the polypeptide and limited modifications to the protein
including fragments which are antigenically or biologically
active. For example, the protein may vary somewhat between
species and natural allelic variations can occur from
. .: - . . . . . . .
WO91/027S5 2 0 ~ PCT/US90/04662
individual to individual. These variations can include
deletions, substitutions, insertions, inversions or
additions of amino acids. These modifications may be
deliberate, as through slte dlrected mutagenesis, or may be
accidental, such as through mutation of the DNA of hosts
which are Fibulin producers. The DNA encoding the protein
can be alternatively spliced to yield different forms of
the protein such as those differences shown in Figures 3,
4 and 5.
As is well-known in the art, proteins can exist in
neutral form or in the form of basic or acid addition salts
depending on their mode of preparation or environment, if
; in solution. Fibulin, in particular, may be found in the
form of its acid addition salts, involving the free amino
groups, or its basic salts, formed with free carboxyls.
Moreover, the protein may be modified by combination
with other biological materials, such as lipids and
saccharides, or by side chain modification, such as
acetylation of amino groups, phosphorylation of hydroxyl
side chains or oxidation of sulfhydryl groups. In
addition, the location and degree of glycosylation will
depend on the nature of the host cellular environment. All
of these modifications are included in Fibulin.
'
The term "nucleic acid which encodes for Fibulin" as
used herein refers to the primary nucleotide sequence of a
gene or cDNA encoding the amino acid sequence Fibulin, as
defined above. An example is the sequence presented in
Figures 3, 4 and 5. The gene may or may not be expressed
in the native host. If it is not expressed in the native
host, it may still be capable of being manipulated through
recombinant techniques to effect expression in a foreign
host. The term refers both to the precise nucleotide
sequence of a gene found in a mammalian host as well as
modified genes which still code for a Fibulin polypeptide
':
. ,
, .
:
W091tO275~ 2 0 ~ ~ 8 ~ 8 PCT/US9o,04662
having biological activity. The gene may exist as a single
contiguous sequence or may because of intervening sequences
and the like, exist as two or more discontinuous sequences,
which are nonetheless transcribed ln vivo to ultimately
effect the biosynthesis of a protein substantially
equivalent to that defined as Fibulin, above.
The term "substantially pure," when used herein to
describe the state of Fibulin, means substantially free of
non-Fibulin proteins or other materials normally associated
with Fibulin in its natural environment. More than one
form or variant protein may be present, however, in the
"substantially purified" form.
As used herein, "fibronectin receptor" refers to that
receptor described in Pytela, et al., Cell 40:191-198
(1985) and Argraves, et al., J. Cell Biol. 105:1153 (1987),
both of which are incorporated herein by reference.
Amino acids are identified herein by their standard
abbreviations, as follows:
WO91/02755 PCT/US90/04662 _~
'~64~18 8
Amino Acid Sym~ol
Alanine A
Arginine R
Aspartic acid D
Asparagine N
Cysteine C
lo Glutamine Q
Glutamic acid E
Glycine G
Histidine H
Isoleucine
Leucine L
Lysine K
Methionine M
Phenylalanine F
Proline p
Serine S
Threonine T
Tryptophan W
Tyrosine y
Valine V
The invention provides substantially purified Fibulin
and substantially purified Fibulin which has an apparent
molecular weight under reducing conditions of 100 kD and
which binds to the cytoplasmic domain of the B1 subunit of
integrin adhesion receptors in a cation dependent, EDTA
reversible manner.
The invention provides a substantially purified
polypeptide, wherein said polypeptide has substantially the
partial amino terminal sequence:
D-V-L-L-E-A-C-C-A-D-G-H-R-M-A. The invention
provides a protein having an amino acid sequence
substantially the same as that encoded by the nucleic acid
sequence of Figures 3, 4 or 5.
;
The invention provides antibodies reactive with
Fibulin or antigenic determinants thereof. The invention
provides antibodies reactive with Fibulin or antigenic
determinants thereof, wherein said antibodies are
' ' ~ '
W091/02755 2 a~ 8l 8 pcT~usgo~o4662
monoclonal. The invention provides antibodies reactive
with Fibulin or antigenic determin~nts thereof, wherein
said antibodies are polyclonal.
The invention provides an isolated nucleic acid which
encodes Fibulin and nucleic acid complementary to nucleic
acid encoding Fibulin. The invention provides the isolated
nucleic acid which encodes Fibulin, wherein the nucleic
acid has substantially the sequence as that shown for base
10 pairs 1 through 1707 in Figures 3, 4 or 5.
The invention provides the nucleic acid which encodes
Fibulin, wherein the sequence further comprises
substantially the sequence as that shown for the base pairs
15 beginning at 1708 and extending to the 3' terminus in -
Figures 3, 4 or 5. The invention provides the nucleic acid
of Fibulin wherein said nucleic acid is cDNA. ~-
The invention provides a recombinant DNA cloning
vector operatively harboring a DNA sequence coding for
Fibulin. The invention provides a host'transformed by the
cloning vector harboring Fibulin. The invention provides
a recombinant DNA sequence effective, in compatible host
cells, of effecting the expression of Fibulin DNA. The
invention provides a process comprising expressing DNA
encoding Fibulin in a host cell.
The invention provides a method for purifying Fibulin
from a Fibulin-containing material comprising the steps of:
immobilizing a peptide substantially comprising the
cytoplasmic domain of B1 integrin subunit on a solid
support; contacting said Fibulin-containing material with
said immobilized cytoplasmic domain of B1 integrin; removing
material not bound to said immobilized cytoplasmic domain
of the B1 integrin subunit; and recovering material bound to
said immobilized cytoplasmic domain, wherein said recovered
material is substantially purified Fibulin.
. .~ '', ~ ", .,
WO91/02755 PCT/US90/04662
2 0 6 ~ O
The invention provides a method of characterizing the
extracellular matrix as to the presence of Fibulin,
comprising the steps of: contacting said extracellular
matrix with antibodies reactive with Fibulin or antigenic
determinants thereofi and determining whether said
antibodies bound to said extracellular matrix.
The invention provides substantially purified Fibulin
having biotin attached thereto.
The invention provides a method of targeting a moiety
to the extracellular matrix of an organism comprising:
attaching said moiety to Fibulin, to form a Fibulin
complex; and administering said Fibulin complex to said
organism. The invention provides the method of targeting
a moiety to the extracellular matrix wherein said moiety is
biotin.
The invention provides a method of purifying Fibulin
from a Fibulin-containing material comprising the steps of:
immobilizing a lectin on a solid support; contacting said
Fibulin-containing material with said immobilized iectin;
removing material not bound to said immobilized lectin; and
recovering material bound to said immobilized lectin,
wherein said recovered material is substantially purified
Fibulin. The invention provides the method of purifying
Fibulin on said immobilized lectin wherein said lectin is
wheat germ agglutinin.
Fibulin can be purified from Fibulin-containing
material, such as a tissue extract, by contacting the
Fibulin-containing material with a solid support, such as
beads, to which is attached the cytoplasmic domain of
integrin, or a lectin such as wheat germ agglutinin.
Fibulin selectively binds to the cytoplasmic domain or
lectin.
-
, ' ~
206~8~ 8
WO91/027ss PCT/US90/04662
, .
11
Fibulin was isolated from an extract of human
placental tissue on an affinity column. A synthetic
peptide corresponding to the cytoplasmic domain of the
fibronectin receptor B subunit (residues 762-798, Argraves
et al., J. Cell Biol. 105:1153 (1987), which is
incorporated herein by reference), was coupled to Sepharose
; and used as an affinity matrix in the presence of buffers
containing divalent cations and octylglucoside to select
putative binding proteins from an extract of human
lo placenta.
Elution with an EDTA-containing buffer released the
Fibulin protein which, when reduced and electrophoresed on
SDS-PAGE, had an apparent molecular weight of lOO,OoO
daltons (100 kd) (Fig. 1). Following the EDTA elution, no
additional Fibulin was released from the column by 8 M urea
suggesting that quantitative removal was achieved by the
EDTA. Peptides corresponding to the cytoplasmic domain of
the B1 subunit also are capable of partially eluting Fibulin
from the column. However, elution using a synthetic
peptide corresponding to the ~ subunit cytoplasmic domain
(residues 1028-1049, Argraves et al., supra) did not
release Fibulin from the B peptide affinity matrix.
Additionally, Fibulin did not bind to a column prepared
with the synthetic ~ subunit cytoplasmic peptide.
.
When the affinity-selected protein was electrophoresed
on SDS-PAGE under non-reducing conditions, two polypeptide
bands with mobilities corresponding to molecular weights of
approximately 80 kd and 200 kd were seen. These
polypeptide bands were excised from gels and the protein
isolated by electroelution. When the eluted proteins were
re-electrophoresed on SDS-PAGE under reducing conditions,
both migrated with an apparent molecular weight of 100 kd.
The difference in the reduced and non-reduced monomer
mobility on SDS-PAGE is likely due to intramolecular
disulfide bonding making the non-reduced form more compact
. . . .
- - :,:, . . , .: . .
WO91/0275; 2 0 ~ CT/US90~04662 --
12
and thus having higher electrophoretic mobility. The~200
kd form may be a disulfide linked dimer or trimer.
Amino acid sequencing of Fibulin indicated the amino-
5 terminal sequence to be: D-V-L-L-E-A-S-X-A-D-G-S-H-M-A. X -~
indicates a position where no amino acid determination
could be made. Subsequent cloning and nucleotide
sequencing confirmed most of the residues and indicated a
cysteine residue at the X position and moreover, indicated
that the seventh position serine is also a cysteine, that
the eleventh position is histidine and that the twelfth
position is arginine. It will be appreciated by those
skilled in the art that amino acid sequencing can, for
various reasons, yield equivocal results, particularly
where the amount of protein available is small. It is
believed that the amino acid sequence deduced from the
nucleotide sequence is substantially correct.
~ '
The amino acid sequence was used to search the Protein
Identification Resource database. No protein present in
the database was found to share this sequence or to be
closely similar, indicating that Fibulin does not
correspond to any previously sequenced protein.
The cDNAs obtained showed that there exists at least
three forms of Fibulin (designated A, B, and C) encoded by
three transcripts likely derived from a common pre-mRNA.
The nucleotide and predicted amino acid sequence of the
Fibulin forms A, B and C are shown in figures 3, 4 and 5,
respectively. The fact that the Fibulin preparations seem
only to have a single polypeptide indicates that
predominantly one form is being isolated or expressed at
high levels. Another puzzling issue has to do with the
disparity between the molecular weight of Fibulin estimated
from SDS-PAGE and that determined from cDNA. The
polypeptides (minus signal peptides) predicted from the
nucleotide sequences of the three cDNAs have molecular
,,
: - , ,
.. ... .
2~6~8~ 8
WO91/02755 PCT/US90/04662
13
weights of 58,670, 62,561, and 71,551 daltons. These
values are not in agreement with Fibulin's apparent
molecular weight of lOO kd obtained from SDS-PAGE.
Carbohydrate analysis indicated that N-linked glycosylation -
5 only accounts for approximately 4-5 kd of the molecular
mass of the lOO kd polypeptide. Other types of
substitution, such as O-glycosylation, may account for the
remaining difference. Overestimation of molecular weight
by SDS-PAGE has been reported for a number of proteins rich
10 in negatively charged amino acids and having low
isoelectric point (pI) values. Fibulins A, B and C have an
average content of aspartic and glutamic acid residues of
13.5% and average calculated pI of the polypeptide chain of
4.7. It is therefore possible that anomalous
15 electrophoretic behavior of Fibulin on SDS-PAGE results in
an overestimation of its size.
Once the amino terminal sequence of a protein has been
determined and antibodies to the protein obtained, the gene
20 of interest can be identified and isolated from a cDNA or
genomic library. Once isolated, the gene or cDNA can be
subcloned into an expression vector and introduced into
host cells which allow the transcription of the gene and
translation into the final protein product. The
25 recombinant protein can be purified from the cells by
methods known to those skilled in the art, as, for example,
by affinity purification using an antibody specific to the
Oprotein of interest. See generally, DNA CLONING: VOLUME I
& II (D.M. Glover ed. 1985); and ~aniatis et al, MOLECULAR
30 CLONING: A LABORATORY MANUAL, (1982) which are incorporated
herein by reference.
. .:
While the affinity chromatography results indicated
that Fibulin was able to interact with the synthetic B1
35 subunit cytoplasmic domain peptide, it was necessary to
determine whether it was able to interact with native
fibronectin receptor. A microtiter plate binding assay was
,, . . .,,, . . . .-...... .. . ~ ,
WO91/027~5 PCT/US90/04662 -~
~ 14
developed which examined the capacity of purified
fibronectin receptor to bind to polystyrene microtiter
plate wells coated with Fibulin. As documented in Figure
2, fibronectin receptor bound to Fibulin coated wells in a
concentration-dependent manner. Control experiments showed
that under similar conditions the receptor did not bind to
either bovine cardiac ~-actinin or bovine serum albumin
coated wells.
To determine if the ln vitro interaction between the
receptor and Fibulin was divalent cation-dependent, as was
the interaction between Fibulin and the synthetic
cytoplasmic domain affinity matrix, divalent cation levels
were modulated with EDTA. As shown in Figure 2, EDTA
indeed inhibited the fibronectin receptor binding to
Fibulin coated wells. To ensure that the EDTA was not -
causing removal of Fibulin from the microtiter plate during
the assay an ELISA was performed on the protein coating
following treatment with EDTA. This assay showed that the
amount of Fibulin coating the wells remained unchanged by
EDTA at the concentrations used in the binding assay.
These results indicate that native fibronectin receptor is
capable of directly interacting with Fibulin. Furthermore,
the interaction is dependent on the presence of divalent
cations.
:; .
The fact that EDTA could cause the disassociation
between Fibulin and both the synthetic receptor cytoplasmic
domain and the native fibronectin receptor prompted
determination of whether Fibulin was capable of binding
divalent cations. Nitrocellulose filters containing
Fibulin electrophoretically transferred from SDS-PAGE were
incubated with radioactive 45Ca2. The radioactive calcium
bound specifically to Fibulin. This result indicates that
Fibulin is indeed a calcium binding protein.
Analysis of the predicted amino acid sequences
,: ' : -' ~' ' ' ' ':
.: '
"
2 0 ~ p8cr
WO91/02755 ~ /US90/04662
(Figures 3 through 5) indicated no sequence homologous to
the consensus divalent cation binding sequences of proteins
such as calmodulin, troponin C and parvalbumin. The
analysis did reveal, however, the presence of four
potential asparagine hydroxylation sites,
CX(D/N)(~)4(F/Y~XCXC, (Stenflo et al., J. Biol. Chem.
263:21-24, 1988, which is incorporated herein by reference)
embodied within EGF-like repeats 5-8. A total of nine EGF-
like repeats exist in Fibulins A, B and C. EGF domains
containing B-hydroxylated residu~s have been implicated in
calcium-binding and are found in numerous proteins
including: the vitamin K-dependent blood coagulation
proteins, complement protein Clr, low density lipoprotein
receptor and thrombomodulin.
In order to determine the cellular localization of
Fibulin, human gingival fibroblasts were grown on
fibronectin coated surfaces and examined by indirect
immunofluorescent microscopy using rabbit anti-lO0 kd
protein serum and fluorochrome conjugated anti-rabbit IgG
serum. Fibulin antiserum specificity was confirmed by
immunoprecipitation analysis. The antiserum precipitated
a single protein with a molecular weight corresponding to
Fibulin from a Triton X-100 extract of 35S-cysteine labeled
gingival fibroblasts. Fluorescent staining of Fibulin was
very prominent when the cells were permeabilized with
detergent. Most non-permeabilized cells showed no staining
for Fibulin, however, sparse staining was noted on the
margins of some cells. Similar levels of peripheral
staining of non-permeabilized cells was also seen using
3Q antibodies to ~-actinin, a known intracellular protein
(Lazarides and Burridge, Cell 6:289 (1975), which is
incorporated herein by reference). It was therefore
concluded that Fibulin is an intracellular protein and that
the observed non-permeabilized staining may be
artifactually related to fixation. Some Fibulin does,
however, exist extracellularly.
: , - . , - : :.:, . ~ . . :
- ~ , . . .
:. . . : . , . ~. :
WO91/02755 2 0 6 4 8 1 8 16 PCT/US90/04662
The immunostaining of permeabilized cells revealed
Fibulin to be distributed in striated or streak-like
accumulations throughout the cell. These streaks were most
prominent in the periphery of the cell. No staining was
apparent when pre-immune serum was used.
The distribution of Fibulin relative to the
fibronectin receptor B~ subunit was examined by double-label
immunofluorescent microscopy. Cells were stained with both
a mouse monoclonal anti-fibronectin receptor B subunit
antibody and the rabbit anti-100 kd protein serum. The
receptor B subunit staining that was observed was similar
to what others have reported using B subunit specific
antibodies (Marcantonio and Hynes, J. Cell Biol. 106:1765
(1988), which is incorporated herein by reference). The
fibronectin receptor B subunit accumulated in focal
contact-like sites in peripheral regions of the cell. The
staining took the form of streaks of fluorescence typical
of extended substrate contacts. Overlapping Fibulin
staining was seen in the focal contact-like sites also
taking the form of streaks of fluorescence, however, the
streaks were finer and more elongated. The codistribution
suggests that there is an ln vivo association between
Fibulin and the receptor B subunit.
The above observations were based on immunofluorescent
staining studies done on fibroblasts grown for 4-6 hours on
fibronectin coated surfaces. However, when cells were
stained with a monoclonal antibody to fibronectin or one
recognizing a presumed extracellular determinant of
integrin ~1 subunit, no specific staining was found unless
the cells were permeablized. Evidently, in the absence of
permeablizing agents, the close association between the
cell and the substratum prevents access of antibodies to
sites where fibronectin and integrin are accumulating.
Therefore, the ability to see staining only after
permeablization may be a misleading indicator that the
~. .
., .
;:
W O 91/02755 2 ~ 6 4 8 1 ~ PC~r/USgO/04662
17 :
target antigen is an intracellular protein.
When immunofluorescent staining studies were extended
to periods beyond 4-6 hours, staining of Fibulin in the
absence of permeablization was seen. With progressive
culture time, Fibulin was found to accumulate
extracellularly into extensive fibrillar patterns
resembling the pattern of accumulation of fibronectin.
Using pulse-chase labeling and immunoprecipitation
lo analyses, it was established that Fibulin was indeed a
secreted protein. Furthermore, lectin affinity
chromatography and N-glycosidase digestion showed that
Fibulin was a glycoprotein containing N-linked
carbohydrate. These findings were supported by the results
of cDNA cloning which showed the predicted amino acid
sequence of Fibulin to have a signal sequence and 3
potential N-glycosylation sites. The presence of the
repeated EGF-like motif is yet another feature not found in
cytoplasmic proteins but common to a number of
extracellular matrix, plasma, and membrane proteins (Engel,
FEBS Letters ~51:1-7, 1989, which is incorporated herein
by reference). Taken together the findings are consistent
with Fibulin being an extracellular matrix protein rather
than a cytoplasmic protein. The significance of the fact
that Fibulin can be purified by affinity chromatography on
the putative cytoplasmic domain of the B1 subunit remains to
be explained. However, Fibulin being an extracellular
matrix component is beneficial for targeting of moieties
such as biotin or other macromolecules to the extracellular
matrix. Such targeting can be accomplished by attaching
the moiety to Fibulin to form a complex and adding the
complex to an extracellular matrix. The complex can be
administred in vitro or in vivo.
35The dissociation by EDTA of the interaction between
Fibulin and the native fibronectin receptor as well as
Fibulin and the synthetic receptor cytoplasmic domain
- - - . . ~ -. . . : . : -
.. . .. ..
., . .. ~
:. ; .
.
... . . . ...
WO91/027~ PCT/US90/04662
18
affinity matrix by EDTA indicates a divalent cation
requirement for the interaction. Calcium is implicated as
a required divalent cation since Fibulin was found to bind
radioactive calcium. Calcium regulation has been
postulated in the interaction of actin with itself as well
as with actin binding proteins. It is then possible that
the calcium regulation not only affects the dynamics of
microfilament assembly but also the interaction of such
filaments with adhesion receptors in the plasma membrane.
Fibulin can be used to manipulate such interactions since
it binds to the cytoplasmic domain of the B1 subunit of
adhesion receptors.
The physical properties of Fibulin clearly distinguish
it from talin, a 225 kd protein (Burridge and Connell, J.
Cell Biol. 97:369 (1983~; Molony et al., J. siol. Chem.
262:7790 (1987), both of which are incorporated herein by
reference) that has been shown to bind to chicken integrins
in vitro (Horwitz et al., Nature, 320:931 (1986), which is
incorporated herein by reference) and to colocalize with
integrins (Burns et al, Proc. Natl. Acad. Sci. U.S.A.,
85:497 (1988), which is incorporated herein by reference),
ln vivo. No protein bands corresponding to intact talin or
its proteolytic breakdown products (O'Halloran et al.,
Nature 317:449-451 (1985), which is incorporated herein by
reference) were apparent in the SDS-PAGE profile of
fractions eluted from the affinity matrix. If talin binds
to the B subunit the binding is too weak to be apparent
under the conditions we have used. Alternatively, the
talin binding may require the ~ subunit.
The physical properties of Fibulin also differ from
those of other known focal-contact associated and
microfilament associated proteins (Geiger, B., Biochem.
Biophys. Acta, 739:305 (1983); Weeds, Nature 296:811
(1982), both of which are incorporated herein by
reference). Two such proteins, gelsolin and ~-actinin,
. . .:
' , .. :,
::, . i
WO91/02755 2 ~ ~ ~ 8 1~ PCT/US90/04662
19
posses some characteristics common to Fibulin. These
characteristics include similar molecular weight, ability
to bind calcium, and cellular localization. No similarity
was found between the amino-terminal sequence of human
gelsolin (Kwiatkowski et al., Nature 323:455 (1986), which
is incorporated herein by reference) and that determined
for Fibulin. Likewise, a comparison of the amino-terminal
sequence of Fibulin with that for chicken skeletal muscle
~-actin (Arimura et al., Eur. J. Biochem. 177:649 (1988),
which is incorporated herein by reference) showed no
similarity. Immunologically, no relationship between ~-
actinin and Fibulin was found. Anti-~-actinin serum
reactive with human muscle and non-muscle isoforms showed
no reactivity with either reduced or non-reduced Fibulin
transferred to nitrocellulose from SDS-PAGE. Furthermore,
anti-Fibulin serum showed no reactivity with bovine cardiac
~-actinin in immunoblotting.
When the amino terminal sequence of Fibulin was used
to search the NBRF protein database, no protein present in
the database was found to share the sequence or to be
closely similar. In addition, sequences have been
determined from three tryptic fragments of Fibulin. When
these sequences were used to search the protein database no
matches were found. The evidence thus far obtained
indicates that Fibulin is a new molecule that may serve as
a link between the fibronectin receptor B subunit and
cytoplasmic components, perhaps the cytoskeleton.
The B subunit of the fibronectin receptor (B1 subunit)
has been shown to be sh~red with at least six other
integrin receptors (Hemler et al., J. Biol. Chem. 263:17660
(1987), J. Biol Chem. 262:3300 (1988), both of which are
incorporated herein by reference). Several other members
of this group are known to be receptors for the
extracellular matrix molecules laminin and collagen. By
interacting with all of the receptors possessing the B1
.. -: - :. . .
:.~ . . ., :
.. . . .. . ...
.
. : . - ~,: :
- .' .~ ~1 :'
, . : .~ . ,, , :~ .
. ~
WO91/~275~ 2 0 ~ ~ 818 PCT/US90/04662
subunit, Fibulin can be used to manipulate adhesion of
cells at least to fibronectin, collagen, laminin, and
possibly to other proteins as well.
Either native or synthetic Fibulin, or peptides
corresponding to antigenic determinants thereof, can be
used to produce antibodies, either polyclonal or
monoclonal. If polyclonal antibodies are desired, antigen
is used to immunize a selected mammal (for example, mouse,
rabbit, goat, horse, etc.) and serum from the immunized
animal is later collected and treated according to known
procedures. Antisera containing polyclonal antibodies to
a variety of antigens in addition to those to the antigen
of interest can be made substantially free of antibodies
which are not antigen specific by passing the composition
through a column to which non-antigen protein has been
bound. After washing, antibodies to the non-specific
proteins will bind to the column, whereas antibodies to
antigen of interest elute in the flow through. Monoclonal
antibodies can also be readily produced by one skilled in
the art. The general methodology for making monoclonal
antibodies by fusing myelomas and lymphocytes to form
hybridomas is well known. Such cells are screened to
determine whether they secrete the desired antibodies, and
can then be grown either in culture or in peritoneal cavity
of a mammal. Antibodies can be recovered from the
supernatant or ascites fluid. Immortal, antibody producing
cell lines can also be created by techniques other than
fusion, such as direct transformation of B lymphocytes with
oncogenic DNA, or transfection with Epstein-Barr virus.
See, for example, M. Schrier, et al., HYBRIDOMA TECHNIQUES
(1980); Hammerling, et al., MONOCLONAL ANTIBODIES AND T-
CELL HYBRIDOMAS (1981); Kennet, et al., MONOCLONAL
ANTIBODIES (1980); Harlow and Lane, ANTIBODIES: A
LABORATORY MANUAL, Cold Spring Harbor (1988), all of which
are incorporated herein by reference. Such antibodies can
be used to characterize an extracellular matrix as to the
. ~ . , ,
,, . :, - :
~ .
.' '~
, ' , ~ , . , ,' ~ ., ,~ ' ' ` ,,' ,
WO9l/OZ755 ~ 6 4 ~ 1~ PCT/US90/04662
21
presence of Fibulin.
Because of the integral role of the cell adhesion
system in mediating attachment, migration, growth,
metastasis and differentiation of cells and tissues,
Fibulin and antibodies reactive with Fibulin or antigenic
determinants thereof, has important diagnostic and
therapeutic utilities for both normal and abnormal
conditions. In addition, Fibulin can be used to target
lo moieties to the extracellular matrix, by attaching such
moieties to Fibulin.
The following examples are intended to illustrate but
not limit the invention.
EXAMPLE I
AFFINITY CHROMATOGRAPHY
The following peptide, corresponding to residues 762-
798 of the fibronectin receptor B subunit (Argraves et al.,
20 J. Cell Biol., 105:1183, (1987a)), was synthesized using an
Applied Biosystems model 430A, according to the
manufacturer's instructions:
.
E-F-A-X-F-E-K-E-K-M-N-A-K-W-D-T-G-E-N-P-I-Y-K-S-A-
V-T-T-V-V-N-P-K-Y-E-G-K
An affinity matrix was prepared by coupling the
peptide to cyanogen-bromide-activated Sepharose (Pharmacia,
Piscataway, NJ), according to the manufacturer's
instructions. The resulting matrix contained approximately
10 mg peptide per ml of Sepharose.
:
Human placental tissue (100 g, ground) was washed with
two volumes of 0.005% digitonin, Sigma Chemical Co., St.
Louis, MO, 1 mM CaCl2, 1 mM MgCl2, TBS (150 mM NaCl, 50 mM
Tris-HCl pH 7.4), 1 mM phenylmethylsulfonylfluoride (PMSF).
: . . - . . , -
~ .... ;,.. -
. ~ : - ~ . , .. . ~ . .... .
. : - : , ' ' ~ ''' ' . ' ': ' ''~
~, :
, . , ... ~ .
.. . . .. ~ ,. . . .
:
WO91/02755 2~ 1 8 PCT/US90/04662
22
After centrifugation at 2600 X g for 15 minutes, the
pelleted tissue was extracted with 100 ml of 50 mM octyl-
B-D-glucoside (Calbiochem, La Jolla, CA), 1 mM CaCl2, TBS,
1 mM PMSF according to the procedure of Pytela, et al.
Methods Enzymol. 144:475 (1987). Extracts clarified by
centrifugation at 2600 X g were first applied to a column
of plain Sepharose CL-4B (15 ml) and then to the synthetic
peptide affinity matrix (7 ml). The column was washed with
8 column volumes of 25 mM octyl-~-D-glucoside, 1 mM CaC12,
1 mM MgCl2, TBS, 1 mM PMSF (wash buffer). Elution was
achieved using 2 column volumes of cation free wash buffer
containing 20 mM EDTA. Samples from each 1/4 column volume
fraction were analyzed by SDS-PAGE (Laemmli, Nature,
227:680 (1970), which is incorporated herein by reference)
and protein bands stained using Coomassie Brilliant Blue R-
250. Typically the yield was 200-300 ~g of Fibulin from
100 g of placental tissue. These results (Figure 1)
indicate that Fibulin interacts with the synthetic
cytoplasmic domain affinity matrix in a divalent cation
dependent manner. Other experiments showed that elution
with buffer containing the synthetic peptide residues 762-
798 of the ~1 subunit, or 8 M urea also released Fibulin
from the affinity matrix.
25Elution using a synthetic peptide corresponding to the
subunit cytoplasmic domain (residues 1028-1049, Argraves
et al., su~ra) did not release Fibulin from the ~ peptide
affinity matrix. Additionally, Fibulin did not bind to a
column prepared with the synthetic ~ subunit cytoplasmic
peptide.
EXAMPLE II
POLYCLONAL ANTIBODY PRODUCTION
35Affinity chromatography purified Fibulin (100 ~g in
0.5 ml TBS) was mixed with an equal volume of Freund's
complete adjuvant, emulsified, and used to immunize a New
,
,, . ~,
- , , . ;: ;. -
~ : .
~ " : ' '' ' ~:
', . '
20~8~8
WO91/02755 PCT/US90/04662
23
Zealand White femal~ rabbit. Booster injections of the
same dose of protein emulsified in Freund's incomplete
adjuvant were made. The rabbit was boosted 3 weeks
following the immunization, then bled 8 days later.
Subsequent booster injections were administered after 1
month and bleeding done as before (this cycle has been
repeated several times). The titer of the serum was
monitored by enzyme-linked immunosorbent assays (ELISA,
Engvall and Pearlman, J. Immunol. 109:129 (1972), which is
lo incorporated herein by reference) and immunoblot analysis.
This antiserum is designated 1323. As a precaution, the
serum used in the immunofluorescent experiments of Example
X was absorbed on columns of human fibronectin and
fibronectin receptor coupled to Sepharose.
For immunoadsorbtion and ELISA of Fibulin, the mouse
monoclonal antibody 5D12/H7 was used. This hybridoma cell
line was produced by fusion of immune mouse spleen cells
with myeloma X63Ag8.653 cells according to published
methods (Ruoslahti et al., Meth. Enzymol. 84:3-19, 1982,
which is incorporated herein by reference). 5D12/H7 reacts
specifically with Fibulin in ELISA, immunoprecipitation and
in immunoblotting under both reducing and non-reducing
conditions.
EXAMPLE III
MONOCLONAL ANTIBODY PRODUCTION
Balb/c mice were injected intraperitoneally with
approximately 50 ~g of Fibulin emulsified in Freund's
complete adjuvant (1:1 vol/vol). Boosts were done in the
same fashion 4 weeks later with Fibulin emulsified in
Freund's incomplete adjuvant. Five days later splenectomy
was performed. Fusions were performed essentially
according to protocols described in (Hessle and Engvall J.
Cell Biol. 259:3955-3961 (1984) and Ruoslahti et al.,
Meths. Enzymol. 84:3-19 (1982), both of which are
. . . - - , ... ~ .
. ~ ~, ,- '.
. ' ' . .
.' . ''
~ . . -: . . .. . :. . ...
WO91/027~5 PCT/US90/04662 ~
;~6~818 24
incorporated herein by reference) using murine myeloma line
X63-Ag8.563. Mouse monoclonal anti-human fibronectin which
does not cross-react with bovine fibronectin was purchased
from Telios Pharmaceuticals, San Diego, CA.
5EXAMPLE IV
AMINO-TERMINAL SEQUENCE ANALYSIS
Affinity chromatography-isolated Fibulin was subjected
to SDS PAGE in a 15% acrylamide gel under reducing
conditions. Following electrophoresis the gel was stained
with coomassie Blue for 5 minutes and destained just until
the lOO kd band was apparent. The band was excised from
the gel and the protein electroeluted (Hunkapiller et al.,
Meth. Enzymol. 91:227 (1983), which is incorporated herein
by reference). SDS was removed from the electroeluted
protein according to the procedure of (Konigsberg and
Henderson, Meth. Enzymol. 91:754 (1983), which is
incorporated herein by reference) and approximately lOO
pmol was subjected to Edman degradation using an Applied
Biosystems (Foster City, CA) model 477A protein sequencer
with an on-line Applied Biosystems model 130
phenylthiohydantoin analyzer.
The following sequence was determined:
25D-V-L-L-E-A-S-X-A-D-G-S-H-M-A
X could not be conclusively identified.
The amino-terminal sequence that was obtained was used
to search the Protein Identification Resource (1~88)
Protein Sequence Database (National Biomedical Research
Foundation (NBRF), Washington, DC). No homologous proteins
were identified.
. .. . ~ ~
206~8~8
WO91/02755 PCT/US90/04662
. ...
EXAMPLE V
ISOLATION AND CHARACTERIZATION OF cDNA CLONES
A polyclonal antiserum prepared against Fibulin was
used to immunologically screen a lambda gtll human
placental cDNA library essentially as described previously
(Argraves et al., J. Cell Biol., 105:1183 (1987), which is
incorporated herein by reference). Selected clones were
shown to express insert encoded protein reactive with
antibodies affinity selected on Fibulin-Sepharose. cDNA
inserts from 3 of these clones were isolated and subcloned
into the sequencing ~ector ml3mpl9. The cDNA inserts were
sequenced by the dideoxy chain termination method (Sanger
et al., Proc. Natl. Acad. Sci. 74:5463-5467 (1977), which
is incorporated herein by reference). The identity of the
cDNAs was confirmed by the fact that they could be shown to
encode Fibulin amino acid sequences determined by protein
sequence analysis.
The partial Fibulin cDNA nucleotide sequence and
deduced amino acid sequence are as follows:
GATGTCCTCCTGGAGGCCT5CTGTGCGGACGGACACCGGATGGCCACTCAT
D V L L E A C C A D G H R M A T H
S X S H
:
Differences between the sequence obtained from amino
acid sequence analysis and deduced sequence are indicated
below the deduced amino acid sequence.
Further, immunological screening of a placental cDNA
library resulted in the isolation of 7 related clones. As
individual cDNAs were sequenced it was found that they
- could be categorized into three types (A, ~, and C) as
shown in Figures 3, 4 and 5, respectively. The nucleotide
sequence of all three types of cDNAs were identical from
their 5' ends to a divergence point at position 1707, after
'
-
W09]/Ot755 2 ~ ~ 4~ 1~ 26 PCT/US90/04662
which they were distinct through to the poly(A) tail. The
categorization was therefore based on the sequence
following the divergence point.
Polypeptides of 566, 601 and 683 amino acid residues
are encoded by the type A (Figure 3), B (Figure 4) and C
(Figure 5) cDNAs, respectively. These polypeptides have in
common the first 566 amino acid residues. The alternative
B and C cDNA segments encode differing polypeptide elements
that add 35 and 117 residues to the 566 residue protein.
The amino acid sequence deduced from the cDNAs was found to
contain the sequences determined from the protein
sequencing of Fibulin including the amino-terminal sequence
and three sequences derived from tryptic fragments of
Fibulin (Figure 3). These findings additionally confirmed
that the immunologically identified cDNAs indeed
corresponded to Fibulin. Preceding the amino-terminal
sequence in the deduced type A, B and C sequences is a 29
residue hydrophobic leader sequence that has features
consistent with it being a signal peptide. Three potential
N-linked glycosylation sites (N-X-S/T) occur in each of the
deduced sequences.
The three forms of Fibulin are rich in cysteine
(approximately 11 mol ~), containing 69, 70 and 72 residues
for the A, B and C forms, respectively. Analysis of the
sequence with respect to the number and spacing of cysteine
residues revealed the presence of two types of repeat
motifs (designated type I and II) that each share homology
with elements from specific proteins found in the database.
The type I motif has a consensus sequence CC(X)12C(X)9
C(X)6CC, and is repeated twice. Separating the two is an
imperfect form of this motif that lacks two cysteines. A
computer aided search of the protein database for sequences
containing the type I motif or slight variations thereof
- revealed that CC(X)12C(X)1112C(X)6CC is found in complement
~. :
2~81 8
W091/0275~ PCT/US90/04662
27
- component anaphylatoxins C3a, C~a and C5a. The inverse
pattern, CC(X)6C~X)1~2C(X)~2CC, is found in the three members
of the albumin gene family which include albumin, vitamin
D-binding protein and ~-fetoprotein. The homology findings
suggest that the overall disulfide stabilized loop
structure may be conserved between Fibulin and these other
proteins even though similarity between residues other than
cysteine in the pattern is unremarkable.
The type II motif of Fi~ulin is related to the repeats
found in epidermal growth factor precursor as well as a
number of extracellular matrix proteins. This 6 cysteine
motif is repeated consecutively nine times in the sequence
of Fibulin A, B and C. Four of the nine type II repeats
(2-4, and 9) differ from the typical EGF-like motif in that
they have a 4-6 residue insertion between cysteines 4 and
5, instead of the usual single residue separating the two.
The ninth type II repeat of Fibulin A is imperfect in that
it lacks a cysteine in the sixth position of the motif
while Fibulins B and C both have cysteine residues in the
vicinity, but the spacing of these is not conserved
relative to the other repeats. Embodied within the four of
; the nine type II repeats (5-8) is consensus sequence for
aspartic acid and asparagine hydorxylation. The seventh
type II repeat contains a consensus 0-glycosylation
sequence, CXCXPC, that is found in the EGF-like domains of
coagulation factors, VII, IX, protein Z and thrombospondin.
Immediately following each type II repeat is a pentapeptide
with a consensus sequence XD(I/V~(D/N)E. Separating the
third type I repeat and the first type II repeat is a 33
residues segment with 36% (12) of the amino acids either
aspartic or glutamic acid.
,,. - . - . - .. . .- ., - .: : ,
., ~ ' : ' - . . :, ' ~ :
.: , , :
- . , ~ - . : , . - . - . . .
. . , . , : " . : . ,
,
.: , . . :
.,, ~ : , . .
. '' ' : : .
., : , .: .
.
, ~:
WO91/02755 ~ 0 6 ~ PCT/US90/04662
28
EXAMPLE VI
FIsRoNECTIN RECEPTOR-FIBULIN IN VITRO BINDING ASSAYS
Microtiter plate wells (Becton Dickinson, Lincoln
S Park, NJ) were coated with Fibulin at 1.0 ~g/ml in coating
buffer (0.1 M sodium carbonate pH 8.5). Control wells were
coated with bovine serum albumin (BSA) at 3 ~g/ml in
coating buffer. Fibronectin receptor was added to wells at
concentrations ranging from 20 ~g/ml to 0.01 ~g/ml in TBS,
0.5~ Tween-20, 1 mM CaCl2, 1 mM MgCl2 (TBS-Tween-cations).
The fibronectin receptor used in these assays was isolated
by affinity chromatography on a column of the 120 kd cell
binding fragment of fibronectin coupled to Sepharose
(Pytela et al., Meth. Enzymol. 144:475-489 (1987), which is
incorporated herein by reference) and further purified on
wheat germ agglutinin-agarose (Vector Laboratories,
Burlingame, CA). Following an 18 hour incubation at 4C
the fibronectin receptor containing solution was removed
and the wells washed 3 times with TBS-Tween-cations.
Rabbit anti-fibronectin receptor serum (Arqraves et al., J.
Cell Biol. 105:1183-1190 (1987); Argraves, et al., J. Biol.
Chem. 261:12922-12924 (1987), both of which are
incorporated herein by reference) absorbed previously on
columns of Fibulin coupled to Sepharose and human serum
proteins coupled to Sepharose was diluted 1:1500 and
incubated with each well for 2 hours at 37C. The wells
were then washed 3 times with TBS-Tween buffer containing
cations. Goat anti-rabbit IgG alkaline phosphatase
conjugate (BioRad, Richmond, CA) was added and incubated
for 1 hour at 37C. The substrate paranitrophenyl
phosphate (Sigma, St. Louis, M0), in 1 M diethanolamine, pH
9.8, 1 mM MqCl2, was added and at various time intervals the
absorbance at 410 nm measured using a Dynatech (Model MR-
600;) reader.
For assays that evaluated the effect of EDTA on the
interaction between the fibronectin receptor and Fibulin,
.. -. . - . .~. . ~ ~ :,: :. . ... . .
.. . - . ............ . . .
: '.
206~81 ~
Wo9l/o27ss PCT/US90/04662
29
wells coated with Fibulin (0.6 ~g/ml) were incubated with
fixed concentrations of fibronectln receptor (20 ~g/ml in
TBS-Tween-cations) in the presence of varying
concentrations of EDTA (10 mM - 0.0046 mM). The receptor
containing solutions were incubated for 18 hours at 4C
with Fibulin coated wells. Subsequent washing and
immunological detection of bound receptor were performed as
described above.
EXAMPLE VII
BINDING OF FIBULIN TO CYTOPLASMIC
DOMAINS OF INTEGRIN BETAS 1-3
In order to evaluate the potential of Fibulin to bind
integrins other than the fibronectin receptor peptides
corresponding to the cytoplasmic domains of the beta 2 and
3 subunits were synthesized on a Milligen peptide
synthesizer (model 9050). These synthetic cytoplasmic
domain peptides were coupled to Sepharose as described
above and used as affinity matrices to select binding
proteins from octylglucoside extracts of placenta. The
columns were washed and eluted with an EDTA solution as
described previously. Individual fractions were sepa~~ted
by electrophoresis on SDS-polyacrylamide gels, staine~ ~ith
; 25 Coomassie and transferred electrophoretically to
nitrocellulose. Protein transferred to nitrocellulose was
immunologically stained with anti-Fibulin antibodies.
The results are presented in Table I. A yes indicates
that the peptide affinity matrix bound Fibulin as indicated
by elution of a Coomassie stainable band of similar
molecular size to Fibulin as well as, cross reaction of the
eluted protein with antibodies specific for Fibulin (1323
and 5D12/H7). A no indicates that the affinity matrix
bound no detectable amounts of Fibulin as determined by
Coomassie staining and immunoblotting. As can be seen from
Table I, Fibulin was bound to peptides corresponding to the
- : . : : ........ .
:'. , , : . , : . ' ~ ,~, . '. : '
. ,
- . .
- ~ .
WO9l/02755 2 0 ~ PCT/US90/04662 _
cytoplasmic domain of the B1 B2 and B3 subunits.
Table I
Fibulin
Cytoplasmic domain Origin of Binding
coupled to Sepharose Sequence (ref) Capacity
(762) EFAKFEXEKMNAKWDTGEN BETA 1 (1) yes
PIYKSAVTTVVNPKYEGK (798)
(785) SAVTTW NPKYEGK (798) BETA 1 (1) no
(762) EFAKFEKEKMNAKWDT (777) BETA 1 (1) yes
15 (734) EYRRFEKEKLKSQWNNDNP BETA 2 (2) yes
LFKSATTTVMNPKFAES (769)
(726) EFAKFEEERARAKWDTANN BETA 3 (3) yes
PLYKEATSTFTNITYRGT (762)
20 (1028) RSLPYGTAMEKAQLKPPAT ALPHA 5 (5) no
SDA (1049)
1. Argraves et al., 1987, J.C.B. 105:1183-1190
2. Kishimoto et al., 1987, Cell 48:681-690
25 3. Fitzgerald et al., 1987, J.B.C. 262:3936-3939.
EXAMPTT~ VIII
Ca BINDING ASSAY
::
Binding of 4~Ca2 to Fibulin was performed according to
the method of Maruyama et al. J. Biochem. 95:511-519
(1984), which is incorporated herein by reference. Briefly,
affinity chromatography purified Fibulin was separated by
SDS-PAGE on 7.5% acrylamide gels under reducing conditions
and then electrophoretically transferred to nitrocellulose
filter paper (Towbin et al., Proc. Natl Acad. Sci USA,
76:4350 (1979), which is incorporated herein by reference).
The protein transfers were washed in 60 mM KCl, 10 mM
imidazole-HCl pH 6.8, 0.1% BSA. 45Ca2 (NEN, Boston, MA) at
1 ~Ci/ml in the same buffer was lncubated with the filters
for 20 minutes at room temperature. Unbound 45Ca2+ was
removed by washing the filters twice for 5 minutes with 50%
2~8~8
W~91/02755 . PCT/US90/0466
31
ethanol. The filters were then air dried and used to
expose Kodak XAR-5 film for 18 hours at -70C.
EXAMPLE IX
INDIRECT IMMUNOFLUORESCENT MICROSCOPY
WITH FIBULIN AND FIBRONECTIN RECEPTOR ANTIBODIES
Cells were seeded onto fibronectin (25 ~g/ml) coated
fluorescent microscopy slides (Carlson Scientific, Inc.,
10 Peotone, IL) at 1. 6 x 104 cells/ml and grown for 2-8 hours
as described in Argraves, et al., Cell 58:623-629 (1989),
which ls incorporated herein by reference. The cells were
fixed for 30 minutes with freshly prepared 3. 7%
paraformaldehyde (Fluka, Buchs, Switzerland), 0.1% Triton
X-100 in PBS. The slides were washed with PBS and then
incubated in 3% normal goat serum in PBS (PBS-serum and
incubated with the slides for 2 hours at 37C. Rabbit
anti-100 kd protein was used at a dilution of 1: 500. In
immunoblot analysis this antiserum showed no detectable
reactivity for fibronectin receptor. Mouse monoclonal
anti-fibronectin receptor B subunit IgG (designated 442)
was used at a concentration of 150 ~g/ml. Following
incubation with the primary antibodies, the slides were
washed with PBS 3 times (5 minutes each wash). The
fluorochrome conjugated antiserum (fluorescein goat anti-
rabbit IgG, or rhodamine goat anti-mouse IgG; Cappel, West
Chester, PA) was diluted (1:40) in PBS-serum and incubated
with the slides for 20 minutes at room temperature. The
slides were again washed 3 times with PBS. A solution of
40% glycerol in PBS was applied to the upper surfaces of
the slides. A glass cover slip was overlaid onto the
surface of the glycerol solution and the edges of the cover
slip sealed with clear nail polish. In those experiments
in which non-permeabilized cells were examined, cells were
treated as described above except that Triton X-100 was
omitted from the fixation solution.
~ ' , ' .'", : .
wos1/o2755 PCT/US90/04662 -
2~6~1 8 32
Stained cells were examined and photographed using an
Olympus BHS microscope equipped for fluorescent microscopy.
Photographs were taken using Fujichrome 1600 reversal film
shot at ASA 400.
EXAMPLE X
IMMUNOFLUORESCENT LOCALIZATION OF FIBULIN,
FIBRONECTIN RECEPTOR AND FIBRONECTIN
This example shows an independent immunofluorescent
experiment than that of Example IX which extended staining
periods beyond 6 hours after platin~.
Human gingival fibroblasts were seeded at a density of
1.5 X 104 cells/ml onto Lab-Tek chamber slides (Nunc Inc.,
Naperville, IL) coated with bovine fibronectin (10 ug/ml,
Telios Pharmaceuticals, La Jolla, CA). Cells were fixed .
for 30 minutes with 3.7~ paraformaldehyde (Fluka, Buchs,
Switzerland), 0.1% Triton X-100 in phosphate-buffered-
saline pH 7.2 ~PBS). In indicated experiments, the
detergent was omitted from the fixing solution. The slides
were washed with PBS and then incubated in 3% normal goat
serum, PBS (PBS-serum) for 1 hour at room temperature. The
primary antisera were diluted in PBS-serum and incubated
with the fixed cells for 2 hours at 37~C. The slides were
then washed with PBS three times 5 minutes. The
fluorochrome-con~ugated antisera, either fluorescein
conjugated sheep anti-mouse IgG or rhodamine conjugated
goat anti-rabbit IgG (Cappel, West Chester, PA) were
diluted 1:40 in PBS-serum, and incubated with the slides
for 20 minutes at room temperature. The slides were again
washed with PBS. A solution of 50% glycerol in PBS was
applied to the surface of the slides and a glass coverslip
overlaid and fixed to the surface with clear nail polish.
Stained cells were examined and photographed using an
Olympus BHS microscope equipped for fluorescent microscopy
-:- " .' . - ' ' ~'~.' ' '' '.' . '
.
.. . . , . - ,- . :
W091/02755 2 0 6 ~ 8 1 ~ PCT/US90,04662
33
and having additional exciter filters so as to narrow
wavelength bands and restrain crossover excitation during
double-fluorochrome label experiments. Photographs were
taken using Fujichrome 1600 reversal film with exposure
settings controlled with an Olympus model PM-lOADS exposure
control unit.
The results showed that Fibulin and the integrin B1
subunit, at early time periods again appeared in
immunofluorescent staining as numerous colocalizing streak-
like accumulations. In the absence of permeabilizing
agent, such staining patterns were not evident. At periods
beyond 6 hours the immunofluorescent staining pattern
showed that Fibulin accumulated into extensive fibrillar
patterns. Furthermore, the fibrillar staining pattern was
apparent in the absence of permeabilizing agent which
indicated that the immunologically detected Fibulin was
extracellular.
.
It was also apparent that the meshwork staining
pattern of Fibulin was similar to that of fibronectin.
When double-label immunofluorescent staining was done using
antibodies to both Fibulin and fibronectin, very similar
staining patterns were seen both at the early and late
periods of culture. The staining patterns obtained using
Fibulin antibodies could be completely blocked by pre-
incubation of the antibodies with 25 ug/ml Fibulin. In
addition, pre-incubation of Fibulin antibodies with human
fibronectin at 25 ug/ml failed to block antibody staining
of Fibulin. These results indicated that Fibulin, like
fibronectin, accumulates extracellularly, forming dense
networks of fibrils.
.
~ .
"'. ' " ~,: . - .
: ~ ; :
WO91/0275~ 2 ~ ~ 4 ~ ~ ~ 34 PCT/US90/04662
EXAMPLE XI
BIOTINYLATION OF FIBULIN
To evaluate the ability of exogenously added Fibulin
to bind to cell monolayers, and become incorporated into a
matrix, biotinylated Fibulin was incubated with fi~roblast
monolayers. In parallel experiments, biotinylated
fibronectin and human IgG were also incubated with
fibroblast monolayers as control proteins. After 12 hours
of incubation, the exogenously added biotinylated Fibulin
was found bound to the cell monolayer, accumulating in
elaborate fibrillar networks. A similar pattern of
incorporation was obtained with biotinylated fibronectin,
but not with biotinylated IgG. The patterns of
incorporation of exogenously added Fibulin and fibronectin
closely resembled the patterns of endogenous matrix
accumulation for each protein as described in Example X.
The Fibulin used for biotinylation was purified by
immunoadsorbtion from extracts of human placenta. Ground
placental tissue was extracted with 4 M KSCN. Extracts
were then clarified by centrifugation, dialyzed against
TBS, 10 mM EDTA and passed over a column of plain Sepharose
CL-4B. The flow through was then applied to an affinity
matrix of monoclonal 5D12/H7 IgG coupled to Sepharose. The
column was washed with 0.5 M NaCl, 50 mM Tris pH 7.4, and
bound Fibulin eluted with a solution of 4 M KSCN. The
eluted Fibulin was dialyzed against TBS and affinity
selected on WGA-agarose (see below). Purified Fibulin was
incubated with sulfo-N-hyroxysuccinimide-biotin (S-NHS-
biotin, Pierce, Rockford, IL) in 0.1 M sodium carbonate pH
8.5 (at a 1:200 molar ratio of protein to S-NHS biotin) for
3 hours at 4C. Following the reaction, the samples were
dialyzed against serum-free DMEM supplemented with
penicillin, streptomycin, glutamine, sodium bicarbonate,
and sodium pyruvate.
wng1/027~s ~ 8 ~ 8 PCT/US90/04662
Gingival cells were grown for 24 hours in Lab-Tek
chamber slides coated with 25 ug/ml bovine fibronectin.
Medium was removed and the cell monolayers washed 3 times
with serum-free DMEM. Biotinylated-Fibulin, -human
fibronectin and -human IgG, each diluted to 0.5 mg/ml in
DMEM, ITS (insulin, transferrin, selenous acid, BSA,
linoleic acid, Collaborative Research, Bedford, MA) were
added separately to the cells and allowed to incubate for
12 hours at 37C. The media were removed and the cell
layers washed 3 times with PBS. The fluorochrome
conjugate, FITC-avidin (Pierce), was diluted to 30 ug/ml in
PBS, was added and incubated for 30 minutes at room
temperature. The cell layers were washed 3 times ~ith PBS,
mounted and examined by immunofluorescent microscopy as
described in Example X.
EXAMPLE XII
INMUNOPRECIPITATION ANALYSIS
"' : .
This example demonstrates the presence of Fibulin in
the culture medium which is secreted from fibroblasts.
Nearly confluent human gingival fibroblasts, in 100-
mm diameter culture dishes (Becton Dickinson, Lincoln Park,
NJ), were radiolabeled for 18 hours with 250 uCi of [35S]-
cysteine (New England Nuclear, Boston, MA) in DMEM
(Mediatech, Herdon, VA) containing 10~ bovine calf serum
supplemented with iron (HyClone, Logan, Utah). The media
was removed and centrifuged at 5000 X g for 15 minutes.
The media supernatant was then dialyzed against 0.5 M NaCl,
2 mM phenylmethysulfonyl fluoride (PMSF), 0.1% Triton X-
- 100, 0.1% Tween-20, 50 mM Tris-HCl pH 7.4 (wash buffer) for
18 hours at 4C. The dialyzed media was pre-cleared with
1/50 th volume of protein A-Sepharose (Sigma, St. Louis,
MO, mixed 1:1 v/v in wash buffer). Following a 1 hour
incubation, the protein A-Sepharose was removed by
'.~
; - . ~ . , : .
, ''
..,. ,:
,, : .
WO91/02755 ~ 8 ~ 8 PCT/US90/~4662 -.
36
centrifugation at 2500 X g for 5 minutes. Antiserum (2 ul)
was added to 2 ml aliquots of media and incubated for 18
hours at 4C. Immune complexes were precipitated with
protein A-Sepharose and washed repeatedly in wash buffer.
After a final wash in Tris-buffered-saline pH 7.4 (TBS),
bound protein was released by addition of SDS
electrophoresis sample buffer and analyzed by SDS-PAGE on
7.5% gels.
The results indicated that Fibulin antibodies
immunoprecipitated a single polypeptide with an apparent
reduced molecular weight of 100 ~d which corresponded to
Fibulin. In the absence of reducing agent, the
immunoprecipitated polypeptide exhibited an increased
electrophoretic mobility characteristic of Fibulin. The
results indicated that Fibulin is secreted by the cultured
fibroblasts.
EXAMPLE XIII
PULSE-CHASE IMMUNOPRECIPITATION ANALYSIS
~:,
To examine the temporal biosynthesis of Fibulin,
pulse-chase immunoprecipitation analyses was performed.
Human gingival fibroblasts were grown to near confluence in
35-mm diameter culture dishes. Cell layers were washed
three times with cysteine-free RPMI-1640 (Gibco
Laboratories, Grand Island, NY) supplemented with ITS and
10 mM Hepes pH 7Ø The cells were then grown for 15
minutes at 37~C in the cysteine-free RPMI, ITS medium. The
cultures were then pulse-labeled for two minutes with
cysteine-free RPMI, ITS medium containing 0.5 mCi/ml [35S ] -
cysteine. After the 2 minute pulse labeling the medium was
removed and the cell layers washed three times with RPMI,
ITS containing 1 mM unlabeled cysteine, 10 mM Hepes pH 7.0
and then allowed to incubate for various periods of time in
the same medium at 37~C. At the appropriate time
intervals, medium was isolated and the cell layer extracted
:...... . .: -
VV~ 91/02755 2 0 ~ ~ 81 8 PC~r/US90/04662
with 1 ml of 1% Triton X-loo, 0.5 M NaCl, 0.05% Tween 20,
0.05 M Tris-HCl pH 7.4, 2 mM PMSF using a disposable cell
scraper. The cell extracts and culture medium fractions
were clarified by centrifugation at 100 K X g in a Bec~man
model TL-100 ultracentrifuge. The resulting supernatants
were pre-absorbed with protein A-Sepharose, used in
immunoprecipitation and analyzed by SDS-PAGE as described
above. Following SDS-PAGE, gels were treated with
Enlightning (NEN Research Products, Boston, MA), dried, and
lo used to expose X-ray film at -70C.
The results indicated that within the first minutes of
chase two immunoreactive polypeptides of approximate 80 and
loo kd molecular weight were present in the cell layer
extract. After 5 minutes of chase the level of 80 kd
polypeptide diminished. Between 30 and 60 minutes of
chase, 100 kd Fibulin polypeptide appeared in the medium
with a subsequent decrease in the 100 kd polypeptide in the
cell extracts. The results demonstrate a precursor-product
relationship between the 80 and 100 kd polypeptides. The
80 kd band may then correspond to the nascent Fibulin
polypeptide which is subsequently processed to the 100 kd
molecule that is secreted.
25EXAMPLE XIV
ELISA FOR DETERMINING FIBULIN
CONCENTRATION IN PLASMA
To determine the amount of Fibulin in plasma, a two-
antibody sandwich ELISA was developed. Microtiter wells
were coated overnight with 3 ug/ml mouse anti-Fibulin
monoclonal 5D12/H7 IgG in 0.1 M sodium carbonate buffer, pH
9.5. Non-specific binding sites were quenched by addition
of 1 mg/ml BSA in PBS. Human plasma, pooled from 5 donors,
was serially diluted and incubated with the antibody
coating for 1 hour at room temperature. Rabbit anti-
Fibulin serum at a dilution of 1:10,000 was incubated for
~ -
,
~ , , .:
, ~.
WO91/02755 ~8~8 38 PCT/US90/04662 -
1 hour at room temperature followed by goat anti-rabbit IgG
alkaline phosphatase for an additional hour. The
chromogenic substrate p-nitrophenyl phosphate (Sigma
Chemical Co., St. Louis, MO) was used to measure enzymatic
activity bound to the wells. Resulting absorbance values
of the plasma samples were compared to those of a serially -
diluted standard of purified placental Fibulin. The
concentration of the Fibulin standard was determined by
protein-dye binding assay (Bradford, Analytical
Biochemistry, 72:248-254, 1976, which is incorporated
herein by reference). The amount of Fibulin in plasma was
determined to be 33 + 3 (mean, + S.D.) ug/ml and SDS-PAGE
analysis showed that the immunologically selected
polypeptide displayed electrophoretic properties
15 indistinguishable from Fibulin. ~
EXAMPLE X~ - -
LECTIN AFFINITY CHROMATOGRAPHY OF FIBULIN
:' ' .
Fibulin was purified from placental extracts by
affinity chromatography on the synthetic B1 subunit
cytoplasmic domain peptide-Sepharose as previously
described in Example I. Fibulin, in 25 mM octyl-~-D-
glucoside, 20 mM EDTA, 2 mM PMSF, TBS was then applied to
a column of wheat germ agglutinin (WGA) coupled to agarose
(Vector Laboratories, Burlingame, CA) equilibrated in the
same buffer. The column was washed with 10 column volumes
of TBS and eluted with 2 column volumes of TBS containing,
0.5 M N-acetyl-D-glucosamine (Sigma). Eluted protein was
electrophoresed on SDS-polyacrylamide gels and protein
bands stained using Coomassie blue.
, ,
Chromatography of placental Fibulin preparations on
columns of WGA coupled to agarose and subsequent SDS-PAGE
analysis revealed that Fibulin bound to the lectin and
could be eluted using a solution of the sugar N-acetyl-
; glucosamine. No 100 kd polypeptide was found in the
.. .
,: ' ' ' ' '"' '- ' "'' '" . ""~, ~ ' " ' ' ' '
' : ' ' , , ' -: ' ' ' , ~ ' ': ' " . . . ',, , . : . . .
W~91/027~5 2 ~ 6 4 8 1 ~ PCT/~S90,04662
material that passed through the lectin column which
indicated that virtually all the Fibulin had bound. These
results indicated that Fibulin is a glycoprotein containing
N-acetyl-glucosaminyl carbohydrate constituents.
EXAMPLE XVI
DETECTION OF N-LINKED OLIGOSACCHARIDES
To determine the presence of N-linked oligosaccharides
on Fibulin, WGA-agarose selected Fibulin as described in
Example XV was first boiled for 3 minutes in 0.5% SDS, 0.1
M ~-mercaptoethanol and then digested with N-glycosidase F
(Genzyme, Boston, MA), according to the manufacturer's
protocol, for 18 hours at 37C. Following the digestion,
samples were analyzed by SDS-PAGE.
The electrophoretic mobility of Fibulin increased
after digestion with the N-glycosidase F. The mobility of
the digested material corresponded to a molecular weight of
95 kd. Controls in which Fibulin preparations were
incubated under similar conditions, without the enzyme,
showed no change in electrophoretic mobility. Assuming a
molecular weight of 1500 for an average N-linked
carbohydrate-side chain, native Fibulin may then have three
N-linked oligosaccharide chains.
.
EXAMPLE XVII
RNA HYBRIDIZATION ANALYSIS
RNA hybridization analysis was performed using a
Fibulin cDNA fragment common to the three types of cDNA
(bases 84-234, (Figure 3) as a probe. Briefly, human
placental poly(A) RNA was electrophoresed in denaturing
0.8~ agarose gels containing 6% formaldehyde (Lehrach et
al., Biochemistry 16:4743-4751, 1977, which is incorporated
herein by reference) and blot transferred to nitrocellulose
(Thomas, Proc. Natl. Acad. Sci., USA, 77:5201-5205, 1980,
.
' '
., .
WO91/02755 ~ ~ 6 ~ PCT/US90/04662
which is incorporated herein by reference). The filters
were probed with a 150 bp DNA segment generated by
polymerase chain reaction (PCR) (Saiki et al., Science,
239:487-491, 1988, which is incorporated herein by
reference) using a Fibulin cDNA insert as template and
upstream and downstream oligonucleotide primers both taken
from a region of Fibulin cDNA common to the three cDNA
types. After hybridization the filters were washed under
high stringency and used to expose X-ray film at -70C.
The results obtained showed two transcripts of
approximately 2.4 and 2.7 kb to be present in human
placental poly(A) RNA.
EXAMPLE XVIII
POLYMERASE CHAIN REACTION ANALYSIS
To verify that all the isolated cDNAs corresponded to
actual transcripts expressed in placental tissue, a reverse
transcriptase polymerase chain reaction (PCR) analysis was
performed (Rappolee et al., Science, 241:708-712, 1988,
which is incorporated herein by reference). Pairs of
synthetic oligonucleotide primers, based on sequence from
either side of the divergence point from each cDNA type,
were used in PCR to ampli~y cDNA prepared from placental
2S RNA.
, . .
Total human placental RNA (l ug) was used with random
hexanucleotide primer (200 ng, Pharmacia), RNasin (30
units, Promega, Madison WI), 1 mM deoxynucleotide
triphosphates (dNTPs) and Moloney murine Leukemia virus
reverse transcriptase (200 units, Bethesda Research
Laboratories, Gaithersburg, MD) to synthesize cDNA. Using
one hundredth of the cDNA product, Taq DNA polymerase (3
units, Stratagene, La Jolla, CA), upstream and downstream
synthetic oligonucleotide primers (800 ng each), and dNTPs
(0.25 mM each) polymerase chain amplification was
.. :
..
. ~. . ''- , '. '. ~
~91/02755 2 0 ~ 4 818 PCT/US90/04662
41
performed. Primer pairs specific for the cDNA of Fibulin
A, B or c, were taken from the following positions within
the respective target DNA sequence; 1657-1674 and 2142-2159
for A; 1657-1674 and 2248-2265, for B and; 1442-1459 and
1966-1983 for C. The following temperature parameters were
cycled 35 times; 1 minute at 94~C, 2 minutes at the Tm-4C
of the primer with the lower Tm of the given pair, and 3
minutes at 72C. Aliquots of the reactions were analyzed
by agarose gel electrophoresis and the separated DNA
stained with ethidium bromide.
The expected sizes for amplified products were 502,
606 and 541 bp for cDNA types A, B and C respectively.
When the products were analyzed by agarose gel
electrophoresis, fragments of the appropriate size were
obtained, confirming the presence of each transcript in
total placental RNA. The product of PCR using the type A
specific primers was repeatedly the lowest in yield. These
results indicated that at least three forms of Fibulin
transcripts existed, most likely through a process of
alternative splicing of a pre-mRNA transcript.
Although the invention has been described in terms of
the presently preferred embodiments, it will be apparent to
one skilled in the art that modifications can be made
without departing from the spirit of the invention. Thus,
the invention is limited only by the following claims.
,
.
