Note: Descriptions are shown in the official language in which they were submitted.
W09l/09965 ~ 7 ~ ~ ~ 6 P~T/VS9o/074~
AN IMPROVED TOXIN FOR CONSTRUCTION OF IMMUNOTOXIN~
The parent application ~06/911,227) teaches the
production of recombinant pro~eins from modified Pseudomo~
nas exotoxin (PE) gene fused with DNA sequences encoding a
recognition protein for which a sp~cific receptor exists
on the cells. This was exemplified in the parent applica-
tion with the construction and expression of an IL-2-PE
fusion gene. The present application relates to the
production of improved toxins which are useful in con-
structing more effective immunotoxin~. Particularly, the
invention provides an altered PE molecule, designated
hexei~ as Lys-PE40, that can be easily conjugated to an
antibody with effective cytotoxicity ~oward target cells.
BRIEF DESCRIPTION OF THE DRAWINGS
Various objects, features ~nd many of the atten-
dant advantages of the invention will be better understood
upon a reading of the following detailed description when
considered in connection with the acoompanying drawings
wherein:
Figure l schematically illustrates the structure
of plasmid pVC85L showing the presence of a T7 promoter,
and OmpA signal sequence and domains II (translocation
domain) and III (ADP ribosylation domain) o Pseudomonas
exotoxin.
Figure 2A shows the results of SDS-PAGE analysis
of I,ysPE40 pools at various stages of purification. 12.5%
gels were stained with Coomassie blue. Lane 1, QMA
concentrated culture medium proteins; ~ane 2, Q Sepharose
pool; Lane 3, Flow throug~ material frsm Mono S; ~ane 4,
Mono S pool; L~ne 5,-TSK 250 pool. The positions of
molecular weight standards are indicated. ~B: SDS-PAGE
analysis of anti-TFR-LysPE40. S~ples were applied on a
10% reducing polyacrylamide gel. Lane 1, TFR-LysPE40;
Lane 2, LysPE40; Lane 3, anti-TFR. Gels were stained with
Coomassie blue.
Figure 3A demonstrates the inhibition of protein
synthesis in A431 cells by anti-TFR LysPE40. Immunotoxin
was added to the cells in the absence (*) and presence (o~
.... .
.
WO91/0996~ PCT/US90/074~
of excess anti-TFR (tp ~g/ml) for 18-24 hrs at 374C. B:
Cytotoxic activity of anti-Tac-LysPE40 on HUT102 cells.
Anti-Tac-LysPE40 was added at various concentrations to
the indicated cell lines. For competition experiment 70
~g/ml anti-Tac was added before '-he addition of the
immunotoxin. 3H leucine incorporation was measured as
described in the text.
Figure 4 shows the blood levels of anti-TFR-
LysPE40. BALB/C mice or nude mice with A431 tumors were
injected I.P. with 100 ~g or 50 ~g of anti-TFR-LysPE40.
Immunotoxin levels were measured in serum at different
time periods. Results are average of two different
experiments.
Figure 5 shows the effect of anti-TFR-LysPE40 on
the growth of A431 tumors in nude mice. Mice were inject-
ed with 3 x 106 A431 cells and treatad with the
immunotoxin as indicated. Mice were given four doses of
S0 ~g each on the indicated days: ~) days 2, 4, 6, 8,
(A ) days 9, 11, 13 and 15; (~) no treatment. ~-B. Mice
gi~en four doses on days 5, 7, 9 and 11; (~) no treatment;
(~) 5~g; (o); 20 ~g; (- ), 50 ~g; (~), single dose of 150
~g on day 5.
Figure 6 shows the gross appearance of subcutane-
ous A431 tumors in nude mice with and without treatment
with HB21-PE40.
Nude mice were injected su~cutaneously with 3 x
1 o6 A431 cells on day 0. Without ~urther treatment, the
tumors were apparent as small bumps under the skin on day
(A; arrow~). ` By day 15, tumors were large, often
erupting through the skin surface (B). Mice treated with
HB21-PE40 on days 2, 4, 6 and 8 usually showed no develop-
ment of tumor, demonstrated here as the absence of gross
tumor on day 26 (C). When mice with large tumors were
treated with HB21-PE40 (on days 9, 11, 13 and 15), the
tumors often began to shrink, collapsing inward on their
necrotic centers (D arrows)~
Figure 7 shows the histological appearance of
typical treated and control A431 subcutaneous tumors.
:
-:
. .
. ., . ' .
w~l/09965 2 0 7 1 9 ~ 6 PCT/U~90/0746~
-- 3 --
A431 tumors were removed at necropsy, fixed on
formaldehyde and processed for routine paraffin embedding
and sectioning, and staining with hema~oxylin and eosin.
A section from a tumor removed from a mouse at day 15 is
shown in A-4. A similar section of a tumor removed from a
mouse on day 19 that had been treated on days 9, 11, 13
and 15 with anti~TFR-LysPE40 is shown in B-B. The cross-
section shown in A shows that the majority of the untreat-
ed tumor contains viable tumor cells (VT) with only small
areas of necrosis (arrow). In contrast, the tumor from a
treated mouse ( B) shows ~hat a large percentage of the
tumor is necrotic (NT), with only a small rim of viable
tumor (VT) remaining (s=skin). (~, A") and (B'B") are
higher magnification fields from the margins of tumors
demonstrating that the untreated tumor is mostly composed
of homogeneous viable tumors (VT), whereas the treated
tumor shows a rim of viable cells of varia~le thickness
lying ad~acent to a connective tissue c~psula (ct). The
majority of the treated tumor shows large areas of central
necrosis, and in some areas of the tumor margin all tumor
cells are nec~otic, whereas in other areas a viable tumor
rim only a few cells thicX remains (B", double arrow).
(~ags: A,B = 5, bar - 1 mm; A', B' = x26, bar = 200 ~m;
A", B" = x260; bar = ~m).
DETAILED DESCRIPTION OF THE INVh'NTION
The above and various other objects and advantages
of the present invention are achieved by an improved
Pseudomonas exotoxin (PE) of the type including a deletion
in the receptor ~inding domain Ia of the native toxin,
wherein the improvement comprises a recombinant PE mole-
cule possessing at least one lysine residue in domain Ia
of the PE molecule, which otherwise will be devoid of a
lysine residue when having a deletion in the receptor
` binding dom~in Ia, said lysine residue providing an
essential linkage for effective coupling of the recombi-
nant PE to other molecules, such as antibodies and the
like.
- : : ' ,: ,
WO91/0996~ ~ PCr/US90/074
-- 4 --
When PE is chemically attached to a~tibodies or
other targeting molecules, lysine residues are required
for coupling PE to other molecules. Since all 12 lysin~
residues of domain I are lost when domain I is deleted
from PE, one of the three lysine residues in the other
part of the molecule (for instance, domain III), must be
used to couple PE40 to an antibody or another targeting
molecule. However, when one of these three lysine resi-
dues are used, a conjugate with low activity is obtained
(Kondo et al, J. Biol. Chem. 263:9470, 1988). In order to
overcome this problem and to obtain a conjugate with high
activity, a new PE molecule was created by deleting most
of domain I (residues 6-252) bu~ maintaining one of the 12
lysine residues originally present in domain I. This new
15 molecule, in accordance with the present invention, is
designated herein as LysPE40.
In order to demonstrate the effect of the new
molecule on immunotoxin cons~ructs, two novel immunotoxins
were made, first with LysPE40 conjugated to antiTac
antibody and second conjugated to an antibody specific for
the human transferrin receptor ~anti-TFR).
Unless defined otherwise, all technical and
scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art to
which this invention belongs. Although any methods and
materials similar or equivalen~ to those described herein
can be used in the practice or ~esting of the present
invention, the preferred methods and materials are now
described. All publications mentioned hereunder are
incorporated herein by reference. Unless mentioned
otherwise, the techniques employed herein are standard
methodologies well known to one of ordinary skill in the
art. The materials, methods and examples are only illus-
trative and not limiting.
The term "antibody" as used herein means a portion
of an immunoglobulin molecule ~see W.E. Paul, ed., ~Funda-
mental Immunolosy," Raven Press, N.Y., 1984, pp. 131-165)
aapable of binding to an antigen. According to this
WO9l/09965 2 o ~ ~ 9 4 6 PCT/~90/07~64
-- 5 --
definition, the term "antibody" includes various f orms of
modified or altered antibodies, such as an intact immuno-
globulin, an Fv fragment containing only the light and
heavy chain variable regions, an Fab or (Fab) 12 fragment
containing th~ variable regions and parts of the constant
regions, a single-chain antibody (Bird et al., lg88,
Scisnce 242, 424-426; Huston et al., 1988, Proc. Natl.
Acad. Sci. USA 85, 5879-5883), and the like. The antibody
may be of animal (especially mouse or rat) or human origin
or may be chimeric (Morrison et al., 1984, Proc._ Nat.
Acad. Sci. USA 81, 6851-6855) or humanized (Jones et al.,
1986, Nature 321, 522-525, and published UK patent appli-
cation #8707252). Methods of producing antibodies suit-
able for use in the present invention are well known to
those skilled in the art and can be found described in
such publications as Harlow & Lane, Antibodies: A Labora-
tory Manual, Cold Spring Harbor Laboratory, 1988. The
genes encoding the antibody chains may be cloned in cD~A
or in genomic form by any cloning procedure known to those
skilled in khe art. See for example Maniatis et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory, 1982.
The term "without significant cytotoxici~y" as
used herein means that the fusion protein of the present
invention does not affect the normal functions of the
untargeted cells to any appreciable degree or to any
abnormal level.
The recombinant antibody-LysPE40 ~usion protein
may contain one polypeptide chain or two chains. The
example disclosed herein relates to the one chain case.
To produce two chains, no amino acid linker would be
inserted be~ween the VB and VL sequences. Instead a
termination codon would be inserted after the V~ sequence,
and an initiation codon and ribosome binding sequence
would be inserted before the VL sequence. In another
embodiment of the invention, the VL and V8 sequences will
be followed respectively by part or all of the light and
heavy chain constant regions, e.g., the whole kappa light
,, :,~: . : .......................... .
. .
, .
W09l/09965 PCT/U59~/074~
~ ~ 9 ~L6 6 --
chain constant region and the CH1 domain of the heavy
chain constant region, with or without the heavy chain
hinge domain. The VL, V~ and PE40 genes may occur in any
order on the plasmid, hence the PE40 gene may be attached
to either the 5' or 3' end of either the light or heavy
chain gene. Those skilled in the art will realize that
additional modifications, deletions~ inser~ions and the
like may be made to the antibody and LysPE40 genes.
Especially, deletions or changes may be made in LysPE40 or
in the linker connecting the antibody gene to LysPE40, in
order to increase cytotoxicity of the fusion protein
toward target cells or to decrease cytotoxicity toward
- cells without antigen for the antibody. All such con-
structions may be made by methods of genetic engineering
well known to those skilled in the art (see, generally,
Maniatis et al., su~ra) and may produce proteins that have
differing properties of affinity, specificity, stability
and toxicity that make them particularly suitable for
various clinical or biological applications.
2 0 ~TERIALS AND METHODS
~he following example is offered by way of illus-
tration, not limitation.
Construction of a vector that encodes LysPE40 and secretes
it into the medium.
Plasmid pVC4 (derived from p~H4 by trea~in~ pJH4
with SphI and Tthllll and relegating the large fragment
containing ~he PE gene) was joined ~o an OmpA signal
sequence as described by Chaudhary et al., PNAS 85, 2929-
2943, 1988, to produce pVC45. Site directed mutagenesis
is a con~enient way to make deletions and it-was used to
create plasmid pJY85L which produces LYSPE4 0 as shown in
Figure 1. A HindIII/SalI fragment of the PE gene in pVC45
was cloned into M13, mpl9 and uracil containing single
stxanded DNA prepared by the method of Kunkel (kunkel,
T.A., PNAS 82, 488-492, 1985). An oligonucleotide 36
nucleotides in length with the structure 5'CCAGGCTGCCGC-
CCTTGAAAGCTTGGCGTAATCATG3' was synthesized which generated
a large deletion in PE of amino acids 6 through 252 and
wosl/o9965 ~CT/US90/0746q
7 2~7~946
retained a lysine residue between amino acids 5 and 253 to
give a molecule ~ith the sequence:
1 2 3 4 5 x 253 254 255 256
Ala-Glu-Glu Ala-Phe-Lys-Gly~Gly-Ser-L~u
A 176 bp HindIIX/SalI fragment was excised from
the replicati~e form of the mutant DNA in M13 and ligated
with a 3.3 kb HindIII/SalI fragment of pVC45 to give
pJY85L which encodes a protein with the following struc-
ture:
Me~-Lys-Lys-Thr-Ala-Ile-Ala-Ile-Ala-Yal-Ala-Leu-Ala-Gly-
Phe
Ala-Thr-Val-Ala-Gln-Ala-Ala-Asn-Leu-Glu-Glu-Ala-Phe-Lys
Gly-Gly-Ser ....
This protein is processed at the (l) and the proressed
product secreted into the medium. When the plasmid was
expressed in E. coli BL21 (ADE3 ) cells, LysPE40 was found
in and purified from the medium wi~h a yield of greater
than 1 mg per liter. The se~uence of amino acids at its
amino terminus was found to be that predicted from the DNA
sequence:
1 2 3 4 ~ 253 254 255
H2N Ala-Asn-Leu-~la-Glu-Glu-Ala-Phe-Lys-Gly-Gly-Ser
(the numbers indica~e ~he location of the amino acids in
the native PE structure).
A deposit o~ plasmid pJY85L has been made at the
American Type Culture Collection (ATCC), 12301 Parklawn
Drive, Rockville, Maryland 20852, U.S.A., on December 18,
1989 under the accession number 68189. The deposit shall
be viably maintained, replacing it if it becomes non-
viable, for the life of the patent, for a period of 30
years from the date of the deposit, or for 5 years from
the last date of request for a sample of the deposit,
whichever is longer, and made available to the public upon
issuance of a patent from this application, without re-
striction, in accordance with the provisions of the law.
The Commissioner of Patents and Trademarks, upon request,
shall have access to the deposit.
WO 91/~)9g65 Pcr/uS9O/07464
-- 8
Ex~ression of LysPE40
BL21 ( DE3) cells were transformed with plasmid
pVC85L and grown in LB medium containing 100 ~g/ml ampi-
cillin at 37C. At absorbance 0.6 (650 nm), isopropyl-1-
- 5 thio-~-D-galactopyranoside was added ~:o a final concentra-
tion of 1 mM. Cells were harvested 90 min later. The
culture medium was used as the source of LysPE40 because
most of the protein was secreted into the medium.
Purification of LysPE40
Clarified culture medium, 25 liters, containing
LysPE40 was diluted four-fold with chilled deionized water
and applied on a 10 x 5.5 cm silica-based anion exchange
column (QMA, Waters) at a flow rate of 100 ml/min. The
column was washed with 0.05 M sodium phosphate buffer,
pH7.0, and proteins were eluted with two liters of 0.25 M
NaCl in the equilibration buffer. LysPE40 from the QMA
column was concentrated further by using Amicon YM30
membranes to 150 ml, dialyzed for 12-16 hours against 0.02
M Tris-HCl, pH7.6, centrifuged at 10,000 x g for 20
minutes and applied on a 2.5 x 14 cm Q-Sepharose column
equilibrated with 0.02 M Tris-HCl, pH 7.6. Proteins were
eluted with a 500 ml linear gradient of 0-0.5 M NaC1;
LysPE40-containing fractions were detected by SDS PAGE,
pooled, diluted 10-~old with 0.02 M Mes, pH 5.5, and
loaded onto an ~PLC Mono S 16/10 colu~n equilibrated with
O.02 M Mes, pH 5.5. LysPE40 bound to the column and was
eluted by a 100 ml linear gradient of 0-0.5 M NaC1. It
was further purified on TSX250 (22.5 x 600 mM) column
(BioRad) using 0.2 M sodium phosphate buffer pH 7.0
containing 1 mM ED~A.
Construction of immunoconiuqates
LysPE40 (2.5 mg/ml) in 0.2 M sodium phosphate
buffer pH 7.0 containing 1 mM EDTA was mixed with a 3-fold
molar excess of SMCC and incubated at room temperature
3S (about 22-24C) for 30 minutes. Protein was separated
from the unreacted cross linker on a PD10 column. MoAb
(~B21 or ~Tac) (5-10 mg/ml) was mixed with a 3-fold molar
excess of 2-iminothiolane-HCl in 0.2 M sodium phosphate
WO91/09965 PCT/US90/074~4
2~71~6
g
buffer pH 8.0 containing 1 mM EDTA and incubated at 37C
for 1 hr. The deri~atized antibody was separa~ed from the
reactants on a PD10 column. To make immunotoxins,
deri~atized LysPE40 and derivatized antibody were mixed in
4:1 molar ratio and incubated at room tempera~ure for 16-
hrs. Immunotoxin was then purified by successive
chromatography on a mono Q and TSK 253 columns.
In order to determine the efficacy, two different
immunotoxins were prepared and used. One is anti-TFR-
LysPE40, which binds to human transferrin receptor (TFR),and the other is anti-Tac-LysPE40, which binds to 55 kD a
subunit of human IL2 receptor.
SDS-PAGE and immunoblottinq
SDS-PAGE described by (Reference).
Protein synthesis inhibition assay
Activities of the conjugates were tested on A431,
KB, HUT102, HT29, OVCAR2, OVCAR3~ OVCAR4, CEM and ~O~T4
cells by measuring 3H-leucine incorporation (Kondo et al.,
Biol. Chem. 263, 9470, 1988). HUT102 cells were washed
two times with RPM1640 and used immediately. Immunotoxins
were diluted with 0.2% human serum albumin in PBS prior to
addition to cells.
Assav of blood levels of anti-TFR-LysPE40 in Mice
BALB/C mice or nude mice bearing A431 su~cutaneous
tumors were injected with 100 ~g or 50 ~g of immunotoxin
I.P. Blood was drawn at different time points and the
level of the IT was assayed by incubating serum with A431
cells and measuring its effect on protein synthesis. A
standard curve was made using anti TFR-LysPE4~.
An,t~tumor activity of anti-TFR-LvsPE40 in nude mice
bearinq a human e~idermoid carcinoma
~ 431 cells ( c x 106) were injected subcu~aneously
on day O into nude mice: this injection produced detect-
able tumors in all mice by day fi~e. Treatment of mice
was started either 2 days, 5 days or 9 days after tumor
implantation. Each treatment group consisted of 4-6
animals. Tumors were measured using a caliper every
fourth day and the volume of the tumor was calculated
.
.
WO91/099~5 PCT/US90/07464
9~ lo
using the formula: tumor volume in mm3 = length x (width)2
x O.4. Tests with anti-Tac-LysPE40 were per~ormed simi-
larly.
As mentioned before, the amino end of PE40 was
s altered so that it contained a lysine residue and an OmpA
signal se~uence. (The OmpA signal sequence was added
primarily to direct the export of LysPE40 to the growth
medium.) The structure of LysPE40 and the plasmid encod-
ing LysPE40 which is under the control of a T7 promoter is
shown in Figure 1. Similar to PE40, LysPE40 was also
secreted in the culture medium in large amounts. The
purity of the protein at each purification step is shown
in Figure 2. Material from the TSK 250 column, which was
used as the final step, was found to be homogeneous when
analyzed by SDS PAGE (Fig. 2, lane 5) as well as by
immunoblotting with an antibody to PE (data not shown).
Typically, 2 mg of pure LysPE40 was obtained from one
liter of culture.
The N-terminal sequence of the purified protein
(LysPE40) was found to be Ala-Asn-heu-~la-Glu-Ala-Phe-Ly~-
Gly-Gly-Ser-Leu. The purified protein had the exact
sequence expected from the DNA sequence and processing
occurred within the OmpA sequence (Figure 1). In con-
trast, the N-terminal sequence of PE40 is Ala-Asn-Leu-Ala-
Glu-Glu-Gly-Gly.
Construction of immunotoxins with LysPE40
LysPE40 was chemically coupled to two different
monoclonal antibodies, HB21 which binds to the human
transferrin receptor (anti-TFR) (Haynes et ~l, J. mmunol
127:347, 1981) and anti-Tac which binds to the 5~ kDa
subunit of human interleukin 2 receptor (Uchiyama et al,
J. Immuno., 126:1393, 1981). After the conjugation, ~he
immunotoxins (ITs) were puri~ied on MonoQ and TSK 250
col~mns. Purified conjugates contain LysPE40 coupled ~o
hoth the light and hea~y chain and do not contain any free
LysPE40 (Figure 3). For comparison, immunotoxin~ were
also made with native PE.
,
.
. . , ,~ . .
WO9~/0~96~ PCT/VS901074~
2~7~ 946
Activity of immunotoxins made with LvsPE40
The activity of anti-TFR-LysPE40 was assayed on a
variety of human cell lines and it inhibited protein
synthesis in all the human cell lines studied (Table I ) .
Anti-~FR-LysPE40 was most active on A431 cells with an ID50
of 4.0 ng/ml. Specificity was demonstrated by showing
that excess unconjugated antibody prevented the cytotoxic
effect of anti-~FR-LysPE40 (Fig. 3A). Anti-TFR-LysPE40
was not cytotoxic to murine Swiss 3T3 cells even at 2
~g/ml (data not shown).
The cytotoxic activity of anti-Tac-LysPE40 was
determined on HUT102 cells, a human T cell leukemia line
containing IL2 receptors. As shown in Figure 5, anti-Tac-
hysPE~0 inhibited protein synthesis in HUT102 cells with
an ID50 of 2.5 ng/ml and excess anti-Tac blocked ~his
effect demonstrating the specificity of the immunotoxin
(Fig. 3B). Anti-Tac-LysPE40 did not inhibit protein
synthesis on IL2 receptor negative cells, even at 2000
ng/ml, ~urther showing the specificity of the IT.
. 20 BloQd levels of anti-~FR-LysP~40 in mice
Balb~C mice were injected I.P. with a single dose
of 100 ~g of anti-TRF-LysPE40 and blood was drawn at
different times after the injection to assay for immuno-
toxin activity. As shown in Fig. 4, a peak blood level of
78 ~g/ml was obtained 4 hrs after the injection and a
le~el of 10 ~g/ml was still present 24 hrs after the
injection. A similar experiment was performed in arthymic
mice bearing A431 tumors. After injecting 50 ~g of anti-
TFR-LysPE40, a blood level of 27 ~g/ml was detected 4 hrs
after injection and 8 ~g/ml after 24 hrs (Fig. 4).
Effect of anti-TFR~LysPE40 on A431 tumors in mice
Anti-TF~-LysPE40 was assayed fvr its ability to
inhibit the growth of A431 cells as subcutaneous xeno-
graf~s in nude mice. To produce tumors, 3 x 106 A431
cells were injected subcutaneously on day 0. In the
control group treated only with diluent, the tumors grew
very rapidly and the anLmals were sacrificed on day 19
with very large tumors that were penetrating the skin
, ~
. .
., ~ , .
.
, . . ~, .
WO 91/Og965 PCr/~S90/074~4
'~L9 ~6
-- 12 --
( Fig . 5, 6 ) . In a group that received anti-TFR-LysPE40 on
days 2, 4, 6, 8, no tumors were evident on day 24 whan the
experiment was terminated ~ Fiy . 5A and 6 ) . In another
group of animals, treatment was delayed until the tumors
were about 125 mm3 in volume and gi~en on days 9, 11, 13
and 15. As soon as the treatment was initiated, the
tumors stopped increasing in size (Figure 5A and 6) and
then developed soft centers. His~ological examination
showed that almost all of the cells in the center of ~he
tumor were nonviable (Figure 7). However, at the rim of
the tumor many via~le cells were observed.
To determine if the antitumor effect was dose
related, treatment with various amoun~s of anti-TFR-
LysPE40 was begun on day 5 when small tumors were evident
(Figure 5B). Even the 5 ~g dose produced a delay in tumor
growth but after the treatment was stopped on day 11, the
tumors began to grow rapidly. As the dose was increased,
(20 or 50 ~g), some or all of the tumors became undetect-
able by day 11, but with time began to reappear and grow.
One group of animals received a single dose on day 5 of
150 ~g, which is close to the ID50. Two animals died, but
in the other three animals the tumor regressed and did not
reappear. When antibody alone or an immunotoxin composed
of a~ antibody that did not react with the tumor (MOPC-
LysPE40) was administered at 50 ~g doses, no antitumorresponse was observed.
In summary, the results indicate that LysPE40 can
be efficiently coupled to antibodies yielding an immuno-
toxin with high cytotoxic activity against cultured cell
lines bearing the appropriate antigen, and no detectable
cytotoxicity against cultured cells to which the antibody
does not bind. Furthermore, an immunotoxin composed of an
antibody to the human transferrin coupled to LysPE40
(anti-TFR-LysPE40~ could be administered safely in large
amounts to mice and caused regression of a rapidly growing
human epidermoid carcinoma implanted subcutaneously.
Nhen administered intraperi~oneally in mice, anti-
TFR-LysPE40 appeared rapidly in the blood. A dose of 50
.
Wogl/09965 PCT/US90/07~64
7194~
~g gave a peak blood level 4 hrs post injection of about
30 ~g/ml, and blood levels were still 8 ~g/ml at 24 hrs
( Fig . 3) indicating that this immunotoxin has a relatively
long half-life. A single dose of 100 ~g gave a peak blood
level of 80 ~g/ml. since a 10 g mouse has a blood volume
of about 1 ml, almost all the immunotoxin is found in the
blood four hours after intraperitoneal administration.
In the treatment protocols described herein, the
tumor cells were allowed to grow to form a detectable
solid tumor before treatment was initiated. Under these
conditions, a treatment consisting of four injections
given over eight days caused obvious tumor regression
(Figs. 5-8). At the lower dose levels with small tumors,
or even at the high dose level with large tumors, viable
tumor cells remained. By continuing the treatment for
lonyer periods, a larger antitumor effect could most
likely be achieved. Nevertheless, the protocol caused
marked regression of a solid tumor resistant to standard
chemotherapy, thereby indicating that hysPE40 when at-
tached to target-specific antibodies acts as a potent
immunotoxin.
A therapeutic composition in accordan~e with the
present invention comprises an effective amount of the
LysPE40-coupled to a target-specific ligand to kill target
cells, and a pharmaceutically acceptable carrier, the
target cells being those that are desired to be selective-
ly killed and carry a binding site to which said ligand
speciflcally binds.
Of course, ligands other than antibodies, such as
receptors, growth factors and molecules which selectively
recognize target cells are coupled to the LysPE40 follow-
ing the methodology similar to that described herein to
obtain target-specific cytotoxic entities.
It is understood that the embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggest-
ed to persons skilled in the art and are to be included
.
, . . -;
.,
wo91/09g6~ 9~6 PCr~US9~/07464
-- 14 --
within the spirit and pur~iew of this application and
scope of the appended claims.
TABLE I
ACTIVITY OF ANTI -TFR-LYSPE4 0 ON ~ARIOUS HU~N CELL LINES
CELLS ;E~soa ( ng!m~
anti-TFR-L~sPE40 L~sPE40
A431 4 . 0 >2000
KB 14 . 0 >2000
Hl!296 . 6 >2000
HUT10221. 0 >2000
CEM 22 . 5 ~2000
OVCAR2135.0 ND
OVCAR3280.O ND
OVCAR430.O ND
MOLT4 32.0 ND
aID50 is described as concentration of the immunotoxin
needed for 50% inhibition of protein synthesis.
N.D. - ~ot done.
TABLE II
INCIDENCE OF TUMOR IN NUDE NICE TREATED WITH
ANTI-TFR-LYSPE40
Athymic mice were injected subcutaneously with 3 x
106 A431 cells. On days 5, 7, 9 and 11, the animals were
injected I.P. with anti-TFR-LysPE40 at the indicated dose.
Number of animals with tumors/total animals is shown on
different days after tumor transplantation.
Treatment _ _DAYS POST TUMOR IMPhANTATION _
11 15 19 24 29 35
None 5/5 5/5 5/5 - - ~
5 ~g 5/6 6/6 6/6 6/6 6/6
20 ~ 1/5 1/5 3/5 3/5 3/5 4/5
50 ~ 0/5 0/5 lJ5 1/5 1/5 2/5
lS0 uq~ 0/3_ 0/3 0/3 _ 0/3 0/3 0/3
~Single dose on day 5
. ~
