Note: Descriptions are shown in the official language in which they were submitted.
WO 91 /t 5~;93 PCr/US91/02060
2078131
POLYPEYlLL~ES USEEIJL IN DIAGNOSIS OF AND TREAl~IENT
AGAINST MYCOPLASMA INFEC~IONS IN ANIMAL`S.
Backcround of the Invention
This application is a continuation-in-part of U.S.
Serial No. 07/196,891, filed May 18, 1988, which is a
continuation of U.S. Serial No. 06/889,153, filed July 25,
1986, now abandoned.
The present invention relates to a class of
polypeptides useful in diagnostic assays to determine the
presence of antibodies to Mvco~lasma organisms in mammals,
particularly in pigs or hogs. The invention also relates to
recombinant-DNA methods for the manufacture of these
polypeptides and recombinant phage clones containing DNA
sequences suitable for use in the recombinant methods. The
invention also relates to vaccination compo~itions and
methods of vaccination to inhibit Myco~lasma infections in
animals.
Enzootic pneumonia of pigs, also known as virus
pneumonia, infectious pneumonia, ant~rior lobe pneumonia,
enzootic virus pneumonia and mycopl~smal pneumonia of swine,
rarely causes death, but often results in severe morbidity
and reduced performance in weight gain of swine. Originally
believed to be caused by a virus, it was determined in 1965
that the causative agent was M~oplasma h~o~neumoniae, also
known as N~co~lasma 3uioneumoniae.
STI`rUTE SHEEl
WO91/15593 PCT/US91/02060
2~8131
--2--
The disease is transmitted from pig to pig through
the nasal passages by airborne organisms expelled from
infected pigs. The Mvco~la~ma establish themselves deep in
the apical and cardiac lobes of the lungs where they cause
visible plum colored or gray lesions and cause difficulty in
breathing and reduced weight gain. The primary infectfon by
M. hvo~neumoniae may be followed by secondary infection by
other mycoplasma species (M. hvorhinus and M. floculare) as
well as bacterial pathogens (Pasteurella and Bordetella
species)~
The MYcoPlasmas are prokaryotic cells smaller and
simpler in structure than bacteria, but more complex than
viruses. Unlike viruses, they are capable of a free living
existence, though they are often found in association with
eukaryotic cells. They are bounded by a cell membrane but
not by a cell wall. They have an extremely small genome,
approximately 750,000 base pairs in length.
While this disease is not often fatal, it causes
decreased growth and weight gain in the affected animals at a
time when the animals are being fed for market. Thus,
animals which have been infected with this organism will be
worth less at slaughter than will their non-infected
counterparts.
Due to the serious economic consequences of pig
pneumonia, dia~nostic testing methods have been sought which
will indicate the presence of an infection caused by
Mvco~lasma h~o~neumoniae in swine. The present inventors
have discovered a class of polypeptides useful in the
diagnosis of this and certain other Mvco~lasma infections.
These polypeptides, when used in in vitro diagnostic assays,
indicate the presence of antibodies against certain
MYcoDlasma organisms in infected pig and hog sera.
SUeSTlTUTE S~EEl ~
wog1/1sss3 PCT/US91/02060
20781 31
To facilitate use of these polypeptides, the present
invention also relates to recombinant-DNA methods for
manufacturing the polypeptides. These recombinant-DNA
methods utilize DNA sequences contained in various
recombinant phage clones which are described herein.
Another object of the present invention is to provide
a vaccine composition and a method of vaccination effective
for pre~enting certain Mvco~lasma infections in animals.
pisclosure of the Invention
It is an object of the present invention to provide
polypeptides useful in the diagnosis of certain Mycoplasma
infections particularly Mvco~lasma h~oPneumoniae infections
in swine. It is also an object of the present invention to
identify recombinant-DNA methods for the manufacture of these
polypeptides.
Additional objects and advantages of the present
invention will be set forth in part in the description which
follows, or may be learned from the practice of the
invention. The ob~ects and advantages may be realized and
attained by means of the instrumentalities and combinations
particularly pointed out in the appended claims.
To achieve the ob~ects according to certain preferred
embodiments and in accordance with the purposes of the
present invention, Proteins A, B, C, D, and E have been
disclosed. The DNA corresponding to portions of these
proteins is contained on various lambda phages which also are
identified herein. Noreover, the entire gene for Protein C
has been provided herein.
In addition, a recombinant-DNA method for the
manufacture of polypeptides analogous to MYco~lasma surface
proteins is disclosed. These proteins are capable of
~~rea~Lny ar. ~-lu~ur.od.aynoâ.ic cGl..plax whar. exposed t3 sara
from swine infected with M~co~lasma h~o~neumoniae and certain
other mycoplasma organisms. This method comprises:
SUBSTITUTE SHEEl
WOgl/15593 PCT/US91/02060
--4--
(a) Preparation of a DNA sequence coding for a
polypeptide possessing antigenic properties analogous to
those possessed by a polypeptide produced by MYCOP1aSma
organisms;
(b) Cloning the DNA sequence into a vector capable
of being transferred into and replicating in a host organism,
such vector containing operations elements for the DNA
sequence;
(c) Transferring the vector containing the DNA
sequence and operational elements into a host microorganism
capable of expressing the antigenic polypeptide;
(d) Culturing the host microorganism under
conditions appropriate for amplification of the vector and
expression of the polypeptide; and
(e) In either order:
(i) harvesting the polypeptides; and
' (ii) causing the polypeptide to assume a
str~cture
whereby it possesses antigenic properties
analogous to properties possessed by
polypeptides produced by M~coPlasma
-; organisms.
' It is understood that the foregoing general
description and the following detailed description are
exemplary and explanatory only and are not restrictive of the
invention as claimed.
Brief Descri~tion,of the Drawin~s
FIGURE 1 depicts the entire DNA sequence and
translated amino acid sequence of the MYcoPlasma
hvo~neumoniae genomic DNA insert in the phage ~gtll clone
R69. The DNA sequence (upper line) is divided into three
base codon~ which align with the proper readins frame of ~,he
gene. The amino acid sequence (lower line) is the
translation of the DNA codon directly above, written in the
single letter amino acid code as described herein.
SUBSTITUTE SHEEl
WOgl/15593 PCT/US91/02060
2o7~l3l
--5--
FIGURE 2 depicts the MYco~lasma hyo~neumoniae DNA
sequence from the recombinant plasmid clone pUC18::28C2 which
contains the entire gene for Protein C. A total of 4547 base
pairs were sequenced. Approximately 1700 base pairs of DNA
downstream were not sequenced. The Protein C gene starts at
nucleotide 1801 and ends at nucleotide 3672 of the insert.
FIGURE 3 depicts the amino acid sequences of peptides
derived from endoproteinase digested purified Protein C and
the positions of these sequences in the amino acid sequence
of the intact protein. The sequences are written in the
single letter amino acid code as described herein.
FIGURE 4 depicts the entire DNA sequence and amino
acid sequence of the Protein C gene. The DNA sequence (upper
line) was directly determined (see Example-VIII-B) and the
amino acid sequence (lower line) was detexmined by
translation of the DNA sequence above. The underlined
segments of the amino acid sequence denote the parts of the
sequence for which there is direct amino acid sequencing data
(see Example VIII-C and D and Figure 3). The three UGA
codons (TGA in the DNA sequence) are enclosed in boxes. The
position of the ~gtll clone R69 insert (starting at
nucleotide 455 and ending at nucleotide 976) is delineated by
marks above the DNA sequence. The amino acid sequence is
written in the single letter amino acid code as described
herein.
FIGURE 5 depicts the modi~ications made to the 5' end
of the Protein C gene for recombinant expression of E. coli
using the plasmid vector pT5T. The initial 25 bases encode a
8amH1 restriction site for connection to the pT5T vector with
the TC3 translational coupler ending with the translational
stop TAA. Following the TC3 coupler is the restart
m..ethior.ine codor. ATC-, f ol l ~wsd b,~ the Protein C ger.Q. Both
the original and modified DNA sequences are shown with the
unchanged nucleotides depicted in lower case letters and the
modified nucleotides depicted in capital letters in the
SUBSTITUTE SHEEl
W091/1~593 PCT/US91tO2060
~ v~ -6-
modified sequence. The translation of these sequences
(unchanged between the original and modified sequences) is
shown in bold below the DNA sequences. The shaded boxes
indicate restriction endonuclease recognition sites in the
sequences, with the name of the restriction endonuclease
noted above or below the box.
FIGURE 6 depicts the DNA sequence and the translated
amino acid sequence of the insert in the expression plasmid
pT5T::M852 which produces the recombinant full length Protein
C. Translation starts at the ATG restart at position l which
is preceded by the TC3 coupler (See Figure 5). Translation
of the sequence proceeds to the natural stop codon TAA at
nucleotide 1876. The three UGA codons (T~A in the DNA
sequence) in the Protein C gene have been changed to UGG
(TGG) in this clone to permit expression in E. coli. These
TGG's are denoted by boxes in the sequence. The numbering
system is offset by three nucleotides from Figure 4 because
of the addition of the start codon ATG to the 3'-end.
FIGURE 7 depicts the DNA sequence and the translated
amino acid sequence of the insert in the expre~sion plasmid
pT5T: :M851 which produces the recombinant truncated Protein
C. Translation starts at the ATG restart at position l which
is preceded by the TC3 coupler (See Figure 5). Translation
of the Protein C sequence proceeds to the HindIII restriction
site at nucleotides 1294 to l299 where the insert is joined
to the pT5T vector which encodes three more amino acids
(glycine, threonine and aspartic acid) before a translational
stop codon. This insert encompasses only the first two of
the three UGA codons in the gene for Protein C (TGA in the
DNA sequence) and these have been changed to UGG (TGG) in
this clone to permit expression in E. coli. These TGG~s are
denoted by Doxes in the sequence. Tne numDering system is
offset by three nucleotides from Figure 4 because of the
addition of the start codon ATG to the 3'-end.
SU~STITUTE SHEEl
WO91/15593 PCT/US91/02060
_7_ 2 07 ~l3~
FIGURE 8 is a photograph of a Coomassie Blue stained
polyacrylamide gel showing the electrophoretically separated
proteins in M. hyopneumoniae extracts Sl, 7S, and 7P (See
Ex~mple X-A).
FIGURE 9 depicts the restriction map of clone
pUCl8::28C2, the M. hYo~neumoniae genomic clone containing
the entire Protein C gene. The arrows below the main figure
depict the sequencing strategy, showing the direction and
extent of the sequencing done. Also depicted are the
positions of the sequences of clone R69, the original ~gtll
clone isolated which encodes part of Protein C, and R68,
another ~gtll clone which starts before the coding region
for Protein C and reads into the coding sequence. The
positions of the three UGA codons in Protein C coding
sequence are also shown.
FIGURE l0 depicts certain features of the bacterial
expression construct pT5T::M852 which expresses the full
length -ec^~binant Protein C. Features are repreqentative
only and not drawn to exact scale. The shaded part indicates
the M. hYo~neumoniae segment containing the Protein C gene.
Expression construct pT5T::M851, which expresses the
truncated Protein C, is essentially the same except that it
lacks the ~2 kb HindIII fragment.
Best Mode for CarrYinq Out,the Invention
Reference will now be made in detail to the presently
pre-ferred embodiments of the invention, which, together with
the drawings and the following examples, serve to explain the
principles of the invention. All reference~ discussed in
this specification are hereby incorporated in their entirety
by reference. The three letter and one letter designations
for amino acids used in this application are as follows:
SIJBSTITUTE SHEEl
WO91/1~593 PCT/US91/0206
Q ~3~ -8-
AMINO ACID THREE-LETTERONE-LETTER
ABBREVIATIONSYMBOL
-
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic acid Asp D
Cysteine Cys C
Glutamine Gln Q
Glutamic acid Glu E
Glycine Gly G
Histidine His H
Isoleucine Ile
Leucine Leu L
Lysine Lys
Methionine Met M
Phenylalanine Phe F
Proline Pxo P
Serine Ser S
Threonine Thr T
Tryptophan Trp W
Tyrosine Tyr Y
Valine Val v
Termination: - Unknown: *
As noted above, tne present invention relates to a
class of polypeptides which are useful, inter àlia, for in
vitro diagnosis of mycoplasma infection in swine. The
present invention also relates to vaccine compositions and
methodc of vaccination including the above-mentioned class of
polypeptides. These substantially purified proteins are
SUE~STITUTE SHEEl
W091/15593 pcr/~s9l/o2o6o
207~1 3~
g
analosous to various MYco~lasma hYoPneumoniae proteins which
are capable of inducing an immune response when present in
swine tissue. Because an immune response has been mounted in
infected swine against analogous antigens, the sera of such
infected swine will contain antibodies which will recognize
one or more of the polypeptides of the present invention.
Thus, the instant polypeptides may serve, eithex in
combination or individually, as the active ingredient in an
in vitro diagnostic assay to determine the presence in swine
sera of antibodies directed toward various MYcoPlasma
species. Moreover, the instant polypeptides, either in
combination or individually, may also be used in vaccine
compositions to illicit an immune response in animals to
prevent _ co~lasma infections in the vaccinated animals.
As used herein, the term "analogous,' when used in
connection with a protein, antigen or polypeptide, is
intended to mean a polypeptide which is capable of detecting
antibodies raised in response to an infection with natural
MvcoPlasma proteins in swine. A polypeptide possessing
analogous antigenic properties will thus exhibit some
homology to the native MYco~lasma protein. It should be
noted that "analogous" polypeptides, as the term is used
herein, may raise an immune response which is stronger than,
the same as, or weaker than the response raised by natural
Mvco~l~sma proteins.
~ y "substantially homologous,l~ as used throughout the
ensuing specification and claims, is meant a degree of
homology to the protein of interest in excess of that
displayed by any previously reported, purified, substantially
homologous protein Gomposition. Preferably, the degree of
homology is in excess of 60%, and more preferably 75%, with
particularly preferred proteins being in excess of 85~ or 90~
homologous with the native protein. The degree of homology
as described above is calculated as the percentage of amino
acid residues found in the qmaller of the two sequences that
align with identical amino acid residues in the sequences
being compared when four gsps in a length of lO0 amino acids
SUBSTITUTE SHE1
WO91/15~93 PCT/US91/02060
--10--
may be introduced to assist in that alignment as set forth by
Dayhoff, M.O. in Atlas of Protein Seauences and Structure,
Vol. 5, page 124 (1972), National Biochemical Research
Foundation, Washington, D.C.
As described herein, the protein of the present
invention is either isolated from a natural source or is a
synthetic polypeptide. The term "synthetic" polypeptide is
intended to mean an amino acid sequence which has not
previously been isolated from nature in a substantially
purified form. In applying this definition, llsyntheticl'
encompasses, among others, polypeptides created by
recombinant-DNA methods or synthesized in whole or in part in
vitro. In particular, synthetic polypeptides are
contemplated in which 1 or 2 amino acids differ from those
set forth in the preferred sequences set forth below.
For the purposes of the preqent application, 'pure
forml~ or "purified form," when used to refer to the protein
of interest disclosed herein, shall mean substantially free
of other proteins which are not the protein of interest~
Preferably, the protein of the present invention is at least
50% pure, more preferably 70~ pure and even more preferably
80% or 90% pure.
The following proteins, in substantially pure form,
have been discovered by the present inventors as useful in
such in vitro diagnostics. These include: Protein A, a
105kd protein of M. hvo~neumoniae; Protein ~, a 9Okd protein
of M. hvo~neumoniae; Protein C, an 85kd protein of M.
hvoDneumoniae; Protein D, a 70kd protein of M. hvo~neumoniae;
Protein E, a 43kd protein of M.
hvo~neumoniae. It should be noted that the molecular weights
aesociated with the proteins disclosed herein are not to be
interpreted as absoiute values.
S~JBSTITUTE SHEE~
WO91/15593 PCT/~S91/02060
207~~3~
It is believed that each of the proteins A through E
is a protein present on the surface of the M~coplasma
organism. When intact Myco~lasma cells are lightly treated
with a protease (trypsin), each of these proteins exhibits
sensitivity to digestion by the protease, indicating their
exposure on the cell surface.
Moreover, it is believed that each of these proteins
contain one or more specific portions which may serve as an
antigenic determinant capable of binding to at least one
antibody present in sera of MYcoPlasma infected swine. These
specific antigenic portions, either singly or in various
combinations, would be,
therefore, capable of serving as the basis for an in vitro
diagnostic assay.
According to certain preferred embodiments, the
present inventors have also shown that at least Protein C (an
85 kd protein) and a fragment thereof are useful in vaccine
compositions to prevent M~co~lasma infection in anim~ls. It
is also believed that the other disclosed proteins and
variants thereof can also ellicit an immune response, and may
also protect animals from M~co~lasma infection. Such
proteins or fragments thereof may be used individually or in
a mixture in a vaccine composition.
DNA sequences encoding portions of these proteins are
contained on the lambda gtll clones identified herein. The
DNA ~equences coding for the entire proteins are contained in
the same lambda gtll library from which the above clones were
derived, and methods are described below that will allow the
identification and isolation of such clones.
SUeSTlTU~E SHEE~
W O 91/15593 PC~r/US91/02060
-12-
A portion of the gene encoding polypeptide A (105kd)
is contained on the lambda gtll clone R6Ob which contains an
insert of MYco~lasma DNA of 1.5 kilobases. This fragment can
be excised using the restriction endonucleases K~nl and Sacl
which cut in the flanking vector sequences but not within the
insert. The corresponding expression plasmid R60b-a has been
constructed by insertion of the ~l/Sacl insertion fragment
of the lambda gtll clone into the plasmid vector pSEV6.
A portion of the gene encoding polypeptide B (9Okd)
is contained on the lambda gtll clone LMHCl-9 which contains
an insert of MvcoPlasma DNA of 0.45 kilobases. This fragment
can be excised using the restriction endonucleases K~nl and
Sacl which cut in the flanking vector sequences but not
within the insert. The corresponding expression plasmid
LMHC1-9a has been constructed by insertion of the KPn/Sac
insertion fragment of the lambda gtll clone into the plasmid
vector pSEV6.
A portion of the gene encoding polypeptide C (85kd)
is contained on the lambda gtll clone R69 which contains an
insert of M~co~lasma DNA of 0.5 kilobases (specifically 522
bases). This fragment~ can be excised using the restriction
endonucleases R~nl and Sacl which cut in the flanking vector
sequences but not within the insert. The corresponding
expression plasmid R69b (also designated pSEV6::R69) has been
constructed by insertion of the K~nl/Sacl insertion fragment
of the lambda gtll clone into the plasmid vector pSEV6.
A portion of the gene encoding polypeptide D (7Okd)
is contained on the lambda gtll clone 86-4 which contains an
insert of Mvcoplasma DNA of 3.2 kilobases. This fragment can
be excised using the restriction endonucleases KPnl and SauI
which cut in the flanking vector sequences but not within the
insert. The corresponding expression plasmid 86-4C has been
constructed by insertion of the RPnl/SauI insertion fragment
of the lambda gtll clone into the plasmid vector pSEV6.
SUE~STITUT~: SHEEl
WO91/15593 PCT/US91/02060
~ ~ 7 ~
-13-
A portion of the gene encoding polypeptide E (43kd)
is contained on the lambda gtll clone Pl which contains an
insert of Mvco~lasma DNA of 0.5 kilobases. This fragment can
be excised using the restriction endonucleases K~nl and Sacl
which cut in the flanking vector sequences but not within the
insert. The corresponding expression plasmid Plc has been
constructed by insertion of the Kvnl/Sacl insertion fragment
of the lambda gtll clone into the plasmid vector pSEV6.
Various methods may be used to express the DNA
encoding the proteins or the proposed antigenic determinants.
In particular, it is contemplated that the DNA contained on
the lambda gtll phage clones may be expressed in mammalian
systems.
In an alternate preferred embodiment, the DNA of
interest is excised from the DNA contained on the lambda gtll
phage clone and inserted, in a suitable form, into a
microbial expression system. In this em~odiment, the
antigenic polypeptides are produced by a method comprising:
ta) preparation of a DNA sequence coding for a
polypeptide ~ossessing antigenic properties
analogous to those possessed by a polypeptide
produced by Myco~lasma organisms;
~b) cloning the DNA sequence into a vector capable
of being transferred into a~d replicating in a
host microorganism, such vector containing
operational elements for the DNA sequence;
(c) transferring the vector containing the DNA
seguence and operational elements into a host
microorganism capable of expressing the
antigenic polypeptides;
(d) culturing the host microorganism under
conditions appropriate for amplification of the
vector and expression of the polypeptide; and
(e) in either order:
SUBSTITUT SHEEl
WO91/15593 PCT/US91/02060
~3~3~
(i) harvesting the polypeptide; and
(ii) causing the polypeptide to assume a structure
~ whereby it possesses antigenic properties analo-
gous to properties possessed by polypeptides
produced by Mvco~lasma organisms.
Since M. hvo~neumoniae is a prokaryote, genomic DNA
may be used directly without concern about introns. However,
other Mvco~lasma species have been shown to utilize the
normal stop codon UGA as a tryptophan codon in protein
synthesis. As this is also true in M. hYoPneumoniae (See
Example VIII-E), expression in other systems (e.g., E. coli)
results in premature termination during protein synthesis
when this codon is read as a stop. Whether this occurs for
the proteins of interest can be determined by growing the ex-
pression vector in suitable tRNA suppressor strains. If
premature termination does occur, it will be possible to
correct the problem by DNA sequencing the area containing the
UGA codon and substituting the proper codon by site-directed
mutagenesis. The present inventors have provided procedures
to accoymplish substitution of the UGA codons to prevent
premature termination. See Example IX-A.
The DNA prepared in accordance with the above methods
is inserted into an expression vector suitable for use in the
intended expre~sion system. Embodiments of the present
invention are envisioned as employing other known or
currently undiscovered vectors which would contain one or
more of the DNA sequences encoding antigenic polypeptides
described herein. In particular, it is preferred that these
vectors have some or all of the following characteristics:
(1) possess a minimal number of hostorganism sequences; (2)
be stable in the desired host; (3) be capable of being
present in a high copy number in the desired host; (4)
possess a regulatable promoter; and (S) have at least one DNA
sequence coding a selectable trait present on a portion of
the plasmid separate from that where DNA ~equence encoding
for the antigenic polypeptide will be inserted.
SIJBSTll'UTE SHEEl
WO91/15593 PCT/US91/02060
2~7~
-15-
The following, noninclusive, list of cloning vectors
is believed to set forth vectors which can easily be altered
to meet the above-criteria and are, therefore, preferred for
use in the present invention. Such alterations are easily
performed by those of ordinary skill in the art in light of
the available literature and the teachings herein.
SUE~STITUTE SHEEl
.
W091/15593 PCT/US91/02060
3~-
-16-
TABLE I
Hosts vectors Comments
E. coli pUC8 Many selectable replicons
pUC9 have been characterized.
pBR3~2 Maniatis, T. et al. (1982)
pGW7 Molecular Clonina: A
placIq Laboratory Manual, Cold
pDP8 Spring Harbor Laboratory.
pTAC
pBR325
pUCl8
pSEV6
Ml3mpl8
Ml3mpl9
BACILLUS pUBll0 Genetics and Biotechnoloqy
B. subtilis pSA0501 of Bacilli, Ganesan and
B. am~loliauefaciens pSA2100 Hoch, eds., 1984, Academic
B. stearotheromo~hilus pBD6 Press.
pBD8
pTl27
PSEUDOMONAS RSFl0l0 Some vectors useful in
P. aeruqinosa Rms149 broad host range of gram-
P. ~utida pRT209 negative bacteria including
RR2 Xanthomonas and Aqrobacterium.
pSa727
CLOSTRIDIUN - PJUl2 Shuttle plasmids for E.
C. perfrin~ens PJU7 coli and C. ~erfrin~ens
pJUl0 construction ref. Squire~,
pJUl6 C. et al. (1984) Journal
pJUl3 Bacteriol._159:465-471.
SACCHAROMYCES YEP24 Botstein and Davis in
5. cere~i~iae YIp5 ~olecular Biolo~v of the
YRpl7 Yeast Saccharomvces,
Strathern, Jones, and
Broach, eds., 1982, Cold
Spring Harbor Laboratory.
It is to be understood that additional cloning
vectors may now exi~t or will be di~covered which have the
above-identified properties and are therefore suitable for
u~e in the present invention~ Tnese veciors aiso are
contemplated as being within ~he scope of the disclosed
series of cloning vectors into which the DNA sequences
SllR~l'ITI IT~: cu~::s-~
WO9l/15593 PCT/US91/02060
207~131
-17-
encoding the antigenic polypeptides may be introduced, along
with any necessary operational elements, and which altered
vector is then included within the scope of the present
invention and would be capable of being used in the
recombinant-DNA method set forth more fully below.
These ~operational elements,~l as discussed herein,
include but are not limited to at least one promoter, at
least one ribosome-binding sequence and at least one
transcription terminator. Preferably, these ~op~rational
elementsl also include at least one operator, at least one
leader sequence for proteins to be exported from the
intracellular space, at least one regulator and any other DNA
sequences necessary or preferred for appropriate
transcription and subsequent translation of the vector DNA.
In addition to the above list, an E coli vector
system is preferred in one embodiment as a cloning ~ector.
Moreover, several vector plasmids which autonomously
replicate in a broad range of Gram negative bacteria are
preferred for use as cloning vehicles in hosts of the genera
Pseudomonas. These are described by Tait, R.C., Close, T.J.,
Lundquist, R.C., Hagiya, M., Rodriguez, R.L., and gado, C.I.
in Biotechnoloov, May, 1983, pp. 269-275; Panopoulos, N.J.
in Genetic Enaineerin~ in the Plant Sciences, Praeger
Publishers, New York, New York, pp. 163-185, (1981); and
Sakaguchi, K. in Current To~ic in Microbiolo~v and
Immunolo~v, 96:31-45, (1982).
One particularly preferred construction employs the
plasmid RSFlOlO and derivatives thereof as described by
Bagdasarian, M., Bagdasarian, M.M., Coleman, S., and Timmis,
R.N. in Plasmids of Medical Environmental and Commercial
Im~ortance, Timmis, K.~. and Puhler, A., eds., Elsevier,
North Hoiland Biomedical Press, (i9lgj. The advantages of
RSF1010 are that it is relatively small, high copy number
plasmid which is readily transformed into and stably main-
tained in both E. coli and Pseudomona species. In this
system, it is preferred to use the Tac expre~sion system as
described for Escherichia, since it appears that the E. coli
~llRgTITIJTF ~FFl
WO9l/l5593 PCT/US91/02060
-18-
trp promoter is readily recognized by Pseudomonas RNA
polymerase as set forth by Sakaguchi, K. in Current Topics in
Microbioloqy_and Immunoloa~, 96:31-45 (1982) and Gray, G.L.,
McKeown, K.A., Jones, A.J.S., Seeburg, P.H., and Heyneker,
H.L. in Bio/TechnolocY, Feb. 1984, pp. 161-165.
Transcriptional activity may be further maximized by
requiring the exchange of the promoter with, e.g., an E. coli
or P. aeruainosa trp promoter.
In a preferred embodiment, P. aeru~inosa is
transformed with vectors directing the synthesis of the
antigenic polypeptides as either an intracellular product or
as a product coupled to leader sequences that will effect its
processing and export from the cell. In this embodiment,
these laader sequence6 are preferably selected from the group
consisting of beta-lactamase, OmpA protein, and that of
carboxyeptidase G2 from Pseudomonas. Translation may be
coupled to translation initiation for any of the E. coli
proteins as well as to initiati nn sites for any of the highly
expressed proteins of the host to cause intracellular
expression of the antigenic polypeptides.
In those cases where restriction minus strains of a
host Pseudomonas species are not available, transformation
efficiency with plasmid constructs i~olated from E. coli are
poor. Therefore, passage of the Pseudomona~ cloning vector
through an r- m+ Ytrain of another species prior to
transformation of the desired host is desired, as set forth
in Bagdasarian, M., et al., Plasmids of Medical
Env~ronmental and Commercial Im~ortançe, pp. 411-422, Timmis
and Puhler eds., Elsevier/North Holland Biomedical Press
(1979).
SUE~STITUTE SllEEl
WO91/15~93 PCT/US91/02060
20731~1
--19--
Furthermore, a preferred expression system in hosts
of the genera Bacillus involves using plasmid pU~llO as the
cloning vehicle. AR in other host vector systems, it is
possible in Bacillus to express the antigenic polypeptides of
the present invention as either an intracellular or a
secreted protein. The present embodiments include both
systems. Shuttle vectors that replicate in both Bacillus and
E. coli are available for constructing and testing various
genes as described by Dubnau, D., Gryczan, T., Contente, S.,
and Shivakumar, A.G. in Genetic Enai- neerin~, Vol. 2, Setlow
and Hollander eds., Plenum Press, New York, New York, pp.
115-131, (1980). For the expression and secretion of anti-
genic polypeptides from B. subtilis, the signal sequence of
alpha-amylase is preferably coupled to the coding region for
the antigenic polypeptide. For synthesis of intracellular
polypeptides, the portable DNA sequence will be
translationally coupled to the ribosome binding site of the
alpha-amylase leader sequence.
Transcription of either of these constructs is
preferably directed by the alpha-amylase promoter or a
derivative thereof. This derivative contains the RNA
polymerase recognition sequence of the native alpha-amylase
promoter but incorporates the lac operator region as well.
Similar hybrid promoters constructed from the penicillinase
gene promoter and the lac operator have been shown to
function in Bacillus hosts in a regulatable fashion as set
forth by Yan~ura, D.G. and Henner in Genetics and Biotechno-
loov of Bacilli, Ganesan, A.T. and Hoch, J.A., eds., Academic
~ress, pp. 249-263, (1984). The lacI gene of lacIq also
would be included to effect regulation.
SUeSTlTUTE SI~EEl
WO91/15593 PCT/US91/02060
~Q~ ~
-20-
One preferred construction for expression in
Clostridium is in plasmid pJU12 described by Squires, C. H.
et al in J. Bacteriol., 159:465-471 (1984), transformed into
C. ~erfrinaens by the method of Heefner, D. L. et al. as
described in J. Bacteriol., 159:460-464 (1984). Tran
scription is directed by the promoter of the tetracycline
resistance gene. Translation is coupled to the Shine-
Dalgarno sequences of this same tetr gene in a manner
strictly analogous to the procedures outlined above for
vectors suitable for use in other hosts.
Maintenance of foreign DNA introduced into yeast can
be effected in several ways. See, for example, Botstein, ~.,
and Davis, R. W., in The Molecular BiolooY of the Yeast
Saccharomyces, Cold Spring Harbor Laboratory, Strathern,
Jones and Broach, eds., pp. 607-636 (1982). One preferred
expression system for use with host organisms of the genus
Saccharomvces harbors the antigenic polypeptide gene on the 2
micron plasmid. The advantages of the 2 micron clrcle
include relatively high copy number and stability when
introduced into cir strains. These vector~ preferably
incorporate the replication origin and at least one
antibiotic re3istance marker from p~R322 to allow replication
and selection in E. coli. In addition, the plasmid will
preferably have 2 micron sequences and the yeast LEU2 gene to
serve the same purposes in LEU2 mutants of yeast.
` The regulatable promoter from the yeast GALl gene
will preferably be adapted to direct transcription of the
antigenic polypeptide gene. Translation of the DNA sequence
in yeast will be coupled to the leader sequence that directs
the secretion of yeast alpha-factor. This will cause
formation of a fusion protein which will be processed in
yeast and result in secretion of the desired antigenic
polypeptide. Alternatively, a methionylantigenic polypeptide
will be translated for inclusion within the cell.
SU~IS~ITUTE SHEEl
WO91/15~93 PCT/US91/02060
2 ~ 7 ,~
-21-
As will be seen from an examination of the individual
cloning vectors and systems contained in Table I and
description, various operational elements may be present in
each of the preferred vectors of the present invention. It
is contemplated any additional operational elements which may
be required may be added to these vectors using methods known
to those of ordinary skill in the art, particularly in light
of the teachings herein.
In practice, it ic possible to construct each of
these vectors in a way that allows them to be easily
isolated, assembled, and interchanged. This facilitates
assembly of numerous functional genes from combinations of
these elements and the coding region of the antigenic
polypeptide. Further, many of these elements will be
applicable in more than one host.
At least one origin of replication recognized by the
contemplated host microorganism, along with at least one
selectable marker and at least one promoter sequence capable
of initiating transcription of ine DNA encoding for the
antigenic polypeptide are contemplated as being included in
these vectors. It is additionally contemplated that the
vectors, in certain preferred embodiments, will contain DNA
sequences cap~ble of functioning as regulators ("operators"),
and other DNA sequences capable of coding for regulator
proteins. In preferred vactors of this series, the vectors
additionally contain ribosome binding sites, transcription
terminators and leader sequences.
These regulators, in one embodiment, will serve to
prevent expression of the DNA sequence encoding for the
antigenic polypeptide in the presence of certain
environmental conditions and, in the presence of other
environmental condi tion-~, a11Q~ tr~nssription and s-lb~equent
expres~ion of the protein coded for by the DNA sequence. In
particular, it is preferred that regulatory segments be
inserted into the vector such that expression of the DNA
sequence will not occur in the absence of, for example,
i~opropylthio-beta-d-galactoside. In this situation, the
SU8STITUTE SHEEl
Wogl/lss93 PCT/US91/02060
3~
transformed microorganisms containing the DNA of interest may
be grown to a desired density prior to initiation of the
expression of the antigenic polypeptides. In this
embodiment, expression o~ the desired antigenic polypeptide
is induced by addition of a substance to the microbial
environment capable of causing expression of the DNA sequence
after the desir~d density has been achieved.
Additional operational elements include, but are not
limited to, ribosome-binding sites and other DNA sequences
necessary for microbial expression of foreign proteins. The
opera~ional elements as discussed herein can be routinely
selected by those of ordinary skill in the art in light of
prior literature and the teachings contained herein. General
examples of these operational elements are set forth in B.
Lewin, Genes, Wiley & Sons, New York (1983). Various
examples of suitable operational elements may be found on the
vectors discussed above and may be elucidated through review
of the publications discussing the basic characteristics of
the aforementioned vectors.
In one preferred embodiment of the present invention,
an additional DNA sequence is located immediately preceding
the DNA sequence which codes for the antigenic polypeptide.
The additional DNA sequence is capable of functioning as a
translational coupler, i.e., it is a DNA sequence that
encodes an RNA which serves to position ribosomes immediately
ad~scent to the ribosome binding site of the antigenic
- polypeptide RNA with which it is contiguous.
Vpon synthesis andtor isolation of all necessary and
desired component parts of the above-discussed cloning
vectors, the vector~ are a~sembled by methods generally known
to those of ordinary skill in the art. Assembly of such
vectors is believed to be within the duties and tasks
performed by those with ordinary skill in the art and, as
SUBST~'rUTE SHEE~
WO91/15593 PCT/US91/02060
2~7,~ 31
-23-
such, is capable of being performed without undue
experimentation. For example, similar DNA sequences have
been ligated into appropriate cloning vectors, as set forth
in Schonert et al., Proceedinas of the National Aoadem~ of
Sciences U.S.A., 8I:5403-5407 (1984).
In construction of the cloning vectors of the present
invention, it should additionally be noted that multiple
copies of the DNA sequence encoding for the antigenic
polypeptide and its attendant operational elements may be
inserted into each vector. In such an embodiment, the host
organism would produce greater amounts per vector of the
desired antigenic polypeptides. The number of multiple
copies of the DNA sequence which may be inserted into the
vector is limited only by the ability of the resultant
vector, due to its size, to be transferred into and
replicated and transcribed in an appropriate hoct
microorganism.
Additionally, it is preferred that the cloning vector
contain a ~electable marker, such as a drug resi~tance marker
or other marker which causes expression of a selectable trait
by the host microorganism. Such a drug resistance or other
selectable marker is intended in part to facilitate in the
selection of transformants. Additionally, the pre3ence of
such a selectable marker on the cloning vector may be of use
in keeping contzminating microorganisms from multiplying in
the culture medium. In this embodiment, ~uch a pure culture
of the trAnsformed host microorganisms would be obtained by
culturing the microorganisms under condition~ which require
the induced phenotype for survival.
SuBsTlTuTE !;~
WO91/15593 PCT/US91/02060
~0~ -24-
It is noted that, in a preferred embodiment, it is
also desirable to reconstruct the 3' end of the coding region
to allow assembly with 3' non-translated sequences. Included
among these non-translated sequences are those which
stabilize the mRNA or enhance its transcription and those
that provide strong transcriptional termination signals which
may stabilize the ~ector as they are identified by Gentz, R.,
Langner, A., Chang, A.C.Y., Cohen, S.H., and Bujard, H. in
Proc. Natl. Acad. Sci. USA, 78:4936-4940 (l98l).
The vector thus obtained is then transferred into the
appropriate host microorganism. It is believed that any
microorganism having the ability to take up exogenous DNA and
express those genes and attendant operational elements may be
chosen. It is preferred that the host microorganism be an
anaerobe, facultative anaerobe or aerobe. Particular hosts
which may be preferable for u~e in this method include yeasts
and bacteria. Specific yeasts include those of the genus
Saccharomvces, ~nd especially SaccharomYces cerevisiae.
Specific bacteria include those of the genera
Bacillus and Escherichia and Pseudomonas. Various other
preferred hosts are set forth in Table I, su~ra. In other,
alternatively preferred embodiments of the present invention,
Bacillu~ subtilis, Escherichia coli or Pseudomonas aeruqinosa
are elected as the host microorganisms.
After a host organism has been chosen, the vector is
transferred into the host organism using methods generally
known by tho~e of ordinary skill in the art. Examples of
such methods may be found in Advanced Bacterial Genetics by
R. W. Davis et al., Cold Spring Harbor Press, Cold Spring
Harbor, New York, (1980). It is preferred, in certain
embodiments, that the transformation occur at low
tempera~ure~, as temperature regulation is contemplated as a
means of regulating gene expression through the use of
SUBSTITUTE SHEEl
WO91/15~93 PCT/~S91/02060
207~13:~
-25-
operational elements as set forth above. In another
embodiment, if osmolar regulators have been inserted in~o the
vector, regulation of the salt concentrations during the
transformation would be required to insure appropriate
control of the synthetic genes.
If it is contemplated that the recombinant antigenic
polypeptides will ultimately be expressed in yeast, it is
preferred that the cloning vector first be transferred into
Escherichia coli, where the vector would be allowed to
replicate and from which the vector would be obtained and
purified after amplification. The vector would then be
transferred into the yeast for ultimate expression of the
antigenic polypeptide.
The host microorganisms are cultured under conditions
appropriate for the expression of the antigenic polypeptide.
These conditions are generally specific for the host
organism, and are resdily determined by one of ordinary skill
in the art, i n light of the published literature regarding
the growth conditions for such organi~ms, for example
Beraev's Manual of Determinative Bacterioloov, 8th Ed.,
Williams & Nilkins Company, Baltimore, Maryland.
Any conditions necessary for the regulation of the
expression of the DNA sequence, dependent upon any
operational elements inserted into or present in the vector,
would be in effect at the transformation and culturing
stages. ln one embodiment, the cells are grown to a high
density in the presence of appropriate regulatory conditions
which inhibit the expression of the DNA sequence encoding for
the antigenic polypeptide. When optimal cell density is
approached, the environmental conditions are altered to those
appropriate for expression of the DNA sequence. It is thus
contemplated that the production of the antigenic polypeptide
will occur in a time span ~ubsequent to the growth of the
host cells to near optimal density, and that the re~ultant
antigenic polypeptide will be harvested at some time after
the regulatory conditions necessary for its expression were
induced.
SUBSTITU-rE SHFFl
WO91/15~93 PCT/US91/02060
-26-
The transcription terminators contemplated herein
serve to stabilize the vector. In particular, those
sequences as described by Gentz et al., in Proc. Natl. Acad.
Sci., USA 78: 4936-4940 (1981), are contemplated for use in
the present invention.
A clone containing the entire gene for Protein C
(pUCl8::28C2) has been isolated and sequenced. The insert
from clone R69 was used as a DNA hybridization probe to
isolate a plasmid clone called pUC18::28C2 was made by
inserting N. hvo~neumoniae DNA, partially digested with the
restriction enzyme Sau3a, into the plasmid vector pUC18 cut
with BamH1. (See Example VIII). The entire gene and part of
the surrounding DNA was sequenced (See Example VIII-B and
Figure 2).
In order to determine the position of the gene within
the region sequenced, the amino terminal sequence of the
intact Protein C, purified from M. hYo~neumoniae cells, was
determined to give a stating point (See Example VIIT-r). In
addition, the amino acid sequence was determined for several
peptide fragments of Protein C, which were generated by
Endopeptidase dige~tion and purified by HPLC (See Example
VIII-D). The sequences of these peptides are shown in
Figure 3. These amino acid sequences were used to determine
the proper reading frame of the DNA sequence. The translated
DNA sequence for the entire Protein C is shown in Figure 4,
with the positions of the sequenced peptides underlined.
The amino terminal sequence of the intact Protein C
was found to lie in the middle of an extensive open reading
frame. It appears that the gene for Protein C actually codes
for a larger protein (a~ much as 20 kd larger) which may be
proce~sed to the 85 kd size. Since mature Protein C (85kd)
has been determined to be protective, the present inventors
have not studied extensively the region which is thought to
be proces~ed away. The gene for Protein C (85kd) (excluding
the processed portion) encodes a protein which is 624 amino
SUBSTITUTE SHEET
WO91/15593 PCTtUS91/02060
2a7~l3~
-27-
acids in length, with a calculated molecular weight of 70.5
kd. The discrepancy between the calculated and apparent
molecular weights as determined by SDS PAGE is not unusual.
The gene for Protein C contains three in-frame UGA codons
(shown boxed in Figure 4) TGA in the DNA, which code
tryptophan (See Example VIII-E). The use of UGA as a
tryptophan codon is common among the mycoplasmas, but in
other organisms (including E. coli) UGA is used as a
translation termination signal. To express Protein C in E.
coli, the UGA codons were changed to E. coli UGG (tryptophan)
codons (See the discussion below and Example IX).
The original clone for Protein C, R69, is contained
completely within the coding sequence for Protein C, starting
at nucleotide 455 and extending to nucleotide 976 in the
sequence shown in Figure 4.
Expression clones were made that produce recombinant
Protein C. A recombinant plasmid (pTST::M852) was
constructed which expre~ed the entire Protein C (85kd) in E.
coli. Expression of the entire Protein C in an E. coli
expression vector required the replacement of the three
inframe UGA codons with UGG codons, the normal tryptophan
codon in E. coli. Operationally, this was acheived by
replacing the final "A" with a "G" in each of these codons.
This was accomplished using a technique called "site directed
in vitro mutagene~is" (Kunkel et al., Methods in Enzymol.,
154, 367-382 (1987) whereby a short oligonucleotide is
synthe~ized which i8 exactly complementary to the region
except for the nucleotide to be changed. This position
contains a nucleotide which is the complement of the desired
substitution. There is enough exact complementarity on
either side of the substitution so that the oligonucleotide
will anneal to a single stranded vector containing the
unaltered sequence. When a second strand is synthesized
using the oligonucleotide as a primer, the alteration is
SUBSTITUTE SHEET
WO91/155~3 PCT/~S91/02~0
~3~
-28-
incorporated and subsequent replication yields DNA molecules
with both strands substituted. This technique was used to
change all three of the UGA codons to VGG in the gene for
Protein C (See Example IX-A).
In order to identify a specific protective protein or
proteins, an actual efficacy test (protection of swine
against Mvco~lasma hYoPneumoniae infection) was used as an
assay for the detection and eventual purification of a
specific protective protein. Starting with relatively crude
extracts which showed some protection, individual protein
components were purified and tested, resulting in the
identification of Protein C as a protective protein. The
cloning and expre~sion of recombinant versions of Protein C
(a full length and a truncated version) which were also
protecti~e prove conclusively that Protein C is a protective
agent.
A variety of protein extracts and purified proteins
were ~ested as vaccines. These included:
Sl : An extract of proteins released from whole
MYco~lasma hvo~neumoniae cells when ~ub~ected to
low pH conditions. (Described in Example X-A2).
7S : Proteins pre~ent in the Sl extract which remain
soluble when the pH is raised to 7Ø
(Described in Example X-A3). Can be denatured
by adding SDS to l.25% or urea to 6M.
- PROTEIN C (N~TURAL 85 kd PROTEIN) : Purified from Sl
or 7S
extracts by methods described in Example X-B.
FULL LENGTH RECOMBINANT PROTEIN C : Described in
Example IX
and X-C.
TRUNCATED RECOMBINANT PROTEIN C : Described in
Section IX and X-D.
SUBSTITUTE SHEET
WO91/1~93 PCT/US91/02~60
2~7~13~
-29-
It is to be understood that application of the
teachings of the present invention to a specific problem or
environment will be within the capabilities of one having
ordinary skill in the art in light of the teaching~ contained
herein. Examples of the products of the present invention
and representative processes for their isolation and
manufacture appear in the following examples. It should be
noted that all literature references used to further
elucidate these examples are specifi~ally in~orporated herein
by reference.
EXAMPLES
The literature articles cited herein are incorporated
by reference in their entirety.
I. CONSTRUCTION OF THE LAM~DA GTll EXPRESSION LIBRARY
A. CONSTRUCTION OF THE M. HYOPNEUMONIAE
GENOMIC DNA EXPRESSION LIBRARY
The rationale for construction of a genomic
expression library was to obtain a representative clone for
every antigenically active protein that could be expressed by
M. hvo~neumoniae. Sin~e prokaryotic DNA does not contain
introns, it was not necessary to construct a cDNA library to
accomplish thi~. ~ecause of the small genome size, a
relatively small number of clones are required to adequately
represent the M. hvo~neumoniae genome. Using 750 kiloba~e
pairs as the e timate of the genome size for M.
h~oDneumoniae, it was calculated that for a g9~ probability
of having every 100 bp region in both orientations and in all
three reading frames, 1.4 x 105 individual recombinants were
required.
SLJBSTITUTE SHEET
W O 91/15593 P(~r/US91/02060
3~
-30-
In lambda gtll, cloned DNA fragments coding for
peptides are expressed as fusion proteins when they are
inserted at the unique EcoRI site near the carboxy terminus
of the beta-galactosidase gene in the phage. Insertion of
foreign DNA in the beta-galactosidase gene inactivates the
gene, thus allowing identification of recombinant phages on
indicator plate~.
The M. hyo~neumoniae genomic expres~ion library was
obtained in four consecutive steps. First, genomic DNA was
obtained from M. hvo~neumoniae cells. Second, random
fragments were generated by sonication, the ragged ends were
blunted using phage T4 polymerase, internal EcoRI restriction
sites were protected by EcoRI methylase, EcoRI linkers were
added to the ends and excess linkers cleaved off. Third, the
prepared fragments were ligated into the lambda gtll vector
DNA (purchased from Vector Cloning Systems, San Diego, CA)
and packaged in vitro. Finally, the in ~itro packaged
recombinant phage were amplified.
1. PREPARATION OF GENOMIC DNA
FRON M~COPLASMA HYOPNEUMONIAE CELLS
Approximately 1011 frozen M. hvo~neumoniae cells were
; thawed in ice and transferred to a polypropylene tube. The
~olume of cells was 0.8 ml. To this was added a ml of
proteinase K solution: 0.075 M Tris pH8; 0.17 M EDTA pH8;
0.15% Triton X 100; and 400 ug/ml Proteinase K (BOEHRINGER
MANNHEIN BIOCHEMICALS, Indianapolis, Indiana). The cells
were incubated with the proteinase R solution at 65C for 30
minutes. 2.0 ml of phenol was added to the mixture and the
tube was gently rocked at 4C for 20 min. The sample was
then centrifug~d in a BECRMAN JA20 rotor at 5000 rpm for 5
min at 4C. The aqueous phase was removed with a large bore
SLJBSTlTUTE SHEET
WO9l/15S93 PCTtUS9l/02060
207~13 ~
-31-
plastic pipette. The aqueous phase was extracted with 2 ml
of a 2~:1 mixture of chloroform and isoamyl alcohol, by
roc~ing for 20 min at 4C, letting the tube stand 5 min for
the phases to separate, and then removing the a~ueous phase
with a large bore plastic pipette.
The aqueous phase was then re-extracted with phenol
followed by chloroform/isoamyl alcohol as described in the
above paragraph. The extracted aqueous phase was ad~usted to
O.3 M sodium acetate by adding a 1/10 volume of a 3.0 M
sodium acetate stock solution. DNA was precipitated from
this solution by adding 2.5 volume~ of cold ethanol. Gentle
mixing with the ethanol yielded a large, viscous mass of
nucleic acid that was ~Ispooled~ out of solution using a small
glass rod. This material was then rinsed twice with 70%
ethanol and allowed to air-dry. The dry nucleic acids were
resuspended in 0.5 ml of TE buffer by rocking the solution
for 16 hr at 4C.
In order to remove any contaminating RNA from the M.
hvo~neumoniae DNA preparation, the nucleic acids were treated
with RNaseA. Five-tenths milliliter of the sporozoite
nucleic acid preparation was treated with 2.5 ugtml of RNaseA
(MILES LABORATORIES, Elkhart, Indiana) at 65C for 30 min.
The aqueous phase was ad~usted to 3.2 M ammonium acetate by
adding a 0.75 volume of a 7.5 M stock solution. The DNA was
precipitated from this solution with the addition of 0.54
volumes of isopropanol. Mixing of the isopropanol yielded a
large viscous pellet that was spooled from the solution and
rinsed twice with 80% ethanol. After air drying, the DNA was
resuspended in 0.2 ml of TE buffer.
Integrity of the M. hvo~neumoniae DNA was analyzed by
electrophoresis through an agarose gel and sub6equent
~t~ininn of the nel with e~.hidium bromida. These res~ s
indicated that the DNA was of high molecular weight and
relatively free of RNA. The concentration of the DNA was
determined by optical absorbance at 260 nm. This particular
preparation yielded 90 ~g of purified DNA.
SUBSTITUTE SH~ET
WO91/15593 PCT/US91/02060
-32-
2. PREPARATION OF SONICATED
M. HYOPNEUMONIAE GENOMIC DNA FRAGMENTS
In order to have a given fragment from the M.
~y~pneumoniae genome aligned in the proper reading frame for
transcription and translation of the native polypeptide, it
was decided to generate random fragments by sonication to
that all possible frames would be represented.
M. hyopneumoniae DNA was sonicated with a small
tipped probe of a Branson Sonifier cell disrupter 200 set at
the lowest power setting. 80 ~g of DNA in 200 ~l total
volume was sonicated in three 3-second bursts. This
generated fragments ranging in size from 0.3 to 23 Kb in size
with the highest proportion in the l.3 to 4.4 Kb range.
The ragged ends generated by the sonication were
blunted using T4-DNA polymerase (NEW ENGLAND BIOLABS;
Beverly, Mass.). The reaction was carried out in 33 mM Tris
Acetate pH7.8; 66 mN Potassium Aceta~e, l0 mM Magnesium
~cetate, 0.1 m,,g~m,l Bovine Serum Albumin, 0.5 mM
dithiothreitol, and 0.l mM of each of the deoxynucleotide
triphosphates, dATP, d&TP, dCTP, dTTP. For 65 ~g of
sonicated DNA, 20 units of T4 polymerase was reacted for l
hour at 37. The reaction was stopped by heating the sample
for l0 min at 68C. ~xcess salts were removed by passing the
reaction mix over a BIOGEL P30 (BIO RAD) column equilibrated
in TE.
In order to protect any M. hvo~neumoniae genomic DNA
fragments that might have internal EcoRI sites, it was
- necessary to modify the DNA. EcoRI methyla~e (NEW ENGLAND
BIOLABS) was reacted with the fragmented M. hYo~neumoniae DNA
in the presence of S-adenosyl methionine using conditions
recommended by the supplier. The methylase was inactivated
SU13S~TUTE S~EEl
WO91/15593 PCT/US91tO2060
207~13~
-33-
by phenol extraction of the reaction mix, and residual phenol
was removed by ether extractions. The mix was then adjusted
to O.3 M with sodium acetate, and 2.5 volumes of ethanol were
added. After 30 min at -70C, the precipitated DNA was
pelleted by centrifugation. This DNA was resuspended in TE
buffer.
Short oligonucleotide EcoRI linkers (NEW ENGLAND
BIOLABS) were added to the blunt ended fragments in a
ligation reaction consisting of 66 mM Tris pH7.6, 5 m~ MgC12,
5mM dithiothreitol, 10 mM A~P, with the linker at 5-10 u~.
T4 DNA ligase (P.L. BIOCHEMICALS) was added and the reaction
proceeded at 14C for 16 hours. The ligation reaction was
terminated by heating the mixture at ~0 for 10 min.
Sodium chloride was then added to 0.1 M, excess EcoRI
was added, and the reactions were incubated at 37C for
several hours. The EcoRI was inactivated by heating at 70C
for 10 min.
Removal of exce~s linkers and size fractionation nf
the DNA fragments was carried out by density centrifugation
in a 10 to 40% sucrose gradient in lM NaCl; 20 mM tris pH8, 5
mM EDTA. The DNA was applied to the top of the gradient and
was spun in a BECKMAN SW41 rotor at 26,000 rpm for 24 hours
at 15C.
Fractions were collected in 0.3 ml aliquots. Samples
of these were assayed by aqueous gel electrophoresis and
staining by Ethidium Bromide to compare the size of the smear
of fragment~ in each fraction with molecular weight markers.
Fractions which were enriched for fragments in the 1 to 6 Kb
range were pooled, then dialyzed and concentrated using a
CENTRICON 30 (AMICON) apparatus.
SUBSTITUTE SHEEl
WO91/15593 PCT/US91/02060
~9~ 34-
3. LIGATION OF FRAGMENTS TO 1AMBDA
gtll AND IN VITRO PACKAGING OF
THE RECOMBINANT DNA
Phosphatased and EcoRI-cleaved lambda gtll DNA was
mixed with the prepared fragments of M. h~o~neumoniae DNA.
These DNAs were ligated with T4 DNA ligase (P.L BIOCHEMICALS)
overnight at 14C. A small aliquot of the ligation reaction
mixture was analyzed by gel electrophoresis to monitor the
ligation reaction. The mixture was heated at 70C for 5 min
and then mixed with lambda in vitro packaging extracts
(VECTOR CLONING SYSTEMS, San Diego, CA). The pack~ging
reaction was allowed to proceed for 60 minutes at room
temperature and then a drop of chloroform was added to
prevent bacterial growth. Titration of this mix yielded a
library with a complexity of l.5 X 105 recombinants.
4. AMPLIFICATION OF THE
M. HYOPNEUNONIAE EXPRESSION LIBRARY
Packaged phage were diluted with lambda dil and
adsorbed to E. coli Qtrain Yl088 as described by Young, R.
and Davis, R. in Science, 222:778-782 (1983). Amplification
of the library on this strain ensures that the beta-
galactosidase gene is not expressed; therefore, any phage
containing coding sequences tha~ might be deleterious to the
host _ coli cell are not expressed and not lost from the
library. Amplifications of the library yield a stock that
was 6 X l09 phage per ml.
II. GEN~RAL METHODOLOGY
A. ANTIBODY SCREENING OF THE LAMBDA GTll:
M. HYOPNEUMONIAE EXPRESSION LIBRARY
The lambda gtll:M. hYo~neumoniae expression library
wa~ plated at densities of 5,000 through 20,000 phage per
l5û-~m pla~e -~aing ~. coli ~lOSû aa ho~ as described by
Young and Davis in Science, 222:778-782, (1983). Plates were
incubated at 37 or 42 for 4 hr, then overlaid with
nitrocellulo~e filters (BA-85, SCHLEICHER AND SCHUELL) that
had been soaked in l0 mM IPTG and air-dried. After
incubating overnight at 37C, filters were batch-washed 3 x
SUeSTlTUTE SHEEl
WO91/l5593 PCT/US~I/02060
207~1 31
--35--
10 min in TBS (10 mM Tris-HCl pH 8.0, 150 mM NaCl). Non-
specific protein binding sites on the filters were blocked by
incubating filters for 60 min in TBS + 2~ bovine serum
albumin (Fraction V, MILES LABORATORIES, Elkhart, IN). The
filters were then incubated individually or in pairs for 2 hr
with 10-20 ml of primary antibody (e.g., immune ~wine serum,
hyperimmune rabbit antimycoplasma serum, mouse monoclonal
antimycoplasma antibodies) typically diluted 1:200 (1:500 for
monoclonals) with TBS to which had been added 2% bovine serum
albumin (BSA). The filters were washed 3 x 10 min with TBS
containing 0.1~ NP-40 (SIGMA), then incubated singly or in
pairs for 60 min with 10-20 ml solution of a second antibody
(e.g., peroxidase-conjugated goat anti-rabbit IgG, CAPPEL
LABORATORIES) diluted 1 500 in TBS + 2% bovine serum albumin.
Filters were batch-washed 3 x 10 min in TBS and stained in a
solution comprising 200 ml TBS, 2.5 ml of a 3% hydrogen
peroxide sol~tion and 40 ml of a 3 mg/ml solution of 4-
chloro-l-napthol in methanol. Staining was quencned by
removing the filters to water. Positive staining plaques
were subjected to several rounds of rescreening with antibody
as described above until pure.
B. ELUTION OF ANTIBODIES BOUND TO ~ROTEIN
I~NOBILIZED ON NITROC2LLUL0SE MENBRANES
When proteins are immobilized on nitrocellulose
membranes such as Western blot transfers of proteins
separated on polyacrylamide gels or replicas of phage plaques
taken from agar plates, it is possible to bind antibodies
which specifically recognize the immobilized proteins.
Antibodies which do not specifically bind to the immobilized
proteins remain in solution and can be easily washed away,
leaving behind only those pecifically bound.
SUBSTITUTF ~ IIFFl
WO91/15593 PCT/US91/02060
36-
The bound antibodies can be eluted by rinsing the
filters in a low pH buffer (5 mM glycine, pH 2.3, 0.5 M NaCl,
O.S~ Tween 20, 0.01% BSA), which dissociates the antibody-
antigen complex. If the eluted antibodies are immediately
neutralized, i.e., using a 50 mM Tris HCl, final
concentration, they retain full activity and can be used for
a variety of analytical purposes.
1. DETERMINATION OF MYCOPLASMA
PROTEIN CORRESPONDING TO INSERT CLONE
Antibodies eluted from plaque replicas of a purified
recombinant clone were uced to determine which Mvco~lasma
- protein corresponded to that clone. By eluting antibodies
bound to plaque replicas of the recombinant clones and using
those antibodies to probe Western blots of Myco~lasma
proteins, it was possible to determine which protein is
encoded in the recombinant clone.
Five thousand to ten thousand plaques from a single
purified recombinant clone were plated on a l00 mm plate, and
a plaque lift was made. The lift filters were washed 3 x l0
min in TBS and non-specific protein binding was blocked by
incubation in TBS + 10% BSA for l hr. The filters were
washed 3 x l0 min in TBS. A strip 5 mm wide was cut from the
filter disc. Polyclonal anti-mycoplasma serum wa~ bound to
the ~trip, wa~hed and eluted as described above. The eluted
antibodies were then used to probe a Western blot of
mycoplasma proteins.
III. PLASNID VECTORS FOR EXPRESSION OF FUSION PROTEINS
A number of antigenically reactive M. hYo~neumoniae
recombinant phage clones were identified in the expression
library. Since the lambda gtll lysogens appeared to make a
limited quantity of fusion protein, we constructed a plasmid
expression vector that would produce the fusion proteins in
milligram quantities.
SUBSTITUTE SHEEl
WO 91/15593 PCr/US91/02060
2 0 7 ~
-37-
A. pSEV4
Plasmid pLG2 was obtained from Dr. L. Guarente (MIT)
(Guarente, L., in Cell, 20: 543-553 (1980). Thi~ vector is a
pBR322 derivative which, like lambda gtll, has lac operator
and promoter sequences in addition to a wild-type beta-
galactosidase gene containing a single EcoRI site near the 3'
end of the gene. In addition, pLG2 contains the lac
repressor gene. Moving M. hYo~neumoniae ~NA in~erts from
lambda gtll into the EcoRI site of this vector yields an
identical fusion protein to that initially identified in the
phage.
Plasmid pLG2 was modified to remove an extra EcoRI
site prior to its use for expression. Plasmid pLG2 was
partially digested with EcoRI restriction endonuclease to
linearize the plasmid. The plasmid DNA was then displayed on
a preparative agarose gel and the linear-sized DNA band was
eluted from the gel. The eluted DNA was precipitated by
making the solution O.3 M with sodium acetate and adding ~.S
volumes of ethanol~ The DNA was pelleted by centrifugation
and the pellet was resuspended in TE buffer. The Klenow
fragment of E. coli DNA Polymerase I was mixed with the DNA
in the presence of dATP and dTTP to fill in the EcoRI
cohesive ends. After heat inactivation at 70C for 10 min,
T4 DNA ligase (P.L. BIOC~ENICALS) was added and the mixture
was incubated at 4C for 16 hr. The ligated DNA was then
used to transform E. coli ANA1004. Casadaban, M., et al., in
Methods in Enzvmolo~v, 100:293 (1983).
Transformants were selected on ampicillin plates in
the presence of a chromagenic substrate for beta-
galactosidase activity (X-GAL). Transformants with beta-
galactosidase activity were screened by cleaving the DNA with
EcoRI. A plasmid, pSEV4, that had only a single EçoRI site
near the carboxy-terminus of the beta-galactosidase gene was
identified from the transformants and characterized.
S U BSTITUTF .C~F~
WO91/1S593 PCT/US91/02060
-38-
Plasmid pSEV4 has a unique EcoRI site near the
carboxy- terminus of the beta-galactosidase gene. Plasmid
pSEV4 contains the wild-type lac operator, promoter and
repressor in addition to the beta-galactosidase gene. Upon
induction with IPTG for 60 min, beta-galactosidase activity
was increased by 300-fold. Uninduced cells containing pSEV4
produced approximately l000 units/mg of total cellular
,
protein, whereas IPTG-induced cells gave approximately
300,000 units/mg of total cell protein. Protein gel analysis
of induced and uninduced cells also showed the overproduction
of beta-galactosidase by induced cells. This new plasmid,
pSEV4, has been used to express a number of M. hvo~neumoniae
antigens as fusion proteins.
B. pSEV6
A successor to pSEV4 was constructed to allow
polarized "cassette" subcloning of DNA inserts from lambda
gtll directly into a plasmid expression vector. Because
EcoRI inserts could be subcloned in either orientation of
pSEV4, each pSEV~ subclone must be screened for its an~igenic
reaction. Polarized subcloning using pSEV6 obviates the need
for this extra analysis.
Extensive mapping of pSEV4 located five restriction
endonuclease sites in the lac operon 5' to the beta-
galactosidase gene's unique EcoRI site. Three of these sites
are unique and two were made unique by deletion of the
superfluous DNA between the lacI gene and the pBR322-derived
amp gene. Only one useful restriction site was found 3' to
the EcoRI site, the Ncol site, therefore, additional
restriction enzyme site~ were inserted in this region using a
chemically synthesized polylinker.
SUBSTITUTE S~lEEl
WO91/15593 PCT/US91/02060
2~7~131
-39-
The construction of pSEV6 was done in two steps.
First, pSEV4 was shortened by approximately 5,700 ~p to
eliminate superfluous DNA. Plasmid pSEv4 was cleaved with
S~hI restriction endonuclease, and the enzyme was inactivated
by heating at 70C for l0 min. The DNA was then partially
digested with AatII and the resulting digest was displayed by
electrophoresis on a preparative agarose gel. ~he 7,620 bp
fragment was excised from the gel and electroeluted.
The electroeluted DNA was precipitated from a 0.3 M
sodium acetate solution by adding 2.5 volumes of ethanol and
incubating at -70C for 30 min. The DNA was concentrated by
pelleting in a Brinkman microcentrifuge for 15 minutes and
the pellet was resuspended in TE buffer. T4 DNA polymerase
(NEW ENGLAND BIOLABS) was added to blunt-end the cohesive
ends generated by the AatII digest. After heat inactivation
of the T4 DNA polymerase, T4 DNA ligase ~P.L. BIOCHEMICALS)
was added to ligate the blunt ends of the DNA fragment. The
ligated DNA was used to transform competent AMA1004 ~. ~nl i
cells. Lac+ transformants were screened for the 7,520 bp
plasmid. One plasmid, pSEV5, was identified and
characterized as having t~e appropriate structure.
DNA from pSEV5 was purified by standard methods, and
subsequently cleaved with the restriction endonuclease NcoI,
which cleaved at a unique site 3' of the beta-galactosidase
gene. An oligonucleotide adapter molecule would regenerate
the NcoI site and which also contained BqlII and K~n I sites
was chemic~lly synthesized. The sequence of this adapter
molecule is as follows:
5'-GTAAGGAGGAATAACATATGGAATTCGAG-3'
3' -ACGTCATTCCTCCTTATTGTATACCTTAAGCTCCTAG -5'
.
SUBSTITUTE SHEEl
., .
WO91/l~593 ~ PCT/US91/02060
-40-
This oligonucleotide was ligated to the NcoI cleaved pSEV5
with T4 DNA ligase (P.L. BIOCHEMICALS). The ligated DNA was
used to transform competent E. coli AMA1004 cells. DNA from
the resulting lac+ transformants was screened for the
presence of the unique K~nI and NcoI sites. A plasmid was
identified from this screen with all of the designed
sequences. This plasmid, pSEV6, has been used for expression
of various of the antigenically reactive fusion proteins.
IV. PURIFICATION OF RECOMBINANT FUSION PROTEINS
The beta-galactosidase::M. hvoPneumoniae antigen
fusion proteins have been purified either by use of a
substrate analog affinity column for beta-galactosidase or by
classical methods of protein purification.
A. Pre~aration of Extracts
Two liters of Luria broth, pH 7.5, containing 50 ug/
mL of ampicillin were inoculated with 10-20 ml of an
overnight culture of E coli ANA1004 containing one of the
recombinant plasmids. The cells were allowed to grow at 37C
to mid-log phase (A600 = 0-2). Isopropyl-thiogalactoside
(IPTG) was added to a final concentration of 1 mM to induce
formation of the fusion protein. The cells were allowed to
grow out for 2 hours, and then harvested by centrifugation at
5000 x G for 15 min at 4C. All subsequent operations were
carried out at 4C.
The cells were resuspended in 20 mL of breaking
buff~r (50 mM Tris-HCl, pH 7.S, 250 mM NaCl, 10 mM MgC12, 5%
glycerol, 1 m~ phenymethyl sulfonyl fluoride (PMSP)) at 4C
and centrifuged again at 5000 x G for 15 min. The cells were
again suspended in 20-40 mL of breaking buffer. The cells
could be frozen at this point and stored at -20C if desired.
SU~STITUTE SHEEl
WO91/15593 PCT/US91/02060
207~131
-41-
The unfrozen or thawed cells were broken with two
passes through a French pressure cell (AMINCO) at 20,000 psi.
Cell debris was removed by centrifugation at 30,000 x G for
30 min. Further clarification of the extract could be
obtained at this point by ultracentrifugation at 100,000 x G
for 30 min. The fusion protein was then precipitated by the
addition of ammonium sulfate to a final concentration of 20
to 40% saturation. The optimal concentration of ammonium
sulfate required for precipita~ion of the fusion protein
varies with the individual protein and must be determined
experimentally, using for example, procedures set forth in
Heppel, L. in Methods in EnzvmoloqY, 1:570-576 (1955).
The precipitate solution was stirred for one hour and
the precipitate was removed by centrifugation at 30,000 x G
for 15 min. The pellet was redissolved in 10 to 15 ml of
starting buffer ~50 mM Tris-HCl, pH 7.5, 250 m~ NaCl, 10 mM
MgCl2, 1 mM dithiothreitol (DTT) and 0.1% Triton X-100), and
then dialyzed overnight against 500 mL of starting buffer.
1. AFFINITY PURIFICATION PROCED~RE
The use of a beta-qalactosida~e affinity column is
based on the method described by Steers and Cuatrecasas in
Methods in EnzvmolooY, 34:350-358 (1974). Affinity resin tp-
aminophenyl-beta-D-Thiogalac~opyranoside-agarose, obtained
from SIGNA) was packed into a 1.5 cm diameter by 15 cm
colu~n. The column was washed with 10 column volumes of
starting buffer of 50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 10 mM
MgC12, and 1.0 mM dithiothreitol (DTT) and 0.1 Triton -X100
before use. The column can be regenerated after use by
washing extensively with elution buffer 0.1 sodium borate, pH
10.0, 250 mM NaCl, 1 mM DTT or by washing with 6M guanidine
hydrochloride in 50 mM Tris-HCl, pH 7.5. After washing, the
column i8 reequilibrated with 10 column volumes of starting
buffer.
SUE~STITU~E SHEEl
.
WO91/1~593 PCT/US91/02060
-42-
For affinity chromatography, dialyzed material was
applied to the pre-equilibrated affinity column at a flow
rate of about 0.2 ml/min. After the sample was applied to
the column, the column was washed with 15 ml of starting
buffer at the same flow rate, then with 30 ml of starting
buffer at about 0.5 ml/min followed with 180 ml starting
buffer at about 1 ml/min. Finally, the column was washed
with 120 ml of starting buffer without T~ITON at the same
flow rate.
The absorbed protein was eluted with 0.l sodium
borate, pH l0.0, 250 mM NaCl, 1 mM DTT using 120 ml at a flow
rate of about l ml/min. The peak-protein containing
fractions were pooled and could be concentrated if desired to
about l0 ml using an AMICON ultrafiltration device (Model
8050) containing an YM-30 membrane~
2. ULTRACENTRIFUGE PURIFICATION
An alternative purification usable for some of the
fusion proteins (e.g., pSEV4::CH2-13) is accompli hed by
obtaining dialyzed protein as set forth above. The dialyzed
material is sub~ected to ultracentrifugation at l00,000 x G
for 30 min. The pellet containing the bulk of the fusion
protein was redissolved in a small volume of dialysis buffer
50 mM Tris-HCl, ph 7.5, 250 m~ NaCl, l0 mM MgCl2 and l.0 mN
dithiothreitol (DTT) and 0.l M TRITON -X l00. This method
yields material that is not as pure as that generated by the
affinity column when judged by SDS-polyacrylamide
electrophoresis.
SUBSTITUTE SHEEl
WO91/l5~93 PCTtUS91/02060
2~7~ 31
-43-
3. ANALYSIS
The purified materials obtained by these methods were
analyzed for protein by the BIO-RAD (Richmond, CA) protein
method as recommended by the manufacturer. It was also
subjected to analysis by SDS-polyacrylamide electrophoresis.
These gels are visualized either by protein staining or by
Western blot analysis. Protein staining was typically done
with either the silver stain method as described by wray,
W.P. et al. in Anal. Biochem., 118:1g7-203 (1981) or the BIO-
RAD protein stain. Western blot analysis is carried out as
described by Remart, J. et al. in PNAS (USA!, 76:3116 (1979).
The Western blot analysis involves electrophoretic
transfer of the resolved protein bands to nitrocellulose,
bloc~ing the nitrocellulose paper with BSA, probing with a
specific antibody (either anti-betagalactosidase or anti-
mycoplasma sera). After washing, the blots are probed with
the appropriate peroxidase conjugated second antibody,
followed by color development using the peroxidase catalyzed
reaction.
V. GENERAL PROCEDURES FOR OBTAINING
THE ENTIRE M. HYOPNEUMQNIAE
GENE ENCODED BY A FUSION PROTEIN CLONE
The recombinant M. hvoPneumoniae clones that were
picked as reactive with various antimycoplasma sera contain
only a portion of the entire coding region for that
particular polypeptide, becauce of the requirement that the
insert sequence be in frame with the beta-galactosidase gen~
in lambda gtll and the limited number of clones screened. In
some cases it may be important to have cloned the entire
coding sequence of a given antigenic N. hYo~neumoniae
polypeptide in order to maximize the immune re~ponse or
modulate the response. ~ method is outlined below that will
allow the isolation of clone~ containing such fùll length
fragments.
SUaSTlTUTE SHEEl
WO91/15593 PCTtUS91/02060
3~
The lambda gtll expression library described above,
may also be viewed as a simple genomic library if one does
not require that the inserted segments of M. h~opneumoniae be
expressed as fusion proteins. Some of these clones should
contaLn the entire coding region for a particular protein
even though it is not in frame with the beta galactosidase
expression system.
These clones may be detected using DNA hybridization
probes derived from the clones already picked by antibody
methods and known to correspond to particular mycoplasma
proteins. The insert fragments from these clones is "nick
translated~ using E. coli DNA polymerase to incorporate 32p_
labeled deoxynucleotides into the DNA. This labeled DNA is
then used as a radioactive probe to select an homologous ~.
hyo~neumoniae sequence from the recombinant lambda gtll
library. Phages selected from the recombinant library by
this method are plaque purified, DNA is prepared, and the M .
hvo~neumoniae specific insert is mapped with various
restriction endonucleases. The resulting map is compared
with a similar map derived from the initial clone to confirm
the identity of the new genomic phage.
Because there are no introns in the prokaryotic
genes, one can determine, from the size of the protein
encoded, how much DNA to either side of the labeled DNA must
be included to be sure that the entire gene is included. The
entire gene may not be contained in a single clone; however,
it is possible for anyone skilled in the art to obtain the
entire gene. This could be done by l'walkingl' along the M.
hvo~neumoniae genome by isolating phages that contain
flanking M. hvoPneumoniae genomic DNA using the method by
Bender, E. et al. in J. Mol. Biol., 168:17-33 (1983). The
present inventQrs have provided the entire gene for Pr~teln r
using methods similar to those discussed above. See
Example VIII.
S V BSTITVTE .~ ~FF~
WO91/155g3 PCT/US91/02060
2 ~ 7 .~
-45-
VI. PROCEDURES FOR IDENTIFICATION
OF CLONES CORRESPONDING
TO SURFACE PROTEINS
Proteins which are exposed on the surface of a
mycoplasma cell have been shown to be susceptible to
digestion by a protease such as trypsin when whole, intact
cells are lightly treated with that enzyme (Klinkert, M.,
Herrmann, R., and Schaller, H., Infection and Immunity, 49;
329-335 (1985)). This technique, in combination with the
elution of antibodies from clones, allows the rapid
determination of whether a particular clone corresponds to a
trypsin sensitive surface protein. Total proteins from
trypsinized and non-trypsinized mycoplasma cells are placed
in adjacent lanes and separated by SDS polyacrylamide slab
gel electrophoresis. The displayed proteins are then
electroblotted onto nitrocellulose membrane by the western
blot procedure. This blot is then probed using antibodies
from a polyclonal serum which have been affinity purified
rrom a specific clone using the antibody elution technique
described above in Example II-B.
The specific mycoplasma protein on the Western blot
corresponding to the clone will be revealed by staining of
the bound antibody in the lane with proteins from non-
trypsinized cells, showing up as a specific stained band. If
that protein is trypsin sensitive, the corresponding position
in the lane with proteins from trypsinized cells will be
blank, whereas a non-trypsin sensitive band will stain as in
the untreated cells. The present inventors have shown
trypsin sensitivity for Proteins A, B. C, D and E, indicating
that they are surface proteins.
VII. DNA SEQUENCE OF CLONE R69,
WHICH ENCODES PART OF PROTEIN C
The recombinant DNA lambda gtll clone R69 encodes
part of protein C. The M. hvoPneumoniae DNA insert in this
clone was sequenced. The in~ert in this clone was excised
with EcoRI and subcloned into the single stranded sequencing
SUBSTITUTE SHEEl
WO9l/15593 pcT/ussl/o2o6o
-46-
~ector M13mpl8 (See Example VIII-B for references to this
vector and sequencing procedures). Subclones with the insert
in each orientation were isolated and the sequence determined
in both directions.
The 5'-->3' orientation of the R69 insert and the
proper reading frame were determined by sequencing directly
from the double stranded lambda gtll-R69 clone (Chen and
Seeburg, DNA, 4:165(1985)) using lambda gtll forward and
reverse primers (NEW ENGLAND BIOLABS).
The DNA insert in this clone is 522 nucleotides long
and encodes 173 amino acids. The DNA sequence and translated
amino acid sequence which comprises part of protein C are
depicted in Figure 1. This DNA sequence is contained
entirely within the coding sequence of Protein C, starting at
nucleotide 455 and extending to nucleotide 976 in the
sequence of the whole gene shown in Figure 4.
VIII. ISOLATION OF CLONE pUC18::2BC2
AND SEOUENCING OF GENE FOR PROTEIN C
A. ISOLATION QF CLONE pUC18::28C2,
CONTAINING THE GENE FOR PROTEIN C
1. CONSTRUCTION OF THE pUC18 GE~OMIC LIBRARY
The pUC18 M. h~o~neumoniae genomic library was
constructed to provide a recombinant library with larger
in~ert fragments than the lambda gtll library (Example I), so
that the entire Protein C gene would be contained on a single
clone.
Genomic MYco~lasma hYo~neumoniae DNA was partially
digested with the restriction endonuclease Sau3a and size
fractionated on a 35 ml 10->40% Sucrose gradient in lM NaCl,
0.02~ Tris pH 8, 0.005 M EDTA. The digested DNA sample was
layered on top of the gradient and centrifuged at 100,000 x g
for 24 hours. One ml fractions were collec~ed from the
bottom of the gradient and samples from selected fractions
were electrophoresed on a O.5% agarose gel in TAE buffer
SUBSTITUTE SHEEl
WO91/15593 PCT/US91/02060
2~7~13~
--47--
(O. 04 M Tris Acetate, Q. 001M EDTA) alongside DNA size
standards and stained with Ethidium Bromide to determine the
size range of DNA fragments in each fraction. Fractions
enriched for DNA fragments in the 8-12 kilo basepair range
were pooled, concentrated and dialyzed against TE8 buffer
(0.0lM Tris, 0.00 lM EDTA pH 8)~
The vector, pUC18, was prepared by complete digestion
with the restriction endonuclease BamH1, followed by
dephosphorylation with the enzyme Calf Inte~tinal Phosphatase
(O.01 Units of BOEHRINGER-MANNHEIM Calf Intestinal
Phosphatase per pmol of vector, 2 X 30 min at 37C, in CIP
buffer lmM ZnCl2, lmM MgC12, lOmM Tris Cl pH 8.3). This
treatment was followed by phenol extraction, ethanol
precipitation and resuspension in TE8 buffer.
Four hundred and fifty (450) ng of the size selected
genomic fragments was ligated into 50 ng of the BamHl
digested pUCl8 vector in 20ul ligation buffer (0.066M Tris pH
7.5, 005M MgCl2, Q Q05M Dithiothreitol, O.OOlM Adenosine
Triphosphate) with 5 units of T4-DNA ligase (PHARMACIA) for 5
hours at room temperature. Competent DH5~ cells (prepared
by the Hanahan method, Hanahan, J. Mol. Biol., 166:557 (1987)
were transformed with the ligation mix and spread onto Luria
agar plates containing 50 ~g/ml ampicillin, O.OOlM IPTG
(isopropylthio-~-D-galactoside) and 40~g/ml X-gal (5-bromo-
4chloro-3-indoylyl-~-D-galactoside), and the plates were
incubated at 37C overnight. The white colonies were
toothpicked onto fresh Luria agar Ampicillin plates in
gridded arrays of 48 per plate, and grown at 37C. There
were 36 arrays picked for a total of ~1700 independent
transformants. Each array was then transferred to several
nitrocellulose discs on Luria agar Ampicillin plates using a
48 tine prong apparatus and grown overnight at 37C.
SUBSTITUTE SHEE7
WO91/15~3 PCT/US91/02060
-48-
The nitrocellulose discs with the arrays of colonies
growing on them were processed for probing by DNA
hybridization. Colonies were lysed and DNA denatured by
floating the discs on puddles of 0.5 M NaOHj l.5 M NaCl for
0.5-l min followed by neutralization in l.5 M NaCl, 0.5 M
Tris Cl pH 7.4 for l-3 min followed by a rinse in 2 X SSC.
The discs were blotted between sheets of Whatman 3MM paper,
then baked at 80C for 2 hours. Discs were then stored at
room temperature until probed.
2. SCREENING THE pUCl8 LIBRARY
FOR THE PROTEIN C GENE
A 3 2 p labelled hybridization probe was made from
the M. hvo~neumoniae DNA insert in the R69 clone. The source
of this insert was the clone pSEV6::R69, which was
constructed by "cassette" subcloning of the insert in ~gtll-
R69 into pSE~6, as described in Example II-B. The 0.6 kb
insert fragment was generated by dige~ting the pSEV6:tR69
plasmid DNA with the restriction endonuclease EcoRl,
releasing the insert, followed by separation by agarose gel
electrophoresis (0.7% agarose, TAE buffer, with gel and
buffer containing 0.5 ~g/ml Ethidium Bromide, 30V, 3h). The
insert band was visualized under long wave W light, a slit
was made with a scalpel blade just below the desired band and
a small piece of Whatman NA50 paper was inserted into the
slit below the band. With further electrophoresis the insert
fragment migrated onto and bound to the NA50 paper, which was
removed and washed in NET buffer ~20mM Tris pH 8, 0.lmM
EDTA). The fragment was eluted from the paper in NET buffer
containing l.0M NaCl, extracted with butanol, precipitated in
ethanol, and finally resuspended in TE buffer. The purified
fragment was labelled by nick translation with 3 2p_~ dC
using a BIORAD nick translation kit, following the
instructions for that kit. The labelled fragment was
separated from the unincorporated nucleotides by gel
filtration using BIORAD P30 resin in TE buffer.
SUBSTITUTE SHEE7
wosl/lssg3 PCT/US91/02060
2~7~
-49-
The hybridization mix contained 50% formamide, 5x
SSPE, 1% SDS, 0.1~ Sodium Pyrophosphate, 0.15 mg/ml tRNA,
O.0125 mg/ml sonicated salmon sperm DNA. To this was added
400,000 dpm/ml of the labeled probe, after it was denatured
by incubation in a boiling water bath for 5 minutes, then
chilled. A11 36 of the gridded arrays were probed with this
mix. Hybridization was carried out in a shaking incubator at
42C for 16 hours. The filter discs were then washed 4 X 15
min in O.lX SSPE, 1~ SDS at 65C, blotted dry and
autoradiographed on KODAK XAR-5 X-ray film at -70C using a
DUPONT CRONEX LIGHTNING PLUS INTENSIFYING SCREEN. The
positions with positive dar~ signals were marked on the film
and the corresponding clones picked from the master plates,
streaked out for single colonies, and three such colonies for
each positive clone were retested by the same fil~er
hybridization process described above. After rescreening,
~everal purified positive clones (pUC18::6E6, pUC18::981,
pUC18::30C6, pUC18::19A3, pUC18::16H2; pTJC18::28C2) were
grown in liquid culture (Luria broth with 50~g/ml
ampicillin) and DNA isolated using a miniprep method (Holmes
& Quigley, Anal. Biochem.l 144:193 (1981)). Restriction maps
of these clones were made and compared with each other and
aligned to determine the overlap between the clones. Also
the gels used for this restriction analysis were blotted to
nitrocellulose and probed with the R69 insert probe using the
Southern blot procedure (Southern, J. Mol. Biol., 98:503
(1975)), in order to determine the position of the R69 probe
segment on the large pUC18 clones. One of these clones,
pUC18:28C2, was determined to carry the entire gene for the
85 kd protein because it contained more than 2.5 kilobases of
DN~ on either side of the R69 probe segment (the entire gene
should be encoded by ~2.4 kilobases). See Figure 9 for a map
of this clone. Clone pUC18::28C2 was used as a source of
subclones for sequencing the gene and for site specific in
vitro mutagenesis to alter specific nucleotides.
SUBSTITUTE SHEEl
wO9l/l5593 PCT/~S91/02060
2 ~ -50-
B. DNA SEQUENCING OF C,ENE FOR PROTEIN C
Approximately 4500 base pairs of the genomic clone,
pUC18::28C2, sufficient to span the entire gene for Protein
C, was sequenced. The sequencing strategies is shown in
Figure 9. Different appropriate restriction fragments from
pUC18::28C2 (e.g. K~nI/H~aI, H~aI/HPaI, HDaI/HindIII, H~aI~
PstI, HindIIIJHindIII, H~aI/B~lII, HindIII/PstI etc.) were
subcloned into the M13mpl8 or M13mpl9 phage vectors (Messing
et al., Gene, 26:101-106, 1983) and sequenced using the
enzyme sequenase, specifically engineered for chain-
termination DNA sequencing by the procedure of Tabor and
Richardson (Tabor et al., PNAS 84:4767-4771, (1987)). DNA
sequenase sequencing kits were purchased from United States
Biochemical Corp. and the reactions were performed ~ccording
to the manufacturer's instructions. Reactions were analyzed
on 6% acrylamide buffer gradient gels (Biggin et al., PNAS,
80:3963-3965, (1983)). DNA sequences were analyzed using the
Pustell and Xafatos ~Pustell et al., Nucleic Acid Res.,
12:643-655, (1984)) algorithms obtained as software provided
by INTERNATIONAL BIOTECHNOLOGIES INC. (New Haven, Conn.).
DNA sequence for the coding region of the gene for Protein C
was obtained for both strands of the DNA. Primers used for
the DNA sequencing reactions were either the M13 universal
primer or synthetic oligonucleotides designed from sequences
obtained using the APPLIED BIOSYSTEM DNA Sequencer.
C. AMINO TERMINAL SEQUENCING OF
NATURAL PROTEIN C
The gel purified Protein C in NH~HCOg buffer (See
Example X-B below) was applied directly to a glass fiber
filter and dried under a stream of argon gas to remove the
NH~HCOg. The ~equencer with this sample was precycled and
then sequenced. The amino-terminal sequence obtained was
QQQEANSTNSSP, which matched the translated DNA sequence
beginning at nucleotide 1801 of the pUC18::28C2 insert,
defining the 5' end of the gene.
SUBSTITUTE SHEET
WO91/15593 PCT/US91/02060
2~78131
-51-
D. AMINO ACID SEQUENCING
OF PEPTIDES FROM PROTEIN C
1. GENERAL STRATEGY
Since much of the DNA sequence of the 85 kd gene was
already known (See Example VIII-B), obtaining the entire
amino acid sequence was not necessary. However, it was
necessary to obtain enough amino acid sequence to be able to
determine the proper reading frame of the DNA sequence, in
order to facilitate locating the positions of inframe UGA
codons in the coding sequence.
2. PURIFICATION OF PROTEIN C
FOR AMINO ACID SEQUENCING
Highly purified Protein C was obtained using a
combination of ion exchange column purification followed by
preparative gel purification by SDS-PAGE. Starting with the
7S extract (See Example X-A3), the Protein C was partially
purified using a Pharmacia Nono Q ion exchange column using
~ne CHAPS method described in Example X-B2. The column
fractions enriched for the Protein C were pooled.
Preparative gel purification was performed es~entially as
described in Example X-B4, except that the sample was reduced
with 2.5% 2-mercaptoethanol before loading onto the gel. The
protein used for endoprotease digestions was eluted from the
gel slices in 0.5 X running buffer ~C.0l25 N Tris, 0.096 M
glycine, 0.05% SDS), as described in Example X-B4. For
direct amino terminal sequencing (see Example VIII-C), the
gel slices were soaked in 0.05 M NH~C09 1 0.1% SDS, then
placed in ISCO sample concentrator cups and eluted in the
same buffer at 50 V for 5 hours. The concentrated sample was
then diluted 50 fold in 0.0l M NH~HCO9, 0.0S% SDS and then
reconGentrated in ISCO s~mple concentxator cups in the same
buffer (50 V, 5 hours).
SUE~STITUT SHEEl
WO91/15593 PCT/US91/02060
~ 3 -52- '
3. GENERATION AND PURIFICATION
OF PEPTIDE FRAGMENTS
For cleavage at lysine, the protein was digested with
2~ (w/w) endoproteinase Lys-C (BOEHRINGER-MANNHEIM) in 0.1 M
Tris, pH 8.6, at 37C for 15 h. The protein was also
digested with 2~ (w/w) Chymotrypsin (BOEHRINGER-MANNHEIM) in
0.25 M Ammonium Bicarbonate buffer, pH 7.8, for 4 h at 37C.
The peptides generated were purified by reverse phase HPLC on
a 5 ~m Vydac C4 (4.5 x 250 mm) column (The Separations
Group) in 0.1% TFA in water with a 0-->50% acetonitrile
gradient (0.5% per minute). Isolated peptides were applied
to a slass fiber filter and sequenced.
4. SEQUENCING OF PEPTIDE FRAGMENTS
Automated sequence analyses were performed on APP~IED
BIO-SYSTEM 477A pulsed liquid-phase and APPLIED BIOSYSTEM
470A gas-phase sequences equipped with on-line 120A
phenylthiohydantoin amino acid analyzers using standard
program parameters and analyzer solvents. Sequence analyses
were carried out on 30-100 pmol of sampie, and repetitive
yields of 91-95% were obtained.
E. UGA ENCODES TRYPTOPHAN
IN M. HYOPNEUMONIAE
The Protein C peptide YLKQNEWD contains a tryptophan
(W) in the seventh position which aligns with a TGA codon in
the DNA sequence (See Figure 4, page 3, nucleotides #1411-
1413). This proves that TGA (UGA in the RNA) encodes
tryptophan in M. ,hyo~neumoniae as has been shown in other
mycoplasma species.
IX. CONSTRUCTION OF EXPRESSION CLONES
TO PRODUCE RECOMBINANT PROTEIN C
(TRUNCATED AND FULL LENGTH VERSIONS)
To express Protein C in E. coli, it was necessary to
mutagenize the UGA codons in the Protein C gene to UGG (the
E. coli tryptophan codon) and to reconstruct the 5' end of
the gene to facilitate insertion into the expression vector.
The expression construct pT5T::M851 which encodes the
S V~STITuTE S ~F~
wosl/1ss93 PCT/US91/02060
-53- 207~
truncated version of Protein C was made first. This
construct contains the first two UGA codons which were
mutagenized to UGG. Later a DNA fragment containing the C-
terminal region of the gene and the third UGA (mutagenized to
UGG) was ligated onto this construct to ob~ain pT5T::M852,
which encodes the full length recombinant Protein C. Below
is a detailed explanation of how this was accomplished.
A. OLIGONUCLEOTIDE-DIRECTED SITE-SPECIFIC
IN-VITRO MUTAGENESIS TO CHANGE UGA TO
UGG CODONS USING GENETIC SELECTION
Oligonucleotide-directed site-specific ln vitro
mutagenesis was carried out to change the UGA to UGG codons.
Mutagenesis was carried out using the MUTA-GENE IN VITRO
M m AGENESIS KIT from BIORAD based on a method described by
Runkel (Kunkel et al., Methods EnzYmol., 154:367-382 (1987)).
The host eell used for genetic selection for mutagenesis is
the E. coli strain CJ236 (Genotype:dut, ung, thi, rel Al,
pCJlO5~capr]) which provides a very strong selection against
the non-mutagenized strand of a double-stranded DNA due to
the dut (dUTPase) and ung (uracil N-glycosylase) mutations.
Template DNA, substituted with uracil and used for
mutagenesis, is selectively destroyed when transformed into
host cells that contain wild-type ung loci, such as JMl03 in
this case, thus allowing preferential replication of the
newly synthesized mutated DNA.
Mutagenesis of the three UGA codons was carried out
in two parts. The first part involved the simultaneous
changing of the A to G in the first two UGA codons
(nucleotide positions 231 and 1068) contained in the DNA
fragment from the beginning of the gene for Protein C to the
HindIII recognition site at nucleotide #1294. The second
part involved the changing of nucleotide A to G in the third
UGA codon at nucleotide position 1413.
SUBSTITUTE SHEEl
WO91/15~93 P~T/US91/02060
Q~
-54-
To perform mutagenesis on the first two UGA codons
described above, clone pSEV6::R68SKH was used. pSEV6::R68SKH
was obtained by joining the ~2.1 kb HPaI f ragment f rom the
genomic clone pUC18::28C2 (see Figure 9) to the H~aI site in
pSEV6::R68. The expression clone pSEV6::R68 is a ~-
galactosidase fusion clone which encodes part of Protein C.
It was derived from the ~gtll clone, R68, by "cassette~
subcloning into the plasmid pSEV6 (See Example III-B). The
insert in R68 begins before the 5' end of the Protein C
coding sequence (as defined by the amino-terminus of the
protein)l but is in frame with the protein coding sequence,
making a fusion protein which is partially Protein C and
partially from the region upstream of the Protein C coding
sequence.
The resulting -2.4 kb SstI/HindIII fragment
containing the 5'-end to the above-mentioned HindlII site of
the gene for Protein C was subcloned into M13mpl8 to obtain
single-stranded DNA template for mutagenesis. Two
oligonucleotides were designed to simultaneously change the
two UGA codons to UGG's in one mutagenesis experiment. The
oligonucleotide
S' GGGAAATTTTGTTTTCCAACCCAAGCATCTAAAAGTGCCTCG 3'
was used to substitute the A at nucleotide position 231 (Fig.
4) and the oligonucleotide
S' GATCTTCGTCTTGGAGTTGACTCCAACTTGCAAAATTTAATC 3'
was used to substitute the A at nucleotide position 1068
(Fig. 4). These two oligonucleotides are the complement of
the coding strand shown in Figure 4 (and also read in the
opposite orientation). The crucial substituted nucleotide in
the oligonucleotide is underlined.
SUBSTITUTE S~El
WO91/tS~93 20 71~1 3
-55-
One of five clones picked and sequenced (clone S9e)
in the mutagenesis experiment was confirmed to have both of
the UGAs changed to UGG's. The correctly mutagenized SstI/
HindIII fragment was subcloned back into the original vector,
pSEV6:R68SKH, and the mutagenized clone was designated as
pSEV6::R68SKHM. The mutagenesis was also confirmed by
increase in size of the ~-galactosidase fusion protein,
expected for replacing the E. coli termination codons (UGA)
with tryptophan (UGG) codons.
To mutagenize the A to G }n the third UGA codon at
nucleotide position 1413 (Fig. 4), the oligonucleotide
S' CTATCTAAAACAAAATGAATGGGATCAAGTTAAAACAACAAATAATGGCC
3'
was used. This oligonucleotide reads the same as the coding
strand (except for the A - G substitution) because the single
strand clone used to do the mutagenesis was the opposite
strand.
To mutagenize this third UGA to UGG, the ~2kb HindIII
fragment from pUC18::28C2 (Ree Fig. 9) was cloned into
M13mpl9 and mutagenesis was carried out using the MutaGene
kit according to manufacturer's specifications. Nine of 10
clones sequenced were confirmed to have the A changed to G
and clone 2Ha was used for the remaining experiments. The
HindIII fragment from clone 2Ha was ligated into HindIII cut
and dephosphorylated pSEV6::R68SXHM. The resulting plasmid,
designated pSEV6::M852a-1, contains the entire gene for
Protein C with the three UGA codons having been changed to
UGG's. The mutagenesis was again confirmed by further
increase in size of the ~-galactosidase fusion protein.
B. RECONSTRUCTION OF 5'-END
3F THE GENE FOR PROTEIN C
Using the mutagenized clone pSEV6::R68SKHM, the 5'-
end of the gene for Protein C was reconstructed for
expression of a nonfused version in E. coli. Restriction
enzyme search of the DNA sequence of Protein C gene showed
that there are three S~eI sites within the first 120
nucleotides at the 5'-end of the gene (see Fig. 9).
SUBSTITUTE SHEE~
.
W091/15~93 PCT/US91/OtO6
-56-
~ligonucleotides were designed to rebuild the amino-terminus
of the gene, taking advantage of the third SpeI site to join
- the oligonucleotides to the remaining part of the gene. In
designing the oligonucleotides, the ~vcoPlasma codons were
changed to E. coli-preferred codons, the first two S~eI sites
were eliminated, and an EcoRI and a NheI restriction sites
were engineered in, all without changing the original amino
acid sequence of the Protein C. The four oligonucleotides
used were:
l) oligonucleotide NA:
5'GATCC&ATCTTGGAGGATGATTAAATGCAGCAGCAGGAAGCAAACTCCACGAAT-
TCTAGCCCGAC 3'
2) Oligonucleotide NB:
5'TCGGGCTAGTCGGGCTAGAATTCGTGGAGTTTGCTTCCTGCTGCTGCATTTAAT-
CATCCTCCAAGATC5 3'
3) Oligonucleotide NC:
5'TAGCCCGAGCCCGAGCCCGACTAGCCCGAGCCCGGCTAGCCCGAGCTCCAGCCCGA-
GCCCGA 3~
4) Oligonucleotide ND:
5'CTAGTCGGGCTCGGGCTGGAGCTCGGGCTAGCCGGGCTCGGGCTAGTCGGGCTCGGG
3'
- Oligonucleotides NA and NB are complementary to each
other and oligonucleotides NC and ND are complementary to
each other. To rebuild the 5'-end of the gene for Protein C,
. the four oligonucleotides were kinased, NA and NB were
annealed to each other and NC and ND were annealed to each
other. pSEV6::M851 was digested with S~eI and the digested
DNA was ligated to annealed oligos NC and ND. This DNA was
then ligated to annealed NA and NB oligos to complete the
reconstruction of the 5~-end of the gene. The ligated DNA
SUE~STltUTE SHEEl
WO91/1ss~3 PCT/US91/02060
2 0 ~
--57--
mix was digested with BamHI and HindIII to obtain the DNA
fragment containing the 5 '-end of the gene to the HindIII
recognition sequence at nucleotide position 1294. This DNA
fragment was used for expression of the truncated form of
Protein C described below. The reconstructed region of 5'-
end is shown in Figure 5.
C. RECOMBINANT EXPRESSION OF PROTEIN C
USING AN EXPRESSION VECTOR BASED ON THE
T7ll PROMOTER SYSTEM (VECTOR pT5T )
1. DESCRIPTION OF pT5T
The T7 promoter based expression vector pT5T is
essentially the same as pJU1003 (Squires, et al., J. Biol.
Chem., 263:16297-16302 (1988)), except that there is a short
~tretch of DNA between the unique BqlII site 5~ to the T7
promoter and the ClaI site in the tetracycline resistance
gene. The sequence of this DNA is:
ATCGATGATA AGCTGTCAAA CATGAGAATT GAGCTCCCCG GAGATCCTTA
GCGAAAGCTA
ClaI
AGGATTTTTT TTAGATCT
BglII
2. CONSTRUCTION OF THE EXPRESSION
VECTOR FOR THE TRUNCATED PROTEIN C
The vector pT5T was linearized with BamXI and HindIII
restriction enzymes and gel-purified. The DNA fragment, from
the rebuilt 5'-end of the protein C gene, to the HindIII site at
nucleotide position 1294 excised from clone pSEV6::R68SRHM (See
Example IX-Al) with BamHI and HindIII containing the first two
mutagenized UGA codons, was ligated to form the expression
constru~tion pT5T::M851.
3. CONSTRUC~ION OF THE EXPRESSION
VEC~QR FQ~ ~HE FT~L-LE~3GTH ~ROTEL~ C
For expression of the entire Protein C protein, the ~2kb
HindIII gel-purified fragment texcised from clone 2Ha, see
Example IX-A), containing the third mutagenized UGA codon and
the C-terminus of the gene, was ligated to pTST::M851 (digested
with HindIII restriction enzyme and treated with alkaline
SUBSTITU'TE SHEE3
WO91/15~93 PCT/~S91/02060
-58-
phosphatase to dephosphorylate the vector to minimize self-
ligation of the,vector). Because the HindIII fragment could
ligate to the digested vector in either orientation,
transformants were restriction site mapped to ascertain the
correct orientation of the HindIII fragment. This resulted in a
construct designated pT5T::M852, which is illustrated in
Figure 10.
4. EXPRESSION OF RECOMBINANT
PROTEIN C (BOTH TRUNCATED PROTEIN C
AND THE FULL-LENGTH PROTEIN C)
Both pT5T::M851 (truncated Protein C) and pT5T::M85~
(full-length) were transformed into the E. coli strain BL21/DE3
for expression. This strain (described in Studier and Moffat,
J. Mol. Biol., 189:113-130 (1986)) contains the T7 RNA plymerase
gene under control of the IPTG inducible lac promoter on a non-
excisable lysogenic ~ bacteriophage. The clone found to be
expressing an IPTG-inducible protein migrated at a molecular
weight of ~50kd (Truncated Protein C) by pTST::M851 is
designated pT5T: :M851-B2~, and the clone found to be expressing
an IPTG-inducible protein migrating at a molecular weight of
~85kd (full length Protein C) by pT5T::M852 is designated
pT5T::~852-1. pTST::M852-1 produces a recombinant protein which
co-migrates on SDS polyacrylamide gels with natural 85kd protein
isolated from mycoplasma. Both the short 85kd and the full-
length 85kd recombinant proteins are immuno-reactive with sera
from pigs immunized with gel-purified natural 85kd protein on
Western blots (See Example X-J).
DNA sequencing of pT5T::M851 and pTST::M852 confirmed
that the sequences of the recombinants were correct. Amino
terminal amino acid sequencing of the intact recombinant full
length Protein C yielded the sequence MQQQEANSTNSSPT confirming
the cO~ ect in ~ial sequencê with ~ ret" o~in~ âddêd to th~
amino terminus (See Figure 4). To determine this sequence, a
sample of the insoluble pellet following French Press disruption
of the cells (See Example X-C.) was solubilized in sample buffer
SUBSTITUTE SHEEl
WO91/15~93 PCT/US91/02060
2071~ 31
-59-
and electrophoresed on a polyacrylamide gel using the MZE system
3328.IV, described by Moos et al. (J. Biol. Chem., 263:6005-6008
(1988)). Separated proteins were transblotted to a PVDF
Immobilon membrane and visualized by Coomassie staining. The
region containing the recombinant Protein C band was cut out of
the membrane, destained, inserted into the sequencer, and
sequenced (See Example VIII-D4).
Expression and purification of full length and truncated
recombinant Protein C are described in Example X-C and X-D
respectively.
X. VACCINATION EXPERIMENTS
A. PROTEIN EXTRACTS FROM MYCOPLASNA
CELLS USED AS VACCINES
1. GROWTH AND HARVEST OF
M. HYOPNEUMONIAE CELLS
M. hyo~neumoniae strain 64C was grown in Friis medium
(Friis, Nord. Veterinaer Med., 27:337-339, (1975)) at 37C in
shaker flasks ~1200 ml in 21 flask) at 230 rpm. Cells were
grown to ODG~o = 0.2-0.3 which took 2.5-3 days and was
accompanied by a shift in color of the medium from red to
yellow/orange and visible turbidity of the culture. Cells were
har~ested by centrifugation at 16,000 x g for 15 minutes at 4C.
Cells were resuspended in 1/10 volume 0.25 M NaCl and then
centrifuged again under the same conditions. The final cell
pellet wa~ resuspended in 1/50 volume 0.25 M NaC1 at
OD~o ~ 10.
2. LOW pH (Sl) EXTRACTION OF
PROTEINS FROM M. HYOPNEUMONIAE CELLS
To M. hvo~neumoniae cells harvested and resuspended as
described above in Example X-Al, 1/4 volume of 10 mM glycine, pH
2.0 was added and mixed with the celis by rocking for 15 minutes
at 4C. The final pH of the mix was 2.5. The mix was then
centrifuged at 48,000 x g for 15 minutes at 4C. The
supernatant was removed and was called the Sl extract. The Sl
extract contains a variety of proteins depicted in the
photograph of a SDS-polyacrylamide gel in Figure 8. The major
Sl.lBSTITUTE SHEE~
WO91/15593 PCT/US9]/02060
-60-
protein components are 87 kd, 85 kd (Protein C), 65 kd, 50 kd,
as well as several other minor proteins. The Sl extract was
concentrated and desalted using an AMICON ultrafiltra~ion cell
(stirred cell type) fitted with an AMICON YM30 DIAFLO
ULTRAFILTRATION membrane operated at 40 psi at 4C. Initial
concentration of the extract to l/l00 of the starting volume
took several hours and left a thick protein coating on the
filtration membrane. When l/2 the starting volume of 2 mM
glycine pH 2.5 was added to the vessel and stirred, the protein
coating released from the membrane in sheets which dissolved in
the 2 mM glycine. After redissolving, the second concentration
step to l/l00 of the starting volume proceeded rapidly at 40
psi, usually taking <l hour. This concentrate was removed from
the vessel and the membrane washed 2X with 2-3 ml of 2 mM
glycine pH 2.5 and the washes were pooled with the concentrate
resulting in a desalted concentrate that was about l/50 the
original volume. This concentrated Sl extract, called Slc, was
indistinguishable from the Sl extract in its protein
composition, as judged by the protein bands on Coomassie blue
stained SDS polyacrylamide gels.
3. FRACTIONATION OF PROTEINS
BY PH PRECIPITATION
When the pH of the concentrated, desalted Slc was raised
to pH 7.0 by the addition of l M MOPS (3-[N-Morpholio]propane-
sulfonic acid) pH 7 to 40 mM, a fine white precipitate formed.
This precipitate was removed by centrifugation (15 min, 48,000 x
g, 4C) and then redissolved in 2 m~ glycine pH 2.5. The
supernatant, called 7S, contained about 40% of the total protein
and was enriched for the 85 kd and 65 kd proteins with about
half of the 50 kd protein and several minor proteins as well.
The redissolved pellet, called 7P, contained the remaining 60%
of the protein and was enriched for the 87 kd protein with half
of the 50 kd protein and several minor proteins. Neither
fraction was completely free of proteins contained in the other
fraction. The proteins in each fraction are depicted in the
Coomassie stained gel in Figure 8.
SUBSTITIJTE SHEEl
.
WO91f15~93 PCT~US91/02060
-61- 7
B. PURIFICATION OF PROTEIN C
FROM M. HYOPNEUMONIAE CELLS
1. ION EXCHANGE CHROMATOGRAPHY
The natural Protein C was purified by ion exchange
chromatography using two different methods: 1) the CHAPS method
utilized a buffer containing the zwitterionic detergent CHAPS
and the 7S extract as the starting material; and 2) the Urea
method utilized a buffer containing 6M Urea and the Slc extract
as the starting material. Purification using either of these
agents was adequate, though the urea containing buffer gave
somewhat better resolution in elution profiles. Without any
detergent or denaturant, resolution of elution peaks was
extremely poor.
2. CHAPS METHOD
The starting material for purification of the natural
Protein C was the extract known as 7S-- the pH 7 supernatant
derived from the concentrated low pH extract -- Sl (see
descriptions of extracts, Example X-A. The 7S is enriched for
the 85 kd protein (Protein C) as well as a 65kd protein and a 50
kd protein and also contains other minor contaminants.
Ion exchange chromatography was performed using a
PHARMACIA Mono Q HR5/5 column ( 1 ml bed volume) connected to a
PHARMACIA FPLC system. The CHAPS buffer con~isted of 0.05%
CHAPS (3-[(3-Cholamidopropyl)dimethylammonio]-l-
propanesulfonate), 0.02 M ~IS-TRIS (bis[2-
Hydroxyethyl]iminotris-[hydroxymethyl~methane), pH 6Ø A
typical szmple consisted of 34 ml 7S extract, 3.05 ml H20, 0.76
ml lM BIS-TRIS pH 6.0, 0.l9 ml l0~ CHAPS, for a total of 38 ml
with 0.02 M BIS-TRIS pH 6, 0.05~ CHAPS. This sample was
filtered through a GELMAN ACRODISC disposable filter assembly
with a Q.2rm pors ei~e. ThQ s~mple waC loadQd onto the col1-m~
at l ml/min, the column was washed with 5-l0 column volumes of
CHAPS buffer, then eluted with a linear gradient of NaCl`in the
same buffer. The gradient ran from 0 to 0.25 m NaCl o~er a
volume of 40 ml. The 85 kd protein eluted at 0.08 -0.l0 M NaCl
with some trailing of the peak into the higher [NaCl] fractions.
SUBSTITUTE SHEFl
.
~.:
WO91/1S59~ PCT/US91/02060
~ -62-
Samples from selected fractions were analyzed by SDS-PAGE and
the gels were silver stained to reveal those fractions
containing the 85 kd protein. The fractions which were enriched
for the 85 kd protein were pooled. These pools contained >60~
85 kd protein and the rest a variety of contaminating proteins,
as estimated visually by Coomassie stained gels. Protein
concentrations were determined using a BIORAD Protein Assay kit.
3. UREA METHOD
The urea buffer consisted of 6M urea (BRL, Ultrapure,
Enzyme grade) in 0.02 M BIS-TRIS pH 6Ø The starting material
was the concentrated low pH extract -- the Slc. A typical
sample contained 4ml Slc, 3.8 ml H20, in which was dissolved
3.85 g Urea. Aft~r the Urea was dissolved, 0.2 ml lM BIS-TRIS
pH 6.0 was added, yielding -lO ml of solution containing 6M
Urea, 0.02 M BIS-TRIS p~ 6Ø Thi~ sample was filtered through
a GELMAN ACRODISC disposable filter assembly with a O.2~m pore
size. The sample was loaded onto the Pharmacia Mono Q HR 5/5
column at 1 ml/min, the column was washed with 5-10 column
volumes of Urea buffer, then eluted with a linear gradient of
NaCl in the same buffer. The gradient ran from O to 0.25 M NaCl
over a volume of 40 ml. The 35kd protein eluted at 0.04 -0.08 M
NaC1 in fairly sharp peaks without much trailing into higher
fractions. Samples from selected fractions were analyzed by
SDS-PAGE and the gels were silver stained to reveal those
fractions containing the 85 kd protein. The fractions which
were enriched for the 85 kd protein were pooled. These pools
contained 50% 85 kd protein with a ma~or contaminant at ~50 kd
and a variety of minor contaminating proteins! a~ estimated
visually by Coomassie stained gels. Protein concentrations were
determined using a BIORAD Protein Assay Kit.
4. GEL PURIFICATION
Fu--theL purilicatiun of the 8; kd protein w~s
accomplished by preparative SDS polyacrylamide gel
electrophoresis (SDS-PAGE). The resolving gel was 8 cm long by
14 cm wide by 3 mm thick and was 7.5% acrylamide (7.3~
acrylamide: 0.2~ N,N'-Methylene-bis-acrylzmide) in 0.1% SDS,
SUBSTITUTE SHEEl
WO91/15593 PCT/US91/02060
_~3_ 2~7~
0.375 M Tris-HCl pH 8.8. The stacking gel was l cm long with
the same width and thic~ness as the resolving gel and was 4.5%
acrylamide (4.38~ acrylamide:0.l2% N,N'-Methylene-bis-
acrylamide) in 0.1% SDS, 0.125 M Tris HCl pH 6.8. The Running
buffer contained 0.025 M Tris base, 0.192 M glycine, 0.1% SDS,
pH 8.3. The sample buffer contained lC% w/v glycerol, 3% SDS,
0.0625 M Tris-HCl pH 6.8. No reducing agent or dye was used for
these samples. The sample (pooled column fractions enriched for
the 85kd protein) was mixed with an equal volume of sample
buffer and heated in a boiling water bath for 10 min, then
cooled to room temperature. Five ml of this mix was loaded into
the gel apparatus and electrophoresed at 50 mA until the ion
front reached the bottom of the gel t~2.5 hours).
To determine the location of the protein band in the gel
a special blotting procedure was used. When the gel was
finished running, it was removed from the electrophoresi~
apparatus and laid horizontally on a glass plate, and the
stacking gel removed by cutting with a razor blade. On the
upper exposed surface of the gel was laid a piece of wetted (in
H20) nitrocellulose ~heet (Schleicher & Schuoll, BA-83, 0.2 ~m
pore size), cut slightly larger than the gel. Over this was
laid a sheet of wetted Whatman 3MM paper, followed by 2 sheets
of dry 3MM paper, a glass plate, and a weight (300-500 g).`
After 30 minutes at room temperature, enough protein was
transferred to the nitrocellulose that it could be visualized by
~taining. Before removal from the surface of the gel, the back
of the nitrocellulo~e sheet was marked with a black VWR lab
marker to indicate the position of the edges-of the gel, so that
the gel could be aligned with the blot after staining. The
nitrocellulose was then removed from the gel, washed 3 times in
TBS + 0.3~ Nonidet P-40 (TBS=Tris-Buffered Saline= 0.15 M NaC1,
0.1 M Tris-HC1 pH 8.0). The~ the sheet was stained in the same
solution to which had been added 0.1% Waterproof Black India Ink
(~oh-i-noor Rapidograph 3080-F Universal). After 10-15 minutes
of shaking in the stain solution at room temperature, stained
Sl)E~STITUTE SHEEl
WO91/155~3 PCT/US9t/02060
3~
-64-
bands appeared on the side of the nitrocellulose sheet which had
been in contact with the gel. The gel was then aligned with the
marks on the nitrocellulose and the area over the darkest and
thickest staining band was excised from the gel using a razor
blade. To facilitate removal of protein from the gel slice, the
slice was crushed by forcing it through a disposable plastic
syringe with no needle attached into a tube containing 0.5X
Running Buffer (see above). The crushed gel slices were stored
in this buffer at 4C.
Elution of the protein from the gel slices was
accomplished using ISCO sample concentrator cups. The crushed
gel slices were placed in the cups in 0.5X Running Buffer and
electroeluted at 1 Watt per cup for 3-4 hours. The concentrated
sample was removed using a pipetman and pooled with samples from
other cups. The concentration of protein in these samples was
estimated by running different amounts of the sample along side
different amounts of a known standard on SDS-PAGE and comparing
the intensity of Coomassie Blue staining of the protein bands.
The concentrated samples were pooled, diluted to a
concentration of 1.0 mg/ml with 0.5 X Running Buffer, and stored
at 4C until used for vaccine testing.
C. EXPRESSION AND PURIFICATION
OF FULL LEN&TH RECOMBINANT PROTEIN C.
Strain pTST::M852-1 (See EXAMPLE IX-C) was grown in
shaker flasks (350 ml in 21 baffled flasks, 250-350 rpm, 37C).
The Nedium used was Luria Broth (1% tryptone, 0.5~ Yeast
extract, 1~ NaCl, pH 7.5) with 10 ~g/ml tetracycline. Cells
were induced at OD~oO = O.7-0.9 with 0.4 mM IPTG (isopropyl-
thiogalactopyrano-side). Cells were harvested 8-11 hours after
induction (ODffoo = 1.4-1.6) by centrifugation 9000 x g, 10
min, 4C. Cells were resuspended in 1/10 volume 20 mM Tris pH
8.2, repelleted at 9000 x g for 10 min, and finally resuspended
in 1/100 volume of the ~am2 buffer. Cells were disrupted using
a French Pressure cell (3 passages, 18,000 psi). The whole cell
SUBSTITUTE SHEEl
WO91/15593 PCT/US91/02060
20781~1
-65-
lysate was centrifuged at 48,000 x g for 30 min at 4C. More
than 90~ of the full length recombinant protein C was contained
in the pellet after this centrifugation. This pellet was
resuspended in the same value of 20 mM Tr~s pH 8.2 as a milky
white suspension. The protein was solubilized by mixing 1:1
with gel sample buffer (100C, 10 min) and purified by
preparative polyacrylamide gel electrophoresis as described for
the natural Protein C purified from M. hYo~neumoniae cells (see
GEL PURIFICATION; Example X-B).
D. EXPRESSION AND PURIFICATION
OF TRUNCATED PROTEIN C.
~ Strain pT5T::M8Sl-B2B (See EXAMPLE IX-C) was grown in
shaker flasks (350 ml in 21 baffled flasks, 250-350 rpm, 37C).
The medium used was Luria Broth (1% tryptone, 0.5% Yeast
extract, 1% NaCl, pH 7.5) with 10 ~g/ml tetracycline. Cells
were induced at OD~ o o = O . 7-0.9 with 0.4 mM IPTG (isopropyl
thiogalacto-pyranoside). Cells were harvested 3-4 hours after
induction (OD~oo ~ -1.6) by centrifugation (9000 x g, 10
min, 4C). Cells were resuspended in ltlO volume 20 mM Tris pH
8.2, repelleted at 9000 x g for 10 min, and finally resuspended
in 1/100 volume of the same buffer. Cells were disrupted using
a French Pre~sure cell (3 passages, 18,00 psi). The whole cell
lysate was centrifuged at 48,000 x g for 30 min at 4C. More
than 90% of the truncated recombinant protein C remained in the
sup~rnatant after this centrifugation. Two method~ were used
for purification of the truncated recombinant Protein C. For
ion exchange chromatography, the supernatant was diluted 5-10
fold in 20 mM Tris pH 8.2 and urea was added to 6M. This was
then passed over a MonoQ FPLC column and eluted with an NaCl
gradient essentially as described in the Urea method of ion
exchange chromatography purification of the natural Protein C
(See Exampl~ X-B) except that the buffer used contained 20 mM
Tris pH 8.2. Truncated Protein C eluted at 0.10-0.12 M NaC1 in
the NaC1 gradient.
.
SUBSTI~UTE S~IEEl
WO91/15~93 PCT/US91/02060
-66-
Truncated Protein C was also purified by preparative gel
electrophoresis. The supernatant was mixed l:l with gel sample
buffer and purified by preparative polyacrylamide gel
electrophoresis as described for the natural Protein C purified
from M. hvoPneumoniae cells (See GEL PURIFICATION; Example x-
B4).
E. PROTOCOL FOR VACCINATION EXPERIMENTS
Healthy, 6-week-old conventional pigs were purchased and
assigned to pens of 5-6 pigs each. Pigs in 3 pens (a total of
lS-18 pigs per group) were vaccinated by intramuscular injection
with 3.0 ml/pig of experimental vaccine or a placebo, in a
water-in-oil emulqion ad~uvant. Pigs received 4 vaccinations
(50,100,200, and finally 400 micrograms total protein per
in~ection) at 7 day intervals.
Two days following the final in~ection, three Mvco~lasma
hvo~neumoniae infected donor pigs were placed in each pen to
provide a natural source of infection for the vaccinate~. The
donor pigs were artificially infected with M. hv~oneumoniae by
intranasal infusion of a homogenate made from infected lung
tissue, which results in a ~erious infection. This infection
was started at the same time that the vaccinate pigs received
their first injection, so that a serious infection was present
at the time of mixing. The vaccinate6 and t~e donors were kept
separated until mixing. Ventilation in the building was reduced
to facilitate transmission of the disease. Blood samples were
collected from each pig, one prior to the first in~ection, and
one after the last in~ection but before mixing with the donor
pigs.
Six weeks after mixing, each pig was killed and the
lungs were examined for severity of the disease. One person,
blinded as to the treatment, did all lung evaluations. The
primary criterion was the percent of gross pneumonic lesions in
the lungs as estimated by visual inspection. Lung tissue was
also collected for an Indirect Fluorescent Antibody (IFA) test
to determine whether the gro~s lesions contained Mycoplasma
SIJBSTITUTE SHEEl
. _
WO91/15593 PCTtUS91/02060
2071~3~,3l
-67-
.hvo~neumoniae infections (See Example X-G). These samples were
also cultured for aerobic bacteria other than mycoplasma.
Animals which had visible gross lesions and tested positive in
the IFA test were considered to be infected when determining the
incidence of the disease in the different groups. The average
lesion score (mean ~ lesions) was also used as a measure of the
effectivenesæ of a vaccine. For the purpose of averaging, those
animals which were scored as having >0~ but ~l~ lesions were
given a lesion score of 0.5%. The pneumonic lesion data were
statistically analyzed using the square root trancformation and
the means shown in the Table 2 were transformed to the original
scale.
Other tests that were conducted in some cases were:
l. ELISA tests (See Example X-H) and Western blots
(See Example X-J) to determine whether sera from
vaccinated pigs reacted with specific antigens.
2. Metabolic Inhibition te~ts (Example ~-I) to
determine whether sera from vaccinated pigs had any
in vivo effects on growth of M. h~o~neumoniae
cells.
3. Histological examination of pneumonic lung tissue
(See Example X-R) to determine the severity of lung
lesions at the microscopic level.
Sl1BSTITUTE SHEEl
WO 91/15~93 PCr/US91/02060
~a~
--68--
F. RESULTS OF VACCINATION TRIA~S
The results of the vaccination trials are presented in
Table 2 below:
TABLE 2
Vaccine Trial Re~ults
E~pt. Vaccine Gross Penumonic I.esion~ IFA
No . Protein ( ~ ~Incidence Mean 96Positive
8702 Sl 7/15a o.63a 7/15a
Nonvaccinatedl4/l5b 8 . llbl4/l5b
7S 5/l5a . 23 5/l5a
8805 7S, 1.25~ SDS4/15a o.o8a 7'15b
7S, 6N Urea 4/l4a 0.28 6/14a
Non~accinatedl2/l5b 2 ~ 23bl2/l5b
8802 Protein C (column
purif ied )
and and l5/33a o . 66al7/32a
8902 Protein C ( gel
purif ied )
Placebo 27/33b 3 . l3b27~32b
_
Full-length
Recombinant l7/3oa 0.44a l7/30a
8904 Protein C
and
8905 Truncated Recomb.
Protein C l9/3oa o . 86al9/30a
Placebo 28/30b 2 . gob28/30b
a,b Values in vertical columns with different superscripts are
significantly different, P c . 05 .
SUBSTITUTE SHEE~
WO91/15593 PCT/US91/02060
2~7,'~13~
-69-
The protocol for the vaccine trials is described
above in Example X-E.
The pneumonic lesion data were statistically analyzed
using the square root transformation and the means shown in
the Table 2 were transformed to the original scale.
INCIDENCE: A ratio of the number of pigs in a group
~hich
have gross pneumonic lesions and score positive
on the IFA test to the total number of pigs in
the group. This ratio indicates the degree to
which the transmission of the disease is reduced
by the vaccination.
MEAN %: The average lesion score of all the pigs
in a
particular group. This number allow~ comparison
of the se~erity of the di~ease between different
groups.
IFA POSI~I~E: ~he IFA (Indirect Fluorescent
Antibody) test
detect~ the pr2sence of M. hYo~neumoniae cells
in the lung tis~ue, particularly in the gross
le~ions. This indicates whether the lesions
seen are in fact caused by M. h~opneumoniae or
some other agent (other mycoplasma species or
bacteria). It i6 expres~ed as a ratio of the
number of pigs in a group scoring positive in
the IFA test to the total number of pigs in the
group. Detailed description of this test in
Example X-G.
SUE~ST~TUTF SHEEl
WO91/15593 ~ PCT/US91/02060
-70-
General conclusions based of the results obtained are
listed below:
1. Sl EXTRACT EXHIBITS SIGNIFICANT PROTECTION
AGAINST M. HYOPNEUMONIAE IN~ECTION. In
experiment 8702, Sl vaccinates showed
significant reduction in incidence, mean percent
lesion scores, and numbers of pigs which were
IFA positive, when compared to nonvaccinated
controls.
2. 7S EXTRACT EXHIBITS SIGNIFICANT PROTEC~ION
AGAINST M. HYOPNEUMONIAE INFECTION. In
experiment ~805, 7S vaccinates showed
~ignificant reduction in incidence, and numbers
of pigs which were IFA positive, when compared
to nonvaccinated controls. The mean ~ lesion
scores were al~o reduced for thi~ group but were
not statistically significant at P~0.05.
3. THE 7S EXTRACT CAN BE DENATURED IN ~HE DETERGENT
SDS OR IN UREA WI~HOUT DESTROYING ITS PROTECTIVE
PROPERTIES.
In experiment 8805, vaccination with 7S which
had been denatured in l.25% SDS resulted in
~ignificant reduction in incidence and in mean %
lesion scores, compared to the nonvaccinated
controls. IFA positive scores were reduced but
were not significant at P<0.05. Vaccination
with 7S which had been denatured in 6M urea
resulted in significant reduction in incidence
and IFA positive scores when compared to
nonvaccinated controls. Mean % lesion scores
were reduced but were not significant at P~0.05.
SU~STITUTE SHEE~
.
WO91/1S593 PCT/US91/02060
2~7~131
4. PROTEIN C (PURIFIED FROM M, HYOPNEUMONIAE C~LLS)
EXHIBI~S SIGNIFICANT PROTECTION AGAINST M.
HYOPNEUMONIAE INFECTION. Results were combined
between experiments 8802 (in which protein C was
purified by ion exchange chromatography) and
8902 (in which Protein C was further purified by
preparative polyacrylamide gel electrophoresis).
There was no statistically significant
difference between the results of these two
tests, 80 they were combined. Significant
reductions in incidence, means ~ lesions, and
IFA po~itive scores are exhibited compared to
placebo vaccinated controls.
5. FULL LENGTH RECOMBINANT PROTEIN C EXHIBITS
SIGNIFICANT P~OTECTION AGAINST M. HYOPNEUMONIAE
INFECTION. Results are combined for experiments
8904 and 8905 (separate tests, both with
preparative polyacrylamide gel purified
protein). Significant reduction~ in incidence,
means % lesion scores, and IFA positive scores
were exhibited when compared to placebo
vaccinated controls.
6. TRUNCATED RECOMBINANT PROTEIN C EXHIBITS
- SIGNIFICANT PROTECTION AGAINST M. HYOPNEUMONIAE
INFECTION. Results are combined for experiments
8904 tin which the protein was puri~ied by ion
exchange chromatography) and 8905 (in which the
protein was purified by preparative
polyacrylamide gel electrophoresis).
Significant reductions in incidence, means %
lesion scores, and IFA positive scores are
exhibited when compared to placebo vaccinated
controls.
SUBSTITUTE SHEEl
WO 91/15593 PCr~US91/02060
--7 2--
G . ~NDIRECT FLUORESCENT ANTIBODY ( IFA ) TEST
In order to determine whether the lesions observed in
infected animals actually were infected with M .
hYo~neumoniae, tissue samples were taken from lesions in
infected lungs or from the tips of the lobes of the lungs in
animals with no detectable gross lesions. This is the region
of the lung where infection is most likely to occur. Frozen
section6 of the e tissues were made, mounted and acetone
fixed on gla~s slides. A rabbit anti-M. h~o~neumonia serum
was bound to the sections, washed, and followed by a
Fluorescein-linked goat anti-rabbit IgG. Unbound antibodies
were washed off and the ~ections were observed under a
fluorescence microscope. Sections which displayed bright
fluorescent rings around the alveoli were scored as positive.
Control sera ~howed only background fluorescence.
H. ENZYME LINRED INMUNOSORBANT ASSAY (ELISA)
Wells in 96-well microtiter plates were coated with
0.3~well of antigen (purified natural Protein C,
recombinant full-length or truncated Protein C, or sonicated
whole mycoplasma cells) in 0.045M sodium carbonate buffer pH
9.6. Nonspecific binding of antibodies was blocked with 5%
gelatin in PBS (lOmM sodium phosphate, 0.15 M NaCl, pH 7.4.).
Serial dilutio~s of primary antibodie~ (vaccinated pig sera)
in PBS + 1~ gelatin + 0.05~ Tween 20 were bound to the
antigen, washed and followed by the secondary antibody
pero~idase linked goat anti-swine IgG (~IERREGARD AND PERRY)
in the Rame buffer. After washing, TMB Microwell Peroxidase
Substrate (RIERREGARD AND PERRY) was added, the reaction run
- for 2-5 min ~t room temperature and terminated by addition of
an equal volume of lM H3PO~. Colored reaction products
were read at 45Onm and recorded.
SVE~STITUTE S~tEFl
W091/15~93 PCT/US91/02060
207~
_73-
Results indicated that sera from pigs vaccinated with
natural Protein C had strong reactivity towards both of the
recombinant proteins when compared with placebo vacclnated
controls. Conversely, sera from pigs vaccinated with either
recombinant protein reacted strongly with the natural Protein
C in the wells. Sera from pigs vaccinated with natural or
recombinant Protein C reacted strongly to sonicated M.
hvo~neumonia cell antigen while placebo vac~inated control
sera did not.
I. NETABOLIC INHIBITION TEST
~ In order to determine whether antibodies present in
~era from swine vaccinated with Protein C nad any direct
inhibitory effect on M. h~o~neumoniae cell growth, a
metabolic inhibition test was performed. Vaccinated pig
serum was substituted for specific-pathogen free pig serum in
Friis medium (See Example X~A), and growth of cells in the
substituted medium was compared with that in normal medium.
The change in color of the phenol red in the medium from red
to yellow was monitored indicating acid produ~ion, a normal
product of M. hvo~neumoniae metabolism.
Serum f rom pigs vaccinated with placebo showed a
slight inhibition in metabolism compared to the normal medium
controls. However, serum from pigs vaccinated with natural
Protein C, recombinant f ull length Protein C, or truncated
Protein C, all strongly inhibited metabolism of M.
hvopneumoniae, as indicated by delay or lack of color change
in th~s~ tubes. Measurement of pH at the time when the
normal media control had changed color (3 day~ for lOO x
dilution of inoculum) showed that acid production was
substantially reduced in the Protein C vaccinates. The
normal medium control was pH 6.7 while the average pH of 5
S~IBSTlTlJTE SHEEl
WO91/15~93 PCT/US91/02060
3~
_74-
sera from each vaccinate group was 7.5, 7.6, and 7.5 for the
natural, full length recombinant, and truncated Protein C's
respectively. The placebo vaccinated control sera averaged
ph 7Ø Normal uninoculated Friis medium is pH 7.5.
J. WESTERN ~LOT ANALYSIS OF VACCINATED PIG SERA
Protein samples were Yeparated by SDS-PAGE as
described in Example X-B4 except that the gel was 0.75 mm in
thicknecs and samples were reduced with 2.5 2-mercaptoethanol
before loading. Proteins were transblotted to a
nitrocellulose sheet (SCHLEICHER & SCHUELL, BA-83, 0.2 ~m
pore size) with a Polyblot transfer system (AMERICAN
BIONETICS) using their recommended buffers, for 30 min. at
100 V. Non-specific binding was blocked with 1% bovine Serum
Albumin (PENTEX, Fraction IV, MILES DIAGNOSTICS) in TBS (10
mM Tris, 0.5 N NaC1 pH 8.0). Primary antibody (sera from
vaccinated pigs) was diluted 1:200 in TBS ~ O.2% TWEEN 20
(SIGMA) 4-16 hours at room temperature. Unbound antibody was
washed off in TBS + 0.2% TWEEN 20 (shaking 3 x 10 min., room
temperature) Second antibody (Peroxides con~ugated rabbit
anti-swine IgG, CAPPEL) was bound in the same buffer for 2-4
hours at room temperature. Unbound antibody was washed off
and the blot immersed in substrate (300 ~m/ml 4-chloro-1-
naphthol, 0.03~ hydrogen peroxide, in TBS + 10% methanol).
The reaction was terminated by rinsing the blot in distilled
water.
Result3 of these blots indicated that sera from pigs
vaccinated with natural Protein C strongly bound to: 1) an 85
kd-band in western blot lanes containing separated proteins
from E. coli stain pTST:~852-1, which expresses the full-
length recombinant Protein C; and 2) a ~50 kd band in lanes
containing proteins from E~ coli strain pT5T:M851-B23, which
SUBSTI~UTE SHEEl
wosl/lsss3 PCT/US91/02060
207~
expresses the truncated Protein C. ~oth of these bands
correspond to the recombinant Protein C products in these
strains. Conversely, 6era from pigs vaccinated with either
of the recombinant Protein C's bind strongly to an 85 kd band
in lanes containing M. hvo~neumoniae extract 7S ~see ~xample
X-A3) which corresponds to Protein C.
K. HISTOLOGIC~L ANALYSIS OF
LESIONS IN VACCINATED PIGS
Samples of lung (from vaccine experiment #8905) were
collected and evaluated microscopically for lesions of
Mvco~lasma pneumonia from three groups of 15 pigs
(recombinant Protein C vaccinates, truncated Protein C
vaccinates, and placebo vaccinates). A grossly non-involved
sample of lung from each pig and one repre~entative lesion
were examined and graded microscopically except for one pig
in which no lesion remained after sampling for IFA and
culture.
~ xtensive lymphoid hyperpla~ia around airways and
associated vessel~ was confirmed microscopically in 9/15
placebo, 5/15 Protein C and 7/15 truncated Protein C
vaccinates. Microscopic lesions of bronchointer3titial
pneumonia were present in 11/15 placebo, 6/15 Protein C, and
7/14 truncated Protein C vaccinates. Bronchointerstitial
pneumonia characterized by either acute (edema and
neutrophils predominately) or chronic alveolitis
(lymphocytes, plasma cells, macrophages and neutrophils) was
confirmed in 11/15 placebo, 6/15 Protein C and 7/15 truncated
Protein C vaccinates. There was no to limited background
(l+) lymphoid hyperplasia and no evidence of
bronchointerstitial pneumonia in the non-involved samples of
lung examined.
SUBSTITUTE St~
WO91/15593 PCT/US91/02060
2~ 3~
-76-
In summary the trend was for microscopic lesions
consistent with mycoplasmosis to be most numerous in placebo
vaccinates which parallels the gross observations. In
addition the acute alveolitis component of the
bronchointerstitial pneumonia occurred with greatest
frequency in the placebo compared to the recombinant
Protein C.
XI. APPLICATIONS ~0 OTHER SP~CI~S
M~coplasma hYo~neumoniae is the causative agent of
enzootic pneumonia in swine. Other mycoplasmas cause similar
respiratory diReases in other organisms. For example: M.
~neumoniae in humans; M. aallise~ticum in chickens; M. bovis
in cattle; etc. It is very possible that surface proteins
homologous to polypeptide C exist in these other Mycoplasmas
that may be effective as vaccines against these infective
agents. The genes encoding these homologous proteins could
be isolated by using the gene for polypeptide C as a probe
for DNA hybridization at low stringency to a reccmbinant DNA
library made from another mycoplasma species. The
recombinant library could be constructed like the pUC18
library described in Example VIII-A1, and the library
screened with the ~69 probe as described in Example VIII-A2
except under different stringency conditions. DNA
hybridization could be carried out in low stringency
conditions at 32 in 30% formamide, 5X SSPE, 1% SDS, 0.1%
sodium pyrophosphate, 0.15 mg/ml tRNA, O.125 mg/ml sonicated
salmon ~perm DNA. An initial wash could be carried out in
the same buffer (minus probe, tRNA, and sonicated salmon
sperm DNA~ at 32C (3 X 10 min washes) and the filters
exposed to X-ray film for autoradiography to reveal clones
which hybridize to the probe. If these stringency conditions
are too low, indicated by a large number of 'positive~ clones
on the film, the filters could be washed under higher
stringency conditions by raising the formamide concentration
in 5% increments, and/or raising the wash temperature in 5C
SU~STITUTE SHEEl
Wo91/15~93 PCT/US91/02060
2~7(gl31
-77-
increments, with each increment being followed by exposure to
film to determine the number of ~positive~ hybridizing
clones. At some combination of stringency conditions, it
should be possible to eliminate most of the background false
"positives" and to be left with the true ~positive~ clones
for further analysis.
Inserts from the newly isolated positives would have
to be-subcloned into sequencing vectors and sequenced (See
Example VIII-B for procedures and general strategy). The
amino terminus of the coding sequence and the reading frame
could be determined by comparison with the sequence for the
Protein C gene. Once the positions of any UGA codons was
determined, changes in the~e codons and other modifications
to facilitate expression could be done in the same general
manner as described for the Protein C gene (See Example IX-A
and lX-B). Expression, purification, and testing of these
recombinant proteins would depend on the propertie~ of the
proteins (likely to be similar to polypeptide C, described in
Example IX-C4, X-B, X-C, and X-D) and the animals being
tested .
There is also the possibility that recombinant
Protein C itself from M. hYopneumoniae might be protective
against other species. The recombinant Protein C could be
tested directly in vaccine trials with other animals
subsequently challenged with the corresponding Mycoplasma
fipecies .
XII. POSSIBLE USE OF PROTEIN C
FRAGMENTS OR PEPTIDES AS
VACCINES OR DIAGNOSTICS
The possibility exists that fragments of Protein C
might be useful either as vaccines or for diagnostic
purpo~e~. Such fr~gments might be produceà in a variety o~
ways: l) cloning of a section of the Protein C gene into a
recombinant expression vector and producing the fragment as 2
recombinant protein much as the truncated version of Protein
C wa6 produced. This could be done for any section or
combination of sections of the protein; 2) digestion of
recombinant Protein C with endoproteinases (such as
SU8STITUT:~ SHEEl
WO91~15~93 PCT/US91/02060
~a~
-78-
Endoproteinase LysC or chymotrypsin as described in the
generation of peptides for amino acid sequencing (see Example
VIII-D3)) and purification of the digestion products by
reverse phase chromatography or other chromatographic
techniques; 3) chemical synthesis of peptides corresponding
to sections of Protein C u~ing a peptide synthesizer such as
the APPLIED BIOSYSTEMS INC. Model 430A. This method would
be most useful for shorter peptides (<30 amino aclds in
length), but should not be ruled out for larger peptides as
well.
One method for choosing regions of the amino acid
sequence of Protein C which are likely to be antigenic uses a
computer program to scan the sequence for regions which are
hydrophilic and likely to be exposed on the surface of the
protein (Hopp & Woods, Proc. Nat. Acad. Sci. USA, 78: 3824-
3828(1981)). However, since Protein C exhibits significant
protection e~en as a denatured protein, other regions of the
protei n ~hould not be ruled out. Any Eegment or combination
of segments of the amino acid sequence of Protein C might
potentially be effective as a vaccine or diagnostic.
A peptide fragment to be used as a vaccine would be
required to elicit an immune response directed against the
natural Protein C (when administered as a vaccine to swine,
See Example X-E). Such a response could be detected by
Western blot analysis, showing that serum from pigs
vaccinated with the fragmentts) recognize an 85 kd protein
band on Western blots containing Protein C. Also a cellular
immune response directed against Protein C could be detected
using a T-lymphocyte proliferation assay in a method
analogous to that described by Schwartz et. al., J. of
Immunol., 115:1330 (1975).
SU~STITUT ' S H FEl
WO91/15~93 PCT/US91/0206
-79~ 07 ~
A fragment to be used as a diagnostic should be
recognized by sera from pigs infected with M. hvoPneumonia in
an analytical procedure such as the ELISA test See Example X-
H.
It will be apparent to those skilled in the art that
various modifications and variations can be made in the
processes of the present invention. Thus, it is intended
that the present invention cover the modifications and
variations of this invention provided that they come within
the scope of the appended claims and their equivalents.
SUE~STITUT r SHEEl
