Note: Descriptions are shown in the official language in which they were submitted.
O ~ 2 '
M&C FOLIO: P67154 2 0 ~ 38 WANGDOC: 0427W
~", ' .
PN~ _ LEIC ACID DERIVATIVE
The pre3ent invention relates to a compound which
inhibits the expre~sion ~f a virus gene or a tumour
gene, which gene originates in a virus or is present in
a tumour cell~ a~ well as to an antiviral agent and an
autitumour agent having said compound as its active
ingredient. .
Viruis genes or tumour genes can be broadly
cla~sified into those that are present in cell~ and, in ~i
the case of tumour genes, those from the outside that
originate in viruses. It has been verified from earlier ~:~
re~earch that the e~pression of these gene~ i3 one of ~-:
~he factors that induces viral disease or which causes
celli3 to become cancerous. . .. ~
~. - . . . '
More ~pecifically, when the genes in normal cells
are expressed abnormally, regardle~s of whether the :-
virus gene or tumour gene is internal or externial,
morphological change~, changes in adhesion or abnorm~l :
proliferation occur, the~e being charact~ristic
phenomena associated wi~h viral di~ea~es or cancer.
. ' .
Thu~, drugs that suppres~ ~his type of gene
activation or expres3ion are expected to be developed as
having u~e in the prevention and treatment of viral .
diseases or cancer.
An oligonucleotide having a sequence of the code
chain of a certai~i-gene, or ha~ing a 3equence - ~
complementary to mRNA transcribed from ~aid gene :::
(hereinafter to be referred to a~ an "anti-sense ~ -
oligonucleotide") i8 knowni to demon~trate action in
, ~.
,
; ' . ~ ' , '. ' . : . . ' ; ;; , , ~ , ' , ' ;
,. "'. ' .'' '' ';' ,,:';i' ' ' ', ''
O ~ 2 7
~ - 2
2 ~
inhibiting the expre~9ion of that gene. In particular,
detailed re~earch ha9 been conducted on the action of an
anti-sense oligonucleotide of virus and tumour genes.
For example, it hag been reported ~hat an anti-sense
nucleotide demonstrateg anti-HIV action. In addition,
it has also been reported that an oligonucleotide having
18 ba~e pair~ complementary to ~RNA transcribed from the
c-myb gene inhibit~ the proliferation of cells having
said gene [Proc. Natl. Acad. Sci. USA, Q6, 3379-3383
(1989)~.
However, there are problems with the effects, and
the ~uration of such effects, of oligonucleotides when
they are used a~ antiviral agents and antitumour agents,
these problems including the low up-take efficiency into
cells of naturally-occurring oligonucleotide~, a~ well
as the fact that the oligonucleotide~ are su~ceptible to
decomposition by nuclease~.
In order to compensate for these shortcomings,
variou3 chemically modified derivatives ha~e been
synthesised, and research has been conducted on their
effects again~t virus-infected cells or cells having
tumour gene3 (hereinafter to be simply referred to as
"tumour cells"). In particular, it ha~ been di~covered
that anti-~ense methylphosphonate oligonucleotides, in
which ~he hydroxy groups of the phosphodiestar bond
portion~ are substituted with methyl groups (U.S. Patent
No. 4,511,713) and anti-~en~e phosphorothioate
oligonucleotides, in which the oxygen atoms of the
phosphodiester bond portion~ are substituted with
~ulphur atom~ (Japanese Pate~t ~pplication No.
Hei-1-503302), bring about a decrease in the rate of
formation of colonies and an inhibition of the
proliferation of virus-infected cell~ and tumour cells,
thereby confirming their efficacy as antiviral agents or
antitumour agent~.
,: .:
- 3 -
2 ~ 8
As a result of in~ensive research conducted over an
extended period ~f time, the inventors of the present
invention diScovered that, when studies were conducted
on the effectg of a~ti-9en9e oligonucleotide derivatives
on virus-infected cells and tumour cell3, which
oligonucleotides were obtained by chemical modification
completely different from methods described in the prior
art, or in other words, anti-sense oligonucleotides
wherein the hydroxy group of ~he 5~-position of a 5
terminal nucleotide i8 modified with various
substituents, the~e compounds demonstrated the ability
to suppres~ viral proliferation and tumour cell
proliferation, to suppress the occurrence of viral
diseases and the characteri~tic morphological changes of
tumour cells, and to demon~trate other eff2cts, such as
specific ~uppression of proliferation, thereby leading
to completion of the present in~ention.
In the present specification, adenine is abbreviated
as A, guanine as G, cyto~ine as C, thymine as T, the
adenine nucleotide as A, the guan:ine nucleotide as G,
the cytosine nucleotide as C, and the thymine nucleotide
as T.
In the present invention, viruses are to include
either DNA viruses or RNA viruses.
- ,' .
Examples of DNA viruse~ includ~ adenoviru~,
hepatitis A virus, hepatitis B virus and herpes virus.
Examples of RNA viruce~ include AIDS virus
(hereinafter to be referred to as "HIV"), adult T type
leukaemia virus, influenza viru~ and hepatitis C virus,
of which HIV is the preferred virus referred to herein.
In the present invention, "virus gene~" and "tumour
gene~" generically refer to those genes whose activity
0 4 2 7
~ -- 4
2~S~a~
induce~ normal cell~ to undergo viral lesions or to
become cancerous~regardl~ss~ o~ whether the genes are
internal or external.
More specifically, examples o~ genes which cause
normal cell~ to become cancerous include c-Ha-ras
[Nature, 302, 33-37, (1983); Nature, 300, 149-152,
(1982); Proc. Natl. Acad. Sci. U.S.~., 81, 4771-4775;
and Proc. Natl. Acad. Sci. U.S.A., 81, 5384-5388,
~1984)~, K-ra~ ~Proc. Natl. Acad. Sci. U.S.A., 81,
71-75, (1984)], N-ras ~EM~O.J., 3, 1321-1326 (1984)],
C-Ci9 [Mol. Cell. Biol., 6, 3018-3022, (1986)], c-myc
[Mol. Cell. ~iol., 8, 124-129, ~1988)], myb tProc~ Natl.
Acad. Sci. U.S.A., 83, 9636-9640, (1986)~, erb B
[Nature, 319, 230-234, (1986)], c-jun [Proc. Natl. Acad.
Sci. U.S.A., 85, 914a-9152, (1988)] and src ~Mol. Cell.
Biol., 7, (1978) 1983-1987].
In addition, examples of yenes that cause ~iral ~;
lesions include HIV-l tProc~ Natl. Acad. Sci. USA, 85,
5507-5511 (1988), Proc. Natl. Acad. Sci. USA, 86, -
4244-4248 (1989), Proc. Natl. Acad. Sci. USA, 84,
7706-7710 (1987), Gene, 72, 343-347 tl988), Proc. Natl.
Acad. Sci. USA, B6, 7790-7794 (1989), Proc. Natl. Acad.
Sci. USA, 85, 7079-7083 (1988), Proc. Natl. Acad. Sci.
USA, 83, 4143-4146 (1986)], HSV-l tProc. Natl. Acad. - ;
Sci. USA, 83, 2787-2791 (1986~, Proc. Natl. Acad. Sci.
USA, ~, 6868-6872 (1989~], and VSV [~iochemistry, 25,
6268-6275 (1986), Proc. Natl. Acad. Sci. USA, 84,
648-652 (1987), ~ucleosi~es &-Nucleotides, 8, a25-828
(1989) and Nucleic Acids Res., 1~, 3777-3783 (1990)].
In particular, detailed research ha~ been conducted
regarding HIV-l, and examples of the genes identified
include tat tScience, 229, 69-73 (1985)] and rev - `
LNature~ 321, 412-417 (1986)].
' '
"To be complementary" means that the thymine ~ ;
.: . .
.-
'`.
'.', l ' . '.,, ; . ' . . ' ' ' ':" : . ':: . ,' :: . . ". . '.'. ~:
~ - 5
$
nucleotide is complementary to the adenine nucleotide or ~::
the uracil nucleotide; the cytoisine nucleotide i9
complementary to the guanine nucleotide; the guanine
nucleotide i~ complementary to the cytosine nucleotide; ;:~
and the adenine nucleotide is complementary to the .
thymine nucleotide of a virus gene or of a tumour gene
of DNA itself or of RNA.
"Being complementary to a virus gene or tumour gene"
means that a sequence i9 complementary to the nucleotide
sequence of the code chain side of a tumour gene, or
being complementary to the nucleotide sequence of mRNA
transcribed by a virus gene or tumour gene, either
before or after splicing.
. ~
"A ~ingle base site" refers to a point mutation site
in a tumour gene that causes activation of a tumour
gene, at which 1 or 2 nucleotides of the original
nucleotide sequence are substituted.
The compound of the present invention i3 the .~:
compound repre~ented by the general formula (1).
' ',.,
,' ' , .
,
'i ' . . ~', .
.; .
'',':: , ". ' , : ' ' "' ", '": ''.. 't'~ '. '' ~ , ,:, . '
0 4 2 7
~ 6
.
~ 0 ~ 3
Rl ~:
33 ~ ~
~ . .'
O
- X-f-o
o
,
CH~
\~ \~a :
y t~
f
x- P= o
O -
, .: ,
O ' ~
~b :~
, .
In the above fonmula ~
. .. -; ,.
k represent~ 0 or an integer of 1 to 20; :
m repre~ents 0 or 1;
n represents an integer ~f 4 to 29; ;~
X represents a hydroxy group, a methyl group, a ~.
mercapto group, an alkoxy group having 1 to 4 carbon `:-
atom~ or a monoalkylamino group having 1 to 6 carbon ;.;
atoms;
Y and Z individually represent an oxygen atom or a
sulphur atom; --. .:
R1, R2 and ~3 are the ~ame or different and -.
each represents a hydrogen atom, an alkyl group ~ ;
having 1 to 6 carbon atom~ or an aryl group having 6 : :
to 10 carbon atom3 optionally substituted by a
~ubstituent ~elected from the following group of :~
substituent~ ~; and . ~ .
D and ~ individually repre~ent a re~idue
.
, . . ~
.' ' . ;','~ :
:
2~t~3bS~3
indepen~ently ~elected from the following group of
substituents ~ in regpective nucleotide units,
with the proviso that m = 0 when k = 0, and the base
sequence containing B i8 the base sequence
complementary to a partial tumour gene or ~iru9 gene;
~ : '
Sub~tituents ~:
~ : -
hydroxy groups, alkyl groups having 1 to 6 carbonatom~, alkoxy groups ha~ing 1 to 6 carbon atoms,
methylenedioxy groups, nitro group~, azide groups,
halogen atom~, aryl groups having 6 to 10 carbon atoms,
aryloxy group~ having 6 to 10 carbon a~oms and
aralkyloxy group~ in which the aryl moiety ha~ from 6 to : ~ .
10 carbon atom~ and the alkyl moiety has 1 or 2 carbon
atom~;
Substituent~ ~:
adenine (A~, guanine (G), cytosine (C) and thymine
(T)~
..
In addition, the pre~ent invention relates to an -
- antiviral agent and antitumour agent having as its
active ingredient a compound of general formula (1), a~ :.
defined above, or a salt thereof.
~ '~
The "base seguence containing B" refers to the
following formula:
, ,
vr .. - .-, , , .. , . - ; ;.;. , . . ., . .. .. , . . .... .. , . i ,.. ,.. . . ... ~. I ., - . :
O ~ 2 7
~ - 8 - .
2~6~
I
: X- P= o
o
,, . __I , "
H0
- - ~. .. :.
:: wherein, when n i~ more than 1, each B may be the same . ~.~
~ or different. .:
: In the above-mentioned general formula (1), examples
~:~ of X in the form of an alkoxy group having 1 to 4 carbon
atoms include the methoxy, ethoxy, propoxy, isopropoxy, . :
butoxy, i~obutoxy, s-butoxy and t-butoxy groups;
preferably the methoxy and ethoxy groups.
' ''~-"",
: : In the above-mentioned general formula (1), examples
j - of X in the form of a mo~oalkylami.no group having from 1 ~`
to 6 carbon atom~ include the methylamino, ethylamino,
~ propyl~mino, isopropylamino, butylamino, i~obutylamino, .
I s-butylamino, t-butylamino, pentylamino, isopentylamino,
. . .
2-methylbutylii~mino, neopentylamino, 1-ethylpropylamino,
hexylamino, 4-methylpentylamino, 3-methylpentylamino, . : :
2-methylpentylami~o, 1-methylpentylamino,
3,3-dimethylbutylamino, 2,2-dimeth~lbutylamino, ; .
dimethylhutylamino, 1,2-dimethylbutylamino, ~::
1,3-dimethyibutylamino, 2,3-dimethylbutylamino and :. .
2-ethylbutylamino groups; preferably 3uch groups having
. from 1 to 4 carbon atoms, and more preferably the
ethylamino, propylamino and butylamino groups.
Z ' -.'
' ' , '
.
In the above-mentiOned general formula (1), exampleg
of R1, R2 and R3 in the form of alkyl groups
having from 1 to 6 carb~n atom~ include the methyl,
et~yl, propyl, isopropyl, butyl, isobutyl, s-butyl,
t-butyl, pentyl, isopentyl, 2-methylbutyl, neopentyl,
1-ethylpropyl, hexyl, 4-methylpentyl, 3-methylpentyl,
2-methylpentyl, 1-methylpantyl, 3,3-dimethylbutyl,
2,2-dimethylbutyl, 1,1-dimethylbu~yl, 1,2-dimethylbutyl,
: 1,3-dimethylbutyl, 2,3-dimethylbutyl and 2-ethylbutyl
groups, and preferably tho~e having from 1 to 4 carbon
atoms.
In the above-mentioned general formula (1), examples :
of Rl, R2 and R3 in the fonm of aryl group3 :
include the phenyl, 1-naphthyl, 2-naphthyl, 1-anthryl
and 2-anthryl group~, pre$erab1y the phenyl and naphthyl
group~, and more preferably a phenyl group.
:
In the above-mentionad general formula (1), examples
of R1, R2 and R3 in the form of alkyl group3
having from 1 to 6 carbon atom~ a~ ~ub~tituted portions
of aryl groups include the methyl, ethyl, propyl, . :
isopropyl, butyl, isobutyl, 3-butyl, t-butyl, pentyl,
isopentyl, 2-methylbutyl, neopentyl, 1-ethylpropyl,
hexyl, 4-methylpentyl, 3-methylpe~tyl, 2-methylpentyl,
1-methylpentyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl,
1,1-dimethylbutyl, 1,Z-dimethylbutyl, 1,3-dimethylbutyl,
2,3-dimethylbutyl and 2-ethylbutyl group3, preferably
such groups having from 1 to 4 carbon atoms, and more
preferably the i~opropyl and t-butyl groups.
In the above-mentioned general formula (1~, example3
of R1, R~ and R3 in the form of alkoxy group3
having from 1 to 6 carbon atoms ae ~ub~tituted portions
of aryl group3 include the methoxy, ethoxy, propoxy,
i~opropoxy, butoxy, i~obutoxy, s-butoxy, t-butoxy,
pentoxy, i~opentoxy, 2-methylbutoxy, neopentoxy,
,. . .
2~ ;3~
hexyloxy, 4-methylpen~oxy, 3-methylpentoxy,
2-methylpentoxy~ 3~3-dimethylbutoxY~ 2,2-dimethylbutoxy,
1,1-dimethylbutOxy/ 1,2-dimethylbutoxY,
1,3-dimethylbutoxy and 2,3-dimethylbuto~y groups,
preferably ~uch groupg having 1 to ~ carbon atoms, and
more preferably the methoxy and ethoxy groups. ~
:'.; .'
In the above-men~ioned general formula (1), examples
of R1, R2 and R3 in the form of halogen atoms as
~ubstituent~ of aryl groups include the fluorine,
chlorine, bromine and iodine atoms, and preferably the
fluorine, chlorine and bromine atoms.
In the above-mentioned general formula (1), examples
of R1, R2 and R3 in the form of aryl groups having
from 6 to 10 carbon atoms a~ sub~titue~t~ of aryl groups
include the phenyl, 1-naphthyl, 2-naphthyl, 1-anthryl
and 2-anthryl group~, preferably the phenyl and naphthyl
group~, and more preferably the phenyl group.
~.
In the above-mentioned general formula ~1), examples
of Rl, R2 and R3 in the form of aryloxy groups
having from 6 to 10 carbon atoms a3 substituents of aryl
group~ include the phenyloxy, 1-naphthyloxy,
2-naphthyloxy, 1-anthryloxy and 2-anthryloxy groups, and
preferably the phenyloxy and naphthyloxy groups.
In tha above-mentioned general formula (1), examples
of R1, R2 and R3 in the form of aralkyloxy groups
with an aryl moiety having from 6 to 10 carbon atom~ and
an alkyl moiety ha~ing 1 or 2 carbon atoms, which groups
are substituents of aryl group~, include the
phenylmethyloxy, phenethyloxy, 1-naphthylmethyloxy,
2-naphthylethyloxy and 2-anthrylmethyloxy groups, an~
preferably the phenylmethyloxy and naphthylmethyloxy
group-. :
,
'
.. ,.,, ,.,. ,,,,.,.,.. ,.. ,, .. , . ,.. ~........... .
O ~ 2 7
- 11 -
2~&~
In the above-mentioned general formula (1), n is
preferably 8 to 29, and more preferably 13 to 18-
In the above-mentioned general formula (1), k is
preferably 0 to 15, and more pre~erably 0 to 12.
In the above-mentioned general formula (1), while
the base sequence contai~ing B include~ all base
sequences, provided that they are se~uences
complementary to a virus gene or tumour gene, preferable
examples of ~aid sequence are as listed below.
(1) A base ~equence of 9 to 30 base~ complementary to
all or a part o~ a nucleotide se~uence including ba~e
number 7947 to base number 7975 of the HIV gene ~Nature
313, 450-458 (1985)]; and
(21 A base ~equence o~ 14 to 19 bases complementary to
all or a part of a nucleotide seq~lence including base
number 7947 to ba~e number 7975 of the HIV gene. --
In addition,
(3) the base seguence containing B i9 a base sequence of
9 to 30 ba~es com~lementary to all or a part of a region
of 30 nucleotide~ spanning a particular nucleotide which
i~ les~ than 30 nucleotides from a translation -~
initiation site in a tumour gene;
(4) the baae se~uence containing ~ i~ a ba~e sequence of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which i~
less than 30 nucleotides from a translation initiation
site in a tumour gene;
(5) the base sequence containing ~ i9 a base sequence of
9 to 30 ba~es complementar~ to all or a part of a region
' ', . ~ '' ', . " ' , ' " ' ' . . . ..
- 12 -
of 30 nucleotides spanning a particular nucleotide which
is less than 5 nucleotides from a translation initiation
site in a tumor gene;
(6) the base sequence containing B is a base sequence of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is
less than 5 cucleotides from a translation initiation
site in a tumour gene;
(7) the base sequence containing B is a base sequence of
9 to 30 bases complementary to all or part of a region
of 30 nucleotides spanning a particular nucleotide which
is a single base site in a tumour gene;
(8) the base sequence containing B is a base sequence of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is a
single base site in a tumour gene;
(9) the base sequence containing B is a base sequence of
9 to 30 bases complementary to all or part of a region
of 30 nucleotides spanning a particular nucleotide which
is less than 5 nucleotides from a single base site in
ras and c-myb tumour genes; and,
(10) the base sequence containing B is a base sequence
of 14 to 19 bases complementary to a part of a region of
30 nucleotides spanning a particular nucleotide which is
less than 5 nucleotides from a single base site in ras
and c-myb tumour genes.
In the above-mentioned general formula (1),
preferred compounds include:
2) A compound wherein:
k is 0 to 20,
0 4 2 7
- 13 -
2~9~J~
m is 0 or 1,
n i9 4 to 29, ~:~
X is a hydroxy group,
Y is an oxygen or a sulphur atom,
Z i9 an oxygen or a ~ulphur atom,
R1, R2 and R3 are the same or dif~erent and
each represent~ a hydrogen atom, an alkyl group having 1
to 6 ~arbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of substituents ~; and
the base sequence containing B is a base sequence
complementary to a tumour gene or a virus gene;
Substituents a: .
: '
hydroxy group~, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms, .
aryloxy groups ha~ing 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl mo.iety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon ~ .:
atoma.
3) A compound wherein:
k is O to 15,
m i9 o or 1,
j n is 8 to 29, ;~
~:: X is a hydroxy group, a methyl group, a mercapto
~ group, a~ alkoxy group having 1 to 4 carbon atom~ or a
i monoalkyl amino group ha~ing 1 to 6 carbon atoms,
Y i~ an oxygen or a sulphur atom,
Z i9 an oxygen or a sulphur atom,
R1, R2 and R3 are the ~ame or diff~rent and
each represents a hydrogen atom, an alkyl group having 1
~o 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally ~ubstituted by a substituent selected
.
~-.
,: . . . . .
,... , , . : . ~ . ,: .:
O ~ 2 7 : ~ ~
~ - 14 -
2 1~ 3 6 ~i 8
from the following group of substituents a; and :
the base se~uence containi~g B i~ a base sequence
complementary to a tumour gene or a VirU9 gene;
Substituents a: ~ ~
' ' .
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy group~, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl moiety having 6 to 10 -~
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms.
' '
4) A compound wherein:
k is O to 15,
m is O or 1,
~ i9 8 to 29,
X i3 a hydroxy group,
Y is an oxygen or a ~ulphur atom,
Z i~ an oxygen or a ~ulphur atom,
Rl, R2 and R3 are the ~ame or different and
each repreRents a hydrogen atom, an alkyl group having 1
to 6 carbon atom3 or an aryl group having 6 to 10 carbon
atom~ optionally sub~tituted by a ~ub~tituent sélected
from the following group of ~ubstituents a; and
the base sequence containing B is a ba3e sequence -~
complementary to a tumour gene or a virus gene;
Sub~tituent~ a
hydroxy groups, alkyl group~ having 1 to 6 carbon
atoms, alkoxy groups ha~ing 1 to 6 carbon atoms, - ~
methylenedioxy groups, nitro groups, azide groups, : ~:
halogen atoms, aryl group~ having 6 to 10 carbon atoms,
aryloxy group~ having 6 to 10 carbon atoms and
',
0 1 2 7
~ 15 -
2 ~ 9 ~
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atom~.
5) A compound wherein:
k is O to 12,
m is O,
n is 13 to 18,
X is a hydroxy group, a methyl group, a mercapto
group, an alkoxy group ha~ing 1 to 4 carbon atoms or a
monoalkyl amino group having 1 to 6 carbon atoms,
Y is an oxygen or a sulphur atom,
Z i8 an oxygen or a sulphur atom,
Rl, R2 and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1 .
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally 3ub~tituted by a substituent selected
from ~he following group of ~ubstituents a; and ~:
the base ~equence containing B is a biase sequence
complementary to a tumour gene or a virus gene;
Substitue~
hydroxy groups, alkyl groups having 1 to 6 carbon
atom~, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups haviny 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atom~ and
aralkyloxy group~ with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms.
6) A compound wherein:
k is 0 to 12,
m i9 0 or 1,
n is 13 to 18,
X is a hydroxy group,
.
,. .', ;, ,. , , : , ' , ,
O ~ 2 7
~ 1 6
7 8 ~ :
Y i5 an oxygen or a sulphur atom,
Z i~ an oxygen or a sulphur atom,
R1, R2 and R3 are the 9ame or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atom9 or an aryl group having 6 to 10 carbon :
atoms optionally substituted by a substituent selected
from the following group of substituen~ ~; a~d
the base seguence containing ~ i~ a base sequence
complementary to a tumour gene or a viru~ gene;
Sub~tit~ents a:
,~
hydroxy group~, alkyl groups having 1 to 6 carbon
atom~, alkoxy group~ having 1 to 6 carbon atoms,
met~ylenedioxy groups, nitro groups, azide group~,
halogen atoms aryl groups having 6 to 10 carbon atoms,
aryloxy group~ having 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety ha~ing 1 or 2 carbon .
atoms.
7) A com~ound wherein:
k is 0 to 12,
m i~ O or 1,
n i~ 13 to 18,
X is a hydroxy group,
Y i9 an oxygen atom,
Z i~ an oxygen atom,
Rl, R2 and R3 are the same or dif~erent and
each repre~ent~ a hydroge~ atom, an alkyl group having 1 ~ ;;
to 4 carbon atoms or an aryl group having 6 to 10 carbon `~
atom~ optionally substituted by a substituent selected
from the following group of ~ubstituents '; and
the base sequence containing B is a base 3equence
complementary to a tumour gene or a viru~ gene; ~ .
"' '' "
" ,~"." " ,'.. ,;;." ",, ", ,, "-" , ;.,,,~
- - 1 7
2 ~ 9 ~
Substituent~
hydroxy groups, alkyl group5 having 1 to 4 carbon
atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl
groups, naphthyl group~, phenyloxy group3,
phenylmethyloxy groups and naphthylmethyloxy groups.
8) A compound whexein: :
k is 0 to 12, :
m i~ O or 1, r-
n i9 13 to 18,
X is a hydroxy group,
Y i~ an oxygen atom, :
Z i~ an oxygen atom~ .
R1, R2 and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 4 carbon atom~, or a phenyl group optionally
~ubstituted by a substituent selected from the following
group of substituents a; and
the base sequence containing B is a ba~e ~equence
complementary to a tumour gene or a virus gene;
Substituents a ~:
methyl groups, ethyl group~, propyl groups, t-butyl
groups, methoxy groupe, ethoxy groups, propoxy groups,
t-butoxy groups and phenylmethyloxy group~.
9) A compound wherein:
k is ~ to 20,
m i9 0 or 1,
n i5 4 to 29,
X i~ a hydroxy gxoup, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, OE a
monoalkylamino group having 1 to 6 carbon atom~,
Y i9 an oxygen or a sulphur atom,
Z i9 an oxygen or a 3ulphur atom,
: .... . . ; . . , . ., . ~ .. .
:. , . : .. . : , ... .. .. . .
0 4 2 7
- 1 8
2 a ~ 8 : ~
Rl, R2 and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atom3 optionally substituted by a ~ubstituent selected
from the followiny group of substituents ~; and
the base sequence containing B is a base ~equence of
9 to 30 ba9es complementary to all or a part of a
nucleotide ~equence including bai~e number 7947 to base .
number 7975 of the HIV gene;
~'
Substituent~
,'
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy group3 having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups ha~ing 6 to 10 carbon atom~
aryloxy group~ having 6 to lQ carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon :~
atoms.
lO).A compound wherein~
k i~ 0 to 20, ~
m is 0 or 1, -
n i9 4 to 29,
: X is a hydroxy group,
Y is an oxygen or a sulphur atom,
Z i~ an oxygen or a ~ulphur atom,
Rl/ R2 and R3 are the same or different and
each represent~ a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl groups having 6 to 10 1 ;
carbon atoms optionally substituted by a sub~tituent
selected from the following group of subi~tituents x; ~:
and - .
the baae sequence containing B i~ a ba2e sequence of
9 to 30 ba~es complementary to all or a part of a
nucleotide sequence including base number 7947 to base : .
....
O ~ 2 7
1 9
2096~a8
number i975 of the HIV gene; -
: ,
Substituents ~
.
hydroxy groups, alkyl grOUp5 having l to 6 carbon
atom~, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro group~, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom and an alkyl moiety having 1 or 2 carbon
atoms.
11) A compound wherein:
k i~ O to 15,
m is O or 1,
n i9 8 to 29,
X i9 a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkyl~mino group having 1 to 6 carbon atoms,
Y i8 an oxygen or a sulphur atom,
Z i9 an oxygen or a sulphur atom,
R1, R2 and R3 are the ~ame or different and
each represents a hydrogen atom, an alk~1 group ha~ing 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally sub~titu~ed ~y a sub9tituent selected
from the following group o~ substituents ~; and
the base ~equence containing B i~ a base sequence of
9 to 30 bases complementary to all or a part of a
nucleotide sequence including ba~e number 7947 to base
number 7975 of the HIV gene;
Sub~ituents a:
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
O ~ 2 7
~ 20 -
2 ~ 9 ~ ~ S 8
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
12) A compound wherein:
k is O to 15,
m i~ O or 1,
n i~ 8 to 29, ~;:
X i9 a hydroxy group,
Y i9 an oxygen or a 3ulphur atom, -':
Z i9 an oxygen or a sulphur atom,
Rl, R2 and R3 are the same or di~ferent and :.
each repre~ents a hydrogen atom, an alkyl group having 1
to 6 carbon atom~ or an aryl group having 6 to 10 carbon
atoms optionally sub~tituted by a substituent selected ~:
from the following group of ubi3tituents a; and
the base sequence containing B is a base sequence of ::
9 to 30 basPs complementary to all or a part of a
nucleotide sequence including base number 7947 to base
number 7975 of the ~IV gene;
Substituents a: ;
. '
hydroxy groups, alkyl group having 1 to 6 carbon
atoms, alkoxy group having 1 to 6 carbon atome,
methylenedioxy groups, nitro sroups, azide group~,
halogen atomi~i, axyl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and . .
aralkyloxy group~ with a~ aryl moiety having 6 to 10
carbon atoma and an alkyl moiety having 1 or 2 carbon
atom~.
: ~
13) A compound wherein~
k i~ O to 12, .
m i~ 0,
~. .
. . . , , , . , . , ,. . , , ,, ,, , . ,. . . ,, ;.. ,.. . . , ., :
O ~ 2 7
- 21 -
2 ~
n iB 13 ~0 18,
X i9 a hydro~y group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atom~,
Y i9 an oxygen or a sulphur atom,
Z is an oxyge~ or a sulphur atom,
R1, R2 and R3 are the ~ame or di~erent and
each repre9ent9 a hydrogen atom, an alkyl group having 1
to 6 carbon atom9 or an aryl group having 6 to 10 carbon ~ :
atoms optionally substituted by a substituent selected
from the following group of sub~tituents ~; and -
~he ba~e ~equence containing B is a base ~equence of
9 to 30 ba3es complementary to all or a part of a
nucleotide sequence including base number 7947 to base
number 7975 of the HI~ gene;
Substituent~ a:
hydroxy group , alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms, : --
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl group3 having 6 to 10 carbon atoms, ~.
aryloxy groups having 6 to 10 carbon a~oms and
aralkyloxy groups with an aryl moiety having 6 ~o 10
carbon ato~ and an alkyl moiety having 1 or 2 carbon
atoms.
14) A compound wherein:
k is 0 to 12,
m i~ O or 1,
n i9 13 to 18,
X i~ a hydroxy group,
Y i9 an oxygen or a sulphur atom,
Z i~ an oxygen or a sulphur atom,
R1, R2 and R3 are the ~ame or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
:, : . . :,;~
,.~ . , . . ,, . ... : .: , ,
O ' 2 7
r
atoms optionally substituted by a substituent selected -~
from the following group of substituents ~; and
the base seguence containing B i9 a base sequence of
g to 30 bases complementary to all or a part of a
nucleotide sequence including base number 7947 to base
number 7975 of the HIV gene;
Substituents a:
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy group~ having 1 to 6 carbon atom~
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
caxbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms.
15) A compound wherein:
k i~ O to 12, -
m is O or 1,
n i9 13 to 18, .;~:
X is a hydroxy group, ~ :
Y is an oxygen a~om, :. .
Z i9 an oxygen atom, ~. .
Rl, R2 and R3 are the same or different and
each represent~ a hydrogen atom, an alkyl group having 1
to 4 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally sub~tituted by a substituent selected .
from the following group of substituents a '; and
the base sequence containing 8 i9 a base sequence of . ~:
9 to 30 bases complementary to all or a part of a
nucleotide ~equence including base number 7947 to base
number 7975 of the HIV gene; :
.'~ ".
O ~ 2 7
- 23
213~) 6 ~ ~ 8
Substituents a ~
nydroxy groups, alkyl group9 having 1 to 4 carbon
atom3, alkoxy groups having 1 to 4 carbon atoms, phenyl
groupsj naphthyl group~, phenyloxy groups,
phenylmethyloxy groups and naphthylmethyloxy groups.
16) A compound wherein:
k is 0 to 12,
m is 0 or 1,
n is 13 to 18,
X is a hydroxy group,
Y i9 an o~ygen atom,
Z is an oxygen atom,
Rlj R2 and R3 are the same or different and
each repre~ents a hydrogen atom, an alkyl group having 1
to 4 carbon atoms, or a phenyl group optionally
3ubstituted by a substituent ~elec~ed from thé following
group of ~ub,3tituent9 ~"; and
the base sequ~nce containing B i9 a base sequence of
9 to 30 ba~es complementary to all or a part of a
nucleotide sequence including base number 7947 to base
number 7975 of the HIV gene;
Substituent~ a 1'
methyl groups, ethyl gxoup~, propyl group~, t-butyl
groups, methoxy groups, ethoxy groups, propoxy groups,
t-butoxy groups and phenylmethyloxy groups.
17) A compound wherein: .
k iis 0 to 20,
m is 0 or 1,
n i8 4 to 29,
X i~ a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atom~, or a :
monoalkylamino group having 1 to 6 carbon atoms,
0 4 2 7
- 24 -
" . , .
2~9~6~
Y i~ an oxyyen or a ~ulphur atom,
Z i~ an oxygen or a sulphur atom,
R1, R2 and R3 are the ~ame or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of sub~tituents ~; and
the base se~uence containing B i~ a base sequence of
14 to 19 base~ complementary to a par~ of a nucleotide .
seque~ce including base number 7947 to base number 7975
of the HIV gene; .
: Substi~uents_~:
hydroxy group~, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups, ~ ~ .
halogen atoms, aryl group~ having 6 to 10 carbon atoms,
axyloxy groups having 6 to 10 carbon atom~ and -~
aralkyloxy group~ with an aryl moiety having 6 to 10 . :
carbon atom~ and an alkyl moiety having 1 or 2 carbon :
atom~
18~ A compound wherein~
k is 0 to 20,
m i~ 0 or 1, i
n is 4 to 2g,
X is a hydroxy group,
Y is an oxygen or a ~ulphur atom,
Z i~ an oxygen or a sulphur atom,
R1, R2 and R3 are the ~ame or different and
each represents a hydrogen atom, an alkyl group having 1 ~:
to 6 carbon atom~ or an aryl group having 6 to 10 carbon
atoms optionally sub~tituted by a ~ubstituent ~elected
from the following group of sub~tituents a; and
the ba~e se~uence containing B is a base sequence of :
14 to 19 ba~e~ complementary to a part of a nucleotide
";,, , ,, ;,~ ";~ ,,., ":~,."'
- 25 -
- 20~v6~
including base number 7947 to base number 7975 of the
HIV gene;
Substituents ~:
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having l to 6 carbon atoms,
methylenedioxy groups, nitro group~, azide groups,
halogen atom~, a~yl groups ha~ing 6 to 10 carbon atoms,
aryloxy groups ha~lng 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 tp 10
carbon atoms and an alkyl moiety havi~g 1 or 2 carbon
atoms.
19) A compound wherein-
k is 0 to 15,
m i~ O or l,
~ is 8 to 29,
X i9 a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having-1 to 6 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atoms,
Y is an oxygen or a ~ulphur atom,
Z i9 an oxygen or a sulphur atom,
Rl, R2 and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atom~ or an aryl group having 6 to 10 carbon
atom~ op~ionally ~ubY~ituted by a subs~ituent ~elected
from the following group of ~ubstituents a; and
the base ~equence containing B i9 a base sequence of
14 to 19 bases complementary to a part of a nucleotide
sequence including base number 7947 to ba~e number 7975
of the HIV gene;
Substituents ~:
hydroxy groups, alkyl groups having 1 ~o 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
,,, .,: , .. : , , , ,,.,, :.. ,,, . .. : .. , ... . ., ~ ., .. , ., . ",
- 26 -
6~3 8
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with ~n aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
- .
20) A compound wherein:
k is O to 15,
m i~ O or 1,
n is 8 to 29,
X i9 a hydroxy group, . ~-
Y i9 an oxygen or a sulphur atom,
Z i8 an oxygen or a sulphur atom, : -~
Rl, R2 and R are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon a~om~ or an aryl group having 6 to 10 carbon
atom3 optionally substituted by a substituent selected
from the following group of sub~tituents a; and
the base ~equence containing B i9 a base sequence o~ ~ -
14 to 19 bases complementary to a part of a nucleotide
se~uence including base number 7947 to ba~e number 7975 : :
of the HIV gene;
Su~stituçn~s a:
hydroxy group~, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atom~, :
methylenedioxy groups, nitro groups, azida groups,
halogen atoms, aryl group~ having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atom~
. .
21) A compound wherein:
k i~ O to 12,
O ~ 2 7
~ - 27 -
209~8
m is 0,
n is 13 to 18,
X is a hydroxy group, a methyl group, a mercapto
gxoup, an alkoxy group having 1 to 4 carbon atoms, or a
monoalky~amino group having 1 to 6 carbon atoms,
Y is an oxygen or a sulphur atom,
Z is an oxygen or a sulphur atom,
Rl, R2 and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atom9 or an aryl group having 6 to 10 carbon
atom~ optionally ~ub~tituted by a substituen~ selected
from the following group of substituents a; and
the base ~equence containing ~ i~ a base sequence of
14 to 19 bases complementary to a par~ of a nucleotide
~equence including base number 7947 to ba~e number 7975
of the ~IV gene;
Sub~tituçnts ~
hydroxy groups, alkyl group~ having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atom~,
methylenedioxy groups, nitro groups, azide groups,
halogen atom~, aryl group~ having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms.
22) A compound wherein:
k is ~ to 12,
m is O or 1,
n is 13 to 1~,
X iY a hydroxy group,
Y i~ an oxygen or a ~ulphur atom,
Z i~ an oxygen or a sulphur atom,
Rl, R2 and R3 are the ~ame or different and
each represents a hydrogen atom, an alkyl group having 1
~ 28 ~ 20~
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of substituents ~; and
the base ~equence containing B i8 a base sequence of
14 to 19 base3 complementary to a part of a nucleotide
seguence including base number 7947 to base number 7975 -~
of the HIV gene; ~
Substituents a: :
. '
hydroxy gxoup3, alkyl groups having 1 to 6 carbon
atoms, alkoxy group~ having 1 to 6 carbon atoms,
methylenedioxy groups, nitro group~, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atom~.
,
23) A compound wherein:
k is O to 12,
m is O or 1,
n is 13 to 18, ::
X is a hydroxy group,
Y i~ an oxygen atom,
Z i~ an oxygen atom,
R1, R2 and R3 are the ~ame or different and
each reprei~ent~ a hydrogen atom, an alkyl group ha~ring 1
to 4 carbon atoms or an aryl group ha~ing 6 to 10 carbon ;~
atom~ optionally substituted by a substituent selected : :
from the following group of subYtituents a '; and
the base sequence containing B is a ba e sequence of
14 to 19 ba~e~ complementary to a part of a nucleotide
3e~uence including base number 7947 to base number 7275
of the HIV gene; : ;
'~,
,
,
s
0 4 2 7
- 29
2~9~3l~
Sub~^tituents a~
hydroxy group~, alkyl groupS having 1 to 4 carbon
atom~, alkoxy group~ having 1 to 4 carbon atoms, phenyl
groups, naphthyl groups, phenyloxy groups,
phenylmethyloxy groups and naphthylmethyloxy groups.
24) ~ compound wherein:
~ is 0 to 12,
m i8 0 or 1,
n i~ 13 to 18,
X i9 a hydroxy group,
Y iis an oxygen atom,
Z i~ an oxygen atom,
Rl, R2 and R3 are the same or different and
~ach represents a hydrogen atom, an alkyl group having
to 4 carbon atoms, or a phenyl group optio~ally
sub~tituted by a substituent select~d from the following
group of subs~ituents "; and
the ba~e sequence containing B is a base ~equence of
14 to lg bases complementary to a part of a nucleotide
sequence including base number 7947 to base number 7975
of the HI~ gene;
,
Sub~tituen~s a
methyl group~, ethyl groups, propyl groups, t-butyl
group~, methoxy groups, ethoxy groups, propoxy groups,
t-butoxy groups and phenylmethyloxy group~.
25) A compound wherein~
k is 0 to 20, ~ ;
m i9 0 or 1,
n is 4 to 29,
X is a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms or a
mo~oalkylamino group having 1 to 6 carbon atoms,
:.
";,
0 4 2 7
30- 209G6~8 - -
.
.
Y is an oxyge~ or a sulphur atom,
Z i9 an oxygen or a sulphur atom,
Rl, R2, and R3 are the ~ame or different and ~
each represents a hydrogen atom, an alkyl yroup having 1 ~ :
to 6 carbon atom~ or an aryl group having 6 to 10 carbon .
atoms optionally substituted by a gubstituent selected -~.
from the following group of substi~uent3 a; and :
tha base sequence containing B i~ a base sequence of -~
9 to 30 bases complementary to all or a part of a region
of 30 nucleotides ~panning a particular nucleotide which ~::
is less than 5 nucleotides ~rom a tranelation initiation
site in a tumour gene;
':
Sub~tituents a: -
' ~ '
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups, :
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms. i~
;;
26) A compound wherein: :
k is 0 to 20,
m is 0 or 1,
n i8 4 to 29,
X i9 a hydroxy group,
Y is ~n oxyge~ or a sulphur atom,
Z i8 an oxygen or a sulphur atom,
Rl, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group ha~ing 6 to 10 car~on
atoms optionally substituted by a substituent selected :
from the following group of substituents ~; and
the base sequence containing B i~ a base ~equence of : .
~, . . ,. . , .. , , . . ., . . . , .. ,. ." .. , . ... , .. " . .. ~ .. . - . . . . . .
.
0 4 2 7
~ - 31 -
2~9~6~8
9 to 30 bases complementary to all or a part of a region
of 30 nucleotide3 spanning a particular nucleotide which
is less than 5 nucleotideg from a translation initiation
site in a tumour ~ene;
Substituent~ a:
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atom3, aryl groups ha~ing 6 to 10 carbon atoms,
aryloxy groups ha~ing 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl moiety ha~ing 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms.
:
27) A compound wherein:
~ is O to 15,
m i9 0 or 1,
n is 8 to 29,
X is a hydroxy group, a methyl group, a mercapto . :- -
group, an alkoxy group having 1 to 4 carbon atom~, or a
monoalkylamino group having 1 to 6 carbon atom~, :
Y i~ an oxygen or a sulphur atom, ~ --
Z i8 an oxygen or a ~ulphur atom, .:
R1, R2, and R3 are the ~ame or different and ~:
each repre~ents a hydrogen atom, an alkyl group having 1 ~:
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally ~ubstituted by a sub~tituent selected
from the following group of substituents ~; and
the base sequence containing B i~ a base ~e~uence of
9 to 30 base~ complementary to all or a part of a region
of 30 nucleotides spanning a particular nucleotide which
i~ less than 5 nucleotides from a translation initiation
3ite in a tumour gene:
- 32 - :
2~9~38
Substituents ~:
hydroxy groupY, alkyl group~ having 1 to 6 carbon ~.
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy group~, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
28) A compound wherein:
k is O to 15,
m i9 0 or 1, ::
n is 8 to 29,
X i9 a hydroxy group,
Y i9 an oxygen or a sulphur atom,
Z i~ an oxygen or a ~ulphur atom, -
Rl, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1.
to 6 carbon atom~ or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of substituents ; and
the base sequence containing ~ i9 a base sequence of .
9 ~o 30 bases complementary to all or a part of a region :~
of 30 nucleotides spanning a particular nucleotide which
i9 le~ than 5 nucleotides from a translation initiation
site in a tumour gene; ~-
Sub~ti~uents ~
hydroxy group~, alkyl group~ having 1 to 6 carbon
atom~, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
o 4 2 7
~ ~ 33 ~ 2 ~ 9 ~ ~ 5 ~
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
29) A compound wherein:
k is O to 12,
m is o, ~ :
n is 13 to 18,
X is a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to ~ carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atoms,
Y is an oxygen or a sulphur atom,
Z is an oxygen or a sulphur atom,
R1, R2, and R3 are ~he same or different and -
each represents a hydrogen atom, an alkyl group having 1 :
to 6 carbon atoms or an aryl group ha~ing 6 to 10 carbon :
atoms optionally i~ubs~ituted by a isubstituent selected : :
from the following group of substituents ); and
the base sequence containing ~ i9 a base seguence of ~ :
9 to 30 base~ complementary to all or a part of a region
of 30 nucleotide~ spanning a particular nucleotide which
is less than 5 nucleotides from a translation initiation
site in a tumour gene;
Sub~tituents a: :
~ ''
hydroxy groupis, alkyl groups having 1 to 6 carbon
atom~, alkoxy groups ha~ing 1 to 6 carbon atoms,
methylenedioxy groups, nitro group~, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms, ;~
aryloxy groups having 6 to 10 carbon atomis and -~
aralkyloxy groups with an aryl moiety having 6 to 10 ::
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
,
30) A compound wherein: .
k ii~ O to 12,
m i~ O or 1, ~.
. , ,
O ~ 2 7
- 34 -
2~9~5~ :
n is 13 to 18,
X is a hydroxy group,
Y i9 an oxygen or a sulphur atom,
Z is an o~ygen or a sulphur atom,
Rl, R2, and R3 are the same or different and
each represents a hydrogen atom; an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent ~elec~ed
from the following group of substituents ~; and
the base se~uence containing B is a ba~e sequence of
9 to 30 bases complementary to all or a part of a region ~ -
of 30 rlucl~otide3 spanning a particular nucleotide which
i~ le9~ than 5 nucleotides from a translation initiation
~ite in a tumour gene;
Substituente
hydroxy groups, alkyl groupY having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy group~, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl moiety having 6 to 10 -:
carbon atom~ and an alkyl moiety having 1 or 2 carbon
a~oms. . ~j :
31) A compound wherein: .
k i~ O to 12 J ~ -
m l8 0 ox 1,
n i~ 13 to 18, :-
X is a hydroxy group,
Y i9 an oxygen atom,
Z i9 an oxygen atom,
R1, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 4 carbon atoms or an aryl group having 6 to 10 carbon . :
atoms optionally substituted by a sub~tituent selected ~;
' ' ' ' ' ' ,.'~ '' ' ', `"' " ' ' '
O ~ 2 7
from the following group of substitu2e~t9s~a', and
the base seq~ence containing B is a base sequence of
9 to 30 bases complementary to all or part of a region
of ~ nucleotides spanning a particular nucleotide which
i9 les~ than ~ nucleotides from a translation
initiation 8ite in a tumour gene;
Substituents a~:
~ '. ',
hydroxy groups, alkyl groups having 1 to 4 carbon
atom~, alkoxy groups having 1 to 4 carbon atoms, phenyl
groups, naphthyl groups, phenyloxy groups, . ~:
phenylmethyloxy groups and naphthylmethyloxy groups.
32) A compound wherein~
k is 0 to 12, :~
m i~ O or 1, . .:
n is 13 to 18,
X is a hydroxy group,
Y i9 an oxygen atom, ~::
. . .
Z i9 an o~ygen atom, :: .
R1, R2, a~d R3 are the same or different and ..
each represents a hydrogen atom~ aIl alkyl group having 1
to 4 carbon atoms, or a phenyl group optionally :: -
substituted by a substituent selected from the following
group of subs~ituent~ ~"; and ~:
the ba~e Yequence containing B i3 a base sequence of ~-
9 to 30 ba~e~ complem~ntary to all or a part of a region
of 30 nucleotide~ ~panning a particular nucleotide which
i8 le. 8 than 5 nucleotides from a tran~lation initiation
site in a tumour gene;
.:
Substituents a " ~
` '
methyl groups, ethyl groups, propyl groups, t-butyl :~
group~, methoxy group~, ethoxy group~, propoxy groups,
t-butoxy group~, and phenylmethyloxy group~. :
:- "', :. '
'~' ' ' ' ' . " , ' ' ' ' ' ' ' ' ':' ' ' ' " .,',, ' ''.. ' ~ ';' . .' " . ''i ' ' ': ' '
0 4 2 7
- 36 ~ 209~B~
3 3 ) A compound wherein:
k i~ O to 2 O,
m i~ O or 1,
n i~ 4 to 29, - -'
X is a hydroxy group, a methyl group, a mercapto :~
group, an alko~y group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to-6 carbon atoms,
Y is an oxygen or a ~ulphur atom,
Z is an oxygen or a sulphur atom,
Rl, R2, and R3 are the same or diEferent and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atom~ or an aryl group having 6 to 10 carbon
atoms optionally substituted by a ~ub~tituent selected
from the following group of substituents ; and :.
the base sequence containing B is a ba3e sequence of
14 to 19 base~ complementary to a part of a region of 30
nucleotide~ ~panning a particular nucleotide which is ~:
les~ than 5 nucleoti~es from a translation initiation
isite in a tumour gene;
.
Substituen~s ~
;
h~droxy groups, alkyl groups having 1 to 6 carbon
atom~, alko~y groups having 1 to 6 carbon atoms,
methylenedioxy groupi3, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon a~oms,
aryloxy group~ having 6 to 10 carbon atoms and ~ :
aralkyloxy group~ with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moie~y having 1 or 2 carbon .:
a~om~. . t ~. -
.:
34) A compound wherein: ~ :
k is 0 to 20,
m is 0 or 1,
n is 4 to 29,
X i~ a hydroxy group, . :
Y i~ an oxygen or a ~ulphur atom, :
0 4 2 7
'~ - 37 -
20g6~'j8
Z is an oxygen or a sulphur atom,
R , R , and R3 are the same or diffexent and
each representS a hydrogen atom, an alkyl group having 1 - ~:
to 6 carbon atomg or an aryl group having 6 to 10 carbon
atoms Optionally substituted by a subgtituent selected -
from the following group of substituents a; and ~::
the base gequence containing ~ is a base ~equence of :~
14 to 19 ba~es complementarY to a part of a region of 30
nucleotides ~panning a particular nucleotide which i ::
less than 5 nucleo~ides from a translation initiation -.
site in a tumour gene; ~ ~
: ,
Substituents ~
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms, .:
methylenedioxy group~, nitro groups, azide group3,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy group~ having 6 to 10 carbon atoms and
aralXylo~y groups with an aryl moiety having 6 to 10 ~ :
carbon atoms and an alkyl moiety ha~ing 1 or 2 carbon
atom~.
35~ A compound wherein~
k is 0 to 15,
m is O or 1,
~ i9 ~ to 29,
X is a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, ox a
monoalkylamino group having 1 to 6 carbon atoms,
i~ an oxygen-or a sulphur atom,
Z is an oxygen or a ~ulphur atom, : .
R1, R2, and R3 are the same or different and :
each represents a hydrogen atom, an alkyl group ha~ing 1
to 6 carbon atom~ or an aryl group having 6 to 10 carbon
. .,
atoms optionally substituted by a sub~tituent selected :.
from the following group of substituentc ~; and
: ., :, :;-.~,:
" ' ' ! ' ' . . , ; . , ~,
0 4 2 7
- 38 -
2~9~
the ba~e sequence containing B is a base sequence of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a partiCular nucleotide which is
less than 5 nucleotides from a tran91a~ion initiation
site in a tumour gene; ..
Sub3tituents a:
hydroxy groups, alkyl groups ha~ing 1 to 6 carbon
atom~, alkoxy groups having 1 to 6 carbon atoms, - -
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups ha~ing 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
36) A compound wherei~: :
k is 0 to 15,
m is O or 1, .
n is 8 to 29,
X i9 a hydro~y group,
Y is an oxygen or a sulphur at:om, ::
Z i9 an oxygen or a sulphur atom,
Rl, R2, and g3 are the ,~3ame or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group ha~ing 6 to 10 carbon
atoms optionally sub~tituted by a 3ubsti~uent selected
from the following group of substituent~ ~x; and
the base sequence containing B is a base sequence of
14 to 19 bases complementary to a part of a region of 30
nucleotldes spanning a particular nucleotide which is
le~,s than 5 nucleotides from a trans,lation initiation
site in a tumour gene;
042 7
,~ - 39
. . . :. ..
209~6~
Substituents ~:
hydroxy groups, alkyl groups having 1 to 6 carbon ~.
atoms, alkoxy groups having 1 to 6 carbon atoms, :
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms, :.
aryloxy groups having 6 to 10 carbon atoms and : -
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms. ~: .
...
37) A compound wherein: ~:
k is 0 to 12,
m is O,
n i9 13 to 18, - .
X i9 a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atoms,
Y is an oxygen or a ~ulphur atom, ~:;
Z is an oxygen or a ~ulphur atom,
Rl, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1 ~:
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally sub~tituted by a ~ub~tituent selected :~
from the following gxoup of sub~tit:uents ~; and
the base sequence containing B i9 a base sequence of
14 to 19 ba~es complementary to a part of a region of 30
nucleotide~ spanning a particular nucleotide which i9
less than 5 nucleotides from a translation initiation
site in a tumour gene;
.,,, .: .,.
Substituent9 a ~
.
hydroxy groups, alkyl groups having 1 to 6 carbon~
atoms, alkoxy groups having 1 to 6 carbon atom~, ~
methylenedioxy group~, nitro groups, azide groups, ~ :
halogen atoms, aryl groups having 6 to 10 carbon atoms,
.,: .
0 4 2 7
: - 40
2 0 ~ 8
aryloxy~groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
38) A compound wherein:
k is 0 to 12,
m i~ O or 1,
n is 13 to 18, ~ .
X is a hydroxy group,
Y îs an oxygen or a sulphur atom,
Z i~ an oxygen or a sulphur atom,
R1, R2, and R3 are the same or different and
each repre~ents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group ha~ing 6 to 10 carbon
atom~ optionally substituted by a substituent selected
from the following group of substituents a; and
the base sequence containing B is a base ~equence of
14 to 19 ba~e~ complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which i9
le89 than 5 nucleotides from a translation initiation
site in a tumour gene;
Substituents a:
hydroxy groups, alkyl groups having ~ to 6 carbon-
atom~, alkoxy groupe having 1 to 6 carbon atoms,
methylenedioxy groups, nitro group~, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atom~.
:
39) A compou~d wherein:
~ i~ O to 12,
m i~ O or 1,
,
- 41 -
n is 13 to 18,
X is a hydroxy group,
Y is an oxygen atom,
Z i9 an oxygen atom,
Rl, R2, and R3 are the siame or different and ;i~
each represents a hydrogen atom, an alkyl group having 1 .
to 4 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a sub~tituent selected
from the following group of substituents ~; and,
the base se~uence containing B i9 a base se~uence of:~
14 ~o 19 bases complementary to a part of a reyion of 30
nucleotides spanning a particular nucleotide which is ~;~
le~s than 5 nucleotides from a tran~lation ini~iation
site in a tumour gene;
.' .
Substituents a ': :
hydroxy groups, alkyl groups ha~ing 1 to 4 carbon : ;
atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl
groups, naphthyl group~, phenyloxy groups,
phenylmethyloxy groups and naphthylmethyloxy groups. ~:
40) A compound wherein: -~.:
k is O to 12,
m is O or 1,
n is 13 to 18,
X is a hydroxy group, ;~
Y is an oxygen atom, :~:
Z i~ an oxygen atom, -~.
Rl, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1~:~
to 4 carbon atoms, or a phenyl group optionally
substituted by a ~ubstituent 8elected from the following -
group of 8ub3tituents a 1l; and
the ba8e sequence containing B is a base seque~ce of
14 to 19 ba~es complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is
'' ' ~ ~ .
.:
- 42 -
less than 5 nucleotides from a translation initiation
site in a tumour gene;
Substituents .alpha.':
methyl groups, ethyl groups, propyl groups, t-butyl
groups, methoxy groups, ethoxy groups, propoxy groups,
t-buoxy groups and phenylmethyloxy groups.
41) A compound wherein:
k is 0 to 20,
m is 0 or 1,
n is 4 to 29,
x is a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atoms,
Y is an oxygen or a sulphur atom,
Z is an oxygen or a sulphur atom,
R1, R2, and R3 are the same or different and
each represents a hrdrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of substituents .alpha.; and
the base sequence containing B is a base sequence of
9 to 30 bases complementary to all or part of a region
of 30 nucleotides spanning a particular nucleotide which
is less than 5 nucleotides from a single base site in a
tumour gene;
Substituents .alpha.:
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylendioxy groups, nitro groups, azide gorups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy group with an aryl moiety having 6 to 10
- 43
.. . .
2 0 9 v ~
carbon atoms and an alkyl moiety having ~ or 2 carbon
atoms .
;""'"
42) A compound wherein: :
k is 0 to 20,
m i~ 0 or 1,
n is 4 to 29,
X is a hydroxy group,
Y i3 an oxygen or a sulphur atom,
Z i~ an oxygen or a 9ulphur atom,
R1, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 aarbon atoms or an aryl group having 6 to 10 carbon
atom~ optionally isub~tituted by a substituent selected
from the following group of substitue~t a; and
the base sequence containing B i~ a base sequence of ~:
9 to 30 base~ complementary to all or a part of a region .
of 30 nucleotide~ ispanning a particular nucleotide which
is less than 5 nucleotides ~rom a ~ingle base site in a.: :
tumour gene;
Subgtituents a~
hydroxy groups, alkyl group~ having I to 6 carbon :-
atomi3, alkoxy group~ having 1 to 6 carbon atom~
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy group~ having 6 to 10 carbon atoms and
aralkyloxy group~ with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety ha~ing 1 or 2 carbon
atom~
43) A compound wherein~
k i~ 0 to 15,
m ii3 0 or 1,
n i~ 8 to 29,
X is a hydroxy group, a methyl group, a mercapto
i .
O ~. 2 7
~ - 4~ -
209~
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atom
Y ifs an oxygen or a 9ulphur atom,
Z i9 an oxygen or a sulphur atom,
Rl, R2, and R3 are the sfame or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of ~ubstituents f~; and
~he base sequence containing E~f ig a bafe sequence of
9 to 30 ba3es complementary to all or a part of a region
of 30 nucleotifdefs spanning a particular nuclf~ffotide which
i9 less than 5 nucleotides from a single base site in a
tumour gene;
Substituents :
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and . :
aralk~loxy groups wi~h an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atomsO
44) A compound wherein:
~ i9 0 to 15,
m is 0 or 1,
n i9 8 to-29,
X is a hydroxy group~ '
Y i~f an oxygen or a sulphur atom,
Z iS an oxygen or a ~ffUlphUr atom,
R1, R2, and R3 are the ~ame or different and
each repreeffents a hydrogen atom, an alkyl group having 1
to 6 carbon atomfef or an aryl group having 6 to 10 carbon
atom~ optionally subetituted by a eubetituent selected
:':
', " i ~ . - " ; ' . ! . . ' ' ,' . . . . ..
0 4 2 7
_~ 45
2~9S~78
from the following group o~ substituents ~; a~d,
the base sequence containing B is a base sequence of
g to ~0 bases complementary to all or a part of a region
of 30 nucleotide~ spanning a particular nucleotide which
i~ less than 5 nucleotides from a single base site in a
tumour gene;
Sub~tituents ~:
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,~
methylenedioxy groups, nitro groups, azide groups, i.
halogen atoms, aryl group3 having 6 to 10 carbon atoms,
aryloxy grol-ps having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atom~ and an alkyl moiety having 1 or 2 carbon
atoms.
.'' .
45~ A compound wherein~
k is 0 to 12, :~
m i9 O,
n i8 13 to la,
X i~ a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atoms,
Y i~ an oxyg n or a ~ulphur atom, :
~ i8 an oxygen or a sulphur atom,
Rl, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1 ;
to 6 carbon atoms or an aryl group having 6 to 10 carbon -
atoms optionally substituted by a ~ub~tituent selected :
from the following group of substituents ~; and -.
the ba~e sequence containiny B is a base sequence of
9 to 30 base3 complementary to all or a part of a re~ion
o~ 30 nucleotides spanning a particular nucleotide which
i8 less than 5 nucleotides from a single base site in a
tumour gene;.
~ - 46 -
2 09 ~ 6 ~ ~
Sub~tituents ~:
hydroxy groups, alkyl group9 ha~ing 1 to 6 carbon
atom~, alkoxy groups having 1 to 6 carbon atoms,
methylen~dioxy groups, nitro groups, azide groups,
halogen atoms, aryl group~ having 6 to lo carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy group9 with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms .
46) A compound wherein:
k is O to 12,
m is O or 1,
n is 13 to 1~,
X is a hydroxy group,
Y i~ an oxygen or a ~ulphur atom,
Z is an oxygen or a sulphur atom,
Rl, R2, and R3 are the same or different and
each repre~ents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally sub~tituted by a subetituent selected
from the following group of substituents a; and
the ba3e sequence containing E3 is a base sequenc2 of
9 to 30 baseis complemen~ary to all or a part of a region
of 30 nucleotidei~ spanning a particular nucleotide which
is less than s nucleotides from a single base site in a
tumour gene;
Substituents a:
~ ~ .
hydroxy groupi~, alkyl group~ having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy group~, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy group~ having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
.~.:. .
,
,
0 4 2 7
- ~7~ 9 ~ ~ ~ 8 - ~
carbon atoms and an alkyl moiety having 1 or 2 carbon
atomis.
.:
47) A compound wherein:
k is 0 to 12, -
m i9 0 or 1, ~
n i9 13 to 18, .
X i9 a hydroxy group,
Y i9 an oxygen atom,
Z is an oxygen a~om,
Rl, R , and R are the same or different and
each xeprese~t~ a hydrogen atom, an alkyl group having 1
to 4 carbon atoms or an aryl group having 6 to 10 carbon ~ ~
atoms optionally substituted by a substituent selected ~-
from the following group of sub~tituents ~'; a~d, : ~
the base sequence containing B i8 a base sequence of ~ ~ -
9 to 30 bases complementary to all or a part of a region
of 30 nucleotides spanning a particular nucleotide which
is less than 5 nucleotide~ from a single base site in a ;;~
tumour gene;
. . ':
Substituents ~
,'
hydroxy groups, alkyl groups ha~ing 1 to 4 carbon
atoms, alkoxy groupi~ having 1 to 4 carbon atoms, phenyl
groups, ~aphthyl groups, phenyloxy groups,
phenylmethyloxy groups and naphthylmethyloxy groups.
"
48) A compound wherein~
k is 0 to 12,
m i8 0 or 1,
n i~ 13 to 18, :
X is a hydroxy group,
Y is an oxygen atom,
Z is an oxygen atom,
R1, R2, and R3 are the isame or different and
each represents a hydrogen atom, an alkyl group having 1
-,,
O ~ 2 7
- 48 -
2 ~ 9 ~ 6 ~ ~
to 4 carbon atoms, or a phenyl group optionally
substituted by a substituent selected from the following
group of substituents ~"; and
the base sequence containing B is a base sequence of
9 to 30 bases complementary to all or a part of a region
of 30 nucleotides spanning a particular nucleotide which
is less than 5 nucleotide9 fxom a single base site in a
tumour gene;
Substituents a ~:
. ~
methyl groups, ethyl group~, propyl groups, t-butyl
groups, methoxy grollp~, ethoxy groups, propoxy group~,
t-butoxy groups and phenylmethyloxy groups.
49) A compound wherein- ~
k is 0 to 20, ~ :
m i~ 0 or 1, ~ :
n is 4 to 29, : ~:
X is a hydroxy group, a methyl group, a mercapto ~:-
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamiino group having 1 to 6 carbon atoms,
Y i9 an oxygen or a sulphur atom,
Z i9 an oxygen or a sulphur atom,
Rl, R2, and R3 are the same or different and
each represent a hydroge~ atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon ~ ~
atoms optionally substitu~ed by a substituent selected - .~:
from the following group o~ sub~ti~uent~ a; and
the ba~e ~equence containing ~ i9 a base ~equence of ~:
14 to 19 ba~es complementary to a part o~ a region of 30
nucleotide~ spanning a particular nucleotide which i8
less than 5 nucleotides from a single base site in ras
and c-myb tumour genes; -
: ~'
,.
:.
:" , . , , '" ' '' , ' . ' . , ' " ,:', . ' ', ' . .'`, :, ',' ' " . ' '; .` . ",: ' ''
O ~ 2 7
. 49
20966~8
.
Substituen~ts~:
hydroxy groupi~, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atom~ and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms.
50) A compound wherein:
k i~ 0 to 20,
m i8 0 or 1,
n i5 4 to 29, :
is a hydroxy group,
Y i9 an oxygen or a sulphur atom,
Z is an oxygen or a sulphur atom,
Rl, R2, and R3 are the ~ame or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atom3 or an aryl group having 6 to 10 ~arbon ~:
atoms optionally ~ubstituted by a substituent selected
from the ~ollowi~g group of subitituents ~; and
the base ~equence contiaining B i9 a baee sequence of :-
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is
le~s than 5 nucleotide~ from a ~ingle base site in ras
and c-myb tumour gene~
Substituents ~:
hydroxy group~, alkyl groupe having 1 to 6 carbon
atoms, alkoxy group~ having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups, - ..
halogen atom~, aryl groups ha~ing 6 to 10 carbon atom~,
arylo~y group~ having 6 to 10 carbon atom~ and
aralkyloxy groups with an aryl moiety having 6 to 10
O ~ 2 7
~ 50 ~ 2~66S~
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms .
51) A compound wherein:
k is O to 15,
m is 0 or 1,
n is ~ to 29,
X i9 a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atoms, or a
monoalkylamino group having 1 to 6 carbon atoms, : :
Y is an oxygen or a sulphur atom,
Z i~ an oxygen or a sulphur atom,
Rl, R2, and R3 are the same or different and :. .
each repre~ents a hydrogen atom, an alkyl group having 1
~o 6 carbon atom~ or an aryl group having 6 to 10 carbon ~: -
atom~ optionally sub~tituted by a substituent selected
from the following group of ~ub~tituents ~; and
the ba~e ~equence containing B is a base sequence of ~:~
14 to 19 ba~es complementary to a part of a region of 30 :;
nucleotide~ spanning a particular nucleotide which i9
la~s than 5 nucleotidea from a single base site in ras .
and c-myb tumour genes;
Sub~ituents a ~
.; : :.
: hydroxy groups, alkyl groups ha~ing 1 to 6 carbon
atoms, alkoxy groups ha~ing 1 to 6 carbon atoms,
methyle~edioxy group~, nitro groups, azide groups, ~ ~ :
~: ~ halogen atoms, aryl group~ having 6 to 10 carbon atoms,: ~:
a~yloxy groups having 6 to 10 carbon atoms and :~
aralkyloxy groups with an aryl moiety having 6 to 10 ~.
carbon atoms and an al~yl moiety having 1 or 2 carbon
atoms.
52) A compound wherein: -
k is O to 15,
m is O or 1,
. .
.
O ~ 2 7
- 51 - ~7
n is a to 29,
X is a hydroxy group,
Y is an oxygen or a sulphur atom,
Z i9 an oxygen or a sulphur atom, ::
R1, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally sub~tituted by a substituent Relected :-
from the following group of substituents a; and
the base sequence containing B i9 a base sequence of
14 to l9 bases complementary to a part of a region of 30
nucleo~ides spanning a particular nucleotide which is
le77 than 5 nucleotide~ from a single base site in ras -.
and c-myb tumour genes; .
SubstituentR ~
hydroxy groups7, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups ha~ing 1 to 6 carbon atoms,
methylenedioxy groups, nitro group7, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms,
aryloxy groups having 6 to 10 carbon atoms and i :
aralkylo~y groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon
atoma.
.
53) A compound whexein:
k is 0 to 12,
m is 0,
n is 13 to 18,
X is a hydroxy group, a methyl group, a mercapto
group, an alkoxy group having 1 to 4 carbon atom~, or a
monoalkylamino group having 1 to 6 carbon atomR, :
Y i~ an oxygen or a sulphur atom,
Z i9 an oxygen or a sulphur atom,
`, R1, R2, and R3 are the same or different and
'. each represents a hydrogen atom, an alkyl group having 1
::
i~ , .. .. . . .
0 4 2 7
~95~8
to 6 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected
from the following group of substituents ; and
the hase sequence containing B is a base se~uence of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is : :
less than 5 nucleo~ides from a single base site in ras ::
and c-myb tumour genes; --
:- . ,: .
Substi.tu nts ~
.~.
hydroxy groups, alkyl groups having 1 to 6 carbon :
atoms, alkoxy groups having 1 to 6 carbon atoms,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms, -
aryloxy groups having 6 to 10 carbon atoms and
aralkyloxy groups with an aryl moiety having 6 to 10
carbon atoms and an alkyl moiety having 1 or 2 carbon :
atoms.
. :'.: ':
54) A compound wherein:
k is O to 12, ~
m is 0 or 1, :~ ;
n is 13 to 18,
X is a hydroxy group,
Y is an oxygen or a sulphur atom,
z is an oxygen or a sulphur atom,
R1, R2, and R3 are the sarne or different and : :
each represents a hydrosen atom, an alkyl group having 1 ::
to 6 carbon atoms or an aryl group having 6 to 10 carbon . :
atoms optionally substituted by a substituent selected
from the following group of substituents a; and
the base sequence containing ~ i3 a ba3e sequence of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is
less than 5 nucleotides ~rom a single base site in ra~
and c-myb tumour genes;
.''
",
0 4 2 7
~ - 53 -
2 0 9 6 6 ;~ 8
Substituents :
hydroxy groups, alkyl groups having 1 to 6 carbon
atoms, alkoxy groups having 1 to 6 carbon atom3,
methylenedioxy groups, nitro groups, azide groups,
halogen atoms, aryl groups having 6 to 10 carbon atoms, :
aryloxy groups having 6 to 10 carbon atoms and ::
aralkyloxy groups with an aryl moiety having 6 to 10 : :carbon atoms and an alkyl moiety having 1 or 2 carbon
atoms. `
~
55) A compound wherein: :
k i~ O to 12,
m is O or 1,
n is 13 to l~,
X is a hydroxy group,
Y is an oxygen atom,
Z is an oxygen atom,
R1, R2, and R3 are the same or different and
each represents a hydrogen atom, an alkyl group having 1
to 4 carbon atoms or an aryl group having 6 to 10 carbon
atoms optionally substituted by a substituent selected .
from the following group of substituents ~'; and, .
the base sequence containing B i9 a base sequenca of
14 to 19 bases complementary to a part of a region of 30
nucleotides spanning a particular nucleotide which is
le6s than 5 nucleotides from a ~ingle base site in ra~
and c-myb tumour geneR;
Substituents ~
hydroxy groups, alkyl groups having 1 to 4 carbon
atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl
groups, naphthyl groups, phenyloxy groups,
phenylmethyloxy group~ and naphthylmethyloxy groups.
.: ' , ' , : .
: ,' ,.', ' ~, . , , ' ' : ~ ` , . .;,' :
, ~ / . : , '.. ' .:. :
~) 4 2 7
- - 54 -
2 ~ 9 ~ 6 a 8 - - - ~
56) A compound wherein: : :
k is 0 to 12,
m is O or 1, : -
.. . . .
n is 13 to 18, ~.
X i9 a hydroxy group,
Y is an oxygen atom,
Z is an oxygen atom,
R1, R2, and R3 are the same or different and :
each represents a hydrogen atom, an alkyl group having 1
to 4 carbon atom~, or a phenyl group optionally .~
substituted by a substituent selected from the following : :
group of substituents a "; and - - : :
the base ~equence containing B is a base sequence of . :::
14 to 19 bases complementary to a part of a region of 30
. . .
nucleotides spanning a particular nucleotide which is :-:
less than 5 nucleotides from a single base site in ras
and c-myb tumour genes; . ~:~
Substituents x": .
. . .
methyl groups, ethyl groups, propyl groups, t-butyl
groups, methoxy groups, ethoxy groups, propoxy groups,
:t-butoxy groups and phenylmethyloxy groups. ..
.,:
,
. 57) A compound wherein: ~;
k is O,
m i9 O,
X i8 a hydroxy group,
Z i5 an oxygen atom, -:::
R1, R2 a~d R3 are the same or different and
each represent~ a phenyl group optionally substituted by
a substituent selected from the following group of ~::
substituent~ a 1' '; and
the base sequence is AGGTGGGTCTGAAAC; ~ .~.
'
'-..:
: :.
,
, . ~
-~ 2 ~ 9 ~
Substltuents ~
methoxy groups, ethoxy groups, propoxy groups and
t-butoxy groups. ~,
58) A compound wherein:
k is 0,
m is 0,
X is a hydroxy group, ~ -
Z is an oxygen atom, .
R1, R2 and R3 are the same or different and
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
subs~ituent~ a " '; and
the base sequence is TCGGGGTTGGGAGGT;
Substituents ~
metho~y groups, ethoxy groups, propoxy groups and
t-butoxy groups. ,~
59) A compound wherein:
k is O,
m is 0,
X is a hydroxy group,
Z is an oxygen atom,
Rl, R2 and R3 are the same or different and
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents ~ nd
the base sequence is TTGGGAGGTGGGTCT;
Substituents ~"':
methoxy group~, ethoxy groups, propoxy group~ and
t-buto~y groups.
., ~ . :, , , ~ : .' , :
.''', . . .' , : ':" ' . ::
', ' ' ,' ' ~' . ' ' ,, ,.",', ",
0 5 2 5
- 56--
209~6~8
60) A compound wherein~
k i~ 0,
m i~ 0, ~ .
X is a hydroxy group, ~ -
~ is an oxygen atom,
Rl, R2 and R3 are the same or different and
each represent~ a phe~yl yroup optionally ~ubstituted by ~:~
a substituent aelected from the following group of~ ~
substituents ~ n ~; and ~ ~ :
the base sequence is ATACTCAGTCATTTTTAGCAG;
Substituent~ a n ~:
methoxy group3, ethoxy group~, propoxy groups and
t-butoxy groups.
.
61) A compound wherein~
- k is 0,
m is 0, ~
X i9 a hydroxy group, . -
Z i9 an o~ygen atom,
Rl, R2 and R3 are the same or different and ~:
each represents a phen~l group optionally substituted by
a substituent selected from the following group of
ubsti~uents x n~l; and
the ba~e sequence i8 ~C~9C ~IL~II9fi~c;
Substituçnts a n~:
: methoxy groups.
62) A compound wherein~
k is 0, :
m is 0,
X i9 a hydroxy group,
Z i~ an oxygen atom,
Rl, R2 and R3 are the same or different and
O 5 2 5
~ 57 :.
2~96~
each repre~ents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents a " '; and
the ba~e sequence is TGGGTCTGAAACGAT;
Substituents a~l t . ' '
. . ' - '
methoxy groups, ethoxy groups, propoxy groups and
t-butoxy group~.
.
63) A compound wherein: - -
k i~ 0, .
m is 0,
X is a hydroxy group, ;:.:
Z i~ an oxygen atom, ~- :
Rl, R2 and R3 are the ~ame or different and
each represents a phenyl group optionally sub3tituted by :~
a sub~tituent selected from the following group of
substituents a ~1~; and
-; the base sequence is T~GTGGGTcTGAAAc;
': .
Substituents a"'~:
methoxy groups.
6i) A compound wherein:
k is O,
m is 0,
X i9 a hydroxy group, ~ ;
Z is an oxygen atom,
Rl, R2 and R3 are the same or different and
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
aub3tituents a " '; and
the baae sequence i~ GGTGGGTCTGAAAC~;
4 2 7
~ 58 - .:.
20966~ :
Substituents x
methoxy groups, ethoxy groups, propoxy groups and :
t-bu~oxy groups. : : :
. .
65) A compound wherein: .
k is 0,
m is 0,
X is a hydroxy group,
Z is an oxygen atom,
R1, R2 and R3 are the same or different and :
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents "'; and .
the base sequence is GGTGGGTTGCTTTGA;
Substituents a ~
" ' ,.
methoxy groups, ethoxy groups, propoxy groups and
t-butoxy groups. ~: .
66) A compound wherein~
~ is O,
m i9 O, ' ~.
X is a hydroxy group, ;~ .
Z is an oxygen atom,
R1, R2 and R3 are the same or different and
each represents a phenyl group optionally sub~tituted by
a substituent selected from the following group of . ~ :
substituentY "~; and
the base sequence is GGAGGTGGGTCTGAA;
Substituentg a " ':
methoxy groups, ethoxy groups, propoxy group~ and :~.
t-butoxy groups. -~
:
'",.''' ':' ' ''
O 5 2 5
, ~ - 59 -
20~S6~
67) A compound wherein-
k is o,
m i9 O,
X is a hydroxy group,
Z is an oxygen atom,
Rl, R2 and R3 are the same or different and
each represents a phenyl group optionally sub~tituted by
a ~ubstituent selected from the following group of :.
substituents 1~; and
the base ~equence is GGGAGGTGGGTCTGA;
Sub~tituents a 1' ':
methoxy group~, ethoxy groups, propoxy groups and
t-butoxy group~.
68) A compound wherein:
k is O,
m i9 O,
X is a hydroxy group,
Z i8 an oxygen atom,
, R2 and R3 are the same or different and
each repre~ent~ a phenyl group optionally subs~ituted by
a substituent ~elected from the ~ollowing group of
sub3tituents a 1 '; and
the ba~e sequence i~ GTTGGGAGGTGGGTC;
. . .
Sub~tituept~ a ~ ':
methoxy groups.
69) A compound wherein:
k is 0,
m is O,
X i9 a hydroxy group,
Z is an oxygen atom,
R1, R2 and R3 are the ~ame or different and
,: , . . ., . . , ~ , ,:., . :.
- 60 -
2~9~
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents x'''; and .
the base sequence is GGGTTGGGAGGTGGG;
Substituents ~"': . -.
methoxy groups, ethoxy groups, propoxy groups and ~.
t-butoxy groups. ~:
70) A compound wherein:
k is 0,
m i9 0, :~
X is a hydroxy group,
Z is an oxygen atom,
~1, R2 and R3 are the same or different and
each represent~ a phenyl group optionally substituted by ;
a substituent selected from the following group of !~
3ubstituents ~"'; and
the base sequence is TGGGAGGTGGGTCTG; ..
Substituents a " ': . :
methoxy groupe, ethoxy groups, propoxy groups and
t-butoxy group~.
71) A compound wherein: .
k is ~
m is 0,
X is a hydroxy group,
Z is an oxygen atom,
R1, R2 and R3 are the ~ame or different and :
each represents a phenyl group optionally sub~tituted by
a substituent selected from the following group of
substituents ~"'; and ~ .
the base sequence is TGGGAGGTGGGTCT; ~'
',,, '
.:
._~ O ~ 2 7
- 61 ~ 2 ~9 6~;~ 8 -.
Substituents Y'~
f ~
methoxy groups, ethoxy groups, propoxy groups and
t-butoxy groups.
72) A compound wherein:
k is 0,
m is 0,
X is a hydroxy group,
Z is an oxygen atom, ~
R1, R2 and R3 are the same or different and ;-
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents a ~ '; and
the base sequence is TGGGAGGTGGGTC;
Substituents ~
,.
methoxy groups, ethoxy groups, propoxy groups and
t-butoxy groups.
73) A compound wherein:
k is O,
m is O,
X i9 a hydroxy group,
Z i~ an oxygen atom,
R~, R2 and R3 are the same or different and
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents i"'; and
the base sequence i~ TGGGAGGTGGGT;
Substituents "':
methoxy groups, ethoxy groups, propoxy groups and
t-butoxy groups.
- :
- 62 -
. 2~6~(~ ' ''
74) A compound wherein:
k is 0,
m i9 O,
X is a hydroxy group,
Z is an oxygen atom,
R1, R2 and R3 are the same or different and
each represents a phenyl group optionally substituted by
a substituent selected from the following group of::
substituents a ~1 '; and
the base ~equence is TGGGAGGTGGG; :
'
Substituents x''':
methoxy groups, ethoxy groups, propo~y groups and -~
t-butoxy groups.
75) A compound wherein~
k is 0,
m is 0,
X i~ a hydroxy group,
Z i9 an oxygen atom,
R1, R2 and R3 are the same or different and
each represents a phenyl group opt:ionally substituted by . ~:~
a substituent selected from the ~o:Llowing group of :
substituents ~"'; and
the base sequence is TGGGAGGT~ ;
Substituents
- .
methoxy groups, ethoxy groups, propoxy groups and .:: : .
t-butoxy groups. ~ -
76) A compound wherein: :
k i~ 0, ~ .
m is 0,
X is a hydroxy group,
Z is an o~ygen atom, `~ -
: ,
O ~ 2 7
- 63 -
2a~66.~
R1, R2 and R3 are the same or different and
each represents a phenyl group optionally substituted by
a substituent selected from the following group of
substituents ~"'; and
the base sequence is TGGGAGGTG;
Substituents ~
metho.xy groups, ethoxy groups, propoxy groups and
t-butoxy groups.
: Preferred compounds of the present invention
specifically include those listed in the ~ollowing Table.
In the Table the following abbreviations are used:
.
: Ph represents a phenyl group,
Me represent~ a methyl group, ~
Et represents an ethyl group, . ~ -
Pr represent~ a propyl group,
iPr represents an isopropyl group,
tBu represents a tert-butyl group,
MDO represents a 3,4-methylenedioxy group,
~y represent~ a phenylmethyl group,
NaPh repre~ents a naphthyl group,
NaPhme represents a naphthylmethyl group, and
dByOBy represents a (3,5-dibenzyloxy)benzyl group.
In the nucleotide sequence portion in the formula
(I), .
[1] represent~ AGGTGGGTCTGAAAC (in the text, it is
abbreviated as ODN-1),
.
[2~ represents TCGGGGTTGGGAGGT (in the text, it i9
abbreviated a~ ODN-21
.:~
: :, ; . , . ., . ~"
0 4 2 7
,-- ~
~ - 64 -
2~9~f~J~ '
[3] represents TTGGGAGGTGGGTCT (in the text, it is
abbreviated as ODN-3) -
[4] represents ATACTCAGTCATTTTTAGC~G (in the text, it is
abbreviated as ODN-4)
[5] represents GTGCCGGGGTCTTCGGGC (in the text, it is
abbreviated as ODN-5)
.:
~6] represents TGGGTCTGA~ACGAT (in the text, it is
abbreviated as ODN-6)
~7] represent3 T~AGGTGGGTCTGAAAC (in the text, it i9
abbreviated as ODN-7)
: .
[8] represents GGTG GTCTGAAACG tin the text, it is
abbreviated as ODN-8) . ;;
[9] representY GGTGGGTTGCTTTGA (in the text, it is
abbreviated as ODN-9) :-
''';
[10] represents GGAGGTGGGTCTGAA (in the text, it is
abbreviated as ODN-10)
~11] represent~ GGGAGGTGGGTCTGA (in the text, it is -.
abbreviated as ODN-ll)
[12] represents GTTG~GAGG~ (in the text, it i9
abbraviated as ODN-12) -: ;
[13~ represents GGGTTGGGAr,GTGGG (in the text, it is
abbreviated as ODN-13)
[14] represents TGGGAGGTGGGT~TG (in the text, it is .:.
abbreviated as ODN-14) :
,;
[15] ~epre~ents TGGGAGGTGGGTCT (in the text, it i9 ~-
.' ',
- 65 -
20g~6:~ 8
abbreviated as ODN-15)
[a] represents TGGGAGGTGGGTC (in the text, it i8
abbreviated as ODN-16)
[b] represents TGGGAGGTGGGT (in the text, it is
abbreviated as ODN-17)
[c] represents TGGGAGGTGGG (in the text, it is
abbreviated as ODN-18)
[d] represents _GGAGGTGG (in the text, it is
abbreviated a~ ODN-l9)
[e] represents TGGGAGGTG (in the text, it is abbreviated :~
as ODN-20)
~1
Z2 1,_r r~ CZ2 ~ z _r,~
X--P= O
` .
~_ .
CH2
~ ~ 8
0~
X- P= O
o
_ l p
H0
- 66 -
2 0 9 ~
..... _ ..... _ .
No. k m n X Y Z R R2 R3 Seq.
. .. ~
1 0 0 13 OH - O 4-MeOPh 4-MeOPh Ph [I4]
2 0 0 13 OH - O 3-MeOPh 3-MeOPh Ph [14]
3 0 0 13 OH - O 4 MeOPh Ph Ph [14]
4 0 0 13 OH - O 3-MeOPh Ph Ph [14]
0 0 13 OH - O 2-MeOPh Ph Ph [14]
6 0 0 13 OH - O Ph Ph Ph [14]
7 0 0 13 OH - O 4-EtOPh 4-EtOPh Ph [14]
~ 0 0 13 OH - O 3-EtOPh 3-EtOPh Ph [14]
9 0 0 13 OH - O 2-EtOPh 2-~tOPh Ph [14]
0 0 13 OH - O 4-tBuOPh Ph Ph [14]
11 0 0 13 OH - O 3-tBuOPh PH Ph [14]
12 0 0 13 OH - O 2-tBuOPh Ph Ph [14]
13 0 0 13 OH - O 4-tBuOPh 4-tBuOPh Ph [14]
14 0 0 13 OH - O 3-tBuOPh 4-tBuOPh Ph [14]
0 0 13 OH - O 2-tBuOPh 4-tBuOPh Ph [14]
16 0 0 13 OH - O 4-EtPh 4-EtPh 4-EtPh [14]
17 0 0 13 OH - O 3-EtPh 3-EtPh 3-EtPh [14]
18 0 0 13 OH - O 2-EtPh 2-EtPh 2-~tPh [14]
19 0 0 13 OH - O 4-iPrOPh 4-iPrOPh 4-iPrOPh [14]
0 0 13 O~I - O 3-iPrOPh 3 iPrOPh 3-iPrOPh [14]
21 0 0 13 OH - O 4-t~uPh 4-tBuPh Ph [14]
22 0 0 13 OH - O 2-tBuPh 2-tBuPh Ph [14]
23 0 0 13 OH - O MDOPh MDOPh Ph [14]
24 0 0 13 OH - O 4-NO2Ph 4-NO2Ph Ph [14]
0 0 13 OH - O 3-NO2Ph 3-NO2Ph Ph [14]
26 0 0 13 OH O 4-~3Ph Ph Ph [14]
27 0 0 13 OH - O 2-NaPh Ph Ph [14]
28 0 0 13 OH - O 4-N3Ph 4 N3Ph Ph [14
29 0 0 13 OH O 3-N3Ph 4-N3Ph Ph [14]
0 0 13 OH - O 4-BrPh 4-BrPh 4-BrPh [14]
~ .
'. '
0 4 2 7
- 67 -
2~9~S~ ~
. . .
No. k m n X Y Z Rl R2 R3 Seq.
. ... . __
31 0 0 13 OH - O 3-BrPh 3-BrPh 3-BrPh ~14]
32 0 O 13 OH - O Ph Ph H [14]
33 O 0 13 OH - O Ph H H [14]
34 0 0 13 OH - O l-NaPhme H H [14]
35 0 0 13 OH - O 2-NaPhme H H ~14]
36 0 0 13 OH - O 4-BrPh Ph H [14]
37 0 0 13 OH - O -3-BrPh Ph H [14]
38 0 0 13 OH - O 4-IPh 4-IPh Ph [14]
39 0 0 13 OH - O 2-IPh 2-IPh Ph [14] ~ :
O 0 13 OH - O 4-ByOPh 4-ByOPh 4-ByOPh [14
41 0 0 13 OH - O 3-ByOPh 3-ByOPh 3-ByOPh [14]
42 0 0 13 OH - O 2-ByOPh 2-ByOPh 2-ByOPh [14]
43 O 0 13 OH - O dByOBy H H [14]
44 0 0 13 OH - O dByOBy dByOBy H [14]
0 0 13 OH - O Bu CH3 CH3 [14]
46 0 0 13 OH - O Bu Pr CH3 [14]
47 0 0 13 OH - O Bu Bu Et [14]
48 0 0 13 OH - S 4-MeOPh 4-MeOPh Ph [14]
49 0 0 13 OH - S 3-MeOPh 3-MeOPh Ph [14]
O 0 13 OH - S 2-MeOPh 2-MeOPh Ph [14] 5
51 O 0 13. OH - S 4-MeOPh Ph Ph [14]
52 o O 13 OH - S 3-MeOPh Ph Ph [14]
53 0 0 13 OH - S 3-MeOPh Ph Ph [14~ .
54 0 0 13 OH - S Ph Ph Ph [14]
55.i o 0 13 OH - S 4-PrOPh 4-PrOPh Ph ~14]
56 0 0 13 OH - S 3-PrOPh 3-PrOPh Ph [14
57 0 0 13 OH - S 2-PrOPh 2-PrOPh Ph [14] ::
58 0 0 13 OH - S 4-tBuPh 4-tBuPh Ph [14]
' :': "
,~
: ':
~ O ~ 2 7
- 6a ~-~ 9 S ~.
No. k m n X Y Z R R2 R3 Seq.
.
59 0 0 13 OH - S 3-tBuPh 4-tBuPh Ph [14]
0 0 13 OH - S 2-tBuPh 2-tBuPh Ph [14]
61 0 0 13 OH - S MDOPh MDOPh Ph [14]
62 0 0 13 OH - S Ph Ph H [14]
63 0 0 13 OH - S Ph X H [14]
64 0 0 13 OH - S 4-NO2Ph 4-NO2Ph Ph [14]
0 0 13 OH - S 3-NO2Ph 3-NO2Ph Ph [14]
66 0 0 13 OH - S 2-NO2Ph 2-NO2Ph Ph [14]
67 0 0 13 OH - S - 4-IPh 4-IPh Ph [14]
68 0 0 13 OH - S 3-IPh 3-IPh Ph [14]
69 0 0 13 OH - S tBu tBu CH3 [14]
0 0 13 SH - O 4-MePh 4-MePh Ph [14]
71 0 0 13 SH - O 3-MePh 3-MePh Ph [14]
72 0 0 13 SH - O 4-MeOPh Ph Ph [14]
73 0 0 13 SH - O 3-MeOPh Ph Ph [14]
74 0 0 13 SH - O 2-MeOPh Ph Ph [14]
0 0 13 SH - O Ph Ph Ph [14]
76 0 0 13 SH - O 4-PrOPh 4-PrOPh Ph [14]
77 0 0 13 SH - O 2-PrOPh 2-PrOPh Ph [14]
78 0 0 13 SH - O 4-tBuPh 4-tBuPh Ph [14]
79 0 0 13 SH - 0 2-tBuPh 2-tBuPh Ph [14]
0 0 13 SH - O MDOPh M~OPh Ph [14]
81 0 0 13 SH - O Ph Ph H [14]
82 0 0 13 SE - O Ph H H [14]
83 0 -0 13 SH - O 4-NO2Ph 4-NO2Ph Ph~14]
84 0 0 13 SH - 0 3-NO2Ph 3-NO2Ph Ph[14]
0 0 13 SH - O 4-IPh 4-IPh Ph. [14]
86 0 0 13. SH - O 2-IPh 2-IPh Ph [14]
. . .
209~ 8
. _ . ... .
No. k m n X Y Z Rl R2 R3 Seq.
87 0 0 13 SH - O tBu . tBu CH3 [14]
88 0 0 13 CH3 - O 4-MeOPh 4-MePh Ph [14]
89 0 0 13 CH3 - O 3-MeOPh 3-M~Ph Ph [14]
0 0 13 CH3 - O Ph Ph 4-MeOPh [14J
91 0 0 13 CH3 - O Ph Ph Ph [14]
- 92 0 0 13 CH3 - O 4-EtOPh 4-EtOPh Ph [14]
93 0 0 13 CH3 - O 2-EtOPh 2-EtOph Ph ~14]
94 0 0 13 CH3 - 0 4-tBuOPh Ph Ph [14]
0 0 13 CH3 - 0 3-tBuOPh Ph Ph [14]
96 . 0 0 13 CH3 - O 4-tBuOPh 4-tBuOPh Ph [14]
97 0 0 13 CH3 - O 3-tBuOPh 3-tBuOPh Ph [14]
:~ 98 0 0 13 CH3 - O 4-EtPh 4-EtPh 4-EtPh [14]
99 0 0 13 CH3 - 3-EtPh 3-EtPh 4-EtPh [14]
: 100 0 0 13 CH3 - O 2-EtPh 2-EtPh 4-EtPh [14]
101 0 0 13 CH3 - 0 4-iPrOPh 4-iPrOPh 4-iPrOPh [14]
102 0 0 13 CH3 - O 2-iPrOPh 2-iPrOPh 4-iPrOPh [14]
103 0 0 13 PrO - O 4-tBuPh 4-tBuPh Ph ~14~
104 0 0 13 PrO - O 2-tBuPh 2-tBuPh Ph [14]
105 0 0 13 PrO - O MDOPh MDOPhPh [14]
10~ 0 0 13 RrO - O 4-NO2Ph 4-NO2Ph Ph ~14]
107 0 0 13 PrO - O 3-N02Ph 3-NO2Ph Ph [14]
108 0 0 13 PrO - O 4-N3Ph Ph Ph [14]
109 0 0 13 PrO O 2-N3Ph Ph .Ph [14]
110 0 0 13 PrO ~ 3Ph 4 N3Ph Ph [14]
111 0 0 13 PrO - O 2-N Ph 2-N3PhPh [14]
112 0 0 13 PrO ~ O 3 N3Ph 3 N3Ph Ph [14]
113 0 0 13 PrO - O 4-BrPh 4-BrPh4-BrPh [14]
114 0 0 13 PrO - O 3-BrPh 3-B~Ph4-BrPh [14]
115 0 0 13 PrO - O 2-BrPh 2-BrPh4-BrPh [14]
.- .
.. ..
' ' ', ' ,. :'
,: ,'; ~''
0 4 2 7
7 0
2 ~ 9 ~
No. k m n X Y Z Rl R2 R3 Seq. ~
.: . .
.... - ---
116 0 0 13 PrO - O Ph Ph H [14]
117 0 0 13 PrO - O Ph H H [14
118 0 0 13 BuO - O 4-ClPhPh H [14]
119 0 0 13 BuO - O 3-ClPhPh H [14]
120 0 0 13 BuO - O 2-ClPhPh H [14]
121 0 0 13 BuO - O 4-BrPhPh H [14]
122 0 0 13 BuO - O 3-BrPhPh H [14]
123 0 0 13 BuO - O 4-IPh4-IPh Ph ~14]
124 0 0 13 BuO - O 2-IPh2-IPh Ph [14]
125 0 0 13 BuO - O 4-ByOPh 4-ByOPh 4-ByOPh [14]
126 0 0 13 BuO - O 3-ByOPh 3-ByOPh 3-ByOPh ~14]
127 0 0 13 RuO - O 2-ByOPh 2-ByOPh 2-ByOPh [14]
128 0 0 13 EtNH - O 4-MeOPh 4-MeOPh Ph [14]
129 0 0 13 EtN~ - O 2-MeOPh 2-MeOPh Ph [14]
130 0 0 13 EtNX - O 4-MeOPh Ph Ph [14]
131 0 0 13 EtNH - O 3-MeOPh Ph Ph [14]
132 0 0 13 EtNH - O Ph Ph Ph [14]
133 0 0 13 EtNH - O 4-PrOPh 4-PrOPh Ph [14]
134 0 0 13 EtNH - O 3-PrOPh 3-PrOPh Ph [14]
135 0 0 13 EtNH - O 4-tBuOPh 4-tBuOPh Ph [14
. .
136 0 0 13 EtNH - O 2-tBuOPh 2-tBuOPh Ph [14~
137 0 0 13 EtNH - O MDOPhMDOPh Ph [14]
138 0 0 13 EtNH - O Ph Ph H [14]
139 0 0 13 EtNH - O Ph HH . [14]
140 0 0 13 PrNH - O 4-NO2Ph 4-NO2Ph Ph [14]
141 0 0 13 PrNH - O 3-NO2Ph 3-NO2Ph Ph [14]
142 0 0 13 PrNH - O 4-IPh4-IPh Ph [14]
143 0 0 ~3 PrNH - O 2-IPh2-IPh Ph [14~
144 0 0 13 PrNH - O 4-tBuPh tBu CH3 [14]
,, ~
: .
; . .
O ~ 2 7
71
20~6~
.
No. k m n X Y Z Rl R2 R3 Seq.
1450 0 13 PrNH - O 3-tBuPh tBu CH3 [14]
14615 0 13 OH - S H H H [14]
14712 0 13 OH - S Ph Ph Ph [14]
1486 0 13 OH - S Ph Ph H [14]
1496 0 13 OH - S PH Ph 4-MeOPh[14]
1506 0 13 OH - S Ph Ph 2~-MeOPh[14]
15115 0 13 SH - S H H H [14]
15212 1 13 OH O S Ph Ph Ph [14]
15312 1 13 OH O S 4-MeOPh 4-MeOPh Ph [14]
15412 1 13 OH O S 3-MeOPh 3-MeOPh Ph [14]
15510 1 13 OH O S Ph Ph . H [14]
15610 1 13 SH O S Ph Ph Ph [14]
1576 1 13 SH O S Ph Ph 4-MeOPh[14]
1586 1 13 SH O S Ph Ph 3-MeOPh[14]
1596 1 13 SH S S Ph Ph H [14]
16012 1 13 CH3 S Ph Ph Ph [14]
16112 1 13 CH3 S 4-BuPh 4-BuPh Ph [14]
16212 1 13 CH3 S 3-BuPh 3-BuPh Ph [14]
16312 1 13 OBu O S Ph Ph Ph [14]
16412 1 13 OMe O S Ph Ph H [14]
16512 1 13 OMe O S Ph Ph Ph [14]
1666 1 l NHB~ O S Ph Ph Ph [14~
1676 1 13 NHBu O S Ph Ph Ph [14]
16~6 1 13 SH O S 4-MeOPh 4-MeOPh Ph [14]
1696 1 13 SH O S 2-MeOPh 2-MeOPh Ph [14]
1700 0 13 OH - O 4-MeOPh 4-MeOPh Ph [1]
1710 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~2]
1720 0 13 OH - O 4-MeOPh 4-MeOPh Ph [3]
1730 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~ [4
1740 0 13 OH - O 4-MeOPh 4-MeOPh Ph [5
' .
.
, '
. . .
~ . . . .
- ~ :
0 4 2 7 : . '
, ~ - 7 2 - ~
2096&~
.. . .
..
No. k m n X Y Z Rl R2 R3 Seq.
- :.. ;.
.
1750 0 13 OH - O 4-MeOPh 4-MeOPh Ph [6]
1760 0 13 OH - O 4-MeOPh 4-MeOPh Ph [7]
1770 0 13 OH - O 4-MeOPh 4-MeOPh Ph [8]
1780 0 13 OH - O 4-MeOPh 4-MeOPh Ph [9]
1790 0 13 OH - O 4-Me~Ph 4-MeOPh Ph ~10]
1800 0 13 OH - O 4-MeOPh 4-MeOPh ~h [11]
1810 0 13 OH - O 4-MeOPh 4-MeOPh Ph [12]
1820 0 13 OH - O 4-MeOPh 4-MeOPh Ph [13]
1830 0 13 OH - O Ph Ph Ph [1]
1840 0 13 OH - O Ph Ph Ph ~2]
1850 0 13 OH - O Ph Ph Ph [3]
1~60 0 13 OH - O Ph Ph Ph [4]
1870 0 13 OH - O Ph Ph Ph [5]
1880 0 13 OH o Ph Ph Ph [6]
1890 0 13 OH - O Ph Ph Ph [7]
1900 0 13 OH - O Ph Ph Ph [8]
1910 0 13 OH - O Ph Ph Ph [9]
192~ 0 0 13 OH o Ph Ph Ph [10]
1930 0 13 OH - O Ph Ph Ph [11]
1940 0 13 OH - O Ph Ph Ph [12]
1950 0 13 OH - O Ph Ph Ph [13]
1960 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~15]
1970 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~a]
1980 0 13 OH - O 4-MeOPh 4-MeOPh Ph [b]
1990 0 13 OH - O 4-MeOPh 4-MeOPh Ph [c]
2000 0 13 OH - O 4-MeOPh 4-MeOPh Ph [d]
~010 0 13 OH - O 4-MeOPh 4-MeOPh Ph [e]
2020 0 13 OH - O Ph Ph Ph [15]
2030 0 13 OH - O Ph Ph Ph [a~
0 4 2 7
- 73 -
2 0 9 6 ~ ~ 8
No. k m n X Y Z __ R3 Seq.
204 0 0 13 OH o Ph Ph Ph [b]
205 0 0 13 OH - O Ph Ph Ph [c]
206 0 0 13 OH - O Ph Ph Ph [d]
. 207 0 0 13 OH - O Ph Ph Ph ~e~
.
', ~
More preferred compounds are 1, 3, 6, 20 32, 33, 35,
43, 45, 46, 47, ~, 54, 6~, 69, 70, 75, 81, 82, a7, 88, - :
91, 128, 132, 147, 153, 157, 159, 160, 165, 166, 168, -
170, 17~, 172, I73, 175, 180, 181, 182, 183, 196, 197,
198, 199, 200, and 201. :
, . .
The most preferred compounds are: ~.
5'-0-~4,4'-dimethoxytrityl)-TGGGA~TGGGTCT (Compound ~.
Number 1), .
5'-0-(4-methoxytrityl)-TGGGAGGTGGGTCTG (Compound Number
~: 3~
.: ~
: S'-O-trityl-TGGGAGGTGGGTCTG (Compound Number 6),
, .
' .'~
5'-O-diphenylmethyl-TGGGAGGTGGGTCTG (Compound Number 32), ;:::
~, :
5'-O-phenylmethyl-TGGGAGGTGGGTCTG (Compound Number 33), :~
5'-0-(2-naphthylmethyl)-TGGGAGGTGGGTCTG (Compound Number .
35), ~ ~ ~-
5~-o-[(3l5-dibenzyloxy)benzyl]-TGGGAGGTGGGTcTG (Compound ..
Number 43), . -
,
0 4 2 7
~ - 7~
2 ~9 ~
5'-S-diphenylmethyl-TGGGAGGTGGGTCTG (Compound Number 62)
5'-S-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCTG (Compound
Number 70),
5'-S-trityl-TGGGAGGTGGGTCTG (Compound Number 75),
5'-0-(4,4' dimethoxytrityl)-AGGTGGGTCTGAAAC (Compound
Number 170), ~;
5'-0-(4,4'-dimethoxytrityl)-TCGGGGTTGGGAGGT (Compound
Number 171), ~
" ~'
5'-0-(4,4'-dimethoxytrityl)-TTGGGAGGTGGGTCT (Compound ;,
Number 172), :~
5'-0-(4,4'-dimethoxytrityl)-ATACTCAGT,CATTTTTAGCAG ~
(Compound Number 173), -
5'-0-(4,4'-dimethoxytrityl~-TGGGTC,TGAaACGAT ~Compound
Number 175), ~-
5'-0-~4,4'-dimethoxytrityl~-GGGAGGTGGGTCTGA (Compound
Number 180), :.
5'-0-(4,4~-dimethoxytrityl)-GTTGGGAGGTGGGTC (Compound ~
Number 181), ,.
'' ~ .'
5'-0-(4,4'-dimethoxytrityl)-GGGTTG,GGAGTGGGG (Compound
Number 182), a~d -
,: ,
5'-O-trityl-TGGGAGGTGGGTCTG (Compound Number 183), .. ~,
5'-0-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCT (Compound~.
Number 196), ,
5'-O-~4,4'-dimethoxytrityl)-TGGGAGGTGGGTC (Compound
~. ',''
', ." ~ '
' ~" ' . ' .'. ,',' . ~ . .''; ' ' '.' , ~ " ' , ' ,. . i ' . . ., ; . .' ` " ,', ': , ' , .
- 75 -
2 ~ 9 ~
Number 197),
5~-0-(4,4'-dimethoxytri tyl)-TGGGAGGTGGGT (Compound
Number 198),
5'-0-(4,4'-dimethoxytrityl) -TGGGAGGTGGG (Compound Number
199 ),
5'-0-(4,4'-dimethoxytrityl) -TGGGAGGTGG (Compound Number ;~-~
200),
- : -
. .
5~-0-(4,4~-dimethoxy~ri tyl)-TGGGAGGTG (Compound Number
201). ~
....".
The compound of the present invention of general
formula (1), as defined above, can be used in the form
of a salt. Examples of suitable salts include inorganic
or organic salts, including alkali metals, such as ;~
~odium and potassium; alkaline earl:h metals, such as
calcium; ammonia; basic amino acids, such as lysine and
arginine; and alkylamines, such as triethylamine.
Preferred such salts are the salts with alkaline metals,
such as the sodium and pota3sium salts.
The compound of general formula (1) of the present
invention can be manufactured u~ing Compound (2): ~ ;
,, ~
... ..
D ~ .
R2 _ C ~ y 3 ,, ( CH2 ~ Z ~0
R~
(2 ) HO
which is prepared according to Proce~se~ A-1, A-2, A-3
and A-4, Process B, C or D when X in general formula (1)
is a hydroxy group, Process E when X i~ general formula
(1) i8 a methyl group, Process F when X in general
.
.
0 4 2 7
~ 76 -
2~9~ 8
formula (1) is a iaulphydryl group, Process G when X in
general formula (1) is an alkoxy group having from 1 to
6 carbon atoms, and Process H when X in general formula
(1) is a monoalkylamino group having from 1 to 6 carbon
atoms.
In Compound (2), R1, R2, R3, Y, Z, m and k
have the same meanings as given for these groups in
connection with the g~neral formula (1), while D'
represents a base selected from the following group
or a protected homologous base.
:
~ Substituents ~: ~
,
adenine ~A), guanine (G), cytosine (C) and thymine
(T). ~
:,. :
In Proces~ B:
(a) a 3~-phosphorous acid derivative prepared by
reacting a phosphitylating agent with Compound (2); and
(b) [1] an oligodeoxynucleotide (hereinafter to be
abbreviated as l'ODN"), produced by synthesis with a DNA
syn~hesiser using a nucleotide wherein the basic portion
and phosphate portion are protected with protecting
groups, and then elimination of the 5~-terminal
dimethoxytrityl group only, which ODN is coupled to
controlled pore glass (hereinafter to be abbreviated as
"CPG"~ or [2] an ODN having a free hydroxy group on its
5'-terminal, which is synthesised by a liquid phase
technique, u~ing a nucleotide wherein the basic portion
and phosphate portion are protected with protecting
groups; are
(c) condensed using a condensing agent to form ..
tripho~phite bonds; followed by ,:
(d) oxidising to the triphosphate using an oxidising
agent or, when coupled to CPG, severing the ODN using
', '.
_ - 77 -
20~6~
ordinary techniques to eliminate the protecting groups;
and
(e) purification by ordinary purification techniques to
obtain the desired compound.
In Process C:
~a) a 3' phosphoric acid derivative prepared by reacting
a phosphorylating agent with Compound (2); and ::~
~b) [1] an ODN, produced by synthesis with a DNA :
synthesiser using a nucleotide wherein the basic portion - :
is protected with protecting groups, and then -. :
elimination o~ the 5'-terminal dimethoxytrityl group ~ -
only, which ODN is coupled to CPG or [2~ an ODN having a
free hydroxy group on its 5'-terminal, which is ~ :
synthesised by a liquid phase technique, using a
nucleotide wherein the basic portion is protected with a
protecting group; are
(c) condensed using a condensillg agent to form
phosphodiester or phospho~riester bonds; and then :-
(d) the protecting groups other than the substituent
bonded to the 5' carbon a~oms of the 5'-terminal are : :
.. . .
eliminated, after severing the ODN using ordinary
techniques when it is coupled to CPG; followed by
(e) purification by ordinary purification technigues to
obtain the desired compound. -- :
In Process D:
~ .
a) a 2'-deoxypho~phonic acid deri~ative, wherein if an
amino group is present in the basic portion of the
2' deoxynucleotide, the amino group is protected with a
protecting group, the desired substituent is introduced
to the 5'-position, and a pho~phonate group is
introduced to the 3'-position; and
(b) [1] an ODN produced by synthesis with a DNA
synthesiser, using a nucleotide wherein the basic - ~ -
"". ..
~ 2 07~
portion is protected with protecting groups such as an
acyl group, from which only the 5'-terminal
dimethoxytrityl group is eliminated, which ODN is
coupled to CPG, or [2] an ODN having a free hydroxy
group on its 5'-terminal, which i9 synthesised by a
liquid phase technique using a nucleotide wherein the
basic portion is protected with protecting groups; are
(c) oxidised by reaction with an acid halide in the
presence of a base to form phosphodiester or ~.
phoi~photriester bonds; followed by
(d) elimination of the protecting groups, after severing
the ODN using ordinary technigues when it is coupled to
CPG; and :
(e) purification by ordinary purification techniques to
obtain the desired compound.
: '
The following provide3 a detailed description of
Processes A to H.
In the reaction schemes of Processes A to H, R1,
R2, R3, Y, Z, m, k, B, D, n and D' have the same -
meanings as defined above, while Hal represents a
halogen atom,`B' represents a bas~ selected from the .
following group of substcituents ~, or a protected
homologous base, A1 represents a protecting group of a
hydroxy group or mercapto group, and A2 represents a
protectiny group of a hydroxy group; .
Substituents ~:
adenine (A), guanine (G), cytosine (C) and thymine
(T).
0 4 2 7
-`" 2 0 ~ 8
Proce: A
This process is for preparing a nucleotide ~:
intermediate (2) to serve as the 5'-terminal of the
compound of the present invention. :.
.'" '.
.:
...
,
~"~
0 4 2 7
~ - 80 -
20~6~
Process A- 1 ~
,
Step 1 A Z ~
HO HO :
(3) (4) :-:
Step 2
,
Step 3 ~
A2 0 A2 0 ' ; .
( 6 ) ~::
~ 5 )
( 6 )
P ¦ N2_C--~y ~, ( CH2~H~e
R3 ( 1 1 ) r --
R2 _ C ~ y _~~ CN2 ~ Z ~
:
( 7 ) A10
Step 5 ¦
RI :
R2 _ Iy ),,, ~ CH2 )k 2 0 ¦ ;~
R3 ~ ~ .
~ : -
HO
(2)
O ~ 2 7
2 ~ 8
.
Process A-1 is composed of Step 1 to Step 5.
Step 1:
This step is for preparing Compound ~4~, in which
only the hydroxy group at the 5'-position is selectively .
protected by reacting a hydroxy group protecting reagent -:
with Compound (3) in an inactive solvent [provided that .~:
the acylation pro~ecting process for those amino groups ~ :
present is included in the previous stage when the base
portions are A, G and C. The protecting process~can be
easily carried out according to known method-[J. Am.
Chem. Soc., 104, 1316 (1982)]. Lower aliphatic acyl or :
aromatic acyl groups are generally used for the
protecting groups of the amino groups. Examples of
those lower aliphatic acyl groups used include the ~ .
formyl, acetyl t propionyl, butyryl, isobutyryl,
pentanoyl, pi~aloyl, vaIeryl and isovaleryl groups and
examples of suitable aromatic acyl groups include the -~
benzoyl, ~-acetoxybenzoyl, 4-methoxybenzoyl,
4-methylbenzoyl and 1-naphthoyl groups. It is preferred
to use benzoyl groups when the base portion is A or C,
and isobutyryl groups when the ba~e portion is G.
. .. .. .
The solvent which may be used preferably includes
aromatic hydrocarbons, such as benzene, toluene and -.
xylene; halogenated hydrocarbons, such as methylene
chloride, chloroform, carbon tetrachloride, ~;
dichloroethane, chlorobenzene and dichlorobenzene; `~
esters, such as ethyl formate, ethyl acetate, propyl ~ :-
acetate, butyl acetate and diethyl carbonate; ethers,
such as diethyl ether, dii~opropyl ether,
tetrah~drofuran, dioxane, dime~hoxyethane and diethylene
glycol dimethyl ether; ketone~, such as acetone, methyl
ethyl ketone, methyl isobutyl ketone, isophorone and
cyclohexanone; nitro compounds, such as nitroethane and ::.
nitrobenzene; nitriles, such as acetonitrile and
-,
.',, ' .
0 4 2 7
isobutyronitrile; amides, such as formamide,
dimethylformamide, dimethylacetamide and
hexamethylphosphorotriamide; sulphoxides, such as
dimethyl sulphoxide and sulpholane; aliphatic tertiary
amines, such as trimethylamine, triethylamine and
N-methylmorpholine; and aromatic amines, such as
pyridine and picoline; more preferably halogenated
hydrocarbons (particularly methylene chloride) and
amides (particularly DMF).
There are no particular restrictions on the`
protecting reagent used, provided that it is able
selectively to protect the 5'-position only and that it
can be eliminated under acidic or neutral conditions.
Preferred such reagents include triarylmethyl halides,
such as trityl chloride, monomethoxytrityl chloride and
dimethoxy~rityl chloride.
A base is usually used when using a triarylmethyl
halide as the protecting reagent.
Examples of bases that are used include heterocyclic
amines, such as pyridine, dimethylaminopyridine and
pyrrolidinopyridine; and aliphatic tertiary amines, such
as trimethylamine and triethylamine; preferably organic
bases ~particularly pyridine, dimethylaminopyridine and
pyrrolidinopyridine).
When organic amines are used as the solvent, there
is no need to add another acid acceptor, since the
organic amine itself functions as an acid acceptor.
While the reaction temperature varies depending on
the starting material, reagent, solvent, etc. employed,
it i9 usually 0 to 150C, and preferably 20 to 100C.
While the reaction time varies depending on the
~' ' , . . : ' ' ~ :, ',, ' . ;~ , ,
' ' . '' :, ' : ',
O ~ 2 7
6 ~
starting material, solvent and reaction temperature
used, it is usually 1 to 100 hours, and preferably 2 to
24 hours.
After completion of the reaction, for example, the
solvent is distilled off and the reaction mixture is
poured in water, made acidic with inorganic acids, such
as hydrochloric acid and sulphuric acid, extracted with
a water-immiscible solvent such as benzene, ether and
ethyl acetate, followed by evaporation of the solvent -
from the extract. The product obtained in this manner
i5 usually used as such in the subsequent step. If
desired, the product can be purified by isolation and by
various chroma~ographic techniques or by
recrystallisation.
Step 2:
. ., ~
This step is for preparing Compound (5) by reacting
Compound (4) with a protecting reagent for hydroxy group
in an inert solvent.
The solvent used preferably includes aromatic -;
hydrocarbons, such as benzene, toluene and xylene;
halogenated hydrocarbons, such as methylene chloride,
chloroform, carbon tetrachloride, dichloroethane,
chlorobenzene and dichlorobenzene; esters, such as ethyl
formate, ethyl acetate, propyl acetate, butyl acetate
and diethyl carbonate; ethers, such as diethyl ether,
diisopropyl ether, tetrahydrofuran, dioxane,
dimethoxyethanè and diethylene glycol dimethyl ether;
alcohols, such as methanol, ethanol, propanol,
isopropanol, butanol, isobuta~ol, t-butanol, isoamyl
alcohol, diethylene glycol, glycerol, octanol, ~
cyclohexanol and methyl cellosolve; ketones, such as
acetone, methyl ethyl ketone, methyl isobutyl ketone,
isophorone and cyclohexanone; nitro compounds, such a~
O ~ 2 7
- 84 -
2 0 9 ~
nitroethane and nitrobenzene; nitriles, such as
acetonitrile and isobutyronitrile; amides, such as
formamide, dimethylformamide, dimethylacetamide and
hexamethylphosphorotriamide; sulphoxides, such as
dimethyl sulphoxide and sulpholane; and more preferably
halogenated hydrocàrbons (particularly methylene
chloride), aromatic hydrocarbons (particularly toluene)
and amides ~particularly D~F).
The choice of protecting reagent employed is not
particularly limited, as long a~ it can deprotect all
groups except the 5~-position, and examples preferably
include silyl halides, such as t-butyldimethylsilyl
chloride; haloalkoxycarbonyl halides, such as
trichloroethoxycarbonyl chloride; and aralkyloxycarbonyl
halides, such as benzyloxycarbonyl chloride.
When the silyl halides, haloalkoxycarbonyl halides
and aralkyloxycarbonyl halides are used as the
protecting reagent, bases are usually used.
The base used preferably includes organic bases
(particularly triethylamine, pyridine,
N methylmorpholine, DBU, etc.).
While the reaction temperature varies depending on
the reagent, starting material, solvent, etc. employed,
it is usually -20 to 150C, and preferably -10 to 50C.
While the reaction time varies depending on the
starting material, solvent and reaction temperature
employed, it is usually 1 to 100 hours, and preferably 1
to 24 hours.
, ~
After completion of the reaction, for example, the
solvent i9 distilled off and the reaction mixture i9
' poured in water, made acidic with inorganic acids, such
,
0 4 2 7
~ - 85 ~96~8
''. ~' ' '.:
as hydrochloric acid and sulphuric acid, extracted with
a water-immiscible solvent such as benzene, ether and
ethyl acetate, followed by evaporation of the solvent
from the extract. The product obtained in thi~ manner
is usually used as such in the subsequent step. If
desired, the product can be purified by isolation and by
various chromatographic techniques or by
recrystallisation.
Step 3: ~
This step is for preparing Compound (6) by reacting
a deprotecting reagent with Compound (5) in an inert
solvent to eliminate selectively the hydroxy group at
the 5'-position.
The solvent used preferably includes aromatic
hydrocarbons, such as benzene, toluene and xylene;
halogenated hydrocarbons, such as methylene chloride,
chloroform, carbon tetrachloride, dichloroethane, ~-
chlorobenzene and dichlorobenzene; esters, such as ethyl
formate, ethyl acetate, propyl acetate, butyl acetate
and diethyl carbonate; ethers, such as diethyl ether, ~-
diisopropyl ether, tetrahydrofuran, dioxane,
dimethoxyethane and diethylene glycol dimethyl ether;
alcohols, such as methanol, ethanol, propanol,
i~opropanol, butanol, isobutanol, t-butanol, isoamyl
alcohol, diethylene glycol, glycerol, octanol,
cyclohexanol and methyl cellosolve; ketones, ~uch as
acetone, methyl ethyl ketone, methyl isobutyl ketone,
isophorone and cyclohexanone; nitro compounds, such as
nitroethane and nitrobenzene; nitriles, such as
acetonitrile and isobutyronitrile; amides, such as
formamide, dimethylformamide, dimethylacetamide and - -
hexamethylpho~phorotriamide; and sulphoxides, such as
dimethyl sulphoxide and sulpholane; and more preferably
alcohols (particularly methanol and ethanol).
- - 86 -
~09~5~
The choice of deprotecting reagent to be used is not
particularly limited, as long as it is normally used for
that purpose, and includes, for example acetic acid,
trifluoroacetic acid and hydrochloric acid methanol when
the protecting group is a triarylmethyl group, and
preferably acetic acid and trifluoroacetic acid.
While the reaction temperature varies depending on
the reagent, starting material, solvent, etc. employed,
it is usually -10 to 100C, and preferably 0 to 50C.
While the reaction time varies depending on the
starting material, solvent and reaction temperature
employed, it i9 usually 1 to 50 hours, and preferably 1
to 24 hour~.
After completion of the reaction the solvent is, for
example, distilled off and the reaction mixture is
poured in water, made acidic with inorganic acid~, such
as hydrochloric acid and sulphuric acid, extracted with
a water-immiscible solvent such as benzene, ether and
ethyl acetate, followed by evaporation of the solvent
from the extract. The product obtained in this manner
is usually used as such in the subsequent step. If
desired, the product can be purified by isolation and by
various chromatographic techniques or by
recrystallisation.
~ Y~d ~
Step ~:
This step is for preparing Compound (7) by reacting
Compound (~) with Compound (11) (in the formula, Hal
represents a halogen atom) in an inert solvent and in
the presence of a base.
The halide portion of Compound (11) employed
includes chlorine, bromine and iodine, and preferably
04 2 7
~ - 87 -
~ ~ 9 ~
chlorine and bromine.
The base employable preferably includes organic
bases (particularly triethylamine, pyridine,
N-methylmorpholine, DBU, etc.)
-., ,
While the reaction temperature is not particularly
limited, it is usually 0C to 100C, and the reaction is ~
carried out preferably at 50C. -
While the reaction time is usually from 5 minutes to
30 hours, the reaction completes in 10 hours when it is
carried out at 50C'C.
After completion of the reaction, the reaction
mixture i9, for example, appropriately neu~ralised or, ~ -
if insolubles exist therein, they are removed by
filtration. Then, an organic water-immiscible solven~
such as ethyl acetate i9 added to the filtrate, followed
by washing with water. The organic layer containing the
desired compound i9 separated and dried over anhydrous
magne,ium sulphate, followed by evaporation of the
solvent to give the desired compound.
The desired compound obtained in this manner can
further be purified by conventional procedures, such as
recrystallisation, reprecipitation, chromatography,
etc., if desired.
Step 5:
This step is for preparing Compound (2) by reacting
a deprotecting agent with Compound (7) in an inert
solvent .
1) In the case where a ,ilyl group is used as the
3'-poaition protecting group, it i9 usually removed by
" ~ ' ' ; '; '~ ' ' ! ; . ,
O ~ 2 7
r~ - as
; 6
treating with a compound which forms a fluorine anion,
such as tetrabutylammonium fluoride.
While the choice of solvent to be used is not
particularly limited, unless it inhibits the reac~ion,
it pre~erably includes ethers, such as tetrahydrofuran
and dioxane.
While the reaction temperature is not particularly
limited, it is usually -30C to 100C, and the reaction
i8 carried out preferably at O~C to 30C.
While the reaction time i~ u~ually from 5 minutes to
30 hours, the reaction completes in 10 hours when it is
carried out at 20C.
After com~letion of the reaction, the reaction
mixture is, for example, appropriately neutralised or,
if insolubles exist therein, they are removed by
filtration. Then, an organic water-immiscible solvent
such as ethyl acetate is added to the filtrate, followed
by wa~hing with water. The organic layer containing the
de~ired compound is separated and dried over anhydrous
mag~e~ium sulphate, followed by evaporation of the - `
solvent ~o give the desired compound.
The desired compound obtained in this manner can
further be purified by conventional procedure such as
recrystallisation, reprecipitation, chromatography,
etc., if desired. ~-
' ' ~ .
2) When a haloalkoxycarbonyl group is used as the ~ ~-
3'-position protecting group, zinc powder i9 usually
u~ed. -
'. .' . .
While the choice of solvent to be used is not
particularly limited unles~ it inhibits the reaction, it :~
, . i~
~ ' '
O ~ 2 7
~~ - 89 -
2~966;~
preferably includes acetic acid, alcohols and a mixture
of water and these solvents.
While the reaction temperature is not particularly
limited, it is usually 0C to 100C, and the reaction is
carried out preferably at room temperature.
: : .
While the reaction time is usually from 5 minutes to
30 hours, the reaction completes in 10 houxs when it is
carried out at room temperature.
.
After completion of the reaction, the reaction
mixture is, for example, appropriately neutralised or,
if insolubles exist therein, they are removed by -~
filtration. Then, an organic wa~er-immiscible solvent
such a~ ethyl acetate i8 added to the filtrate, followed ~i
by washing with water. The organic layer containing the ~ -
deYired compound is separated and dried over anhydrous
magnesium sulphate, followed by evaporation of the
solvent to give the desired compound.
The desired compound obtained in this manner can
further be purified by conventional procedure such as
xecrystallisation, reprecipitation, chromatography,
etc., if desired.
~ '~
3) In the ca~e where an aralkyloxycarbonyl group is used
as the ~'-po~ition protecting group, the deprotection i9
usually carried out by catalytic reduction or
oxidisation.
While the choice of cataly~t to be used when the
catalytic reduction is carried out is not particularly
limited, ~o long as it i9 usually used for the catalytic
reduction reaction, it preferably include~ palladium
carbon, Raney nickel, platinum oxide, platinum black,
rhodium-aluminium oxide, triphenylphosphine-rhodium
,, , . i.
'. ~'"
., ,: ' .' ' ' ' . i
0525
G ~1 (J
chloride and palladium-barium sulphate~
Whilè the presaure is not particularly limited, the
reac~ion is u~ually carried out at 1 to 10 atmospheres.
While the reaction temperature and the reaction time
vary depending on the s~arting material and the type of
solvent and catalyst, the reaction is usually carried
out at 0 ~o 100C for 5 minute~ to 24 hours.
While the choice of solvent to be used in the
elimination by oxidi~ation i9 not particularly limited,
unle~ it participates in the pre~ent reaction, it i~
preferably a water-containing organic solvent.
Such organic solvents preferably include ketones,
such aa acetone; halogenated hydrocarbon~, ~uch as
methylene chloride, chloroform and carbon tetrachloride;
nitriles, such as acetonitrile; ethers, such as diethyl
ether, tetrahydrofuran and dioxane; amides, 3uch as
dimethylformamide, dimethylacetamide and
hexamethylpho~phorotriamide; and sulphoxides, such a3
dimethyl sulphoxide.
While the choice of oxidising agent to be u~ed is
not particularly limiteds as long as it i~ a compound to
be used for oxidi~ation, paotassi ~ ~ersulphate, sodium
persulphate, ~Yc~tr~cerium~nitrate (CAN),
2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ~ are
preferably used.
While the reaction temperature and the reaction time
vary depending on the starting material, and the type of ~ -
~olvent and catalyst, the reaction is usually carried
out at 0 to 150C for 10 minute~ to 24 hour~.
Also, the 3'-poaition protecting group can be
o ~ 2 7
~ 2 0 9 ~ ~ 3 ~ ~
eliminated by reacting with an alkali metal, such as
metallic lithium and metallic sodium in liquid ammonia,
or an alcohol such as methanol and ethanol at -78 to ~
-20C. ~ :
.' ,
Further, the 3'-position protecting group can be
eliminated by using aluminum chloride-sodium iodide or
an alkylsilyl halide, such as trimethylsilyl iodide in a
solvent.
While the choice of solvent to be used i9 no~
particularly limited, unless it particiates in the
present reaction, it preferably include~ nitriles, such
as acetonitrile, halogenated hydrocarbons, such as
methylene chloride and chloroform, and a mixture of
these solvents. ;;
While the reaction temperature and the reaction time ;
vary depending on the type of starting material and
solvent, the reaction is usually carried out at 0 to
50C for 5 minutes to 3 days.
:
If the reaction substrate contains a sulphur atom,
aluminum chloride-sodium iodide is preferably employed. ~
: .
The reaction mixture is then, ~or example,
appropriately neutralised or, if insolubles exist
therein, they are removed by filtration. Then, an ;
organic water-immi~cible solvent such as ethyl acetate
is added to ~he filtrate, followed by washing with
water. The organic layer containing the desired
compound is separated and dried over anhydrous magnesium
sulphate, followed by evaporation of the solvent to give
the desired compound. ~
The desired compound obtained in this manner can
further be purified by conventional procedure such as
.
',', '''
. . . : '. . , - . ,!, .j;',, ' ', ' ' ;.'.' ' . ! ' ' ' ' ; ' '"
O ~ 2 7
~ - 92 -
i` 2~966~8
recrystallisation, reprecipitation, chromatography,
etc., if desired.
Process A-2
HO
Step 6 (1
. , ,
R I D
. R2--C~Y~ ( CH2 )k Z~~ . :
R3 ~ ~:
~10 :'':,.:
(2) ; -`
~ ~ ' ' ``.''''`''
: ~ ,
.~' ~' " .
.
' ~' ' ' '~
":~. ':.
~ .
93 ?0966~ig ~-27
Process A- 3
A~ O ~ ~ .
( 6 )
H ~ Y 3,,, -~ CH2 )h Ha ~
Step 7 ( 1 2 ) ~-
D' :
HY - ( CH2 ~ Z ~ O
( 8 ) A20 -~
~' ' . .'
(1 1) - '
Step 8 -:
R I D
R2--C ~ y ~ CH~ ~ Z ~
,,
( 9 ) A20
,~
Step 9 : :
' ~,',.. ~
R I D
R2 - C ~ y )m ( CH2 ~ Z ~0~
R3 ~/ ~:
HO :~. -
. ( 2 ) : -.
0 4 2 7
- 9 9~ _
2096~ 8
Process A-3 consists of Step 7 to Step ~.
Step 7:
This step i~ for preparing Compound ~8) by reacting
Compound (6) with Compound (12) in an inert solvent and in
the presence of a base.
The halide portion of Compound (11) includes chlorine,
bromine and iodine, preferably chlorine and bromine.
The solvent to be used preferably includes aromatic
hydrocarbon~, such as benzene, oluene and xylene;
halogenated hydrocarbons, such as methylene chloride,
chloroform, carbon tetrachloride, dichloroethane, -
chlorobenzene and dichlorobenzene; esters, such as ethyl
formate, ethyl acetate, propyl acetate, butyl acetate and
diethyl carbonate; ethers, such as diethyl ether,
dii~opropyl ether, tetrahydrofuran, dioxane,
dimethoxyethane and diethylene glycol dimethyl ether; -~
ketones, such as acetone, methyl ethyl ketone, methyl
isobutyl ketone, isophorone and cyclohexanone; nitro
compounds, such as nitroethane and nitrobenzene; nitriles,
~uch as acetonitrile and isobutyronitrile; amides, such as
formamide, dimethylformamide, dimethylacetamide and ~-
hexamethylphosphorotriamide; sulphoxides, such as dimethyl
sulphoxide and sulpholane; more preferably ketones
(particularly acetone), halogenated hydrocarbons `~
(particularly methylene chloride) and amides (particularly
DMF).
,~
The base to be used preferably includes organic bases
(particularly triethylamine, pyridine, N-methylmorpholine,
DBU, etc.) and alkali metal carbonates (particularly~
sodium carbonate and lithium carbonate).
W~ile the reaction temperature is not particularly
':
';. '
'
9s
- ~9~
limited, it is usually 0C to 100C, and the reaction i9
carried out preferably at 50C.
While the reaction time is usually from 5 minutes to
30 hours, the reaction completes in 10 hours when the
reaction is carried out at 50C.
After completion of the reaction, the reaction mixture
is, for example, appropriately neutralised or, if
insolubles exist therein, they are removed by filtration. ; ~ -
Then, an organic water-immiscible solvent ~uch as ethyl
acetate i9 added to the filtrate, followed by washing with
water. The organic layer containing the desired compound
is separated and dried over anhydrous magnesium sulphate,
followed by evaporation of the solvent to give the desired
compound.
.
The desired compound obtained in this manner can
further be purified by con~entional procedure such as
recrystallisation, reprecipitation, chromatography, etc.,
if desired. `,
~ ~''' .
Step 8:
This step is for preparing Compound (9) by reacting
Compound (8) with Compound (11) in an inert solvent and in
the presence of a base. The ba~e employable preferably
includes organic bases (particularly triethylamine,
pyridine, N-methylmorpholine, DBU, etc.) and alkiali metal
carbonates (particularly sodium carbonate and lithium
carbonate).
While the reaction temperature is not particularly
limited, it i9 usually 0C to 100C, and the reaction i9
carried out preferably at 50C.
While the reaction time is usually from 5 minutes to
o 1 2 7
~ - 96 -
2~9~6~8 -
30 hours, the reaction completes in 10 hours ~hen the
reaction is carr.ied out at 50C.
After completion of the reaction, the reaction mixture
i9, for example, appropriately neutrali3ed or, if
insolubles exist therein, they are removed by filtration.
Then, an organic water immiscible solvent such as ethyl
acetate is added to the filtrate, followed by washing with ~-
water. The organic layer containing the desired compound -
is separated and dried over anhydrous magnesi~n sulphate,
followed by evaporation of the solvent to give t`he desired ~
compound. ~ ;
The desired compound obtained in this manner can ; ~`
further be purified by conveDitional procedure such as
recrystallisation, reprecipitation, chromatography, etc.,
if desired. ~ ~
. ' - . .'~ ~ :
Step 9:
~ , . .
This step i8 for preparing Compound (2) by reacting a ;
deprotecting agent with Compound (9) in an inert solvent,
and i8 carried out in the same manner a~ in Step 5 of
Process A~
' ~
: ' .
.: .
' ' ~
: . -:
- 97 -
209~6~ -
Process A-4 i-
D
HZ
HO
: (3) ~.
~ ..
(1 2)
step 10 ~:~
. .
, . . .
H~Y 3, ~ CH3~2~
(1 O) ' :',
HO :.
step 11 ¦
R3-C~Y~ CR~
: (2) :- .
HO ~ ~:
:: Process A-4 consi~ts of Step 10 and Step 11. ::
:::
: Step 10: .
This 3tep is for preparing Compound (10) by reacting
Compound (12) (in the fonmula Hal reprenents a halogen r ., ,
atom) with Compound (3) in an inert solvent and in the
pre3ence of a base. Thi9 ~tep i9 carried out in the same
manner as in Step 7 of Proces~ A-3.
:: '
:,
"~ "~ 3i ~: 3 , ~
O ~ 2 7
` - 98 -
~ O ~
Step 11:
This s~ep is for preparing Compound (2~ by reacting -
Compound (12) (wherein Hal represents a halogen atom) with : -
Compound (10) in an inert solvent and in the presence of a
base. This step is carried out in the same manner as in
Step 8 of Procesis A-3.
" ':
.
`:`: ~ ,'
~ ' ':` '
,'~'', ' ' :
' ',''' ~'"'~' .'"'
:' '
, . ~
- 99 -
M&C FOLIO: P67164 - FP-9135 2~66.~ W~NGDOC
Process B
Rl
( 2 ) ~R2--c~y~cH2~z-cH
Step 12 R3 . k ~ D
O ( 1 4 ) :
V-P-U .::
, H !
Step 13 ~0~, ~ :
~ :
_ :
O--P--O ~. ~
~' O ,.
~ . I n
~ ~ C\~ 0, ' ~
R2-C~y~CN2~z-c~
.,
'~ ' .
- P=O : '
O .'
CH~
\~ ~ B : :
~)~ .
O
O--P= ~
O ~ ..
C~2
( 1 ) ~ B
HO
.. " . , .. . . " , ,. ., ~.
., , ,,. .. . . ., , . ,, , . ~ ;. .... , :., ,.; . . .
~ . :
0 4 2 8
- 10 0
209~65~
Process B can be performed according to Step 12 and
Step 13 indicated below. An explanation o~ each of these
.~ .
steps i~ given below.
Step 12:
.. .. :
This step is for preparing a 3'-phosphorous acid
derivative ~Compound (14)] by reacting
chloropho~phoramidite [Compound (13)], a phosphitylating
agent, with Compound (2) in an inactive ~olvent and in the
presence of an acid acceptor~ A dialkylamino gx~up, such
as a dimethylamino group and dii30propylamino group J or a
heterocyclic group having 1 or 2 oxygen atoms and/or ~;
nitrogen atoms in it3 ring, such a~ a morpholino group, is
used for U of Compound (13). While any group can be u~ed
for V o~ Compound (13), provided that it can be removed
following formation of a phosphodiester group in Step 13,
lower alkyl groups, such as a methyl group, and cyanoalkyl
group~, such a~ a cyanoethyl group, are preferably u~ed.
Examples of Com~ound (13) include phosphines, such a~
chloromorpholinomethoxyphosphine, chloromorpholino-
cyanoethoxyphosphine, chlorodimethylaminomethoxyphosphine,
chlorodimethylaminoethoxyphosphine, chlorodiisopropyl-
aminomethoxyphosphine and chlorodii~opropylaminoethoxy-
phosphine; preferably chloromorpholinomethoxyphosphine,
chloromo~pholinocyanoethoxypho~phine, chlorodiiso-
propylamlnomethoxyphosphine and chlorodii~opropyl-
aminocyanoethoxypho~phine.
While the solvent-u~ed is not particularly limited,
provided that it does not affect the reaction, preferred
solvent~ include ethers, such as tetrahy~rofuran, diethyl
ether and dioxane. ~
.'~,
While examples of the deoxidlser used include
heterocyclic amines, ~uch as pyridine a~d dimethylamino-
pyridine, and aliphatic amines, ~uch as trimethylamine,
. .
, ' '
,1 . . ~ ,.
.
0 4 2 8
- 101 -
~ o 9 ~ 5 3 ~
triethylamine and diisopropylethylamine~ aliphatiC amines
(particularly dlisopropylethylamine) are preferably used.
While the reaction temperature is not particularly
limited, it is usually -50C ~o 50C, preferably room
temperature.
While the reaction time varies depending on the
starting material, reagent and temperature employed, it is
usually 5 minutes to 30 hours, preferably 30 minute~ when
the reaction i9 carried out at room temperature. The
reaction mixture is then, for example, appropriately
neutrali~ed or, if insolubles exist, they are removed by
filtxation. Then, an organic water-immiscible ~olvent
euch as ethyl acetate is added thereto, followed by
washing with water. The organic layer containing the
de~ired compound is separated and dried over anhydrou~
magnesium sulphate, followed by evaporation of the ~olvent
to give the desired compound.
The desired compound obtained in this manner can
further be purified by con~entional procedure such as
recrystallisation, reprecipitation, chromatography, etc.,
if de~ired.
Step 13:
In this step:
(i) Compound (14) obtained in Step ~12); and
(ii) ~1] a~ ODN synthe3i~ed with a DNA sy~the~iser and
coupled to CPG, wherein only the 5~-terminal ;-
dimethoxytrityl group i~ eliminated and the ba~e portion
i9 protected with a protecting group such a3 an acyl
group, or [2] an ODN syntheeised by a liquid phase
technique having a free hydroxy group at it~ 5~-terminal,
wherein the base portion is protected with a protecting
group, such a~ an acyl group;
, .
.
., :. ., ,, . .. -, "
0 4 2 ~
- 1 0 2
2~965;~
(iii) are [1] condensed using a guitable condensing agent
to form a triphosphite bond, followed by [2] oxidation
using a suitable oxidi~ing agent to convert to the
phosphotriester, and severing the ODN from the CPG when
the ODN is coupled to CPG, followed by elimination of the
protecting group to;
(iv~ obtain the final product after following a
purification procedure.
The ODN of the desired nucleotide ~equence, in which a
free hydroxy group at the 5'-terminal is protected, can be
synthesised using a DNA ~ynthesiser such as the Model
380-B of Applied Biosystem~ Inc. applying the phosphoro-
amidite method, according to any variation of the Stek
method described in the J. Am. Chem. Soc., 106, 6077-6089
(1984). ,~
In addition, a base protected with an acyl group i9
u~ed for base in ~he material of ODN synthesis. A benzoyl
group i9 preferably used for the acyl group when the base
portion i9 A or C, while an isobut~yryl group i9 used for ~ -
the acyl group when the base i~ G.
. .
Furthermore, in the case of a free ODN not coupled to
CPG, it i9 preferred that qaid ODN be purified in order to
be used in the following reaction. Said ODN can be
purified with a purification procedure used in ordinary
purification of nucleic acids, including various types of '~
chromatography such as re~erse phase and ion exchange
chromatography (including high-performance liquid
chromatography).
While examples of acidic substances used for the
catalyst in the condensation reaction of this step include
acidic substances, such as mesitylene
sulphonylnitrotriazolide and tetrazole, tetrazole is used
preferably.
., ,
O ~ 2 8
~ - 103 -
2 0 ~ 8
While the 901vent employable i9 not particularly , -
limited unless it inhibitS the reaction, it preferably
includes ni.triles.
While the reaction temperature may be in the range of
-30 to 50C, the reaction i9 usually carried out at room
temperature.
While the reaction time i9 in the range of 1 minute to
20 hours, and it may vary depending on the reaction -.
temperature, the reaction completes in 10 minutes when the :
reaction is carried out at room temperature.
:::
While there are no particular limitations on the ' .:
~hoice of oxidising agent used in the oxidation reaction
of ~his proce~s, provided that it is an oxidising agent
usually used in oxidation reaction~, it can.preferably be
exemplified by inorganic metal oxidising agents including
mangane~e oxides, such as potassium penmanganate and
manganese dioxide; ruthenium oxide~, such as ruthenium
tetraoxide; selenium compounds, such as selenium dioxide;
iron compound~, such a~ iron chloride; osmium compound~,
~uch as osmium tetraoxide; ~ilvex compoun~s, ~uch as
~il~er oxide; mercury compound~, such as mercury ace~ate;
lead oxide compound~, such as lead oxide and lead
tetraoxide; chromic acid compound~, such as potas~ium
chromate, chromic acid-sulphuric acid complex and chromic
acid-pyridine complex; and cerium compounds, such as
cerium ammonium nitrate (CAN~; inorganic oxidising agents
including halogen molecules, such aQ chlorine molecules,
bromine molecules and iodine molecules; periodic acids,
~uch as sodium periodate; ozone; aqueous hydrogen ~ -
peroxide; ni~rous acid compound~, such as nitrous acid;
perchlorate compounds, such a8 pota~sium chlorite and
sodium chlorite; chlorous acid compound~, such as
pota~sium perchlorat~ and ~odium perchlorate; and
persulphuric acid compounds, such as potassium persulphate
, - 104 -
2~9g~8
,
and sodium persulpha~e as well as organic oxidising agents
including reagentS uged in DMSO oxidation (complexes of :~
dimethyl sulphoxide and dicyclohexylcarbodiimide, oxalyl
chloride, acetic anhydride or phosphorus pentoxide, and
complexe~ of pyridine and sulphuric anhydride); peroxides,
such as t-butylhydroperoxide; stable cations, such as
triphenylmethyl cation; succinimides, such as
N-bromo~uccinimide; hypochlorous acid compounds, such as :
t-butylhypochlorite; azo-dicarboxylic acid compounds, such
as azo-dicarboxylic acid ester~; disulphides and triphenyl
pho~phine~, ~uch as dimethyl disulphide, dipheny~ :
disulphide and dipyridyl di~ulphide; ~ulphites, such as
methyl sulphite; tetrahalogenated carbon such a~ methane
tetr~bromide; and quinone compounds, such as
2,3-dichloro-5,6-dicyano-p-benzoguinone (DDQ),
particularly preferably iodine. ;.;~
The choice of solvent to be used in the reaction is ~ .
not particularly limited, provided that it does not :-
interfere with the reaction and can dissolve the starting
materials to some extent, and it preferably includes
aromatic hydrocarbons, i~uch as benzene, toluene and
xylene; halogenated hydrocarbon~ 3uch as methylene
chloride and chloroform; ethers, such as ether, ~: -
tetrahydrofuran, dioxane and dimethoxyethane; amides, such
as dimethylformamide, dimethylacetamide and
hexamethylphosphorotriamide; sulphoxide~, such as dimethyl
sulphoxide; alcohols, such ais methanol, ethanol, propanol,
isopropanol, butanol, isobutanol and i~oamyl alcohol;
diluted acids, ~uch a~ aqueou~ sulphuric acid; dilllted
baises, such as agueous sodium hydroxide; water; acetone;
ketones, ~uch as methyl ethyl ketone; heterocyclic amines,
such as pyridine; and nitriles, such as acetonitrile,
pre~erably nitriles (particularly acetonitrile), eth~rs ~. ;
(particularly tetrahydrofuran) and halogenated
hydrocarbon~ (partisularly methylene chloride).
'
; .
. . . , . " ~ . , -. .. , " , . . . . . ... . ..... ... . . . . . . . .
'' ~ '' :: , , : , , ' ' ' "
~ - 105 -
209~6-~'g
The reaction is carried out at a temperature of -50 to
100C. While the reaction time varies depending on the
reaction temperature, raw material compounds and type of
solvent used, it i5 u5ually 30 minutes to 15 hours.
Furthermore, in the a~tove-mentioned oxidation reaction,
the reaction is accelerated by the addition of a layer
migrating catalygt 5uch as triethylbenzylammonium chloride
and tributylbenzylammorlium bromide.
Severing the ODN from the CPG whPn the ODN is coupled
to the CPGI as well as removal of the protecting~group~
other than those sub3tituted at the 5'-tenminal, can be -~
carried out according to k~own method~ ~J. Am. Chem. Soc.,
103, 3185 (1981)~.
By purifying the compound of the general formula (1)
obtained in this manner with a purification procedure
u~ually u~ed for purification of nucleic acids, includi~
various type~ of chromatography such as reverse phase and
j ion exchange chromatography (including high-performance
liquid chromatography), the compound having the
above-mentioned general formula (1) can be obtained.
:
~' .
:
,
~'
t
s
., ~
0~2a
. - 106 -2~9665~ :
Process C
R
( 2 ) --~ RZ- C ~ Y J 1 CHz 1 Z~ C~
- ( 1 1 ) `:
~ O - P= O
S~ep 15 . OAr
HO
:~ C~}
~''-
O
~ O - P= O ,' ' '
~ D n
Rl ~B '
ZZ-C~Y~CN2~Z-C~ W (I S)
O :.
J I .,
', . ~ '.
'. CH2 o .''; ~`
,, . ~
-O--P=O .'~ ,:
~, CH
( 1 ) ~B
' ~ HO .
O ~ 2 ~
- 107 -
2 0 9 ~ 6 :~ 8
Process C can be performed according ~o Step 14 and
Step 15 indicated below. An explanation of each of these
steps is given below.
Step 14:
In this step, after reacting a phosphating reagent
such as ditriazolide (16) with Compound (2) in an inactive
solvent, the reaction mixture i9 treated following
addition of water to obtain a mononucleotide (17) to serve
as the intermediate.
While the choice of solvent is not paticularly
limited, provided that it doe~ not interfere with the
reaction, it usually includes aromatic amines, such as
pyridine. While there are also no particular limitations
on the Ar group of the phosphating reagent, provided that
it can be eliminated under conditions for eliminating the
protecting group of the base portion following completion
of the conden~ation reaction of Step 15, an
ortho-chlorophenyl group i~ usually used.
While the reaction temperature ie not particularly
limited, provided that it i9 within a range of -20 to
100C, the reaction is usually carried out at room
temperature. While the reaction time varies depending on
the solvent used and the reaction temperature, the
reaction ~ime i~ 1 hour when u~ing pyridine for the
reaction solvent and carrying out the reaction at room
temperature.
~ .
Step 15:
-
In thi~ ~tep, the mononucleotide (17) obtained i~ St~p
14, and [1] an ODN sy~the~ised with a DN~ ~ynthesi~er and
coupled to CPG, wherein only the 5'-terminal
dimethoxytrityl group i8 eliminated and the base portion
. :
..
-
..... , . . . . . .. . . " ... . . ., . . . .. " . , .. . ... .. ,., .. " . ... - , , .... . , , , . . - . - .. , . ,,., .,
, ~
oq 2a
- 108 -
20966~
and phosphate portion are protected with protecting
group~, or [2] an ODN synthesised with a liquid phase
technique and having a free hydroxy group at the
5'-terminal, wherein the base portion and phospha~e
portion are protected with protecting groups, are
condensed using a conden~ing agent to form phosphotriester
bonds, followed by severing the ODNi from the CPG when the ;
ODN is coupled to CPG, and elimination of the protecting
groups to obtain final product (1) after following a
purification procedure. While the solvent used in this
tep i3 not particularly limited, provided that it does
not interfere with the reaction, it preferably includes
aromatic amines, 3uch as pyridine.
~.: . .
While ex~mples of the conden~ing agent used for
conden~ation iniclude dicyclohexylcarbodiimide (DCC),
me~itylene sulphonyl chloride (M~-Cl),
triisopropylbenzenesulphonyl chloride, mesitylene
~ulphonyl triazolide (MST), mesitylene
sulphonyl-3-nitrotriazolide (MSNT),
triisopropylbenzenesulphonyl tetrazolide (TPS-Te),
triiYopropylbenzenesulphonyl nitroimidazolide (TPS-~I) and
triisopropylbenzene~ulphonyl pyriclyltetrazolide, MSNT,
TPS-Te and TPS-NI are preferably used.
While the reaction temperature is not particularly
limited as long as it is in the range of -10 to 100C, the
reaction i9 usually carried out at room temperature.
While the reaction time varies depending on the solvent
and the reaction tempera~ure employed, it i~ 30 mi~utes
when pyridine i9 used a~ the reactive solvent and the
reaction i9 carried out at room temperature.
.
After completion of the reaction the reaction mi~ture
i9, for example, appropriately neutralised or, if
in~olubles exist therein, they are removed by filtration.
Then, an organic water-immiscib1e solvent such as ethyl
''i
. .
1~ ' , ~ , , .
0 4 2 ~I
` - 109 -
2~9~3
acetate i8 added to the filtrate, followed by washing with
water. The organic layer containing the desired compound
is separated and dried over anhydroug magnesium sulphate,
followed by evaporation of the sol~ent to give the desired
compound.
The desired compound obtained in this manner can
further be purified by conventional procedure such as
recrystalli~ation, reprecipitation, chromatography, etc.,
if desired.
:.:
..
~ , t~
- 110 -
2 ~ 8
Process D
R l - :
( i' ) _~ R2--C ~ Y~ CH2 ~ Z CH2 .:
Step 16 R3 . k \~>_ D'
( 1 9) 0~ ' ~'
H- P--O
HO
, . I , .
Step 17 , ~B' ~
- O- P= O '~
~ ~ 1- n :
Ra-C~Y 1, 1Cl2~Z-C~ W~I S ~
-o-P=o ' :'
~ . .
~a ~ ~
- o- P--
o . . .
CN2
(1)' . ~ "
HO ,
O ~ 2
- 111 -
2 0 9 ~ & ~ ~
Proces8 D is indicated below. It can be performed
according to Step 16 and Step 17. An eXplanation of each
of these steps i9 given below.
Step 16:
In Step 16, after reacting, for example,
tris~ 2~4-triazolyl)phosphite (18), prepared in advance
from phosphoru~ trichloride and 1,2,4-triazole according
to the literature [B.C. Freohler, P.~. Ng and M.D.
Matteucci, Nucleic Acid Req., 14, 5399 (1986)], with ~ -
Compound (2) in an inactive aolvent, wa~er is added to the
reaction mixture to stop the reaction followed by
po~-treatment to obtain 3'-H-phosphonate nucleo~ide
(~9). While the choice of solvent u~ed is not
particularly limited, provided that it does not interfere
with the reaction, a preferred 901Yent i9 a halogenated
hydrocarbon, such as methylene chloride. ~hile there are
no particular limitation~ on the reaction temperature,
provided that it i9 within a range of -20 to 100C, the
reaction i8 u~ually carried out at room temperature. -
~ - .
While the reaction time varie~ depending on the :-
~olvent and reaction temperature employed, it is 30 ~.
minu~es in the case where the reaction is carried out in .
methylene chloride at room temperature.
'.
Step 17
.
In this step, the 3'-H-pho~phonate nucleoside (19) ;~
obtained in Step 16~ and an ODN synthe-~ised with a DNA -
i ~ynthe~iser and connec~ed with CPG and wherein only the
5'-terminal dimethoxytrityl group ia eliminated and the : :
~a~e portion i9 protected with a protecting group [~.C.
Froehler, P.G. Ng and M.D. Matteucci, Nucleic Acid ReR., ~ :
14, 5399 (1986)], are condensed in the pre~ence of a~.
condensing agent, such as pivaloyl chloride and an acid
.
acceptor to form H-phosphonic die9ter bond~, followed by
conversion of the H-phosphate bonds to phosphodiester
bonds using an oxidising agent and removal of the -~
protecting group of the base portion at the same time as
severing the ODN from the CPG under basic conditions, to -~
obtain the final product (1) [after ~ollowing a
purification procedure]. While the choice of solvent u~ed
in this procesg is not particularly limited, provided that
it does not interfere with the reaction, anhydrous
acetonitrile is u~ed preferably. While acid chlorides of
carboxylic acids or phosphoric acid are used as the
conden3ing agent, pivaloyl chloride i~ preferably used.
While there are no particular limitations on the
choice of oxidising agent used for oxidi~ing the
H-phosphonic acid ODN to the ODN containing phosphodiester
bonds, provided tha~ it i8 an oxidising agent usually used
in such oxidation reaction~, it can be exemplified by
inorganic metal oxidising agents including manganese
oxides, such as potas~ium permanganate and manganese ~ -
dioxide; ruthenium oxide~, ~uch as ruthenium tetraoxide;
selenium compounds, such as selenillm dioxide; iron
compounds, such as iron chloride; osmium compounds, ~uch
as osmium tetraoxide; silver compound~, such as silver
oxide; mercury compound~, such as mercury acetate; lead : .
oxide compounds, ~uch as lead oxide and lead tetraoxidei
chromic acid compounds, ~uch as potas~ium chromate,
chromic acid-sulphuric acid complex and chromic
acid-pyridine complex; and cerium compounds, such as ::~
cerium ammonium nitrate (CAN), inorganic oxidising agents :~
including halogen molecules, ~uch as chlorine molecules,
bromine molecules and iodine molecules; periodic acids,
such as sodium periodate; ozone; aqueous hydrogen
peroxide; nitrous acid compound~, such as nitrous acid;
chlorite compound9, such a3 pota~sium chlorite and sodium
chlorite; and per~ulphuric acid compounds, such as
pota~sium persulphate and ~odium persulphate as well as
.': , ., I ' ' , " ,','~.',,, .. , ,';' . ' . .
O ~ 2 8
- 113 -
~096~8
organic 0xidising agents including reagents used in DMS0
oxidation (complexes of dimethyl sulphoxide and
dicyclohexylcarbOdiimidel oxalyl chloride, acetic
anhydride or phosphorus pentoxide, and complexes of
pyxidine and sulphuric anhydride); peroxides, such as
t-butylhydroperoxide; stable cationg, guch as
triphenylmethyl cation; succinimides, such as
N-bromosuccinimide; hypochlorous acid compounds, such as
t-butylhypochlorite; azo-dicarboxylic acid compounds, such
as methyl azo-~icarboxylate; disulphides and triphenyl
phosphines, such as dimethyl disulphide, diphenyl
disulphide and dipyridyl disulphide; sulphites, such as
methyl sulphite; tetrahalogenated carbon~, ~uch as methane
tetrabromide; and quinone compounds, such as
2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ), and
particularly preferably iodine molecule.
While examples of the acid acceptor used include
heterocyclic amines, ~uch as pyridine and dimethylamino-
pyridine, and aliphatic amine~, such as trimethylamine,
triethylamine and diisopropylethylamine, aliphatic amines
(particularly diisopropylethylamine) are preferably used. ~ -
~ :.
While the reactlon temperature is not particularly
limited, it i8 usually -50 to 50C, preferably room
temperature.
While the reaction time varies depending on the
starting material, reagent and temperature employed, it is ~ -
u~ually 5 minutes to 30 hour~. When the reaction is ~ -
carried out at room temperature, the reaction time is
preferably 30 minutes. After completion of the reaction
the reaction mixture is, for example, appropriately
neutrali~ed or, if insolubles exist therein, they are
removed by filtra~ion. Then, an organic water-immiscible
solvent such as ethyl acetate is added to the filtrate,
followed by wa~hing with water. The organic layer ~-
,
~'~
~" ,' . ', , : : , . : , ' , ' ' ~: . ,' ~.. ' .. ' , 'i I . ' ' ' ' ' ' '
04 2a
9~a~ :
containing the degired compound is separated and dried
over anhydrou9 magnesium sulphate, followed by evaporation
of the solve~t to give the desired compound.
The desired compound obtained in thi~ manner can
further be purified by conventional procedure such as.
recrystallisation, reprecipitation~ chromatography, etc.,
if de~ired.
'' ' '
',:
;i ":
' ~':,'.
.,
. ' , ~
'~'.
, ' , ;
'.'',
;~ .
O ~ 2 ~
- r ~^.
~ ~ 115
2a9 v~ 8
Proce~39 E
Rl .
(2) --~ R2--C~Y~cH2 l Z-C~D '
O ( 2 2 ~ -
= P--N~N
CH3 . -
HO
Step 19
\ O ~ .': '.
`~ ~B ' ~ . ~
. 0/~ ' ','"'',
H3 C - P= O . : :
n
RI ~ ~--0
R3 CH2 ~ z- ~H2 W~J ( 2 3 )
D
0/~' ."', ,
3 ~ :
- O , . ':: '
C~y . , ~
( 2 4 ) O
,~
H3C-P--o
.
O - : .
~_ I ,
~ 0
HO
0 4 2 8
~c - 1l6 -
2~6~
Process E ca~ be performed according to Step 18 and
Step 19 indicated beloW-
Step 18:
In this ~tep, methylphOsphonic bis-imidazolide (22),
synthesised in advance by reacting methylphosphonic
dichloride and imidaæole in the presence of, for example, ~ -
imidazole, i9 reacted with Compound (2) in an innert
solvent to obtain 3'-methylphosphonic imidazolide (22~.
~Reference: P.S. Miller, M.P. Reddy, A. Murak~mi, K.R.
~lake, S.B. Lin and C.H. A~ri3, Biochem., 25, 5092 (1986)].
While the choice of solvent to be used is not
particularly limited, provided that it does not interfere
with the reaction, tetrahydrofuran i~ preferably used.
While the reaction temperature i~ not particularly limited
and it i9 in the range of -20 to 100C, the reaction is ,
preferably carried out at room temperature. The reaction
time varieis depending on the solvent and reaction
temperature employed and it ie 6 hours when the reaction
i9 carried out at room temperature in tetrahydrofuran.
', "
Thii3 step can be al80 carried out using ~econdary
amines, such a~ diisopropylamine in place of imidazole to
aynthesise 3'-methylphosphonic diisopropylamidite (22')
and Compound (2) according to the re~erence S. Agrawal and
J. Goodchild, Tetrahedron ~ett., 28 3539 (1987), and the
resulting compound can be used in the subsequent Step 19.
lP. Bhan and P.S. Miller, Bioconjugate Chem., 1 82 (1990)].
. ..
Step 19:
' ,,' ':
In this ~tep, Compound (22) obtained in Step 18, and a
methylphosphonate ODN (23) synthesised according to the
above-mentioned reference and coupled to CPG, wherein only
the 5'-terminal dimethyoxytrityl group is eliminated and
i
0 4 2 ~
-~~r ~ 117 -
2 Q ~
the base portion i5 protected with a protecting group, are
condensed in the presence of tetrazole to form
methylphosphonic diester bonds, ~ollowed by elimination of
the protecting group of the base portion at the 9ame time
a~ severing the ODN from the CPG under basiC conditions,
to obtain the final product (24) [after following a
purification procedure]. While the aolvent used in this
procesg i9 not paxticularly limited provided that it does
not interfere with the reaction, acetonitrile is used
preferably. While there are no particular limitations on
the reagent used for the condensing agent, provided that -
it causes protonation of the imidazole and
diisopropylamino groups of Compound (22) or ~22') to form
methylphosphonic diester bonds between the hydroxy groups
of a compound having hydroxy group~, such as Compound (23)
when iaid compound i3 present, tetrazole is preferably
used.
While the reaction temperature i9 not particularly
limited, it i~ usually -50 to 50C, preferably room
temperature.
: '
While the reaction time varies depending on the
~tarting material, reagent and temperature employed, it is
usually 5 minute3 to 30 hours. When the r~action i9
carried out at room temperature, the reaction time i~
preferahly 30 minute~. After completion of the reaction
the reaction mixture i~, for example, appropriately
neutrali~ed or, if in~olubles exist therein, they are
removed by filtration. Then, an organic water-immiscible
solvent such as ethyl acetate is added to the filtrate,
followed by wa~hing with water. The organic layer
con~aining the desired compound i9 separated and dried
over anhydrous magnesium sulphate, followed by evaporation
of the ~olvent to give the desired compound.
The de~ired compound obtained in this manner can
~.
O ~ 2 8
- 118 - . .
2~9~
further be purified by conventiOnal procedure such as
recrystalli~ation, reprecipitatiOn, chromatography, etc., ::
if desired.
.
`
; :
' ;'
.~
~".'
'. '
.
.:
'~
. .
;i '
~: ...... , ., . ~ .. ... . . . . . . .
.,, :. I .. .. . : ' . . ~ . ` - .
!
0 4 2 8
119
2 Q ~
Process F
R
R2--C~Y~cH2 l Z-CH~
Step 16 13 ~ ~ ~D ;
(1 9) o : ,~
H P= O . : ~ ~
O- ` . ` ~
HO
, ~ ; . ~ .
CH2 .-:
Step 2 0 \~~ ~ ~
~ . ":
O . ~ ~
e S - P= O ~ ~
O , ' ~
' CH2 ' n
~ 1 ~ B '
R~--C~Y~CIlz~Z-C~ W (~
O '' .:
.j 9$--p=O
' O '.
. C~ B
,~
i, o .
3S P O ' . ::.
. n
n
( 2 5 ) 2 0 ~ .
S \< ~a . :
Y
, . . HO
~ . .
.
~ ~ .
0 4 2 ~
_ - - 120 - 2 ~
Procegs F is composed of Step 20 wherein thioate ODN
(15), coupled to CPG and having a free hydroxy group only
at i~s 5'-terminal, is reacted wit~ compound (19),
obtained in Step I6, as indicated in ProCe~s D.
S~ep 20:
In thi~ step, Compound (19) obtained in Step 16 -
according to, for example, the method described in the
literature ~M. Matsukura, G. Zon, K. Shinozuka, C.A. :-
Stein, H. Mitsuya, J.S. Cohen and S. Broder, Gene, 72, 343
(1988)], and thioate ODN (15) synthesised on a DNA
synthesiser and coupled to CPG wherein the 5'-terminal
dimetho~ytrityl group is eliminated to form diphosphonate
bonds are reacted in the same manner as in Step 17 in
Process D u~ing pivaloyl chloride or 1-adamantane carbonyl
chloride as the conden~ing agent, followed by reacting
sulphur di~sOlved in carbon disulphide in the presence of
triethylamine using pyridine as the reaction solvent, ` -~
converting the dipho phonate bonds into pho~phoric thioate
bonds, and eliminating the protecting group of the base
portion at the ~ame time a~ severing the ODN from the CPG,
under basic conditions, to obtain t:he final deYired
compound [after following a puri~ication procedure].
While the choice ~olvent u~ed for thioation of thi~
process is not particularly limitecl, provided that it does
not inter$ere with the reaction, pyridine is used
preferably, and carbon disulphide is u~ed preferably as
the ~ulphur solvent. In addition, although there are no
particular limitation~ on the amine used, tertiary amines,
such as triethylamine are preferable.
Severing of the thioate ODN from the CPG, as well as
elimination of the protecting group of the base porti-on, -
can be performed according to U~er Bulletin of Model 381A
(1987) available from Applied Biosystems Inc.
,
. , ~,.: . :; . ~ : , ,: . .. . . . , . ,: , . ...
, .: ' ' - ; : :
- 1 2 1
2 ~ 8 :;
Proce3s G
., .
R~
( 2 ) > R2 - C~ Y~ CH2 l --- Z- CH2
step 12 R3 J k \~D
O~ ( l 4 ) ~ .~
VO- P- U ' :; '~ :
HO
_. . ~ . .
CH2
\~ ~tB
step 15 0~/
VO- P= o ',
O .
~/--B
Rl W (1 5)
R2--C ~ y ~ CH2 ~ O
R3 \~ ~D
~J .....
O ~',' :.
~O- P= O . :~
O ::-
.
C~O
>~
O
RO--P= O
( 2 6 )
~ B
HO
- 122 -
2Q96~8 :
Process G is the sulphiting agent employed in Step 12
of Process B. Triester ODN derivative (26~ is obtained by
carrying out Step 12 and Step 13 u9ing a reagent (13)
including an alkyl group ~uch as a lower alkyl group, e.g.
ethyl, propyl and butyl, that is not eliminated during
severing of ODN, 9ynthe9i3ed with a DMA synthesiser,
wherein V i8 a methyl group or cyanoethyl group, from CPG,
as well as under ba9ic conditions for elimination of the
protecting group from the base portions.
O ~ 2 8
~ - ~ 23 : ~
2 V ~
ProCess H ..
R I
( 2 ) --> R2- C~ Y~ C~2~ Z-CH2
S-ep 16 k
o (19) , ,.
- Ste~ /7 H- P--O
HO
CH2 o ~;
: . \~ ~ B
,,, ' 0~/ ~''
R- HN--P= O
Q
CH2
RZ-C~Y~CN2~2-C~ W ( I 5')
'~,' .'i ' .
RHN- P= O - !: : :
O
_~ .
C,~o
' "'i'
R--HN--P= O
( 2 1~ ~K n
\< ~ B
HO
0 4 2 ~ ,
- 124 -
20~6~
I~ Process H, the H-phosphonate e~ter (19) synthesised
in Step 16 o~ Proce5S D, and an alkylphOgphoramidate ODN
(synthesised with a DNA synthesiser according to the
method degcri~ed in the literature [s. Agrawal, J-
Good-child, M.P. Civeira, A.H. Thornton, P.S. Sarin and
P.C. Zamecni~, Proc. Na~l, Acad. Sci., ~5, 7079 (1988)])
and Connected with CPG, from which the s~-terminal
dimethoxytrityl group wa~ remo~ed, were condensed in the
pre~ence of of pivalic chloride in the ~ame manner as in
the condensation reaction of step ~7, followed by
treatment of the regulting ODN with a S'-terminal hydrogen
phosphate-die~ter group with an appropriate amine in
tetrachloromethane at room temperature for 1.5 hours. At
the end of thia time, the ODN was separated from the CPG,
and treated with aqueous concentrated ammonia to eliminate
the protecting group of the base portion, either at 55C
for 5.5 hours or at room temperature for 2 days or more,
~o obtain Compound (27).
An antiviral agent or antitumor agent having the
compound represented by the general formula (1) of the
present invention a~ its active ingredient can be prepared
by u3ing ~aid compound in the form of a pharmacologically
acceptable non-toxic salt.
In the preeent invention, viral di~ea~e~ and infection
or tumour g~nerically refer to all types of diseases that
are induced by cellular changes due to the action of
internal or external viruses or tumour genes. Antiviral
agents or antitumour age~t~ refer to alI drugs that are
used to prevent and/or treat these diseases.
,
Pharmaceutical preparations of these drugs can be
manufactured by well known methods in ~aid field. Such
preparations can be administered by, for example, oral
administration in the form of tablets, capsules, granules,
powders and syrups, or parenteral administration in the
. ' , , , ~ ' , , ~ ' ' '
-' , ' ' ' . ' ' ' ' .' ' ' , ' . . '"" '', ' " ', '
2 ~ 8
foxm of injectiOn preparations (intravenous, intramuscular
and Subcutaneous)l intravenous drip preparations and
~UppoSitorie8. water-~oluble solvent~, such as
phygiological galine, sterilized water and Ringer's
solution, water-in90luble solvents, isotonic agents,
stabilizers, preservativesl SUSpending agents, buffers and
emulsifiers, and 60 ~orth, can be arbitrarily used for
preparing injection preparations and intravenOus drip
preparations. Each of the3e types of preparations can be
prepared using known adjuvants that can usually be used in
technical fieldg of preparation formulation, such as
excipient 8, binders, disintegrators, flavourings,
fragrances, solubility assistants, suspending agents and
coating agents, according to conventional method~. While
the dose used varie~ according to ~ymptom~, a~e, body
weight and 80 forth, ~he dose given to adults i9 about 10
mg to 1000 mg per day in the case of oral administration,
with this dose to be administered once or in several
portions. In addition, in the case of parenteral
administration, 10 mg to 500 mg per daily admi~istration
can be gi~en by subcutaneous injec~ion, intramuscular
injection or intravenou~ injection.
The present invention is specifically described below
by way of Example~, Comparati~e examples, Test examples
and Preparation examples, but the invention is not limited
thereto.
EXAMPLE 1
Tr-AGGTGGGTCTGAAAC
'De~y
(la) ~ 5'-O-trityl-N6-ben~oyladenosine
2.60 g (7.31 mmol) of ~-benzoyladenosine were
dissolved in 50 ml of dry pyridine, and the resulting
solution was subjected to azeotropic distillation to
';
- 126 -
209~6~3
dryness by evaporating the pyridine under reduced
pressure. The residue was dissolved in 70 ml of dry
pyridine, followed by the additiOn o~ 2.24 g (8.05 mmol)
of trityl chloride and stirring at sOC in an atmosphere
of argon. After 3,5 hours, an additional 2.24 g of trityl
chloride were added t~ereto, followed by stirring at 50C
for 6.5 hour~. After allowing to stand overnight at room
temperature, the mixture wa~ diluted with 500 ml of
methylene chloride, wa9hed three times with 200 ml of a
saturated aqueousi solution of NaHC03, and dried o~er
anhydrous MgS04. After removing the drying agen~ by
filtration, the residue obtained by distilling off the
solvent under reduced pressure was applied to a 120 g
silica gel column (70-230 me3h) and eluted with methylene
chloride containing 1 to 3~ methanol to obtain 2.27 g of
the desired subitance.
H-NMR(60MHz, CDC13) ~ppm: ;
9072 (lH, b9, NH); 8.70 (lH, S, H-8); 8.16 (lH, g,
H-2); 8.12-7.84 (2H, m, ortho-H of Bz); 7.6Z-~.92
(18H, m, Tr and m, p-H of Bz); 6.46 (lH, t, J=6Hz,
H-l'); 4.84 (lH, b8, OH); 4.73 (lH, bs, H-3'); 4.22
(lH, b~, E-4'), 3.33 (2H, bs, H-5'); 2.84-2.30 (2H, m,
,~ ~H~;2')
(2a) ~ 5'- ~ -N -benzoyladenosine 3~-0-(2-cyano-
ethyl-N,N-diisopropyl)phosphoroamidite
deo)~y
1.195 g (2 mmol) of~5'-O-trityl~ benzoyladeno9ine
were dis801ved i~ 10 ml of dry pyridine, and the resulting
solution was sub~ected to azeotropic di3tillation to
dryness by evaporating the pyridine under reduced
pressure. The residue was di~solved in 10 ml of dry-
tetrahydrofuran, followed by addition of 1.39 ml (8 mmol~
of diisopropylethylamine and stirring at room temperature
in an atmo~phere of argon. 0.892 ml (4 mmol) of
" ' ' ' .: `. . , '. . , : " ' , ~ ' '"'. ',. ,' .' ~. ' ,. . . ': .'' ' , ` :
:. ' ' ' ' . ' ., ' ' '' '' ;' ';" '~ '; '' ' .. ''; -.'
~ - 127 -
2~9~6
2 - cyanoethyl N N diisopropylchlorOphOsphoroamidite wa~
added to the mixture, followed by 9tirring at room
temperature ~or 30 minutes. After reaction, the
precipitate wa~ removed by filtration, and the solvent was
distilled off under reduced pressure. The residue was
dissolved in 100 ml of ethyl acetate and washed twice with
50 ml of ice-cooled 10~ aqueous Na2C03. After drying
the organic layer over anhydrouq Na2CO3, the drying
agent wa~ removed by filtration, and the solvent was
distilled off under reduced pre~sure. The re~idue was
a~plied to a 40 g ~ilica gel column (70-230 mesh) and the
desired substance waa eluted with a solution of ethyl
acetate, methylene chloride and triethylamine (45:45:10).
After distilling off the ~olvent, the desired ~ubstance
wa~ dissolved in 4 ml of toluene. This ~olution was then
dropped into 200 ml of vigorously stirred hexane. The
resulting precipitate was then collected by filtration.
The precipitate obtained in thia manner wa~ then dissolved
in methylene chloride, followed by distilling off the
solvent to obtain 1.04 g of the desired product in an
amorphoua state.
, . ,'.
lH-NMR (60MHz, CDC13) ~ppm: ~-
, ','~'' .
9.82 (lH, bs/ NX); 8.66 (lH, 8, ~-8); 8.18 (lH, 9,
H-2); 8.12-7.84 (2H, m, ortho-H of Bz); 7.62-7.05
(18H, m, Tr and m, p-H of Bz~; 6.48 (lH, t, J=6Hz,
l'-H); 7.80 (lH, bs, 3'-H); 4.35 (lH, bs, 4'-H);
3.90-3.20 (6H, m), 3.05-2.23 (4H, m); 1.40-0.95 (12H,
m, (~3)2CH).
(3~ Tr-AGGTGGGTCTGAAAC
l ~ e~y ~ 6
25 mg (30 mol) of~5'-O-trityl-~-benzoyladenosine
were dissolved in 1 ml of dry pyridine, and the resulting
~olution was aubjected to azeotropic distillation to
dryness by distilling of$ the solvent under reduced
.. . .
.. .
1282~ 9 ~
pressure. The residue was dissolved in 150 ~1 of dry
acetonitrile. Separately, 35 mg of lH-tetrazole were
dissolved in 1 ml of dry pyridine and the xegulting
solution was subjected to azeotrOpic di9tillation to
dryness by distilling off the solvent under reduced
pressure, and the residue was dissolved in 1 ml of dry
acetonitrile. 180 ~1 of ~ eso/ution wa ~added to the
above-mentioned solution of~5~-o-trity~ benzoyl-
adenosine in acetonitrile, and this mixture was added to a
solid phase carrier (1 ~mol scale) supporting a DNA
derivative, having the sequence of GGTGGGTCTGAAAC from the
5' end and having a free hydroxy group at it~ 5' terminal, ;
prepared in advance using an automated DNA synthesiser.
After stirring this mixture of a non-uniform system for 10
minutes, the solid was collected by filtration, and the
solid was the~ washed with acetonitrile and pyridine. At
this point, 1 ml of a previously prepared ~olution of
acatic anhydride and pyridine (1:9, v/v) containing 0.1 M
dimethylaminopyridine was added, followed by stirring for
1 minute. After collecting the solid by filtration and
washing with pyridine and methylene chloride, 1 ml of a
previously prepared solution of tetrahydrofuran, lutidine
and water (2:2:1, v/v/~) containing 0.1 M iodine was
added, followed by stirring for 1 minute. After
collecting the solid by filtration, washing with pyridine
and methylene chloride, and drying under reduced pre~ure,
20 ml of concentrated aqiueous ammonia was added to the
residue, followed by stirring for 1 day at room
temperature and then fo~ 5 hours at 50C. After removing
the ~olid by filtration, concentrating the filtrate under
reduced pressure, removing the ammonia and washing three
time~ with 10 ml of diethyl ether, the resulting aqiueous
301ution was freeze-dried. The residue was then di~solved
in 5 ml of water and then applied in several separate
applications to preparative reverse pha~e HP~C (Inertsil
PREP-ODS, 20 x 250 mm, 0.1 M NH40Ac (pH 7.0), 0-50~
CH3CN/50 min.: linear gradient) to obtain a fraction
' ' ' .' ' ' '. . ' . ' . , ': ' ,: . , .,. ` .. , ! , `: : . ., . ,, " " , . ..
O ~ 2 ~
~6~8
ha~ing a primary peak that eluted at 2~.5 minute~. After
applying this to Sep-pak and wa3hing with 20 ml of water,
a desalting procedure was performed by eluting with 10 ml
of a mixture of methanol and water (1:1, v/v) to obtain
the desired ~ub8tance Tr-AGGTGGGTcTG~Ac having an optical
density of 28 OD (260 nm) ~approximately 1 mg).
The de~ired substance obtained in this manner,
Tr-AGGTGG&TCTGAAAC, was ~ubjected to high-performance
liquid chromatography resulting in the confirmation of a
single peak.
~; .
The conditions are de~cribed below:
~'
Flow rate: 1 ml/min.
Column: Inertsil ODS 2 4.6 x 150 mm
Sol~ent: 0.1 M N~40AC (pH 7)
Gradient: 0-40~ CH3CN/40 min. (linear)
Retention Time: 29.1 min.
' W: Max. 256 nm, Min. 229 nm (~olvent: H20)
, '~,~ .
EXAMPLE 2
;~
Dimethoxy-Tr-TCG ~ TTGGGAGGT -
Dimethoxy (hereina~ter abbreviated a~
~Dm"3-Tr-TcqGGGT~GAGGT wa~ synthesised following the
pho~phoroamidite method described in the operation manual
of Applied Bio3ystems Inc. and using model 394.
Purification of the compound was performed wikh ;~
preparative C18 reverse phase HPLC.
" .
- The behaviour of this compound under the analysis
' conditions indicated below are a~ follows. - ~ ;
,
:1 .
Colum~ used ASAHI PAC ODP-50
Flow rate: 1 ml/min.
., .
'i ' ' ~ .
~ 130 ~96~
Solvent: 0.1 M triethylamine-acetic acid (pH 7.0)
acetonitrile 15 to 30~ min.
Retention time: 14.9 minutes
~XAMPLE 3
Dm-Tr-TGGG~GGTGGGTCTG wa~ obtained according to the
method of Example 2. The beha~iour of this compound, as
determined by reverse phase liquid chromatography, was a~
indicated below.
Column u~ed: ASA~I PAC ODP-50
Flow rate: 1 ml/min.
Solvent: 0.~ M triethylamine-acetic acid (pH
7.0)
acetonitrile 15 to 30~/18 min.
Reten~ion time: 15.4 minutes
EXAMPLE 4
Dm-Tr-TTGGGAGGTGGGTCT waa obtained according to the
method of Example 2. The behaviour of thi~ compound, as
determined by reverse phase liquid chromatography, was as
indicated below. -~
Column u~ed: ASAHI PAC ODP- 50
Flow rate: 1 ml/min.
Solvent: 0.1 M riethylamine-acetic acid (pH ;
7.0)
acetonitrile 15 to 30~/18 min.
Retention time: 15.4 minutes
....
,: .:
EXAMPLE 5
, Dm-Tr-AGGTGGGTCTGAA~C wa~ obtained accordi~g to the
,~ method of Example 2. The behaviour of this compound, as
~ determined by reverse phase liquid chromatography, wa~ a~ ;
~.' ..
. .
:s ,~-:
- 131 -
2096~
indicated below. ;
Column used: ASAHI PAC ODP-50
Flow rate: 1 ml/min.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0)
acetonitrile 15 to 30~/18 min.
Retention time: 13.2 minutes
EXAMPLE 6
i'
Dm-Tr-ATACTCAGTC~TTTTTAGCA~ was obtained according to
the method of Example 2. The behaviour of this compound,
a~ determined by reverse pha~e liquid chromatography, was ~ -
a~ i~dicated below. `~
Column u~ed: ASAHI P~C ODP-50
Flow rate: 1 ml/min.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) :
acetonitrile 20 to 40~/20 min.
Retention time: 14.3 minutea ~ ~
'~ ~ '~"':'
EXAMPI~E 7
Dm-Tr- TGC GGGGTGTTCGGGC was obtained according to the ~ ;
method of ~xample 2. The beha~iour of this compound, as
determined by reverse phase liquid chromatography, was as
indicated below.
Column u~ed: Senshu pak VP-304-4251
Flow rate: 5 ml/mln.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0)
acetonitrile 18 to 30~/15 min.
Retention time: 10.8 minutes
-
,;.. . , . , . , , ... , , . ".. . . ~ . . . ... , .. ~ . ... . . . . . . . . -
O ~ 2 8
- 132 -
E ~ ~-~ 8
Dm-Tr-TG~GTCTGAAACGAT was obtained according to the
method of Example 2. The behaviour of thi~ compound, a~
determined by re~erse phase liquid chromatography~ was as
indicated below.
Column u~ed: Senshu pak VP-304-~251
Flow rate: 5 ml/min.
Sol~ent: 0.1 M triethylamine-acetic acid (pH
7.0)
acetonitrile 18 to 30%/15 min.
Retention time: 11.2 minute,s f
EXAMPLE 9
Dm-Tr-TAGGTGGGTCTGA~A was obtained according to the
method o~ Example 2. The behaviour of this compound, as --
determined by reverse phase liquid chromatography, was as
indicated below.
~ ~.
Column used: Sen~hu pak VP-304-4251
i Flow rate: 5 mltmin.
Solve~t: 0.1 M triethylamine-acetic acid (pH
7.0)
~ acetonitrile 18 to 30~/15 min.
i Retention time: 12.5 minutes
^' ~' .:
` EXAMPLE 10 ~ ~ `
,, . '', '~
Dm-Tr-~GT~GGTCTGAAACG wa3 obtained according to the
method of Example 2. The behaviour of this compound, as
determined by reverse phase liquid chromatography, was as
indicated below.
Column l-sed: COSMOSIL 5C18-AR (20 mm x 250 mm)
, Flow rate: 5 ml/mi~. ~
. . . ;.
.~ .. . .
042 a
- 1 3 3
2Q96~8
Solvent: 0.1 M triethylamine acetic acid (pH ~ -
7.0)
acetonitrile 20 to 45~/15 min.
Retention time: 11.2 minute~
.- .
EXI~MPLE 1 :L
.
Dm-Tr-GGTGGGTTGCTTTGA was obtained according to the
method o~ Example 2. The behaviour of this compound, as
determined by reverse phage liquid chromatoyraphy, was as
indicated below.
Column used: COSMOSIh 5C18-AR (20 mm x 250 mm)
Flow rate: 5 ml/min.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0)
acetonitrile 20 to 45%/15 min.
Retention time: ~0.8 minute~ ~ -
EXAMPLE 1_ `;
~, :- .,,
Dm-Tr-~GAGGTGGGTCTGAA wa~ obtained according to the
method of Example 2. The behaviour of thi~ compound, as
determined by reverse phase liquid chromatography, wa~ as
i~dicated below.
Column used: COSMOSIL 5C18-AR (20 mm x 250 mm)
Flow rate: 9 ml/min.
Solvent: 0.1 M triethylamine-ace~ic acid (pH
7.0)
acetonitrile 20 to 45~/15 min.
Retention time: 11.2 minutes
.
EXAMPLE 13
Dm-Tr-GGGAGGTGGGTCTGA wa~ obtained according to the
method o~ Example 2. The behaviour o~ this compound, as
042a
.~ - 13~ -
2~9~
determined by reverse pha3e liquid chromatography~ wa9 as
indicated below.
Column used Sen~hU pak Vp-3o4-42
Flow rate: 5 ml/min.
Solvent: o.l M triethylamine-acetic acid (pH
7.0)
acetonitrile 18 to 30~/15 min.
Retention time: 10.9 minutes
EXAMPLE 14
Dm-Tr-GTTGGGAGGTGGGTC was obtained according to the
method of Example 2. Thie behaviour of this compound, as
determined by re~erse phase li~uid chromatography, was as
indicated below.
Column used: Senshu pak VP-304-4251
Flow rate: 5 ml/min. :
Solvent: 0.1 M triethylc~ine-acetic acid (pH ::
7~0) : :
acetonitrile 18 to 30~/15 min. ~ : -
Retention time: li.5 minutes i i-
. ~ .
EX~MPLE lS :~
Dmi-Tr-GGGTTGG~AGGTGGG was obtained according to the
method of Example 2. Th~ behaviour of this compound, as
determined by reverse pha~e liqiuid chromatography, was a~ :
indicated below.
.i:: :
Column uYed: Senshu pak VP-304-4251 :.::
Flow rate: 5 ml/min. :
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) ::
acetonitrile 18 to 30~/15 min.
Retention time: 12.7 minuteY : .
0 4 2 8
1352~9~&-~g
EXAMPLE 16
.
s~-o-Benzyl ODN-14~ 16CL
It should be noted that ODN-40 represents an Et3N
salt of D~A having a sequence of TGGGAGGTGGGTCTG ~rom the
5~ terminal.
(16a) 5'-0-Lenzylthymidine
3'-0-[(1,1-dimethylethyl)diemthyl~ilyl]thymi`dine was
synthesised in the ~ame manner as described in Can. J.
Chem., 56, 2768 (1978). 713 mg (2 mmol) of
3'-0-[tl,I-dimethylethyl)dimethylsilyl] thymidine were
dis~olved in 4 ml of tetrahydrofuran, after which 175 mg
(4 mmol) of 5S~ NaH were added, whilst keeping the mixture
in an atmosphere of argon and whil~t stirring at 60C for `
2 hours. After allowing the temperature to return to room
temperature, a solution of 0.238 ml (2 mmol) of benzyl
chloride dissolved in 1 ml of tetrahydrofuran wa~ added
dropwise thereto, followed by addition o~ 149.9 mg (1
mmol) of NaI and stirring at room temperature. After 21
hours, the solvent was distilled off under reduced
pre~sure, and the re~idue wa~ dissolved in 50 ml o~ ethyl
acetate. After the resulting 301ution had been washed
twice with 50 ml of O.lN HCl, the solution was dried over
anhydrous magnesium sulphate. After the solvent had been
distilled o~ under reduced`pre~sure, the residue was
applied to a 30 g (70-230 me~h) ~ilica gel column and
eluted with a 1 ~ methanol-methylene chlori~e solution to
obtain 592 mg o~ 3'-0-[(1,1-dime~hylethyl)dimethylsilyl]-
5'-0-(benzyl)thymidine.
H-NMR t270MEZ, CDC13) 6ppm~
9.99 (lH, 8), 7.59 (lH, 8), 7.38-7.26 (5H, m), 6.35
(lH, t, J=5.94Hz), 4.58 (2H, 3), g.~7 (1~, m), 3.98
.' '
,`'~ ` .
. ~
0 4 2 B
136 - 2 ~9 ~6 ~
(lH, bs), 3.8~-3.60 (2E, mj, 2.32-2.08 (2H, m, H2'),
1.60 (3X, s, CH ), 0.88 (9H, s, (cH3)3c)~ 0-07
(6H, s, CH3-Si)
Next, the whole of the compound obtalned as described
above was di9solved in 2.64 ml of ~etrahydrofUran, and
2.64 ml of a solution (lM) of tetrabutylammonium fluoride
in te~rahydrofuran were added to the resulting solution,
followed by stirring at room temperature. After 30
minutes, the ~olve~t was distilled off under reduced
pressure, and the re~idue wa~ dissolved in S0 ml of ethyl -
acetate, followed by washing twice with 50 ml of a
saturated aqueou solution of sodium chloride. After the
resulting mixture had been dried over anhydrous magnesium
sulphate, the solvent was distilled off under reduced
pre3sure, and the residue was applied to a 30 g (230-400
i mesh) silica gel column and eluted with a 2 to 3 ~
solution of methanol-methylene chloride to obtain 392 mg ~ -
of (16a) as crystals. ;~
~-NMR (270MHz, CDC13, TMS) ~ppm:
7.59 (lH, 9, H6), 7.35-7.22 (5H, m, Ph), 6.42 (lH, t, -
Hl'), J=6.59Hz), 4.56 (2H, s, PhC~2), 4.51 (lH, bs, -
H3'), 4.13 (lH, bs, H4'), 3.80-3.65 (2H, m, H5') -
2.42-2.12 (2H, m, H2'~, 1.58 (3H, g, CH3)
'".`'.
(16b) 5~-0-Benzylthymidine-3~-0-(2-cyanoethyl-
N,N-diisopropyl)phosphoramidite
166 mg (0.5 mmol) of the compound 16a in pyridine was
subjected to azeotropic diistillation three times to
drynesa, after which it waY dissolved in 2.5 ml of
tetrahydrofuran. 0.348 ml (2 mmol) of diisopropyl-
ethylami~e and 0.223 ml (1 ml) of 2i-cyanoethyl
N,N-diisopropylchloropho~phoroamidite were then added to
the resulting solution, followe~ by stirring at room
temperature in an atmosphere of argon. A~ter 30 minutes,
:
0 4 2 8
- 137 -
2~95~
precipitates were removed by filtration and the solvent
was distilled off under reduced pressure. The residue was
dissolved in 50 ml of ethyl acetate and washed twice with
50 ml of ice-cooled 10~ aqueous Na2C03, followed by
drying over anhydrous sodium ~ulphate. After the solvent ;:
had been distilled off under redu~ed pressure, the residue
was applied to a 30 g silica gel column (70-230 mesh) and
eluted with methylene chloride : ethyl acetate :
triethylamine (45 : 45 : 10, v/v/v) to obtain 271 mg of
16b.
H-NMR (270MXz, CDC13, TMS) ~ppm:
7.53, 7.56 (lH, 2~, H6), 7.38-7.26 (SH, m, Ph), 6.40
(lH, t, Hl', J=7.32Hz), 4.68-4.55 (lH, m, H3'), 4.60,
4.59 (2~, 29, PhCH23, 4.24, 4.18 (lH, 2m, H4') :~ :
- 3.90-3.55 (6H, m, H5', POCH2, PNCH), 2.65, 2.58 (2H,
2t, CH2CN), 2.52-2.15 (2H, m, ~2'), 1.63 (3H, 9,
CH3), 1.18 (12H, d, (C_3)2CH) ~:
(16c) 5'-O-benzyl ODN-12 ;~
A completely protected oligodeoxynucleotide ~ .
derivative, having the sequence of GGGAGGTGGGTCTG from the
5'-terminal and formed on a controll~d pore glass (CPG),
and which wa~ synthesised using an automatic synthesiser
(CycloneTM Plus), was purchased from Nippon Millipore
~, himited-Milligen/Biosearch.
After immersing 135 mg (approximately 5 ~mol) of the
abo~e-mentioned compound in 2 ml of a 3~ solution of
dichloroacetic acid and methylene chloride for 1 minute,
the compound was ~iltered with a glass filter, and the CPG
beads were collected and wa~hed with methylene chloride. :;~
These CPG bead~ were then dried by azeo~ropic distillation
in pyridine.
. ~ .
~ . ~ . : . .. , . . -. ,
- 138 -
2 0 9 6 6 _~? 8
Separately, o.g ml of a Solution of 42 mg of
lH-tetrazole, drled in advance by azeotropic distillation
with pyridine, dis30lved in 1.2 ml of acptonitrile~ were
added to a solution i~ which 80 mg (0.15 mmol) of compound
16b, above, were subiected to azeotropic distillation to
dryness with pyridine and then dissolved in O.75 ml of
acetonitrile. The resulting ~olution was then added to
the above-mentioned dried CPG beads and stirred at room -
temperature in an atmosphere of argon. AftPr 30 minutes, `--
the mixture was filtered with a glass filter and the CPG
beads were collected, and washed with pyridine. 2 ml of a
tetrahydrofuran ~olution containing 5~ acetic anhydride,
5% 2,6-lutidine and 3~ N-methylimidazole were added to the ;~
beads obtained in this manner, followed by stirring at
room temperature. After 1 minute, the CPG bead~ were
collected by filtering with a gla~s filter and then washed
with pyridine. 2 ml of a solution of tetrahydrofuran,
pyridine and water (40:20:1) containing 0.1 M iodine were ;
added to the resulting CPG beads, followed by additional
stirring at room temperature. After 1 minute, the CPG
beads were collected by ~iltering with a glass ~ilter, i`
wa~hed with pyridine and methylene chloride, and then
dried under reduced pressure. Approximately 10 ml of
concentrated aqueous ammonia was added to the resulting
CPG beads followed by ~tirring overnight at room ~-
temperature and then stirring for 3 hours at 50C. A~ter
this reaction, the CPG beads were removed by filtration
and washed twice with 10 ml of water. After combining the
filtrate and washing~, the mixture was washed three times
with 30 ml of diethylether, and the ammonia and
diethylether were removed under reduced pressure. The ;~
re~ulting aqueous ~olution was freeze dried. The residue
was dissolved in about 5 ml of 0.1 M an aqueous solution
of triethylammo~ium acetate (TEAA) (pH 7.3), and
insoluble~ were removed with a 0.45 micron millipore
filter. The resulting ~olution was applied in three
portion~ to reverse pha~e HPLC (Intertsil PREP-ODS, 20.0 x
,.
,
.
0~2a
139 2~96~18
25~ mm, 0.1 M TEEA, pH 7.3; 10-40% CH3cN/30 min-, linear
gradient; 9 ml/min.; 254 nm). The fraction that eluted at
14.1 minutes was collected. A~ter removing the
acetonitrile under reduced pre~sure and ~reeze drying, the
residue was dis~olved in SO ml of water, followed again by
freeze drying to obtain amorphous compound 16c having an
optical den9ity of 126 OD (260 nm).
UV max: 256 nm
EXAMPLE 17
5'-0-Benzhydryl ODN-12 ~17c)
(17a) 5'-O-Benzhydrylthymidine
,
1.426 g (4 mmol) of 3'-0-[(1,1-dimethylethyl)dimethyl-
8ilyl] thymldine were dissolved in 8 ml of
tetrahydrofuran, after which 350 mg of 55% NaH were added,
in an atmo~phere of argon, whilst stirring at 60C for 2
hour~. After allo~ing the temperature to return to room -
temperature, a solution of 988 mg (4 mmol) of Ph2CHBr
di~solved in 2 ml of tetrahydrofura~ was added dropwiise
thereto, followed by addition of 300 mg (2 mmol) of NaI
and stirring at room temperature. After 17 hour~, the
solve~t was distilled off under reduced pressure a~ter
which the residue wa~ dis~olved in 50 ml of ethyl
acetate. After the resulting ~olution had been wa~hed
twice with 50 ml of a ~aturated aqueous sodium chloride,
the ~olution was dried over anhydrous magnesium ~ulphate.
After the ~olvent had been distilled off under reduced
pre~sure, the rei~idue was dis~olved in 4 ml of
tetrahydrofuran followed by addition of 4 ml of a solution
(1 M) of tetrabutylammonium fluoride in tetrahydrofuran
and stirring at room temperature. After 2 hours, the
solvent wa~ distilled off under reduced pressure, the
re3idue wa~ di~solved in 50 ml of ethyl acetate, and then
f." ~ ,"" ~ "~"'"~ "~ " '`' ~'''
~ 140 - 2~966~g 0~28
washed twice with 50 ml of a saturated aqueOU~ sodium
chloride. After the organic layer had been dried over
anhydrou9 magne9ium sulphate, the ~olvent was distilled
off under reduced pre~sure and the regidue was applied to
a 60 g (230-400 mesh) silica gel column to obtain 377.7 mg
(23 ~) of compound 17a by elution with a 1 to 2.5%
metha~ol-methylene chloride 901ution. ;~
NMR (270MHz, CDCl3, TMS) ~ppm:
~ ' .
9.85 (lH, bs, NH), 7.56 (lH, ~, H6), 7.38-7.20 (lOH,
m, Ph), 6.45 (lH, tl Hl', J=6.92Hz), 5.40 ~1~, 9, :
Ph2CH), 4.62-4.58 (lH, m, H3'), 4.17-4.15 (1~, m, ~--
H4'), 3.75-3.58 (2H, m, H5'~, 2.47-2.22 (2H, m, H2'),
1-36 (3H, ~, CH3~
..' ~,
(17b) 5'-0-Benzhydrylthymidine-3'-0-(2-cyanoethyl-N,N-
dii~opropyl)phosphoramidite
':'.
The procedure of Example 16 was repeated analogously
using 204.2 mg (0.5 mmol) of the Compound 17a to give
213.4 mg (70~) of compound 17b.
H-NMR (270MHiz, CDC13, TMS) ~ppm: ~ ~
', :
7.55, 7.51 (lH, 29, Hi6), 7.43-7.22 (lOH, m, Ph),
604a-6.42 (lH, m, Hl'), 5.44, 5.42 (lH, 2s, Ph2CH),
4.73-4.64 (lH, m, ~3'), 4.25, 4.19 (lH, 2bs, H4'),
3.90-3.55 (6H, m, H5', POCH2, PNCH~, 2.68-2.24 (4H,
m, H2', NCCH2), 1-.39 (3H, 9, CH3), 1.30-1.10 (12H, ;-
m, (C~)2CH)
(17c) 5'-0-~enzhydryl ODN-12 -
! -
This compound, 17c, was synthesised according to the
~ame procedure a~ described in Example 16 using 91 mg
(0.15 mmol) of the Compound 17b, above. For purification,
. . .
`.,. ': :,. , ., ... ,. , : ` , ., . - ' .: : ' " , .. ~ ', , .. , ., ' , : ,
';";'"' i' ','' ' '' "' 'i,'.. "~ '' ' ' "' ,,
O ~ 2 8
-~ - 141 ~ 20966~8
Compound 17c was applied in three portion9 to reverse
phase HPLC (Inertsil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA,
pH 7.3; 0-40% CH3CN/40 min., linear yradienti 9 ml/min.;
254 nm), and the fraction was collected that was eluted at ~ ~-
29.2 minutes. After the acetonitrile had been distilled
off under reduced pre~sure, the residue wa~ freeze-dried,
and it wa9 di9901ved in 50 ml of water, followed again by
freeze drying, to obtain amorphous compound 17c having an
optical den9ity of 130 OD (260 nm).
W max: 265 nm
EXAMPLE 18
5'-O-Trityl ODN-12 (18c)
(18b) 5'-O-Tritylthymidine-3'-0-(2-cyanoethyl-N,N-
diisopropyl)pho~phoramidite
'
5'-O-tritylthymidine (18a) wa~ ~ynthesised in the same
manner a~ described in J. Am. Chem. Soc., 80, 6212
(1958). The procedure of Example 16 was repeated
analogously u~ing 969 mg (2 mmol) of Compound 18a to
obtain 1.35 g (99 ~) of compound 18b.
H-NMR (270MEz, CDC13, TMS) ~ppm:
7.62, 7.57 (lH, 28, H6), 7.46-7.20 (15H, m, Ph),
6.46-6.37 (lH, m, H1'), 4.68 (lH, bs, H3'), 4.19 and
4.15 (lH, 2bs, H4'), 3.90-3.30 (6H, m, H5', POCH2,
PNCH), 2.63-2.28 (4H, m, H2', NCCH2), 1.47 (3H, s,
CH3), 1.23-1.00 (12H, m, (CH3)CH)
-
(18c) 5'-O-Trityl ODN-12
This compound, 18c, was synthesised in the ~ame manner
a~ described in Example 16 on a scale of 15 ~mol, but
usi~g 308 mg (0.45 mmol) of Compound 18b. For
.
, . : ,.: ; . . - . . : i, . :, : :.,
~, ,, ~ ;. . : :, .
O ~ 2 8
- 142 -
20~5~
purification~ compound 18c was applied in ten portions to
reverse pha9e HPLC (Inertsil PREp-oDs~ 20.0 x 250 mm; 0.1
M TEAA, pH 7.3; 20-50~ CH3CN/20 min., linear gradient; 9 -
ml/min.; 2sg nm), and the fraction that eluted at 12.6
minutes wa~ collected. After the ace~onitrile had been
distilled off under reduced pressure and the residue was
freeze-dried, it was di5901ved in 50 ml of water, followed
again by freeze drying, to obtain amorphou~ compound 18c --
having an optical density of 464 OD (260 nm).
..'' ~':
Wmax: 256 nm
EXAMPLE 19
. ,
5'-0-(4-Methoxytrityl) ODN-12 (19c)
(19b) 5'-0-(4-Methoxytrityl)thymidine-3'-0-(2-cyanoethyl-
N,N-diisopropyl)phosphoramidite
5'-0-(4-Methoxytrityl)thymidi~e (compound l9a) was
synthe~iSed in the ~ame manner as de cribed in J. Am.
Chem. Soc., 85, 3821 (1963). The procedure of Example 16
was repeated analogou ly, but u~ing 257.3 g (0.5 mmol) of
Compound l9a to obtain 261.9 mg (73 ~) of the compound l9b.
H-NMR (270MEz, CDC13, TMS) ~ppm:
7.64, 7.59 (lH, 2s, H6), 7.46~7.20, 6,88-6.82 (14H, m, ;-
Ph), 6.46-6.39 (lH, m, H1'), 4.73-4.62 (lH, m, H3'),
4.19, 4.15 (lH, 2bs, H4'), 3.90-3.30 (6H, M, H5',
POCH2, PNCH), 3.78 (3H, 9, C~30), 2.66-2.29 (4H,
m, H2', NCC~2), 1.46 (3H, 8j CH3), 1.17 (12H, d, ! ''.. ''' '.
(CH3)2CH, ~=7.26Hz) -
:.
(19c) 5'-0-(4-Methoxytrityl) ODN-12 ~;
This compound, l9c, was synthe~ised according to the
~ame method as described in Example 16, but using 107 mg
., ~ .: . ,.
,. .
.
O ~ 2 8
- 143 - 2 0 ~ 6
(0.15 mmol) of compound l9b. For purification~ Compound
l9c was applied in three portions to reverse phase HPLC-
(Inert3il PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
20-53% CH3CN/30 min., linear gradient; 9 ml/min.; 254
nm), and the fraction that eluted at 14.4 minutes was
collected. After the acetonitrile had been di~tilled off
under reduced pre~3ure, the re~idue wa3 freeze-dried, and
it was dissolved in 50 ml of wa~er, followed again by
freeze drying, to obtain amorphous compound l9c having an
optical density of 91 OD (260 nm).
Wmax: 256 nm
EXAMPLE 20
5'-0-(~,5-Dibenzyloxy)benzyl ODN-12 (20c)
(20a) 51 0 (3,5-Dibenzyloxy)benzylthymidine
3,5-(Dihenzyloxy)benzylbromide was synthesi~ed by the
method described in Chem. ~er., 02, 2887 (1969). The
procedure de~cribed i~ Exampl~ 17 was repeated
analogously, but using 713 mg (2 ~Imol) of
3'-O-[(l,l-dimethylethyl)dimethylsilyl]thymidine and
767 mg (2 mmol) of 3,5-(dibenzyloxy)benzylbromide to
obtain 258.5 mg (23~) of compound 20a.
H-NMR (270 MXz, CDC13, TMS) ~ppm:
7.87 (lH, 9, NH), 7.52 (lH, s, H6), 7.43-7.27,
6.59-6.52 (13H, m, Ph), 6.37 (lH, t, Hl', ~=6.75Hz),
5.03 (4H, 9, PhCH2), 4.51 (2H, d, PhCH20CH2,
J=3.30Hz), 4.50-4.44 (lH, m, H3'), 4.06-4.03 (lH, m,
H4'), 3.77-3.63 (2H, m, H5'), 2.32-2.12 (2H, m, H2'),
1.67 (3H, 9, CH3)
.,.. , .. ... , . .. . , ,, . ............... . . . - , .
,: ~. . ~ . . . .
;, , .. . . : . . ,
0 4 2 8
1 4
2096~
(20b) 5~-o-(3/5-Dibenzyloxy)ben~ylthymidine-3J-o-(2-cyano-
ethyl-N/N-diisopropyl)phogphoramidite ~
The procedllre of ~xample 17 wa9 rep~ated analogou~ly,
but using 258.5 mg (0.475 mmol) of Compound 20a to give
307.7 mg (87~) of compound 20b. -~
H-NMR (270 M~iz, CDC13, TMS) ~ppm
7.56, 7.53 (lH, 2g, H6), 7.42-7.28, 6.56 (13H, m, Ph),
6.40 (lH, t, H1~, J=6.60Hz~, 5.02 (4H, 8, PhCH2),
4.67-4.58 (lHi m, H3'), 4.53, 4.51 (2~i, 2~,
PhCH2OCH2), 4~23, 4.17 (lH, 2bs, H4~), 3.90-3.52
(6H, m, ~5~ POCH2, PNC~), 2.68-2.53 (2H, m,
NCC_2), 2.49-2.12 (2H, m, H2'), 1.65 ~3H, ~, CH3),
1.1~ (12H, d, (CHi3)2C~, J=5.g4Hz) `;~
~.
(20c) 5'-0-(3,5-Dibenzyloxy)benzyl ODN-12
.
Thi9 compound, 20c, waR synthesised according to the
same procedure as de3cribed in Example 17, butfusing 112
m~ (0.15 mmol) of Compound 20b. For purification,
Compound 20c wa~ applied in 3 3eparate applications to
reverse phase HPLC (Inertsil PREP-ODS, 20.0 x 250 mm; 0.1
M TEAA, pH 7.3; 20-50% CH3CN/30 min., linear gradient; 9
ml/min.; 254 nm), and the fraction was collected that
eluted at 15.7 minutes. After the acetonitrile had been
di~tilled off under reduced pressure, the residue was
freeze-dried, and it wa3 di~olved in 50 ml of water, -
followed again by freeze drying, to obtain amorphous
compound 20c having-a~ optical density of 85 OD (260 nm).
~. .. ..
Wrnax: 256 nm
,
.
, '
.: .
.
;,, ' ,, : :, . , . ,; . ,, ! " ,, .
- 145 -
209G6~8
~ EXAMP~LE 21
~ , ,
5'-0-{3,5-gig~3,5- (dihenzyloxy~benzvloxylbenzy--l} ,;
ODN-12 (21c)
(21a) 5l-o-{3/5-~ 3~5-(dibenzyloxy)benzyloxy]benzyl}
thymidine
3~5-Bis~3~s-(dibenzyloxy)benzyloxy]benzylbromide was
i3ynthesised by ~he method descr.ibed in Chem. Ber., 10~,
2887 (1969). The procedure of Example 17 wai~ repeated `~-
analogouisly, but using 713 mg (2 mmol) of
3'-O-[(1,1-dimethylethyl~dimethyl~ilyl]thymidine and
1.61 g (2 mmol) of 3,5-bis[3,5-(dibenzyloxy)benzyloxy]-
benzylbromide to obtain 381 mg (20~) of compound 21a.
~ ~ .
- l~ NMR (270 MHz, CDC13, TMS) ~ppm:
7.86 (lH, g, NH), 7.52(1H, 5, H6), 7.45-7.2a,
6.68-6.50 (29H, m, Ph), 6.35 (lH, t, Hl', J=8.10Hz),
5.03 (8H, 8, PhCH2), 4.98 (4H, 8, PhCH2), 4.50
(2H, dd, PhCH2), 4.42-4.3a (lH, m, H3'), 4.03-3.98
(lH, m, H4'), 3.73-3.59 (2H, m, H5'), 2.30-2.09 (2H,
m, H2'), 1.70 (3H, 9, CH3)
~'
(21b) 5'-0-{3,5-~i~[3,5-(dibenzylo~rt)benzyloxy]benzyl}
thymidine-3'-0-(2-cyanoethyl-N,N-diisopropylJ-
pho3phoramidite
, ....
The procedure of Example 18 w~s repeated analogously,
but u~ing 242 mg (0.25 mmol) of Compound 21a, to gi~e -
146 mg (50~) of compound 21b.
~H-NMR (270 MHz, CDCl3, TMS) ~ppm: -
7.56, 7.53 (lH, 25, H6), 7.45-7.28, 6.66, 6.5~-6.52
(29H, m, Ph), 5.01 (8H, 9, PhCH2), 4.95 (4H 9,
~` - 146 2~g66~ 0~2g .
PhC_2), 4.66-4.57 (lH, m, H3'), 4.52, 4-51 (2H, 29,
PhCH2), 4.22, 4.16 (lH, 2bs, H4'), 3.83-3.34 (6H, m,
H5', POCH2, PNCH), 2.69-1.77 (~ m, H2~, NCCH2),
1.66 (3H, ~, CH3), 1.30-1.08 (12H, m, (CH3)2CH)
(21c) s~-o-{3~s-Bis[3~5-(dibenzyloxy)benzyloxy]benzyl}
ODN-12
This compound, 21c, was synthesised according to the
~ame procedure as described in Example 18 using 146 mg
(0.125 mmol) of Compound ~lb. For purification, Compo~nd `~
21c was applied in two portions to reverse pha~e HPLC
(I~ert~il PRE~-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
20-70i~ CH3CN/50 min., linear gradient; 9 ml/min.; 254
nmi), and the fraction that eluted at 36.6 minute~ was
collected. After the iacetonitrile had been di~tilled off
und~r reduced pressurei, the residue was freeze-dried, and
it was dis~olved in 50 ml of water, followed again by
freeze drying, to obtain amorphou~ compound 21c having an
optical density of~g9 OD (260 nm).
,
UVmax: 256 nm
"'
EXAMPLE 22
5'-0-(2-Na~hthylmethylL ODN-12 (22c)
(22a) 5'-0-(2-Naphthylmeth~l)thymidine
The procedure of Example 17 wa3 repeated analogously,
but using 480.5 mg (1.35 mmol) of 3'-0-~(1,1-dimethyl- ; `
ethyl)dimethyl~ilyl]thymidine and 298 mg (1.35 mmol) of `~
2-bromomethylnaphthalene, to obtain 179.5 mg (35%) of
compound 22a.
H-NMR (270 iMHz, CDC13-CD30D, TMS) ~ppm:
7.88-7.77, 7.53-7.43 (7H, m, naphtyl), 7.61 (lH, 9,
- 147 - 209~6~
H6~, 6.35 (lH, t, Hl~, J=6.60Hz), 4.76 (2H, s, CH2),
4.52-4.~7 (lH, m, H3'), 4.11-4.09 (lH, m, H4 ),
3.89-3.71 (2H, m, H5'), 2.38-2.14 (2H, m, H2'), 1-54 :~
(3H, s, CH3)
(22b) 5~-0-(2-Naphthylmethyl)thymidine-3~-0-(2-cyano-
ethyl-N,N-diisopropyl)phogphoramidite
The procedure of Example 16 was repeated analogously,
but using 179.5 mg (0.47 mmol) of Compound 22b, to give
165 mg (60~) of compound 22h.
H-NMR (270 MHz, CDCl3, TMS) ~ppm:
7.~8-7.77 and 7.52-7.42 (7E, m, naphtyl), 7.60, 7.57
tlH, 2~, H6), 6.40 (lH, t, Hl~, J=5.94Hz), 4.81-4.71
(2H, m, CH23, 4.67-4.58 (lH, m, H3~), 4.24, 4.18
(lH, 2bs, H4'), 3.90-3.50 (6H, m, H5'~ POC_2, PNCH),
2.68-2.15 (4H, m, H2~, NCCH2), 1.5~, 1.56 (3H, 2e, ; :
CH3) 1.17 (12H, d, (CH3)2C~, J=6.60Kz)
(22c) 5'-0-(2-Naphthylmethyl) ODN-12 -
This compound, 22c, was synthe~i~ed according to the
same procedure as described in Example 16, but u~ing 87 mg
(0.15 mmol) of Compound 22b. For purification, Compound
22c wa~ applied in two portion~ to rever~e phase HPLC
(Inertsil PR~P-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
10-40~ CH3CN/30 min., linear gradient; 9 ml/min.; 254
nm3, and the fraction that eluted at 17.6 minutes was
collected. After th~ acetonitrile had been distilled off
under reduced pressure, the re~idue wa~ freeze-dried, and.
it was dissolved in 50 ml of water, followed again by
~reeze drying, to obtain amorphous compound 22c having an
optical den~ity of 141.6 OD (260 nm).
W max: 256 nm :
"~ . ,
'.~, ~ ' ;.. ' ',"' . ' . ' ". ,
- 148 - 20~6~ 0~28
EXAMPLE 23
5'-BenzylthiO-5'-deoxy ODN-12 (23c)
(23a) 5~-~enzylthio-5~-deOxythymidine
.
: 5'-deoxy-s~-mercapto- ~ -
thymidine (775 mg, 3.0 mmol) was di~solved in acetone (20 ~`
ml), follow~d by addition of benzylbromide (564 mg, 3.3 :
mmol) and ~odium carbonate ~660 mg, 6.6 mmol) and stirring
at room temperature for 17 hours in a drying atmosphere.
After any insoluble ~alt had been removed by filtration,
the solvent was distilled off under reduced pressure. The ~ `
residue wa~ disaolved in methylene chloride (40 ml), and
the resulting solution was washed twice with 2~ ml of
water, followed by drying over anhydrous magnesium
: sulphate. The solvent was distilled off under reduced
pressure to obtain a caramel-like residue. This was ~`
dissolved in 10 ml of ethanol and left to stand in a !`
refrigerator overnight to g~ive 451 mg of the desired
compound in white prism crystals.
H-NMR (270 ~Hz, DMSO-d6) ~ppm~
11.28 (lH, 9, NH), 7.46 (lH, s, H6), 7.46-7.21 (5H, m,
: Ph) 6.61 (lH, t, J=6.8, 7.3Hz, H1'3, 5.32 (lH, d, .
4.4Hz, OH,), 4.15 (lH, m, H3'~, 3.83 (lH, m, H4'),
3.78 (2H, s, PhCH2), 2.78-2.59 (2H, m, H5'), :.
2.25-2.00 (2H, m, H2'), 1.77 (3H, ~, C~3
.
(23b) 5'-Benzylthio-5'-deoxythymidine-3'-0-(2-cyano~
ethyl-N,N-diisopropyl)phosphoramidite ~ :
The procedure of Example 16 was repeated analogously,
but ueing 174 mg (0.5 mmol) of Compound 23a to give 262 mg
(95%) of compound 23D.
''': '
~ - 149 2096~8
H-NMR (270 MXz, CDcl3/ TMS) ppm
7.37 (lH, g, H6), 7.34-7.20 (sH~ m, Ph), 6.32-6.25
(lH, m, Hl'), ~,49-4.38 (lH, m, H3~), 4.18-4.08 (lH,
m, H4'~, 3.90-3.50 (6H, m, PhC~2, POCH2, PNCH),
2.87-2.68 (2H, m, H5'), 2.67-2.56 (2H, m, NCCH2),
2.55-2.12 (2H, m, H2'), 1.91 (3H, s, CH3), 1.20-1.15
(12H, m, (C~3)CH~
(23c) 5'-Benzylthio-5'-deoXy ODN-12
This compound, 23c, was ~ynthesi~ed according to the
same procedure as described in Example 16, but using 82 mg
(0.15 mmol) of Compound 23b. For purification, Compound
23c was applied in three portion3 to reverse phase HPLC
(Inertsil PR~P-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
0-40~ CH3CN~40 min., linear gradient; 9 ml/min.; 254
nm), and the fraction that eluted at 25.8 mlnutes was
collected. After the acetonitrile had been distilled off
under reduced pres~ure, the residue wa~ freeze-dried~ and
it was dissolved i~ 50 ml of water, followed again by
freeze drying, to obtain amorphou~ compound 23c having an
optical den~ity of 46 OD (260 nm).
W max: 256 nm
~XAMPLE 24
5'-Diphenylmethylthio-5'-deoxy ODN-12 (24c)
- - ~
(24a) 5~-Diphenylmethylthio-5'-deoxythymidine
5'-deoxy-5'-mercaptothymidine (516 mg, 2.0 mmol) was
dis~olved in acetone (320 ml), followed by addition Of
diphenylmethyl bromide (741 mg, 3.0 mmol) and ~odium
carbonate (1.0 g) and refluxing for 5 hours in a dxying
-, , atmosphere. After confirming the ab3ence of the starting
.
, ~, , : , .
~- - 150 - 209&6~8
substance with TLC (using methylene chloride containing
10~ metha~ol as the developer), any insolubles were
removed by filtration. After distilling off the solvent
undex reduced pressure and dissolvlng the residue in a
small amount of me~hylene chloride, the solution was
applied to a silica gel column and purified by allowing to
~low off with methylene chloxide containing 5~ methanol.
The re~idue obtained by collecting the major peak and
concentrating to dryness was crystallised from ethanol to
obtain 334 mg of the desired product in the form of a - -
colorless powdery crystal.
H NMR (270 MHz, DMSO-d6) ~ppm:
11.28 (lH, s, NH)/ 7.47-7.20 (llH, m, H6, Bzh-ph),
6.15 (lH, t, J=6.8Hz, H1'), 5.37-5.32 (2H, m, OH,
Ph2CH), 4.16-4.12 (lH, m, H3'), 3.85-3.79 (lH, m,
H4'), 2.71-2.50 (2H, m, H5'), 2.21-2.00 (2H, m, H2'),
1.79 (3H, s, C_3)
, . ...
(24b) 5'-Diphenylmethylthio-5'-deoxythymidine-3'-O-(2-
cyanoethyl-N,N-diisopropyl)phosphoramidite
The procedure of Example 16 was repeated analogously,
but using 212 mg (0.5 mmol) of Compound 24a, to ~ive 253.7 -
mg (81~) of compound 24b.
H-NMR (270 MHz, CDCl3, TMS) ~ppm:
7.47-7.17 (llH, m, Ph, H6), 6.35-6.27 (lH, m, H1'),
5.29, 5.27 (lH, 2s, Ph2CH), 4.50-4.40 (lH, m, H3'),
4.19-4.10 (lH, m, H4'), 3.92-3.50 (4H, m, POCH2,
PNCH), 2.80-2.10 (6H, m, H2', H5', NCC_2), 1.77 (3H,
~, CH3), 1.20-1.15 (12H, m, (CH3)CH)
, .
- 151 -
2~9~6~8
(24c) 5~-Diphenylmethylthio-5'-deoxy ODN-12
This compound, 24c, was synthesised according to the
~ame procedure as described in Example 16, but using 94 mg
(0.15 mmol) of Compound 24b. For purification) Compound
24c was applied in three portions to reverse phase HPLC
(Inertsil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
0-50% CH3CN/50 min., linear gradient; 9 ml/min.; 254
nm), and the fraction that eluted at 30.3 minutes was
collected. After the acetonitrile had been distilled off
under reduced pressure, the residue was freeze-dried, and
it wais dissolved in 50 ml of water, followed again by
freeze drying, to obtain amorphous compound 24c having an
optical density of 73 OD (260 nm).
W max: 256 nm
EXAMPLE 25
5'-Triphenylmethylthio-5'-deoxy ODN-12 (25cJ
(25a) 5'-Triphenylmethylthio-5'-deoxythymidine
5'-deoxy-5'-mercaptothymidine (775 mg, 3.0 mmol) was
dis~olved in dry pyridine (20 ml), and the resulting
solution was dissolved in trityl chloride (920 mg, 3.3
mmol), followed by ~tirring at 50C for 2 hours. After
water (1 ml) had been added to the solution and the
resulting mixture stirred at room temperature for 15
minutes, the solvent was distilled off under reduced
pressure. The residue was then dissolved in methylene
chloride (50 ml) and then washed with 40 ml each of a
saturated aqueous sodium chloride, 0.2 N HCl and a
saturated aqueous sodium chloride. Each of the aqueous
layers was then wa3hed in ~equence with 20 ml of methylene
chloride, and then combined with the organic layer and
dried over anhydrous magnesium sulphate. The solvent was
. . ~ ; ~ . , , . ; .
O ~ 2 B
. ~ ` 2 ~
then concentrated to dryness to obtain a yellowish-white
residue. This residue was dissol~ed in a small amount of
methylene chloride and applied to silica gel column
chromatography packed with methylene chloride. After
eluting with a mixed solvent of cyclohexane and ethyl
acetate in a ratio of 2:1, the ma~or peak was collected
and concentrated to dryness to obtain 437 mg of the
desired substance in the form of a caramel-like substance
producing a single spot in TLC (using methylene chloride
containing 5~ methanol a~ the developer).
. ...
H-~MR (270 MHz, DMSO-d6) ~ppm: ~
11.28 (lH, s, NH), 7.40-7.20 (16H, m, H6, Ph3C), ,
6.07 (lH, dd, J=6.84, 7.32Hz, H1'), 5.26 (lH, d,
J=4.40Hz, OH), 3.99-3.94 (lH, m, H3'), 3.60-3.55 (lH,
m, H4'), 2.50-2.30 ~2H, m, H5'), 2.18-1.94 (2H, m,
H2'), 1.75 (3H, s, CH3)
(25b) 5'-Triphenylmethylthio-5'-deoxythymidine-3'-0-(2-
cyanoethyl-N,N-diisopropyl)phosphoramidite
The procedure of Example 16 was repeated analogously,
but using 250 mg (0.5 mmol) of Compound 25b, to give 231 -~-
mg (66~) o~ compound 25b.
H-NMR (270 MHz, CDC13, TMS) ~ppm~
7.48-7.15 (16H, m, H6, Ph3C), 6.27-6.17 (lH, m,
H1'), 4.22-4.19 (lH, m, H3'), 4.06, 4.00 (lH, 2bs,
H4'), 3.85-3.40 (4H, m, POCH2, PNCH), 2.67-1.95 (6H,
m, H2', H5', NCCH2), 1.83 (3H, e, CH3), 1.20-1.10
(12H, m, CH ) CH)
3 2
(25c) 5'-Triphenylmethylthio-5'-deoxy ODN-12
This compound, 25c, was synthesised according to the
.
,
.
... . .. . . . . . ~ . . . . ... . . . . . . . .
~ 153 - 2~9~
same procedure as described in Example 1 on a scale of 2
~mol using 42 mg (0.06 mmol) of Compound 25b. For
purification, Compound 25c was applied in two portions to
reverse phase HPLC (Inertsil PREP-ODS, 20.0 x 250 mm; 0.1
M TEf~A, pH 7.3; 20-50% CH3CN/20 min., linear gradient; 9
ml/min.; 254 ~m), and the fraction that eluted at 13.1
minutes was collected. After the acetonitrile had been
distilled off under reduced pre~sure, the residue was
freeze-dried, and it was di~solved in 50 ml of water
followed again by freeze drying to obtain amorphous 25c
having an optical density of 38 OD (260 nm).
W max: 256 nm
E~AMPLE 26
5'-Hexadecylthio-5'-deoxy (ODN)-12 (26b)
(26a) 5 J -Hexadecylthio-5'-deox~ffthymidine
5'-deoxy-5'-mercaptothymidine (258 my, 1 mmol) was
dissolved in acetone (20 ml), and hexadecyl bromide
(457 mg, 1.5 mmol) and sodium carbonate (500 mg) were
added to the resulting solution, followed by refluxing for
3 hours in a dryfing atmosphere.
I~soluble~ were removed by filtration and the solvent
was distilled off under reduced preYsure. The residue was
dissolved in a small amount of methylene chloride and the
solution wa~ applied to silica gel column chromatography
packed with methylene chloride and eluted with methylene
chloride containing 5~ methanol. The major peak was
collected, and the solvent was distilled off to obtain 303
mg of the desired product in the form of a colorless
caramel-like substance.
lH-NMR (270 MHz, DMSO-d6) ~ppmo
.~ ' .
.~, ~ ., . . . ,, , . , ....... . .... . . . ~ , - . . . . .. .. .... . . ...
; ~ ~ f ; ;
_~ 154
2 0 9 6 ~ ~ 8
11.28 (lH, s, NH3, 6.61 (lH, dd, J=6.35, 7.82Hz, H1'),
5.31 (lH, d,- J=4.40Hz, OH), 4.19-4.12 (lX, m, H3'),
3.84-3.79 (lH, m, H4'), 2.83-2.68 (2H, m, H5'),
2.58-2.47 (2H, m, CH2), 2.25-2.00 (2H, m, H2'), 1.79
(3H, s, 5CH3), 1.57-1.45 (2H, m, CH2), 1.30-1.23
(26H, s, CH2), 0.85 (3H, t, J=6.83Hz, CH3)
(26b) 5'-Hexadecylthio-5'-deoxythymidine-3'-0-(2-cyano-
ethyl-N,N-diisopropyl)phosphoramidite
,
The procedure of Example 16 was repeated analogously,
but using 241 mg (0.5 mmol) of Compound 26a, to give 193
mg (56~) of compound 26b.
,,.
H-NMR (270 MHz, CDCl3, TMS) ~ppm:
7.46-7.41 (lH, 28, H6), 6.29 (lH,-t, H1', J=7.26Hz),
4.55-4.g5 (lH, m, H3'), 4.22-4.12 (lH, m, H4'),
3.92-3.54 (4H, m, POCH2, PNCH), 2.93-2.17 (6H, m,
H2', H5', NCCH2), 1.93 (3H, s, CH3), 1.60 (2H, bs,
CH2S), 1.26 (30H, 9, CH2), 1.20 (12H, d, ~ -
(C_l)2CH, J=6.60Hz), 0.88 (3H, t, CH3, J=7.00Hz) ;;~;;
(26c) 5'-Hexadecylthio-5'-deoxy ODN-12
This compound, 26c, was synthesised according to the
same procedure as described in Example 16 using 102 mg
(0.15 mmol) of Compound 26b. For purification, Compound
26c wa3 applied in three portions to reverse phase HP~C
(Inert~il PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
10 70~ CH3CN/60 min., linear gradient; 9 ml/min.; 254
nm), and the fraction that eluted at 42.3 minutes was
collected. A~ter the acetonitrile had been distilled off
under reduced pressure, the residue was freeze-dried, and ~.
it was dissolved in 50 ml of water, followed again by
freeze drying, to obtain amorphous compound 26c having an
optical den~ity of 81 OD (260 nm).
:: `
~ , - 15S
2~9~
Wmaxo 256 nm
.
EXAMPLE 27
$'-(12-Tri~henylmethyloxydodecylthio)-S'-
deoxy ODN-122 (27a)
(27a) 5'-(12-Triphenylmethyloxydodecylthio)-5'-deoxy-
thymidine
51-deoxy-5'-mercaptothymidine (516 mg, 2.0 mmol) were
dissolved in acetone (30 ml), followed by addition of
12-hydroxydodecyl bromide (1.06 g, 4 mmol) and sodium
carbonate (2 g) and heating under reflux for 3 hours in a
drying atmosphere. After confirming that the starting
substance was no longer present with TLC (using methylene ~ ~-
chloride containing 5~ methanol as the developer) and
filtering out insolubles, the solvent was distilled off
under xeduced pressure. The residue was applied to silica
gel column chromatography packed with methylene chloride ~ -
and eluted with methylene chloride containing 3
methanol. The major peak was collected and the solvent
was distilled off to obtain 712 mg of 5'-deoxy-5'-(12-
hydroxydodecylthio)thymidine in the form of a colourless
cari~mel-lik~ substance. This caramel-like substance ~589
mg, 1.30 mmol) was dissolved in anhydrous pyridine (30 ml)
followed by addition of trityl chloride (541 mg, 1.95
mmol) and stirring at 70C for 4 hourY in a drying
atmosphere. The solvent was then distilled off under
reduced pressure and the residue was dissolved in
methylene chloride (30 ml), and the resulting solution was
wa~hed with 30 ml each of a saturated aqueous solution of
sodium chloride, 0.2 N HCl, a saturated aqueous solution
of ~odium chloride and a saturated aqueous solution ~f
sodium hydrogencarbonate. The aqueous layers were then ~;~
washed in sequence with 20 ml of methylene chloride,
combined with the organic layer and dried over anhydrous -
~, ~
:'.
': .
~ 156 -
209g6:~8
magnesium sulphate. The ~olvent was then concentrated to
dryness under reduced pressure. The re~idue was di3solved -
in a 9mall amount of methylene chloride and applied to
~ilica gel column chromatography packed with methylene ~ -
chloride and eluted with methylene chloride containing 5~ ~-
methanol. The major peak wa~ collected and ~he 301vent
was distilled off. The re~idue wa~ then freeze dried with
cyclohexane to obtain 757 mg of the desired compolmd in
the form of a yellowish-white powdery substance.
H-NMR (270 MHz, DMSO-d63 ~ppm: ~
11.28 (lH, 8, NH), 7.50 (lH, ~, 6H), 7.38-7.21 (15H,
m, Ph~, 6.16 (lH, t, J=6.34Hz, H1'), 5.31 (lH, d,
J=4.4Hz, 0_), 4.17-4.14 (lH, m, H3'~, 3.83-3.80 (lH,
m, H4'), 2.95 (2H, t, J=6.35, CH2), 2.77-2.73 (2H,
m, H5'), 2.20-2.05 (2H, m, H2'), 1.78 ~3H, s, CH3),
1.10-1.60 (20H, m, CH2)
.
~27b) 5'-(12-Triphenylme~hyloxydodecylthio)-5'-deoxy-
thymidine-3'-0-(2-cyanoethyl-N,N-dii30propyl)-
phosphoramidite
~. .
The procedure of Example 16 wa~ repeated a~alogously,
but using 342 mg (0.5 mmol) of Co~ound 27a, to give 423.8
'~ mg (96%) of compound ~b
H-NMR (270 MHz, CDCl3, TMS) ~ppm:
7.55-7.22 (16H, m, H~, Ph3C), 6.3~ ~lH, t, H1',
J=6.60Hz), 4.61-4.51 (lH, m, H3), 4.30-4.12 (lH, m, ;
H4'), 3.97-3.55 (4H, m, POC_2i PNCH), 3.10 (2H, t,
CH2, J=6.40Hz), 2.99 2.20 (8H, m, H2', H5', NCCH2,
¦ CH2S), 1.97 (3H, 8, CH3), 1.72-1.25 (lOH, m,
CH2), 1.25 (12H, d, (C~)2CH, J=7.26Hz), 1.09
(3H, t, CH3, ~=7.26Hz)
,
O ~ 2 ~
-- - 157 - 2 ~ ~6
(27c) 5'-(12-Triphenylmethyloxydodecylthio)-5'-deoxy
ODN-12
This compound, 27c, was synthesised according to the
same procedure as described in ~xample 16 using 133 mg
(0.15 mmol) of Compound 27b. For purification, Compound
27b was applied in three portions to reverse phase HPLC
(Iner~sil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
20-70~ CH3CN/50 min., linear gradient; 9 ml/min.; 254
nm), and the fraction was collected that elute~ at 36.0
minute~. After the acetonitrile had been disti~led off ~i
under reduced pressure, the residue was freeze-dried, and
it was dissolved in 50.ml of water, followed again by
freeze drying to obtain amorphous compound 27c having an
optical density of 48 OD (260 nm).
Wmax: 256 nm -
EXAMPLE 28
Phosphorothioate type DmTrODN-12 of the
compound of Ex~mple 3 -~
. .
The phosphorothioate type DmTrODN-12 was synthesised
using the model 394 according to the phosphoroamidite
method available from Applied Bio~ystems Inc. following
the User's Manual. Purification of the compound was
performed using the preparative C18 reverse phase HPLC.
The conditions are as follows.
Flow rate: 9 ml
Column: COSMOSIL 5C18-AR (20 x 250 mm)
Solvent: 0.1 M triethylamine acetic acid (pH 7.0) `
acetonitrile 15 to 30 ~ ~
Retention time: 14.04 min, 14.63 min.
'' ,.', '
'' ' ' ' ' ~
.. ' ' '~;
' ' .' ~
O ~ 2 8
- 158 ~ 209~
COMPARATIVE EXAMPLE 1
Dm-Tr-CAA~GTCTGGGTGGA (comparative compound No. 1) was
obtained following the procedure of Ex~mple 2. The
behaviour of this compound in rever~e phase liquid
chromatography was as follows.
Column used: Waters Microbondapack C18
Flow rate : 1 ml/min
Solvent: O.l M triethylamine-acetic acid (pH 7.0)
acetonitrile 15 to 30 i%/20 min
Retention time: 16.6 min :
COMP~RATIVE EXAMPLE 2
' .
Dm-Tr-GTCTGGGTGGAGGGT was synthesised in the same
manner as in Comparative example 1.
COMPARATIV~ EXAMPLE 3
Dm-Tr-ACCCTCCACCC~GAC was synthesised in the ~ame
manner as in Comparative example 1. -~
''
COMPARATIVE EXAMP~E 4 :
Dm-Tr-TTTTTTTTTTTTTTT was synthesised in the same
manner as in Comparative example 1. :~
.: .
TEST EXAMPLE 1 ~ .
Inhibitory Effects on HIV Replication .
The anti-HIV activity of unmodified naturally
occurring anti-sense oligonucleotides having a base
sequence homologous to the compound of the present
invention, a~ well as corresponding non~en~e
,
- . , , . - . - , - . .. . .. , . .. " , . . .. ... . . .
O ~ 2 ô
- 159 - 2~9~8
oligonucleotides was determined with respect to the
vicinity of the splicing acceptor site of pre-mRNA of HIV
tat and rev.
Anti-HIV activity was determined according to
conventional methods [R. Pauwel et al., J. Virological
Methods 20, 309-321 (1988)].
More specifically, cell pellets obtained by
centrifuging MT-4 cells in the logarithmic growth phase
for 5 minutes at 150 x g were infected with HIV at 37C
for 1 hour at a concentration of ~4 CCID50. :
HIV-infected MT-4 cells were then obtained by centrifuging
the cells in 10~ fetal bovine serum containing RPMI-1640
medium (to be referred to as "~erum medium") and washing. -~
.,
The HXV-infected MT-4 cells as well as mock-infected
MT-4 cells were suspe~ded in serum medium at a
concentration of 4 x 105 cells/ml, respectively.
100 ~l each of previously stepwise-diluted solutions of -
the specimen compounds (suspended in serum medium) were
placed in each of the wells of a 96-well plastic ~ ~
microtiter plate. Next, 100 ~1 each of the ;
abo~e-mentioned cell suspensions was placed in each of the
wells, followed by ~ulturing while allowing ~he plate to ~;-
stand at 37~C for ~days in the presence of 5~ carbon
dioxide gas. ~
:: -
HIV-infected MT-4 cells to which the ~pecimen compound
had been added, as well as mock-infected MT-4 cells to
which the specimen compound had not been added were
cultured in the same manner.
I
After completion of culturing, the cells were assayed
based on the MTT 13-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide] method lh.M. Green et al., J.
Immunolo. Methods, 70, 257-268 (1984)] to determine the
'~'
0 4 2 ~
- 160 -
': ' .
HIV-induced cytocidal activity. The concentration of
specimen that i~hibited 50~ of the HIV-induced cytocidal
activity in HIV-infected MT-4 cells (effective dose,
ED50) was determined by taking the activity of
HIV-infected MT-4 cells to which the specimen compound was
added to be 100~, and taking the cytotoxic activity of
non-HIV-infected MT-4 cells to which the specimen compound ~:
was not added to be 0~.
a In addition, ~he concentration that suppressed the
proliferation of~HIV-infected MT-4 cells to 50~ (CD50)
was determined as an indication of the cytotoxic activity :. .
of the specimen compound, and the value of CD50/ED50 ~ -
waY taken to be the selectivity index (S. I.) of anti-HIV
activity.
:,
Tho~e results are indicated in Table 1. : :
;
.
~ .
; . ~ .,
O ~ 2 8
- 161 -
6 3 ~
TABLE 1
.
Test compounds and their HIV activity
, ,:
Example ~ase sequence ED50 CD50 Selectivity
: No. (~g/ml)(~g/ml) index
:. . ;. , ,:
1 AGGTGGGTCTGAAAC 6.5 >100 >15 :.
2 TCGG~GTT&GGAGGT 7.0 >100 ~14.3 .;~
3 TGGGAGGTGGGTCTG 4.0 ~100 ~25 ;
4 TTGGGAGGTGGGTCT 2.2 ~100 ~45 ;
AGGTGGGTCTGAAAC 7.2 ~100 ~13 `
8 TGGGTCTGA~ACGAT 4.0 ~100 ~25
9 TAGGTGGGTCTGAAAC .12.5 ~100 ~8 .~:~
GGTGGGTCTGAAACG 11.0 ~100 ~9.1 .
12 GGAGGTGGGTCTGAA 18.0 ~100 ~5.6 .. :. :
13 GGGAGGTGGGTCTGA 9.O ~100 ~11.1 :
14 GTTGGGAGGTGGGTC 10.0 ~100 >10
GGGTTGGGAGGTGGG 8.5 >100 ~11.8 ~ .
.:: .
17 TGGGAGGTGGGTCTG 6.2 ~100 ~16.6
18 TGGGAGGTGGGTCTG 5.2 ~400 ~76.5 ~.
19 TGGGAGGTGGGTCTG 8.0 ~100 ~12.5 ::
TGGGAGGTGGGTCTG 4.3 90 ~20.9 :.
22 TGGGAGGTGGGTCTG 7.4 ~100 ~13.S
24 TGGGAGGTGGGTCTG 2.5 ~100 ~40
TGGGAGGTGGGTCTG 7.2 ~100 ~13.8
26 TGGGAGGTGGGTCTG 12.5 ~100 ~8 ' :
27 TGGGAGGTGGGTCTG 34 ~100 ~2.9 .:
28 TGGGAGGTGGGTCT5.5~100 ~18.2
29 TGGGAGGTGGGTC4.6 >100 ~21.7
TGGG~GGTGGGT4.5 ~100 ~22.2
31 TGGGAGGTGGG 4.6 ~100 ~21.7 ~:
32 TGGGAGGTGG 5.0 ~100 ~20
33 TGGGAGGTG 5.5 ~100 ~18.2 ~.
....
~, ''-' .
'; ~
O ~ 2 a
~`\ - 162 -
2 0 9 ~
~ll of the compounds of the present invention were
observed to demonstrate inhibitory effects on HIV
proliferation at concentrations of 100 ~g/ml or less.
On the other hand, those corresponding compounds in which
the 5' terminal was not modified were not observed to
demonstrate anti-HIV activity over the range of ~-
concentrations investigated (c600 ~g/ml). In addition,
even when modified, those sequences not complementary to
HIV gene (compounds of Comparative Examples 1 to 4) did
not demonstrate inhibitory effects (c100 ~g/ml). These
result~ indicate that modifying the 5' terminal~of the
oligonucleotide molecule enhances the action of the
anti-sense sequence. -
TEST EXAMPLE 2 -
Action on tumor ~ene ras
It was also confirmed that, in the method pertaining
to the present invention, modified anti-sense
ollgonucleotides, which are anti-sense to the oncogene
ras, are able to inhibit proliferation of DT cells at a
concentration at which unmodified anti-sense
oligonucleotides do not demonstrate efficacy.
A$ter twice infecting NIH3T3 cells with Carsten's
mouse sarcoma viru9, DT cells wer~ produced coniisting of r
a non-virus-producing transformed cell strain that is
cloned according to the agar colony method, incorporating
two copies of activated ras gene (v-Ki-ras) in the form of
chromosomes [Noda et al., Proc. Natl. Acad. Sci. USA, 80,
5602 (1988)]. Consequently, DT cell~ differ from the
parent NIH3T3 cells in that they have remarkably low
adhesion, they do not exhibit contact inhibition, ana they
proliferate in multi-layer form, with said proliferation
not limited to single layers.
.
`;
",,~ ",, . . ,,, ", ;". ;,, . ~ ".-, " ~ ` " , , ,~ " , ,,-
- 163 - 209~8
The action of an anti-sense sequence (the compound of
Example 6) corresponding to 21 bases from the 9th bai3e
up~tream from the trani~lation initia~ion site to the 12th
base down~tream from the initiation codon of this v-Ki-ras
gene was investigated for the purpo~e of inhibiting
expresi3ion of thisi gene. The~ ~ are indicated in
Table 2: -- -
Title: Oligonucleotide Structure (5~-3~
DmTr-ODN-4 DmTr-ATACTCAGTCATTTTTAGCAG
(Compoundof Example 6) -
., '~ "
ODN-4 -ATACT QGTC~TTTTTAGCAG
'" " ' '
The ability of the above mentioned sequ~nec to inhibit
proliferation of DT cells was measured a~ described
below. DT celli~ were 3uspended in DMEM medium containing
10~ serum to a concentration of 5 x 103 cells/ml.
500 ~l of this i~uspension was added to each well of a ~;
48-well plastic microtiter plate together with 20 ~g of
specimen. Ihe plate was then cultured while allowing to
stand in the presence of 5~ CO2. rrhe medium was
replaced with fresh medium every three days, and the
~peci~en wa~ al~o added at that time. The numher of cells
was counted after lO days, and the actiYity in inhibiting
proliferation was determined by comparing with a group to
which specimen had not been added. A~ indicated in the
result~ of Fig. 1, ~trong activity in inhibition of cell
proliferation was demonstrated only for the compound of
Example 6, wherea~ activity in inhibiting proliferation
was not ohserved for homologou~ naturally occurring
anti-~en~e oligonucleotides. In addition, morphological
change~ were al~o observed in the cells to which the
compound of Example 6 had been added. More i~peci~ically,
0 4 2 8
. - 164 -
2 ~ 8
there was an increaaed proportion of flat cells iaimilar to
the morpholog~ of the parent NIH3T3 cells (Fig. 1).
TEST EXAMPL~ 3 :,
,. ~
Action on tumor gene c-myb .
It has been reported that expression of the tumour
gene c-myb i~ over-expressed in HL60 premyelocytlc
leukaemia cells, and that cell proliferation i9
- interrupted by suppression of its expres~ion with an
anti-sense oligonucleotide [Anfossi e al., Proc. Natl.
Acad. Sci. USA, ~6, 3379 3383 (1989~]. ~he compound of
Example 7 was also confirmed to demonstrate strong
activity in inhibiting proliferation on compariiaon with a
homologous unmodified anti-sen3e oligonucleotide.
The effect of inhibitlon of proliferation on H~60
cells was measured in the manner described below for a
compound in which a DmTr group wa~ bonded to the 5'
, ~ terminal of the 18mer sequence of 5'-GTGCCG5$GTCTTC~GGC~
i complementary to the mRNA of c-myb, for which inhibitory
activity has been observed in the report of Anfossi et al.
(DmTr-ODN-4: compound of Example 7), as ~ell as ~or the
corresponding unmodified oligonucleotide. After
suspending the HL60 cells in ~erum medium to a ~-
j co~centration of 2 x 104 cells/ml, and adding specimen
to each to a concentration of 20 ~g/ml, 500 ~l
aliquot~ of tho~e cell suspenaion~ were added to each of
the wells of a 48-well pla~tic microtiter plate ~ollowed
' by cul~uring while allowing to stand for 5 days in the
.~ presence of 5% CO2. The number of cell~ was counted on
the 4th and 5th days of culturing. A~ a result, the
i compound of Example 7 demonstrated approximately double
the activity in inhibition of pro~iferation of the
homologou~ unmodified compound~ tFig. 2).
., ~
.' , 1 . ' . ' :': ' i ' , ' ' . ,; ' . ' , ~ ., , ' .~' , '' ' : ' .:
" ' ' -: ' '':',: ': ', " ': . , ' .,: ' ' ~ ' : ' ' ' '~ ' ' ' ,' .' . ' , . '
' ,'; ' , '; , ' ' ; ' ;; " ' ' ' 'i", ,;~,- ' , " ' '
O ~ 2 ~
~ - 165 2 0 ~ ~ ~ 5 8
.
TEST EXAMPLE_4
.
Suppression of_Production of Viral Antigen ln HIV-Infected
Cells
It was confirmed by the following two types of
experiments that treatment of HIV-l infected cells with an
anti-sense oligonucleotide suppresses synthesis of viral
proteins.
.
(1) Inhibition of the Amount of Viral Reverse~
Transcriptase Released in Media
~. .
MT-4 cells were infected with HIV-l in the same manner
as described in Test Example 1. Various concentrations of
the compound of Example 3 were then added, followed by
culturing at 37C for 6 days in a carbon dioxide gas
incubator. Following culturing, the activity of the
rever~e transcripta~e contained in the viral particles
released into the culture supernatant was assayed using
the method of Somogyi et al. [Somogyi et al., J. Virol.
Methods, 27, 269 (1990)]. Those results are indicated in
Fig. 3. The activity of reverse transcriptase relea~ed by
~IV-l infected cells decrea3ed with dependence on the
amount of the compound of Example 3 added to the medium.
The concentration that resulted in 50~ inhibition was 4.7
~g/ml, and virus-cau3ed cell damage, assayed at the same
time, was nearly equal to the oligonucleotide
concentration resulting in 50~ inhibition (7 ~g/ml).
~a~ed on the above results, it became clear that the
compound of Example 3 inhibits the production of viral
reverse transcriptase in HIV-l infected cells.
: :
(2) Inhibition of Production of viral Antigen in HIV-l
Infected Cells
Next, the amount of viral antigen produced in HIV-l
'',
, ~ .
., :
" ,; , , : .; r, , ~ ' l : ' ~ ' " ; ' '
- 1~6 -
2~9~ 8 ~
in~ected cells treated with various concentrations of the
compound of Example 3 was investigated in order to
determine the action of ~aid compound of Example 3 on the
production of vixal antigen other than reverse
transcripta~e. After adding the sample preparation
solution, described by Laemmli et al., containing SDS and
the reducing agent mercaptoethanol [Laemmli, Nature, 227,
680 (1970)] to virus infected cells obtained according to
the method indicated in Test Example 1 and control
non-infected cells, and treating at 100C for S minutes,
SDS-PAGE electrophoresis was per~ormed using a 12.5
polyacrylamide gel. After the electrophoresis, the
protein was transferred to a nitrocellulose filter, and
the viral antigen was specifically labelled using anti-~IV
human serum prepared from HIV-1 infected patients, and
anti-human goat antibody labelled with peroxiclase. The
labelled protein was then developed using the
immunostaining kit manufactured by Konica. As indicated
in lane 1 of Figs. 4A and 4B, various viral antigen~
including env (pl60, pl20) and gag (p55, p29, p24) are
produced in viru~ infected cells [Petteway, et al., TiPS,
12, 28 (1991)]. However, when the compound of Example 3
is added, production of viral antigens is inhibited
dependent on the concentration of the compound added. At
a concentration of 12 ~g/ml or more, essentiall no viral
antigen is observed. On the other hand, when the compound
corresponding to Example 3 in which the 5' terminal is not
modified, despite having an identical base sequence,
production of viral antigen is not inhibited at all even
when added to a concentration of 100 ~g/ml (Fig. 4B~.
Based on the above results, compounds in which the 5'
terminal is modified were confirmed strongly to inhibit
biosynthesis of all viral antigens in HIV-1 infected cells.
::: , .. .. , ~: : :
0~2a
- 167 -
2~6~8
:
TEST EXAMPLE 5
,
Inhibition of Viral RNA Synthesis in HIV-1 Infected Cells
As previously described, the compound of Example 3, in
which anti-HIV-1 activity was observed a~ shown in Table
1, i9 designed to inhibit the splicing of mRN~ which is
essential for production of TAT and REV proteins of the ~:
HIV-1 gene. Thus, it is predicted that, if this compound ~:
inhibits biosynthesis of these viral proteins within virus
infected ceIls, this would result in a shortage`of TAT
protein required for synthesis of viral RNA, thus also
resulting in inhibition of synthesis of viral RNA. ~ .
Synthesis of viral RNA in HIV-1 infected cells treated
with the compound of Example 3 was analyzed by Northern `~
blotting. : :
`':
A~ MT-4 cells were infected with HIV-1, according to . ``
the method de~cribed in Example 1, the compound of Example .
3, and a compound corresponding to Example 3 that was not
modifled, were added to a ~i~al concentration of 20 : -
~g/ml. The cells were then cultured at 37C for 5 days
in a carbon dioxide gae incubator. After removing the
culture supernatant, the cells were wa~hed with ::~
physiological saline solution and total cellular RNA was
isolated by the guanidine thiocyanate method (Chirgwin et
al., Biochemistry, 18, 5294 (1979)). 20 ~g of RNA were : ;
subjected to electrophore~is on a formaldehyde/agarose !.
gel, transferred to a nitrocellulose filter and then ~`
hybridised at 42C for 24 hours with synthetic
32p labeled oligonucleotide probes complementary to
HIV-1 RNA S'-GAGGTGGGTCTGAAACGAT-3' and ``
5'-GAGGTGGGTCATTTGTACA-3'. After washing the filter twice
for 15 minuteR each at room temperature in 1 X SSC ~
containing 0.1~ SDS, the filter was again washed twice for
15 minutes each in 0.2 X SSC containing 0.1% SDS. The :~
signa~ specific for HIV-1 viral RNA was then detected by ;`
'.'~ ~ ` -'.
O ~ 2 8
- - 168 ~ 209~8
autoradiography
As indicated in Fig. 5, in addition to a clear signal
fox genomic RNA of 9.2 kb coding for the gag and pol
proteins, weaker signals were also detected for viral RNA
of 4.3 kb coding for the splicing product of env, as well
as 2.0 kb coding for the proteins tat and rev in MT-4
cells infected with HIV-l (Fig. 5, lane 1). On the other
hand, these signals were not detected in those cells not
infected with HIV-l (Fig. 5, lane 2).
No viral RN~ was detected in HIV-l infected cells
treated with 20 ~g/ml of the compound of ~xample 3 (Fig.
5, lane 4). On the other hand, there was no inhibition of
viral RN~ synthe~is ob~erved at all in cells to which the
compound corre~ponding to Example 3, in which the 5'
terminal wa~ not modified, was added, despite having an
identical base sequence (Fig. 5, comparison between lanes
1 and 3).
The result~ shown above suggest that compounds in
which the 5' terminal is modified also strongly inhibit of ;
~iral RNA synthe~is in HIV-l infected cells.
TE~T EXAMPLE 6
:...
Stabili~ation of Oligonu _eotides by 5'_Terminal
Modification `~
All of the above test examples indicate that
modification of the 5' terminal of oligonucleotides with a
~ubstituent is a prerequisite for expres~ion of anti-HIV-l
activity. One of the reasons that can be considered for
this expression of anti-HIV-l activity is that ~aid
modification increa~es the stability of the
oligonucleotide in the serum. In other word~, although
unmodified oligonucleotides are rapidly degraded due to
~ - 169 -
20966~ :
the various kinds of nuclease contained in the serum, it
is predicted that the oligonucleotides modified with
substituents demonstrate higher stability. After labeling
the 3' terminal of the compound of Example 3 as well as
the unmodified compound corresponding to Example 3 with
32p, using the 3'-end labeling kit manufactured by
Amersham, fixed amounts of those compounds were incubated
at 37C for 30 hours in either RPMI-1640 medium containing
30% fetal bovine serum which is not inactivated, or the
same medium, but without the serum, for the purpose o~
verifying this possibility. After the incubation, those
oligonucleotides that were still present and had not been
degraded were detected with 20~ polyacrylamide gel
electrophoresis. As indicated in Fig. 6, when serum was
not added, both oligonucleotides were not degraded,
regardless of whether modified with substituents at the S'
terminal. However, when serum was added, more than 90~ of
the unmodified compQund corresponding to Example 3 was
degraded. On the other hand, the compound of Example 3
was still present and resistant to degradation (comparison
of lanes 2 and 4 of Fig. 6). This result suggests that,
in contrast to the unmodified compound corresponding to
Example 3 being unstable and rapidly degraded in serum,
oligonucleotide~ like the compound of Example 3, which has
been modified with substituent such as DmTr, demonstrate
improved stability making them less susceptible to
degradation~ Thus, it was strongly suggested that this is
one of the factors of ~he increase in anti-HIV-l activity.
.. ..
'''",'',''' ":,:'''''"'"'.'.'",' ' "''',''"''.' "
042a
1 7 0
209~5a8
TEST EXAMPLE 7 ~ :
Assay of Anti-HIV Activity against Fresh, Clinically
Isolated _Strains
1) HIV-1 Separation Method [Method for Separating HIV-1
from HIV-1 Infected Peripheral Blood Monocytes (PBMC)]
10 ml of blood from HIV-1 infected patients to which
heparin was added was layered on a heucoprep tube
(manufactured by Becton Dickinson). A white layer
containing peripheral blood monocytes (PBMC) was collected
after 30 minutes centrifuging at 2000 x g~ The resulting
PBMC suspension was washed twice with PBS(-) (manufactured
by Nissui Seiyaku) and suspended in 0.5 ml of PBS. After
counting ~he number of viable cells in the PBMC
suspension, anti-human CD8 antibody-bound magnetic beads
(Dynabeads; Dynal Inc., N.Y., USA) were added to the PBMC
suspension in an amount 20 to 40 fold relative to the
number of PBMC. The suspension was allowed to stand for 1 ~-;
hour in an ice bath while repeating stirring 2 to 3
times. To the above-mentioned centrifuge tube was then
added 5 ml of RPMI-1640 medium containing 10~ inactivated
fietal bovine serum, and the tube was then mounted on an
MPC (Magnetic Particle Concentrator; Dynal Inc.). The
Dynabead~ (demonstrating a red color) adhered to the
inside of the centrifuge tube within 1 minute due to the
application of magnetic force. The PBMC serum medium
suspen~ion was then collected from the centrifuge tube
while being careful not to suck any of the Dynabeads.
PBMC separated from the blood of suitable healthy
persons to which heparin was added was stimulated in
advance for 3 days with PHA (10 ~g/ml). Equal amounts ~-
of the juvenile PBMC obtained in this manner and the PBMC
separated from HIV-1 infected patients, from which the
above-mentioned CD8 positive cells were removed, were
.
- 171 -
2 0 ~
mixed into separa~ion serum medium (serum medium
containing the additives of 20 IU/ml of IL-2, 10 ~g/ml
of PHA and 2 ~g/ml of polybrene) to a final
concentration of 5 x 105 to 1 x 106 cells/ml. Mixed
culturing was then performed at 37C in a 5% carbon
dioxide gas incubator. Mixed culturing was continued for
approximately 14 days while replacing half the amount of
juvenile PBMC with fresh juvenile PBMC of suitable healthy
person~ every 3 to 4 days. The amount of p24 antigen in
the culture supernatant and viral titer (Focal
immunoassay) were assayed when syncytium demonst~rating
well-defined ~loon-like forms were observed
microscopically.
2) Drug Sensitivity Test on Clinically Isolated Strains
by a Focus Formation Inhibition Assay (Slightly
Modified MPthod of B. Chesbro et al.)
'" ~
Infection Procedure: Recombinant HeLa cells (1022
cells), which express CD-4 after inroduction of the CD-4
gene, were prepared to a density of 5 x 104/ml in serum
medium.
'..~ ,:, . .
0.5 ml aliquots of the 1022 cell suspension was
inoculated into each of the wells of a 48-well plate
(manufactured by Coa~ter) using an Eppendorf pipette (so
that cells are uniformly adhered to the cùlturing surface
of each well). The 1022 cell~ were cultured overnight at
37C in a 5~ carbon dioxide gas incubator using a 48-well
plate. On the following day, the serum medium in the
48-well plate for proliferation of 1022 cells was removed
by suction with an aspirator. Next, DEAE dextran solution
diluted with 250 ~l of RPMI-1640 medium (8 ~g/ml) was
added and the plate was allowed to stand at 37C in a 5% -
carbon dioxide gas incubator ~or exactly 20 minutes.
Immediately after removing the DEAE dextran solution by ~;
suction with an aspirator, 100 ~1 of diluted virus
~` ~ - 172 2 09 ~ 8
solution (diluted with serum medium) was added having a
titer allowing the formation of 50 to 80 foci. The plate
was then allowed to stand at 37C in a 5% carbon dioxide
gas incubator for 90 minutes to infect the 1022 cells with
virus. After completion of infection, 0.5 ml each of
semi-logarithmically stepwise-diluted anti-HIV-containing
serum medium was added to each of the wells followed by
culturing at 37C for at least 3 days in a 5~ carbon
dioxide gas incubator.
'
Enzyme-Antibody Staining Procedure: After completion
of culturing, the serum medium in the 48-well plate for
proliferation of 1022 ce~ls was completely remo~ed by
suction with an aspirator followed by addition of 250 ~1
of methanol to fix the cells at room temperature for
exactly 5 minutes. Immediately after the 5 minutes had
elap~ed, the methanol was completely removed by suction
and the plate was washed twice with PBS(-) containing 1~
F~S. Next, 100 ~1 of serum from an AIDS patient diluted
by a factor of 800 with PBS(-) containing 1% FBS were
added as the primary antibody, ancl allowed to react for
about 30 minutes at room temperature. The added serum
from the AIDS patient was then removed by suction and the
plate was washed twice with PBS(-) containing 1~ FBS. 100
~1 of horseradi8h peroxidase-labelled anti-human
F(ab)2 diluted by a factor of 200 with PBS(-) were
added, and allowed to react for at least about 45 minutes
at room temperature. After washing the plate three times
with PBS(-), 250 ~1 of enzyme substrate solution (0.2
mg/ml of 3-amino-9-ethyl-carbazole and 0.015~ hydrogen
peroxide/0.05 M ~odium acetate buffer (pH 5.0)) was added
to perform enzyme activity staining at room temperature
for 20 minutes.
After completion of staining, excess substrate
solution was washed from the-plate with PBS(-), and the
number of foci that .stained red was counted
7i
. .
~ ~ 0 ~ 8
microscopically (10 x 4).
,
Results: HIV-1, the pathogen of AIDS, is a
h~pervariable virus that demonstra~es a high rate of -
mutation even within the same host. Thus, it is necessary
to investigate the effects of the compound of the present
invention against virus infected cells originating in AIDS
patients actually infected with HIV at its various
infection stages (AC, ~RC and AIDS). A study was
conducted regarding the sensitivity of clinically isolated
~IV strains, isolated from HI~ patients at various
infection stages (AC, ARC and AIDS), ~o the compound of
the present invention. More specifically, a focus
formation inhibitory test (focus reduction assay~ was
performed to investigate the drug sen3itivity of 12 virus
strains with respect to the compound of Example 3.
Sensitivity to the compound of Example 3 was confirmed for
10 standard laboratory strains and isolated strains.
Moreover, this compound demonstrated uniform effects
against clinically isolated strains from the various
infection stages (~C, ARC and AIDS) of ~IV patients.
" '' '
'"'
'
,''. , ', ' ;, ' ' ' ' ,' " ' . ' " ', . ' ' " ' ', ', ' ' ' ~ ' ' ' ~' 1 ' , ~ "
0 4 2 8
'~ ~ - 174 - 2~66~8
TABLE 3
Various HIV-I infected clinically isolated strain
Sensitivity to the compound of Example 3
HIV isolated strain Clinical symptom ICso (~g/ml)
: HTLVIIIB* - ~1.4
HTLVIIIRF* - 2.3
GOT9156 AC 2. a
SAS91817 AC 7.2
. S~T91817 ARC 6.8
FUJ91725 ARC 8.6
FUJ91811 ARC ~.2
YU6a AIDS 13.1
ICH91513 AIDS 7.8
SAI9166 AIDS 5.6
IKE AIDS ~ 3.3
SUE AIDS 16.0 ~
* Te3t standard ~train -
~: AIDS (Acquired immunodeficiency syndrome)
ARC (AIDS-related complex) -:
AC (Asymptomatic Carrier)
TEST EXAMPLE 3
Acute toxicity was determined according to
conventional methods. More specifically, 150 mg/kg of the ~::
compound of ~xample 3 was orally administered to five ddy
mice (males). The mice were observed for 5 days, and it
was found that all were viable after that time period.
~,,; ' ~
O ~ 2~
- 175 -
2 ~
PREPARPATION EXAMPLE 1 , ~:
Inlectible Preparation
The injectible preparation i9 provided for use in the
formi of ampules containing a ~terile solution or
suspen~ion with water or other pharmaceutically acceptable
liguid, or a sterile powder preparation (preferably that .:-
resulting from freeze drying of the anti-sense compound)
is filled into ampules and it may be ~imultaneously :~
diluted with a pharmaceutically acceptable liquid.
PREPA.RATION EXAMPLE 2
Tablet~
..
1) Compound of Example 3 200 ~ :
2) Sodium ialt of pyro-acid S
3) ~erosil~200 5
~) ~ i stearate 5
5) Lactose 495 ~:
6) Corn ~tarch 154 :~ ~:
7) Avicel 123
8) HPL(L) 10
997 g ~ ~:
: A crushed mixture of above-me~tioned ingredients 1) to ..
4) were added to pre-production granule~ consi~ting of a
granulated mixture of above-mentioned ingredients 5) to ..
8). Next, the mixture wa~ formed into tablets, using a :~
tablet m~king machine, to obtain tablets containing 100 mg
per tablet. Sugar coating ca~ be applied to the~e
tablets, a~ necessary.
'' ," ~
,,
,, ~ :'.
, ,~".,.. . .. " .. , ,, . ... , , , ,, ,, ~, ., . ". , . . . .. , , .. , , ., , , , ,, , . , :
O ~ 2 ~
~ 176 -
2~9~8 '
PREPARATION EXAMPLE 3
Capsules
1) Compound of Example 3 200
2) Calcium hydrogenpho phate 200
3) Aluminum silicate 345
4) Crystal cellulose 250
5~ Magnesium stearate 2
.
997 g
'.
The ingredient~ 1) to 5) listed above were mixed and
crushed. Further, after the mixture had been passed
through a ~ieve and blended well, the ingredients were
formed into 200 mg capsule~ in accordance with
conventional methods.
The compound~ of the present invention posses~
~peci~ic activity that damage~ virus infected cells and ~`
tumour cells, activity that suppresses the characteristic ~-~
morphological change~ as~ociated with the occurrence of
viral di3eases or cancer, and further possess the ability
to inhibit, specifically, proliferation, etc.. Thus, the
compou~ds of the present inve~tion are useful a~ a
therapeutic and preventive drug for viral diseases and
cancer.
Fig. 1 indicates a microphotograph representing the
action on DT cells.
'' `:-..
- Fig. 2 indicate3 the effect~ on proliferation o~ ~L ~D
4~ cell~.
Fig. 3 indicates suppression of production o~ reverse
tran~cripta~e.
.,'' ;~ ,
0 4 2 a
~ - 177 -
2 ~ 9 ~
Fig. 4 indicates suppression of production of viral
antigen in HIV-l infected cells.
Fig. 5 indicates inhibition of viral RNA synthesis in
HIV-l infected cells.
Fig. 6 indicates stabilization of oligonucleotides by
modification of the S' terminal.
.
.
'
: . .
,
,~
,: ' ;::.
'; ~
,..
,, .' '
,
' .
0 4 2 ~
~ - l7a -
209~6~
SEOUENCE LISTING
INFORMATION FOR SEQ ID NO.: 1
Sequence length: 15
Sequence type: Nucleic acid
Strandness: single
Topology: Linear
Hypothetical: No
Anti-sense: Yes
Sequence: .
AGGTGGGTCT GAAAC
INFORMATION FOR SEQ ID NO.: 2 ..
Sequence length: 15.
Sequence type: Nucleic acid ~;
Strandness: single
Topology: Linear
Hypothetical: No
Anti-sense: Yes
Sequence:
TCGGGGTTGG G~GGT
INFORMATION FOR SEQ ID NO.: 3 :-~
Se~uence length: 15 ~.
Sequence type: Nucleic acid
Strandness: single
Topology: Linear : :-
Hypothetical: No ~;
Anti-sense: Yes : :
Sequence: :
TTGGGAGGTG GGTCT ` ;
.:
'' :,
.:~
: : ,
- 179 -2~96~
.
-.::- .
INFORMATION FOR SEQ ID NO.: 4 :
Sequence length~ 21
Sequence type: Nucleic acid
Strandness: single
~I'opology: Linear
Sequence:
ATACTCAGTC ATTTTTAGCA G
INFORM~TICN FOR SEQ ID NO.: 5
Seguence length: 18
Sequence type: ~ucleic acid ~:
Strandness: single
Topology: Linear
Sequence:
GTGCCGGGGT CTTCGGGC
INFORMATION FOR SEQ ID NO.: 6 ;
Sequence length: 15
Sequence type: Nucleic acid
Strandness: single
Topology: Linear
Sequence:
TGGGTCTGAA ACGAT ~ .
INFORMATION FOR SEQ ID NO.: 7 ; ~.
Se~uence length: 16
Sequence type: Nucleic aci,~
S,trandness,: single
Topology: Linear
Sequence:
TAGGTGGGTC TGAAAC
:
. ~, : j . ... , . , ,, :i., . . : : . .:, : ; ,
.. . . .. . . . .. . ..
0 4 2 1~
1 8 0
2~9~S~,~
INFORMATION FOR SEQ ID NO.: 8
Sequence length: 15
Sequence type: Nucleic acid
Strandness: single
Topology: Linear
Sequence:
GGTGGGTCTG AAACG
INFORMATION FOR SEQ ID NO. 9
Sequence length: 15
Seguence type: Nucleic acid
Strandness: single
Topology: Linear
Sèquence:
GGTGGGTTGC TTTGA .
.-
INFORMATION FOR SEQ ID NO.: 10 : I
Sequence length: 15 : ~ .
Sequence type: Nucleic acid
: Strandness: single
Topology: Linear ::
Sequence:
GGAGGTGGGT CTG~A
.: :: .:
INFORMATION FOR SEQ ID NO.: 11 :
Sequence length: 15 ~ :
Sequence type: Nucleic acid . :
Strandness: single :~
Topology: Linear
Sequence~
; GGGAGGTGGG TCTGA
I' :
, ,
~ .
. .
:, .
O ~ 2 1~
~~ - 181 -
20~658
INFORMATION FOR SEQ ID NO.: 12
Sequence length: 15
Sequence type: Nucleic acid
Strandness: single
Topology: Linear :
Sequence:
GTTGGGAGGT GGGTC
INFORMATION FOR SEQ ID NO.: 13 :-
Sequence length: 15
Sequence type: Nucleic acid
Strandness: single ~
Topology: ~inear . i .
Sequence:
GGGTTGGGAG GTGGG
INFORMATION FOR SEQ ID NO.: 14
Sequence length: 15 . --.
Se~uence type: Nucleic acid
Strandness: single :~ :
Topology: Linear
Sequence~
TGGGAGGTGG GTCTG
.:
INFORMATION FOR SEQ ID NO.: 15 : -
Sequence length; 14 , :
Sequence type: Nucleic acid .:
Strandness: single
Topology: Linear
Sequence: ;~
TGGGAGGTGG GTCT
'. , , : . . . . ' ' ' . ' ,', ~ . ' ' , i '. ' i ': ' . ~ '
' i , ;", 1 ,,,, " ",~ ,, ,,," , ,,,~ ",,, , "~ "; , ~ , " ~
- 182 -
` ' 2~9~g58
INFORMATION FOR SEQ ID NO.: 16
Sequence length: 13 `
Sequence type: Nucleic acid
Strandness: single
Topology: Linear
Sequence:
TGGGAGGTGG GTC
,
INFORMATION FOR SEQ ID NO.: 17
Sequence length: 12
Sequence type: Nucleic acid
Strandness: single
Topology: Linear -
Sequence:
TGGGAGGTGG GT : :
INFORMATION FOR SEQ ID NO.: 18 .--~
Sequence length: 15 ;: ~ `
Sequence type: Nucleic acid :~ :~
Strandness: single `:
Topology: Linear : .
Sequence:
TGGGA~GTGG G
....
.,
INFORMATION FOR SEQ ID NO.: 19 :.:
....
Sequence length: 10 ~
Sequence type: Nucleic acid : ~ :
Strandness: single `.::' .
Topology: Linear : :
Sequence:
TGGGAGGTGG
''
,
':`.
. ',
- 183 -
2~9~
INFORMATION FOR SEQ ID NO.: 20
Sequence length: 9
Se~uence type: Nucleic acid
Strandness: single
Topology: Linear
Sequence:
~ TGGGAGGTG
`:~
,
: ' ' ':, . ,
:'~
: ' ' ':
: ~ .. : ,,; -
