Note: Descriptions are shown in the official language in which they were submitted.
`
WOg2~6~ PCT/US91/07756
~ ~ 9 ~
. .
.-..
. - ..,":
`.
,.:.-;
.: ,
. 1 . . :.
. ::
THERAPEUTIC FRAGMENTS OF VON WI~LEBRAND FACTOR
''' " .
Field of the Invention
This invention relates to polypeptides which are ~
useful in the treatment of vascular disorders such as ~ .
thrombosis. This invention relates also to :;~
polypeptides which are useful in the treatment of ~ :~
hemorrhagic diseases, such~as von Willebrand disease
(vWD). This invention further relates to the
~: production by;recombinant:DNA-directed methods of
pharmacologically useful quantities~of the~polypeptides
of the present~inventlon. :
The term "hemostasis" refers to those processes
which comprise the:defense mechanisms of the body
against~loss of circulating blood cause~ by vascular
injury. Proce~ses which are normal as a physio1ogic;~
respons~ to vascular injury may lead in~pathologic ~-
~' circumstances, such as in a patient afflicted with ~
atherosclerotic vascular disease or chronic congestive : ~:
heart failure, to the formation of undesired thrombi
.. ... . . . . ... .. .
(clots) with resultant vascular occlusion. Impairment
:~ of blood flow to organs under such circumstances may
lead to severe pathologic states, including myocardial
:~ .. "'
~V092/0~ PCT/US91/07~
~0~
in~arction, a leading cause of mortality in developed
countries. r
The restriction or termination of the ~l~w of
blood within the circulatory system in response to a
wound or as a result of a vascular disease state
involves a complex series of reactions which can be
divided into two processes, primary and secondary
hemostasis. Primary hemostasis refers to the process
of platelet plug or soft clot formation. The platelets
are non-nucleated discoid structures approximately 2-5
microns in diameter derived from megakaryocytic cellsu
Effective primary hemostasis is accomplished by
platelet adhesion, the interaction of platelets with
the surface of damaged vascular endothelium on which
are exposed underlying collagen fibers and/or other
adhesive macromolecules such as proteoglycans and
glycosaminoglycans to which platelets bind. -
Secondary hemostasis involves the reinforcement or -~
; crosslinking of the soft platelet clot. This secondary
process is initiated by proteins circulating in the
plasma ~coagulation factors) whi~h are activated during
primary hemostasis, either in response to a wound or a
vascular disease state, The activation o~ these
factors results ultimately in the production of a
polymeric matrix o~ tha protein fibrinogen (then called
~ibrin) which rein~orces the soft clot.
. '.'.
- . ................ . - . . . .................................................... ...... ~ ~ : .
The present invention relates to antiplatelet
drugs. Antiplateiet druys include drugs which suppress
primary hemostasis by altering platelets or their
interaction with other circulatory system components. --~
.::
~...
. ,:~. ,.. ., . ,.. . ,,. . . ,., .. . . , .. . . . .. .. . . . . . .. . . . . .. . .. . . .. .. . .. I .
'"'.'',' "' " '~' ~'"', '.'''.' ,.' ' ', ,'", ' ' '' '; ".''' "" , 1',' .'' '"'
W092/06~ PCTIUS91/~7756
2~9~2~ :
..
Reported Developments
'
Specific antiplatelet drugs operate by one or
several mechanisms. A first example involves reducing
the availability of ionized calcium within the platelet
cytoplasm thereby impairing activation of the platelet
and resultant aggregation. Pharmaceuticals
representative of this strategy include prostacyclin,
and also Persatine~ (dipyridamole) which may affect
calcium concentrations by affecting the concentration
of cyclic AMP. Numerous side effects related to the
administration of these compounds have been reported.
An additional class of antiplatelet drugs acts by
- inhibiting the synthesis of thromboxane A2 within the
platelet, reducing the platelet activation response.
Non-steroidal anti-inflammatory agents, such as
ibuprofen, phenolbutazone and napthroxane may produce a -
~ similar effect by competitive inhibition of a
- particular cyclooxygenase enzyme, which catalyzes the
synthesis of a precursor of thromboxane A2. A similar
~herapeutic effect may be derived through the
administration of aspirin which has been demonstrated
to irreversably acetylate a cyclooxygenase enzyme
necessary to generate thromb~xane A2. A third anti-
platelet mechanism ha~ involved the pla~elet membrane
50 as to inter~ere with surface receptor function. Or,e
such drug is dextran, a large branched polysaccharide,
which is beliQved to impair the interaction of ;~
~ibrinogen with platelet receptors that are exposed
during aggregation. Dextran-is contraindicated for
patients vith a history of renal problems or with
cardiac impairment. ~he ther~peutic ticlopidine is
stated to inhibit platelet adhesion and aggregation by
suppressing the binding of von Willebrand factor and/or
.
W~2~0~ PCT/VS91/077~6~
2~9~2ra9
fibrinogen to their respective receptors on the
platelet surface. However, lt has been found that
ticlopidene possesses insufficient specificity to
eliminate the necessity of administering large doses
which, in turn, may be associated with clinical side
effects.
.
The aforementioned pharmaceuticals are ~oreign to
the body and may cause numerous adverse clinical side
effects, there being no way to prevent such compounds
from participating in other aspects of a patient's
physiology or biochemistry, particularly if high doses
are required. It would be desirable to provide for
pharmaceuticals having such specificity for certain of
the reactions o~ hemostasis, that they could be ~:
administered to patients at low doses, such doses being -
much less likely to produce adverse effects in ~;
patients.
,:
An example of a pharmaceutical which is
representative of a therapeutic that is derived from -~
natural components of the hemostatic process is ;;
described in EP0 Publication No. 317278. This
publication discloses a method ~or inhibiting
thrombosis in a patient by administering to the patient
a therapeutic pol~peptide comprised o~ the amino-
terminal region Or the ~ chain of platelet mem~rane
glycoprotein Ib, or a subfragment thereo~.
,~ . .
The present invention is directed to the provision
of antithrombotic polypeptides derived from von
Willebrand factor, one of the proteins of the
hemostatic mechanism.
WOg2~06~ PCTlUS91/07756
S~mmary of the_Present Invention
In accordance with the presant invention, there is
provided a polypeptide patterned upon a parent
polypeptide and comprising the amino acid sequence of
that fragment of mature von Willebr~nd ~actor subunit
which beings approximately at residue 441 (argininP)
and ends at approximately residue 733 (valine), or an~
subset thereof, in which one or more of the cysteine ;~
residues normally present in the parent polypeptide~ or
subset thereof, have been deleted and/or replaced by
one or more other amino acids, said polypeptide having
therefore less tendency than the parent polypeptide, or
- subset thereof, to form intra or interchain disulfide
bonds in aqueous media at a physiological pH. ;
,~
The polypeptides of the invention are expressed in ~ .
~ both recombinant bacterial and recombinant eucaryotic
; ~ host cells.
Modification in accordance with the present
inv ntion of a paren~ polypeptide by dPleting or
replacing one or more cysteine residues normally
presant in the parent polypeptide, or subset thereof,
results in a polypeptide having }ess tendancy than the
p~rent polypeptide, or~ subset thereof, to ~orm
intrachain or interchain disulfide bonds in aqueous
media at physiological pH. The practical effect o~ :
this is that the polypeptide o~ the present invention : ;
exhibits a higher degree of therapeutic activity than
the parent polypeptide and improved stability and
solubility. For convenience, a polypeptide of the
present invantion is o~ten referred to herein as being
"~utant". . .
- ~ .'.
,
.
, . . . - , ~ . . . .
WOg2/~ PCT/US91/~7756
.
In pra~erred ~orm, it is recommended that the
invention be practiced by substituting ~or one or more
cysteine residues particular amino acid residues which -
are expected to not significantly alter the
predetermined tertiary structure of the parent
cysteine-containing vWF polypeptide or fragment
thereof. This contributes to maintaining the :
therapeutic potency of the mutant polypeptide. :;
Preferred amino acid replacements include glycine,
serine, alanine, threonine and asparagine, with serine, .:
alanine and glycine being preferred. -
Another aspect of the invention is based upon the
discovery that cysteine residues 509 and 695 of the ` :~
mature von Willebrand factor subunit nor~ally form an .::
intrachain disulfide bond which confers upon the ` :
subunit, or a fragment thereof, a particular tertiary ::
structure which is involved in ~he binding of von ::
Willebrand factor, or of a therapeutically useful :
polypeptide derived therefrom, to the glycoprotein Ib ;
receptor of platelets. Accordingly, another aspect o~
the invention comprises a polypeptide comprising the -~:
amino acid sequence from approximately residue 441 :.
(arginine~ to approximately residue 733 (valin~) o~ . :
mature von Willebrand ~actor subunit, or any subset of
said sequence which contains residues 509 ~cysteine) ;
and 695 (cysteine), wherein one or more of cysteine
residuss 459, 46~, 464, 471, and 474 are deleted or
, ~ :
replaced by one or ~ore other amino acids A preferred
polypeptide is one in which each of cysteine residues
459, 46Z, 464~, 471 and 474 is replaced by a glycine -`
residue and in which cysteine residues SO9 and 695 are
linke~ by an intrachain disulfide bond. `
WO9~06~ PC~/US91/0775~
h~ 9 ~
Another aspect o~ the present invention is the
provision of a therapeutic composition which comprises
a therapeutically effective amount of a polypeptide of
the present invention and a pharmaceutically
acceptable carrier therefor.
.
Still another aspect of the invention provides a
method of inhibi~ing thrombosis in a patient which
comprises administering to the patient an effective
amount of one or more of the therapeutic compositions
of the invention. It is expected that therapeutic
compositions comprising one or more of the polypeptides
of this invention will be substantially less toxic or
cause fewer adverse physiological effects in patients
than currently available antiplatelet drugs such as
dipyridamole.
A preferred method for ~enerating the polypeptides
of the present invention is to subject a DNA nucleotide
sequence coding for the von Willebra~d factor subunit,
or fragments thereof, to mutagenesis resulting in the
deletion of cysteine residues, or their replacement by
other amino acid species. The resultant encoding DNA
may be inserted into recombinant bacterial host cells
for expression o~ the v~F polypeptide.
The invention provides also ~or eucaryotic host ~
cells containing recombinant vWF DNA-sequences from ~ :
which are expressed therapeutically-active polypeptides
related to the 52/48 kDa-tryptic fragment or domain of
vWF. The polypeptides are suc_essfully secreted from
the host cells.
W092/06~ PCT/US9t~07756
' '
- 2~9~
8 ;
The polypeptides expressed in this way have
certain advantageous features when compared with
polypepti~es expressed from racombinant bacterial host -~
cells.
'-'
1) The polypeptides of the present invention
assume three dimensional structures which are
characteristic o~ the domain which exists in
mature circulating von Willebrand factor and
they have properly formed disulfide ~onds.
2) The polypeptides of the present invention are
closer analogs o~ the natural vWF 52/48
functional domain in that they have the
glycosylation characteristic of said domain.
Such polypeptides, when present in monomeric form, may
be used as antithrombotic agents. In dimerized form
(which dimerization further validates that the
polypeptides have natural structural domains), they can
be used as antihemorrhagic agents. The therapeutic
properties of polypeptides o~ the present invention can
be enhanced by altering the glycosylation thereof, as
described in detail hereinbelow.
Of importance to the proper three-dimensional
folding and secretion of the polypeptides o~ the
invention is tha initial attachment thereto o~ a signal
peptide ~equence which is also e~fective in causing
searetion of other polypeptides ~nrelated to vWF from
the same or other-host cells. - -
.. . ~
In accordance with the practice of this invention, -~ :
there are provided therapeutically useful polypeptides
which are effective in preventing adhesion o~ platelets
` WOg~/O~ PCT/US91/07756
4 ~ ~ ~
.
g
.
to surfaces, in inhibiting activation or a~gregation o~
platelets, and in inhibiting thrombosis. More ~.
specifically there are proYided glycosylatèd
polypeptides which are effective in inhibiting the
binding of von Willebrand factor multimers to platelets :.
. and which are created by expression in mammalian cells
; of mutant human von Willebrand factor subunit DNA
sequences. Such polypeptides show less tendency than
homologous non-mutant polypeptides to form interchain .:
disulfide bonds which tend to adversely affect the
therapeutic utility thereof~
.
Accordingly, there is provided a polypeptide
patterned upon a parent polypeptide and comprising the
amino acid sequence of that fragment of mature von
Willebrand factor subunit which begins approximately at
residue 441 (arginine) and ends at approximately .
residue 733 (valine), or any subset thereof, wherein
one or more of cysteine residues 459, 462 and 464 are .
deleted and/or replaced by one or more other amino
acids, and wherein said polypeptide has less tendency r
than said parent polypeptide to form interchain
disulfide bonds. . - :
~ .
It is belie~ed that this aspect of the invention
will be most commonly practiced by substituting ~or one
or more o~ the specified cysteine reæidues particular
amino acid residues which do not signi~icantly alter
the pre~etermined tertiary structure of the parent
cysteine-containing vWF polypeptide, or-of a fragment
thereof, thereby maintaining the therapeutic potency of
the mutant polypeptide. Suitable amino acid
replacements include glycine, serine, alanine, -:
: ~VOg~./Q~ PCT.rUS91/077~6
~,
, . .
' , ';'
" 2~ 2~9 10
threonine or asparagine with alanine and glycine being
~ost preferred.
The present invention is concerned also with the
preparation by recombinant DNA~directed methods of a-
monomeric and properly glycosylated ~ragment of von -
Willebrand factor subunit which is useful in inhibiting
thrombosis in a patient. The recombinant methods
minimize the production of structures which tend to
adversely affect the desired therapeutic activity of
the desired monomeric form of the fragment, ~or
example, dimers, multimers, or aggregates of said ~.
fragment. Accordingly there is provided a process for
producing from DNA corresponding to that fragment of
mature von Willebrand factor subunit comprising
essentially the amino acid sequence from approximately .
residue 441 (arginine) to approximately residue 730
(asparagine), a biologically active monomer of ~aid
subunit fragment having an apparent molecular weight by
SDS-polyacrylamide gel electrophoresis of approximately
52 kDa which process comprises the steps of: .-
(A) constructing a DNA sequence encoding the
subunit fragment which contains upstream from ~
the fragment encoding region ~hereof, and in ~.
proper reading frame there~or, a signal
peptide sequence;
(B) mutagenizing the DNA sequence to reduce the
number o~ cysteine codons capable of
specifying cysteine residues normally
involved in interchain disulfide contacts;
(C) inserting the DN~ sequence into a suitable
vector to create a construct comprising an :
expression plasmid or viral expression
vector, said construct being capable of ~:
~ . .
.; , ,. .. , . , ' ' . ' . .. ' , , . - ', - . ' ~,, , ., , -.. ~... . '. . '.. , ,. , .,, ' : ' :' ' .. : .
W092/~6~ PCT/US~1/077S6 .
' ;:''
1 1
directing the expression in and secretion
from eucaryotic cells of said monomeric
` subunit fragment;
:~ (D) transforming a eucaryotic host cell with said
construct; and
(E) culturing said transformed host cell under ~ -
conditions which cause expression within and
secretion from said host cell of the .:~
monomeric subunit fragment, said conditions .
also permitting glycosylation of said
: ~ fragment.
The present invention is also concerned with the .- .
preparation of polypeptides which are useful in the
treatment of hemorrhagic disease such as von Willebrand
disease (vWD). Speci~ically, the present invention is ~
,~ ~ concerned with preparation by recombinant DNA-directed :
methods of particular ~ragments o~ von Willebrand ~:
factor which fragments are capable of performing a
bridging function between the GPIb(a) receptor o~ the
platelet me~brane and ~ similar receptor on another
platelet cell, or between such a receptor and
.
components of the subendothelium including collagen, ~ .
thereby performing the crucial physiological role of
native multimeric von Willebrand fac~or in affected
indivi~uals. Accordingly there is provided a process
rox producin~ from ~NA corresponding to that monomeric
fragment of mature von Willebrand factor subuni~ :.
comprising essentially the amino acid sequence from
: approximately residue 441 (arginine) to approximately
residue -730 (asparagine), or a subfragment thereo~
containing one or ~ore of residue positions 4S9, 462, ~ ~,
and 464, a biologically active dimer of said monomeric
~ W092~06~ PCT/US91/~7756
` 2~25~
`. .
~` 12 .`::
.:3 :`:
fragment or subfragment which process a~mprises the -:
; steps of: ' :
~ (A) constructing a DNA sequence encoding the . -:
., monomeric fragment or subfragment which .further~contains upstream from the fragment .:
encoding region thereof and in proper reading
frame therefor, a signal peptide sequence;
(B) inserting the DNA sequence into a suitable .~:~
vector to create a construct comprising an
expression plasmid or viral expression
vector, said construct being capabls of
directing the expression in, and secretion :
from, eucaryotic cells of said monomeric
. , .~! fragment or subfragment;
(C) transforming a eucaryotic host cell ~ith said
~: . construct;
(D~ culturing said transformed host cell under
conditions that cause expr~ssion within the
host cell and secretion therefrom of the
dimeric form:of the monomeric fragment or
: : subfrag~ént and under which the~monomeric
fragmént or subfragment assumes a tertiary
structure ~uitable for dimerization and the
dimerization thereof, and undar which there
is e~fected glycosylation of said monomeric
subunit fragment or subfragment or of a
dimeric ~o~m thexeof.
.
Another~ spect~of:the invention:is based upon the
discovery that the ri~stocetin-induced interaction ::. ` :~
~ 30 between cloned 116 kDa vWF fragment and platelets can
: : be enhan~ed by reducing the amount of glycosylation on
the 116 kDa fragment.~ This discovery is useful in the ~-
design of additional polypeptides effective in the
, ~.
'
`; ;~ ' ' ` ' '' ' . I ; ; A . ~; ~,
I ~0~2/06~ PCT/U~91/077~6
2 ~ 2 'a ~j
13
treatment of thrombosis or o~ von Willebrand disease.
Accordingly, there is provided a mutant polypeptide
patterned upon a parent polypeptide which comprises the
amino acid sequence of that fragment of mature von
S Willebrand factor subunit which begins approximately at .:~
residue 449 (valine) and ends at approximately residue :
- 728 (lysine), or a dimer thereof, from which parent one ;:-
or more serine, threonine or asparagine residues which
- are sites of O- or N-linked glycosylation have been ~:
deleted or replaced by one or more other amino acids,
said mutant polypeptide having less glycosylation when
said mutant polypeptide is expressed from recombinant
DNA in a host eucaryotic cell than the species of the
parent polypeptide having an apparent molecular weight
of 52 kDa, as measured by SDS-polyacrylamide gel
electrophoresis.
It is believed the invention, and the mutagenesis
and protein expression procedures thereof, will be
widely practiced in the art to generate mutant mature
: 20 von Willebrand factor subunit fragments with improved
solubility, stability and therapeutic activity. :~
Although the invention is described initially in
connection with the expression and secretio~ ~rom
mammàlian cells of certain glycosylated ~ragments of
mature von Willebrand factor having therapeutic :
utility, it should be understood that it is applicable
also to the expression in mammalian cells of other
therapeutic polypeptides in which secretion from said
cells of said polypeptides is facilitated by an
additional sequence o~ amino acids which are also
encoded by a DNA for the therapeutic polypeptide and
which comprise human von Willebrand factox signal
~ : r
` W092/06~ PCT/US91/07756~ :
', 20~s2~9 1~
peptide, or a subset thereof, and the amino terminal
region o~ the von Willebrand factor propeptide. :-
: Accordingly, there is also provided a polypeptide ~hich
-, is capable of directing the transport of additional
polypeptide sequence across the membrane of the
endoplasmic reticulum of a cell and which is comprised
of a domain (A) and a domain (B~ as follows: -
domain (A) any subset of the signal :
peptide of human von
~o Willebrand factor subunit
which signal peptide is
capable of being recognized by
the endoplasmic reticulum
and/or by translocation
. 15 receptors which complex with `~
the endoplasmic reticulum
and/or the signal peptide; and
domain (B) a peptide sequence consisting ::
- essentially of up to the first ~ :
ten residues of the amino :~:
terminal end of von Willebrand
factor propeptide;
: said domain (B) being connected by amide linkage to the
carboxy terminus of domain (A) a~d capable of being
connected by amide linkage to the amino terminus of
said additional polypeptide sequence; which polypeptide
comprising domain (A) and domain (B) contains a .
sufficient subset Or the sequence of the human ~on ~ ~ .
Willebrand factor signal peptide and propeptide to
facilitate cleavage in a manner such that there remains
attached to the amino terminal end of the additional
polypeptide sequence a subset of the sequence derived
from domains (A) and (8), and wherein therapeutic .
,",
, . ~
.~,'' '.~.
W09 ~n6~ PCT/US91/077~6
.
`~ activity of ~he additional polypaptide sequence is
. retained in whole or part.
Speaking more generally, there is also proYided a
process for producing from DNA a therapeutic
polypeptide comprising:
(A) constructing a DNA sequence encoding the
therapeutic polypeptide which contains
- upstream ~rom the polypeptide encoding region
thereof, and in proper reading frame
therefor, a DNA sequence which itself
corresponds to a signal peptide ~nd directly ; -:~
downstream therefrom a semipolar or polar
spacer se~uence;
(B) inserting the resultant DNA sequence into a :
suitable vector to create a construct -~:
comprising an expression plasmid or viral
expression vector which is capable of
directing the exprèssion in and ~ecretion
from eucaryotic host cells of said `
therapeutic polypeptide; ~
tC) transforming a eusaryotic host cell with said : :
construct; and
(D) culturing said transformed host cell under
conditions which cause expression within and
secretion from said host cell of the
therapeutic polypeptide.
Brie~ Description of the Drawlnq.s
Pigure l is a table which shows the previously
reported amino acid and DNA sequence for the mature von
Willebrand factor subunit (human) between residue 431
and residue 750.
~ . . .. .. . . . . . . .
.. . , .~ . . - .. . . - . ~ .
W092/06~ PCT/US91/07756
.~ , .. .
~, F ~ re 2 ~s a graph whlch shows the inhibition of
botrocetin-induced binding of vWF to platelets by a
` cysteine-free mutant polypeptide of the present
invention.
. : :
Figure 3 is a graph which shows the inhi~ition of
the binding of an anti GPlb monoclonal antibody to
platelet by a mutant polypeptide of the present ;~
invention.
.
Figure 4 is a map of pCDM8 plasmid.
Definitions ~-.
Unless indicated otherwise herein, the following
terms have the indicated meanings.
Codinq Sequence (Encodin~ DNA~ - DNA sequances which~
in the appropriate reading frame, code for the amino
acids of a protein. For the purpose of the present
invention, it should be understood that the synthesis
or use of a coding sequence may necessarily involve
synthesis or use of the corresponding complementary
strand, as shown by: 5'-CGG-GGA-GGA-3'/3/-GCC CCT CCT-
5' which "encodes" the tripeptide NH2-arg-gly-gly-CO2H.
A discussion of or claim to one strand is deemed to
refer to or to claim the other strand and ~he double `
stranded counterpart thereof as is appropriate, useful
or necessary in the practice of the art. ~-
cDNA - A DNA molecule or sequence which has been
enzymatically synthesized from the sequence(s) present
in an mRNA template.
.. ~
W0~2/06~ PCTJU~9i/077~
.
; ..
;j 17
Tra~scribed Strand - The DNA strand whose nucleotide
sequence is read 3' ~ 5' by RNA polymerase to produce
mRNA. This strand is also re~erred to as the noncodinq
strand.
.:~
Coding_Strand or Non-Transcribed Strand - This strand
` is the antiparallel compliment of the transcribed
strand and has a base sequence identical to that of the
~RNA produced from the transcribed strand except that
thymine bases are present (instead of uracil bases of
the mRNA). It is referred to as "coding" because like
~' mRNA, and when examined 5' ~ 3', the codons for- translation may be directly discerned.
~, Bioloaical Activity - One or more functions, ef~ects
of, activities performed or caused by a molecule in a
- 15 biological context (that is, in an organism or in an 'n
vitro facsimile). A characteristic biological activity
of the 116 kDa homodimeric fragment of the mature von
Willebrand factor subunit is the potential ability to
~, bind to more than one platelet GPIb receptor thereby
- 20 enabling the molecule to facilitate aggregation of
platelets in the presence of ristocetin. Other
resultant or related effects o~ the 116 kDa species
include ~unction as a thrombotic and the induction of
platelet activation, and/or adhesion to surfaaes.
Similarly, a characteristic biological activity of the
52/48 kDa monomeric fragment of the mature von
Willebrand factor subunit is the potential ability to
bind to only one platelet GPIb receptor thereby
enabling the molecule to inhibit botrocetin-induced
binding of multimeric vWF to platelets. Other
- resultant or related effects of the undimerized 52/48
kDa species include inhibition of platelet activation,
W~ g2~ g9 PCr/USgl/07756
-`` ~Q~42~9
.. . .
18
aggregation, or adhesion to surfaces, and the
~ inhibition of thrombosis.
; Reducinq Conditions - Refers to the presence of a
"reducing" agent in a solution containing von
Willebrand factor, or polypeptides derived therefrom,
which agent causes the disruption of disulfide bonds of
j the vWF. However, consistent with u-~age typical in the
art, the "reducing" agent such as dithiothreitol (DTT)
causes a vWF disulfide bond to be broXen by forminq a
disulfide bond between a vWF cysteine and the DTT with
no net change in oxidation state of the involv~d sulfur
atoms. , - `
~, . J ~ .'
Promoter - DNA sequences upstream from a gene which
promote its transcription.
Clonin Vehicle (Vector) - A plasmidj phage DNA or
other DNA sequence which is able to replicate in a host
cell, typically characterized by one or~a small number
of endonuclease recognition si~es at which such DNA
sequences may be cut in a determinable fashion for the
insertion o~ heterologous DNA without attendant loss of
an essential biological function of ~he DN~, e.g., -
replication, production of coat prot~ins or loss o~
expression control reglons such as promoters or binding
sites, and which may contain a selec~able gene marker
suitable for use in the identification of host cells
trans~ormed therewith, e.g., tetracycline resistance or
ampicillin resistance.
,
Plasmid - A nonchromosomal double-stranded DNA sequence
comprising an intact "replicon" such that the plas~id
is replicated in a host cell. When ~he plasmid is
. .
.. . . .. . . . .. . .
WOg2/06~ PCT/US91/07756
.
` .~
."` 19 .
~` placed within a procaryotic or eucaryotic host cell,
the characteristics of that cell may be changed (or
transformed) as a result of the DNA of the plasmid.
For example, a plasmid carrying the gene for
-~ 5 tetracycline resistance ~TetR) transforms a cell
previously sensitive to tetracycline into one which is
resistant to it. A cell transformed by a plasmid is
called a "transformant.l'
, .
Expression Plasmid - A plasmid into which has been
inserted the DNA being cloned, such as the von
Willebrand factor structural gene. The DNA sequence
inserted therein may also contain sequences which
- con~rol the translation of mRNA resultant therefrom,
and contai~ restriction endonuclease sites which
- 15 facilitated assembly of, and may facilitate further
modification of, said expression plasmid. An
; expression plasmid is capable of directing, in a host
cell, the expression therein of the encoded pol~peptide
and usually contains a transcription promoter upstream
- 20 from the DNA sequence of the encoded structural gene.
.` An expression plasmid may or may not become integrated
into the host chromosomal DNA. For the purpose of this
invention, an integrated plasmid is nonetheless
referred to as an expression plasmid.
Vi~l Expres~ g~Q~ - A viral expression vector is
similar to an expression plasmid except that the DNA
may be packaged into a viral particle that ca*
; transfect cells through a natural biological process.
Downstream - A nucleotide of the transcribed strand of
a structural gene is said to be downstream from another
section of the gene if the nucleotide is normally read
`: :
W092/06 ~ PCT/US91/07756 ";
` 2Q94~5~ ~ :
'
;.
~l by RNA polymerase after the earlier section of the
~ gene. The complimentary nucleotide of the
- nontranscribed strand, or the corresponding base pair
within the double stranded form of the DNA, are also ,-
~- 5 denominated downstream.
-l - Additionally, and making reference to the "'
;,~ direction of transcription and of translation within
` - the structural gene, a restriction endonuclease '
,~ sequence added upstream ~or 5') to the gene means it is ' '
added before the sequence encoding the amino terminal
~, end of the protein, while a modification created
downstream (or 3') to the structural gene means that it
is beyond the carboxy terminus-encoding region thereof. ''',,
von Willebrand ~actor (vWFl - It is understood that all ' '-
references herein to von Willebrand factor refer to vWF ;'.
in humans. The term "von Willebrand factor" is
intended to include within its scope any and all of the ''~-
terms which are defined directly below.
Additionally, von Willebrand factor is found as a '~
component of the subendothelial matrix, as a component "~
of the ~-granules secreted by activated platelets, and
as a circulating blood plasma protein. It is possible
that the three-dimensional subunit structur~ or
multisubunit struc~ure of vWF varies in these different
contexts potentially caused, for example, by
di~erences in glycosylation. Such differences do not ~ '
-prevent useful therapeutic,vWF-derived,polypeptides
~xom being produced from the vWF DNA sequences of
endothelial cells or megakaryocytes according to the
practice of this invention.
.
WOg~06~ PCr/US91/07756
,....... :
`"` - 2~2~9
,, 21
Furthermore it is possible ~bat there are minor
biologically unimportant differences betwee~ the actual
DNAs and polypeptides manipulated or otherwise utilized
~ in the practice of the invention and the structural
,~,, 5 , sequences of amino acids or nucleotides thereof as
reported herein. It is understood that the invention
, encompasses any such biologically unimportant
, variations.
, .
;- Pre-pro-vWF,- von Willebrand factor is subject to
extensive posttranslational processing. "Pre-pro-vWF"
contains (from the N to the C terminus) a signal
peptide comprised o~ approximately 22 amino acid
--~ residues, a propeptide of approximately 741 amino
, -acids, and then the approximate 2,050 residues of
circulating vWF.
;; Pro-vWF - The signal peptide has been removed from pre-
pro-vWF.
Mature vWF - Circulating vWF as found in the plasma or
~ as bound to the subendothelium. It consists of a
-~ 20 population o~ polypeptide monomers which are typically
j ~ associated into numerous species of multimers thereof,
~': each subunit o~ which being 2,050 residues in length.
Additionally, when expressed in mammalian cells, mature
vWF is usually glycosylated.
Signal Peptide ~Sequ~nce~ - A signal peptide is the
sequence of amino acids in,a,newly transIated
polypeptide which signals translocation of the
polypeptide across the membrane of the endoplasmic
reticulum and into the secretory pathway of the cell. :
A signal peptide typically occurs at the beginning
; :.:
'-~
~j,.,,,,, ,.,, .,,,,,,,,,,.... ,,.,,,,,., ,,,.:, ~; :;
wo ~06~ 2 ~ 9 ~ 2 ~ 9 PCT/US91/077~6
: . ' '
~ 22
`~ ~amino terminus) of the protein and is 20-40 amino ~ ~
acids long with a stretch of approximately 5-15 -
hydrophobic amino acids in its center. Typicaily the
signal sequence is proteolytically cleaved from the
protein during, or soon after, the process of
translocation into the endoplasmic reticulum. That -
portion of a gene or cDNA encoding a signal peptide may
also be referred to as a signal sequence.
. .
Table 1 shows the standard three letter
designations for amino acids as used in the -
application.
TABLE I
Alanine Ala
Cysteine Cys
Aspartic Acid Asp
Glutamic Acid Glu
Phenylalanine Phe
Glycine Gly
~ Histidine His
- Isoleucine Ile
~ Lysine Lys
;~ Leucine Leu
Methionine Met
Asparagine Asn
Proline Pro
Glutamine Gln
Arginine Arg
Serine Ser
Threonine Thr
Valine Val
~ryptophan Trp
Tyrosine Tyr
. ~
Detailed Description of the Invention
As set forth above, both the antithrombotic and
antihemorrhagic polypeptides of the present invention
are based upon fragments of the natural occurring ;
':
wo 9~J0699~ Pcr~ussl/b77s6
2 ~ ~
23
protein von Willebrand factor (hereina~ter "vWF"). For
background purposes, there is set forth hereafter
information concerning this protein and its role in
hemostasis and thrombosis.
~' . .
Description of the Role of vWF
in Hemostasis and Thrombosis
. .
vWF perfoxms an essential role in normal
hemostasis during vascular injury and is also of
central importance in the pathogenesis of acute
thrombotic occlusions in diseased blood vessels. Both
of these roles involve the interaction of vWF with
~ platelets which are induced to bind at the affected
-- site and are then crosslinked. It is believed:that
-~ single platelets first adhere to a thrombogenic surface
3' 15 after which they become activated, a process involving
major metabolic changes and significant morphological
, changes within the platelet. Activation is evidenced by
the discharge of platelet storage granules containing
adhesive substances such as von Willebrand factor (an
~ adhesive protein), and the expression on the surface of
the platelet of additional functional adhesive sites.
once activa~ed, and as a part o~ normal he~ostasis,
platelet cells become aggrega~ed, a process which
involves extensive crosslinking of the platelet cells
with additional types of adhesive proteins.
:::
As stated above, these processes are normal as a
physiologic response to vascular injury. ~owever, they
may lead in pathologic circumstances, such as in
diseased vessels, to formation of undesired platelet
throobi with resultant vascular occlusion.
'
' ' ' ~.
,. :
YO ~/0~ PCT/US91/07756~
`` 2Qg42~9
;~ 24
Other circumstances in whic~ it is desirable to
prevent deposition of platelets in blood vessels
include the prevention and treatment of stroke, and to
prevent occlusion of arterial gra~ts. Platelet
thrombus formation during surgical procedures may also
interfere with attempts to relieve preexisting vessel
obstructionsO '.
.~, .'' .
~' The adhesion of platelets to damaged or diseased -
vessels occurs through mechanisms that involve specific
platelet membrane receptors which interact with
; specialized adhesive molecules. One such platelet
receptor is the glycoprotein Ib-IX complex which
consists of a noncovalent association of two integral
~ membrane proteins, glycoprotein Ib (GPIb) and
! 15 glycoprotein IX (GPIX). The adhesive ligand of the
GPIb-IX complex is the protein von Willebrand factor [
which is found as a component of the subendo*helial
matrix, as a component of the ~-granules secreted by
activated platelets, and also as a circulating blood
' 20 plasma protein. The actual binding site of the vNF to
the GPIb-IX receptor has been localized on the amino
terminal region of the ~ chain of glycoprotein Ib which
! is represented by GPIb(~).
: .
It is believed tha~ ~he interaction o~ multimeric
vWF with glycoprotein Ib-IX complex tat GPIbt~)) ~
results in platelet activation and ~acilitates the ~ ,
recruitment o~ additional platelets to a now growing : -
thrombus. The rapidly accumulating platelets are also
crosslinked (aggregated) by ~he binding o~ fibrinogen
at platelet glycoprotein IIb-IIIa receptor sites, and
possibly also by vWF at these sites, and/or at
additional glycoprotein Ib-IX receptor sites. In
:
WO~06~ P~T/US9~/07756
5 9
.~
addition, the glycoprotein IIb/IIIa receptor may also
be involved in the ~ormation of the i~itial monolayer
of platelets. Of particular importance in this process
is the multimeric and multivalent character of
~ 5 circulatiny vWF, which enables the macromolecule to
- effectively carry out its binding and bridging
functions.
i,
Inactivation of the GPIb~ or GPIIb/IIIa receptors
- on the platelets of a patient or inactivation of the
binding sites for vWF located in the suben~othelium of
a patient's vascular system, thereby inhibiting the
bridging ability of vWF, would be of great medical
i importance for treating or inhibiting thrombosis.
, Accordingly, the present invention relates to the
development of polypeptides which are effective in
accomplishing the foregoing.
., .
Although preventing unwanted thrombi is of great
importance, thsre ars circumstances where promoting
thrombus formation is desirable. von Willebrand
disease, the most co~mon of the bleeding disorders, is
the term used to describe a heterogeneous ~isease state
which results when von Willebrand factor is produced in
inadequate quan~ities or when circulating vWF molecules
are somehow de~ective. Various subtypes of the disea~e
have been described. It is apparent that supplying the
bridging function o~ vWF is of central importance in
the treatment of patients afflicted with von Willebrand
disease.` The present invention is concerned also with
preparation of fra~ments of von Willèbrand factor
capable of performing a bridging function b tween the
GPIb(~) receptor or GPIIb/IIIa receptor of the platelet
membrane and a receptor on another platelet, or between
':
....
W0~2~06~ PCT/US91~07756
, ::: 2~9~2~9
` . :
: 26
` such a receptor and components of the subendothelium,
;~ thereby performing in affected individuals the crucial
: physiological role of native multimeric von Willebrand
~` factor.
.~.`, .
. 5 Information Concerning the Structure of vWF
. and the Desian of Therapeutics Derived Therefrom ~:
.~ The domain of the von Willebrand factor subunit
which binds to the platelet membrane glycoprotein Ib-IX ~:~
. receptor-(GPIb~)) has been identified within a
~:. 10 fragment of vWF. The fragment may be generated by ~:
~. trypsin digestion, followed by disulfide reduction, and
: extends from approximately residue 449 ~valine) of the
circulating subunit to approximately residue 728
(lysine) thereof. Current evidence indicates that this
~rl 15 segment also contains (between residues 509 and 695
1: thereof) binding domains for components of the
;~ subendothelium, such as collagen and proteoglycans, : .
although other regions of the mature vWF subunit may be
more important in recognizing these substances~(an
additional protaoglycan or heparin binding site is :
.~; located in residues 1-272 of the mature subunit and an
addi$iona; collagen binding site within residues 910- .
1110 thereo~).
. .
Figure 1 (SEQ ID N0: 1) shows the previou~ly .
reported amino acid and DNA sequence for the mature von
Willebrand factor subunit (human) between residue 431
and residue 750~. The 52/48 kDa fragment produced by ~:
tryptic di~estion has an amino terminus at residue 449
(valine) and extends approximately to residue 728
(lysine). Amino acids are shown by standard three .
letter designations. The DNA se~uence is represented
by the coding strand (non-transcribed strand). Very
'
; W092/06~ PCT/US91iO7756
`` 2~9~2~9
.~
27
little polymorphism has been reported in the 52/48
; human sequence with one significant exception -
`~ histidine/aspartic acid at position 709, see Mancuso,
D.J. et al. J. Biol. Chem., 264(33), 19514-19527, Table
V, (1989). DNA sequences used for the experiments
; described in the Example section below contain an ;
aspartic acid codon for residue 709 ~codon GAC),
although placemen~ of histidine at residue position 709
: (the other known naturally occurring amino acid at this
position in ths human sequence, codon CAC) is also
`l- useful in the practice of the invention.
`, .
With respect to the therapeutic antithrombotic
polypeptides of the present invention, the following
information concerning vWF is of particular interest.
.
A fragment of mature ~on Willebrand factor having
platelet glycoprotein lb(~) binding activity and of
approximately 116,000 (116 kDa) molecular weight is ~--
isolated by digesting vWF with trypsin. If the 116 kDa
fra~ment is treated with a reducing agent;capable of
cleaving disulfide bonds, a pair of identical fragments
is generated. Each of the identical fragments ~which ~ `
together comprise the 116 kDa polypeptide) has an
apparent molecular we~ght of about 52,000 (52 kDa)c
~Polypeptide moleaular weight are typically measured by ;
migration, relative to standards, in a denaturing gel
electrophoresis system. Weight values which result are
only approximate.)
.= . . - - .:: .
Typically, the S2,000 molecular weight fragment is
30 referred to as a "52/48" fragment reflecting the fact
that human enzyme~systems gIycosylate the ~ragment
contributing to its molecular weight. The amount of
.
~;': ';
,, ., . . .......... . . , . , ~. .. ,. - .. . . .. , . , ~ . .. . . ... .
., . . . . -. . . .. . . . , . .. . . , ,: . ~ - : ,. : ., . -, -
WOg2~0~ PCT/US9l/077~6
~9~2~9
28
glycosylation varies from molecule to molecule, with
two weights, 52,000 and 48,000, being most common.
::
The 52/48 fragment has been demonstrated to have
as its amino-terminus residue 449 (valine) of the
mature subunit, and as its carboxy-terminus residue 728
(lysine) thereof. Without the additio~al weight
contributed by glycosylation, the polypeptide has a
molecular weight of approximately 38,000.
. .:
The 52/48 fragment has been demonstrated to
competitively inhibit the binding of von Willebrand
factor to platelets. However, manipulation of the `
52/48 fragment or its unglycosylated 38 kDa equivalent
has proved difficult. Successful manipulation of the
fragment has typically required that the cysteine
residues thereo~ be reduced and pe~manently alkylated.
Without this treatment, undesired reaction of the
cysteine residues thereo~ invariably occurs, leading to
the formation of insoluble and biologically inactive
polypeptide aggregates unsuited for effective use as
therapeutics.
.
It is known that the residue 449-728 ~ra~ment of
mature von Willebrand factor subunit, which contains
the platelet glycoprot~in Ib(~) binding domain, has
cysteine residue~ at positions 459, 462, 46~, 471, 474,
509 and 695. It is known also that all o~ the cysteine
residues of the mature vWF subunit are involved in
disulfide bonds. tLegaz, et al., J! Biol. Chem., 248,
3946-3955 (1973)). ; - ~ -
. .
Marti, T. et al. Biochemistry, 26, 8099-8109
(1987) conclusively identified mature subunit residues ~;
. . .
` W~92~06~ PCT/US91/07756
' :
471 and 474 as being involved in an intrachain
disulfide bond. Residues 509 and 695 were identified
as being involved in a disulfide bond, although it was
` not demonstrated whether this pairing was intrachain or
interchain (that is, within the same mature vWF
- su~unit).
` ' `:
~ Mohri, H. et al. J. Biol. Chem., 263(34), 17901-
'~ 17904 (1988) inhibited the ristocetin-induced binding
of I~I-labelled multimeric vWF to formalin-fixed
platelets with peptide subfragments of the 449-728
subunit fragment. Peptide sub~ragments fifteen ;~
residues in length were synthesized and tested. Those
- peptides which represent subunit sequence contained -
within, or overlapping with, two distinct regions,
Leu4~ to Asp498 and Glu689 to Val7li were found to be
active. ~`
.. .. , ~ ~ . `.
Mohri concluded that the GPIb~) binding domain of `~
vWF was formed by residues contained in two
~ discontinuous sequences Cys47~-Pro488 and ~eu~-Pro7
-` 20 maintained in proper conformation in native vWF by
disulfide bonding, although the authors were unable to
identify the cysteine residue which formed the
stabilizing bond~s) and whether the bonds were intra or
interchain.
The present invention provides for polypeptides
derived from the residue 449-728 region of the mature
von Willebrand factor~subunit which are useful in the
treatment of vascular disorders such as thrombosis.
Such ~olecules can be made most efficiently from
DNA which encodes that fragment of mature von
':,
. ,.,, = .. . . . , ,;. , ;, . , .. . ,, ",, ., ~,, ,, .,, , .,~ , . , ., , .:.
~ . .
W092~06~ PCT/US91/~77~6
``` 2 ~
: ,:
-~ 30
Nillebrand factor subunit comprising essentially the
a~ino acid sequence from approximately residue 441
(arginine) to approximately residue 733 ~valine~, or
which encodes any subset of said amino acid sequence,
or a mutant polypeptide fragment, or subset thereo~,
1~ which contains fewer cystei~e residues tha~ that of the
- comparable wild-type amino acid sequence. A preferred
; method for the preparation of the molecules comprises
culturing a host organism transformed with a
biologically functional expression plasmid which ;
contains a mutant DNA sequence encoding a portion of
said von Willebrand factor subunit under conditions
which effect expression of the mutant von Willebrand
factor fragment, or a subset thereof, by the host
organism and recovering said fragment therefrom.
A preferred means for effecting mutagenesis of
cysteine codons in a vWF DNA to codons encoding amino
acids incapable of d'sulfide bonding is based upon the
site directed mutagenesis procedure of Kunkel, T.A.,
Proc. Natl. Acad. Sci. U.S.A., 82, 488-492 (1985).
Such ~utant DNA sequences may then be expressed ~rom
either racombinant-bacterial or reco~binant eucaryotic -
host cell systems.
Fi~st Embodiment of the Invention
An important aspect of this embodiment of the
invention is the provision of compositions of said vWF-
derived polypeptides which are less prone to
aggregation and denaturation caused by undesired I -
disulfide bonding within the inclusion bodies of host
expression cells (or resultant from inclusion body
solubilization procedures) than previous preparations. , ;;
:`
~ wo92/n6~ PCT/US91/07756
``` 2~9~2~9
.
I . . ..
. 31 :
: Tha develcp~ent employs mutagenesis to limit the number
~!~ of cysteine residues present within said polypeptides-
;~ Mutagenesis of vWF DNA Encoding The
Mature Subunit Residue 449-728 Reqion
' 5 A variety of molecular biological techniques are ~.
available which can be used to change cysteine codons
.,` for those of other amino acids.. Suitable techniques
include mutagen~sis using a polymerase chain r~action,
.. gapped-duplex mutagenesis, and differential
- 10 hybridization of an oligonucleotide to DNA molecules :.
differing at a single nucleotide position. For a ~.
; review of suitable codon altering techniques, see : .
Kraik, C. "Use of Oligonucleotides for Site Specific
Mutagenesis", Biotechniques, Jan/Feb 1985 at page 12.
. 15 In the practice of this embodiment, it preferred
to use the site-directed or site-specific mutagenesis
procedure of Kunkel, T.A., Proc. Natl. Acad. Sci. USA,
~ 8~, 488-492 (1985). This proceduxe takes advantage of .
~: a series of steps which first produces, and then
selects against, a uracil- ontaining DNA template.
~xample 1 of the present invention explains in detail .;
~` the mutagenesis techniques u~ed to create mutant vWF
cDNA.
.
Other publications which disclose site-directed .
mutagenesis procedures are: Giese, N.A. et al.,
: Science, 236, 1315 (1987); U.S. Patent No. ~,518,584; ~.
and U.S. Patent No. 4,959,314. ~ :.
It is also preferred in the practice of this
embodiment to cause to be substituted for one or more ::
of the cysteine codons of the wild type DNA sequence
codons for one or more of the following amino acids~
:
...
W092~06~ P~TIUS91/07756
2~259
32
alanine, thrRonine, serine, glycine, and asparagine.
Replacement with alanine and glycine codons is ~ost
preferred. The selection of a replacement for any
particular codon is generally independent of the
selection of a suitable replacement at any other
position.
The following are representati~e examples o~ the
types of codon substitutions which can be made~ using
as an example cysteine residue 459:
~) the codon for cysteine 459 could be replaced
by a codon for glycine; or -
(B) the codon for cysteine 459 could be replaced
by two or more codons such as one for serine
and one for glycine, such replacement
resulting in a new amino acid sequence:
-His45s-ser459(~-Gly459o-Gln~-; or
(C) the codon for cysteine 45s could be deleted
from the cDNA, such deletion resulting in a
shortened amino acid sPquence represented by: ;
_Hi5458-Gln4~-; or
(D) one or more codons for residues adjac~nt to
cysteine residue 459 could be deleted along
with codon 459 as represented by: -Glu457-
Gln4~-.
It is conte~plated that codons for amino acids other
than alanine, threonine, serine, glycine or asparagine
will also be useful in the practice of the invention
depending on the particular pri~ary, secondary,
tertiary and guaternary environment of the target
cysteine residue. - i.
~,
. ~ . - - - , ", . .. .-
.
W092/06~ PCT/US91/07756 ~
33 :
It is considered desirable in tha practice o~ this
embodiment to provide as a replacement for any
particular cysteine residue of the 449-728 tryptic vWF -:
. subunit fragment an amino acid which can be ~:
accommodated at the cysteine position with minimal
perturbation of the secondary structure (such as ~
~. helical or ~-sheet) of the wild type amino acid .:
; sequence subsegment within which the cysteine position
is located. In the practice o~ the present invention,
alanine, threonine, serine, glycine and asparagine will
generally be satisfactory because they are, like :
cysteine, neutrally charged and have side chains which
are small or relatively small in size.
'. '.'
. Substantial research has been conducted on the
subject of predicting within which types of structuraI
domains of proteins (~-helix, ~-sheet, or random coil3
one is most likely to find particular species of amino
acids. Serine is a pre~erred amino acid for use in
the practice of this invention because it most closely : .
approximates the size and polarity of cysteine and is
~; believed not to disrupt ~-helical and ~-sheet domains. :.
Reference, for example, to Chou, P.Y. et al.,
Bioch~ist~, 13(2), 211-222 (1974) and Chou, P.Y. et
al., "Prediction of Protein Conformation,"
Biochemist~y, 13(2j, 222-244 (1974) provides further
information useful in the selection of replacement
amino acids. Chou, P.Y. et al. predicted the secondary ~ -
. structure of specified polypeptide seguence segments :;
based on rules for determining which species of amino :
acids therein are.likely to be found in the center of, :
for example,:an alpha helical region, and which . -
residues thereof would be likely to terminate ~ ~-
- , : ., ......... -, - - , , . . . . .. . . ,. .: . -. ~ ,
' ! . - . ,., .: . . , ,.. . . , , " , . " , ... " , " ,, , . ~ , " ,. ... ~. .
W092~06~ PCT/US91/07756 ~
.,`" ` ' . . ''.
~ 2~42~9
`~ 34
~`~ propagation of a helical zone, thus becoming a boundary
~;' residues or helix breakers. Acoording to Chou, P.~. et
al., supra, at 223, cysteine and the group of -
threonine, serine, and asparagine are found to be
indifferent to ~-helical stru~ture, as opposed to being
; breakers or formers of such regions. Thus, threonine,
serine and asparagine are likely to leave unperturbed
an ~-helical region in which a potential target
cysteine might be located. Similarly, glycine, alanine
lQ and serine were found to be more or less indifferent to
the formation of ~-regions. It is noted that serine,
threonine and asparagine residues represent possible r -
new sites of glycosylation making them potentially
unsuitable replacement residues at certain positions in
secretory proteins subject to glycosylation.
` Generally, the primary consideration which should
be taken into account in connection with selecting
~ suitable amino acid replacements is whether the
- contemplated substitution will have an adverse effect
on the tertiary structure of the fragment. Thus, other
amino acids may be suitable as acceptable~substitutes
for particular cysteine residues as long as the new
~ residues do not introduce undesired changes in the
- tertiary structure of the 449-728 ~ragment. Reactivity
with NMC-4 antibody is recommended as a test of whether
a mutant polypeptide has the desired therapeutic
properties.
Particularly preferred ~utant polypeptides of the
pr~sent invention are patterned upon a monomeric form
of the residue 449-728 domain of the m~ture subunit
fragment, as opposed to a dimer thereof which could
provide a bridging function between two platelets.
.~ ~, . .... .... . ....... .. .
, -,
~ WOg2~06~ PCT/US91/07756 ;~ ~
2 ~
`.
` ` 35
Normally, those codons in a vWF DNA fragment for
speci~ic cysteines which normally participate in - -
~ intsrchain disul~ide bonding should be replaced.
; Cysteine codons encoding residues which form intrachain
disulfide bonds should~be left unmutated, i~ the
intrachain bond is demonstrated to con~er upon the
subunit fragment important structural features, and if
conditions can be found which allow the intrachain bond
to form properly~
More specifically, preparation of a mutant
polypeptide fragment which corresponds to that fragment
of mature von Willebrand subunit having an amino
terminus at residue 441 (arginine) and a carboxy
terminus at residue 733 (valine), but which differs
', 15 therefrom in that each of the cysteine residues thereof
is replaced by a glycine residue is disclosed. .
The embodiment also teaches that retention of a
certain disulfide~bond within polypeptides ~ ;
corresponding to the 449-728 vWF subunit region is
particularly important for the design of therapeutic ~-
~- molecules derived therefro~. In this regard there is
provided a mutant vWF fragment expressed by p5E
plasmids, as described in ~xample 4, and containing an
intrachain disulfide bond.
.,, . ~
Important factors in~olve~ in the design of
pre~erred mutant polypeptides of the invention are
described hereafter. - - -
., - , -~ . :
Potential binding sites for collagens and heparin-
like glycosaminoglycans exist in the 449-728 tryptic
fragment in the loop region between cysteine residues
"~ .
~;
W092~06~ PCT/US91/07756~
2 ~ 9
36
509 and S95. In the event that binding at these sites
impairs the antithrombotic therapeutic utility of the
-~ molecule by, for example, also providing bridging to
collagen, the polypeptide can be redesigned (for
example, by chemical synthesis or proteolysis) to
delete the loop region.
von Willebrand factor polypeptides derived from
bacterial expression systems substantially lack the
- glycosylation vWF normally acquires as a re~ult of
1o post-translational processing such as in the Golgi
apparatus or Weibel-Palade bodies. The present
invention includes within its scope molecules which are
made by E.coli BL21~DE3) or other suitable procaryotic
host cells and which are enzymatically or chemically
; 15 glycosylated to more resemble the molecules expressed
; by mammalian cells.
Alternatively, the ~NA encoding sequences can be
tranferred to expression plasmids or viral expression
j vectors capable of causiny expresion in mammalian host ~;
cells to provide normal glycosylation.
It has been established that both platelets and
von Willebrand factor molecules contain large numbers
of negative charges such as, for example, those
contributed ~y sialic acid. Such charges aan
facilitate desirable mutual repul~ion o~ the molecules
under non-injury conditions. The addition of one or
more positively charged residues of lysine and~or of
arginine extending from the amino and/or from the
carboxy terminus of the 52/48 tryptic frag~ent or
recombinant equivalents thereof can overcome electrical
repulsions with respect to the ~PIb-IX receptor
W092/0~ PCT/US~1/07756
'
~ 37 2~2~
~acilitating use of the fragment as an antithrombotic
therapeutic.
In addition, and with respect to polypeptides
patterned upon the 449-728 vWF subunit fragment, it is
within the scope of the invention to remove certain
cysteine residu~s by site directed mutagenesis and
thereaftex inactivating any remaining cysteine residues
by chemical inacti~ation thereof, such as, for example,
by S-carboxymethylation.
~ , .',
A mutant polypeptide that is insoluble can be made ,-~
soluble by covalently linking to i~ a subdomain of a ~-
- water soluble polymer, for example, a polyacrylamide. !,
Other techniques can also be used to impart solubility
: to an otherwise insoluble polypeptide.
In light of the aforementioned, which is generally
applicable to all the polypeptides of the invention, ;~
there follows hereafter a discussion of means by which
mutant polypeptides of the first em~odiment of the
invention can be prepared.
.. ...
To accomplish this, a cDNA clone encoding the von
Willebrand factor gene (for the pre-propeptide) was'
utilized. ~he cDNA was then subjected to enzymatic
ampli~ication in a polymerase chain reaction using
oligonucleotides which flanked the indicated r~gion.
The first oligonucleotide representing coding strand
DNA contained an EcoRI site 5' to-the codon ~or residue
441 (arginine) and extended to the codon for residue ,
446 (glycine). The second oligonucleotide,
corresponding to non-coding strand DNA, encoded amino
acids 725 to 733 and encoded 3' to codon 733 a HindIII
~ .
;':
~092/06~ PCT/US91/07756
2~2~
38
restriction sequence. The resultant double stranded
: von Willebrand factor cDNA corresponding to the amino
- acid sequence ~rom rasidue 44~ to residue 733 ~of the
mature subunit) was then inserted, using EcoRI and
- 5 HindIII restriction enzymes, into the double stranded
replicative ~orm of bacteriophage M13mpl8 which
contains a multiple cloning site having compatible
EcoRI and HindIII sequences. Following the procedure
~ of Kunkel, T.A., Proc. Nat-l. Acad. Sci. USA, 82, 48
: 10 492 (1985), site directed mutagenesis was performed
using hybridizing oligonucleotides suitable for
replacing all of the cysteine codons (residue positions ~:
4S9, 462, 464, 471, 474, 509 and 695) with individual
glycine codons (see Example 1) or, for example, 5 of
the cysteine codons, residue positions 459, 462, 464,
471 and 474, with individual glycine codons (see
Example 4). Mutant double stranded vWF cDNA fragments
derived from the procedure were removed from M13mpl8
~; phage by treatment with EcoRI and HindIII restrictionendonucleases, after which the ends of the vWF cDNA
fragments were modified with BamHI linkers.
~,
The two types of mutant vWF cDNA, containing
either 5 or 7 Cys to Gly mutations, were then
: separately cloned into the pET-3A expression vector
(see Rosenberg, A.H. et al., Gene, 56, 125-136 (1987))
for expres3ion ~rom E.coli strain BL21(DE3), Novagen
Co., ~adison, WI. pET-3A vehicle containing cDNA for
the vWF subunit fragment with 7 cysteine-to-glycine
mutations is referred to as "p7E", and as "p5E" when
the contained vWF cDNA fragment encoded:the 5 above
specified cysteine-to-glycine mutations. Mutant von
Willebrand factor polypeptides produced by bacterial
cultures containing expression plasmid p5E were
WO ~/06~ PCT~US91/~775S
, S~ r~ ~ ~
39 `~
.
compared with those expressed from cultures containing
p7E plasmids. The p5E molecule is capable of forming a
disul~ide bond between cysteine residue 509 and 695
whereas the p7E molecule cannot.
.; ,,~, .
The mutant polypeptides were nok secreted by the
; bacterial host cell~, but rather accumulated in poorly -~
soluble aggregates ("inclusion bodies"~ from which the
polypeptides were successfully solubilized following
the procedure of Example 1 (p7E) and Example 4 (p5E~.
Polypeptides expressed from p7E and p5E plasmids were
characterized by SDS-polyacrylamide gel electrophoresis
and immunoblotting (Examples 2 and 5). Under reducing
conditions both plasmids express polypeptide species
` having an apparent molecular weight of approximately. ~`
38,000 as measured by SDS-polyacrylamide gel
.
electrophoresis, as would be predicted from the
unglycosylated molecular weight of the expected amino ~,
acid sequences.
: - ,
The behavior of p5E and p7E extracts was examined
using immunologiral methods (see Example 5). vWF-
speific murine monoclonal antibodies RG-46 and NMC r4
were used as probes. RG-46 ha~ been ~emonstrated to , `
recogniza as its epitope a linear sequence of amino
acids, comprising residues 694 ~o 708 within the mature
von Willebrand ~actor subunit. The binding of this
antibody to its dete~minant is essentially con~ormation `
independent. Mohri,~ ~. et al., J. Biol. Chem.,
263(3~), 17901-17~04 ~1988). ~ `
- . . --. . . . .: ; . ~; :
NMC-4 however, has as its epitope the domain of
the von Willebrand factor subunit which contains the
glycoprotein Ib binding activity. Mapping of the -
WOg2~6~ PCT/US91/07756
- '
2`~ 9
epitope has demonstrated that it is contained within
two discontinuous domains (comprising approximately
mature vWF subunit residues 474 to 488 and also
approximately residues 694 to 708) brought into
disulfide-dependent association, Mohri, H. et al.,
supra, although it could not be determined whether the
disulfide bond conferring this tertiary conformation in
the native vWF molecule was intrachain or interchain.
Id. at 17903.
Accordingly, 7.5 ~g samples (of protein) were
first run on 10~ SDS-po}yacrylamide gels so that the
antigenic behavior of particular bands (under reducing
and nonreducing conditions) could be compared with
results obtained by Coomassie blue staining.
Immunoblotting ('tWestern Blotting") according to a
standard procedure, Burnette, A. Anal. Biochem., 112,
- 195-203 ~1981), was then performed to compare pSE and
p7E extracts.
It has been determined that, under nonreducing
conditions, the single chain p5E pol~peptide fragment
(representing the seguence from residue 441 to re~idue
733) displays an approximate 1~0 fold increase in
binding a~finity ~or NMC-4 compared to the comparable
cysteine-free species isolated from p7E. After
electrophoresis under reducing conditions ~utilizing
100 ~M DTT), the single chain p5E specieC shows a
remarkably decreased affinity for NMC-4, which was then
very similar to that of the cysteine-free p7E species
under either reduced or nonreduced conditions. NMC-4
also failed, under reducing or non-reducing conditions,
to recognize as an epitope disulfide-linked dimers from
the p5E extract.
W092/06~ PCT/US91~07756
..,
' 41 2~942~9
The nitrocellulose filters used to produce :
'. ` autoradiographs based on NMC-4 were rescreened with RG-
46 by subtracting the initial NMC-4 exposure response,
.. which was kept low through a combination of low
:` 5 antibody tit~r and short exposure time. The binding of
RG-46 to the 36,000 kDa p7E polypeptide on the filters
was the sa~e whether reducing or non-reducing
conditions were chosen, consistent with the replarement
of all cysteines by glycine in the expressed .
polypeptide. ;
~.............. ................................................................... ... ... ~' .
A large molecular weight vWF antigen (raactive to
RG-46) was present in the p5E polypeptide extract under
nonreducing conditions. These p5E vWF aggregates
(reflecting interchain disulfide bonds) migrated under
reducing conditions in the same position as the p7E : .:
polypeptide indicating disruption of their disulfide - .
contacts. However, the large p5E interchain disulfide
~' aggregates which are readily recognized under
nonreducing.conditions by RG-46 were not recognized by
NMC-4 under either reducing or nonreducing conditions.
It was thus demonstrated that the disulfide bond ..
between residues.509:and 695 in native multimeric vWF
: subunits represents an intrachain contact.
The disul~ide bvnd between residues 471 and 474 of
the mature vWF subunit~has previously been shown to be .
an intrachain contact, thus the arorementioned ;`
embodiment i5 able to suggest that interchain disul~ide .
bond(s) in multisubunit mat~re vWF would be for~ed -
using one or~ore of cysteine residues 459, 462 or 464.
A wide variety of expression plasmids or viral
expression vectors are suitable for the expression of ~:
W092~06~ PCT/US~1/07756
````-`` 2~9~259
~`~ ' ` ,.
:`~
42
~, the 441-733 fragment, or similar vWF ~ragments.
' Representative sxamples inalude pBR322, and derivatives
'`~ thereof such as pET-l through pET-7. Suitable host ; `
cells include the bacterial genuses of Escherichia and
Bacillus. Of importance in the selection of an
expression system is the rerommended presence of a high
efficiency transcription promoter directly adjacent to
the vWF cloned DNA insert. Mutant vWF cDNA fragments
may also be cloned in eucaryotic host cells.
`:`
Thi~ discovery is expected to be particularly
useful in the design of therapeutic vWF polypeptides
patterned upon the 52/48 tryptic fragment (for use as
antithrombotics) or patterned instead upon the 116 kDa
homodimer thereof (for use as antihemorrhagics)'.
Second Embodi,ment ,of the Invention
Many of the factors dsscribed above with re~pect
to the design of and expression of therapeuti~
fragments of vWF from recombinant bacterial cells are
i applicable to the design of and expression of vWF
i 20 fragments from eucaryotic host cells. Such
applicability is readily apparent to those skilled in
` the art.
This ~econd embodiment includes withln itæ scope
the recognition of,,certain o~ the roles performed by
, cysteine residues present in the residue 449-728
primary se~uence fragment of the mature vWF subunit.
In this connection, this embodiment confirms that the
cysteine 509-695 disulfide bond is an intrachain bond
and provides for effective therapeutics incorporating
the 509-695,bond for the purpose of treating
..
W092/06~ PCT/US~l/077~6
2 ~ 9 '~
43
thrombosis, or ~or the purpose of treating von ``
Willebrand's diseas~. ;
Both the antithrombotic polypeptides and
antihemorrhagic polypeptides of this the second
embodiment of the inYention are based upon that amino
acid sequence domain which comprises approximately
residues 449 to 728 of the mature von Willebrand factor ~:
subunit and which, if ~ully glycosylated, would be : :
equivalent in weigh~ to the 52/48 kDa vWF subunit
: 10 fragment. In practice it is difficult to derive
therapeutically useful quantities o~ such polypeptides
~rom blood plasma. Di~ficulties include effective ~
separation of 116 kDa and 52/48 kDa fragments from .
; other components of tryptic digests and effective :.`
sterilization of blood-derived components from human ~ :
viruses such as hepatitis and AIDS. In addition,
methods reported in the literature to generate the
52/48 kDa monomer from the 116 kDa dimer have utilized
complete disulfide reduction with resultant loss of
tertiary structure. Certain important manipulations of
the 52/48 frag~ent, such as replacement of selective
cysteine residues to i~prove product utility and
stability, can only be accomplished in a practical
sense by recombinant DNA technology.
. .
However, the production by recombinant DNA- :
directed means of.therapeutic vWF polypeptides
analogous to the 52/48--tryptic fragment has ~et with
certain li~itations. It is desirable that the --
polypeptide not only be made by the host cells but that
it be correctly folded for maximum therapeutic utility.
It is believed that the principal factor which has to
date prevented the expression of the most
W092/06 ffl PCT~US91~07756
2a~2rj9
therapeutically active forms o~ the 52/48 ~ragment is
the incorrect ~olding o~ the molecule caused by the
linking up of cysteine residues to for~ incorrect
disulf ide contacts. In addition, such polypeptides
appear to exhibit hydrophobic properties or solubility
problems which would not be encountered if they were to
be contained within the entirety of the natural vWF
subunit, or were properly glycosylated.
Of critical importance, therefore, to the
synthesis of vWF-deriv2d therapeutic polypeptides is
the selection of conditions which minimize the
formation of improper disulfide contacts. Prior
expression of such polypeptides from recombinant DNA in
host bacterial cells has certain disadvantages. With
reference to the first embodiment, newly produced vWF
polypeptides are unable to escape from the host cells,
causing them to be accumulated within insoluble
` aggregates therein (inclusion bodies) where the
efféctive concentration of cysteine residues was
extremely high. Under these circumstances, disulfide
bonds not characteristic of the vWF molecule as it
naturally exists in the plasma are encouraged to, and
do, form either within the inclusion bodies or during
attempts to solubilize the polypeptide therefrom~
This embodiment provides a solution to these
difficulties by causing the vWF-derived polypeptides to
be expressed in mammalian cells using a DNA sequence
which encodes the polypeptide and which also encodes
for a signal peptide, the presence of which causes the
vWF polypeptide to be secreted from the host cells.
Incorrect disulfide bond formatlon is minimized by
:
- W0~2/06~
P~T/~S91/07756
. .
.: . .
2~9~2~
limiting the accumu}ation of high local concentra~ions
of the polypeptide as in inclusion bodies.
In addition, enzymes present in the host
eucaryotic cells, unlike bacteria, are able to
glycosylate (add carbohydrate chains to) the vWF-
1 derived polypeptides resulting in therapeutic molecules
-; which ~ore closely resemble domains of vWF molecules derived from human plasma.
The recombinant 116 kDa polypeptide generated
according to this embodiment, without mutation of any
of the cysteine codons therefor, is demonstrated to
represent a dimer of the subunit fragment consisting of
- residues 441-730 and possesses an amount of
glycosylation equivalent to that found in the
comparable reg}on of plasma-derived vWF.
There follows hereafter a description of the types
of therapeutic vWF-derived p~lypeptides which have or
may be generated according to the ef~ective recombinant
procedures of the second embodiment.
' .:
Recombinant vWF Polypeptides
o~ the Se~Qond ~m~odiment
Stated broadly, this second embodiment includes
any fragment of mature von Willebrand subunit
~ comprising that sequence of amino acids between
approximately residue 449 and approximately residue
728, or a subfragment thereof, from which at least one
of cysteine residues 459, 462 and 464 thereof is , ;
removed. Such removal reduces the tendency of the -
fragment to form undesired interchain disulfide bonds
;''
:
,;
W092/06~ PCT/US91/077~6
. 2~'12~
:
46
(and resultant dimers) with the result that therapeutic
utility as an antithrombotic is improved.
,
A further aspect o~ the embodiment encompasses a
glycosylated form of the above defined polypeptides.
In the design of antithrombotic polypeptides
derived from the aforementioned region of vWF, it is
preferred that cysteine residues be retained at
positions 509 and 695 so that the tertiary structure of
the GPIb(~) binding domain o~ the mature vWF subunit
fragment is preserved. `
~,
Also preferred in the practice of the embodiment
is a glycosylated polypeptide derived from the
aforementioned region of vWF in which cysteine residues
are retained at positions 509 and 695 and in which each
of cysteine residues 459, 462 and 464 i~ deleted or
replaced by residues of other amino acids.
.. ,
Additionally preferred in the praotice of the
,~ embodiment is a glycosylated polypeptide derived from
the aforementioned region of vWF in which cysteine
residues are retained at positions 509 and 695 and in
which any one of cysteine residues 459, 462 a~d 464 is ~ `
deleted or replaced by a single residue of another
amino acid.
Important factors involved in the de~ign of, or
further modification to, the preferred mutant ;~
polypeptides (antithrombotics) of the invention are;`
described hereafter. ;~
,`,.:
',.' :'
. :,,
. . :, .
W092/06~ PCT/U~9l/077~6
'''
```` - 2 ~
;:
47
Potential binding sites ~or collagens and
glycosaminoglycans ~or protaoglycans) exist in the 449-
` 728 tryptic fragment in the loop region between
cysteine residues 509 and 695. In the event that
binding at these sites by such macromolecule~ impairs
; the antithrombotic therapeutic utility of any of the
- recombinant polypeptides of the invention by, for
example, also providing bridging to collagen, the
polypeptide can be redesigned (for example, by
proteolysis, covalent labelling or mutagenesis) to
deleta or alter the loop region, or a subdomain
thereof.
. . ' .
The second embodi~ent is also concerned with the
` preparation of polypeptides which are useful in the
treatment of hemorrhagic disease. Stated broadly,
there is provided a process for the production by
- recombinant DNA-directed methods of a dimeric
, polypeptide substantially equivalent to the 116 kDa
,
tryptic fragment derived from circulating vWF. In
accordance with the process, the monomeric fragment
initially formed assumes a tertiary structure suitable
for dimerization, and dimerization thereo~ is ef~ected
- (see Example 7). In addition, the process conditions
are such that it is posaible to form a propexly
glycosylated dimeric polypeptide.
There follows hereafter a discussion of means by
which polypeptides of ~he second;embodiment can be
prepared and, in particular, by which such polypeptides
can be ef~ecti~ely secreted from host cells in proper
folded form and possessing preferably only those
disulfide bonds whose presence is consistent with
therapeutic utility.
:
W092/06~ PCT/USgl/077~
`` 2~25-9
48
Preparation of Mutant Polypeptides of the
Second Embodi~ent - Construction of
Suit~a~b~l~e~J~ y~ Expression Plasmids
, ,
Essential elements necessary for the practice of
the embodiment are: (A) a DNA sequence which encodes
the residue 449-728 domain of the mature vWF subunit,
or encodes a subdomain thereof; (B) an expression
plasmid or viral expression vector capable of directing
in a eucaryotic cell the expression therein of the
aforementioned residue 449-728 domain, or subdomain
thereof; and (C) a eucaryotic host cell in which said
expression may be effected.
;
The expression of the DNA sequence of the von
Willebrand factor subunit fragment is facilitated by -
placing a eucaryotic consensus translation initiation
sequence and a methionine initiation codon upstream
(5') to the residue 449-728 encoding DNA. The vWF DNA
sequence may be a cDNA sequence, or a genomic sequence
ZO such as, for example, may be produced by enzymatic
amplification from a genomic clone in a polymerase
chain reation. Expression of the residue 449-728 `-`
encoding sequence is further facilitated by placing
downstream there~rom a translatio~ termination codon `
such as ~GA. The vWF-polypeptide so expressed
typically remains within the host cells because of the
lack o~ attachment to the nascent vWF polypeptide of a
signal peptide. In such a situation, purification of
proteins expressed therein and the extraction of
pharmacologically useful ~uantities thereof are more
difficult to accomplish than if the polypeptide`were
secreted into the culture medium of the host cells.
Such Pxpression syste~s are nonetheless useful for
diagnostic assay purposes such as, for example, testing
W092/0~ PCT/US91/07756
'
~4~
4~
the proper ~unc~ion o~ platelet GPIb-IX receptor
complaxes in a patient.
- In the preferred practice of the invention in
; which the polypeptide is secreted from the host cell,
there is provided a vWF-encoding DNA sequence for
insertion into a suitable host cell in which there is
also inserted upstream from the residue 449-728
encoding sequence thereof a DNA sequence encoding the
: vWF signal peptide (see Example 7). Other vWF-encoding
DNA sequences correspo~ding to different regions of the
mature vNF subunit, or corresponding to the propeptide, ~;
or to combinations of any of such regions, may be
similarly expressed by similarly placing them
downstream from a vWF signal peptide sequence in a
suitable encoding DNA. When attached to the amino
terminal end of the residue 449-728 fragment of the vWF
- subunit, the signal peptide causes the fragment to be
- recognized by cellular structures as a polypeptide of
the kind to be processed for ulti~ate secretion from
the cell, with concomitant cleavage of the signal
polypeptide from the 449-728 fragment.
With respect to the construction of a eucaryotic
' expression system and the expression therein of the
tryptic 52/48 kDa domain of mature subunit vWF (the
residue 449-728 fragment~, it has been fou~d (see
Example 7) to be conveneint to manipulate a slightly
larger fragment represented by residues 441 (arginine)
to 730 (asparagine). Other similar fragments- :-
containing s~all regions of additional amino acids
(besides the 449-728 residue sequence), which
additional amino acids do not significantly affect the
function of said fragment, may also be expressed.
. .
~ W092/06~ PCT/US9l/07756
``` 2~9~2~9
- 50
Similarly, functional fragments may be expressed
from which, when compared to the 449-728 fragment,
several residues adjacent to the a~ino and carboxy
terminals ha~e been removed as long as the GPIb(~)
binding sequences are not compromised.
~, ~
It has also been found to be e~fective, with
respect to the construction of a suitable DNA séquence
for encoding and axpressing the residue 441-730
fra~ment, to cause to be inserted between the DNA
; 10 encoding the carboxy terminus of the signal peptide and
the codon for residue 441, codons for the first three
amino acids of the vWF propeptide (alanine-glutamic
acid-glycine) said codons being naturally found
directly downstream (3') to the signal sequence in the
. . .
human vWF gene. As is further elaborated below (see
Example 17), the presence of such a propeptide sequence
~a spacer) facilitates recognition hy signal peptidase ~;
of a proper cleavage site which process generates a
therapeutic vWF polypeptide of a proper size and
facilitates secretion from the host cell of the
therapeutic product. As elaborated below, this spacer
sequence should be of semipolar or polar character. ;
.:
In accordance with this invention, there is
provided a spacer sequance comprising between one and
up to the ~irst ten residues of the amino terminal
region of the vWF propeptide. It is within the scope
of the invention to utilize longer propeptide encoding
sequences with the understanding that the desired
tertiary structure of the 441-730 residue sequence is
not adversely affected.
':
~ W092/0S~ PCT/USgl/07756
. .
2 ~ a ~ ;
.` 51
:~ A wide variety of expression plasmids or viral
expression vectors are suitable for the expression of
the residue 441-730 mature vWF subunit fragment or
- - similar vWF fragments. One factor of importance in
selecting an expression system is the provision in the :
plasmid or vector of a high efficiency transcription
promoter which is directly adjacent to the cloned vWF
insert.
.~ .
Another factor of importance in the æelection of e.
` 10 an expression plasmid or viral expression vector is the
provision in the plasmid or vector o~ an antibiotic .~-
. resistance gene marker so that, for example, continuous
selection for stable transformant eucaryotic host cells ;
.- can be applied. :.-
Examples of plasmids suitable for use in the
practice of the invention include pCDM8, pCDM8~,
pcDNAl, pcDNA1~, pM~r~ and Rc/CMV. Preferred plasmids
include pCDM8~, pcDN~ , pMU~ and Rc/CMV.
Examples of viral expression vector systems
suitable for the practice of the invention include
those based upon retroviruses and those based upon
baculovirus Auto~3~ha californ~ca nuclear polyhedrosis .
vlrus.
Representative host cells comprising permanent
cell lines suitable for use in the practice of the
invention include CHO-K1 Chinese hamster ovary cells, ::
ATCC-CCL-61, COS-l cells, SV-40 transformed African ;:- .
Green monkey kidney, ATCC-CRL 1650; ATT 20 murine
pituitary cells; RIN-5F rat pancreatic ~ cells;
~ W092/06~ PCT/US91/077~6
9~259
52
cultuxed insect cells, Spod~etera ~uqi~erd~; or yeast
~Sarcomyces).
. .:
Example 7 contains a detailed explanation of ;
preferred procedures used to express and secrete the
441-730 sequence. In that Example, the fragment is -
secreted as a homodimer held together by one or more
~` disulfide bonds involving cysteine residues 459, 462
and 464. Expression of monomeric fragments useful as ;
antithrombotics necessitates control be made of the
disulfide bonding abilities of the monomers which is -
. achieved most preferably by mutagenesis procedures as -
described in the aforementioned ~irst Embodiment of the
Invention.
.. ..
,';
The specific proto~ol used to generate the mutant
, 15 vWF residue 441-730 fragment containing cysteine to
- glycine substitutions at each of residue positions 459,
462 and 464 is des~ribed in Example 9. ~he expression
plasmid used therein was designated pAD4/ 3C.
The specific protocol, adapted from that of
- 20 Example 9, and which was used to generate the three
mutant residue 441-730 fragments, each of which
contains a different single Cys ~ Gly mutation ~at
positions 459, 462 or 464) i9 described in Example 11.
The respective expression plasmids used therein were
designated pAD4/G459, pAD4/GU2 and pADlG~ (collectively
"the pAD4/~lC plasmids"). Similar procedures may be
used to produce mutant residue 441-730 fragments with ~ ~
Cys ~ Gly mutations at two of the three a~orementioned :
positions.
:,',:.
. "'''
' ~ '' '
. .; . . ,;, ... , ., ., . . ~, , ~:
W092/06~ PCT/US91/07756
53
Properties of the P~ly~eptides o~ the Seco~d Embodiment
:
Homodimeric 116 kDa vWF Frraqments
Example 7 below discloses the use of stably
transformed CHO-Kl cells to express the unmutagenized
residue 441-730 vWF subunit fragment~ As set forth in
Example 10 below,-the unmutagenized fragment was also
expressed in unstable COS-l trans~ormants.
SDS-polyacrylamide gel electrophoresis of secreted
- and immunoprecipitated proteins derived ~rom CHO-Kl
cells demonstrates that, under nonreducing conditions,
the dominant vWF-derived polypeptide, detected by
staining with coomassie blue, has an apparent molecular
weight of about 116,000 (Example 7). This result W2S . .
confirmed by characterizing the polypeptides secreted
by pAD4/WT transformed COS-l cells (Example 12) using
- autoradiographs of 35S-labelled proteins. Under
disulfide-reducing conditions (such as in the presence
of 100 mM dithiothreitol~ the 116 kDa fragment was no
longer detected and the vWF-derived material appears as
the expected 52/48 kDa mono~er. ~ ~
: - " ".
Th~ apparent molecular weight of the recombinant
115 kDa polyp~ptide wa~ cons~stent with the presence of
said polypeptide as a homodimer o~ the 441-730
~ragment. This homodimer carries al~o an amount of
glycosylation equivalent to that observed in the 116
kDa polypeptide~isolated by tryptic digestion of mature
plasma (circulating) vWF. It is thus demonstrated that
exprsssion cf the 441-730 fragment in the mammalian
cell cultures of this invention favors the formation of
the disulfide-dependent 116 kDa dimer thereof,
,. .. .. .
` WO9~06~ PCT/US91/07756
- ~ ,
2a342~9
54
mimicking the structure seen in plasma. ~hat the 116
kDa fragment so formed represents a correctly ~olded
polypeptide was evidenced by its reaction (under
nonreducing conditions) with conformation-dependent ~ -
NMC-4 antibody. This antibody recognizes a properly
assembled GPIb(~) binding site (Example 7). Reactivity
- with NMC-4 disappears under reducin~ conditions.
The dimeric 116 kDa fragment which is within the
scope of the present embodiment and which contains two
GPIb(~) binding sites supports ristoc~tin-induced
platelet aggregation by virtue of its bivalent
character. This was evidenced in Example 8 below.
Since it was demonstrated in the first embodiment
(using bacterially-expressed vWF fragments) that
cysteine residues 471 and 474 and also residues 509 and
695 are involved in intrachain bonds, the interchain
bonds which stabilize the 116 kDa homodimer must be
formed from one or more of residues 459, 462 and 464.
It is further noted that since residues 459, 462 and
464 are in such close proximity in any monomer, there
may be variation as to which particular residue or
residues contribute the interchain disulfide bond or
bonds which ~orm the interpoly~eptide contact in any
particular mature vWF dimer or multimer, or recombinant
116 kDa ~ragment. ~herapeutically-ac~ive populations
of dimerio ~olecules can be generated according to the
practice o~the invention utilizing any of the possible
combinations of interchain disulfide bonds.
It is noted that Lt is also possible that some
structural folding or disulfide bond formation
associated with thie generation of therapeutically
- .
` WOg2/06~ PCT/US91/07756
: ,.
2 0 ~ 9
. .
. ~ :
active con~ormations of the recombinant 116 kDa dimers
of the invention, or disulfide exchange therein, occurs
after the polypeptides are secreted from a host cell.
Since there are also contained within the 441-730
vWF fragment potential binding sites for collagens,
; proteoglycans and glycosaminoglycans, the 116 kDa
polypeptide is capable of performing a bridging
function between a platelet and the subendothelium.
This enables it to bP used in a method for inducing
platelet adhesion to surfaces such as, for example,
vascular subendothelium. There is also provided a
; method of inducing platelet activation and/or
aggregation which comprises contacting platelets with
an effective amount of the recombinant 116 kDa
polypeptide. Such a method is useful in the treatment '
of von Willebrand disease.
It is noted that as long as at least one of the ~
one or more potential interchain disulfide bonds ~ ;
stabilizing the~homodimer is left intact, and the amino
acid sequences comprising the two GPIb(~) binding sites
- are preserved, that other regions of one or more o~ the
two monomeric fragments thereo~ ~ould be deleted, if
necessary, to modi~y the therapeutic propertie~ of the
dimer. "
52/4B kDa monomeric vWF fraoments
An important aspect of the second embodiment of
the invention is the provision of glycosylated 52/48
kDa monomeric frag~ents of the vWF subunit having
substantial elements of normal tertiary structure.
Such fragments have a reduced tendency to form dimers
. - -: . .
~' ~
`~ WO9~/06 ~ PCT/US91~077~6
2 ~i 9
` .
.
56
which tend to be unsuitable for use as antithrombotici
therapeutics. ~
'. ' ~ : .
Following the above described procedures for site
directed mutagenesiis, residue 441-730 vWF ~ragments -~
were produced in which one or more of cysteine residues ~ -
459, 462 and 464 were replaced with glycine residues.
~xa~ples 9, 10 and 11 below explain the mutagenesis and
cell culture conditions necessary to create COS-1 cell
transformants expressing these mutant vWF polypeptides. -
Examples 12 to 14 of the in~ention describe the
: properties of the molecules so derived in comparison
with the recombinant 116 kDa polypeptide produced from
pAD4/WT transformed COS-1 cells.
The vWF-derived polypeptides expressed by pAD4/~3C
transformed COS-1 cells (containing the vWF 441-730 DNA
sequence, but with each of cysteine ciodons 459, 462 and
464 thereof replaced by single glycine codons) were
- compared with the polypeptides secreted by pAD4/WT
transformed COS-l cells. To performi the comparisons,
35S-methionine-supplemented culture medium from each
culture was subjected to immunopreicipitation using
equal amounts of NMC-4 and RG-46 anti-vWF antibodies
~Example 12) to collect the vWF-derived secreted
proteins. The immunoprecipitated vWF polypeptides were
then resolved by autoradiography of 35S-label on SDS
polyacrylamide gels. No 116 kDa polypeptide could be
detected in culture extracts of pAD4/~3C transformed
cells under-nonreducing conditions. Instead, under
either reducing or nonreducing conditions, a band
having an apparent molecular weight of 52 kDa was seen.
In contrast, the pAD4/WT trans~ormed COS-1 cells
WO g2/O~ P~/US91/07756
., .
203~2~i9
` 57 . .
; produce under nonraducing conditions, as expected, a
polypeptide o~ apparent molecular weight o~ 116 kDa.
.
The immunoprecipitation procedure was also ;
repeated using only conformation-dependent NMC-4
antibody (Example 13). The major vWF-derived component
isolated from the culture medium of pAD4/WT trans~ormed
cells again had an apparent molecular weight of 116 kDa
under nonreducing conditions and 52 kDa under reducing
conditions. A band of apparent 52 kDa molecular weight
was detected under nonreducing conditions on gels o~
pAD4/A3C derived polypeptide material. As described in
Example 13, reactivity with NMC-4 antibody is important
evidence that the 52 kDa fragment detected in pAD4/A3c
transformed cells possesses the tertiary structure of
the natural residue 441-730 domain.
The immunoprecipitation procedure was also used to
detect NMC-4 reactive vWF polypeptide produced by
pAD4/AlC transformed COS-l cells cultured under i~
; conditions similar to those for pAD4/WT and ~3C
~ransfor~ants in the presence of 35S methionine.
Immunoprecipitated proteins were run under reducing and
nonreducing conditions in SDS-polyacrylamide gels and
compared with vWF polypeptides produced by pAD4/WT and
pAD4/~3C transformants tExample 14).
~5 It was r~vealed that substitut1on of any one o~
cysteine residues 459, 462 or 464 by glyeine results
predominantly in a polypeptide having an apparent
molecular weight-of 52 kDa under nonredu~ing or
reducing conditions, the formation of the 116 kDa
species having been prevented.
. - ., - . - . . . ~ . .
- , -, : . .. :.
. - - . . ~ :, .
.. . ~. .. .
.. . - . , . ... ~ . ~ .
WO ~/06~ PC~/US91~07756
2~)9~2~9 ~,~,.,
58
The apparent molecular weight o~ 52 kDa ~r
recombinant polypeptides derived ~rom COS-l cells
transformed with either p~D4/A3C or pAD4/AlC plasmids
is consistent with said palypeptides being ~onomers of
the 441-730 fragment, while carrying also an a~ount of :~:
glycosylation equivalent to that seen in the 52 kDa .
polypeptide as isolated ~rom tryptic digestion and
reduction of mature plasma (circulating3 vnF.
:' ,
Unlike the dimeric polypeptides o~ apparent 116 ;:
kDa molecular weight, the monomeric 52 kDa polypeptides
produced by pAD4/~lC and pAD4/~3C plasmids are unlikely - :.:
to be capable of the bridging ~unction associated with
the dimer. Accordingly, there is provided a method of
preventing platelet activation and/or aggregation which
comprises contacting platelets with an effective amount
of a mutant recombinant 52/48 kDa polypeptide which
polypeptide shows at least a substantially reduced
tendency to~dimerize when compared with nonmutant (wild
type) recombinant 52/48 kDa polypeptides.
There is further provided a method of preventing : -
the adhesion of plate}ets to sur~aces which comprises
contacting platelets with an effective amount of a
mutant recombinant S2/48 kDa polypeptide which shows at
least a substantially reduced tendency to dimerize when
compared with nonmutant recombinant 52/48 kDa .1:
polypeptides.
Contained within the 441-730 vWF fragment are
potential binding sites for collagen (approximately
residues 542-622) and glycosaminoglycans and :-
proteoglycans (also within the residue 509-695 .
disulfide loop1, in addition to the GPIb~ binding
, :
.
.~ -.
., , : .. , , , .: . : - . . . , . .,, - ., .. , ........ :,: .. ~ ..
W~92/06~ PCT/US91/077S6
.
2~2~
59 ;
sites. It is probable becauæe o~ steric ¢onsiderations -`
that a single fra~ment comprising residues 441-730
- could not perform effectively as a bridging,
potentially thrombotic, molecule. It is noted,
however, that as long as the GPIb(~) binding domain of
the 52/48 kDa monomer (consisting of approximately the
primary sequence regions 474-488 and 694-708, and a
tertiary domain thereof contributed in part by the 509-
695 disulfide bond) iB preserved, other regions (such
as part of the heparin and collagen binding loop) of
the said 52/48 kDa monomeric fragment could be deleted
or altered, such as by proteolysis or by mutagenesis,
if necessary, to modify or preserve the antithrombotic
therapeutic properties thereof.
` 15 It is also possible that some structural folding
or disulfide bond formation associated with the
generation of therapeutically active confor~ations of
the recombinant~52/48 kDa monomers of the invention, or
disulfide exchange therein, occurs after the
polypeptides are secreted from a host cell. ~- ;
.~ .
Limitation of the Glycosylation of vWF-Derived
Polypeptidas to nhan~e ~herapeutic Activity
von Wil~ebrand factor and platelet glycoprotein
Ibt~) are glycoproteins, that is, proteins to which
carbohydrate molecules ~such as sugars) are attached.
In the case of von Willebrand factor, this natural
process of adding carbohydrate (referred to as
glycosylation) substantially increases the molecular
weight of the protein. For example, with respect to
the tryptic fragment of the mature vWF subunit which
consists of residues 449-728, the apparent molecular
.~_ ~ .. .. .. .. . .. . . ....... .. .. .
. .. . .. . . . .
- - . : . :. - - , . . . . - -
WO ~2/06999 PCr/USgl/07756 ;~' ,
3 4 2 ~ 9
weight rises ~rom about 38 kDa to 52 kDa in humans as a
result of said glycosylation.
.. Glycosylation of newly synthesized polypeptides is :
much more complex in eucaryotic cells (such as
ma~malian cells) than in bacterial cells.
Glycosylation has been found to be particularly co~mon
in protein species which sPrve as membrane recaptors, .: .
` such as GPIb~, and in proteins which interact
therewith (such as vWF).
By way of background, glycosylation iB typically
accomplished in mammalian cells in several stages
beginning soon after the nascent polypeptide appears on ~.
the ribosome and continuing as the protein is further ~-
processed for ultimate insertion into the cell
: 15 membrane, or for secretion from the cell. Since
glycosylation is so important to the function of many ::
glycoproteins (see Wagner, D.D. et al., J. Ce.11 Biol., ~ .
102, 1320-1324 (1986) concerning certain possible
~unctions with respect to vWF), the role of -:
glycosylation in the GPIb(~)- binding activity of the
residue 449-728 region of the mature von Willebrand
fac~or subunit was investigated. As demonstrated
herein the therapeutic activity of the vWF 116 kDa
dimer can be enhanced by restricting the glycosylation
thereof. This indicates that the activity of 52~48 kDa
monomers should also be similarly enhanced.
Any suitable means can be used to restrict the
glycosylation of the vWF 116 kDa dimers or of the 52/48
kDa monomers.
,.,~
W092/06~ PCT/US91/07756
2 ~ 5 9
61
By way o~ background, it is noted that
qlycosylation o~ the 52/48 tryptic ~ragment of
circulating mature von Willebrand factor subunit has
been determined to occur predominantly at residue
`i 5 positions 468 (asparagine); 500 and 723 ~serine); and
- 485, 492, 493, 705, 714 and 724 (threonine). Titani,
; K. et al., Biochemistry, 25, 3171-3184 (1986).
Glycosylation of asparagine is N-linked (from the side
~` chain amide group). Serine and threonine hydroxyl
groups present 0-linked glycosylation sites. The ~-
present invention encompasses modi~ication o~
glycosylation at both N- and 0-linked sites.
Tunicamycin, an antibiotic which may be isolated
from cultures of Streptomyces has been demonstrated to
inhibit the glycosylation of proteins in eucaryotic
cells. Duskin, D. et al., J. Biol. Chem., 257(6),
3105-3109 (1982). Speci~ically, tunicamycin inhibits
the synthesis of N-type glycosidic linkages ~at
asparagine N-linked sites). See Mahoney, N.C. et al.,
J. Chromatoq., 198, 506-510 tl980). Accordinglyt the
- treatment of eucaryotic cells with tunicamycin provides
for an effective system in which to modify
glycoproteins that are produced therein.
.
Following the procedure of Example 15, stable CH0-
Xl transformants containing pAD5/WT plasmids and
capable o~ secreting the recombinant 116 kDa vWF
~ragment (see Example 1) were cultured in the presence
of tunicaymcin. A~ter:about-36 hoursji the culture
medium was harvested and concentrated. The
concentrated culture~medium, in vhich the dominant vWF-
derived polypeptide species has an apparent molecular
weight of 116 kDa, was tested in ristocetin-induced
... . .. , . . " , , .............. . . , ...... ... . . ~ .
,~ ~ , .: .;. - .
- ..
W092/06~ PCT/US91/07756~
` : " `
` 209~2~
:` ' ,
62
platelet aggregation assays (see Example 9j and ,~
compared with culture,medium ~rom untreated cell
cultures (generating polypeptides with normal N-linked
~ glycosylation). It was demonstrated that the ' -
,~ 5 tunicamycin induced limitation on N-linked ' ,
glycosylation of the secreted 116 kDa vWF ~ragment ~ '
substantially increased its ability to support
ristocetin-induced platelet aggregation.
.
For the purpose of inhibiting N-linked ,,
glycosylation, it is preferred in the practice of this
invention to add to the culture medium of cells
expressing vWF-derived polypeptide a concentration of
tunicamycin between about 0.3 and about 1.5 ~g/ml.
Below about 0.3 ~g/ml, the action of the antibiotic
tends to result in a heterogeneous population of ' '
differentially cleaved polypeptides. This effect is', ~'
not expected to be significantly lessened by longer
exposure of the host cells to antibiotic-containing`: ~:
, medium since the nascent vWF polypeptides are likely',
,- 20 only to be processed by glycosylating enzymes for a '~
limited period of time after translation. Above
approximately 1.5 ~g/ml, there were signs of toxicity,~
with respect to CHO-Kl cells. It is beiieved that this','
was caused by inhibition of glycosylation of CHQ-K1 ''
proteins, such glycosylation being necessary for cell',
function and growth. Although the range of suitable','~
tunicamycin concentrations may be;different under
dif~erent cell culture conditions,:or with different~, '-
host cell lines, the ~bove guidelinea can be readily
used ~o ascertain with,respectito other cell lines
appropriate tunicamycin incubation conditions.
-
WO~/06g~9 PCT/US91/07756
2~2~
63
~he Role of Sialic Acid-containing Carbohydrate
Side Chains in the Binding o~ the 52/48 vWF
Fraqment to Platelets
one of the most important types of carbohydrate
S which is found on both N- and 0-linked carbohydrate
side chains of the 52/48 tryptic fragment is sialic
acid. Sialic acid is negatively charged and -
contributes to regions of net negative change on the
surface of vWF multimers and also of platelet GPIb~)
receptors. Sialic acid facilitates mutual repulsion of
vWF and GPIb(~) under non-injury conditions. In fact,
platelets and circulating vWF normally coexist in the
blood without any interaction occuring, although vWF
bound to the subendothelium, presumably as a result of
chemical or physical changes induced by injury, binds
to platelets.
The vWF-platelet GPIb(~) interaction can be
demonstrated in vitro in the presence of certain
mediators such as the positively charged glycopeptide
ristocetin, or following chemical manipulation of the
vWF molecule itself, as by removal of terminal
negatively charged sialic acid residues ~rom
carbohydrate side chains. ~eMarco, L. et al., J. Clin.
Invest., 68, 321-328 (1981). Slalic acid residues are
~ound in carbohydrate side chains which are attached ~o
serine and threonine sites ~0-linked) and also
asparagine (N-linked) sites in the resldue 449-728 vWF
~ragment. ~ ,
- ~
The ef~ect of tunic~mycin in enhancing the
therapeutic capability of the 116 kDa fragment results
in part from limiting the sialic acid content of the
- 116 kDa dimer. This effect should be equally
applicable to 52/48 kDa monomers. Accordingly, the
. W092/06~ PCT/USgl/b7756
, ~
....
'; 2~n~2~9
. 64
.,,
: treatment with tunicamycin of host cells containing
Qxpression plasmids which produce monomeric 52/4B kDa
vWF fragments (such as pAD4/~3C or pAD4/~lC, Examples 9
and 11) will cause to be expressed therefrom ~;
antithrombotic therapeutics with increased GPIb(~) :
binding activity. .
Accordingly this invention encompasses the process
of treating a eucaryotic host cell which contains a DNA :-
sequence encoding the 449-728 tryptic vWF fragment with . -
tunicamy~in for the purpose of limiting ~he
glycosylation of said fragment, or of dimers thereof.
This invention also encompasses additional ways to - .
restrict the glycosylation of vWF-derived polypeptides
- for the purpose of improving the therapeutic utility :
thereof.
(A) It is noted that there are numerous
enzymes which can be used to cleave
carbohydrate side chains ~including N-
or 0-linked) from glycoproteins.
Representative examples include (1) 0-
glycanase~, an endo-~-N-acetyl-
galactosaminidase, which cleaves O-
linked sugars whare there is a gal-~-
(1,3)gal NAc core disaccharide linked to
a serine or threonine residue; (2) N-
glycanase~, an N-glycosidase F, peptide-
~N-acetyl-~-glucosaminyl~asparagine
amidase, which hydrolizes asparagine-
linked oligosaccharides; and (3) gal~
1,4-GlcNAc-~-2,6-sialyl transferase,
- which can be used to modify sialic acid
sites, all from Genzyme Co., Boston, MA,
WOQ2/06~ PCT/US91/07756
~ :.
`; 2~9~2~9
or endo-H and endo-F from Sigma Chemica].
Co., St. Louic, M0.
(B) Example 16 describes the production by
site directed mutagenesis of mutant
: 5 polypeptides patterned upon a parent
: polypeptide which comprises the amino
acid sequence of that fragment of mature
von Willebrand faot~r which begins
approximately at residue ~49 (valine)
and ends approximately at residue 728
; (lysine). It is taught in ~xample lÇ
. that particular codons encoding serine,
threonine, and also asparagine residue
which are or are potentially sites of 0-
or N-linked glycosylation respectively
(for the parent polypeptide encoded by a
vWF cDNA) can be deleted or replaced
with codons for other amino acids
thereby enabling the expression in host
: 20 cells and secretion therefrom of a
polypeptide having less glycosylation
(including sialated carbohydrate~ than
the parent vW~ polypeptide.
As taught in ~xamples 7, 9 and 11, control over
whether the e~pressed polypeptide is dimeric or
monomeric is e~fected by mutation of one or more of
cy~teine codons 459, 462 and 464. ~onomeric
polypeptides so derived are useful antithrombotics
whereas the dimeric forms are useful in treating
hemorrhage in patients with von Willebrand disease... It
is noted that the same secondary and tertiary . `
structural factors previously described for selecting .
: suitable replacement amino acids for cysteine residues
. ..
: .
'~
W092/06~ PCT/US91tO7756
20'J ~'~ 59
`~ 66
may be applied to replace the serine, threonine and
~ asparagine xesidues which are glycosylation sites. In
; addition, and ~or the purpose of designing mutant vWF-
derived polypeptides, although serine, threonine, and
asparagine are considered suitable replacements for
most cysteine residues, the possibility must be
considered that cys - thr, cys - ser or cys ~ asn
substitutions will introduce into the vWF-deri~ed
polypeptide naw glycosylation sites resulting in ;
polypeptides with increased carbohydrate content.
It is also noted that mutant polypeptides derived -,
from the 449-728 region of the mature vWF subunit can
be designed to possess substantially increased
carbohydrate content by using site directed mu~agenesis
procedures to introduce additional serine, threonine
ans asparagine codons into a DNA within a host cell
capable of glycosylating the polypeptide and then
secreting it.
Use of the von Willebrand Factor Signal
Peptide to E~fect Secretion from ~ost ;
; Cells of~Non-vWF Derived PolypePtides
The present invention provides als~ a process for
producing from an encoding DNA se~uence biologically
active monomers and dimers corresponding approximately
to the residue 449-728 sequence of the mature von
Willebrand ~actor subunit, which polypeptides are
secreted from host cells. Of central importance to the
success of this process is the assembly of a VWF DNA
sequence to which is also attached a DNA sequence
encoding the vWF signal peptide. Recognition of the
signal sequence by cellular components enables the vWF
polypeptide to be secreted from the cell in-~tead of
accumulating therein as a substantially insoluble
; I ' ' '' ' ' . ' ' . ' ' '. ' '.' ' . ' . '' .. . '.' ' ' ' .. '. ~ ' '' ' ~ . .
; , .,' ' ' '. ' ' ' ' ' ' ' . ~ ~ '~ ' ' ' . ' " '. ' . ' ' "' ' . '. ' . ," " ,' ' ' ' ' . . '
W0~2/06~ PCT/US91iO77~6
`:
67
aggregation of polypeptides. Proteins trapped in
inclusion bodies are generally believed to demonstrate
improper folding and disulfide bonding. See Williams,
; D.C. et al., science, 215, 687 (19~2).
In order for the reoombinant polypeptide
representing vWF subunit residues 441 to 730 to be
secreted from a host cell, it is necessary that the
nascent polypeptide which combines the signal peptide
and matura vWF subunit sequence be recognised by the
endoplasmic reticulum and cellular components such as
translocation receptors and signal peptidase which are
necessary to the process of secretion. Proper
recognition of the carboxy terminal end of the signal
peptide by signal peptidase is generally required. ~or
' 15 the purpose of enhancing the secretion from host cells
ij of the recombinant 441-730 vWF fragment or other
i unrelated therapeutic polypeptides, there may also be
-; inserted between the DNA encoding the vWF signal
peptide and the DNA encoding the structural sequence of
2Q the therapeutic polypeptide a small spacer DNA
sequence.
. '' ~.
Preferred examples o~ spacer DNA include sequences
encoding from about one to about ten of the amino acid
residues which comprise the amino terminal sequence
reg~on of the vWF propeptide. Particularly preferred
as spacer cDNA sequences are those wh1 ch encode
,. NH2-Ala-Glu-Gly-CO2H, ~ '"
- NH2-Ala-Glu-Gly-Thr-CO2H, or
- NH2-Ala-Glu-Gly-~hr-Arg-CO2H, -
which represent the first 3, 4 and 5 amino acid
residues of the amino terminal region of the vWF
propeptide.
:'
..
, W092/06~ ~ PCT/US91/07756 , ','
.
` ~a~2~9 ,
~ 68
Example 17 teaches conditions under which such
combined constructs may be expressed in host cells. As
depicted in Example 17 of the invention, the vWF signal
peptide contains a substantially hydrophobic region (as - ,
is true of most signal peptides) whereas the amino
terminal region of the vWF propeptide is substantially
hydrophilic. - '-',
Proper recognition by signal peptidases of target
cleavage sites generally requires semipolar or polar ','`
regions adjacent to or in conjunction with the carboxy
terminal region of the signal peptide. von Heijne, G., ,
J. Mol. Biol., 184, 99-105 (1985).
:
The DNA sequence used in the practice of this
; invention to cause secretion of t~e 52/48 kDa domain of
the vWF subunit provides such a polar domain by ~ ,
connecting to the signal peptide a spacer derived from , ~ '
the vWF propeptide (Ala Glu-Gly) followed by the highly
polar Arg~ Arg~2 residues of the mature subunit
sequence.
This aspect of the invention is particularly
important with respect to the expression and secretion
of therapautic fragmants of polypeptides. Such ' ''
fragments do not include the amino terminal region of
the e~tire polypeptide. The amino terminus would
normally present a hydrophilic,domain which is
positioned directly adjacent,to the, carboxy terminus of
the signal peptide. In such cases, a semipolar or
polar spacer (such as ala-glu-gly of vWF) may be caused ,''~
to be inserted between the signal sequence and the
sequence for the therapeutic polypeptide fragment to
facilitate recognition as a proper signal peptidase
W092/06~ PCT/US91~07756
~ 4'~
69
cleavage site. Alternatively, and i~ the polypeptide
fragment's activity i9 unaf~ected, the exact residue
position which comprises the amino terminus of said
cloned therapeutic polypeptide ~ragment may be selected
so as to commence a region of hydrophilic residues
which will form a recognition sequence. The
substantially hydrophilic character of residue 441-450
region of the 52/48 kDa fragment indicates that the
fragment may be successfully expressed within and
secrated from eucaryotic cells without use of a spacer
between the signal peptide and the mature subunit
sequence.
; ' ~ ,,
The use of preferred species of spacer
polypeptides (such as the first 3, 4 or 5 residues of
the vWF propeptide) is advantageous in that it causes
to remain attached to the therapeutic polypeptide upon
secretion from the cell only a biologically
insignificant sequence of foreign amino acids unlikely
to afPect the function of the therapeutic polypeptide.
~ . : :. .:
i 20 The following information is provided to
: facilitate selection of semipolar and polar spacer
se~uences useful in the practice of the invention.
; - It is possible to predict the extent o~ relative
hydrophobic or hydrophilic character which a particular
peptide ~e~uence wilI exhibit when present within
larger polypeptides. One such model is the relative
hydrophobicity/hydrophilicity index as described by
Kyte, J. et al., J. Mol. Biol., 156, 105-132 (1982)~.
An overall index value is assigned based on individual
residue contributions and the position of the
particular amino acid residues within the peptide. The
';.-.:
' ': ' :.
_ . ~ i, ... ...... . .. . .. .. ... . .
wo ~2Jo~ Pcr/usgl/b7756.
2~9~2~9
.
maximum value of hydrophobicity described therein is
~4.5 (equivalent to isoleucine). The maximum value of
hydrophilicity described therein is -4.5 (equivalent to
arginine). In the practice of the present invention, a
` 5 spacer peptide is considered semipolar or polar if
according to the method of Kyte, J. et al., supra, it
possesses an overall index value of between
approximately 0 and approximately -4.5. It is noted
however that a very short, slightly hydrophobic spacer
may nonetheless prove functional i~ the adjacent ~ -
therapeutic polypeptide sequence is highly polar.
Representative index values for spacer peptides
useful in the practice of the invention are as follows.
Subscript numbers refer to residue positions within the
mature vWF subunit sequence which can be seen to alter
significantly the relative hydrophilicity of the
combined sequence region.
(A) Ala-Glu-Gly -0.7
(B) Ala-Glu-Gly-Thr -0.7 ~ -
(C~ Ala-Glu-Gly-Thr-Arg -1.46 `
(D) Ala-Glu-Gly-Arg~l-Arg~2 -2.22
tE) Ala-Glu-Gly-Arg~l to Lys~7 -1.16
~F) the first ten ~amino terminal) residues -1.45
o~ the vWF propeptide
- ,,
With respect to the exprassion of therapeutic
polypeptidas derived from von Willebrand factor or
other proteins in which recombinant DNA-directed
methods are used to create a host cell transformed with
an expression plasmid or viral expression vector
containing an appropriate DNA, it is generally accepted
that a variety of eucaryotic signal peptides are
suitable. In addition, amino acid sequence subsets of
, : . . - - . .
W092/06~ Pcr/us9l/b7756
'
2~9~9
71
signal peptides which supply ~he necessary hydrophobic
do~ain thereo~ ara usaful in the practice o~ the
invention.
Preferred as additional polypeptides which may be
successfully secreted from host cells ~y constructing a
DNA sequence encoding the target polypeptide and a vWF
signal peptide sequence are polypeptides comprising "A"
type sequence domains. Preferred as additional
polypeptides which may be successfully secreted from
host cells by constructing a DNA sequence encoding the
target polypeptide and a vWF signal peptide/propeptide
sequence are also polypeptides comprising "A" type
sequence domains.
.. '
"A" type domains have originated from gene
duplication of a common structural genetic element with .
tha result that they share substantial amino acid
sequence homology (greater than approximately 15 to
20~) with the regio~ of the mature vWF subunit between
approximately residues 500 and 700. Mancuso, D.J. et ~:;
alO, J. Biol. Chem., 264(33) 19514-19527 (1989).
Representative of such proteins are complement factor
3, co~plement component C2, cartilage matrix protein,
~I-collagen type VI, ~ subunits o~ leucocyte adhesion
receptors Mac-l, and LFA-l, VLA-1 and VLA-2. The 2,050
residue mature von Willebrand subunit itself contains -
two other "A" domains, A2 (approximately residues 710-
910) and A3 ~approximately residues 910-1110).
':''
Antibodies with ~erapeutic Activity
.
Antibodies, and particularly conformation
dependent antibodies, are powerful tools for analyzing
':
'
WO9~J06~ PCT/VS91/077~6
'' ~.
~9~
72
the structure and function of macromolecules. By
blocking macromolecular interactions, antibodies can
also have important therapeutic utility.
Accordingly, this invention includes within its
S scope an antibody which is specific for the vW~
subunit, or any polypeptide containing a subset thereof
which antibody is made by a process which involves
immunizing animals with a polypeptide patterned upon
th~ mature vWF subunit sequence between approximately
residue 441 and residue 730 thereof, and having less
-~ tendency than the polypeptide upon which it is
patterned to form interchain disulfide bonds owing to
- deletion or replacement, of one or more of cysteine
residues 4S9, 46Z or 464 of the pattern sequences.
Further diagnostic or therapeutically useful antibodies
can be generated against polypeptides so patternad upon -
, the above stated sequence region and in whic~ cysteine
residues 509 and~695 form a disulfide bond, thereby
- recreating important domains of tertiary structure. ;
Therapeutic comDositions
one or more of the polypeptides of the present
invention can be formulated into pharmaceutical
preparations ~or therapeutic, diagnostic, or other
uses. To prQpare them ~or intravenous administration,
the compositions are dissolved in water containing
physiologically compatible substances such as sodium
chloride (e.g. at 0.35-2.0 M), glycine, and the like
- and having a buffered pH compatible with phy~iologica
conditions, which water and physiologically compatible
substances comprise a pharmaceutically acceptable
carrier. ~,
~ WQg2/06~ PCT/US91/077~
'
2 j ~
.
73
With respect to the monomeric 52 kDa polypeptides
o~ the invention having at least a substantially
reduced tendency to dimerize, the a~ount to administer
for the prevention or inhibition of thro~bosis will
depend on the severity with which the patient is
subject to thrombosis, but can be determined readily
for any particular patient.
With respect to the recombinant 116 kDa
polypeptide of the invention, or other dimeric ~
polypeptide subfragments thereof, the amount to ~ -
administer for the treatment of von Willebrand disease
will depend on the severity with which the patient is
subject to hemorrhage, but can be determined readily
for any particular patient.
~.
Examples
," ~
The following Examples are representative of the :
practice of the invention.
.
I. Construction of vW~ Polypeptides
Suitable to Carry IIb-Type Mutat~ons ;
,
Example 1 - Expression of a ~utant cysteine-free
mature von Willebrand factor subunit
fragment having an amino terminus at
residue 441 (arginine) and a carboxy
terminus at residue 733_(valine) _ _
;
Preparation of a cDNA Clone fxom
pre-ero-von Willebrand Factor mRNA
..~
- A cDNA clone encoding the entire von Willebrand
factor gene (for the pre-propeptide) was provided by
- Dr. Dennis Lynch, Dana-Farber Cancer Institute, Boston,
wos2~06sss Pcr/usslib77s~,
2~425!~
.
.
74
MA and was prepared as describe,d in Lynch, D.C. et
al., Ce~l, 41, 49-56 ~1985). It had been deemed
probable that the size of vWF mRNA would likely exceed
- that of human 28S type rRNA. Accordingly, total RNA
from endothelial cells (the major source of plasma vWF)
was sedimented in sucrose gradients, with ~NA larger
than 28S being selected for construction of a cDNA
library.
:, ..
This enriched fraction was further purified using
- 10 two separate cycles of poly(u)-Saphadex~ chromatography
to select for RNA species (mRNA) having 3'
: polyadenylated ends. Lynch at al., supra, estimated
~! the prevalence of vWF mRNA in this fraction at about 1
in 500, which fraction was used to generate a cDNA
library of approximately 60,000 independent
, recombinants.
To generate the cDNA library, stand,ard techniques
were used. The mRNA population was primed using an
oligo (dT) primer, and then transcribed with a reverse
transcriptase. ThP RNA strands were then removed by
alkaline hydrolysis, leaving cDNA anticoding stran,ds
(equivalent to transcribed strandsj which were primed
by hairpin looping for second stran,d synthesis using
DNA polymerase I, The hairpin loop was removed wi~h S~
nuclease and rough ends were repaired with DNA
polymerase I.
GC tailing, Maniatis, T. et al., Molecular
lonin~, 2nd ed., v.l, p.5.56 ~1987), was then used to
anneal the cDNA into plasmid vector pBR322. Oligo(dC)
tails were added to the cDNA fragments with terminal
transferase and were annealed to oligo(dG) ~ailed
WO ~2~ 9 PCr/USgl/b775f;
r~
pB~322. The plasmids were transformed into ampicillin
sensitive ~.coli, strain ~101 for propagation.
Suitable clones were identified after screening with
32P-labelled cDNA prepared as reverse transcriptase
product of immunopuri~ied vWF polysomes. Positive
clones were subcloned into pSP64 (Promega Co., Madison,
. .
Primer Directed AmPlification of cDNA
- cDNA representing the full length pre-pro-vWF gene
from p5P64 was subjected to enzymatic amplification in
a polymerase chain reaction. Based upon the
established nucleotide sequence of the pre pro-vWF -
gene, Bonthron, D. et al. Nucl Acids Res., 14(17), -
7125-7127 (1986); Mancuso, D. et al., ~. of Biolo~ical
Chemistry, v.264(33~, 19514-19527 (1989)
oligonucleotides flanking the region of interest
(designated (1), SEQ ID N0: 2, and (2), SEQ ID N0: 3)
were prepared. All oligonucleotides used herein were
synthesized by the phosphoramidite method , Sinha, et
al., Tetrahedron Letters, 24, 5843 (1983), using a
model 380B automated system, Applied Biosystems, Foster
City, ~A.
Oligonucleotide (1) (SEQ ID N0: 2)
5'ACGA~C CGG CGT TT~ GCC ~CA GGA3' ;
EcoRI Arg~l A Gly4~
Oligonucleo~ide (2) (SEQ ID N0: 3~ ~ -
3'GG GAC CCC GGG TTC TCC TTG AGG TAC CAT TCGAAG5'
5'cc ctq ggg ccc aag agg aac tcc atg qta aqcttc3'
Leu~ - Me~32Val733HindIII
.
!
; ""'
W092r06~ PCT/US91/077~ _
:
~ ~ 9 ~
76
The oligonucleotide~ overlap the ends of the coding
region ~or that fragment of the mature vWF subunit
which can be produced by digestion with trypsin and
which begins with residue 449 (valine) and ends with
residue 728 (lysine). Oligonucleotide (1) corresponds
to coding strand DNA (analogous with mRNA) for amino
acid positions 441 to 446 and adds an EcoRI restriction
site 5' to the codon for amino acid 441.
Oligonucleotide (2~ corresponds to the non-coding
strand (transcribed strand) of mature vWF D~A for amino
acids positions 725-733 and adds a ~indIII restriction
site 3' to the codon for amino acid 733. The coding
strand complementary to (2) is shown in lower case
letters.
Using the above oligonucleotides with the full
length cDNA as template, a cDNA fragment corresponding
to mature vWF residues Nos. 441-733, and containing
EcoRI and Hind III linkers, was then synthesized in a ~
polymerase chain reaction following the method of ~ :
Saiki, R.K. et al. Science,-239, 487-491 (1988).
'
The procedure utilizes a segment of double-
stranded vWF cDNA, a subsegment of which is to be
amplified, and two single-stranded oligonucleotide
primers (in this case oligonucleotides ~1), (2)) which
flank the ends o~ the subsegment. The primer
oligonucleotides (in the presence of a DN~ polymerase
and deoxyribonucleotide triphosphates) were added in
~uch higher concentrations than the DNA to be~
amplified.
Specifically, PCR reactions were performed with a
DNA thermal cycler (Perkin Elmer Co., NorwalX, CT/Cetus
WOg2~06~ PCT~US91/07756
.~ . .
.
` 77
Corporation, ~erkeley, CA) using Taq polymerase
tThermus ag~aticus~. The reactions wera run in 100 ~e
volumes containing 1.0 ~g of pre-pro-vWF cDNA, 1.0 ~g
- of each synthetic oligonucleotide primer, and buffer
consisting of 50 mM KCl, 10 mM Tris HCl (pH 8.3), 1.5
mM MgCl2, 0.1% gelatin (BioRad Co., Richmond, CA) and -~
200 mM of each dNTP. PCR conditions were 35 cycles of
30 seconds at 94C, 30 seconds at 52C and 1 minute at
72OC. Amplified fragments were then purified and
isolated by electrophoresis through a 2~ agarose gel,
-- Maniatis et al., Molecular Cloning~ A Laboratory
Manual, 164-170, Cold Spring ~arbor Lab., Cold Spring
Harbor, NY (1982).
The vast majority of polynucleotides which
accumulate after numerous rounds of denaturation,
; oligonucleotide annealing, and synthesis, represent the
desired double-stranded cDNA subsegment suitable for
further amplification by cloning.
For some experiments, cDNA corresponding to the
! 20 mature vWF fragment beginning at amino acid sequence
position 441 and ending at poæition 733 was prepared
and amplified directly from platelet mRNA following the
procedure of Newman, P.J. et al. J. Clin. Invest., 82,
739-743 ~1988). Primer nucleotides No. 440 and 733
were utilized as be~ore with the resulting cDNA "~ ~;
containing EcoRI and HindIII linkers.
Insertion of cDNA into M13mpl8 Cloninq Vehicle ~
The resultant double stranded von Willebrand -
factor cDN~ corresponding to the amino acid sequence
from residue 441 to 733 was then inserted, using EcoRI
.,
W~2/~ P~T/US9l/~775~
2~9~59 :
and HindIII restriction enzyme~, into the double
stranded replicative form of bacteriophage M13mpl8
; which contains a multiple cloning site having
compatible EcoRI and HindIII sequences. ~ -
,
M13 series filamentous phages infect male (F
factor containing) E.coli strains. The infecting form
of the virus is represented by single stranded DNA, the
(~) strand, which is converted by host enzymes into a
double stranded circular form, con~aining also the
minus (~) strand, which double stranded structure is
referred to as the replicative form ~RF). The ability
to isolate a stable single stranded (*j form of the
virus is particularly useful to verify ths integrity of
any cloned sequences therein. See Messing, J., Meth.
Enzymolooy, 101, 20-78 (1983); Yanish-Perron, C. et
al., Gene, 33, 103-lO9 (1985).
Accordingly, the vWF cDNA insert was completely
sequenced using single-stranded dideoxy methodology
(Sanger, F. et al. Proc. Natl. Acad. Sci USA, 74, 5463-
5467 (19771~, utilizing the single-stranded (+~ form of
M13mpl8, to confirm that the vWF cDNA fragment
contained the correct coding seguence for mature vWF '~
subunit residues 44~-733. - ~;
Si~e-Di~ctedJM~t~g~ s to Replace Cysteine Residues
Cysteine residues 459, 462, 464, 471, 474, 509,
and 695, within the mature vWF fragment corresponding r ~''
to amino acids 441 to 733, were replaced with glycine
residues by substitution of glycine codons for cysteine ;~
codons in the corresponding cDNA. In order to
accomplish this, oligonucleotides (see Sequence Listing
WO9~/06~ PCr/US91/0775S .
: .:
2 ~ 3 4 ~6 r~.S ~3
,~
79 :
ID NOS: 5-8~ encompassing the region of each cysteine
codon of the vWF cDNA were prepared as non-coding
strand (transcribed strand) with the corresponding base :-
substitutions needed to substitute glycine for
; 5 cysteine. The oligonucleotides used were as follows~
Oligonucleotide (3) (SEQ ID NO: 4~
3 'GGA CTC GTG CCG GTC TAA CCG GTG CAA CTA CAA CAGS'
5'cct gag gac aqc cag att agc cac qqt gat gtt gtc3'
Pro Glu ~is Gly Gln Ile Gly His Gly Asp Val Val
459 462 4~4 .:
(simul~aneously replacing cy~eines 459, 462, 464).
"~.' .
: Oligonucleotide (4~ (SEQ ID NO: S) ~
3 ' TTG GAG TGG CCA CTT CGG CCG GTC CTC GGC5' - :
j 5~aac ctc acc aat gaa gcc qac cag gay ccg3' .~
., 15 Asn Leu Thr Gly Glu Ala Gly Gln Glu Pro .:.
471 474 .:
(simultaneously replacing cysteines 471, 474)
.. ..
Oligonucleotide (5) (SEQ ID NO: 6)
3'CTA AAG ATG CCG TCG TCC G5'
205'gat ttc tac qc agc agg c3' :~
Asp Phe Tyr Gly Ser Arg
- 509 ; :
~ (replacing cysteine 509) `:~.
.:~ : . ': ''
Oligonucleotide (6) (SEQ ID NO: 7)
3'TCG ATG GAG CCA CTG GAA CGG5'
5'agc tac ctc qat gac ctt gcc3'
Ser ~yr Leu Gly Asp Leu Ala
695
(replacing cysteine 695)
--- ,
Hybridizing oligonucleotides are shown in capital .
letters and are equivalent to the transcribed strand ~`'
(non-coding DNA). .The equivalent coding strand is
' '~.,.
. ::
:
W~g2~0~ PCT/US91/0775~
`: 209~2~
: ` ~o
shown in lower case letters with the oorresponding
amino acids shown by standard three letter designation. ;~
(for designations see Table 1)
As elaborated below, cysteines 459, 462 and 464
were replaced simultaneously using oligonucleotide ~3).
Cysteine residues 471 and 474 were then replaced
` simultaneously using oligonucleotide t4). Cysteine
residues 509 and 695 were then replaced individually
using oligonucleotides (5) and ~6) respectively.
'~:
The cysteine to glycine cDNA substitutions were
accomplished following the procedure of Kunkel, T.A.,
Proc. Natl. Acad. Sci. USA, 82,488-492 (1985) which
' procedure repeats a series of steps for each
oligonucleotide and takes advantage o~ conditions which
select against a uracil containing DNA template:
~A) M13mpl8 phage, containing wild type
vWF cDNA corresponding to amino
acid positions 441 to 733, is grown
in an E.coli CJ236 mutant
dut~ung~strain in a uracil rich
medium. Since this E.coli strain
is deficient in deoxyuridine
triphosphatase (dut-), an
intracellular pool of dUTP
accumulates which competes with
dTTP for incorporation into DNA.
(see Shlomai, J. et al. J. ~iol.
Chem:., 253(9), 330S-3312 ~1978).
Viral DNA synthesized under these
conditions includes several uracil
insertions per viral genome and is
stable only in an E.coli strain
c
WO 9~/D69g9 PCr/US91/07756
2 ~ ~ :
. .
81
which i5 incapable of removing . ;
uracil, such as (ung~) strains . .
whi~h lack uracil glycosylase.
Uracil-containing nucleotides are
: - 5 lethal in singIe stranded (+) ~ .
M13mpl8 DNA in ung~ strains due to ~ ~-
, the creation of abasic sites by : ~
. ~: uracil glycosylase. ; :.
(B) ~Single-stranded ~+) viral DNA is .: ;~
isolated from culture media in
: which phage were grown in E.col1 :
strain CJ236 dut~ung~. The single r
stranded ( ~ form of the virus
contains the specif ied vWF cDNA at `, ~ ~
its multiple cloning site which .,~ ~;
cDNA is equivalent to the
~ : : nontranscribed vWF DNA strand ~ : ~ :
:~ ~C)~ Oligonucleotide (3), which:contains
~ codon alterations necessary to
~ substitute gly~ines for cysteines ::
at positions 459, 4~62 and 464, is
then~ annealed in vitro~ to single
stranded :(~ phage: DNA. Gerlerally, : .~.
a wide range o~ oligonuclaotide
concentra~ion8 i8 suitable in this
procedure. 5ypically 40 ng o~
: oligonucleotide was annealed to
0.5-1.0 ~g N13mpl8 phage (+~ DNA.
- (D) AlI missing sequence o~ the ~ :
30 . ~ M13~pl8(-) strand is then completed
~ in vitro using T7 DNA polymerase ;.
; ~: ànd T4 ~A ligase in a dTTP rich .i :
environment thereby generating a .:
transcribable vWF cDNA sequence
-.',
: .:
''~
` W0~2/06~ PCT/US91/~7756 ~
`" 209~-2~
. .
corresponding to amino acid ;~
positions 441 to 733 of the mature
vWF subunit.
(E) The double stranded M13mpl8 phage,
S now containing a thymine normal (~)
strand and a (+) strand with
~; several uracil substitutions, is
trans~ormed into a wild type E.~oli
XL-1 Blue (Stratagene, La Jolla,
- CA) strain which contains normal
levels of uracil glycosylase and
deoxyuridine triphosphatase.
(F) Uracil glycosylase and other ;
enzymes present in the new host
initiate destruction of the uracil- ''~r
containing (') strand of the
double-strand phages, leading after ~".
replication in the host of ~ ;
remaining pha~e (~) strand DNA to
20 ~ the presence of stable~thymine-
~ normal double~strand d (RF) DNA
; ~ which reflects the glyoi~e
mutations inducéd by`the
oligonucleotide.
~- 25 (G~ Steps (A) to (F) of the above
process are then repeated for each
o~ oligonucleotides (4), ~5) and
~6) until each successive cysteine
codon of the vWF sequence within
the M13~pl8 phage has been replaced
by a glycine codon.
- . : , .
~ (H) Upon completion of mu~agenesis
,
procedures the sequence of the vWF
; ~ cDNA insert was reconfirmed using
.
' ' '
j
. -
`: :
W~92~06~ PCT/US91/07756
209~259
83
::?` the eingle stranded DN~ dideoxy
~ethod. (Sanger, F. et al., supra)
construction of_Expression Plasmids
The double stranded vWF cDNA fragment containing 7
site-specific cystei~e to glycine mutations is then
removed from M13mpl8 phage by treat~ent with EcoRI and
HindIII restriction endonucleases, after which the ends
of the fragment are modified with BamHI linkers
!~ (Roberts, R.J. et al. Nature, 265, 82-84 (1977)) for
.3 10 cloning into a high efficiency E.coli expression
`3 vector. The particular expression vector chosen is
plas~id pET-3A, developed by Rosenberg, A.H. et al.
Gene, v.56, 125-135, (1987) and which is a pBR322
derivative containing a high efficiency (~10) T7
- 15 transcription promoter directIy adjacent to the BamHI
- linker site. When containing the above-specified
fragment of-mutant vWF cDNA, the pET-3A vehicle is
refered to as "p7E" or p7E expression plasmid. ~ -
A second pET-3A-derlved expression plasmid
~designated p7D3 was constructed containing the ;~
identical vWF coding sequence cloned into the plasmid
in the opposite orientation. p7D should be unable to
express the vWF polypeptide fragment.
A third expression plas~id (pJD18) contains wild
type 52/48 tryptic vWF fragment cDNA encoding the vWF
amino acid sequence between residues~441 and 733, (with
7 cysteines) in the same pET-3A vector. ~
The p7E (or p7D and pJD18) expression plasmids -~`
were then cloned into an ampicillin sensitive E.coli ~
WOg2/OS~ PCT/US91/07756~
20~12~9
:` :
``~ 84
~ strain, B~21(DE3), Novagen Co., Madison WI, ac~ording
- to a well established protocol Hanahan, D., Mol.
Biol., 166, 557-580 (1983). Strain BL21(DE3) is
engineered to contain a gene for T7 RNA polymerase so
that the vWF insert can be transcri~ed with high
efficiency.
,
Expression of Mutant vWF PolypeEtides ~ -
:`
Three separate samples of E.coli strain BL21(DE3)
containing respectively p?E, p7D or pJD18 expression
plasmids were innoculated into 5-6 ml of 2X-YT growth
~ medium containing 200 ~g/ml of ampicillin, and grown
- overnight at 37C to create fully grown cultures. 2X-
YT growth medium contains, per liter of water, ~0 gm
Bacto-tryptone, lQ gm yeast extract and 5 gm NaCl.
` 15 Five ml of each overnight culture was then innoculated
into 500 ml of 2X-YT medium, again containing 200 ~g/ml
of ampicillin and grown for 2 hours at 37C with
shaking.
.
After the 2 hour incubation period, the cultures
were induced for protein expression by addition of
isopropyl-beta-d-thiogalactopyranoside to a
concentration of 5 mM. The incubation was then
continued for 3 hours at 37C.
A high level of expression of vWF polypeptide was
obtained with p7E and p~D18 resulting in the generation
of cytoplasmic granules or "inclusion bodies" which
contain high concentrations of vWF polypeptide in
essentially insoluble form. Solubilization of vWF
polypeptide was accomplished according to the following
procedure. As explained in Example 2, p7E and pJD18
- .. - ~.... .. .
~`~ W092/06~ ` PCTi/US91/077S6
~`` ~
!', !
` 85 2~9~259
extracts responded very differently to solubilization
procedures. See Maniatis, T. et al., Molecular
Clonin~, 2nd ed., vol. 3, Sec. 17.37, (1989) Cold -
, Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
~j; 5 for a general discussion of the properties of, and
-i successful manipulation ~trategies for, inclusion
bodies.
: - :
.-, . . .
. The cells were harvested by centrifugation at 4000
g for 15 minutes in a JA-14 rotor at 4C. The pelleted
cells were washed in 50 ml of ice cold bu~fer (0.1 N ..
NaCl, 10 mM Tris pH 9.0, 1 mM EDTA) and repelleted by
`~ centrifugation at 4000 g at 4C. `
:
The cell pellets from p7E, p7D and pJD18 cultures
were each redissolved in 5 ml of lysing buffer and kept
ice-cold for 30 minutes. The lysing buffer comprises a
solution of sucrose 25%(w/v), 1 mM
'! phenylmethylsulfonylfluoride (PMSF), 1 mM ethylene
diaminetetraacetic acid ~EDTA), 2 mg~ml lysozyme and 50
mM Tris hydrochloride, adjusted to pH 8Ø --
J ., ' ':
After the 30 minute incubation, aliquots of 1.0
Molar MgCl2 and MnCl2 were added to make the lysing
solution 10 mM in each cation. Sixty ~g o~ DNAseI
~Boehringer-Mannheim) was then added and the incubation
wa~ contlnued at room temperature rOr 30 minutes.
Twenty-ml of buffer No. 1 (0.2 M NaCl, 2 mM EDTA,
and 1% (w/v) 3-~(3-cholamidopropyl)-dimethylammonio~
propanesulfona~e (CHAPS), 1~ (wiV) Non-idet 40, and 20
mM Tris hydrochloride, pH 7.5) was then added to the
incubation mixture. The insoluble material was
` WOg2/06~ PCT~US9l/07756
~09~;i9
:-
8~
pelleted ~y centrif`ugation at 14,00Q g ~12,000 rpm in aJA-20 rotor) for 30 minutes at 4C.
- The relatively insoluble pelleted material derived
from each culture (which contains the desired
polypeptides except in the case of p7D~ was washed at
25C in 10 ml of buffer No. 2 (0.5~ (w/v) Triton X-lO0
surfactant, 2 mM EDTA, 0. 02 M Tris hydrochloride, pH
7.5) and vortexed extensively. The suspension was
centrifuged at 14,000 g for 30 minutes at 4C and the
supernatant was then discarded. The process o~
- resuspension of th:e pelleted material in buffer No. 2,
vortexing and centrifugation was repeated twice.
Each pellet was then washed in 5 ml of buffer No.
3 (O.02 M Tris hydrochloride, pH 7.5, and 2 mM EDTA) at
` 15 25C and vortexed extensively. The suspension was then
centrifuged at 4C for 30 minutes at 14,000 g after
which the supernatant was discarded leaving a pellet of
inclusion body derived material (the ~Iwet pellet") with
a clay-like consistency (With respect to the following
final steps, and in replacement therefor, see also
Example 20 which presents an additional improved
procedure).
The insoluble pellet was slowly redissolved in an
8 Molar urea solut~on held at room temperature ~or 2
hours, after which solubilization was con~inued
overnight at 4C. The urea-soluble material was
extensively dialyzed against a solution of 0.15-N NaCl
containing 20 mM Hepes (N-t2-hydroxyethyl]piperazine-N-
r2-ethanesulfonic acid]) ~pH 7.4) (!'Hepes-buffered
saline") at 4C.
- - . - .. . - . . . . . , , , , , . :
.': ' ' - , - .. ' . ' . . , , ',. ! ,, . ,. ". , ,, . .,, . ~... . , ,, ~ ,. . .. . .
` W~92/06~ PCT/U~91/07756 ;
`: 2 ~ ~ 4 ~
.~ .
~;` 87
The æolublized peptide extracts were assayed for
purity (Example 2), used in vWF binding inhibition
assays (Example 3) or subject to further purification.
Further purification steps should not be delayed and
the samples should remain cold.
,~ ., .
The cysteine-free vWF polypeptide (comprising
subunit positions 441 ~o 733) cons~itutes more than 75
of the material solubilized from the inclusion bodies
according to the above procedure. Further purification
of the cysteine-free mutant ~WF polypeptide was
accomplished by redialyzing the partially purified
- peptide extract against 6 M guanidine ~Cl, 50 mN
Tris HCl, pH 8.8 followed by dialysis against 6 M urea, .
25 mM Tris-HCl, 20 mM KCl, 0.1 mM EDTA, pH 8Ø The
; 15 extract was then subjected to high performance liquid
chromatography using Q-Sepharose0 Fast Flow (Phar~acia,
Uppsala, Sweden) for anion exchange. The column was
c preequilibrated with 6 M urea, 25 mM Tris HCl, 20 mM
~Cl, 0.1 mM EDTA p~ 8Ø Elution of the vWF ~:;
polypeptide utilized the same buffer except that the
concentration~of~Cl was raised to 250 mM. ~ol~peptide
samples used *or ~urther assays were redialyzed against
0.15 ~ NaCl, 20 mM Hepès, p~ 7.4. However, long term
storage was best achieved in ureà bu~fer (6 ~ urea, 25
mM Tris HCl, 20 mN RCl, 0.1 mM EDTA pH 8Ø Final p7E-
vW~ polypeptide percent amino acid compositions (by
acid hydrolysis) compared closely with values predicted
from published sequence information (Bonthron, D. et
al. and also Mancuso, D. et al. in Example 1, supra; -
see also Figure 1).
:'' ~ ~'
~, .. ., . . . . .. ... , .. ; .. .. .. . . ....... ~ . .. .......... . .. .
~ W09~/~6~ PCT/~S91/07756
"2 ~ 9
.
88
Example 2 - Characteri2ation o~ the cysteine-free
mutant von Willebrand factor fragment
roduced by expression plasmid p7E _
. .
Urea-solubilized and dialyzed polypeptides
~` 5 extracted from inclusion bodies of cultures containing
, expression plasmids p7E, p7D and pJD18 were analyzed
usiny polyacrylamide gel electrophoresis tPAGE) and
immunoblotting.
~ Characterization by SDS-
- 10 Polyacrylamide Gel Electrophoresis
'
The purity and nature of the expression plasmid
extracts, which had been urea-solubilized and then
extensively dialyzed, were first analyzed using the
denaturing sodium dodecylsulfate-polyacrylamide gel
- 15 electrophoresis procedure of Weber, K. et al. ~ _~iQ
- Chem., 244, 4406-4412 (1969), as modified by Laemli,
U.K. Nature, 227, 680-685 (1970) using an acrylamide
concentration of 10%. The resultant gels were stained
with Coomassie blue and compared.
;i' '
~' 20 The extract from expression plasmid p7E contains
as the major component, the mutant von Willebrand
factor polypeptide which migrates with an apparent
molecular weight of approximately 36,000 Daltons. The
polypeptide appears as a single band under both
reducing conditions (addition of between 10 and lO0 ~M
dithiothreitol "DTT" to the sample for 5 min at 100C
prior to running the gel in a buff~r also containing
the same DTT concentration) and nonreducing conditions, -
which result is consistent with the substitution of ;
glycine residues for all of the cysteine residues
therein. No vWF polypeptide could be extracted from
host cells containing p7D expression plasmids as
~.:
~ ~ .
.. ,,,,,.. ..... ; 1:
W092~ P~T/US91/0~756
.
5 ~
` 8
expected ~rom the opposite orientation of the vWF cDNA
~ insert.
., ,-,., ~ .:
The cysteine-containing vWF polypeptide expressed
by host cells containing pJD18 plasmids, and which
- 5 contains the wild type amino acid sequence of the 52J48
fragment, (herein represented by a residue 441 to 733
cloned fragment) behaved differently under redu~ing and
nonreducing conditions of electrophoresis. The wild- :
type sequence expressed ~rom pJD18 forms intermolecular
disulfide bridges resulting in large molecular weight
aggregates which are unable to enter the 10~ acrylamide
gels. After reduction (incubation with 100 mM DTT for
5 min at 100C), the vWF peptide migrates as a single
-, band with a molecular weight of approximately 38,000.
Characterization ~y Immunoblottin~
!
Polypeptides expressed from p7E, p7D and pJD18
were further characterized by immunoblotting ("Western
~! blotting"~ according to a standard procedure Burnett et
al., A. Anal. Biochem., 112, 195-203, ~1981) and as
recommended by reagent suppliers. Samples containing
approximately 10 ~ o~ protein fro~ the urea-
solubilized and dialyzed inclusion body extracts of
host cells (containing p7E, p7D and pJD18 plasmids)
were subjected to electrophoresis on 10~ polya~rylamide
gels, Laemli, U~K. Nature, 227, 680 ~85 (1~70), in the
preaence o~ 2% concentration of sodium dodecyl sulfate.
Thè proteins were blotted and im~obilized onto a
nitrocellulose sheét (Schleicher and Schuell, Keene,
NH) and the pattern was then visualized using
immunoreactivity.
:: '
W092~ PCT/US91/b7756
2~25~
~ The von Willebrand ~actor-specific monoclonal
;~ antibodie~ Ifrom mice) used to identi~y the
polypeptides were RG-46 (see Fugimura, Y. et al. J.
Biol._Chem., 261(1), 381-385 (1986), Fulcher, C.A. et
al. Proc. Natl. Acad. sci. USA, 79, 1648-1652 (1982) ),
and NMC-4 (Shima, M. et al. J. Nara Med. Assoc., 36,
662-669 (1985) ), both of which have epitopes within the-
expressed vWF polypeptide of this invention.
.
The secondary antibody t~ rabbit anti-mouse
- 10 IgG), labelled by the method of Fraker, P.J. et al.
Biochem._Biophys. Res. commun., 80, 849-857 tl978) ),
~, was incubated for 60 minutes at 25C on the
nitrocellulose sheet. After rinsing, the sheet was
developed by autoradiography.
..;
Peptide extracts from host cells containing p7E
and pJD18 sxpression plasmids display strong
immunoreactivity for RG-46 antibody and a weaker but
definite affinity for NMC-4 antibody. As expected,
~ peptide extracts from p7D plasmids show no
,`1 20 immunoreactivity with either RG-45 or NMC-4.
.
Example 3 - Inhibition of botrocetin-induced binding
o~ vWF to platelets by the cysteine-~ree
nutant ~olypep,tide ex~ressed by ~7E
It has been demonstrated that botrocetin,
extracted from the venom of Bothrops iararaca modulates
the in vitro binding of multimeric von Willebrand ~'`
factor to platelets (Read, et al~ Proc. Natl. Acad. - ~
Sci., 75,-4514-4518 ~1978)) and that botrocetin binds .'
to vWF within the region thereof containing amino acid
30 , sequence positions 441-733 (of the mature subunit), and ',,
- ~'`' ':
:~.
' .
': '. '
. ,. . , , ~ , ~, , , , , . ~ , ; .
W092/0~
PCT/US9l/D7756
`~- 2~425~
.. - :.':.
`:`` 91 ' '
`~ thus the GPIb binding domain. (Andrews, R~K. et al.,
Bioche~istry, 28, 8317-8326 (1989)~.
- The urea-solubilized and dialyzed polypeptide
extracts, obtained (according to the method of Example ~`
1) from cultures containing expression p~asmids p7E,
p7D and pJD18, were tested without further purification
for their ability to inhibit botrocetin-inducPd vWF `
binding to formalin-fixed platelets on a dose dependent
basis.
`'
Formalin-fixed platelets, prepared according to
the method of MacFarlane, D. et al., Thromb. Diath.
Haemorrh. 34, 306-308 (1975), were pre-incubated at
room temperature for 15 minutes with specified
dilutions of peptide extracts obtained from cultures :`
containing pJD18, p7D, and p7E plasmids. Botrocetin,
(Sigma, St. Louis, M0) to a final concentration of 0.4
~g/ml, and ~I-labelled multimeric vWF (isolated ~rom
human plasma cryoprécipitate according to the method of
Fulcher, C~A. et al. Proc. Natl. Acad. Sci. USA, 79,
1648-1652 (1~82), and labelled according to the method
o~ Fraker, P.J. et al. Bioche _ Biop~s. Res. Commun.,
80, g49-857 ~1978)) were then added to the incubation
mixture, and the a~ount of ~ vWF bound to the
platelets was deter~ined.
fflI-vWF binding to the platelets was re~eren~ed
against 100~ binding which was de~ined as the a~ount of
vWF bound in the absence of added peptide `~`
extracts.
. . ' '
Figure 2 demonstrates that peptide extracts from
expression plasmids p~D, and pJD18 (unr duced and
~2/f~ PCr~US~1/0i756
2 ~9 ~hS9
`~ 92
unalkylated) cannot competa with plasma-derived vWF ~or
platelet GPIb receptor binding sites. The peptide
~ extract ~rom plasmid p7E was e~fective in a dose
- dependent manner (using a range of 0 to 100 ~g
extract/ml) in inhibiting vWF binding. The
concentration o~ urea-solubilized polypeptide extract
(~g/ml) in the incubation mixture reflects the total
; protein concentration from the extract. Addition of
peptide extracts to the reaction mixture causes certain
` 10 nonspecific effects which raise apparent initial
binding to 110% of the value found in the absence of
the added peptide extracts. The l~-IvWF concentration
used was 2~g/ml.
.
Example_4 - Expression of a mutant vWF fragment of
reduced cysteine content containing a
disulfide-dependant conformation
Utilizing the procedures of Example 1, except as --
modified below, a mutant vWF polypeptide fragment
(corresponding to the mature vWF subunit sequenGe from
residue 441 to residue 733) was prepared in which the
cysteines at positions 459, 462, 464, 471 and 474 were
each replaced by a glycine residue. Cysteine residues
were retained at positions 509 and 695, and allowed to
form an intrachain disulfide bond.
Site directed mutagenesis was perform~d only with
oligonucleotides No. 459 and 471, thereby substituting
glycine codons only at positions 459, 462, 464, 471 and
474. Upon completion of mutagenesis procedures, the ~ "~
sequence o~ the mut~nt vWF c~NA was confirmQd using the
single-stranded dideoxy method. ~;~
,,,'~ ~,
, ,
W092~06~ PCT/US9~/07756
.
;`
;` 93
Th~ double-stranded ~orm of the vWF cDNA insert .
` (containing 5 cysteine to glycine mut~tions) was then
removed from M13mpl8 phage by treatment with EcoRI and
. HindIII restriction endonucleases, modified as in
i 5 Example 1 with
BamHI linkers, and cloned into pET-3A. The pET-3A
: vehicle so formed is referred to as "p5E" or p5E
'?' expression plasmid.
.
: The p5E expression plasmids ~ere then cloned into
. 10 ampicillin sensitive E.coli strain BL21(DE3), Novagen
~ Co., Madison, WI, according to the procedure of
.~. Hanahan, D., J. Mol. Biol., 166, 557-580 (1983). The
; p5E mutant polypeptide was e~pressed from cultures of : `
E.coli BL21(DE3) following the procedure of Example 1
except that solubilization of inclusion body pellet
material in the presence of 8 Moiar urea need not be
~ continued beyond the initial 2 hour period at room
~ temperature, at which point redissolved material had ..
reached a concentration of 200 ~g/ml. Oxidation of .::
cysteine residues 509 and 695 to form a disulfide bond ~-
was accomplished by dialysis overnight against Hepes-
. bu~fered saline. ~Formation of intrachain rath2r than
interchain disulfide bonds is favored by allowing thiol :.
i oxidation to proceed at a low protein concentration
such as 50-100 ~g./ml.
As in Example l ~ertaining to the p7E extracts, ;:
final purification of urea-solubilized inclusion body
preparations was accomplished by dialysis against the 6
M guanidine and 6 M urea buffers followed by anion
exchange chromatography.
:
. ~ .
.. . , ~., . ,.. . ~ .. . . , , , , , , : : , .
- :,. . - ,,i , . ': ;., , ~ ;. ' . ,; , . . -, ,,
.. . .
W~92/~6~ PCT/US91/07756
2~259
. .
94
Example 5 - Characterization of the mutant
vWF ~ragment produced by
exprassion ~lasmid p5E
.
The mutant von Willebrand factor polypeptides
produced by cultures containing expression plasmid p5E
were characterized utilizing the procedures of Example
- 2, and in particular compared with the vWF fragment
expressed by plasmid p7E.
Urea-solubilized and dialyzed polypeptides
extracted from inclusion bodies (according to the
procedure of Example 4) were compared with similar `
extracts from p7E plasmid cultures produced as in `
~xample 1.
., ` .
,~1 Characterization by SDS-
' 15 PolyacFylamide Gel Electrophoresis
J The denaturing sodium dodecylsulfate gel procedure
s of Example 2 was used to compare the p5E vWF fragments,
which can form disulfide bonds using cysteine residues
509 and 695, with the p7E ~ragment which has no . -, `
~ 20 cysteine residues. ~Electrophoresis was conducted using ~i`
'~ ~ 7.5 ~g of protein extract per lane on 10% acrylamide
gels under reducing (100 mM dithiothreitol) and non-
reducing conditions.
~' .
Under reducing condition6, and a~ter staining with
Coomassie blue, extracts ~rom p7E and p5E have
~identical el~ctrophoretic mobilities.
Electrophoresis under nonreducing conditlons,
however, demonstrates the effects of disulfide bonds
involving residues 509 and 695. A substantial amount
.
:
,,
; ~
W092/06~ PCT/US91/07756
`~ 95
`~ o~ the p5E extract appears as a high molecular weight
complex (resulting from interchain disulfide bonds)
~ which enters the gel only slightly. Densitometric
.r` scanning of the gels of initial preparations indicates
- 5 that approximately 25% of the p5E polypeptide material
`f found on nonreducing gels is represented by monomers of
'`,r' the 441-733 fragment having an apparent molecular
weight of approximately 38,000. The percent of monomer
present in p5E extracts can be improved significantly -
by conducting urea solubilization, dialysis, and thiol
oxidation at a more dilute protein concentration, such
as 50-lO0 ~g/ml, to favor intrachain rather than
,i interchain disulfide bond formation.
,. . . ...
, This p5E monomeric species has a slightly higher
mobility during electrophoresis under nonreducing
conditions than the comparable p7E product species
which has no cysteine residues. The mobilities of
these p5E and p7E monomeric 38 kDa species appear
identi~al under reducing conditions. The slightly
accelerated mobility of a polypeptide which retains ~i
tertiary structure in the presence of SDS under
nonreducinq conditions, when compared to the mobility
`' o~ the homologous polypeptide which the anionic
detergent converts completely into a negatively charged
fully rigid rod under said conditions, is generally
considered suggestive of the presence of an intrachain
d~sulfide bond.
Characterization_by_~mm.un~ob~lottinq
.~
The behavior of p5E ~nd p7E extracts were also
examined using immunological methods.
., - . : . . : - . -
` W~92/06~ PCT/US91/077~6
; :
: 2~9~2~9
96
As in Example 2, vWF-specific murine monoclonal
antibodies RG-46 and NMC-4 were used as probes. RG-46
has been demonstrated to recogni7e as its epitope a
linear sequence of amino acids, comprising residues 694
to 708, within the mature von Willebrand factor
subunit. The binding of this antibody to its
-~ determinant is essentially conformation independent.
Mohri, H. et al., J. Biol._Chem., 263(34), 17901-17904 -
(19~
NMC-4 however, has as its epitope the domain of ~`
the von Willebrand factor subunit which contains the
glycoprotein Ib binding site. Mapping of the epitope
has demonstrated that it is contained within two
3~ discontinuous domains ~comprising approximately mature
vWF subunit residues 474 to 488 and also approximately
residues 694 to 708) brought into disulfide-dependent `
, ~ association, Mohri, H. et al., supra, although it was
Y unknown whether the disulfide bond conferring this
tertiary conformation in the native vWF molecule was
intrachain or interchain. Id. at 17903.
-~ 7.5 ~g sample~ (of protein) were fir-~t run on 10% SDS polyacrylamide gels so that the antigenic behavior
of particular bands ~under reducing and nonreducing
conditions) could be compared with results obtained
above by Coomassie blue staining. Immunoblottin~ was
performed as in Example 2 to co~pare pSE and p7E
extracts.
Application of antibody to the nitrocellulose
sheets was usually accomplished with antibody solutions
prepared as follovs. Mioe were injected with B- . -
lymphocyte hybridomas producing NMC-4 or RG-46. ;~
'":: .'
'-'. `
' ~
-- , . . .
, .. .. '" , !, . , . ~,., ~ ., ' ` ' .; ~, i `.' ' ', . . ' ,.
`; W0~2J0~ PCT/US91~7756
~ 2~259
: 97
- Ascites ~luid from peritoneal tumors was collected and
;~ ` typically contained approximately 5 mg/ml of monoclonal
antibody. The ascites fluid was mixed (1 part per
i 1000) into blocking fluid (PBS containing 5% (w/v) non- ..
. 5 fat dry milk, carnation) to minimize non-specific
- background binding. The antibody-containing blocking
fluid was then applied to the nitrocellulose.
. .
Under nonreducing conditions, the single chain p5E
:. polypeptide fragment (representing the sequence from
. 10 residue 441 to residue 733) displayed an approximate
120 ~old increase in binding affinity for M~C-4
compared to the comparable cystein-free species
:~ isolated from p7E also representing the primary
i~ sequence from residue 441 to 733. After electro-
.~ 15 phoresis under reducing conditions (utilizing 100 mM
DTT), the single chain p5E species showed a remarkably
de~reased affinity for NMC-4, which was then very ~:
-~ similar to that of the cysteine-free p7E specie~ under
either reduced or nonreduced conditions. NMC-4 also
fails, under reducing or non-reducing conditions, to :-
recognize as an epitope disulfide-linked dimers from
the p5E extract. ;::
': ' " . .
The nitrocellulose filters used to produce
autoradiographs based on NMC-4 were rescreened with RG-
46 by subtracting the initial NNC-4 exposure response,
which was kept low through a combination of low.
antibody titer and short exposure ~i~e. The binding
of RG-46 to the p7E 36,000 kDa polypeptide on the
~ilters is t~e sa~e whether reducing or non-reducing
conditions were chosen, consis~ent with the replacement
of all cysteines by glycine in the expressed
polypeptide.
. ' ~ .
. _, . . , . , . ~ , . . . . .
, . : .- ,~ - . -: :
- - . -- , ~ - , :
W092/~ PCT/US91/077~6
```` 2~9~2~
.... .
, 98
~: .
A large molecular weight vWF antigen (reactive to
RG-46) is present in the p5E pol~peptide extract under
nonreducing conditions. ~hese p5E vWF aggregates ;
(reflecting interchain disulfide bonds) migrate under -~
reducing conditions in the same position as the p7E
-` polypeptide indicating disruption of their disulfide
contacts. However, the large p5E interchain disulfide
aggregates which are readily recognized under
~` nonreducing conditions by RG-46 ~re not recognized by
NMC-4 under either reducing or nonreducing conditions. -
It is thus demonstrated that the disulfide bond between
residu~s 509 and 695 in native multimeric vWF subunits
; represents an intrachain contact.
` Example 6 - Inhibition of the binding of
an anti-GPIb monoclonal antibody
by p5E polypeptide
t
Monoclonal antibody LJ-Ibl is known to compl tely
inhibit von Willebrand ~actor-platelet glycoprotein Ib
interaction. ~anda, M. et al., J. Biol Chem.,
261(27), 12579-12585 (19863. It reacts specifically
with the amino terminal 45 kDa domain of GPIb~ which
contair.s the vWF binding site. Vicente, V. et al., J~
` Bio~ _ em., 265, 274-280 (1990).
To assess the inhibitory actiYity of p5E extracts
on antibody binding, a concentration o~ LJ-Ibl was
~irst selected which would, in the absence of p5E
extracts, provide half-maximal binding.
. . .
.. . .. . .
LJ-Ibl was iodinated by the procedure of Fraker,
D.J. et al., Biochem. Biophys. Res. Commun., 80, 849-
857 (1978~ using Il~ from ~mersham, ~ lington Heights,
IL and Iodogen (Pierce Chemical Co., Rockford, IL).
WOg2/06~ PCT/US91/07756
2~259
. 99 .~, .
... .
~ Wash~d platelets were prepared by the albumin density
,~ gradient technique of Walsh, et al., Br. J. Eaematol., -
~! 36, 281-2~8 (1977), and used at a count of 1 x ~08/ml.
~ Half-maximal binding of antibody to pla~elets was
- 5 observed at 10 ~g/ml LJ-Ibl concentration, which
concentration was selected for p5E polypeptide
inhibition studies.
' ?, The p5E polypeptide extract was purified according
to the procedure of Example 4 including final
lo puri~ication of the urea-solubilized inclusion body
preparation by dialysis against 6.0 M guanidine and
urea solutions followed by Q-Sepharose0 chromatography.
To evaluate binding, platelets were incubated for
30 minutes at 22-25C with LJ-Ibl (10 ~g/ml) and
concentrations of purified p5E protein (.002-10.0
~Molar~ as indicated in Figure 3. Inhibition was
plotted in the presence of 2 ~g/ml botrocetin, Sigma
Chemical Co., St. Louis, MO, (Figure 3, dark circles)
and in the absence of botrocetin (open circles).
~ess than 5 percent of the I~I label bound to the
platelets was contributed by labelled substances other
than LJ-Ibl as determined by binding competiti~n
experiments in the presence o~ a 100 ~old excess of
unlabelled LJ-Ibl. BacXground labelling was subtracted
rrom data points. ~inding of I~I LJ-Ibl was expressed
as a percentage of a control assay lacking recombinant
polypeptides. Fifty percent inhibition of I~I LJ-Ibl ~-
binding to plàtelets was àchieved at 10 ~M of p5E
polypeptide without botrocetin whereas in the presence
of botrocetin (2 ~g/ml), 50% inhibition may be achieved
at less than 0.1 ~M. It is known that botrocetin
- . : : - . . .; : ~ -, , -
- - - . .:
~: :
~ W092/V6~ PCT/US91/07756
`- 2 ~ g
:`` ` ,,
~ ..
.~. 100
induces in circulating multisubunit von Willebrand
. ~actor and single subunits thereof a con~ormational
, change which enhances or permits binding to the GPIb~ -
receptorO This example demonstrates that the p5E ::
polypeptide ~containing an intrachain cysteine 509-695
bond) behaves very much like native circulating von
; Willebrand factor with respect to how its activity is
`. modulated by botrocetin. Structural similarity is
therefore indicated. .
Example 7 - Expression o~ homodimeric 116 kDa
von Willebrand factor fragment in
stable mammalian trans~ormants . :
, ~ .
This example is illustrative of conditions under .
-? which a DNA sequence encoding the mature vWF subunit
!`. 15 fragment having an amino terminus at residue 441
(arginine) and a carboxy terminus at residue 730
(asparagine) may be expressed, and of the secretion
.. from cultured ma~malian host cells of a glycosylated
homodimeric form of the 441-730 vWF fragment having
native tertiary structure.
~ . . .;
~xpression of the 116 XDa homodi~er is achisved
using a DNA construct in which the ~ollowing structural
~lements are assembled in a 5' to 3' dir~ction
~referring to tha codiny or ~ontran~cribed strand): ' ;
(A) a eucaryotic consensus translation initiation
sequ~nce, CCACC; and
(B) the initiating vWF methionine codon followed
by--the remaining 21 amino acids of the vW~
signal peptide; and .
~C) the coding sequence corresponding to the
first three amino acids from the amino
terminus region of the vWF propeptide; a~d
- ',
: `
W~9~/0~ PCT~U~91/07~6
9425~
.. . .
; `~ 1 o 1
, tD) the coding sequence ~or vWF amino a~id ~.
residues 441-730; and
-'~ (E) the "TGA" translation termination codon. :
. . ~ . . .
:: Preparation o~ a cDNA Clone from
.~ 5 Pre-pro-von Willebrand Factor mRNA ~-
.. . .
The cDNA clone, pvWF, encoding the entire pre-pro-
vWF gene was obtained from Dr. Dennis Lynch, Dana- .
Farber Cancer Institute, Boston, MA and was prepared as
described in Lynch, D.C. et al., Cell, 41, 49-56
(1985). Preparation of pvWF was described in Example
~, 1. ':
. 1 .
Primer Directed Am~lificatlon of cDNA - Phase I
i The cDNA representing the full length pre-pre-vWF :~.
- gene from pSP64 was subjected to enzymatic
amplification in a polymerase chain reaction according
J to the method:of Saiki, R.K~ et al. Science, 239, 487-
~ 491 (1988~, as described in Example 1.
,
:i -
-~ : For PCR amplification, the followin~
} oligonu~leotides were synthesizsd by the
phosphoramidite method, Sinha, e~ al., Tetrahedron
, 24, 5843 (1983), using a model 380B automated
system, Applied Biosystems,. Foster City, CA.
Oligonucleotide (7) - see SEQ ID N0: 3 ; .
5' - GTCGACGCCACCATGATTCCTGCCAGA - 3'
:SalI Met . .:
.: - .,
Oligonucleotide ~8) - see SEQ ID NO:. 9
5' - TCAGTTTCTAGATACAGCCC - 3'
XbaI
;~ -
`W092~V~gg~ PCT/US91/07756 :
``` 2~25~ :
102 -
:In designing the oligonucleotides used herein,
reference was made to the estab~ished nuclsotide
sequence of the pre pro-vWF gene, Bonthron, D. et al., ~
Nucl. Acids.Res., 14(17), 7125-7127 (1986); Mancuso, D. -
et al., J. Biol. Chem., 264(33), 19514-19527 (1989).
'~ ,:',
Oligonucleotide (7) was used to create a SalI
restriction site fused 5' to a eucaryotic con~ensus -:
-~ translation initiation sequence [CCACC) preceding the
initiating methionine codon of the vWF cDNA. See
Kozak, M. Cell, 44, 183-292 (1986).
, :
Oligonucleotide (8) hybridizes with the non-
transcribed strand (coding strand) of the vWF cDNA and ~.
overlaps with nucleotides which are approximately 360 ; .
base pairs from the initiating methionine in the pre-
pro-vWF cDNA, thus spanning (at residues 120 and 121
within the pre-pro-vWF cDNA sequence) an XbaI
restriction site.
The polymerase chain reaction therefore
synthesi~ed a cDNA fragment, containing (reading from
5' to 3' on the coding strand) a SalI site, a consensus
initiation sequence, an initiating methionine codon,
the codon sequence for the signal peptide, and
approximately, the first 100 codons of the propeptide,
followed by an XbaI site.
Ins~s~ _oDNA into Ml3mPl8 Cloninq Vehicle
..
The ampli~ied cDNA fragment was then inserted,
using SalI and XbaI restriction enzymes, into the :
double stranded replicative form of bacteriophage ~: .
M13mpl8 which contains a multipla cloning site having :
_ . .. . . . .
WOg2/06~ PCT/US91/07756
2 ~
.
103
compatible SalI and XbaI sequences. The resulting
clone is known as pADl. see ~rrand, J.R. et al. J.
Mol. Biol., 118, 127-135 (1978) and Zain, S.S. et al.
J. ~ol. Biol., 115, 249-255 (1977) for the properties
of SalI and XbaI restriction enzymes respectively. The
~-~ vWF cDNA insert was completely sequenced using single-
stranded dideoxy methodology (Sanger, F. et al. Proc.
Natl. Acad. Sci. USA, 74, 5463-5467 (1977)) to confirm
that the vWF cDNA fragment contained the correct vWF
coding sequence.
., .
~ Primer Directed Amplification of cDNA - Phase II
-~ cDNA corresponding to mature vWF amino acid
residues 441 to 732 was then amplified in a poiymerase
chain reaction. For amplification, the pvWF clone
encoding the entire pre-pro-vWF gene was used. ~`
Alternatively, a cDNA corresponding to mature subunit
j residues 441 to 732 may be prepared and then amplified
directly from platelet mRNA following the procedure of
Newman, P.J. et al. J. Clin. Invest! ~ 82, 739-743
tl988).
Suitable ~lanking oligonucleotides were
synthesized as follows:
Oligonuclaotide ~9) - see SEQ ID N0: 10
5! - AC GAA~TC CGG CGT TTT- GCC TCA GGA - 3'
EcoRI Arg~lArg~2
Oligonucleotide (10) - see SEQ ID N0: 11
5' - G AAGCTT AC CAT GGA ~ CCT C?T GGG - 3'
HindIII Met Ser Asn Arg Lys Pro
732 731 730 729 728 727
. - . ~ - . -
.,
... . - - .: . :
W092/~ ~ PCT/US91/07756
'~
~` ,
2~25~ .
"` 104
s 3' - ~QQ TTC cC TTG~AGG TAC CA ~~ÇGA~ G - 5 '
Pro Lys Arg Asn Ser Met HlndIII
727 728 729 73~ 731 732
(equivalent to anticoding strand)
The ends of the double stranded vWF cDNA fragment
product were then modified with BamHI linkers ~Roberts,
-~ R.J. et al. Nature, 265, 82-84 (1977)), digested with
BamHI, and inserted into the BamHI site of pADl, which
~ site is directly downstream(3'3 from the XbaI site.
'.`~'4.'10 The resultant plasmid was designated pAD2.
~ LOODOUt Mutagenesis of pAD2.
" .
Site-directed (loopout) mutagenesis was then
performed to synchronize the reading frames of the
first insert with the second insert simultaneously
deleting all propeptide codon sequence (except that
encoding the first 3 amino terminal residues of the
- propeptide), and the remaining bases between the XbaI
and BamHI sites.
As a loopout primer, the following oligonucleotide
was utilized which encodes the four carboxy-terminal ~ ~
amino acid residues of the signal peptide, the three ~`
amino-terminal residues of the propeptide, and amino
acid residues 441 to 446 o~ the mature vWF subunit
sequence. . , :~
Oligonucleotide (11) - see SEQ ID NO: 12
5' - GGGACCCTTTGTGCAGAAGGACGGCGTTTTGCCTCA~ 3' ..
Arg~l Gly46 ~;
The loopout of~undesired nucleotide sequence was
accomplished following the procedure of Kunkel, T.A., ;: :
Proc._Natl. Acad. Sci. USA, 82, 488-492 (1985). This
procedure involves the per~ormance of a series of steps
,~
-','.,' ;' '
, ..
W~92/0~ PCT/U~9~/07756
` 2~9~2~9 ~ ~
105
to take advantage of conditions which select against a
` uracil containing DNA template: -
(A~ M13mpl8 phaga (containing cDNA corresponding
to the consensus translation initiation
, 5 seguence, the signal peptide, approximately
the first 121 amino acids of the propeptide,
residual intervening M13mpl8 polylinker
~ . se~uence, and codons corresponding to mature
;1 subunit sequence residues 441 to 732) is
grown in an E.coli CJ236 mutant dut~ung~
strain in a uridine rich ~edium. Since this
; E.coli strain is deficient in deoxyuridine
triphosphatase (dut-), an intracellular pool
of dUTP accumulates which competes with dTTP
for incorporation into DNA. (see Shlomai, J.
et al. J. Biol Chem., 253(9), 3305-3312
(1978~.~ Viral DNA synthesized under these
conditions includes several uracil insertions ~-
- per viral genome and is stable only in an ~ .
~ ggli strain which is incapable of removing
uracil:,: such as ~ung~) strains which lack
uracil glycosylase. Uracil-containing ~ ;~
nucleotides are lethal in single stranded (+j
M13mpl8~DNA in ung+ strains due to the
creation o~ abasic sites by uracil
glycosylase.
~B) Single-stranded (~) viral DN~ is:isolated
~rom culture media in which phage were grown
in: E.ooli strain. CJ236 dut~ung~. The single
.. stranded (~) form of the virus contains the
specified vWF cDNA at its multipla cloning
site. This cDNA is equivalent to the ~ -
transcribed vWF cDNA strand.
: WOD2/06~
PCTJUS91/07756
;``:`` 2~2~9
.
106
~; (C) Oligonucleotide (11) is then annealed ln ....
. vitro to single stranded t~) phage DNA, r , .
thereby looping out the undesired sequence. :.
. Generally, a wide range o~ oligonucleotide
concentrations is suitable in this procedure.
, Typically 40 ng of oligonurleotide was
annealed to 0.5-1.0 ~g ~13mpl8 phage (+) DNA.:
i . .,:
i (D) All missing sequence o~ the M13mpl8(~) strand
is then completed in vitro using ~7 DNA
polymerase and T4 DNA ligase in an .
- environment containing dTTP, dGTP, dATP and rC~
dCTP, thereby generating a chimeric vWF cDN~
sequence without the undesired intermediate
sequence.
. . . .
tE) The double stranded M13mpl8 phage, now
.. containing a thymine normal (~) strand and a
t+) strand with several uracil substitutions,
is transformed into a wild type E.coli XL-l
-~ Blue (Stratagene, La Jolla,~CA) strain which -. -
contains normal ievels of uracil glycosylase ~ -
and deoxyuridine triphosphatase.
.
F~ Uracll glycosylase and other enzymes present : -
in the new host initlate dastruction o~ the ::
uracil-containing (~) strand of the double
strand~d phages, leading after replication in ~:
the host of~remaining phage (~) strand DNA to ~ .
the presence of stable thymine-normal dou.ble
stranded (RF) D~A-~hich reflects the desired
deletion. Upon completion of mutagenesis
procedures, the sequence of the vWF cDNA
insert was confirmed using the single ; ~ ;
.
',
w~ s~/~sg
PCT/US91/07756
. 107
s~randad ~A dideoxy method. (Sanger, F. e~
al., supra).
. . .
`~ A second mutagenesis procedure, ~ollowing steps
(A) to (F) above, was performed to add to the cDNA
insert a translation termination codon (T~A), and an
Xbal restriction site (TCTAGA). The oligonucleotide, ~-
-~ again synthesized by the phosphoramadite method and
, containing also sequence homology at its 3' end with
the ~13mpl8 vehicle sequence, was as follows. The stop
.~ 10 codon was added after residue 730.
Oligonucleotide (12) - see SEQ ID N0: 13
5'- GGGCCCAA~`AGG`AAC-TGA-TCTAGA-AAGCTTGGCACTGGC -3'
Argn~sn~0 XbaI
~ : .
. The f inal M13mpl8 recombinant containing the ~ :
' 15 desirad construct as a SalI - XbaI ins~rt was
designated pAD3-1. In addition to the XbaI site
created 3' to the termination codon, an XbaI site
exists in the polylinker region of M13mpl8 directly 5 '
to the SalI site. The vWF insert was again sequenced
by the dideoxy method to verify organization and
integrity of the components.
Cloning of the SalI XbaI Fragm~nt of
~AD3-J~to ~he 1~ Ve tor ,e
~he SalI-XbaI fragment was th~n removed from pAD3-
1 (as contained within the XbaI~XbaI fragment) and
ins`erted into p~iuescript II KS(-j vector (Stratagene,
La Jolla, CA) which had been previousiy digested with.
XbaI. pBluescript II KS(-) contains an XhoI
restriction site which is 5 ' to the XbaI insert and a
NotI site which is directly 3' to the XbaI insert. A
.. . . ..... .
WO~ 6~ PCT/US~l/07756
2 ~ 9`~
?~ 108
resultant plas~id selected aæ having the proper insert
orientation was designated pA~3-2.
Alternatively, the SalI-XbaI ~ragment itself may
-i be removed from pAD3-1 and inserted into pBluescript II
5 RS(-~ vector which would have been digested previously
with SalI and XbaI restriction enzymes. The resultant
plasmid, a form of pAD3-2, would also contain an XhoI ~ -
restriction site which is directly 5~ to the SalI site,
and a NotI site which is directly 3' to the XbaI site.
Such a construct (see below) is also suitable for !,,
insartion into pCDM8~ vectors. ~
-- . .
Construction of Plasmids for
; Intearation into Mammalian Cells
"
A selection procedure, based on aminoglycosidic
~ 15 antibiotic resistance, was then employed to select
- continuously for transformants which retained the vWF
expression plasmid.
: .
pCDM8 vector~(developed by B. Seed et al. Nature~
329, 840-842 ~1987) and available from Invitrogen, San
Diego, CA) was~modified by Dr. Timothy O'Toole, Scripps
Clinic and Research Foundation, La Jolla, CA to include
a neomycin resistance gene (phosphotransferase II3 that
was cloned into the BamHI restriction site of pCDM8 as
a part oP a 2000 base pair BamHI fragment. The site of
t~e BamHI insert is indicated by an arrow in Figure 4.
The protein produced by the neoy cin(neo) gen~ also
confers resistance against ot~er~aminoglycoside
antibiotics such as~Geneticin0 G418 sulfate ~Gibco/Life
Technologies, Inc., Gaithersburg, MD). The neo gene is
provided by the Tn5 transposable element and is wideIy
distributed in procaryots. Lewin, J., Genes, 3rd ed.,
~ W092/06~ P~T/US91/~7756
,
```; ` ~9~2~ `
'` 109
- p.596, Wiley ~ Sons (1987). The final construct places
the neo gene under the control o~ an SV40 early
promoter. -
~' Several other ~uitable expression vectors
containing neomycin resistance markers are commercially
available: pcDNA 1~ (Invitrogen, San Diego, CA~
Rc/CNV (Invitrogen, San Diego, CA) and p~r~
~; (Clontech, Palo Alto, CA). If necessary, ~he vWF
fragment may be differently restricted or modified for
expression capability in these other expression
plasmids.
.
The XhoI-NotI fragment o~ pAD3-2 was therefore
inserted into pCDM8~ which had been r~stricted with
XhoI and NotI. Ampicillin sensitive E.coli strain XS-
127 cells ~Invitrogen, San Diego, CA) were trans~ormed
with the resultant ligated DNA mixture following the
method of Hanahan, D., J. Mol. Biol., 166, 557-580
(1983).
Plas~ids from resultant colonies were
characterized by restriction mapping and DNA ~equencing
to identify colonies which contained the intended
insert. One such appropriate plas~id ~d~signated
pAD5/W~) was maintained in E,~o~1 strain XS-127, and
was selectQd ~or mammalian cell transformation
proceduras.
; .,
Prior to use in trans~orming mammalian cells,
: supercoile~ plasmids-(pAD5/~T) were recovered ~rom host
E.coli by an alkaline cell lysis procedure, Birnboim,
H.C. and Doly, J., Nucleic Acids Research, 7,1513
~1979), followed by purification by CsCljethidium
WO92~h~ PCT/US91/07756
20~ 9 ~ ~
` lI0
bromide equilibrium centri~ugation according to
Maniatis, T. et al., Molecular_Clo~ing, 2nd ed~, p.
1.42, Cold Spring Harbor Laboratory Press (1987). -
:
Transformation o~ Chinese Hamster Ovary Cells
pAD5/WT was introduced into C~O-K1 Chinese hamster
ovary cells (ATCC-CCL-61) by a standard calcium
phosphate-mediated trans~ection procedure. Chen, C. et
al. Mol._Cell. Biol., 7(8), 2745-2752 (1987).
CHO-K1 cells were grown at 37C in Dulbecco~s
modified Eagle's medium (DMEM) (Gibco/Li~e
Technologies, Inc., Gaithersburg, MD) supplemented with
- 10% heat-inactivated fetal calf serum (FCS), 0.5 mM o~ -
each nonessential amino acid (from NEAA supplement,
Whittaker, Walkersville, MD) and 2 mM L-glutamine under -
a 5% C2 atmosphere, and then subcultured 24 hours
prior to transformation at a density of 1.5 x 105 cells
per 60 mm tLssue culture dish (approximately 25% of
confluence). C~O-Kl cells have a doubling time in
DMEM/10%FCS of approximately 16 hours undsr these
conditions.
' ~
To accomplish transformation, pAD5/WT plas~ids
were recovered ~rom cultures of E.Coli strain XS-127,
according to tha method of Birnboim, H.C. and Doly, J.,
Nup~eic Aclds Research, 7, 1513 (1979). Ten ~g o~
plasmids were applied to the cells of each 60 mm dish
in a calcium-phosphate solution according to the method
of Chen et al., supra. After inoculation with plasmid,
the cells were maintained in DMEN/~0% FCS for 8 hours
at 37C in a 5% C02 atmosphere.
' .
~` ~
~ W092/06~ PCT/U~91/07756
~` .2~.2~.9
., .
.
, 111
The growth medium was then replaced with a
solution o~ phosphate-bu~fered salina, 137 mM NaCl, 2.7
mM KCl, 4.3 ~M Na2HP04 7H2O/l.4 mM KH2P04, pH 7.4,
hereinafter "P~S", containing also 10% (v/v) glycerol.
The cultures were then maintained in glycerol-PBS for 2
minutes to increase the efficiency of transfor~ation
- (see Ausukel, et al., eds. current Protocols in
Molecular Biology, p.9.1.3, Wiley & Sons tl987). After
2 minutes the glycerol-PBS solution was replaced with
DMEM/10~ FCS.
.
After approximately 24 hours of growth at 37C in
a 5% C02 atmosphere, the cells were trypsinized as
follows. Growth medium for each dish was replaced by 3
ml of 0.25% trypsin in PBS. Trypsinization was
conducted for 3 minutes. The trypsin-containing medium
was removed and the dishes were then placed in the
incubator for a further 15 minutes after which the
cells~were resuspended in DMEM containing 10% fetal
calf serum. The cells from each dish were then split
20 fold, and pl ed at a density of 3 x 104 cells/60 mm
dish (approximately 5~ of confluence).
Production of stable transforman~s, which have
integrated the plasmid DNA, was then accomplished by
adding Geneticinæ G418 sul~ate to the 60 mm dishes to a
concantration o~ 0.8 ~g/ml. Growth was continued for
10-14 days at 37C in a 5% CO2 atmosphere. Surviving
independent colonies were trans~erred to }2- well
plates using cloning rings and then grown for another ~-
seven days in DME~ FCS supplemented with 0.8 mg/m}
of Geneticin~. Under these conditions, 3 to 7 -
surviving colonies per plate were apparent after 10-14
days. Approximately lOQ stable transformants can be
~:
~ W~92/06 2a~ P~T/US91/0775~
'`` :
1~2
isolated from each original 60 mM dish originally
containing approximately ' - :
5 x 105 cells at a plate density of 50-70~ of
confluence.
. :. .
Fifty to seventy percent of G418-resistant cell ;;
lines produce the 441-730 mature vWF subunit fragment.
The specific geometry of integration o~ each clone
presumably prevents expression in all cases. Stable
transformants were then cultured and maintained at all
; 10 times in medium containing Geneticin~ G418 sulfate (.8 ~ -
mg/ml) to apply continuous selection.
't ' ~
Colonies expressing the recombinant 441-730 vWF
polypeptide were detected by dot-blot analysis on
nitrocellulose after lysis in disruption buffer (see
Cullen, Methods i __~1zy~oloqy, 152, 684-704 (1987))
7 comprising 10 m~ Tris HCl, pH 7.8, 150 mM NaCl, 5 mM
EDTA, 10 mM benzamidine, 1 mM PMSF, 1~ (w/v) Non-idet
40 (an octylphenol-ethylene oxide condensate containing
an average of 9 moles of ethylene oxide/mole phenol),
Sigma, St. Louis, M0.
.
RG-46 (see Fugimura, Y. at al. J. Biol. Chem~,
261(1), 381-385 ~1986) and Fulcher, C.A. et al. Proc.
NatL~cad. Sci. USA, 79, 1648-1652 (~982)) was used as
the primary antibody. ~he secondary antibody (~
rabbit anti-mouse IgG) which had been labelled by the
method of Fraker, P.J. et al. Biochem. Biophys. Res.
Comm~n., 80, 849-857 (1978) was incubated for 60
minutes at 25C on the nitrocellulose sheet. After
rinsing, the nitrocellulose was developed by
autoradiography to identify those colonies expressing
the vWF fragment.
. ~'
' . .
- . - . : . - ': . - . ', , . : . ': :. I . - - . :~ .
W092/06~ PCT~US91/~77S6
9~2~9
:``
113
Secretion Qf the von Wi~lebrand Factor Fraqment
.'
Secretion o~ the 441-730 mature vWF subunit
fragment into the culture medium by CH0-R1 cells was
confirmed by immunoprecipitation and immunoaffinity
chromatography of culture medium.
Confluent transformed CH0-K1 cells were rinsed
- three times with PBS to remove bo~ine vWF and then
incubated in DMEM without FCS for 16 hours at 37OC in a
5% C02 atmosphere. To a 5 ml volume of the cultur~
medium was added a 1/10 volume (0.5 ml) of lOx
immunoprecipitation buffer (lOxIPB) which comprises 100
` ~M Tris HCl, pH 7.5, 1.5 M NaCl, 10 mM EDTA, and 10%(w/v) Non-idet 40. It has been established that bovine
vWF-derived polypeptides present in fetal cal~ serum do
not react with NMC-4.
J~ ~ ~
The mixture was then incubated for 16 hours at 4~C
with approximately 0.05 mg of NMC-4 or 0.0 mg of RG-46
murine monoclonal anti-vWF anti~ody (or 0.1 mg of both)
allowing formation o~ IgG-vWF complexes. Immune
complexes were precipitated by taking advantage o~ th~
affinity of protein A (isolated from the cell wall of
St~phyl~occu~ reus) ~or consta~t regions of heavy-
ahain antibady polypeptides following generally the
method o~ Cullen, B. et al., Meth. E~ olQ~y~, 152,
684-704 (1987). See also Harlow, E. et al. eds,
Antibodies. A Laboratory Manual, Chapters 14-15, Cold
Spring Harbor Laboratory Press (1988). ;
.: :
Protein A-Sepharose~ beads were purchased from
Sigma, St. Louis, M0. Immune complexes were then
preoipitated with the beads in the presence o~ 3 M
'
WOg2/~ PCT/US91/077~6_ .
209~g
~ ~ .
: ::
114 ;
NaCl/1.5 M glycine (pH 8.9), and washed twice with lx
IPB and then once with lx IPB without Non-idet 40.
Immunoprecipitated proteins were then ~--
- electrophoresed in polyacrylamide gels containing ;
sodium docecyl sulfate (SDS-PAGE~ following the method
of Weber, K. et al., J. Biol. Chem., 244, 4406-4412
(1969), or as modified by Laemli, U.K., Nature, 227,
680-685 (1970), using an acrylamide concentration of
10~. Samples of immune-complexed vWF protein were
dissociated prior ~o electrophoresis by heating at
100C for 5 minutes in non-reducing and 2% SDS-
containing acrylamide gel sample buffer to disrupt non-
covalent bonds. The protein A-Sepharose~4B beads were
spun down and discarded. Visualization was
accomplished with Coomassie blue staining which
revealed the dominant vWF-derived polypeptide species ::
to have an apparent molecular weight, based on
molecular weight markers, of:about 116,000 daltons.
~,
Protein bands: in duplicate gels were blotted and
immobilized onto nitrocellulose sheeks (Schleicher
Schuell Co., Xeene, NH) and the pattern wa~ then
visualized using immunoreactivity according to the :
highly sensitive "Western blot" technique. Burnette,
et al., A. An~ ioche~, 112, 195-2C3 (1981).
The von Willebrand factor-specific monoclonal
antibodies (from-mice; used to identi~y the
polypeptides were RG-46 ~see Fugimura, Y. et al. J. . ;
Biol. Chem., 261(1), 381-385 (1986), Fulcher, C~A. et
al., Proc. Natl. Acad. Scl. USA, 79, 1648-1652 (1982)),
and NNC-4 (Shima, ~. et al., J. Nara Med. Assoc., 36,
- .-. ,. -.. - , .. . . ~. -.. . , .. , ... . ; .. ... . . ~.. . : . - ,
.. . .. , .. . ... . ~ . . . . . ... . . , - .. ~ .. . .. . :
- W0~2/06~ P~T/US91/0775~
. . .
`` 2~942~
.
115
662-669 ~19~)), both o~ which ~ave epitopes within the
expressed vWF polypeptide of this invention.
~ . .
The secondary antibody (~ rabbit anti-mouse
IgG), labelled by the method of Fraker, P.J. et al.,
- 5 Biochem. Bio~hys. Res. Commun., 80, 849-857 (1978)),
~ was incubated for 60 minutes at 25C on the
.~? nitrocellulose sheet. After rinsing, the sheet wa~
developed by autoradiography.
' .
, Growth medium from non-transformed CH0-Kl cells
shows no immunoreactivity with RG-46 and NMC-4 anti-vWF
,~ monoclonal antibodies under identical conditions.
., ~
The 116 kDa fragment may also be isolated from the
~ culture medium of CH0-Kl cells using immunoaffinity
?, : chromatography. Approximately 300~g of the 116 kDa
fragment can be recoyered from 500 ml of culture medium
derived from transformed CH0-Rl culture plates using
NMC-4 antibodies coupled to partic~es of Sepharose~4B.
.
Example 8 - Induction of platelet aggregation
by the homodi~eric 116 kDa von
Willebrand factor fragment derived
from the culture medium o~
stable CH0-K1 t ansformant~
The tryptic 116~XDa fragment has been previously ` `
characterized as a dimer consisting of two identical
disulfide-linked subunits each corresponding to the `
tryptic 52/48 kDa fragment of vWF and containing the
mature subunit sequence from residue 449 to residue `
728. owing to its bivalent character,~the dimeric 116
kDa fragment can support ristocetin-induced platelet `
aggregation wheroas the cons~ituent 52/48 kDa subunit
- '",'~
.
: ` :
W~2/06~ PCT/US91/07756 `
:~`' ,:
~,~9 ~2;i9
116 . .
cannot (see Mohri, H. et al., J. ~iol. Che~., 264(29~,
17361--17367 (1989) ~, r
Stable pAD5/WT CH0-Kl transformants, and
untransformed CH0-K1 cells as controls, were aach grown
to 90% of confluence in DMEM/10~ FCS, at 37OC in a 5%
C2 atmosphere. The 60 mm plates were then rinsed
twice with PBS and the incubation was continued in DMEN
(without FCS) for 24 hours. The resultant ~erum-free
culture medium was collected and concentrated (at 18C)
300 fold in a centrifugation-filtration apparatus,
Centricon 30, Amicon Co., Lexington, MA.
, .
A dose-dependent platelet aggregation curve
results from the addition of concentrated culture
: medium from pAD5/WT transformed cells to pIatelets. No
aggregation was seen in the presence of control culture
medium derived from untransformed CH0-K1 cells. -:
Platelets for the assay were prepared using albumin
density gradients according to the procedure of Walsh,
~ ~ et ~l. British ~. of Hematolo~y, 36, 281-298 ~1977).
; 20 Aggregation was monitored in siliconized glass cuvettes
maintained at 37C with constant stirring (1200 rpm) in.~
a Lumi-aggregometer ~Chrono-Log Corp., Havertown, PA). ..
Aggregation experiments followed generally the
procedure o~ ~ohri, ~. et al., ~ L~LLJ ~h~a ~ 264(29),
17361-17367 (1989). rwO to ten ~l quantities o~ 300
~old con~e~trated FCS-free DMEN from cultures of
pAD5!WT-transformed and control untransformed CH0-X1
cells (~M? were brought up to 100 ~l by dilution with
"Hepes" buf~ered saline, comprising 20 mM Hepes, N-~2- .
hydroxyethyl]piperazine-N'-E2-ethanesulfonic acid], (pH
7.4), and 0.15 M.NaCl. The 100 ~l samples were then
: mixed with 200 ~l of platelet suspension (4 x 108/ml)
- -. . ;... : ~ . . . ~ . ... . . .
~ WO92~0Sggg PCT/US91/07756
2~259
~ 117
: .
and then incubated with stirring in the aggregomet~r
~or 5 ~inutes. Riætocetin was then added to a final
~' concentration o~ lmg/ml at the injection timepoints
, ` (time zero). Aggregation was monitored by recording
~i 5 changes in light transmittance. Platelet aggregation
can be observed with as little as 100 ~1 of
: unconcentrated serum-free medium from pAD5jWT~
transformed cell lines. Serum-free medium from control
untransformed cultures concentr~ted up to 300 fold, and
assayed at up to }0 ~1 concentrated medium/100 ~1
sample did not induce platelet aggregation.
Preincubation w MonoclonaI Antibodies
,~ As a further control to confirm the speci~icity of
~ the ristocetin-induced 116 kDa vWF fragment-platelet
i, 15 interaction, platelets were preincubated with anti- '~
platelet glycoprotein Ib monoclonal antibody L3-Ibl
which has been specifically demonstrated to block vWF-
platelet GPIb-IX receptor interaction ~Handa, et al., -~
J. Biol. Chem., 261, 12579-12585 (1986)).
.1 - `
The effect of preincubating the platelets with
platelet surface receptor-speci~ic LJ-Ib~ monoclonal
antibodies prior to conducting the aggregation assay
was examined~ Platelets subjected to this ~-
preincubation did not exhibit an aggregation response
whereas platelets similarly preincubated with
monoclonal antibody LJ-C~ (Trapani-Lombardo et al., J.
Clin. I~vest., 76, 1950-1958 ~1~85) gave an effective
aggregation response. LJ-CP3 has been demonstrated to
block platelet GPIIb~IIIa receptor sites and not vWF- -
specific GPIb-IX receptors. To perform the as~ays
antibody W -Ibl or antibody LJ-CP3 was added, at a `
~V092/06~ PCT/US91/07756
~a9~2s9
' .
118
;~ concentration of 100 ~g/ml, to the platelet/serum
mixture while the mixture was being stirred in the
aggregometer/ and at a timepoint one minute prior to
the point when ristocetin (to 1 mg/ml) was added. The
assays were otherwise identical to those described
abo~e. Changes in light transmittance were monitored
for an approximate 5 minute (LJ-Ibl~ or 4 minute tLJ-
CP3) interval.
.
Example_9 - Construction of a mammalian transformant
for the expression of the monomeric 441-
730 mature von Willebrand factor subunit
fragment with cysteine-to-glycine
mutations at residues 459~ 462`and 464
.. . .
. This example is illustrative of conditions under
: 15 which a DNA sequence encoding a mature vWF subunit
fragment, which has an amino terminus at residue 441
(arginine) and a carboxy terminus at residue 730 ~ -
(asparagine) and which further contains glycine
residues substituted for cysteine residues at positions
459, 462 and 464 thereof, can be constructed and
transfected into mammalian cells.
; ., ` : .
The SalI-XbaI insert of pAD3-2 (see Example 7) was
removed by restriction and then cIoned into pcDNAl `
vector ~Invitrogen, San Diego, CA) which had been
previously diges~ed with XhoI and XbaI restriction
enzymes. Since XhoI and SalI restriction sites contain
identical internal sequences -TCGA- / -AGCT- , a S~lI
restricted fragment may be annealed into an XhoI site.
The ~ragments were ligated with T4 DNA ligase; however A ;~
the integrity of the XhoI site was not restored. This
plasmid construct was designated pAD4/WT.
` W092/06~ PCT~US9l/07756
~09~2~9
: .
`` 119
Site-directed mutaqenesis usinq M~ 3mpl8
pAD4/WT was restricted with EcoRI and SmaI
enzymes. pcDNAl vector contains an EcoRI site withi~
its polylinker region which is upstream from the XhoI
('~SalII') site but contains no SmaI site. As shown in
Figure 1 (SEQ ID NO: 1), a unique SmaI site (CCCGGG~ is ~-~q
~ contained within the vWF cDNA insert, spanning mature
- sllbunit residues 716 (glycine) to residue 718
(glycine~.
. ., ~:.
Accordingly, an approximate 950 base pair EcoRI-
SmaI fragment of pAD4/WT was subcloned into the EcoRI-
SmaI site within the polylinker region of M13mpl8
phage. The vWF sequence in M13mpl8 was then
mutagenized and reinserted into the previously
restricted pAD4/WT construct leading to reassembly of
the intact residue 441-730 vWF sequence.
The mutagenesis followed the procedure of Example
1 and Kunkel, T.A., supra, and utilized the following
oligonucleotide.
Oligonucleotide t13) - see SEQ ID N0: 14
3' - GGACTCGTGCCGGTCTAACCGGTGCCACTACAACAG - 5'
5' - cc~gagcaca~ccagattggccacggtgatgttgtc - 3'
GlY4ss Gly462 S;ly~4
Tbe hybridizing oligonucleotide i5 shown ~3' ~ 5')
in capital letters and is equivalent to transcribed
strand (non-coding strand DNA). Underlined letters
indicate the single base mutations ~or the mutant
codons. The equivalent coding strand is shown in lower
case letters with the corresponding glycine
substitutions identified by three letter designation.
':
:- .
WO9~/06~ PCT~US91/077~6
`~09~12~9
,
;~` 120
The mutant 950 base pair EcoRI-SmaT fragment was
then re-inserted into the EcoRI SmaI site of the
previously restricted pAD4/WT plasmid. The mutant
construct was designated pAD4/~3C. To facilitate long-
term storage and propagation, pAD4/~3C was transformed -
into ampicillin sensitive E.coli strain XS-127
according to the method of Hanahan, D., J. Mol. Biol.,
166, 557-580 (1983).
. .
Consistent with the proc2dures of Example 1, the
sequence of the mutant cDNA was confirmed by the
dideoxy method and the plasmid was purified by
CsCl/ethidium bromide equilibrium centrifugation.
! Transformation of COS-1 cells ~
,. :
pAD4/~3C was introduced into COS-l cells (SV 40
- 15 transformed African Green monkey kidney cells, ATCC -
CRL 1650) by a standard calcium phosphate-media~ed
transfection procedure. Chen, C. et al., Mol. ~ell.
; Biol., 7(8), 2745-2752 (1987).
:~ ' , , " COS-l cells were grown at 37C in Dulbecco's
modified Eagle's medium (DME~) (Gibco/Li~e
Technologies, Inc., Gaithersburg, MD) ~upplemented with
10% fetal calf serum (FCS) under a 5% C2 atmosphere,
and then su~cultured 24 hour~ prior to transformation
at a denæity of 1.5 x 105 ~ells/60 mm tissue culture
dish (approximately 25% of confluence). COS-l cells
have a doubling time in DMEM/10% FCS of approximately
20 hours under these conditions.
:
To accomplish transformation, pAD4/~3C plasmids
were recovered from cultures ~f E.coli strain XS-127
- WOg2/06~ PCT/U~91/0~7~6
~9.~2~9 .................... .
. . . . .
121
according to the method of Birnboim, H.C. and Doly, J.,
Nucleic A~ids Research, 7, 1513 (1979). Ten ~g of ;
plasmids were applied to the cells of each 60 mm dish -
in a calcium phosphate solution according to the method
of Chen et al., supra. After inoculation with plasmid, -~
the cells were maintained in DMEM/10% FCS for 8 hours
at 37OC in a 5% CO2 atmosphere.
., ,,-.,", .
The growth medium was then replaced with a
solution of phosphate-buffered saline/10% (vjv)
glycerol. The cultures were then maintained in
glycerol-PBS for 2 minutes to facilitate the production
of transformants (Ausukel, et al. eds, Current
Protocols in Molecular Biology, p.9.1.3, Wiley & Sons
- (1987)). After 2 minutes, the glycerol-PBS solution -;
was replaced with DMEX/10% FCS. Antibiotic resistance -
was not used to select for stable transformants. The
cells were then maintained at 37C in DMEM/10~ FCS in a
5~ C2 atmosphere. ;
ExamDle_10 - Transformation of COS 1
cells by pAD4 !WT ~lasmids
COS-1 cells were also transformed successfully
with pAD4/WT plasmids. Although antibiotic resistance
was not used to select for stable trans~ormants,
transient expression of the 116 k~a fragment therefrom
Was part~cularly use~ul for the purpose of comparing
the properties of the 116 kDa mutagenizad polypeptide -
produced by pAD4/ 3C plasmids to those of the pAD4/WT
116 kDa homodimer.
.... . . .. . .
Following the procedures of Example 9, pAD4/WT
plasmids were recovered from storage cultures of E.coli~!~
strain XS-127. Transformation of COS-1 cells with !
pAD4/WT was then accomplished using the procedures of
,';"':'
. . - .
.; - ,
W092/OS~ PC~/US91/07756
.: . . .
~,~ ` "' .
122
Example 9. The cells were then maintained a~ 37C in
DMEM/10% FCS in a 5~ CO2 atmosphere.
~' Example 11 - Construction of ~ammalian transformants ~-
~ which express mutant 441-730 mature von
- 5 Willebrand factor subunit fragments
wherein each mutant contains a single
cvs~eine-to-alvcine substitution
Following the procedures of Example 9, and using
suitable oligonucleotides for site-directed
mutagenesis, three plasmids (pAD4/G459, pAD4/G4Q and
pAD4/G~, coIlectively referred to as "pAD4/~lC
plasmids") were constructed. Such plasmids are
identical to pAD4/WT except that each contains a single
base pair mutation which corresponds to a single
cy~teine to glycine substitution at mature vWF subunit
~'è residue positions 459, 46Z and 464 respectively. The ~-
oligonucleotides used are identical to oligonualeotide
(13) used to prepare pAD4/~3C except that each contains
only one of the three mutant codons of that
oligonucleotide, the other two codons being represented
by the wild type coding sequence. To facilitate long-
term storage and propagation, samples of pAD4/G4s9,
pAD4/G462, and pAD4/G~ were each cloned into ampi~illin
sensitive E.coli strain XS-127 following the method of
~xample 9.
Consistent with the procedures o~ Example 9, the
sequences of the mutant cDNAs were confirmed by the
dideoxy method and the plasmids were purified by
CsCl/ethidium bromide equilibrium centrifugation.
Transformation of COS-1 cells with either
pAD4/G459, pAD4/~4Q or pAD4/G464 plasmids was accomplished
~ ...... .. . , . . , ~.. ~ , . .. .... ...... . . . .
., . . . ,. : ..
;:
-~ W0~2/06~ PCT/US91/07756
. ~, . . .
- 2~39'4~5~
~, .
123
according to the protocol of Example 9. Antibiotic
, resistance was not used to select for ~table
~ transformants. The cells were then maintained at 37C -
M in D~EM/10% FCS in a 5~ CO2 atmosphere.
':
Examle 12 - Expression and characterization
of von Willebrand factor subunit
fragments by COS-l cells transformed
with pAD4/WT and pAD4/A3C plasmids-_
,
COS-l cells which had been transformed~with
pAD4/~3C or pAD4/WT plasmids according to the -
procedures of Examples 9 and 10 respectively were
cultured to express the encoded vWF DNA as explained
below. COS-1 cells similarly transformed with pc~NA1
plasmid vector (not containing a vWF cDNA inse~t) were
used as controls.
.~ ; .
COS-l cells at a density of 4-5 x 105/60 ~m dish
, were transformed by adding, at time zero, 10 ~g of
? pAD4~WT, pAD4/a3C or p~DNAl plasmid. Following the
procedure of Examples 9 and 10, the cells weré
glycerol-shocked a~ter a period o~ 8 hours. The cells
` ~ were then covered with DNEMjlO% F~S at 3~C in a 5~ CO2
atmosphere for 32 hours.
, .
The cells for each culture were then rinsed three ! '
ti~es with PBS and the incubation was continued with
DMEM (without FCS) which was supplemented wîth 35S~
methionine (A~ersham Co., Arlington Heights, IL) having
a specific activity`of 1300 Ci/~mol to a final
concentration of 100 ~Ci/ml. The cells were returned
to the incubator for 16 hours, after which time the -
respective culture media were harvest~d for
'' :'
.~ .
~ W092/06~ PCT/US9ltO77~
2a9~ 9
.
;`......................................................................... .
124
purification by immunoprecipitation of secreted vWF
polypeptides.
Immunoprecipitation followed generally the
procedure of Example 7. Five ml volumes of culture . -
media were incubated with 0.5 ml of lOX
immunoprecipitation buffer, 0.05 mg of NMC-4 antibody
~: and 0.05 mg of RG-46 antibody for 16 hours.
Treatment with protein A-Sepharose~8 was
performed according to Example 7. Samples of IgG- :
. 10 complexed vWF protein were dissociated prior to SDS-
PAGE in SDS-containing sample buffer.
For analysis of the vWF polypeptides under
reducing conditions, the sample buffer was modified.to
contain 100 mM dithiothreitol (DTT).
.:
Results
The gels were run under reducing and non-reducing:
conditions and were dried and subject to
autoradiography to develop the 35S label. No 35S-
labelled protein was detected as an immunopreaipitate :
: 20 derived from control cultures of COS-l cells
(transformed by unmodi~ied pcDN~1 vehicle) undex either
reducing or non-reducing conditions (see gel lanes
d~signated MOCK).
,
COS-1 cells transformed with pAD4/WT plasmids
produce, under non-reducing conditions, a prominent 35S-
labelled band of an approximate apparent molecular
weight of 116,000. This value is consistent with
proper mammalian glycosylation of the 441-730 fragment.
~
: ~ :
W092/~6~ PCT/US91/07756 .
,
"` 2~2~9
"` 125
When run under reducing conditions, no 116 kDa material
is apparent, consistent with the reduction of the -
'9 , disul~ide bonds which stabilize the 116 kDa homodimer. -
.` Under reducing conditions, a pro~inent 35S-labelled band
- 5 is visualized of approximately 52,000 apparent
molecular weight. The apparent 52 kDa value is again -:
consistent with proper glycosylation of the redu~ed
monomeric 441-730 fragment.
.
.~ The gel lanes corresponding to transformation with .
pAD4/~3C show no apparent 116 kDa material. Instead a
band is apparent, under reducing and non-redùcing ~
~ conditions, at an apparent molecular weight of `;
:~i approximately 52,000. .
Thus, mutagenesis to replace cysteine residues
459, 462 and 464 within the 441-730 vWF fragment with
glycine residues results in the successful expression . -~
of a non-dimerizing polypeptide presumably having only .`~
intrachain (471 to 474 and 509 to 695) disulfide bonds. ~.
Interaction with NMC-g (see also Example 7) is known to
20 : require an~intact~509 to 695 intrachain disul~ide bond, :
.~ thereby demonstrating the presence of native wild type
tertiary structure in the polypeptide produced by
pAD4/~3C.
'
The gels also demonstrated the presence of low
2S molecular we~ght 35S-labelled material (under reducing
and non-reducing conditions) probably indicati~g tha~
- not all vNF polypeptides produced by pAD4/WT constructs -,
successfully dimerize and that proteolysis andlor .
incomplete glycosylation of the polypeptide may prevent
higher yields. Proteolysis andjor incomplete :`:
glycosylation also presumably affect the yield of the .~
: .
W0~2/06~ PCT/US91/077~6
'1 2 ~ ~
126 ..
~onomeric vWF polypeptide produced by the pAD4/~3C :.
trans~or~ants. Some high molecular weight aggregate ~ ~-
material (essentially not entering the gels) is present ~ -
in non-reduced samples from pAD4/WT and pA~4/~3C.
Example 13 - Use o~ NMC-4 monoclonal antibody to
, immunoprecipitate vWF polypeptides
:~ secreted by pAD4/WT and pAD4/Q3C
transformed COS-1 cells _
.,. :
The NMC-4 monoclonal anti~ody has as its epitope
the domain o~ the von Willebrand factor subunit which
contains the glycoprotein Ib binding site. ~apping o~ -
the epitope has demonstrated that it is contained
within two discontinuous domains (comprising
approximately mature vWF subunit residues 474 to 488
: 15 and also approximately residues 694 to 708) brought
into disulfide-dependent association by an intrachain
(residues 509 to 695) disulfide bond.
-
Thus, reactivity with NMC-4 is important evidence
of whether a particular recombinant 441-730 mature vWF
subunit fragment has assumed the tertiary structure of
the analogous wild type residue 441-730 domain.
Accordingly, the procedure o~ Example 12 was
followed to characteri2e v~F polypeptides secreted by
pA~4/WT and pAD4/~3C transformed COS-1 cells, with the
modi~ication that immunopxecipitation of the culture
media was ef~ected solely with NMC-4 antibody (0.05 mg
NNC-4 per 5 ml of cultur~ media to which 0.5 ml of 10X
immunoprecipitation bu~fer had been added).
Samples were run under reducing and non-reducing
conditions. Consistent with the results of Example 12,
.=,,, , . ~ , .. ... .
: . - - . . :
W0~2/06~ PCT~US91/077~6
127
the major component isolated from pAD4/W~ cul ure
medium has an apparent molecular weight of 116 kDa
under non-reducing conditions and 52 kDa under reducing
conditions.
.
Although only a small fraction of the total - :.
~ pAD4/ 3C derived vWF polypeptide material binds to NMC-
:.~ 4 (compared to conformation independent RG-46), a band
:~ o~ apparent molecular weight o~ S2 kDa is visible under -
reducing and non-reducing conditions in gels of NMC-4 i~
~ 10 immunoprecipitates.
Exam~le 14 - Expression and ~haracterization of
von Willebrand factor subunit fragments
produced by COS-l cells transformed with
AD4/G459, pAD4/G~2 or pAD4/G4~ plasmids - ::.
.
Transformation of COS-1 cells by either pAD4/G459, `.
.',: pAD4/i~2 or pAD4/G~ plasmid (collec~ively the ~p~D4/QlC ~ -
~ plasmids") was accomplished according to the procedure
i of Example 11. Culture media were analyzed for . .;
secreted vWF polypeptide according to the procedure of --~
Example 7, using only NMC-4 for immunoprecipitation. :
35S-labelléd proteins, prepared according to .
Example 12, were immunoprecipitated by NMC-4 and run in
SDS-polyacrylamide gels u~der reducing and non-reducing . ~-
conditions and compared with vWF antigen produced by ..
pAD4/WT and pAD4/Q3C transformants. : .~ ~
~he gels demonstrated that substitution of any one , : -
o~ the 3 cysteines;~459, 462, 464) believed responsible I- .
~or interchain disulfide contacts in native mature
subunits prevents the formation of the homodimeric 116
kDA polypeptide characteristic of pAD4/WT transformed
-.
- , ~ `'.
.; . !.,''. ?. .. ' ' ' ,. , .. , - '
. W092/06~ PCT/US91/077S6
`i ~` 2 0 9 ~ 9
,`
:~. 128
" CQS-l cells. ~hese three vWF antigens with a single
glycine su~stitution appear predominantly as monomeric
polypeptides of an apparent molecular weight of 52,000
under reducing or non-reducing conditions. That the
predominant material has an apparent molecular weight
of 52 kDa is strongly suggestive of correct
.; glycosylation by the COS-1 cell transformants
duplicating glycosylation 6een in the human 52/48 kDa
- tryptic vWF fragment. Some inadequately glycosylated
and/or proteolyzed vWF antigen (molecular weight less
than 52 kDa) is also apparent in the gels. The
- relatively small fraction of pAD4/~3C vWF polypeptidP
which is successfully folded and secreted, thereby
presenting an NMC-4 epitope, was shown by the low
intensity of the pAD4/~3C transformant autoradiograph
~- band of apparent 52,000 molecular weight.
:
Example 15:- Enhancement of the Af~inity of the
Recombinant 116 kDa vWF Fragment for
Platelet GPIb(~) Receptor Sites in the
Presence of Ristocetin
This example demonstrates that the affinity of the ~ :
recombinant 116 kDa vW~ fragment for platelets can be
enhanced by reducing the amount of N-linked
glycosylation present in the 116 kDa polypeptide.
. ~ .
Stable CHO-X1 transformants containing DNA ~rom
pAD5/WT plasmids were incubated overnight (following
generally the cell culture procedures of Example 1 and
with an initial cell density of about 5 x:105 cells/60
mm tissue culture dish~ in DMEM containing 10% FCS wi~h
0.5 mM of each nonessential amino acid, 2 mM L-
glutamine, and also tunicamycin (from StreptomYces,
- , :. ~ , ", .
:-: ~, .
: i
` W092~06~ P~T/US91/0775
:
"` 2~X~
.
;~ 129
product T7765 containing A, B, C and D isomers thereo~,
i Sigma Chemical Co., Sk. Louis, M0) at 0.8 ~g/ml.
.~ ` The cells were then washed twice with PBS and
incubated in DMEN with 0.5 mN of each nonessential
.~ 5 amino acid, 2 mM L-glutamine and 0.4 ~g~ml tunicamycin . ::
~- - for 24 additional hours. The culture medium was
harvested and concentrated 300 fold in a
centrifugation-~iltration apparatus, model Centricon
. 30, Amicon Co., Lexington, MA.
lo As a control, medium ~rom stable transformants :
incubated without tunicamycin (under otherwise
identical conditions) was also harvested. The
. respective abilities of the vWF-derived recombinant 116
kDa dimeric polypeptides (fro~ treated and untreated
cultures) to support ristocetin-induced platelet ., .
aggregation were cQmpared. ~ :
-.
The amount of vWF derived antigen varied from ~.
preparation to preparation depending on the precise
extent of growth in each tissue culture dish. Based on
~he ratio of NMC-4 reactivity of particular samples of -
FC9-free medium derived from treated:and untreated ..
cells, respective ~l amounts of 300 fold concentrated
mediu~ were chosen to reflect equal amoun~s of vWF
antigen ~or comparison in the ristocetin assay. Equal
NMC-4 a~inity constants were presumed. ~
: .
In order to determine the normalizing ratio, ~.
between 10 and 100 ~l quantities of FCS-free cultura : :
medium samples ~from treated and untreated cultures) -
were electrophoresed in SDS-polyacrylamide gels as
described in ~xample 1, after which the bands were
' WO9~/06~ PCT/US91/077~6
::`` 2~9~'~5'~
130
." transferred to nitrocellulose sheets for immunoblotting :~
according to a standard procedure. Burnette, et al.,
. A.~nal. Biochem., 112, 195-203 (1981). Detection on
the nitrocellulose sheets was accomplished using NMC-4
as primary antibody followed by ~ rabbit anti-mouse
IgG as secondary antibody and visualization by
autoradiography (see Example 1). For normalization,
total vWF antigen reactive with NNCo4 fro~ each culture
was determined from densitometric scans of the
autoradiographs.
~ .
- Ristocetin-induced platelet aggregation assays
- were performed according to the procedure of Example 2
and demonstrated that tunicamycin treated cells
produced a NMC-4 reactive antigen having a greater
platelet aggregation inducing capability than that
, produced by untreated cells which generated
polypeptides with normal N-linked glycosylation. The
comparative aggregation profiles used ristocetin
concentrations of 0.5, 0.75 and 1.0 mg/ml.
:
In addition, the NMC-4 reactive 116 kDa
- polypaptide material from untreatPd cells was resolved
by ~estern blotting into multiple species with slightly
di~ferent electrophoretic mobilities. Aftar treatment
with tunicamycin, only a single species was observed.
It is thus demonstrated that N-linked glycosylation of
the recombinant 116 kDa Pragment i~ heterogeneou~ and
that the level o~ such glycosylation affects the
biological activity of the fragment.
` ` wo 9~ 9g9
PCT/US91/07756
. ~ j .
.
~``` ` 2~9~2~9
! '
~ 131
., ~xamPle 16 - Construction of Mammalian Transformants
ror the Expression of Monomeric or
.~ Dimeric Fo~ms of the Residue 441-730
~i 5 von Willebrand Factor Subunit Frag~ent !~
with Reduced Levels o~ Glycosvlation
, This example demonstrates the preparation o~ vWF-
derived polypeptides patterned upon the mature subunit
449-72~ sequence (the 52/48 kDa frag~en~), or dimers ~:`
; thereof, but containing less glycosylation than that ,,.
;, 10 present in the 52/48 fragment, or dimers thereof, as
~, isolated from circulating plasma ~WF.
. ~.,
~ Mutaaenesis of_vWF cDNA
, . ~'
One or more particular codons of a cDNA encoding
. the mature subunit residue 441-730 fragment which
encode serine, threonine or asparagine residues thereo~
may be replaced with codons for other amino acids, such ~ -
as, for example, alanine or glycine, following the
procedures of Examples I and 3.
,..~,
Brie~ly, the M13mpl8 recombinant DNA sequence .;
encoding vWF subunit residues 441-730 and designated :~
pAD3-1 (Example 7) can be cloned into pcDNAl vector
(according to the proceduxe o~ Example 9) to generate
the pAD4/WT pla~mid.
pAi4/WT pla~mid aan be restricted with EcoRI and
SmaI enzymes. A~ explained in Example 9, pcD~A1
contains an EcoRI sits within its polylinker region but
no S~aI ~ite. A unique SmaI site (CCCGGG) is contained :~
within the vWF cDNA insert, epanning mature subunit
residues 716 (glycine) to residue 718 (glycine).
- :
W092/06~ PCT/U~g~/07756
2~ 5 ~
; 132
This approximata 950 base pair EcoRI-SmaI fragment
: o~ pAD4/WT can be subcloned into the EcoRI-SmaI site
within the polylinker region of Ml3mpl8 phage. The vWF
sequence can then be mutagenized to delete or replace
one or more serine, threonine, or asparagine codons
(encoding potential sites of glycosylation) prior to
being reinserted into the previously r~stricted pAD4/WT
construct, leading to reassembly of the intact residue
441-730 vWF sequence.
A pr~ferred form of mutagenesis follows the
procedure of Kunkel, T.A., supra (Exa~ple 7) and
utilizes a hybridizing oligonucleotide suitable for
deleting one or more serine, threonine, or asparagine
codons, or alternatively suitable for substituting one
or more codons ~or other amino acids, such as for
glycine or alanine. ~he pcDNA1-derived plasmid
containing vWF cDNA which encodes a polypeptide with
reduced potential for glycosylation can be designated
pAD4/-G.
Following the procedures of Examples g and 10,
COS-l cells can be transformed with pAD4/-G plasmids.
The polypeptides expressed in this way will form 116
kDa homodimers which compared to the pA~4/WT
polypeptides have fewer potential sites ~or
glycosylation. Many other expreæsion plasmid/host cell
systems can be used to express the mutant vWF cDNA
including notably the pCDN8~/CHO-Xl system of Example
7.
ExDression of Monomeric Fraqments
WOg~/06~ PCr/US9~07756
;
2 ~ ~ ~ c~
.
133
Following the procedure o~ Example 9, deletion of . .
- or substitution for one or more codons encoding one or
~ more of the above mentioned potential glycosylation .
sites within the 441-730 sequence can be per~ormed with
an oligonucleotide which also encodes cys - gly codon
changes at, for example, cysteine residue posi~ions ; ;~
: 459, 462, and 464. Alternatively, a second round of - ~
mutagenesis could be performed in ~13mpl8 phaye to ; ~:
effect the cysteine to glycine mutations.
When reassembled, the pcDNA1 plasmid construct
containing cys - gly mutations at vWF subunit positions
459, 462, and 464, and one or more further codon .::
mutations to restrict glycosylation of the encoded vWF
polypeptide, can be designated pAD4/~3C,-G. This
polypeptide, lacking the cysteine residues which
stabilize the 116 kDa homodimer (s~e Examples 12 and .~:
14) will be expressed and secreted from host cells as a
monomeric fragment.
: ExamPle 17 - Expression and Secretion by Eucaryotic
Cells of Other ~herapeutic PolyPeptides
. ~
:: Example 7 and Examples 12-14 demonstrate that the
polypeptide consis~ing o~ the 22 residue human vWF
signal peptide and the first three amino acids of the
human vWF propeptide directs the successful secretion
~rom CHO-Kl and COS-1 cells of the mature vWF subunit
~ragment, ~onsisting of residues ~41-730, which
fragment could otherwise only be recovered from host
cells by cell lysis.
` WOg2/~6~ PCT/US91/077~
2 ~
5~ r`~ `.
134 .
~he amino acid sequenc~ ~see SEQ ID NO: 15)
NH2- Met-Ile-Pro-Ala-Arg-Phe-Ala-Gly-Val-Leu-Leu-Al~-Leu-Ala-1~u-
Ile-Le~-Pro-Gly-Thr-Leu-Cya-Ala-Glu-Gly-Thr-Arg-Gly-Arg-Ser-
Ser-Thr-CC2H t
Xnown ~ignal peptidase cleavage site
: and fragments and combinations of fragments thereof
will prove useful in the process of directing the
secretion into the lumen of the endoplasmic reticulum
and, therefore, into the culture medium of eucaryotic
host cells of therapeutic polypaptides comprising other
regions of the vWF molecule or consisting of other
protein species or fragments thereof.
It is believed also that the amino acid sequence
comprising NH2-ala-gluogly-CO2H will facilitate the
identification by signal peptidases of a proper :
clea~age site, when said amino acid seguence is `.
positioned on the C-terminal side of the human vWF
signal peptide.
.
Following the procedures of Example 7, a DNA
sequence useful in the expression of a therapeutic
polypeptide can be constructed in which the following
structural elements would be assembled in a 5' to 3'
direction (re~erring to the coding or nontransc~ibed
strand):
(A) a sequence of nucleotides suitable for
re~triction;
(B) a eucaryotic consensus translation initiation
sequence;
(C) a methionine codon followed by 21 other
codons which together would encode the human : :
vWF signal peptide; . ;
~' ,,.,: '
~: .
.,--.. ., .. , . , .: . .
: `
. .
:
W092/06~ PCT/US91/07756 -
2 ~ ~
.
i.
: 135 ::
~D) a coding sequence corresponding to
approximately the ~irst three amino acids of
the amino terminal regivn of the human vW~
propeptide; :~
(E) the coding sequence for the therapeutic ~:
polypeptide; ~:-
. (F) a translation termination codon; a~d
- ~G) a sequence of nucleotides suitable for
~ - restriction.
;
This construct may then be inserted into a plasmid or
viral expression vector which cloning vehicle may in
turn be used to transform suitabIe eucaryotic hoRt n
cells from which the therapeutic polypeptide would be :~.
expressed.
Exam~le 18 - Preparation of Subsets of
the 52/48 kDa Polype~tide
This example is illustrative of the preparation of
~: polypeptides representing embodiments of the invention
which are cysteine-deficient subset~ derived from the
residue 441-733 fragment of vWF subunit. The example
is also illustrative of conditions under which such
subsets may be expressed from recombinant bacterial
host cells. The subsets ~ay be expressed also from
recombinant eucaryatic cells, for example, by following
the general procedùres of Examples 7 and 9. The
subsets are capable of interfering ~ith the interaction
of multimeric vWF and platelet ~PIb~, ~hat is, they : .
have utility às antithrombotics.
- - . . ~ , ;,
: There follows hereafter a description of the :~ ;
preparation of three groups of polypeptides co~prising
the afore~entioned type subsets, with the first group
~ .
: .:.
.
WOg?/06~ ~ PCT/US91/07756~
`2 ~ X 5`~
'
136
o~ subsets being cysteine-free and those of tha second
: and third groups of subsets having but two cysteine
residues (five of the cysteine residues having been
removed). The subsets of the second and third goups -~
differ in that there is retained either the N-terminal
- region ~second group) or the C-terminal region (third group) of the polypeptide.
Polypeptide Subsets ~cysteine-free)
of the_Residue 441-733 Domain of vWF Subunit
Mutant (fusion) polypeptides consisting of the
residue 441-733 seguence, but lacking either the
internal G10 ~residues 474-488) or D5 (residues 694-
708) region, were created using loopout mutagenesis in
M13mpl8 phage of restriction fragments of p7E
constructs and then tested for antithrombotic activity.
Specifically, p7E plasmids were recovered from
cultures of E.coli BL21(DE3) using an alkaline cell
lysis procedure, Birnboim, H.C. and Doly, J~, Nucleic
Acids Rese~ch, 7, 1513 (1979) followed by purification
by CsCl/ethidium bromide equilibrium centrifugationO
An XbaI restriction site exists in p7E plasmid
~contributed by the parent pET-3A vector) upstream from
the T7 transcription promoter. Accordingly, the vWF
insert ~for residues 441-733) was removed as an
XbaI-HindIII restriction fragment for loopout
mutagenes~s ~see Example 1) in M13mpl8 phage. Loopout
of the G10 region or D5 region, respectively, was
accomplished using the following oligonucleotides which
represent non-coding strand ~transcribed strand) DNA.
Shown below the two 3' ~ 5' oligonucleotides are the
corresponding coding strands and resultant amino acid
sequences.
'`" '
:
~ . . . . . . ... .... .... .. . . . .. ..
W092/Q6~ PCTI~S91/07756
: .
2~9~259
137 -
` Oligonuclaotide (1~) - see SEQ ID N0: 16 :
3' - GAG TGG CCA CTT CGG CAC TCG GGG TGG TGA - 5'
5' - ctc acc ggt gaa gcc gtg agc ccc acc act - 3'
Leu Thr Gly Glu Ala Val Ser Pro Thr Thr
469 470 471 47~ 473 489 490 491 492 493
deletion of G10 binding peptide
Oligonucleotide (15) - see SEQ ID N0: 17
3' - CTC TAG CAA TCG ATG CTG TAC:GGT GTT CAG - 5'
5' - gag atc gtt agc tac gac atg gca caa gtc -3'
Glu Ile Val Ser Tyr Asp Met Ala Gln Val
689 690 691 692 693 709 710 711 712 713
deletion of D5 binding pept1de
DNA sequence analysis was used to confirm that the
intended vWF coding~sequences were produced.~ The ~wo ~ .
mutagenized XbaI-Hin~III restriction ~ragments were
then inserted into eepArate pET-3A plasmids that had -~
been cut wi~h XbaI and HindIII restriction endonuclease
: 20 and which w~re thereafter designated p7E/~GlO and ...
~ p7E/~D5.
.
The resultant mutant (~usion) vWF polypeptides
were then te~ted ~or their ability to bind to GPIb~.
U~ing the as~ay procedure of Example 6 (inhibi~ion of
the binding o~ LJ-Ibl antibody to GPIb~ in the absence
: of botrocetin modulator), it was determined that the
residue 441-733 ~ragment, which was expressèd from p7E
and from which the l'G10" peptide sequence was deleted, ~ .
: binds 5PIb~. The p7E-derived fusion fra~ment lacking
: :
.,
,' ~ "~';'" .
W~92/06~ PCT/US91/07756
:`` " 2~9~259
:
138
the 'ID5'' peptide sequence did not. However, when the
experiments were repeated using botrocetin as a
modulator of binding (sae the method of ~xample 6),
both of the fused subfragments were effective in
inhibiting binding by LJ-Ibl, and hence have
` antithrombotic utility.
Other in vitro assays which can be used to
- identify vWF-derived polypeptides having antithrombotic
activity include inhibition of botrocetin-induced
binding of vWF to platelets by the mutant polypeptide
(6ee Example 3), and the inhibition of human platelet
agglutination in a system using bovine vWF, but without -
a modulator such as botrocetin or ristocetin.
Cysteine-deficient Polypeptide
Subsets Having N-terminal Deletions
- Therapeutic polypeptide subsets effective as
antithrombotics have also been prepared which are
patterned upon the residue 441-733 vWF subunit
fragment, but which contain N-terminal deletions.
- ' . .-
Preparation of such polypeptides was accomplished ~;
using loopout mutagenesis in M13~pl8 phage of the XbaI-
HindIII restriction fra~ment from p5E expres ion
plasmid. Thus, the vWF encoding sequence ~p5E) encoded ~;
cysteine ~or residue positions 509 and 695 and glycine
at residue positions 459, 462, 4~4, 471 and 474. p7E
sequence is also useful for expression of such
antithrombotic polypeptides. Antithrombotic
polypeptides equivalent to those expxessed from p7E
constructs can be made by reduction and alkylation of
cystaine residues otherwise contained therein.
.:~ .
.' ' '
. WOg2~06~ ~CT/US91/07756
2~'12~
.,` , .
,
139
The dssign o~ oligonucleotides used to create N-
terminal deletions in the vWF subunit fragment made
reference to DNA sequence of the pET-3A vector that is
upstream (5') from the codon encoding vWF residue 441.
Expression of the residue 441-733 fragment as an EcoRI-
HindIII insert (with both 5' and 3' ends thereof .
modified by Bam~I linkers, Example 1) in pET-3A
involves expression also of a twenty residue amino aoid ~-
~ sequence (SEQ ID N0:18) that remains attached to the
amino terminal of the vWF fragment. ~This sequence, as
shown below, is encoded by vector DNA downstream from :
the T7 promoter site but does not affect adversely the :~.
therapeutïc activity of the vWF polypeptide.
initiation codon
~ .
- Met Ala Ser Met Thr Gly Gly Gln Gln Met .
Gly Arg Gly Ser Pro Gly Leu Gln Glu Phe Arg~
~ from EcoRI
~ .
:~ 20 It is noted that the EcoRI encoding sequence (Glu-
Phe) survived~modification with a ~amHf linker in the
~; T4-DNA ligase procedure (Example 1) ln this particul~r .
case. The corresponding pET-3A vector coding sequence
located upstream from the initiating methionine and
residue 441 (arginine) is as follows.
Oligonucleotide (16) - see SEQ ID N0: l9
S' - GAA GGA GAT ATA CAT ATG GCT AGC . . . ;.~
- ~ Met Ala Ser -:
. .
Accordingly, generation of N-terminal dele~ions
was accomplished using loopout mutagenesis with a
hybridizing oligonucleotide which encodes sequence .-:
from the veotor (ending at the initiating methionine)
.. :,,
- -, ... . . . . . . .. ..
W0~2/06~ PCT~USgl/~77S6
` 299'~2~ ~
` 140
and then the intended N~terminal region of the new vWF ~,
polypeptide.
. ~ .
Representative of the oligonucleotides necessary ~,
for the preparation of the therapeutic polypeptides is
oligonucleotide 17 (SEQ ID N0: 20) which corresponds to
non-coding strand (t~anscribed strand) DNA. Shown ~,~
- below this oligonucleotide are the corresponding coding
strand and resultant amino acids. '
'.-~ .''..
3' - CCT CTA TAT GTA TAC GTC CTC GGC CCT CCG - 5 ' `
gga gat ata cat atg cag gag ccg gga ggc '
Met Gln Glu Pro Gly Gly
474' 475 476 477 478 479 ,~,',
Representative of cysteine-deficient polypeptides ','
reflecting such N-terminal deletions are Met Gln47s to
Valn3, Met-Thr4~ to Val~3, and Met Ty~ to Val~3. Such ' ~ ~'
polypeptides (and other species having terminal '-
~ deletion of any subsets of the vWF residue 441-508 -
`~ sequence that contain one or more cysteine residues)
have antithrombo~ic therapeutic activity. These ~-~
polypeptides can present also the cysteine 509-695 loop
when expres6ed from p5E constructs.
Cysteine-defici~nt Polypeptide
Subsets Havina C-Terminal ,Deletions '''
The procedure used to express recombinant
bacterial polypep~ides using pET-3A vectors results in
polypeptide~ that comprise also a series of amino acids
on the C-termina} side of Val~3, the additional
residues arising from transl~tion of vector sequence
(see SEQ ID N0: 21).
~. .
Specifically, residue 441-733 fragments expressed '
from p5E (or p7E) constructs contain also 22 residues ~
W0~2/06~ PCT/US91/077~6
.2.~ ~ ~.2 .~.~
.
141
~used to the C-terminal side of residue 733 (valine~
- resulting ~rom the expression of vector sequence prior
to the ~irst vector stop codon.
:.
This pET-3A vector sequence, which reflects also
modification (Example 1) of the HindIII site of the
EcoRI-HindIII fragment by a BamHI linker, is 5SEQ ID :
No: 21):
Val Ser Ser Asp Pro Ala Ala Asn Lys Ala
733
Arg Lys Glu Ala Glu Leu Ala Ala Ala Thr
Ala Glu Gln *
stop codon .
In order to prepare an appropriate encoding DNA
sequence for vWF polypeptides having C-terminal
deletions, loopout mutaganesis was performed in p5E
using hybridizing oligonucleotides patterned on non-
coding strand DNA. To prepare a polypeptide (using the
. polypeptide ~nding at residue Asp7~ as an example~, a
Aybridizing oli~onucleotide was created encoding vWF
subunit sequence (for ~xample, from residue 706 to 713)
that included also between certain codons thereof (for
example, c~don 709 and codon ilO~ the stop
~odon/reading frame shi~t se~uence 3' - ACT-ACT-T - 5'.
Accordingly, vWF-derived polypeptides were
generated that have C-terminal deletions and which
terminate at residues 709, 704, 700 and 696
- respectively. ,~
~V092/0~ PC~/~S91/077~
2 ~
142
Deposit o~ Str~ins Useful in Practic-in~ the Invention
Deposits of biologically pure cultures of the . -
following strains were made under the Budapest Treaty
with the American Type Culture.Collection, 12301 .
Parklawn Drive, Rockville, Maryland... The accession
numbers indicated were assigned after ~uccessful .:
viability testing, and the requisite fees were paid..;.
Access to said cultures will be available during .~::
pendency of the patent application to one determined by ..
the Commissioner of the United States Patent and .~::
Trademark Office to be entitled thereto under 37 C.F.R.
~ 1.14 and 35 U.S.C. ~122, or if and when such access is
required by the Budapest Treaty. All restriction on .
availability of said cultures to the public will be .. :~
-lS irrevocably removed upon the granting of a patent based
upon the application and said cultures will re~ain. . :.
permanently available for a term of at least five.years :.
- after the most recent request for the furnishing of
samples and in any case for a period of at least 30 :~
years after the date.of the deposits. Should the
cultures become nonviable or be inadvertantly
destroyed, they will be replaced with viable culture(s) .
of the ~ame taxonomic description.
Stra~/Plasmi~ ATCC No. Deposit Date
EL~Qli p5E BL21 (DE3) 96.3 ATCC.68406 9/19/go
E.cQli XS127 96.4 . ATCC 68407 9/19/90
,, :.
' ': '
- . : . ~ . .. . . . . . . ..
