Note: Descriptions are shown in the official language in which they were submitted.
Our ref.: B 572 PCT
Foundation for Research and
Technology - Hellas (FO.R.T.H.) ... 2 0 ~ ~1 5 ~
Portable ribozyme cassettes. DNA sequences containing them. ribozy~es
encoded by these DNA sequences. and compositions containin~ these
ribozymes
The present invention relates to portable ribozyme cassettes (which may
also be designated as ninsertable ribozyme cassettes") of general appli-
cability which can be inserted into given restriction enzyme cleavage
sites and can thus be used for the simplified construction of ribozymes.
The invention also relates to DNA sequences containing said portable ri-
bozyme cassettes, recombinant vectors containing such DNA sequences and
to host organisms which are transformed by the recombinant vectors of the
present invention. Pur~hermore, the invention relates to the ribozymes
encoded by said DNA sequences. The invention also relates to compositions
containing the ribozymes or DNA sequences of the present invention. Other
embodiments will become apparent from the following description.
,........................................................................... .
Enzymes which are composed of an RNA chain only, are called ~RNA enzymes~
; or ~ribozymes~. Such catalytic RNAs have been observed in different bio-
; logical systems.
.
~he first ribozyme discovered is the nuclear rRNA from Tetrahymena ther-
mophila which contains an intervening sequence (IVS) of 413 nucleotides,
ant is capable of undergoing self-cleaving in the absence of proteins.
The IVS catalyzes different transesterification reactions which result
in the excision of the IVS from the precursor RNA and the ;igation of the
two exons. This IVS RNA enzyme has been described in detail, e.g. Rruger
at al., Cell 31 (1982); 147-157, Cech, Cell 34 (1983), 713-713; Zaug et
al., Science 224 (1984), 574-578; Cech, Cell 44 (1986), 207-210; Cech and
Bass, Annu. Rev. Biochem. 55 (1986), 599-629; Zaug et al., Nature 324
(lg86), 429-433; Zaug and Cech, Science, 231 (1986), 470-475; Cech,
Science 236 ~1987), 1532-1537; Latham et al., ~ethod. ~nzymol. 181
`~ (1990), 558-569.
Cech and coworkers have also described the modification of the IVS ri-
bozy~e to use it for the cleavage of large RNA molecules in a sequence- -
specific manner. The modified IYS recognizes small sequence motifs, like
CUCU and related sequences like CCCU and cleaves them in a sequence-spe-
': -
2 2 0
cific manner comparable to DNA restriction enzymes.
A precise description of the ribozymes of Cech et al., in particular the
usage as a sequence-specific endoribonuclease, can also be found in WO
88/04300.
The ribozymes of the present invention are derived from another class of
naturally occurring RNAs which undergo site-specific autolytic cleavage
generating two cleavage products having a 5'-hydroxyl group and a 2',3'-
cyclic phosphodiester, at their termini, respectively. The majority of
these self-cleaving RNAs originates from satellite RNAs of plant viruses.
There is also one self-cleaving RNA of this type found in another plant
pathogen, the avocado sunblotch viroid (ASBV) and in an RNA transcript of
newt (reviewed by 8ruening, Method. Enzymol. 180 (1989), 546-558). A
s21f-catalyzed cleavage reaction has been demonstrated in vitro for the
avocado sunblotch viroid (ASBV) (Hutchins et al., Nucleic Acids Res. 14
tl986), 3627-3640, the satellite RNAs of tobacco ring spot virus (sTobRV)
(Prody et al., Science 231 (1986), 1577-1580; Buzayan et al.,
Proc.Natl.Acad.Sci. 83, (1986), 8859-8862), of lucerne transient streak
virus (sLTSV) (Forster and Symong, Cell 49 (1987), 211-220) and also for
RNA transcripts of repeated DNA sequences from newt (Epstein and Gall
Cell 48 (1987), 535-543).
All these self-cleaving RNAs can assu~e a 30-called ~hammerhead~ struc-
ture (For~ter and Symons, Cell 50, (1987), 9-16) which determines the
site of cleavage. Using two synthetic RNA oligomers, which can ~ogether
form a hammerhead structure, it was demonstrated that cleavage can occur
in trans, i.e. that one molecule can catalyze the cleavage of the other
~Uhlenbeck, Nature 328 (1987), 596-600).
.. . .
When cleavage occurs in tran~, the RNA which can be cleaved is consideret
the ~ubstrate (target) R~A, and the RNA which catalyzes the cleavage is
J called an KNA enzyme or ~ribozyme~.
i It is now possible to design an appropriate ribozyme against any GUC se-
~, guence motif of a given substrate RNA, so that cleavage occurs 3'-termi-
1 nal of it (Haseloff and Gerlach, Nature 334 (1988), 585-591). Likewise
J GUA, G W , CUA, C W , A W and W C are suitable tasget sequences for the
I hammerhead-type ribozyme RNAs (Roizumi et al., FEBS Lett. 228 (1988),
: ::
''
'`'. ' ' ' ` ' '- . . ' ' " . - . . ' . ' ' .' . ': : -~' ' -': ' ' . ' ': .
:' ' . ` '' ''.. : . - ., '' ' ~' . , ': ' . . `: ~ ; . . . ''. ' : . ' ,
3 208~
228-230 and FEBS Lett. 239 (1988), 285- 288 and EP-A2 321 201). The motif
GUG was cleaved in one cas~ (Sheldon and Symons, Nucleic Acids Res. 17
(1989) 5679-5685), whereas it was not cleaved in others (Roizumi et al.,
FEBS Lett. 228 (1988) and Haseloff and Gerlach, Nature 334 (1988) 585-
591). According to an investigation on the sequence requirements by
Ruffner et al., Biochemistry 29, (199Q) 10695-10702, any trinucleotide
sequence NUH can be a target sequence (N can be A, C, G or U, H can be
A,C or G). Thus, also the motifs AUA, AUU, CUU, UUA, U W represent target
sequences.
EP-A2 321 201 describe~ the ribozymes of the ~hammerhead~-type and its
usage to create RNA endonucleases which are, in contrast to the IVS ri-
bozyme described in WO 88/04300, highly specific for a certain target
RNA. In order to cleave a given substrate RNA (target RNA) at a certain
site, a specific ribozyme RNA can be designed that consists of two func-
tional regions: tbe actual catalytic domain, and the regions which are
comple~entary to the target RNA, so that the ribozyme can bint to its
substrate in a sequence-specific manner, and in that way that the cat-
alytic tomain of the ribozyme is placed opposite of the cleavage motif of
the target RNA.
EP-A2 321 201 describes the procedure to create a ribozyme. ~3Or this pur-
pose, a DNA oligonucleotide is synthesized according to a specific cleav-
age motif and the sequence context next to it within the target RNA. Af-
ter cloning of this DNA oligonucleotite downstream of an appropriate pro-
~oter, this synthetic DNA can be used for the in vitro and in vivo syn-
thesis of the target-specific ribozyme RNA. Transcription generates an
RNA molecule which contains the catalytic ribozyme domain, flanked by se-
quences that are complementary to the target RNA and usually also vector-
terived sequences which are not complementary to the target RNA. After
the sequence-specific hammerhead conformation has been formed, cleavage
occurs 3'-terminal to the motif of the substrate RNA, e.g. GUC. Since the
ba~e-pairing complementary regions bet~een the substrate RNA and the ri-
bozyme RNA which do not participate in the catalytic reaction, enable the
sequence-specific binding of the ribozyme to its target, their length in-
f1uences the specificity and efficiency of the ribozyme reaction. ~ `
:
~' ' .
'
-. ,: .. : . .. : : ..... . ., ~ , . : : . ..
.:: . . : . . . . :,
-- 2~315'1
The ribozymes of the hammerhead-type which are so far known from the ap-
prove prior art suffer from the disadvantage that for each and every use
they have to be synthesized de novo. Such a synthesis is laborious, time
consuming, and also involves technical difficulties because the synthetic
ribozyme encoding DNA sequences have to have a length sufficient to war-
rant a reasonable preciseness of the cleavage of the target RNA. There-
fore, so far there have been limits in the applicability of the ribozyme
technology.
Accordingly, the technical problem underlying the present invention is to
provide a means permitting the ease and precise construction of DNA se-
quences of sufficient leDgth which encode ribozymes that cleave a desired
target RNA.
" . ':
The solution to the above technical problem is achieved by providing ri-
bozyme cassettes consisting of DNA which can be inserted into selected
restriction enzyme cleavage sites of the DNA sequence encoding said tar-
get RNA. Furthermore, it is achieved by proviting the other embodi~ents
characterizet in the claims.
'r'
i Thus, the presen~ invention relates to portable ribozyme cassettes dis-
playing the following features :
;-~ (a) a DNA sequence (a) encoding that part of a ribozyme which does not
,61 form base pairs with the target RNA; and
(b) DNA sequences (b) flan~ing the DNA sequence (a), which are derivet
s from the protruding ends of a restriction enzyme cleavage site of a
s DNA sequence encoding a target RNA, and which encode a part of that
part of a ribozyme which forms base pairs with the target RNA,
~t wherein after insertion of the ribozyme cassette into a target DNA that
encodes the target RNA, said D~A sequences (a) and (b) encode together
s with that strand of said target DNA that is complementary to the target
RNA (antisense strand), a ribozyme, having endoribonuclease activity for
said target RNA.
s The term ~DNA sequence encoding that part of a ribozyme which does not
form base pairs with the target RNA~ refers to DNA sequences encoding the
, loop of ribozymes which may al~o be called the ractive domaina or
ncataIytic domain~ of the ribozyme. Examples of such a DNA sequence (a)
.
~, ! , . ! ~ .. . . .
are the loops created when the ribozymes given in Yigs. 1, 4, 7 and 13,
pair with their target RNA (substrate RNA). Examples of a sequence (a)
are also indicated in Figs. 2 and 3. When referred to a particular DNA
strand, it is understood that the DNA strand that "encodes~ the RNA is of
the same polarity as the corresponding RNA. As shown in Fig.2, the sense
strand of a cDNA sequence encodes the target RNA, whereas after insertion
of the portable DNA cassette, the antisense strand, together with the se-
quence (a), encodes the ribozyme RNA that is directed against the target
RNA.
The term ~DNA sequences flanking the DNA sequence (a), which are
derived from the protruding ends of a restriction enzyme cleavage site of
a DNA sequence encoding a target RNA, ant which encode a part of that
part of a ribozyme which forms base pairs with the target RNA~ refers to
nucleotides neighboring the sequence (a). Therefore, sequences (b) do not
represent a continuous sequence but consist of a part flanking sequence
(a) at its 5'- end and another part at its 3'-end, respectively. Se-
quences (b) can also consist just of a part flanking the 5'-end of se-
quence (a) or just at the 3'-end, respectively. An example, of such DNA
sequences (b) is given in Fig. 1, and 2.
In some embotiments of the present invention the portable ribozyme cas-
settes can be easily synthesized because - as is evident from the general
formula presented hereinbelow - they only contain a few nucleotides. In
other embodiments, the production of the portable ribozyme cassettes of
the present invention preferably involves cloning steps because these
portable ribozyme cassettes contain additional longer sequences, such as
marker sequences.
~: .
The portable ribozyme cassettes of the present invention simplify the
generation of target-specific ribozyme RNAs. ~or this purpose, they are
inserted into the DNA encoding the target RNA, e.g. into a cDNA. As a re-
sult of this insertion, the cDNA encoding the target RNA is converted
into a ribozyme construct, respectively, so that transcription can gener-
ate the desired catalytic antisense ribozyme RNA. As will be temonstrated
below, more than 20 preferred restriction enzyme cleavage sites can be
used for the insertion of the portable ribozyme cassettes of the present
invention. A particular advantage of the ribozyme cassettes of the pre-
~ent invention is that it is not necessary to design a ribozyme RNA ac-
.. ..
~ .
. ;:: . , : . .. : - i - . .. ,., , ,, . . , , ~:: .. .. . .
, . , . ~ . . ~ . . , - . - : , ,. : . ,: .
, .,:, , . , . . . . .. .:
. .
6 2~3~,~rj,,~,
cording to the sequence of the target. In fact, it is not even necessary
to know the nucleotide sequence of the target. A particular portable ri-
bozyme cassette of the present invention, e.g. a SalI-specific cassette
can be used in an universal way for the insertion into any SalI site in
any target. The eventually resulting RNAs combine the characteristics of
ribozymes and antisense RNAs and are therefore also called ~catalytic an-
tisense RNAs~ or "antisense-ribozymes" or "antizymes". A striking advan- -tage of the portable ribozyme cassettes of the present invention thus is
their general applicability. .. -
:
In a preferred embotiment, the present invention relates to a portable
ribozyme cassette, wherein said DNA sequences (a) ant (b) are represented
by the following general formula:
5' M2 Ml R L T T C Gl(X)X C2Yy T C W T C A G Nl N2 N3 N4 3'
3' M'2M'lR'L'A A G Cl(X')XG2Y'yA G W'A G T C N'lN'2N'3N'4 5'
. ~ .
in which said DNA sequence (a) i8 represented by the sequence : -
:~. , :
5' T T C Gl(X)X C2Yy ~ C W T C A G 3'
3' A A G Cl(X')xG2Yy'A G W'A G T C 5'
and said DNA sequence (b) is represented by the sequences :
? 5I M2 Ml R L and 1 N2 N3 N4 3
3' M'2M'lR'L' N lN 2N 3N'4 5
,~i ~
wherein: `
the nucleotides R and L represent the first and second nucleotide (5'-3')
of the target motif of the target RNA, and the nucleotides Ml and Nl are
`~ the first nucleotides flanking the target motif of the target RNA at tbe
, 5'- and 3'- side, respectively;
i the nucleotides M2 and N2 are the second nucleotides flanking the target
motif of the target RNA at the 5'- and 3'- side, respectively, and the
nucleotides ~3 and N4 are located in the third and fourth position at the
3'-side of the target motif of the target RNA;
~ the nucleotides M2, Ml, R, L, Nl, N2, N3, and N4, independently, are ~ -
,: :
..
A,G,C ~r T or not present in the cassette, under the proviso that
the presence of M2 requires the presence of Ml,
the presence of Ml requires the presence of R,
the presence of K requires the presence of L,
the presence of N4 requires the presence of N3,
the presence of N3 requires the presence of N2,
the presence of N2 requires the presence of Nl,
and unter the proviso that the total number of said nucleotides
M2, Ml, ~, L, Nl, N2, N3, and N4 is O to 4, preferably 1 to 4;
W, X or Y is A, G, C or T;
x is at least 6, wherein each X independently is A, G, C or T and wherein
X is selected so that the complementary nucleotides X' form at least one
additional base pair next to the base pair formed by the nucleotides Cl
ant G2 ( which flank the sequence (X')) in the secondary structure which
is formed when the ribozyme pairs to its target sequence;
y is O or l;
when the nucleotide Cl is C, the nucleotide Gl i9 G, when the nucleotide
Cl i8 T, the nucleotite Gl is A, when nucleotite Cl is C or T, the nu-
cleotites c2 ant G2 are either C and G or T ant A, respectively;
the nucleotites market with ~ ' ~ are complementary nucleotites;
ant
the nucleotites M2, Ml, R, L, Nl, N2, N3, ant N4 correspont to nu-
cleotides from the protruting ents obtainet after cleavage of a restric-
tion enzyme cleavage site within the DNA encoding the target RNA with the
corresponting restriction enzyme, sait restriction enzyme cleavage site
containing in said protruding ends an additional nucleotite Z which is
A,G,C or T.
c
;~ The tefinitions given in context with the above general formula are given
for the DNA level. As will be unterstood by the person skillet in the
art, T is U when reference is made to RNA se~uences.
.. ..
-
The interaction between the target RNA ant the ribozyme of the present
invention can schematically be illustrated as follows:
.`
. . :
.
. :: ~ . : : . ::: :. : ~ . .
:, ~ ..: .:: . .: .
,, . - ~., . , , , : .
20~8~4
5' N N N N N N N N M2 Ml K L Z Nl N2 N3 N4 N
* * * * * * * * * * * * * * * * * * * * * * * * ....
3' N~N~N~N~N~N~N~N~ M'2M'lR'L' N'lN2'N'3N'4 N'N'N'N'N'N~N~N~ 5
A C
A T
cl * G2 AA
X'(x)G W'
.- . .
~" '
wherein, the nucleotites N and N' are derived from the DNA encoding the
`; target RNA,
the nucleotides R L Z represent the cleavage motif of the target RNA;
* represents a hydrogen bond;
the sequence 3' A A G Cl(X~)(X)G2Y~(y)A G W'A G T C 5' represents the
sequence (a), that i8 the DNA sequence encoding that part of a ribozyme
which toe~ not form base pairs with the target RNA;
(x) is at least 6~ wherein these X' residues form a loop structure with
at least one attitional base pair, preferably at least three base pairs,
neighboring the Cl * G2 pair of the ribozyme within sequence (a); and
(y) is 0 or 1.
A specific example of such an interaction is depicted in Figure 1.
;~ ., ,: .
~n this preferret embotiment of the present invention, the ribozyme cas-
sette is inserted into a SalI site, wherein R is G, L is U, Z is C, Nl is
G, N2 is A and N3 is C, i.e. the nucleotides R, L, Z, Nl, N2 and N3 rep-
resent a SalI cleavage site containet in the DNA encoting the target RNA,
wherein the nucleotides L, Z, Nl and N2 are located within the protruting
ends created by Sill difestion. Simuleaneously, the nucleotides L', N'l
and N'2 represent the nucleotite~ of the ribozyme cassette of the present
invention which form base~ pairs with the target RNA on the RNA level.
Again, it has to be understoot that on the RNA level T is U. The latter
pa~rt consisting of nucleotites L', N'l ant ~'2 i8 also generally referred
to~as the sequence (b) of the present invention. Together with the loop
depictet in Figure 1 ~which is generally referred to as DNA sequence (a)
`in the present invention) ant with the flanking nucleotides N' (incluting
1 ,, ~ "_, ,, ~,, ,,; ,~,,,, ; ,~_ , ", "; ,,, ,, ", , """, " ,, ,,, " j ~".", ~ , ",, ,"", " ~
"~., . ! ' i ~
.::: : : . . :' :: 1 ': : .. :' : ~` ' : :' .. :. :: :.,' `. ' ~,,
203~
the nucleotides M'2, M'l, R', and N'3, N'4, which fulfill in this partic-
ular sequence the same function as the nucleotides N'), given in the Fig-
ure 1, said DNA sequence forms the ribozyme ("antizyme") of the present
invention.
It has to be understood that due to the polarity of the target RNA or the
corresponding DNA sequence, the ribozyme of the present invention is de-
picted in 3'-5'-orientation in the claims, figures and illustrations of
the present invention. Therefore, it will be evident to a person skilled
in the art that a DNA sequence encoding the ribozyme or ribozyme cassette
of the present invention has to be expressed in 5'-3'-orientation, i.e.
in the opposite orientation as given in said figures and illustrations,
in order to obtain the desired ribozyme as the expression product which
has the desired endoribonuclease activity.
~ The superiority of the portable ribozyme cassettes of the present in~en-
tion is evident from Figures 2 ant 3. The portable ribozyme cassette is
iDserted into a given cleavage site of the DNA sequence encoding the tar-
get RNA (substrate) RNA, in this preferred embodiment a SalI site. The
precise sequence specificity of the ribozyme (~antizyme~) encoded by the
resulting DNA sequence is automatically obtained without any difficult
and time consuming steps or further manipulations. This is because the
DNA sequence flanking the inserted ribozyme cassette is fully homologous
s to the DNA sequence encoding the target RNA.
Thus, according to the present invention, the length of the base pairing
regions which influence the specificity and efficiency of the endoribonu-
clease activity of the ribozy~e - because they are relevant for the cor-
rect and efficient binting of the resulting ribozyme to the target RNA -
i8 only limited by the length of the D~A sequence into the restriction
enzyme cleavage site of which the portable ribozyme cassette of the pre-
sent invention has been incorporated. Thus, the present invention allow~
the construction of ribozymes, the base pairing region of which may have
up to the same length as the substrate RNA if this is desired.
.
Depending on the meaning of the nucleotides M2, Ml, R, L, Nl, N2, N3, and
N4 in thc above general formula, this general formula either represents
the non~ grated ribozyme cassette of ~he present invention (~portable
.
20~,1 S~
.
: ribozyme cassette") or the integrated ribozyme cassette together with the
total flanking sequences derived from the restriction enzyme cleavage
site of the DNA sequence encoding the target RNA.
If the nucleotides M2, Ml, R, L, Nl, N2, N3, an 4
cleotides from the protruding ends obtained after cleavage of said re-
striction enzyme cleavage site with the corresponding restriction enzyme, :
the above general formula represents the portable ribozyme cassette.
In cases where this portable ribozyme cassette lacks any of the above nu-
cleotides M2, Ml, R, L, Nl, N2, N3, ant N4, these have to be provided by
the 5'-terminu~ of the DNA sequence encoding the target RNA in order to
obtain a functional ribozyme.
~ .
.. In a preferred embodiment of the portable ribozyme cassette of the pre-
sent invention, nucleotide L is T.
. In a particularly preferred embodiments of the present invention, the nu- . -
i cleotides Ml, R, L, Nl, N2, N3 ant N4 have any of the following meanings
. :
Ml R L Nl N2 N3 N4
1 - - - G
2 - - - T
s 3 - - T A
4 - G T
, 5 G A T
. 6 - C T G
, 7 - G T C
8 - - T G A
.. 9 - - T G G - -
- - - A T G
- - C G G
12 - - - - T A G
~! 13 - G T A C
~; 14 - - - C A G G
- - - C T G G
16 - - T C A - -
17 - - T
. . .
- : : . . . , :
.. : : -
- 2 ~
11
L Nl N2 N3 N4
- 18 - - - A
19 - - T A A
- T T A
21 A A T
.
In another preferred embodiment of the present invention, Y or W is se-
lected such that it forms a restriction enzyme cleavage site together
with the neighboring nucleotides.
The creation of such a restriction enztyme cleavage site within the
portable ribozyme cassette of the present invention provides a means for
screening for target DNA sequences in which the portable ribozyme cas-
sette of the present invention has been incorporated. Furthermore, such a
restriction enzyme cleavage site provides a means for the determination
of the orientation in which the portable ribozyme cassette of the present
invention has been incorporated into the target DNA sequence. Further-
more, such a restriction enzyme cleavage site provides a means for the
excision of excess cassettes in case more than one cassette has been in-
serted into the DNA encoding the target RNA.
In another preferred embodiment of the present invention, X is selected
in the above general formula such that it forms a restriction enzyme
cleavage site either alone or together with the neighboring nucleotides.
This restriction enzyme cleavage site also provides a means for screening
and determination of the orientation of the portable ribozyme cassette of
the present invention. In addition, this restriction enzyme cleavage si~e
provides a means for the insertion of a marker sequence or any other de-
sired sequence into the portable ribozyme cassette of the presen~ inven-
tion. Thus, in a particularly preferred embodiment of the present inven-
tion, the portable ribozyme cassette al80 contains a marker sequence
which is incorporated into the restriction enzyme cleavage site located
at nucleotide X.
Surprisingly, it has been found, that the enzymatic activity of the ri-
bozyme encoded by a desired DNA sequence into which the portable riboztyme
casset~e of the prese~t invention has been incorporated is retained even
after the insertion of marker sequences.
. ~ .
. , .
' ~ ~
`': : .:
. .
20~31~
12
The marker sequence contained in said restriction enzyme cleavage site of
the portable ribozyme cassette of the present invention allows a rapid
- selection of ribozyme constructs which contain the portable ribozyme cas-
sette of the present invention. Therefore, particularly preferred marker
sequences of the present invention represent a selectable marker gene,
such as an antibiotic resistance gene or a gene such as the ~-galactosi-
dase gene, allowing the identification of desired recombinant DNA se-
quences by providing a color reaction.
In cases where it is not desired to retain the marker sequence in the
portable ribozyme cassettes of the present invention, they can be removed
by simply cleaving the constructed recombinant DNA sequences with the re-
striction enzyme recognizing the restriction enzyme cleavage site at po-
sition X and re-ligating the cleavage product, i.e. the DNA sequences
flanking the originally contained marker sequence.
.
In a further preferred embodiment, the portable ribozyme cassettes of the
present invention are cloned in a recombinant vector, so that said
portable ribozyme cassette of the present invention is flanked by re-
striction enzyme cleavage sites. In a preferred embodiment these cleavage
; sites are derived from a class-IIS restriction enzyme ~hat cleaves in a
definet di~tance away from its actual recognition sequence that is lo-
cated outside the sequence of the portable ribozyme ca3sette. This in~er-
tion of the portable ribozyme casse~te of the present invention allows an
excision and thus a simple transfer of the same into another target DNA
~equence.
Moreover, the ribozyme cassette of the present invention which itself
contains a restriction enzyme recognition sequence and which is cloned on
a vector so ~hat it can be precisely excised, may contain another DNA,
e.g. a marker gene can be inserted. This enables the generation of a ri-
bozyme ca3sette containing a marker gene.
,: .
In a further embodiment, the present lnvention relates to a DNA sequence
encoting a ribozyme (antizyme), said DNA sequence containing a portable
ribozy~e cassette of the present invention in an orientation allowing the
production of a ribozyme displaying endonuclease activity upon expression
::
~: ~ - . . - , . , . ,- , . . . . . .
': : ~ : . : . , .; , . : ,
,. . - : , . : - : , , -.
,:: . . :, :: : : , . . . ..
2 ~
13
in a host cell, or when used as template in a polymerase chain reaction,
and containing additional sequences flanking said ribozyme cassette which
have a length sufficient to provide a target-specific endoribonuclease
activity of the encoded ribozyme.
These ~NA sequences of the present invention can be used for the produc-
tion of highly selective ribozymes (antisense ribozymes, antizymes) in
the systems described below. They can be easily obtained by inserting the
portable ribozyme cassette of the present invention into a restriction
enzyme cleavage site of a DNA sequence encoding an RNA which is an anti-
sense RNA in comparison to the target RN~. Therefore, as already men-
tioned, the ribozymes of the present invention are also called antisense
ribozymes or ~antizymes~.
The additional sequences flanking the portable ribozy~e cassette after
insertion of it into a desired DNA sequence encode an antisense RNA in
relation to the target RNA. These flanking sequences can be either a part
of the antisense RNA or a full-length antisense RNA. Unless desired, a
part of the antisense RNA having a length which is sufficient for highly
selective binding of the ribozyme RNA to the target RNA can be used to
express a target-specific ribozyme acting as endoribonuclease, e.g. in a
given cell.
.,~ . .
- In a preferred embodiment of the present invention, said DNA sequences of
the present invention which i8 contained in the recombinant vector i9 un-
der the control of a suitable promoter. These recombinant vectors of the
present invention are expression vectors which are suitable for the ex-
~; pression of the ribozymes of the present invention in a desired host
, cell. Examples of such procaryotic promoters are the bacteriophage lambda
;~ PL and PR promoters, the bacteriophage SP6, T3 and T7 promoters (which
,- are preferred for the in vitro synthesis of the ribo2ymes of the present
;~ ~ invention), the lacZ, tac, trc ant the trp promsters. Examples for eu-
l caryotic promoters in animal systems are the glucocorticoid-induciblepromoter present in the mouse mammary tumor virus long terminal repeat
~MMTV LTR), the SV40 early and late promoters and for plant systems the
nopaline synthase promoter, the cauliflower mosaic virus (CaMV) 35S pro-
moter, and promoters derived from gemini virusas.
'` ' :'
- ,
~` :
~, . . , , ~ , .
- 2~'g~ ~ 5~
14
In a preferred embodiment of the present invention, the additional DNA
sequences, which encode an antisense RNA, and which flank the portable
ribozyme cassette after insertion, contain at their S'- and/or their 3'-
ends sequence domains that are self-complementary and that form after
transcription into RNA highly stable stem-loop structures, which confer
protection against exonucleases.
In a particularly preferred embodiment of the present invention, the se-
quences which after transcription into RNA form the stable stem-loop
structure are derived from a double-stranded DNA cassette that can be in-
serted by blunt-end ligation and that has the following sequence:
5' pG~GGCCGCTCGGGCCACGCGAGGCCCGTGCGGCCGT 3'
3' CGCCGGCGAGCCCGGTGCGCTCCGGGCACGCCGGCAp S' .
In a further embodiment, the present invention relates to recombinant
vectors containing a portable ribozyme cassette of the present invention
or the above mentioned DNA sequences of the present invention.
,
The present invention also relates to host organisms containing these re-
combinant expression vectors such as bacteria, e.g. E.coli or Bacillus
subtilis, lower eucaryots, such as yeast or fungi.
In another embodiment, the present invention relates to a method for the
production of a ribozyme of the present invention, said method comprising
cultivating a host of the present invention under suitable conditions,
and isolating the ribozyme of the present invention from the culture.
The present invention also relates to the ribozymes encoded by the DNA
sequences of the present invention. Furthenmore, the present invention
relates to viral, bacterial, plant and animal genomes, con~aining a
portable ribozyme cassette of the present invention or any other of the
DNA sequences of the present invention referred to above. Additionally,
the present invention relates to the corresponding viruses, bacteria,
fungi, plants or animals containing such genomes. For instance, such
viruses can be used as vectors for introducing DNA sequences encoding the
ribozymes of the present invention into a desired host. Retroviruses a~d
vaccinia viruses are preferred vector viruses.
- : . : . . :. ::. . . . ,,. :, , . :
. ~ . . : .,: :: . .
: ~ :: : . . ................... . . .
:; . ~ - . . ~ .. - : ,. . .
: 2~3~
; 15
As explained herein above, the transcription of the DNA sequences encod-
- ing the ribozymes of the present invention gives rise to ribozymes which
act to inactivate a desired target RNA (substrate RNA). Thus, either the
- DNA sequences encoding the ribozymes of the present invention or the ri-
bozymes themselves have extensive ~herapeutic and biological applica-
tions. For example, they can be used for the suppression of certain un-
wanted genes or the treatment of viral infections in man, animals and
plants by inactivating a target RNA, produced in the life cycle of the -
virus. Thus, the ribozymes of the present invention can be used for the
~, treatment of infections with retroviruses such as the human immunodefi-
ciency virus (HIV) and positive-sense RNA viruses, such as infections
'~ with togaviruses, coronaviruses, picornaviruses, cali~iviruses and also
for infections with negative-sense RNA viruses such as paramyxoviruses
(e,g. Sentai virus), rhabdoviruses, the influenca viruses, the
bunyaviruses, or arenaviruses.
Also the viral mRNAs of DNA viruses can be targeted by ribozymes of the
present invention, ~o that they can be uset for treatment of viral infec-
tions with pox-, irito-, herpes- (e.g herpex simplex virus (HSV)), adeno,
papova- ~e.g. hepatitis B virus (HBV) ant/or reoviruses The ribozymes
ant the corresponting encoting DNA sequences of the present invention can --
also be uset for the inactivation of target RNAs in procaryotic cells,
;:~ such as bacteria, or eucaryotic cells such as protozoa and yeast, in
ij~ plants ant animals, such as parasitic animals, e.g. plasmotium faliparum,
and humans. In the treatment of humans, the ribozymes of the present in-
:7 vention or the corresponting encoting DNA sequences may be administered
to a patient in neet thereof. -
Therefore, the present invention also relates to a composition containing
a ribozyme or a corresponting encoding DNA sequence of the present inven-
tion. The present invention furthermore relates to a method of eliminat-
ing a target RNA in a plant, an animal or a human patient, which com-
prises treating said plant animal or human patient with a DNA sequence ~
encoding the ribozyme of the pre~ent invention or with a ribozyme of the ~ -
present invention, optionally in association with a pharmaceutically,
veterinarially or agriculturally acceptable carrier and/or excipient. By
using such compositions, the ribozymes or the corresponding encoding DNA
sequences of the present invention may be delivered by parenteral or
16 2~
other means of administration.
. .
In a preferred embodiment of the compositions of the present invention,
the DNA sequence encoding the ribozyme of the present invention and con- -
`- taining a portable ribozyme cassette of the present invention is con-
tained in a vehicle, such as a carrier virus, by which it is transported
to a particular target tissue or cell into the genome of which it can be
incorporated or in which it can be transiently expressed. A carrier virus
- which may be used here for example is a recombinant retrovirus or a re-
combinant vaccinia virus.
In the case of plants, ~he compositions of the present invention may con-
tain Ti-plasmid based vectors or vector systems or correspondingly trans-
formed Agrobacteria, which are capable of directing the transfer of the
DNA sequences of the present invention containing the portable ribozyme
cassette into a desired target tissue or target cell of the plant to be
. treated. Alternatively, the compositions of the present invention may
contain expression vectors which are suitable for direct gene transfer
techniques into plant cells or tissues, such as electroporation or parti-
cle acceleration. . .
~i Again, the expression of the ribozyme in such a plant target tissue or
io target cell may be either transient or permanent.
'`i
~! Thus, the present invention also relates to compositions for eliminating
~ the disease-causing capability of an infectious agent.
i
The present invention also relates to a method for the production of a
DNA sequence encoding a ribozyme, wherein this DNA sequence contains a
portable ribozyme cassette as described herein, said method comprising
. t~e steps of:
~, (A~ selecting in a DNA sequence encoding a desired target
RNA, which is to be inactivated by a ribozyne, a restriction enzyme
. ~ .
cleavage site of the following nucleotide sequence:
M2 Ml R L Z Nl N2 N3 N4
Y~ erein M2, Ml, R~ L~ Nl, N2, N3, and N4, have t:he same meaning as
~ given before;
.~
.j . .
~: :
... . . ~ . -, ;. . , ,, . . . . - ., . : -
: .. ... . . : ,: . . : , ~ .: , :
17
Z is A, G, C or T;
Z corresponds to the 3'-tenminal nucleotide of the 5'-ter~inal ri-
bozyme cleavage product of the target RNA;
the nucleotide sequence K L Z corresponds to a nucleotide sequence
of the target RNA which is cleavable by a ribozyme; - .
and wherein Z is part of the protruding ends obtained after cleavage .
of said restriction enzyme cleavage site with the corresponding re-
striction enzyme;
A (B) cleaving said restriction enzyme cleavage site of the DNA
: sequence given in (A) with the corresponding restriction enzyme;
(C) removing the protruding ends of the cleavage product of
(B) and creating blunt ends; . .
,, .
(D) protucing a ribozyme cassette by carrying out a method
comprising the following steps :
' :: -
(DA) atding to the 5'-terminus of a DNA sequence (a), as :
3 tefinet in the preceding claims, the nucleotides locatet at the
S'-side of Z in the protruding ends as obtained in (B); and
(DB) atting to the 3'-terminus of said DNA sequence (a) the ~ :
nucleotites located at the 3'-site of Z in said protruding ents;
,; (~) insertion of the ribozyme cassette obtained in step (D)
into the DNA sequence obtainet in ~tep (C).
In a preferred embodiment of this method, the ribozyme cassette display- :
ing the structure given in step (D), which is inserted in step (E) into
the DNA sequence obtained in step (C), is excised from a cloning vector ~: :by cleavage of restriction enzyme cleavage sites flanking said portable
ribozyme cassette.
, .
Furthermore, the present invention relates to a method for the production
of ~a portable ribozyme cassette of the present invention comprising the
steps of :
, .
~ 18 2~$~
(A) selecting in a DNA sequence encoding a desired target RNA,
which is to be inactivated by a ribozyme, a restriction enzyme
cleavage site of the following nucleotide sequence:
M2 Ml R L Z Nl N2 N3 N4
wherein M2, Ml, K, L, Nl, N2, N3, and N4, have the same meaning as
before;
Z i8 A, G, C or T;
Z corresponds to the 3'-terminal nucleotide of the 5'-term.inal ri-
bozyme cleavage product of the target RNA;
the nucleotide sequence K L Z corresponds to a nucleotide sequence
of the target RNA which is cleavable by a ribozyme;
and wherein Z is part of the protruding ends obtained after cleavage
of said restriction enzyme cleavage site with the corresponding re-
striction enzy~e;
~! .
fi(B~ tetermining the protruding ends of said restriction enzyme
cleavage site which are created by cleaving with the corresponding
restriction enzyme; and
(C) producing a ribozyme cassette by carrying out a method
comprising the following steps :
w
.(CA) adding to the 5'-terminus of a DNA sequence (a), as
,defined in the preceding claims, the nucleotides located at the
5'-side of Z in the protruding ends determined in (B); and
(CB) adding to the 3'-terminus of said DNA sequence (a) the
.. ~ nucleotides located at the 3'-side of Z in said protruding ends.
I~ a preferred embodiment of the present invention, the technique to gen-
~: ~erate a DNA construct that encodes an antisense-ribozyme, (which is di-
rectea against a particular target RNA (substrate RNA)), comprises five
~~ steps: (i3 the preparation of the DNA cassette, (ii) the preparation of
;~the cDNA that codes for the target RNA (substrate RNA), (iii) the actual
insertion of the DNA cassette`into the cDNA, (iv) the analysis of the re-
co~binant clones and (v) the confirmation of the catalytic activity of
. ~ .
;... - . ` . - ~ . : . ~ -
.. :. . ~
~" ~ ` ' ':: ' '
'~:
the resulting RNA in a ribozyme assay. The individual phases of the pro-
cedure are done as follows. A more detailed description of some conven-
tional laboratory procedures are found in Sambrook et al., "Molecular
Cloning", Cold Spring Harbor, second edition, 1989.
(i) Preparation of the DNA cassette:
As outlined in Ex~mple 2 and Fig.8, for each desirable DNA cassette an
oligodeoxynucleotide is cloned in a plasmid vector, which is preferably
the plasmid pT3T71ac (Boehringer Mannheim, FRG). The resulting recombi-
nant plasmid ~for example plasmid pAzSall) contains a DNA sequence,
corresponding to the desired DNA cassette between two recognition sites
of a class-IIS restriction enzyme, like EarI, that allows to specifically
release a DNA fragment with defined ends so that after filling-in of its
protruding ends the desired DNA cassette can be obtained. After confirm-
ing the correct cloning of the oligodeoxynucleotide by sequence analysis,
the plasmid that carries the ribozyme DNA cassette is cleaved with XhoI.
A DNA fragment that is flanked by XhoI sites and that contains the tetra-
cycline resistance gene (tet gene) is inserted. This DNA fragment is ob-
tainet from a modified version of the plasmid pBR322 that had been gen-
erated by successive introduction of XhoI linkers into the EcoRI and AvaI ~-
sites of plasmid pBR322, respectively, after cleaving with said restric-
tion enzyme8 and sub~equent filling-in with Rlenow polymerase (the EcoRI
site is thus restored). Then, the orientation in which the tet gene hat
been insertet into the XhoI site is determined by tigestion with EcoRI
ant HintIII, which cleave once within the tet gene and once in the plas-
mit pT3T71ac. After completing this analysis, the actual DNA cassette is
generated by cleaving the recombinant plasmid (for example pAzSall-tet)
with EarI. About 5-10 ~g of the plasmit are tigested with about 20-30
units of the isosshizomer Rsp632I from Boehringer Mannheim in a volume of
100 ~1. After 2-3 hours at 37-C, dNTPs are atdet to a final concentration
of 500 ~M, 5 units of the large fragment of E.coli D~A polymerase I
(Rlenow en~yme, N.E. Biolabs) are atted and the reaction mixture is in-
cuba~et for 5 minutes at 16-C. After adtition of EDTA to a final concen-
tration of 15 mM, the DNA is loaded in se~eral l~nes on an agarose gel.
After separation of the DNA fragments by electrophoresis, the gel is
stained with ethidium bromide ~1 ~g/ml) ant the fragment of about 1450
.
: ' :
-,
`, ' ' - ' , - . :
2 ~ u ~
base pairs, corresponding to the desired DNA cassette, is excised. The
DNA is electroeluted, phenolized and collected by isopropanol precipita-
tion. The DNA cassette is then dissolved in a small volume (10-20 ~1) of
TE buffer (lO mM Tris/HCl, 1 mM EDTA pH 8.0). A small aliquot (1 ~1) is
again loaded on an agarose gel to estimate the concentration of the re-
covered DNA cassette.
The residual solution of the DNA cassette is stored at -20-C and can be
used for several incorporation experiments.
_preparation of the ç~A
The cDNA (or a fragment of it) that encodes the target RNA is cloned into
a cloning vector that allows in vitro transcription of the inserted DNA
in different directions from bacteriophage-encoded RNA polymerase promot-
ers, such as T3, T7 or SP6 RNA polymerase. Many of these ~gemini~-type
vectors are co~mercially available. A preferred example is the tran-
scription vector pT3T71ac (or modifications thereof, where one restric-
tion site had been destroyed) from Boehringer, Mannheim, FRG. The plasmid
contains a polylinker region between the promoters for T7 and T3 RNA
polymerase. This enables the in vitro synthesis of RNA that corresponds
to the substrate RNA or its complementary RNA (compare Fig.2). Thus, la-
beled RNA can be synthesizet that can act as substrate for the ribozyme
assay (see below).
After selection of a restriction site where a corresponding DNA ribozyme
cassette should become introduced, one ~g of the recombinant plasmid is
cleaved with said restriction enzyme. After phenolizing and subsequent
collection of the plasmid by isopropanol precipitation, that plasmid is
dissolved in 18 ~1 of Sl buffer (225 mM NaCl, 30 mM potassium acetate
pH 4.5, 200 ~M ZnS04 and 5% glycerol) and incubated in ice for at least
10 minutes to be cooled down to O-C. In parallel, nuclease Sl (Boehringer
Mannheim) is diluted in Sl buffer to a concentration of 1 unit per ~1 and
also incubated for at least lO ~inutes on ice. Then, 2 ~l, corresponding
i:
,~ to two units of nuclease Sl, are added to the cleaved plasmid. After 20
-~ ` minutes on ice, 5 ~1 of Sl Stop buffer (300 mM Tris/HCl, 50 mN EDTA,
pH 8.0) are adted ~o the reaction mixture, which is in the following in-
cubated for 10 minutes at 65-C for inactivation of the nuclsase. The sam-
ple is subsequently phenolized and again precipitated with isopropanol.
. ~ .
~,
2 ~
21
It is dissolved in a small volume of TE buffer (10 ~1) and 1 ~1 is loaded
on an agarose gel to estimate the concentration.
(iii~ In~er~ion of the DNA cassette into the cDNA:
,
About 200 - 300 ng of the cDNA-containing plasmid, cleaved with the re-
striction enzyme, into which the DNA ribozyme cassette should be intro-
duced, and the resulting protruding ends trimmed by treatment with nucle-
ase Sl is mixed with about 100 ng of the DNA ribozyme cassette and lig-
ated in a small volume (5 - 10 ~1) of blunt end ligation buffer t50 mM
Tris/HCl pH 7.5, 10 mM MgC12, 5% PEG 8000, 1 mM DTT and 100 ~M ATP with
3 units of T4 DNA ligase (Minotech, Heraklion, Greece) for at least 12
hours at 12-C. The ligation mixture is then transformed into E.coli, pre-
ferably strain JMô3, and plated on agar plates that contain 13 ~g/ml
tetracycline and 100 ~g/ml ampicillin.
',J
(iv!_~Dalvsi~ of ~he recombinant clones
After isolation of plasmids from the recombinant clones (minipreps),
~restriction analysis~ is carried out, in order to test for the presence
of the StuI site originating from the DNA cassette. XhoI digestion con-
firms that the tet gene can be excised. The orientation of insertion is
determined by using a restriction enzyme that cleaves within the tet gene
and in the cDNA insert or within the vector, e.g. Bam~I, EcoRI or
NindIII. Depending on the orientation of insertion of the tet gene, it
can be concluded whether a sense- or an antisense directed- ribozyme has
been constructed.
(v) ~ibozvme assav:
- . ~:
The correct generation of the ribozyme RNA is confirmed by a functional
test. For this purpose/ labeled substrate RNA is prepared by in vitro
transcription, using the transcription vector into which the cDNA frag-
ment of interese had been cloned. The ribozyme constructs are cleaved
with a restriction enzyme (which does not cleave within the tet gene, nor
within the oDNA insert), so that they proYide a template for run-off
transcription. The ribozyme RNA is prepared by in vitro transcription
:
'" ' ' "' ' ' ' ' ; " ' ' ' '`;. ' ,.'.'\ ' '1 '; ' '~ "'' ' ' '" .".' ' . ' . ' ' . '
2 ~
22
(unlabeled) from the corresponding promoter under standard reaction con-
ditions (according to the supplier of the enzymes (N.E. Biolabs or
Boehringer Mannheim) in 20 ~1 for one hour at ~7-C. In the last two min-
utes of the reaction, 4 units of DNaseI, RNase-free (Boehringer Mannheim)
are added. Then the mixture is phenolized and precipitated with ethanol.
The ribozyme RNA is then incubated with the labeled substrate RNA in
20 ~1 of 50 mM Tris/HCl p~ 8.0, 20 mM MgC12 for 30 minutes at 60C. After
addition of sodium acetate (pH 5) to a final concentration of 0.2 M and
1 ~g of tRNA (used as "carrier~), the samples are precipitated with
ethanol and separated on a denaturating 5% polyacrylamide gel as de-
scribed by Tsagris et al., EMB0 J., 6 (1987), 2173-2183, and visualized
by autoradiography. Detection of cleavage products of expected size con-
firm the ribozyme nature of the tested RNAs.
Ultimately, the corresponding DNA construct is cleaved with XhoI and re-
ligated in order to excise the tet gene.
For a fast analysis, the ribozyme RNA can also be taken directly after
transcription (wi~hout phenolizing and precipitation the ribozyme RNA).
In that case, 20 ~1 of labeled substrate RNA in 100 mM Tris/HCl pH 8.0
and 40 mM MgCI2 are adted to the unlabeled ribozyme RNA and the reaction
mixture is incubated for 30 minutes at 60-C. Then 20 ~1 of 0.6 M sodium
acetate, 150 ~g/~l tR~A is added, followed by 150 ~1 of ethanol. The sam-
ples are collected by centrifugation and separated on a denaturating
polyacrylamide gel together with an aliquot of labeled but untreated sub-
strate RNA. After visualization by autoradiography, cleavage products of
the substrate can be identified. Due to the lacX of phenolization of the
ribozyme RNA, the substrate RNA might undergo some unspecific degrada-
tion. The cleavage products can, however, be identified. Thus, the ri-
bozyme activity of certain constructs can be verified.
.
Examples of restriction enzyme cleavage sites (taken from the catalogue
of New England Biolabs) which can be used in the above mentioned methods
of the present invention are listed in the following Table I.
.. . . ,, - - . .............. - ,. , . , :
~ . , , . . .. , :
s~
: 23
Table I
Examples of restriction enzyme cleava~e sites for the insertion
of restriction enzyme-specific portable ribozyme cassettesa
: _ __ _ ___ _ _ _ _________ ___ _ _ _ __ _ _ _ _ __
Restrictionb TargetC No.of casesd sequence DNA cassettef
- enzyme moti~ in % after trimminge
KLZ MlK L (a) NlN2N3N4
: _ _ _ _ _ _ _ _ _ _ _ _
ATC~Q~ifs:
BamHI -G'G=~C- 100 -G C- G A T (a) - - - -
BclI -T'GATÇA- 100 -T A - G A T (a) - - - - -
BglII -A'GATACT- 100 -A T - G A T (a) - - - -
SstYI -RG~Q'Y- 100 -R y _ G A T (a) - - - -
ClaI -AT'CGAT- 100 -AT AT- ~ ~ ~ (a) G - _ _
CTA ~ ~
. ~ ,
AvrII -C'Ç~5GG- 100 -C G-- C T (a) G - - -
, NheI -G'~GC- 100 -G C-- C T (a) G - - -
SpeI -A'Ç~GT- 100 -A T-- C T (a) G - - -
~1 XbaIg -T'~GA- 100 -T A-- C T (a) G - - -
.? -------------------------------------- .
.....
~' XhoI-C'TCGAG- 100 -C G-- - T (a) G A - -
AvaI-C'YCGRG- 50 -C G-- - T (a) G R - - ~.
--_________ ____ :
.~ CT~ mo~ifQi:
~ .
:,
~: Bsu36I-CC'TNAGG- 50 -CC GG - - - T (a) A - - -
; DdeI-C'TNAG- 50 -C G - - - T (a) A - - -
j EspI-GÇ'T,N~AGC- 50 -GC GC - - - T (a) A - - -
? ---------------------------------------- :
'^ ' :
', ':
.,
"" . ' " . ' ' . ' ., ' . ' ' ' . ` ', , ' ' ' . .: ' ,
,': .'.' '' ': ' ~''' ' . . '' , ' ' .,', : ' , . : .
,` : ''., :' ' ' ,. : ''
24
- Continuation of Table I
______ _ _ _ _ _ _ _ .
Restrictionb TargetC No.of casesd sequence DNA cassettef
enzyme motif in X after trimminge
RLZ MlR L (a) NlN2N3N4
_ _ ~
GTA moti~s :
' .
Asp718 -G'GTACC- 100 -G C- - G T (a) C - - -
RpnI -G~C'C- 100 -G C- - G T (a) C - - -
Acclh -=~ ~TAC- 50 -GT AC- - - - (a) T - - -
_________ _____ ______________ ______ __ ____________ __ ___ _ _ _ ,
G~C m~tifs~ :
:.:
SalI -G'TCGAC- 100 -G C- - - T (a) G A - -
`, AccIh -9l ~GAC- 50 -GT AC- - - - (a) G - - -
AvsII -G'~C- 50 -G C- - G T (a) - - - -
PpmuI-RG'~CY- 50 -RG CY- - G T (a~
RsrII-CC'GW~CCG- 50 -CG CG- - G T (a) - - - -
, E~oO109I -RG'Q~CY- 25 -RG CY- - G T (a) - - - -
s _ _ _ _ _ _ _ _ _
` Ç~L~:
.. .. . .
BstEII -G' ~ ACC- 100 -G C- - G T (a) A C - -
MaeIII -'Q~AC- 100 ~ ~ - G T (a) A C - -
___________________________ __________________________ ___________
9~L~:
. . .
: ApaLI -Çi~QCAC- 100 -G C- T (a) C A - -
.
, . _ ___ __ _________________________________________________________
.~ NTC mQtifs:
i:
BspHI -( ~ ATGA- 100 -(N)T A- - - - (a) A T G -
BspMII -( ~ CGGA- 100 -(N)T A- - - - (a~ C G G -
TaqI -(N)T'CGA- 100 -(N)T A- - - - (a) G - - -
XbaIg -(~2~TAGA- 100 -(N)T A- - - - (a) T A G -
EcorII (NT?'CCWGG- 25 -(NT) - - - - ~a) C W G G
: _________________ _____ __ _______________________________________ -
, .
,~:
.; , '
,2,~&~
Continuation of Table I . .:
_____________________________________________~________ _______ _
Restrictionb TargetC No.of casesd sequence DNA cassettef
enzyme motif in % after tri inge
RLZ MlK L (a) NlN2N3N4
________________________________
TTÇ motif:
BstBI - ~ G M - 100-T A- - - T (a) G A - -
______ __ _ ___ __ _ _
A~A mQtif:
NdeI -CA'TATG- 100-CA TG- - - T (a) - - - -
______________________ ___ ___ _________________ _____________ ___ .
,~A~Qt~~:
AseIk -,~EAAT- 100-AT AT- - - - (a) A - - -
EcoRI -G'AQ~C- 100-G C- A A T (a) - - - -
___~_____________ ____________________________________ ______ ___
'',.':- '
AflIIl -Ç'~T M G- 100-C G- - - T (a) A A - -
J --_____-____________ ____
1 ` '' ~
, AseIk -A~ ~AT- 100-AT AT- - - T (a) - - - - .
AflIIl -C'3~AG- 100-C G- - T T (a) A - - -
_ _ _ _ _ _---- ----
Foot notes :
a: A detailed example for the interpretation of the Table is given
below;
b: The restriction enzymes are listed which can be used for insertion of
a ribozyme cassette; with the exception of TaqI, only restriction
enzy~es with a recognition sequence of five and m~re nucleotides are
. listed. .
J :
, . ..
,' -," "
~ : ~ ! ;; ' ' '
26 2~V~
c: The recognition sequences of the restriction enzymes, which is part of
the DNA encoding the target RNA, are given,
the cleavage site is indicated by ~ n ~
the nucleotides N are A, C, G or T, W are A or T, Y are C or T, R
are A or G,
the target motifs consisting of the three nucleotides KLZ (as de-
fined before) within the restriction sites are underlined,
all the restriction enzymes listed produce such protruding ends that
they contain the nucleotide Z in it.
d: The percentage gives the proportion of restriction sites
which provide a target motif - e.g. the sequence GGTCC represents
only approximately 50 ~ of all possible AvaII sites with the recog-
nition sequence GGWCC. Only 50% of the AvaII sites can be expected
to be target motifs.
e: Remaining nucleotides of the restriction recognition sequence
~: after diges~ion and removing the protruding ends.
f: The sequence of the DNA cassette which is used for insertion
into the DNA encoding a target RNA, for creating a ribozyme as te-
scribet. The DNA cassette consists of the sequence (a), as definet
before, to which some nucleotites out of Ml, K, L and Nl, N2, N3,
`, ant N4, also tefinet before, are atdet 5'-terminal and 3'-terminal
to sequence (a), respectively.
, g: XbaI contains two target motifs: -( ~ TAGA- ant -T'Ç~9GA-.
1 h: There are two possible AccI sites ~E~G~C ant Q~TAC which
contain a GTA ant GTC motif, respectively.
i: So far, cleavage has only been observed for CTA ant CTC motifs.
k: AseI contains two target motifs: AT'T M T and AT'T M T.
1: AflII contains two target motifs: C'TTAAG and C'TT M G.
~'.
,
.:.
~',
,
~ - .
.. : . . ., , - . . . . . . ~ . , : . - : . . . - . . : .
: ~ . : : ~: . : , :
.
æ~
27
For the better understanding of the present invention, in the following
an example of how to apply and interpret Table I is given: :
If, for instance, a ribozyme is desired which contains a GTC target motif
within a SalI recognition sequence, the DNA cassette is selected accord-
ing to Table I as follows:
The SalI site is
,~ -GTCGAC- (in Table I given as G'TCGAC)
-CAGCTG-
- ., .;
After digestion :
.. ,'~
-G TCGAC-
-CAGCT G-
and trimming : :
-G C- (in Table I given as -G C- )
-C G-
The portable ribozyme cassette of the present invention with the cat-
alytic domain which has to be inserted may for instance consist of the :
following core sequence (DNA sequence (a)), and the ~replacement nu-
cleotides" which are the DNA sequence (b) (here, 5'- end: L is ~, and
' 3'-end: Nl is G and N2 is A) which are specific for each restriction
r recognition sequence:
'. . ' : .
5' T TTCGGCCTCGAGGCCTCATCAG GA 3'
3' A AAGCCGGAGCTCCGGAGTAGTC CT 5'
core sequence
', (DNA sequence (a)) . .
5' 3'
(in Table I given as : T (a) GA)
~` ~
,.. - ~ ;, .. ~ : .: . .. , . ~ : .: . .
~s~
28
In order to create a ribozyme of the present invention which is specific
for a particular target RNA, only two requirements must be fulfilled :
(i) at least a partial DNA construct encoding the target RNA
(substrate ~NA) must be available, preferably cloned in a plasmid or
phage vector (sequence information is not necessary !), and
(ii) the DNA construct must contain a restriction enzyme cleavage
site as defined hereinabove in the general formula, e.g. a restric-
tion enzyme cleavage site as given in Table I.
All these sequence motifs contain one of the cleavage motifs re-
quired for ribozyme activity.
The sequences of portable ribozyme cassettes which are preferred on the
basis of our current Xnowledge on restriction enzyme cleavage sites and
OA the poYRible tarRet =otifs are s~L~arized i= Table II.
.
,'' , :
. '
~ - .
.~ ; .
.
.
~- 2 ~ s ~
29
Table II
Summary of the different DNA cassettes used for insertion
into different restriction sites in order to create a DNA
.~ that encodes for a ribozyme :
, _____________________________________________________________ _ . :
- No. sequence of restriction nucleotides presentC sum of nu- -. --
DNA cassettea enzyme(s)b in DNA cassette cleotides in
sequence (b)d
______________________________________________--_----
1 (a) G AccIe Nl
ClaI
TaqI :
. :
, 2 (a) T AccIe Nl
___________________________________________________________ ______
. 3 T (a) A Bsu36I L Nl 2 :
`, DdeI
: EspI -
-,.
__________________________________________________________________
~' 4 G T (a) AvaII R L 2
EcoO109I ::
PpmuI
RsrII
,,__________________________________________________________________ .
~, 5 G A T (a) Bam~I Ml K L 3 :
BclI
~ Bgl II ;
i BstyI
_____ ______________________ _____________________________________ ,
6 C T (a) G AvrII R L Nl 3
NheI
' SpeI
~,~ XbaIf
,~ 7 G T (a) C Asp718 R L Nl 3
~ RpnI
________________________________________________________________ _ ...
~ ' ' . '
~' , .
:; ' ', : ' ' :; ., :: . . , , - . . ' ' ~ ' ' :. ' :` .
2 ~ s~
Continuation of Table II
No. sequence of restriction nucleotides presentC sum of nu-
DNA cassettea enzyme(s)b in DNA cassette cleotides in
sequence (b)d
______________ ___________________________________________________
8 T (a) G A AvaIe L Nl N2 3
BstBI
SalI
Xhol
__________________________________________________________________
9 T (a) G G AvaIe L Nl N2 3
_______________
(a) A T G BspHI Nl N2 N3 3
__________________________________________________________________ ,
11 (a) C G G BspMII Nl N2 N3 3
_________ ________________________________________________________ ,
. 12 (a) T A G XbaIf Nl N2 N3 3
__________________________________________________________________ - ..
13 G T (a) A C BstEII R L Nl N2 4
MaeIII
____________________________________________ _____________________ ,
14 ta) C A G G EcoRIIe Nl N2 N3 N4 4 ~
_____________________________________________________________ ____
(a) C T G G EcoRIIe Nl N2 N3 N4 4
_____________________ ____________________________________________
, 16 T (a) C A . ApaLI L Nl N2 3
--_____________.____
17 T (a) NteI L
AseIg : .
13 (a) A AseIg Nl
_____ __________________ _ __________________________________ ____
, 19 T (a) A A AflIIh L Nl N2 3
~: _________________________
T T (a) A AflIIh R L Nl 3
:
21 A A T (a) EcoRI Ml ~ L 3
- ' : ', .
31 ~ S.~
- .
Foot notes
a : The DNA cassette consists of sequence (a) as defined plus the addi-
tional nucleotides as indicated;
b : The restriction enzymes which can be used in combination with this
DNA cassette; -
c : The nucleotides added to sequence (a) of the DNA cassette given in
the general form as defined before;
d : indicates the sum of the nucleotides added to sequence (a);
e : These restriction enzymes can be used in combination with two differ-
-~ ent DNA cassettes depending on the recognition sequence of that
: particular cleavage site.
f : Since XbaI contains the two target motifs: -(N?T'CTAGA- and -T'Ç~_GA,
.. every XbaI site can be used with each of the two DNA cassettes.
iii g : AseI contains two target sites: Q~ ~ M T and AT'T M T.
~ h : AflII contains two target sites: Ç ~AAG and C'~AG.
-~ The Figures show :
J Fig 1.
The hammerhead conformation between a substrate RNA (target RNA) contain-
I ing a SalI recognition sequence (GUCGAC) and its corresponding ribozyme
`i; RNA.
`:t The part of the ribozyme molecule which i8 bulged out is the catalytic
. domain and residues which are assumed to participate in the cleavage re-
, action are boxed. The site of cleavage is indicated.
In this particular case, the sequence GUC is thç target motif of the sub-
`~ strate RNA. Therefore, these nucleotites represent the nucleotides RLZ,
:~; wherein nucleotide Z (in this case C) is the only nucleotide of the sub-
strate RNA that does not directly base pair with the ribozyme RNA and
which is that residue, that corresponds to the 3'-terminal nucleotite of
the 5'-terminal ribozyme cleavage product of the target RNA as indicated.
The sequence 5' CUGAUGAGUCCGUGAGGACGAA 3' rçpresents a sequence (a), i.e.
i~ that part of a ribozyme which does not form base pairs with the target
'', .
. '~ .
.!
~; r
~ S 1 ~i ~
32
RNA.
After cleavage of a DNA encoding the substrate RNA with SalI, the nu-
cleotides UCGA of the target RNA are located within the protruding ends.
The nucleotides U and GA of the substrate RNA and A and CU of the ri-
bozyme RNA are part of the protruding ends of the SalI site and are also
part of the base pairing region between substrate RNA and ribozyme.
Therefore, they represent the sequence (b), i.e. the DNA sequences flank-
ing the sequence (a) which are derived from the protruding ends of a re-
striction enz~me cleavage site of a DNA sequence encoding a target RNA,
and which encode a part of that part of a ribozyme which forms base pairs
with the target RNA.
.
Fig.2 ~-
The cDNAs which allow transcription to yield the target RNA and the ri-bozyme RNA.
The top shows the cDNA of a target RNA with a SalI site as indicated, and
the lower part represents the corresponding ribozyme DNA construct. Upon
transcription in the directions indicated by arrows, the target and the
ribozyme RNA (which can be considered as an antisense RNA with a ribozyme
domain) will be synthesized which can form the hammerhead structure as
given in Fig.l. The sense strant of the cDNA encodes the target RNA and
the antisense strand of the corresponding ribozyme construct encodes the
ribozyme RNA. The sequence of the two DNAs differ only in the two parts
which are boxed, wherein the lower box represents sequence (a). The base
pairs T/A and GA/CT which neighbor the boxed C/G pair in the target RNA
and the boxed sequence (a) in the antisense ribozyme construct, represent
the sequence (b) derived from the protruding ends of the SalI cleavage
site.
This figure summarizes the principle of the present invention in which
the boxed C/G pair within the DNA encoding the target R~A is replaced by
the box given at the bottom, resulting in a DNA construct which gives
rise to a ribozyme RNA specific for the target RNA when an antisense
(antizyme) RNA is synthesized utilizing the DNA construct as template.
;
.
~ ~ a (''3 ~
33
Fig.3
Strategy for creating a ribozyme construct directed against an RNA with a
SalI recognition sequence.
The top illustrates a double-stranded cDNA containing a SalI site with
the sense strand at the top. The four internal nucleotides TCGA are re-
moved by digestion with SalI and subsequent trimming of the protruding
ends. By insertion of a synthetic SalI-specific double-stranded DNA cas-
sette, a sense- or antisense-directed ribozyme construct can be obtained,
depending on the orientation of insertion. The hatched part of the syn-
thetic DNA cassette corresponds to the lower strand of the boxed sequence
of Fig.2 and represents a sequence (a) within the ribozyme sequence. In
this case, the sequence (a) is modified to contain a StuI site (AGG'CCT)
as given in Fig.4. The nucleotides which are attached (5'T and 3'GA, and
5' TC ant 3'C, respectively) comprise sequence (b) and correspond to nu-
cleotides L, Nl and N2 of the general formula. They are used to replace
three of the four nucleotides which have been removed by SalI digestion
and subsequent trim~ing.
The nucleotide C in third position of the SalI site corresponds to nu-
cleotide Z, and is not replaced by inserting the cassette.
Fig.4
The hammerhead structure formed by a ribozyme RNA that contains a StuI
recognition sequence and is directed against an RNA containing a SalI
recognition sequence.
The substrate RNA contains a SalI recognition sequence like in Fig.l. The
catalytic tomain is modified by three nucleotide exchanges. The newly in-
troduced residues G,U,C (5'->3') are given in bigger letters and the
original nucleotides are indicated in parenthesis. The nucleotide ex-
changes create a new StuI recognition sequence AGGCCU and opposite of it
an additional HaeIlI sequence GGCC.
: . , . :~
.. , ~ , . .
2 ~ ~ o 1 5 ~ -
Fig.5
Map of the plasmids pPVl and pPV2 and their resulting antizyme con-
structs.
The two maps at the top show the plasmids pPVl and pPV2 which each con-
tain an EcoRI fragment of the cDNA of plum pox virus (PPV) ranging from
nucleotide 3409-3831, with a SalI site at nucleotide 3631, which is de-
tailed. The EcoRI fragment is inserted in different orientations in the
two plasmids. The right legend indicates the polarity of the PPV RNA
which can be synthesized with T3 and T7 RNA polym~erase from these plas-
mids, respectively.
The two maps in the middle are antizyme constructs derived from plasmid
pPVl and the two maps at the bottom represent derivative~ of plasmid
pPV2. The hatched parts of the DNA cassette in the four antizyme con-
structs, represent the sequence (a) of the ribozyme sequence. The right
legend indicates whether T3 or T7 RNA polymerase can synthesize a sen~e
or an antisense-directed ribozyme construct.
-- .
. ~ .
~-, Pig . 6
. '' .
Autoradiograph of the gelelectrophoretic analysis for cleavage of PPV
target RNA by an antizyme RNA.
The plasmids pPV2 and pPV12 were used to synthesize radioactively labeled
PPV (-) RNA serving as substrate (S) and antizyme RNA (Az), respectively,
by tran~cription with T7 RNA polymerase. The RNAs were incubated in 50 mM
Tris/HCl, 20 mM MgC12, pH 8.0 for 30 minutes at either O-C or 60-C, alone
or in mixture. After collection by ethanol precipitation, the RNAs were
analyzed on an polyacrylamide gel (5% polyacrylamide, 0.125% bisacry-
lamide) containing ôM urea.
Lane 1, antizyme RNA (Az) from pPV12, incubated at O-C, Lane 2 PPV sub-
strate RNA (S) from plasmid pPV2, incubated at 0C, Lanes 3 and 4 corre-
spont to 1 ant 2, but the incubation temperature is 60-C. Lane 5 contains
~,
'~ ` both RNAs of lane 3 ant 4 incubated together. Lane 6 is like in Lane 5,
:~ but the ribozyme ~NA is not ratioactively labeled ~indicatet by AZ in
parenthesis). Lane 7 contains a truncated marker transcript (T) synthe-
sized by T7 RNA polymerase from plasmid pPV2 which had been cleaved with
-
~ g ~ 5 L.I
SalI before, so that it corresponds to the expected 5'-terminal cleavage
product.
As can be seen in Lanes 5 and 6, the PPV target RNA is cleaved into two
smaller RNAs by the antizyme RNA. The smaller of the two cleavage prod-
ucts co-migrat~s with the marker transcript in lane 7 and represents the
5'-half of the PPV target transcript.
After a reaction time of 30 minutes, more than half of the substrate RNA
was cleaved.
Fig.7
The hammerhead structure with a ribozyme RNA, specific for a SalI recog-
nition sequence, that contains an XhoI and a StuI recognition sequence.
Compared to the structure in Fig.4, an additional base modification (U to
C) is made, creating now an XhoI site (CUCGAG) that forms a hairpin loop -
of the catalytic domain.
. '.' :
Fig.ô
::.
Strategy for constructing an universal SalI-ribozyme-caæsette with selec-
tion for the tetracycline resistance gene (tet gene).
The sequence at the top represents a part of the plasmid pAzSall. After
`~ digestion with the restriction endonuclease EarI and subsequent filling-
in of the protruding ends, a 25 bp DNA casse~te is formed which can be
used to create ribozyme constructs as described in Fig.3.
By inserting the tetracycline resistance gene (tet gene) into the XhoI
site of plasmid pAzSall, the plasmid pAzSall-tet is obtained (lower
past). EarI digestion followed by Rlenow reaction results in a cassette
as shown at the bottom, which can equally be used for insertion into a
trimmed SalI site. Using tetracycline, it can be selected for the inser-
tion of the portable ribozyme cassette.
.
'. .
.~ ' ' '
~:- : . . - . . . . . :
.
.. . .: . , . . , -
, ."
~ ~ S ~
36
Fig.9
Schematic map of different types of antisense ribozyme RNAs.
The peculiarity of antisense ribozymes is that they contain a long region
of sequences complementary (antisense) to the target RNA. Antizymes with
one or two catalytic domains are given in the two upper maps. The map at
the bottom represents an antizyme RNA, in which a foreign RNA, e.g. the
mRNA of the tetracycline resistance gene, has been introduced. It should
be stressed that in case of the tetracycline resistance gene, the in-
serted sequence is more than 50-fold bigger as compared to the actual
catalytic domain.
Fig.10
Map o~ plasmid pPV12-tet.
Plasmid pPV12-tet was createt from plasmid pPVl (Fig.5) by inserting the
SalI-specific DNA cassette obtained from plasmid pAzSall-tet (Fig.8) into
the cleaved and tri~med SalI site of pPVl. The boxed part shows the rele-
vant sequence of inserted cassette in detail. The resulting construct
pPV12-tet is related to plasmid pPV12 (Figs. 5 and 6). A (-) directed an-
tisense ribozyme can be obtained by transcription with T7 RNA polymerase.
After excision of the tet gene with XhoI and subsequent re-ligation, the
plasmid pPV12a was obtained.
Fig.ll
!, . :
Autoradiograph of the gelelectrophoretic analysis for cleavage of PPV
target RNA by two types of antizyme RNA.
The analysis was done as described for-Fig.6. Three types of RNAs were
synthesized by T7 transcription : from plasmid pPY2 the PPV (-) RNA sub-
strate (S), from plasmid pPV12 the antizyme RNA (Az) and from plasmid
pPV12-tet the antizy~e RNA which contains the tetracycline resistance
gene inserted into the Xhol recognition sequence (Az-t). The lanes 1-3
contain the RNAs of plasmids pPV12, pPV2 and pPV12-~et, incubated at 0C.
Lanes 4-6 contain the same RNAs incubated at 609C. Lane 7 con~ains the
mixture between the RNAs of lane 4 ant 5. In lane 8 the RNAs o~ lane 4
. - :
~ .
~$$i ~s~
,~
37
and 6 are mixed. Lane 9 is identical to 8 but the antizyme RNA is not la-
beled. -
It is shown that the RNA derived from plasmid pPV12-tet is able to cleave
the PPV (-) target RNA in the same manner as the antizyme RNA derived
from plasmid pPV12.
. :.
Fig.12
Ceneration of a SalI-specific DNA ribozyme cassette in which the tet gene
is inserted into an AflII site.
A, The plasmid pAzSall (Fig.8) was linearized with XhoI and the protrud-
ing ends were removed by digestion with nuclease Sl.
B, In plasmid pBR322, an AflII linker (pCCTT M GG) had becn introduced
subsequently at the EcoRI and AvaI sites, respectively, that had been
cleaved and filled-in with Klenow polymerase, thus creating plasmit pBR-
af2. It should be mentionet that tbe EcoRI site was restored by introtuc-
tion of the AflII linker. The plasmit pBR-af2 was then cleavet with AflII
that releases a DNA fragment containing the tet gene. The protruding
AflII ents were filled-in with Rlenow polymerase ant the resulting DNA
fragment recovered from an agarose gel.
C, The DNA fragment obtainet in B was then ligated into the plasmid pre-
pared according to A. The resulting construct pAzSal3-tet corresponds
(except the orientation of the tet gene) to plasmit pAzSall-tet (Fig.ô),
and likewise a SalI-specific DNA ribozyme cassette including tet gene can
be obtained from plasmid pAzSal3-tet in analogy to pAzSall-tet. After in-
sertion of the DNA cassette into the SalI site of a cDNA, the tet gene
can be removed by digestion with AflII.
.. ~ .
Fig.13
The hammerheat structure with a ribozyme RNA, specific for a SalI recog-
nition sequence, that contains an AflII and a StuI recognition sequence.
The ribozyme sequence containing an AflII site is derived from DNA cas-
~ ,
'T~ settes such as from plasmid pAzSal3-tet (Fig.12). CDm~Dared to the se-quence given in Fi~.4, there is another G to A mutation, that creates an
AflII site within the catalytic domain.
. ,.......... , .: . ;;: : . .:
38
. ~ .
Fig. 14
Map of plasmid pPV-BSl and the resulting ribozyme construct pPV-BSll-tet.
The map at the top shows plasmid pPV-BSl that contains a BstYI - SphI
fragment of plum pox virus (PPV) corresponding to nucleotides 3461-4058,
with a SalI site at nucleotide 3631, inserted into the vector pT3T71ac
(Boehringer Mannheim) from which the EcoRI site had been deleted by
cleaving ant subsequent filling-in followed by re-ligation. ~y inserting
the SalI-specific DNA cassette form plasmid pAzSal3-tet (Fig.12), the
construct pPV-BS11-tet was obtained that delivers after cleavage with
PvuII and transcription with T3 RNA polymerase a (+) directed antisense
ribozyme RNA.
Fig.15
Autoradiograph of the gelelectrophoretic analysis for cleavage of the PPV
target RNA by an antisense ribozyme RNA containing the tet gene inserted
into an AflII site.
Labeled target R~A was obtained from plasmid pPV-BSl that had been lin-
earized with HindIII and transcribed with T7 RNA polymerase. Unlabeled
RNA transcript, obtainet by tsanscription with T3 RNA polymerase from
plasmit pPV-BSll-tet that had been cleaved with PvuII, was incubated with
the labeled target RNA as described in Fig.6 and analyzed on a denaturat-
ing polyacryiamide gel: Lane 1, labeled RNA of pPV-BSl not incubated;
Lane 2 labeled RNA of pPV-BSl incubated at 60-C for 30 minutes with the
unlabeld RNA transcript of pPV-BSll-tet in 50 mM Tris/HCl pH 8.0, 20 mM
MgC12; Lane 3 labeled RNA of pPV-BSl incubated at 60C for 30 minutes in
50 mM Tris/~Cl pH 8.0, 20 mM MgC12. As demonstrated by the gel, the se-
quence modification into an AflII site did not influence the catalytic
activity.
. 0 . . : . ; ,:, . - ., . .. ~ ~ . : : . ~ . .. .
The following examples illustrate the invention.
More information on the methods applied herein can be found in Sambrook
et al., "Molecular Cloning", Cold Spring Harbor, second edition, 1989.
.
Example 1
Description for t~ generation of antizvme RNA directed against the (-l
RNA_Qf plum~Fox virus ~PPV). utilizing the SalI site of the cloned cDNA
of PPV
The restriction enzyme SalI recognizes the palindromic sequence
--GTCGAC-- . It contains within its recognition sequence a "cleavage~ mo-
tif (cleavable motif or target motif) of the hammerhead RNA: GUC (= GTC,
respectively). A ribozyme RNA directed against an RNA, which contains
such a SalI recognition sequence, forms the hammerhead conformation as
indicated in Fig.l. The objective is to create a DNA construct, which al-
low~ the transcription of such a SalI-directed ribozyme RNA. Fig.2 gives,
in general form, the sequenceY of such a cDNA construct in comparison to
the cDNA of the target. The direction of transcription is different and
the boxed C/G pair within the SalI recognition sequence of the target is
replaced by the catalytic domain of the ribozyme RNA. Fig.3 describes a
strategy to convert the cDNA of the target into the desired ribozyme con-
struct.
,,
In order to test this general strategy in a practical experiment, two DNA
oligonucleotides were synthesized with an automated DNA synthesizer
(Applied Biosystems). The oligonucleotides comprising 25 nucleotites çach
had the following sequence :
~ .
Rz-Sall 5' T T T C G G C C T C A A G G C C T C A T C A G G A 3' -
Rz-Sal2 S' T C C T G A T G A G G C C T T G A G G C C G A A A 3'.
After purification of the two synthetic DNA oligonucleotides by gel-elec-
trophore~is followed by electroelution through isotachophoresis, the DNAs
were phosphorylated at the S'-terminu~ with the aid of polynucleotide ~i-
nase. After this enzymatic reaction, equimolar amounts of the two labeled
DNA oligonucleotides we~e mixed, incubated for one minute in a boiling
. ..
.~ :
~ ~ ~ 3 ~
water bath and slowly cooled down to room temperature. Upon this de- and
re-~aturing step the desired double-stranded DNA cassette is formed:
~' -
Rz-Sall ---StuI ---
- 5' T T T C G G C C T C A A G G C C T C A T C A G G A 3'
3' A A A G C C G G A G T T C C G G A G T A G T C C T 5'
----------- Rz-Sal2
These two annealed oligodeoxynucleotides represent such a DNA cassette
which is needed to create - according to the strategy outlined in Fig. 3
- a ribozyme RNA as depicted in Fig. 4, which is characterized by the
presence of the StuI recognition site AGGCCT within the ribozyme se-
quence.
.,.
The DNA cassette consisting of the two synthetic DNA oligonucleotites Rz-
Sall and Rz-Sal2 was used to create an antizyme RNA against the (-) RNA
of plum pox virus (PPV) which is a plant virus of the potyvirus group.
For this purpose, an EcoRI fragment containing 423 bases of the cDNA of
(PPV), ranging from nucleotides 3409-3831 of the viral RNA genome
(accorting to the sequence of Techeney at al., Nucleic Acid~ ~es. 17
(1989) lOllS), was cloned into the plasmid pT3T7-Sal, a modified version
of the pIasmid pT3T71ac (Boehringer Mannheim) from which the SalI site
had been removed before, by cleaving with SalI, trimming the protruding
ents with the aid of mung besn nuclease followet by re-ligation of the
pla8mit DNA. The EcoRI fragment was insertet in both possible orienta-
tions into this vector, so that the two plasmids pPVl and pPV2 as given
in Fig. 5 (top), were obtained. The PPV cDNA insert contains a SalI site
at nucleotide 3631, i.e. 223 and 200 nucleotides apart from the EcoRI
sites. The SalI site~of each of the two plasmids was digestet and trimmed
by treatment with~mung bean nuclease using the protocol as described by
the supplier (N.E.Biolabs), which removes the protruding ends as outlined
in Fig.3. Then, the above mentioned SalI-specific synthetic ribozyme DNA
cassette, containing a StuT site, was inserted by blunt-end ligation.
The restriction enzyme StuI was used to screen the transformants for the
in~ertion of the DNA cassette. Those plasmids which could ~e linearized
by StuI digestion,~were digested with EcoRI and the resulting DNA frag-
ments were separated on a 5% polyacrylamide g~l. By comparison with the
~, ... , . , .: . ..
2 ~ $ ~
41
- 423 base fragment of the plasmid pPV2, recombinant plasmids could beidentified which contained one, two or three copies of the SalI-specific
DNA cassette inserted into the trimmed SalI site.
Those plasmids which contained more than one inserted cassette were di-
gested with StuI and religated. Since neither the substrate cDNA nor the
vector contains a StuI site, this procedure removes the cassette present
in excess. However, only about 50% of the resulting plasmids can be ex-
pected to c~ntain a correct monomeric DNA cassette, whereas in the other
50%, there are head-to-head or tail-to-tail connscted parts of the DNA
cassette which are useless for the generation of ribozyme RNA.
In orter to screen for the orientation of insertion of the SalI-specific
DNA cassette, within the two plasmids pPVl and pPV2, a functional ri-
bozyme assay was carried out. For this purpose, the plasmids pPVl and
pPV2 were linearized with HintIII, which cleaves that part of the
~, polylinker next to the T3 promoter (see Fig. 5, top). Upon transcription
with T7 RNA polymerase radioactively labeled PPV ~+) and ~-) RNA was syn-
thesized from these two templates. ~-
~ The recombinant plasmids containing the monomeric SalI-specific DNA cas-
sette inserted and those plasmids which were obtained by StuI digestion
;, and re-ligation, in order to eliminate excess cassettes, were digested
with HintIII or PvuII, respectively. The HindIII cut DNA was transcribed
with T7 RNA polymerase and the PvuII cut DNA served as template for T3
RNA polymerase. The resulting RNA transcripts were tested for ribozyme
activity.
As can be detucet from Fig.3, the orientation of insertion of the SalI-
specific ribozyme cassette determines whether a sense- or an antisense-
directed construct will be obtained. Therefore, plasmids derived by
inserting the SalI-specific ribozyme cassette into plasmid pPVl were
screened in the following way:
The RNA transcript synthesized with T3 RNA polymerase, which represents a
potential sense-directed antizyme (comp. Fig.3), was incubated with PPV
RNA, derived from plasmid pPVl by transcription with T7 RNA poly-
merase for 30 minutes at 60C in 20 mM MgC12, 50 mM Tris pH 8.0, followed
î by ethanol precipitation and separa~ion of the products on a denaturing
}~ 5% polyacrylamide gel (0,125 % bisacrylamide), containing 8M urea. Li~e-
,~
,
' . : ': ' :
,'.' , ' . .~ ~
', ' ' .. ' ' ' ' ' ,': ' ' : , .' ~ .' ' '
2 ~
42
wise, the RNA transcripts synthesized with T7 RNA polymerase from the
same recombinant plasmids, which represent a potential antisense-directed
antizyme (comp. Fig.3), were incubated with PPV (-) RNA derived from
plasmid pPV2 by transcription with T7 RNA polymerase.
.
By using this functional assay for catalytic activity of the RNA tran-
scripts, the recombinant clones pPVll and pPVl2 (Fig. 5, middle) were
identified amongst the pPVl derived plasmids.
Similarly, the pPV2-derived plasmids pPV21 and pPV22 (Fig. 5, bottom)
could be identified, by incubating transcripts synthesized by T3 RNA
polymerase with the T7 RNA transcript of plasmid pPV2 which is a PPV (-)
RNA and testing the T7 RNA transcripts with the T7 RNA transcript of
plasmid pPVl, respectively.
An example of a ribozyme reaction is given in Fig. 6.
Example 2
,~:
Usage of selectable markers for the construction of antizvme RNAs
" .
For further improvement of the technique to generate antizyme constructs,
an atditional nucleotite exchange in the ribozyme cassette was made to
create an XhoI recognition sequence which is located directly in the cen-
ter of the hairpin loop of the ha; erheat structure ~Fig.7).
Instead of using a synthetic SalI-specific DNA cassette with a further
motifiet sequence, the DNA oligonucleotide Az-Sall was synthesized which
contained beside the sequence of the actual DNA cassette, two flanking
EarI recognition sites as indicated in the top of Fig.8. In addition, the
DNA oligonucleotide containet the such nucleotides at the 5'- and 3'-ter-
minus, that it could be cloned into the plasmid pT3T71ac which had beencleaved with an enzyme that produced 5'-protruting ends (BamHI) and an-
other enzyme that produced 3'-protruding ends (KpnI).
, .
The sequence of the DNA oligonucleotide Az-Sall was as follows ~the re-
i~ striction enzyme recognition sequences contained in this oligonucleotide are indicated):
.~ . .
: .
. : .' .
. - .~.. : - .. . . . . .
~ . . , . , . , . . . -
2 ~ ~ S i ~ ~
43
.~ ,
BamHI StuI EarI
_ _ _ _ _
5' GATCCTCTTCATCCTGATGAGGCCTCGAGGCCGM ACG M GAGGTAC 3'.
______ _ __ __
EarI XhoI RpnI
The oligonucleotide was annealed to these protruding 8amHI- and RpnI-
ends of the vector and the ligation was done in presence of Rlenow poly-
merase and dNTP, so that the DNA strand complementary to Az-Sall was syn-
thesized enzymatically during the ligation reaction. Thus, the plasmid
pAzSall was created (Fig. 8, top) .
; EarI is a class-IIS restriction enzyme that has its cleavage site outside
of its recognition sequence, and it cleaves a DNA sequence in the follow-
ing ~ nner:
S' CTCTTCNNN~- 3' -> 5' CTCTTCN NNN- 3' ~;
3' GAGAAGNNNN- 5' -> 3' GAG M GNNNN - 5'.
j Consequently, the desired SalI-specific ribozyme cassette can be obtained
~ from plasmid pAzSall, by digestioD with EarI and subsequent filling-inI tho protruding ends with Rlenow enzyme.
. .
This procedure to obtain the SalI-specific DNA cassette would, as such,
have no sigDificant advaDtage as compared to the syDthetic DNA cassette
used in Example 1. But since the DNA cassette was now cloned on the plas-
mid pAzSall, it was possible to take advantage of the XhoI site within
the ribozyme sequeDce in~order to introduce a marker gene.
For this purpose, an XhoI linker was introduced into the EcoRI site and
also into the AvaI site of the plasmid pBR322 (after cleaving and fill-
ing-in the protruding ends, re~pectively), so that the te~racycline
resi~taDce gene (tet gene) could be excised by XhoI cleavage.
The resulting XhoI fragment containing the tetracycline resistance gene
of pBR322, includi~g its promoter, was introduced into the XhoI site of
plasmid pAz-Sall ~creating the plasmid pAz-Sall-tet (a schematic map of
plas~id pAz-Sall-tet i8 giveD in Fig. 9, lower part).
In o~der to create an antizyme RNA, the plasmid pAz-Sa:ll-tet was digested
`~ ' ' : ' ' ' . :: ' ` ' ' , .: :' ',,:, ' ' :'`~ . ,; ' . ', .: . ; ,', , : , : : , ` ,
~ ~ $ ~
44
with EarI, the protruding ends were filled-in by Rlenow polymerase and
the resulting DNA fragments were separated on an agarose gel, and the DNA
fragment which was the desired SalI-specific ribozyme cassette was puri-
fied by electroelution via isotachophoresis. This fragment is about 1450
bp in size and was used for ligation into plasmid pPVl, which had been
cleaved with SalI and treated with mung bean nuclease in order to remove
the protruding ends as described under Example 1.
Ampicillin and tetracycline were used to select for transformants.
The recombinant plasmids were analyzed for the presence of the StuI site,
which is characteristic for the SalI-specific ribozyme cassette, and for
the presence of the XhoI fragment containing the tetracycline resistance
gene. By digesting the recombinant plasmids with restriction enzymes that
cleave within the tetracycline resistance gene and also in the sequences
terived from plasmid pPVl, e.g. HindIII or BamHI, is was possible to de-
duce the orientation in which the SalI-specific DNA cassette had been in-
serted. In this way, the plasmids pPVll-tet and pPV12-tet were identi-
fied, which are related to plasmids pPVll ant pPV12 (Fig. 5, mitdle), but
contain, in addition, the tetracycline resistance gene within the ri-
bozyme sequence.
Before excising the tetracycline resistance gene from the plasmids, by
XhoI digestion, plasmid pPV12-tet (Fig.lO) was tested whether it already
could deliver a functional antizyme RNA such as the RNA given at the bot-
tom of Fig. 9. Therefore, the plasmid was cleaved with XbaI and tran-
scribed with T7 RNA polymerase ant the resulting RNA was incubatet with
the target RNA terived from plasmid pPV2 by T7 transcription. Surpris-
ingly, the insertion of the tetracycline resistance gene into the ri-
bozyme cassette tid not affect the catalytic activity of the ribozyme
~Fig. 11).
The experiment shows that the catalytic domain of the ribozyme which does
not form base pairs with the target RNA (sequence (a)), which consists of
22 nucleotides in case of plasmid pPV12, can be divided into two sub-do-
mains of 9 and 13 nucleotides, respectively, and separated by more than
1400 bises in pPV12-tet, without 108s of catalytic activity.
After cleavage of the plasmid pPV12-tet with XhoI and re-ligation, the
tetracycline resistance gene was removed and plasmid pPV12a was obtained.
This plasmid is very similar ~o plasmid pPV12. The only difference is
that it contains an XXoI site according to Fig. 7, whereas plasmid pPV12
' .
.
23~5-~
, .
contains a ribozyme sequence according to Fig. 4.
- The addition of the tetracycline resistance gene into the portable ri-
bozyme cassette has two major advantages :
` (i) It drastically reduces screening work, in order to identify an-
tizyme clones, because it can be selected for tetracycline resis-
. . .
~ tance.
~, ' . . .
(ii) It can be discriminated between sense or antisense directed an-
tizyme constructs, according to the orientation of the tetracycline
resistance gene by simple restriction analysis.
... .
Once the antizyme construct has been mate, the tetracycline resistance
gene can be removet by digestion with XhoI, but the antizyme RNA also
works in the presence of it.
Exsmple 3
Cons~ction_Qf the ~lasmids ~AzBaml. ~zBaml-tet. pA-Cl-l. pAzClal-tet.
~z~ u,_lAcygol-tet~ t. ~AZX~ Azbal-tet. ~AzX
~L~L l~zlka2-tet fro~ w~i~h DNA ~Lgozyme cassettes wi~h and~witho~ tet
gene can ~LJD~ suita~l~ for the insertion into tifferent
re ~ s~lica~ion of these ~cassettes ~ ~q~e~te fur-
ther ~ibQ~Y~
To extend the spectrum of available DNA cassettes that can be utilized to
generate antisense ribozymes by incorporation into cDNA, several DNA
oligodeoxynucleotides, similar a8 AzSall giVeD ID Example 2, were cloned
in order to creste constructs which correspond to pAzSall and
;pAzSall-tet. The following~list shows the relevant sequence of the re-
sulting plasmids that contain DNA cassettes that are located between two
EarI~site3, so that they can be released by digestion with that class-IIs
restriction enzyme, followed by filling-in the protruding ends. Each con-
struct exists with and without tet gene~inserted into the XhoI site (that
is-marked below), so that DMA cassettes with ant without tet gene can be
ubtained. The sequence ~of the ~core ribozyme" corresponds to sequence
46
pAzSall, pAzSall-tet
5'<- SalI specific nuc. -> 3'
KpnI ! core ribozyme !! BamHI
------ ! ---------------------- !! ------
5' GGTACCTCTTCG T TTCGGCCTCGAGGCCTCATCAG GA TG M GAGGATCC 3'
3' CCATGGAG M GC A AAGCCGGAGCTCCGGAGTAGTC CT ACTTCTCCTAGG 5'
_ _ _ _ _ _ _ _ -- _ . : : .
EarI XhoI EarI
pAzBaml, pAzBaml-tet
5'<- BamNI specific nuc.
RpnI ~!! core ribozyme BamHI
~~~--- !!! ---------------------- ______
5' GGTACCTCTTCG GAT TTCGGCCTCGAGGCCTCATCAG TG M GAGGATCC 3'
3' CCATGGAG M GC CTA AAGCCGGAGCTCCGGAGTAGTC ACTTCTCCTAGG 5' .
________________ _ :
EarI XhoI EarI
"'
pAzClal, pAzClal-tet
ClaI specific nuc~ -> 3'
RpnI core ribozyme BamNI
______ -----__----__-________ ! ------ . :
t 5' GGTACCTCTTCG TTCGGCCTCGAGGCCTCATCAG G TG M GAGGATCC 3'
! 3' CCATGGAG M GC AAGCCGGAGCTCCGGAGTAGTC C ACTTCTCCTAGG 5'
_ _ _ _ _ _ _ _ _ ~
EarI XhoI EarI
pAzEcol, pAzEcol-tet
.~ 5'<- EcoRI specific nuc. ~-~
RpnI !!! core ribozyme BamHI
~: 5' GGTACCTCTTCG M T TTCGGCCTCGAGGCCTCATCAG TGAAGAGGATCC 3'
3' CCATGGAGAAGC TTA M GCCGGAGCTCCGGAGTAGTC ACTTCTCCTAGG 5'
I ~ -------- :,
; ~ EarI XhoI EarI -:;
'
:
, ' '~
.
47
:pAzKpnl, pAzKpnl-tet
5'<- KpnI specific nuc. -> 3'
RpnI !! core ribozyme ! BamHI
------ !! ---------------------- ! ------
5' GGTACCTCTTCG GT TTCGGCCTCGAGGCCTCATCAG C TGAAGAGGATCC 3'
3' CCATGGAG M GC CA M GCCGGAGCTCCGGAGTAGTC G ACTTCTCCTAGG 5'
;~~~~~~~ ------ ::
EarI XhoI EarI
pAzXbal, pAzXbal-tet
XbaI: NTC type
: XbaI specific nuc. -> 3'
.RpnI core ribozyme BamHI
------ ---------------------- !!! ------
. 5' GGTACCTCTTCG TTCGGCCTCGAGGCCTCATCAG TAG TGAAGAGGATCC 3'
3' CCATGGAG M GC M GCCGGAGCTCCGGAGTAGTC ATC ACTTCTCCTAGG 5'
____ ______ _____ .
.1' EarI XhoI EarI
.
,;
,pAzXba2, pAzXba2-tet
XbaI CTA type
5'~-- XbaI specific nuc. -> 3'
KpnI !! core ribozyme ! BamHI
; ----- !! ------------------ !
:, 5' GGTACCTCTTCG CT TTCGGCCTCGAGGCCTCATCAG G TG M GAGGATCC 3' -.
j 3': CCATGGAGAAGC CA M GCCGGAGCTCCGGAGTAGTC C ACTTCTCCTAGG 5'
. : --_ _ _ _ _
EarI XhoI EarI
With the aid of these constructs, it was possible to generate ribozymes
that were directed against the mRNA of the ice nucleation gene (inaZ) and
hrpS gene -of Pseudomonas syringae (SalI sites), the white gene of
Drosophila melanogaster (SalI site), the transcriptional regulator GCN4
of yeast (BstEII site, in that case a synthetic cassette without tet gene
was used). Ribo~iymes were also created against the (+) and (-) RNA of
Sendai virus by inserting DNA cassettes into two different BstBI sites,
:
- .
~ ~ ~ O 1 ~3 ~
48 ;
and both possible cassettes for the XbaI site (L gene of the virus) and a
SalI site (P gene).
In all cases, catalytic antisense ribozymes could be obtained after the
incorporation of the corresponding DNA cassettes.
Example 4
Con~uction of the plasmids pAzBam3-tç~ pAzCla3-tet. pAzSal3-tet.
pAzKe~l:L~s. ~AzXba3-tet~ yAzXb~4-tet from which DNA riboz~me casL_~
can be exciscd tha~_ cont~in the tet gene inserted into an AflII site
within the sequence of the catalvtic domain
A potential complication of the technique to incorporate selectable DNAcas~ettes with a selectable marker gene arises when the cDNA itself con-
tains an XhoI site. Then, a DNA cassette, such as the one derived from
plasmid pAzSall-tet, can still be incorporated into any site of interest.
However, the excision of the tet gene, that is cloned into the XhoI site
within the catalytic domain (compare Fig.7), requires to prepare par- - -
tially digested DNA. The same complication arises when a second cassette
is to be introduced into a cDNA construct that already contains a DNA
cassette with a ribozyme domain including an XhoI site. In order to over-
come this inconvenience, a second series of recombinant plasmids was pre-
pared that contained the tet gene within an AflII site. For this purpose,
the plasmid pAzSall (compare Fig.8, top) was digested with XhoI, and the
resulting protruding ends were removed by trimming with nuclease Sl
(Fig.12A). In parallel, a synthetic AflII linker (CCTTAAGG1 was consecu-
tively introduced into the EcoRI ant AvaI sites of the plasmid pBR322 af-
ter filling-in the corresponding protruding ends, respectively. From this
modified plasmid pBR-af2 (Fig.12B), an AflII fragment, containing the t¢t
gene, was released and the protruding ends filled-in with ~lenow poly-
merase. After purification on an agarose gel and subsequent electroelu-
tion, the DNA fragment was inserted into the XhoI-cleaved and trimmed
plasmit pAzSall (Fig.12C). Thus, the AflII site C'TT M G was restored. As
a result of this manipulation, the XhoI site within the catalytic domain
is replaced by the AflII site. Therefore, a secont type of DNA cassettes
could be obtained which can be introduced into cDNAs that contain an XhoI
site or alreaty an inserted ribozyme cassette with an XhoI site. After
~ ,"' ' ~
.
~ ~ ~ S
49
excision of the AflII fragment containing the tet gene, a ribozyme as
given in Fig.13 is obtained.
The following plasmids, each containing a tet gene inserted into the
AflII site, were generated : :
' pAzSa13-tet
5'<- SalI specific nuc. -> 3'
RpnI ! core ribozyme !! BamHI
------ ! ---------------------- !! ------
5' GGTACCTCTTCG T TTCGGCCTT M GGCCTCATCAG GA TG M GAGGATCC 3'
- 3' CCATGGAG M GC A MGCCGG M TTCCGGAGTAGTC CT ACTTCTCCTAGG 5'
EarI AflII EarI
~ pAzBam3-tet
'~ 5'<- BamHI specific nuc.
KpnI!!! core ribozyme BamHI
------ !!! --------------------~- ~~~~~~
5' GGTACCTCTTCG GAT TTCGGCCTT M GGCCTCATCAG TG M GAGGATCC 3'
3' CCATGGAG M GC CTA M GCCGGAATTCCGGAGTAGTC ACTTCTCCTAGG 5'
______ _____~ ,______
I;EarIAflII EarI
pAzCla3-tet
ClaI specific nuc. -> 3'
. . KpnIcore ribozyme BamHI
__ ______ _______----------- ! ~~~~~~
5' GGTACCTCTTCG TTCGGCCTT M GGCCTCATCAG G TG M GAGGATCC 3'
.~ 3' CCATGGAG M GC AAGCCGGAATTCCGGAGTAGTC C ACTTCTCCTAGG 5' ~-
~ ~ ~ _ _ _ _ _ .
1~ EarI AflII EarI :
:
' ~ .
.. . .. ...
so
:pAzKpn3-tet
5'<- RpnI specific nuc. -> 3'
KpnI !! core ribozyme !BamHI
------ !! ---------------------- ! ------
. 5' GGTACCTCTTCG GT TTCGGCCTTAAGGCCTCATCAG C TGM GAGGATCC 3'
:~ 3' CCATGGAG M GC CA AAGCCGG M TTCCGGAGTAGTC G ACTTCTCCTAGG 5'
.,
EarI AflII EarI . ;
pAzXba3-tet
XbaI: NTC type
XbaI specific nuc. -> 3'
~1! KpnI core ribozyme BamHI
------ ---------------------- !!! ------ ;-~.`
~ 5' GGTACCTCTTCG TTCGGCCTT M GGCCTCATCAG TAG TG M GAGGATCC 3' `
- 3' CCATGGAGAAGC AAGCCGGAATTCCGGAGTAGTC ATC ACTTCTCCTAGG 5'
,;------------ _ _ __ __ .
.i :
',EarI AflII EarI .
.~ . .
pAzXba4-tet
XbaI CTA type
5'C- XbaI specific nuc. -> 3'
,~ RpnI !! core ribozyme ! BamHI ..
5' GCTACCTCTTCG CT TTCGGCCTT M GGCCTCATCAG G TGAAGAGGATCC 3'
3' CCATGGAG M GC GA M GCCGG M TTCCGGAGTAGTC C ACTTCTCCTAGG 5'
______ ______ ______
i~ EarI AflII EarI
; . ~
'~;~ : ' .'::
~ '
;,' : :
51
Example 5
A ribozyme conaining an AflII recognition sequence in it~ catalvtic do-
main
From the plasmid pAzSal3-tet, a SalI-specific DNA cassette was prepared
by digestion with Rsp632I (isoschizomer of EarI) and filling-in the re-
sulting protruding ends. This SalI-specific DNA cassette was purified on
an agarose gel and electroeluted. In parallel, one ~g of plasmid pPV-BSl
(Fig.14), which contains a fragment of the cDNA of plum pox virus (PPV)
was cleaved with SalI. The plasmid was dissolved in 20 ~1 of Sl buffer
(225 mM NaCl, 30 mM potassium acetate pH 4.5, 200 ~M ZnS04 and 5X glyc-
erol) ant treated with 2 units of nuclease Sl (Boehringer Mannheim) for
20 minutes on ice. Then 5 ~1 of Sl Stop buffer (300 ~M TrisjHCl, 50 mM
~DTA, pH 8.0) were added and the sample incubated for 10 minutes at
65 C, followed by phenolization ant precipitation with isopropanol. Com-
pared to the construction of the ribozymeæ describet in Examples 1 ant 2,
the above process represents a preferred embodiment with respect to reac-
tion contitions for the trimming reaction. About 300 ng of the plasmit
pPV-BSl, treated in that way, was ligatet with about 100 ng of the above
mentionet SalI-specific DNA cassette prepared from plasmid pAzSal3-tet in
a volume of 5 yl of blunt end ligation buffer (50 mM Tris/HCl pH 7.5,
10 mM MgC12, 5% PEG ôO00, 1 mM DTT ant 100 ~M ATP containing 3 units of
T4 DNA ligase (Mlnotech, Heraklion, Greece) for 16 hours at l2-C. After
transformation in E.coli strain JMô3, ant selection for ampicillin and
tetracycline, the resulting clonPs were analyzed by restriction mapping.
Thus the plasmits pPV-BSll-tet (Fig. 14) ant pPV-BSl2-tet were itentified
that deliver a (+) or (-) directet ribozyme, respectively. Fig. 15 shows
an autoratiograph, confirming the catalytic activity of the transcript
obtained from pPV-BSll-tet.
':
~:
.''~ ~ . ..
,
:: :
: :- : . . : ,~ . .
~ ~ : . . ~ . . ,; :, : 1: , :., , .~. .. . . . .
2 ~ 3 ~
52
Example 6
StabilisatiQn of the antisense rib.ozyme RNA by insertion of a DNA c ~-
se~te that forms after transcription a s~em-loop structure -
In order to protect the ribozyme after expression in vivo, two synthetic :~
DNA oligonucleotides were synthesized:
Steml: 5' GCGGCCGCTCGGGCCACGCGAGGCCCGTGCGGCCGT 3'
and
Stem2: 5' ACGGCCGCACGGGCCTCGCGTGGCCCGAGCGGCCGC
,
which after phosphorylation with T4 polynucleotidkinase and subsequent
annealing can form the following double-stranded DNA cassette: :
5' pGCGGCCGCTCGGGCCACGCGAGGCCCGTGCGGCCGT 3'
3' CGCCGGCGAGCCCGGTGCGCTCCGGGCACGCCGGCAp 5' . .
The DNA cassetteg contains restriction sites for AvaI, EagI,
AvaI AvaI
5' pGCGGCCGCTCGGGCCACGCGAGGCCCGTGCGGCCGT 3'
3' CGCCGGCGAGCCCGGTGCGCTCCGGGCACGCCGGCAp 5' . `
_ _ _ _ _ _ _ _ _ _ _
. EagI EagI . :.
,: .
and for the restriction endonucleases NotI, SfiI that recognize a se-
quence of 8 bases:
: ~' "
NotI
------ ____
5' pGCGGCCGCTCGGGCCACGCGAGGCCCGTGCGGCCGT 3'
3' CGCCGGCGAGCCCGGTGCGCTCCGGGCACGCCGGCAp 5' . .
..... .....
SfiI SfiI :
The DNA cassette can be inserted by blunt-end ligation into the DNA con-
:
:
.:. : . , .: , :- : ~ : . . . . . -:
'.; ' .': " :, :' ',, . , '' ' "'' ' ;'',''- '` . .,: . `:,
" , ' " " " ' , ' ` ' ' . : ` ' ~, . . ; ' ' .
' ' . ': ." ' " :', ': ~ ' ' . ' ,.' ' " ' , . ' ` ' '
' ' ` ' ' "" ' ' . r; " .. ' . ' '
77 ..~
53
struct that encodes an antisense ribozyme at two sites, up- and down-
stream of the inserted DNA ribozyme cassette(s). The restriction sites
allow to detect the insertion of the cassette and to test for the orien-
tation of insertion and also the excision of excess cassettes. Preferred
are the same orientations of insertion at the 5'-terminus and the 3'-ter-
minus, respectively.
The sequence of the DNA cassette was chosen to ensure that when the DNA
containing the DNA cassette composed of Steml and Stem2 is used as a tem-
plate for transcription, the resulting RNA will assume a stem loop struc-
ture as shown below:
G C G C
C G C G
A A A A
C-G C-G
C-G C-G
G-C C-C
G-C G-C -
; G-C G-C
~i C-G C-G
U U U U
C-G C-G
G-C G-C
, C-G C-G
:7 , C-G C-~
, G-C G-C
, G-C G-C
, C-G C-G
5' G-U----- antisense ribozyme -------G-U 3'
~, .
The s~quence of the DNA cassette was also chosen, so that the resulting
RNA stem is not completely double-stranded to avoid degradation by dou-
ble-strand-specific endoribonucleases of the RNaseIII-type. The stem-loop
structures at the 5' and 3'- ends of the antisense ribozyme RNA provide
protection against exonucleases. Similar structures, that are highly sta-
ble in vivo, are found amongst bacterial IS elements; see Si~ons ant
~leckner, Annu. Rev ~enet. 22 ~1988), 567-700.
.
,: : : ~ , , . :. ,,:; : . : , .: : :;:., ;, ::: .
,:: , ~:, :: .: :: : - : : ~ . .-: :
::, : : . :: .: : : : ~ :
20$S ~ ~
54 .
..
The RNA transcript can assume an alternative structure involving the S'-
and 3'-terninal regions derived form the cloned Stem cassette by forming :
a "folding back" structure (ping pong paddle). Thus a ~pseudo-circularn
structure can be formed in which the 5'-end and the 3'-end of the anti-
sense ribozyme basepair, without fonming a completely double-stranded RNA
segment. Also this structure confers protection against exonuclease at-
tack:
U A A U
5' CGCGGCCGC CGGGCC CGCG GGCCCG GCGGCCGU-----antisense -------
3' GCGCCGGCG GCCCGG GCGC CCGGGC CGCCGGCA------ribozyme--------
U A A U . -
,~ , . ...
The plasmids pPV-BSl and pPVl were deposited in E. coli JM83
at the Deutsche Sammlung von Mikroorganismen und Zellkulturen
GmbH, Braunschweig, Germany, under the requirements of the
Budapest Treaty under the deposition numbers DSN 6624 and DSN
6625, respectively, on July 26, 1991.
.
..
-:
: . :-,, . ~. . . ,; ~ , ,
, - : .. , - : .. :