Note: Descriptions are shown in the official language in which they were submitted.
WO91/050~ 2 ~ ~ r~ PCT/US90/0~27
A SENSITIVE METHOD FOR MEASUREMENT OF CHIMERIC
TRANSCRIPTS OF DNA CONTAINING TRANSLOCATIONS
The present invention is related generally to
the measurement of mRNA present in a biological sample.
More particularly, the present invention is related to a
sensitive and ef-~cient method of measuring chimeric mRNA
resulting from a chromosomal translocation, especially
from biopsy specimens or the like, by a novel technique
combining reverse transcription and polymerase chain
reaction (PCR).
BACKGROUND OF THE INVENTION
Follicular lymphoma is a common B-cell neoplasm
which has remained largely an incurable disease.
Approximately 95~ of follicular lymphom~s carry the
t(l4;18) (q32;q21) chromosomal translocation which
results in joining of the putative oncogene bc1-2 on
chromosome 18 to the immunoglobulin heavy chain joining
region gene, JH, on chromosome 14 (Tsujimoto et al, 1984,
Science 226:1097; Tsujimoto et al, 1985, Science
228:1440). This creates a unique segment of DNA composed
of a joined bc1-2/JH seauence. Studies with cell lines
have indicated that this translocation results in
deregulation of bc1-2 expression, perhaps due to the
effect of the IgH enhancer, leading to inappropriately
high levels of the bcl-2 fusion transcript (Seto et al,
1988, Embo.J. 7:123; Hua, 1988, Oncoaene Res. 2:263).
The high level expression of this chimeric transcript in
follicular lvmphoma has been proposed as a factor
involved in the pathogenesis of follicular lymphoma
(Tushjimoto, Y., 1989, Proc. Natl. Acad. Sci 86:1958) and
the level of expression may be correlated with clinical
course. Howeve , the levels of the bcl-2-Ig fusion
-: :, . .,, : : . . .
,~ - ' :
- . . : .
W091/050~ ~ PCT/US90/05427
transcript in follicular lymphoma tissue has not been
studied and correlated to clinical prognosis due to the
relatively low levels of expression compared with other
gene products and inherent difficulties in isolation of
S RNA containing sufficient quantities of the chimeric mRNA
from biopsy specimens. Conventional methods involve
preparation of large quantities of ~NA, denaturation of
RNA, electrophoresis in agarose formaldehyde gels and
transfer to a nitrocellulose paper followed ~ by
hybridization with a specific probe and comparison to a
product of known level of expression (Graninger et al,
1987, J. Clin. Invest. 80:1512). A reliable method for
detecting micro quantities of ~RNA found in biopsy
samples is still needed.
SUMMARY OF THE INVENTION
It is, thereore, an object of the present
invention to provide a sensitive, reliable and efficient
method for detecting micro quantities of mRNA found in
biological samples, such as biopsy specimens.
It is a further object of the present invention
to provide a diagnostic test for detecting and predicting
the course of conditions resulting from t(14;18)
translocation, such as follicular lymphoma, Hodgkins
disease and the like.
Other objects and advantages will become evident
from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRANINGS
These and other objects, features and many of
the attendant advantages of the invention will be better
understood upon a reading of the following detailed
description when considered in connection with the
accompanying drawings wherein:
. , . , . . . . - .. ,~
WO91/050~ h ~ S 1 ~1 PCT/US90/05427
Figure 1 shows different levels of expression of
bc1-2. RNA extracted from tumor cells (lanes 1, 2, 3, 4)
and from the cell line S~DHL-6 (lanes 5 and 6) was
reverse transcribed and specifically amplified using the
polymerase chain reaction technique. The amplified
segments are subjected to electrophoresis and Southern
blotting. Southern blots were then probed with a 32-P-
labeled internal oligo.
DETAILED DE5CRIPTION OF THE INVENTION
The above and various other objects and
advantages of the invention are achieved by a method for
detecting the presence of mRNA in a biological sample
which comprises:
(a) extracting mRNA from a biological sample by
any suitable procedure;
(b) then reverse transcribing the extracted
mRNA using for example, moloney murine
leukemia virus reverse transcriptase to
obtain cDNA; and
(c) then amplifying by PCR a diagnostic
fragment of the cDNA and quantitating the
product thus obtained by any suitable means
known to one of ordinary skill in the art,
such as radiometric, fluorometric,
colorometric, densitometric, photometric
measurements and the like.
Unless defined otherwise, all technical and
scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art
to which this invention belongs. Although any methods
and materials similar or equivalent to those described
herein can be used in the practice or testing of the
' t ' '~ - . '` . ~ . . . ,' ., , ', , -, : .
~al~c~,ur~,l/rlu ~ y
P~ US9/ C5 4
present invention, the preferred methods and materials .
are now described. All publications mentioned hereunder
are incorporated herein by reference. Unless mentioned
otherwise, the techniques employed or contemplated herein
are standard methodologies well known to one of ordinary
skill in the art. The materials, methods and examples
are illustrative only and not limiting.
MATERIALS AND METHODS
Materials. The following is a list of materials and
their sources.
Guanidine isothiocyanate - Sigma; Cesium chloride -
Bethesda Research Lab (BRL); Moloney murine leukemia :
virus reverse transcriptase - BRL; Fast tract mRNA .;
isolation kit-Invitrogen; Tris and agarose - BRL; EDTA- : :
Fischer; Taq polymerase - Cetus; dATP, dTTP, dCTP, dGTP -
Pharmacia; Nusieve and Sea kemp agarose - FMC;
Genescreen - DuPcnt; 32-P-gamma ATP - ICN.
Methods
Two methods of. RNA extraction. are used, a
. 2Q... micrnprocedure and a.~tanda~-~e~hnd, ThR.micr~procPdu~-.....
- . inYolves pe}letin~ of an.aliquat... nf.. lOQ,QQO .cel~.. in.~ . .
- sterlle Eppendorf tubesj a~ditLon of:about~ g of yeast-. . -
R~- and. suspensisn.. cf.. :~e~ls-.an~ RNa.in lOO ~l....... o~
i - guanidin~;isath~Qcyana~ buffer. ~h;5 lS . layered.. o~er~
25 100 ~1 of -:.5.~ ~.~sCl:~and..centrif~ged at 75,000 L~ for-
two hours in the Beckman TL-100. The resulting pellet is,
precipitated with ammonium acetate and ethanol and
resuspended in 10 ~l of sterile Tris EDTA buffer.
The standard method uses the Fast Tract mRNA
Isolation Xit (Invitrogen) and provides polyA selected
mRNA. The extracted RNA is reverse transcribed using
Moloney Murine Leukemia Virus Reverse Transcriptase (BRL)
SUBSTITUTE S~
., . . - .
. . .... ~ -.. : .. , - : .
.
, , .. ~ . .~, . .` . .
WO9l/OSO~ ~O~ PCT/US90/05427
and one of two types of primers, oligo dT12-18 and a
mixture of a specific immunoglobulin heavy chain mu
constant region primer Cmu(GAGGGGGAAAAGGGTTGGGGCGGAT) and
a specific immunoglobulin heavy chain gamma constant
region primer C gamma (CAACTGTCTTGTCCACCTTGGTGTT). The
reverse transcription reaction is terminated after
production of the first strand by addition of Na-EDTA,
phenol chloroform extraction and ethanol precipitation.
The cDNA is resuspended in 10-15 ~1 of tris EDTA bu~fer
and 5 ~1 are amplified using the polymerase chain
reaction technique (PCR) with Taq polymerase (Cetus).
The primers for PCR are the mu constant region and gamma
constant region primers described above and the bc1-2
primer adjacent to the major breakpoint region
(TTAGAGAGTTGCTTTACGTGGCCTG) reported by Stetler-Stevenson
et al (1988, Blood 72:1822) as well as 5' and 3' primers
for a standard housekeeping gene such as beta actin.
PCR is performed in the Thermocycler (Perkin
Elmer Cetus) using a 100 mM Tris HCl buffer, pH8.~,
containing 500 mM KCl, 15 mM MgCl, 0.1% gelatin, 2.5
units of Taq polymerase, 200 ~M each of dATP, dTTP, dCTP,
and dGTP as well as 1 ~g of each primer. The reaction
mixture is heated to 91C for 5 minutes, cooled to 55 C
for 5 minutes and brought to 74C for 5 minutes.
Following this first round, samples are heated at g4C,
55C, and 74C for 1.5, 1.5, and 2 minutes, respectively,
for a total of forty cycles. Fifty percent of the PCR
sample (25~1) is resolved by electrophoresis (lOOV, 4-6
hr) in either 1.5% agarose (BRL) or 3% NuSieve (FMC) and
1% SeaKemp (FMC) a irose with O.5 ~g ethidium bromide/ml
in Tris-Borate buffer. Alkaline Southern transfers are
performed overnight using Genescreen Plus nylon filters
- . .
- . . : . : , . . . ., ..... : . , . . ~ . : , - . - ~ :
: . . -: , . , . . ~ .
: : , .- :: : : .
WO91/050~ 2 0 ~ PCT/US90/05427
(DuPont) and 0.4 N NaOH as a transfer buffer. Blots are
then probed with a 32P-labeled 2.8 kb EcorRI/HindIII
fragment of the bc1-2 major breakpoint region, a 32P-
labeled genomic JH SauIIIA fragment, and a 32P-labeled
oligo with a sequence complimentary to a region
immediately 3' to the bc1-2 primer
(CAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGC).
Amplified segments ranging between 125 and 300 base pairs
are detected by autoradiography. PCR amplification~of
contaminating genomic DNA produces a product several
kilobases in length due to the nontranscribed region
(intron) between JH and C mu or C gamma that is present
in the rearranged gene, but not in the mRNA transcript.
Thus, the technique of the present invention allows easy
discrimination between PCR amplified products from the
mRNA and genomic levels. The blots are also probed for
the housekeeping gene amplified segment, such as beta
actin. Comparison of the chimeric bc1-2/JH amplified
segment intensity to the intensity of the beta actin
amplified segment allows relative quantitation of the
expression of bc1-2.
Utilities:
1. This technique can be used to diagnose tissue or ~-
peripheral blood involvement with lymphoma. RNA
is extracted from tissue or mononuclear cells
isolated from blood and subjected to the
procedures described herein above. Presence of
the translocation is indicative of tumor
involvement in the setting of follicular
lymphoma.
2. This technique can be used to determine the
level of bc1-2 expression and this may be
~ . . ,, - .
' ~
W091/OSO~ ~ PCT/US90/05427
~.c,,O,,
utilized in determination of prognosis and thus
in selection of proper treatment modalities.
3. This technigue can be used to measure the
expression of any known oncogene in tumor tissue
and thus be utilized as a prognostic indicator
and for selection of appropriate therapy.
4. This technique can be used to determine the
presence of leukemic cells containing a
translocation and thus allow early detection of
relapse following therapy.
5. This technique can be used to determine the
level of expression of proteolytic enzymes
involved in tumor invasion and metastasis and
thus provide an indicator of metastatic
potential in tumors.
6. This technique is also useful in staging of
Hodgkins disease in cases with known t(14:18)
translocation. As mentioned herein before, mRNA
is isolated, reverse transcribed and the cDNA
fragment amplified and quantitated by standard
methodologies well known in the art; a
difference from the known steady state level of
mRNA being indicative of the presence of
t~14;18) translocation.
In summary, the combined reverse transcription
polymerase chain reaction is a novel technique for
measurement of bc1-2 transcripts requiring only small
quantities of RNA that can be easily obtained at the time
of biopsy. Low levels (nanogram quantities) of bc1-2/JH
mRNA can still be detected because following reverse
transcription the specific bc1-2/JH segment is amplified
up to a million fold by the polymerase chain reaction
,
' ' , ,
W091~050~ 2 0 5 ~ PCTtUS90/05427
technique (Saiki et al, 1988, Sci. 239:487).
Furthermore, amplified segments are run in agarose gels
without formaldehyde thus removing a significant health
hazard to laboratory personnel. Detection of a segment
of genomic DNA or of RNA containing the t(14;18)
translocation is diagnostic for tissue or peripheral
blood involvement with follicular lymphoma in patients
with this primary diagnosis and in addition,
determination of levels of expression allows prediction
of clinical cause. Therapy modified according to the
prognosis indicated by this determination may achieve
better patient survival. The t(l4;18) translocation has
recently been found in Hodgkins disease and, therefore,
the combined reverse transcription polymerase chain
reaction measurement of bc1-2/JH transcripts can be
applied to this disease as well.
The method could also be applied to measure the
expression of oncogenes and enzyme markers involved in
tumor invasion and metastasis in other neoplasms.
Furthermore, this diagnostic test allows a more accurate
assessment of the aggressiveness of individual tumors and
appropriate adjustment of therapy. A diagnostic test for
predicting the clinical course of a malignancy where
aggressive behavior by malignant cells is associated with
deregulation of an oncogene, lower expression of an
antioncogene, or excessive production of proteolytic
enzymes associated with metastasis, comprises the step of
measuring the level of target gene (oncogene,
antioncogene or enzyme and the like) mRNA in tumor
specimens by the method of the present invention and
comparing the level of this mRNA with mRNA of normal
uninvolved tissue, any statistically significant
. - . : : -
.
. :. ~- . - - . ~ :
. . - ~ , :
.
wo gl~oSo~ ~ d S ~J i l ~ PCT/US90/0~27
.,~".
deviation from the normal levels being indicative of the
clinical behavior of the tumor.
It is understood that the examples and
embodiments described herein are for illustrative
purposes only and that various modifications or changes
in light thereof will be suggested to persons skilled in
the art and are to be included within the spirit and
purview of this application and scope of the appended
claims. ~ -
. - . , . . , - ...... , ., ., . . . . . , :
- ~ - . . . , , :-:. . . : . ., : : . : . : : . ~
,. ~ . . , .. . . , . . . . ~ . . .
