Note: Descriptions are shown in the official language in which they were submitted.
~-`` 21~2963
Simple nucleic acid am~lification ~ocess
The subject matter of the invention includes a process for amplifying a
segment of a deoxyI~bonucleic acid, a process for detecting this
deoxyribonucleic acid, and reagents for the implementation of said processes.
Samples, such as body fluids, contain deoxyribonucleic acids only in minute
amounts. These contain, however, sequence information which is often a fairly
reliable indicator for the presence of certain organisms or the conditions of
such organisms. Amplifying the sequence info~nation has proven to be a
usefill tool. While the first applicable amplification systems were based on ~e
exponential amplification of sequence information in temperature cycles, more
recent systems allow these reactions to occur at almost constant temperatures.
Such a system is described in EP-A-O 329 822, for example. This publication
describes a process for amplifying ribonucleic acids where an antisense-
p~omoter-containing oligonucleotide is hybridized to the one end of the
nucleic acid to be amplified. Using the nucleic acid as a template, this
oligonucleotide is extended by adding deoxyTibonucleotides. After the
RNA/DNA hybrid is denatured, another oligonucleotide is hybridized to the
end of the DNA which is remote from the promoter sequence and is extended
under the formation of a functional promoter.
The segment of the double strand which follows the promoter is then
transcribed into RNA under control of the promoter. Then, the RNA is again
used to synthesize the promoter-containing DNA double strand. A great
disadvantage of this process is that if DNA is used as the initial template, thecorresponding sequence is either chemically or synthetically produced or
cleaved out of a plasmid by means of a restriction enzyme such ~at the
nucleotides of the nucleic acid to be amplified which are located at the 5'-end
hybridi~e to the promoter oligonucleotide. Yet another disadvantage of the
process is that a denaturing process is necessary after the formation of cDNA
which, in addition to a time delay, also leads to the destruction of the enzyme
- 2 -
used to form the cDNA (e.g. thermal denatul~ng). Consequently, additional
enzyme must then be added or the sample must be diluted (e.g. addition of
reagent), and the sensitivity is reduced.
WO 91/02818 describes a process which, as opposed to EP-A-O 329 822, ismodified in that the 5'-end of the nucleic acid to be amplified hybridizes to the ~-
3'-end of the target-specific sequence of the promoter primer. Again, this is a
process which requires pretreatment steps in order to obtain a defined ~5'-end of
the nucleic acid to be amplified. This pretreatment requires that the nucleic
acid to be amplified be purified prior to the actual amplification procedure.
WO 91/02818 andJ. vir. Methods 35, 273-286 (1991), andNature 350 (1991),
also describe a process where RNA is amplified under the above listed
conditions. In this process, cDNA which corresponds to the analyte RNA is
formed in a first step, then the RNA is digested by means of RNAse H, and the
treatment of the cDNA is continued as in the detection of analyte DNA.
Because of the substrate specificity of RNAse H, however, this process is
limited to RNA analytes only, and many organisms or conditions which are
based on characteristic DNA sequences cannot be detected with this process.
Object of the present invention was to find a process for the amplification of
nucleic acids which applies to deoxyribonucleic acids and functions on
transcription basis and which does not exhibit the above disadvantages known
in prior art and is particularly easy to implement.
Subject matter of the invention is, hence, a process for amplifying a segment
of a deoxyribonucleic acid A comprising the following steps: - ;
a) converting possibly present double-stranded deoxyribonucleic acid A into
single strands resulting in the formation of the strands A- and A+,
b) formation of a strand B+, which is at least partially complementary to
strand A- by extending a first primer P1+, which contains a nucleotide
sequence that is specific for a partial sequence of the segment as well as a
promoter-containing nucleotide sequence,
--` 2102963
- 3 -
c) formation of a strand B-, which is essentially complementary to strand B+
by extending a second primer P2-, said strands B- and B+ together
containing a functional promoter for a DNA-directed RNA polymerase in
addition to sequence information from nucleic acid A,
d) transcription of the nucleic acid double strand from B- and B+ into
ribonucleic acid C+ under control of the promoter,
e) formation of a strand D'- which is essentially complementary to C+ by
extending a primer,
f) formation of a strand D+ which is essentially complementary to D'- by
extending a primer and extending D'- to D-, said strands D- and D+
together containing a functional promoter in addition to the sequence
information of ribonucleic acid C+,
g) transcription of the nucleic acid double strand from D- and D+ into
ribonucleic acid C+ while controlling the promoter, while one or several of
the reagents for calIying out steps c) to f) are added to the reaction mixture
already prior to or simultaneously wi~ the formation of the nucleic acid
B+ or with no complete separation be~ween B+ and A- being realized
between steps a) and b). ; -
Also subject matter of the invention are processes for the detection of
deoxyribonucleic acids and reagent kits for the implementation of said
processes, particularly for the detection of Listeria monocytogenes.
A deoxyribonucleic acid is understood to be a nucleic acid which is
predominantly composed of deoxyribonucleotide components. These
deo~yribonucleotides can be of a natural origin. As opposed to natural
nucleotides, however, they can also be modified, for example by adding a
chemical group to label the deoxyribonucleic acid. In case nucleic acids are
used, which are to be extended at ~e 3'-end, these nucleic acids can be
blocked at the 5'-end, for example, having a dideoxyribose as deoxyribose. A
segment of a deoxyribonucleic acid as understood in ~e invention can be
--- 2102963
~ . .
either a single strand or a double strand. In case of a double-stranded segment,this segment can be double-stranded at both ends (blunt-ended).
A llucleic acid stralld or sequell~c is esselll;ially co~ lel~e~llary to allolher shan~l or
sequence, if its nucleo~ide seque~-ce is so complemellt~uy to ~le otllel sequence alat
~e slrands can h yblidize to eacll o~er ove~ tlle wllole sequence of lhis straud. I~is
is especially the ~ase, if the strand is produced by a polymerase using the otller
st~ d as a te~nplate for the synthesis oftt~is stratld. Ill t}us case the strands may only
comprise not complemellta~ ucleotide bases inco1poraled by e~or of ~le
polymeraSe.
ucleic acid s~arld or sequence is considered to be at least partially
complementa~ to atlother strand o~ sequence, if at Ieast ~ part of ~e strand ca~hybridize to ~e od~er str~nd, the ~1r~d therefore can b~ essentia~ly co~plementaFy
o~rer ~ its sequence or can com~se a sequence part which is essentially
com~lementary and a sequence pa~t which is not complementaly to ~e o~er s~and.
These pa~ts preferably are more thall ~bouL 10 nucleohdes ~n l~ng~,
A sequence is considered to be homologous to anotller sequence, if it hy~idizes to
t~e same sequence ~ e othe~ seque~e. Preferably ~ore ~a~ ~0% of ~e
U~ U~ vr~ uqll-;q~uqi~ lIU11~iullt;~u~ u~ u~
other soquel~ce. The sequellce C~UI be lollger or sholtel than the odler sequence.
~' ~
~- ~
~ :
... , , .. ... .. . . .. .... I . ~ , ,
--. 210~3
- 4a-
Provided it is hybridized to a deoxylibonucleic acid, a primer is a nucleic acidwhich can act as the starting point for the DNA polymerase activity of an
enzyme. For this purpose, tne 3'-end of the primer, especially the nucleotide atthe 3'-end is complementary to the deoxyribonucleic acid and has a free, non-
phosphorylated 3'-hydroxyl group. A primer contains a deoxyribonucleotide
sequence which is specific for the deoxyribonucleic acid and can hybridize
with the segment of the DNA because of its complementarity. This sequence is
hereinafter referred to as a target-specific sequence. The location where the
primers are supposed to hybridize to the deoxyribonucleic acid can be
determined in that the 3'-ends of the primer, with respect to the sequence afterhybridization to the strands, are facing one another. The distance between the
3'-ends of the primers covers a nucleotide sequence of at least one nucleotide,
preferably at least 30, more preferably 40-1000 nucleotides. Further, it is alsopreferred that the sequences are not complementary to each other or cannot
hybridize to each other. The target-specific sequence has a minimum length of
10 nucleotides, preferably 15-50, a particularly preferred length covers
18-30 nucleotides. Further, the primers are subject to the conditions listed in
US-A-4,683,202. The tar~et-specific sequences of the plimers can, however,
also be identical or contain identical sequences. They should, however, not be
capable of hybridizing to each other.
A promoter-containing nucleotide sequence is a nucleotide sequence which, if
it were double-stranded, would initiate the transcription of the nucleic acid ~ ~-
segment, following the sequence in 3'-direction by means of an RNA
polymerase. Preferably, the sequence has a single-stranded primer. In a
preferred manner, it has a length of 17-100 bases, particularly preferred is a
length of 17-50 bases. Suitable double-stranded sequences capable of binding
an RNA polymerase are, for example, known from NucleicAcids Research 12,
pages 7035-7056 (1984) and Pro~ein Sequences and DNA Analysis 1,
pages 269-280 ~1988J, Biophysical Chemis~ry, Part III, pages I I83-1211,
Freeman & Co., San Francisco, 1980; J. Bacteriol 170, pages 5248-5256
(1988J; Biochem. ~ 224, pages 799-815 ~1984); Gene Acal. Tech 6, pages
2 9 6 ~
29-32 (1989), EP-A-O 292 S02 and Nucleic Acid Probes, ed. Symons (C~C
Press, Boca Raton, 1989).
The conditions under which primer extension reactions occur are known to the
expert from text books, but are also described in US-A-4,683,202. Under the
given conditions, the result is an extension product of a primer which can
serve as a template for the extension of another primer, and so forth.
In the invention, the term partially complementary means sequences which are
either completely complementaty to another nucleic acid or to a part of
another nucleic acid or complementaly to another nucleic acid or part of
another nucleic acid to such an extent that they can hybridize with the other
nucleic acid under the conditions of the extension reaction.
A fimctional promoter is a double-stranded nucleic acid segment which starts
the target-specific synthesis of RNA by recognizing and binding RNA
polymerase.
DNA-directed RNA polymerases are known to the expert. They operate
promoter-dependent. Examples include the polymerases from phages T7, SP6,
N4, or T3. For the transcription system of T7, please refer to Nucleic Acids
Research 15, 8783-8798. Transcription is understood to be a process, wherein
a ribonucleic acid is formed with ~e aid of a promoter-containing DNA
double strand as a template, said ribonucleic acid being complementary to a -
part of a strand of the double strand which is located in transcription direction
beginning at the promoter-containing sequence of the plimer. ~ a particularly
preferred manner of the invention, the ribonucleic acid formed is
complernentaIy to the strand of the DNA, which is the basis for the ;~
amplification procedure of the invention. -
RNAse H is an enzyme which digests the RNA strand of an RNA/DNA ~ ~ ~
hybrid, but leaves single-stranded RNA essentially undigested. It is also ~ ~ -
possible to use other enzymes, provided they catalyze isothermal strand - -
separation.
.., }.''..'-;,.,.,.,.';~'
~` 21029~3
- 6 -
A label as understood in the present invention is a directly or indirectly
detectable group L. Directly detectable groups are, for example, radioactive
(32p), colored, or fluorescent groups or metal atoms. Indirectly detectable
groups include, for example, immunologically or enzymatically active
compounds such as antibodies, antigens, haptens, or enzymes or enzymatically
active partial enzymes. They are detected in a subsequent reaction or reaction
sequence. Particularly preferred are haptens as nucleoside triphosphates (rNTP
or dNTP) labeled with haptens are particularly suitable as substrates of (RNA
or DNA) polymerases. Further it is simple to join a reaction with the labeled
antibody to the hapten or the haptenized nucleoside. Such nucleoside
triphosphates include, for example, bromide nucleoside triphosphate or
digoxigenin, digoxin or fluorescein-coupled nucleoside triphosphates. The
steroids listed in EP-A-O 324 474 and their detection have proven to be
particularly suitable. For their incorporation in the nucleic acids, please refer
to EP-A-O 324 474.
The method of the invention is a special embodiment of so-called
hybridization tests whose fundamentals are known to the expert in the field of
nucleic acid diagnostics. For experimental details which are not listed
hereinafter, please refer to the following publications: "Nucleic acid
hybridization", B.D. Hames and S.J. Higgins (edts.), IRL Press, 1986, ~ -~
especiallychapters 1 (HybridizationStrategy), 3 (QuantitativeAnalysisof
Solution Hybridization) and 4 (Quantitative Filter Hybridization); "Current
Protocols in Molecular Biology", F.M. Ausubel et al. (edt.), J. Wiley and Son,
1987, especially 2.9.1 - 2.9.10, and "Molecular Cloning", J. Sambrook et al. -
(edt.), CSH, 1989, especially 9.4.7 - 9.5.8. These experimental details include
in particular known processes for the preparation of labeled nucleoside
triphosphates as described in EP-A-0 324 474, the chemical synthesis of
modified and nonmodified oligonucleotides; further cleaving nucleic acids by ~ -
means of restriction enzymes, selecting the hybridization conditions to achieve
a certain specificity which depends on the homology between the nucleic acids
to be hybridized, their GC contents and ~eir lengths, and include the
formation of nucleic acids from nucleoside triphosphates by means of
polymerases, if necessary with the aid of pnmers.
- 7 -
Processes for the amplification of nucleic acids serve the purpose of increasingthe number of copies of a given nucleic acid. Object of the process of the
invention is the amplification of a segment of a deoxylibonucleic acid. In
particular, this segment is not located at one of the two ends of the
deoxyribonucleic acid. However, it is understood that the present process can
be used to amplify several segments of a deoxyribonucleic acid which are
separated from each other or located adjacent to each other. The method of the
invention allows a great range of variation as regards both the position and
length of the segment. A preferred segment has a length of more than
25 nucleotides, particularly preferred is a length between 30 and
1000 nucleotides.
A process for amplifying nucleic acids as understood by the invention includes ~ ~ ~
also a process where the sequence information of a segment of a nucleic acid - -
A is amplified. Sequence information refers to the type and sequence of
nucleotide bases at the sugar phosphate residue of the nucleic acid. The
method of the invention is sequence-specific, i.e. it is possible to amplify only
certain sequences or nucleic acids by selecting the primer sequences and to
leaveotheravailablesequenceslargelyunamplified.
The deoxyribonucleic acid A to be amplified can be of any desired origin. It ~ -
can be isolated from organisms or be present in organisms, but may also be
chemically or enzymatically synthesized. Possible organisms include, for
example, viruses and bacteria, but also animal, vegetable, or human cells. It is,
however, understood that the present process can be used to amplify several
segments of a deo~ibonucleic acid which are separated from or adjacent to
one another, and both the position and the length of the segment may valy in
wide limits. A segment has a preferred length of more than 25 nucleotides, a
particularly preferred length is between 30 and 1000 nucleotides. The DNA
can be pretreated in various ways, which may also depend upon a possible
isolation from the organism. Extraction, concentration, amplification,
restriction, or cDNA formation are possible, but not necessary to implement
the steps of the method of dle invention.
2102~63
, ~
- 8 -
The deoxyribonucleic acid A can be present as strand A in a single stranded
form or as a double strand consisting of the strands A- and A+. If present as a
double strand, it must be converted into a single-stranded form in a procedural
step "a". The expert is familiar with the various ways of denaturing in order toachieve this. A preferred manner of conversion is thermal denatunng, i.e.
heating the sample to exceed the melting point of the deoxyribonucleic acid A.
If the sample to be analyzed contains only one strand of the deoxyribonucleic
acid A, said strand is subject to the amplification procedure. If both strands of
the segment of the deoxyribonucleic acid A to be amplified are present in the
sample, at least one of the two strands is amplified. The one strand of the
deoxyribonucleic acid A which is ultimately amplified is hereinaftèr referred
to as A-. Before the assay is started, a decision must be made as to which one
of the two strands of a double-stranded deoxyribonucleic acid A serves as the
basis for the method of the invention and is, hence, referred to as A-. Once
made, the decision cannot be reversed.
The references - and + are subsequently used to characterize nucleic acid
strands, in order to determine their orientation with respect to
complementarity. Strand A- is, for example, at least partially complementary
to strand A+. The - and + signs are not to be understood as references to a
possible translation. ~`
On a molecular basis, step a is followed by the reactions b - g. If these
reactions are not stopped, steps e - g subsequently occur again using ~e
respectively formed ribonucleic acid C+ one or several times. This requires the
addition of the primers Pl+, P2-, a DNA-directed RNA polymerase,
ribonucleotides, deoxyribonucleotides, and additives that serve to adjust the
conditions for steps b - d or b - g. To accomplish the object of the invention, it
is essential to add one or several of the reagents necessary to carry out steps c -
f already prior to or simultaneously with the formation of the nucleic acid B+.
These reagents include in particular the second primer P2-, a DNA-directed
RNA polymerase and ribonucleoside triphosphates. In processes known from
prior art, these reagents are only added after the fonnation of nucleic acid B+
and after denatuling the double strand of A- and B+.
2102~)3
.
In reaction b, a first primer Pl+ is hybridized with strand A- in a region PT1-.For this purpose, the first primer Pl+ has a nucleotide sequence PT1+ at its
3'-end. Said nucleotide sequence PT1+ is essentially complementary to
segment PT1- of strand A-, and under the given conditions, it can hybridize
with ~is segment. Especially at the 3'-end, the nucleotides are perfectly
complementary to the corresponding nucleotides in segment PTl-. In a
preferred manner, the 3'-end of the PTl- segment is separated from the 3'-end
of strand A- by a nucleotide sequence segment X-. This segment is at least 1,
preferably more than 5, and more particularly more than 30 nucleotides long,
and the nucleotides of segment Xl- are essentially not complementary to the
corresponding nucleotides on primer Pl+. This ensures that the 3'-end of
strand A- does not hybridize with primer P1+.
In addition to the nucleotide sequence PTl+, primer Pl+ contains in 5'
direction of PTl+ a nucleotide sequence PPl+, which corresponds to a strand
of the promoter sequence. This sequence is subsequently referred to as
promoter-containing. It turned out that the use of the sense strand of the
promoter sequence is preferred with respect to the sensitivity of the reaction.
Moreover, p~imer Pl+ can contain additional nucleotide sequences PXl+ 5' of
the sequence PTl+, preferably between sequence PTl+ and sequence PP1+. In
a preferred manner, the sequences PXl+ are not complementary to sequences
on strand A-. These may be enhancer sequences, for example.
In a preferred manner, primer Pl+ is extended by adding monodeoxyribo-
nucleotide units to the 3'-end of primer Pl+. Each of the mononucleotides
added is complementary to the corresponding nucleotide of strand A-. The
new segment formed by adding nucleotides is hereina~ter refeIred to as T+. Its
length depends on the ability of the enzyme used for the extension to catalyze
the formation of long nucleic acids. This ability of the enzyme also determines
the nucleotide sequence of the second primer P2-, for the sequence PT2- must
be selected such that it can hybridize with B+ within the T+ segment. PT2- is a -
segment which contains nucleotides that are complementary to the nucleotides
of segrnent T+. -
21~2'~63
- 10-
For both primers, a DNA polymerase is the enzyme used to extend the
primers. In a preferred manner, the polymerase for both primers is the same. A
particularly preferred enzyrne is reverse transcriptase as it accepts both RNA
as well as DNA single strands as templates.
In addition to the PT2- segment, prirner P2- may contain additional
nucleotides or segments, which are preferably linked to the 5'-end of PT2-.
The nucleotides at the 3'-end of PT2- are essentially complementary,
preferably exactly complementary to the corresponding nucleotides of the
PT2+ segment and correspond to the respective nucleotides of the A- strand.
The 5'-end of PT2- can be located inside or outside the 5'-end of A+.
The second prirner P2- is added to the reaction mixture preferably prior to or
simultaneously with the formation of the nucleic acid B+. The former case can
be realized by adding P2- together with P l+ to the mixture containing the A-
strand. In a preferred manner, there is no complete separation of the B- and A+
strands, i.e. no denaturing, especially no thermal denatDg after the addition
of Pl+, and in a particularly preferred manner, there is no denaturing between
the addition of P1+ and the extension of a second primer P2-.
Yet, primer P2- is extended to become a strand B- by using the B+ strand as
template, with nucleotide units being added to the 3'-end of P2-. This results in
a formation of a strand B-, which contains the segments PTl-, PXl-, and PPl-.
Together with the strand B+, strand B- forms a doubled-stranded nucleic acid,
which contains a functional promoter for a DNA-undirected RNA polymerase
as well as the sequences PT1 and PT2.
This nucleic acid is now transcribed into a ribonucleic acid C+ under the
conditions listed in the pnor art publication EP-A-O 329 822. Subsequently, a
strand D'- is formed which is essentially complementaIy to strand C+. This
D'- strand serves as a template for the formation of a strand D, resulting in the
fonnation of a new nucleic acid, which contains a functional promoter and the
segrnents PTl and PT2 as does the hybrid consisting of B- and B+. A strand
D- is forrned from the interrnediate strand D'- by extending the latter at the
3'-end with the aid of Pl+ as a template. The result is a system in which the
number of the nucleic acids C+, D'-, D- and D+ forrned in the reaction
21V2')63
sequence is amplified. Provided a release of the deoxyribonucleic acid D'- is
realized by digestion with RNAase H, a system will result which can operate
at an almost constant temperature, i.e. no operation in temperature cycles. In apreferred case, the enzyme for step e) is the same as the one used for step b).
A particularly preferred enzyme is reverse transcriptase.
An advantage of the method of the invention is that a complete denaturing of
deoxyribonucleic acid double strands is not necessary after the single-stranded
nucleic acid A- is obtained. This means less operational steps and saving
instruments to implement the temperature increase/decrease, or saving at least
one reagent addition step when chemicals are used for the denaturing
procedure. Note that in the detection of nucleic acids as they are present in
samples in only minute amounts, it is crucial to avoid contamioation. For this
reason, it is desirable to open the reaction vessel as rarely as possible. In the
present case, all reagents necessary for the amplification can be added to the ~ ;
prepared sample mixture together with the single-stranded nucleic acid A-.
Then, the reagent vessel must not be opened again until the resulting nucleic
acid products C+, D-, or D+ are either removed or taken out for further
processing. Moreover, it is an advantage of the method of the invention that - ;
only very small reagent volumes are added when all reagents are added at once
such that the sample liquid is diluted to a much smaller extent than in prior art ~ -
processes. This renders the method of the invention much more sensitive as it
were the case with sequential addition of reagent and intermediate denaturing.
Another advantage of the method of the invention is the use of nucleic acids -
A- witnout requiring pretreatment by means of restriction enzymes. This also ; -
allows the amplification of the segments of genomic DNA in a simple maoner.
Note that since the restriction step is no longer necessary, the following
purification of the nucleic acids to remove possibly present restriction
enzymes is no longer necessary.
Yet another advantage is that there is no time delay waiting for the formation
of cDNA from the analyte DNA to occur which brings about considerable
process advantages even when automated systems are used. -
2I 0~963
- 12-
The simultaneous addition of all reagents necessary for the amplification
includes advantages with respect to the final volume of the amplification
mixture (dilution effect, smaller volurnes are possible) and for the handling
(pipetting errors). Moreover, it is advantageous to add the primers Pl+ and P2-
in equal amounts. This can be accomplished in a particularly simple and
reproducible manner in one single addition step. The method of the invention
is particularly suited for the amplification and the detection of parts of
chromosomal DNA.
Analogous to US-A-4 683 202, the method of the invention can also be used in
connection with the variant where so-called "nested" primers are employed. In ~
this case, the preamplification according to the invention is followed by the ~ -
use of one or two primers whose target-specific sequences are within the
amplified segment. This increases the selectivity of the amplification.
Another subject matter of the invention is a method for the detection of
deoxyribonucleic acids A by completing steps a to g (if desired steps e-g
several times) of the method according to claim 1 and detection of the formed
nucleic acid C+, D'-, D-, or D+ or hybrids thereo The implementation of the
method according to clairn 1 leads to an increased formation of nucleic acids
C+~ D'-, D-, D+, and hybrids thereof. The method of the invention for the
detection of nucleic acids makes use of at least one of the so-forrned formed
nucleic acids to deterrnine the presence or the amount of deoxyribonucleic
acid A in the sample. While caIIying out steps a - g as indicated in claim 1, the
detection of the ~ormed nucleic acids C+, D'-, D-, D+, or hybrids thereof can
be carried out in a known manner. In ~is case, one or several of the reagents
for calIying out steps c - f are added to the reaction mixture already prior to or
simultaneously with the formation of nucleic acid B+, or there is no complete
separation of B- from A+ between steps a and b. Such known steps include,
for example, the hybridization of the above-listed nucleic acids with a labeled
nucleic acid probe and detec~ng ~e ~ormed hybrid, e.g. according to
US-A-4,58 1,333 or EP-A-0 079 139. When detecting the hybrids of the
nucleic acids C+, D- and D+, these nucleic acids must be converted into single
strands prior to hybridizing with a single-stranded probe.
~ 2102g63
- 13-
In a particularly preferred embodiment of the method of the invention, step d)
includes the incorporation of a label into the ribonucleic acid C+ by means of
a labeled ribonucleoside triphosphate. The label can be either a detectable or
an immobilizable group. In this case, the formed nucleic acid C can be
detected either directly or after immobilization to a solid phase.
Also subject matter of the invention are reagent kits for the above-listed
methods. These kits contain
- a description of a method according to claim l; -
- a container 1 with an enzyme mixb~re containing an RNA polymerase, a
container 2 containing two primers with opposite senses, one of which
contains at least one promoter sequence, and containing an enzyme with -
reverse transcriptase activity; further, a container 3 containing
deo~ibonucleotides and ribonucleotides as well as the necessary
additives in one or several suitable containers while the contents of one of
several containers may be combined in one;
- a packaging.
Moreover, a reagent kit for the detection of deoxyribonucleic acid A
preferably comes with a container with a labeled nucleic acid probe S.
Yet, another subject matter of the invention is a set o oligonucleotides for the
detection of bacteria of the ~amily Listeria containing at least two Listeria-
specific primers 1 and 2, which essentially do not hybridize with themselves
under the conditions applying to the hybridization of oligonucleotides with the
nucleic acids from Listeria. The primers are such that the extension product of
the one primer can serve as a template for the extension of the second primer.
Such a set may, for example, consi~t of oligonucleotides which contain
nucleotide sequences that are to at least 90 /0, preferably 95 % homologous to
~e Listeria-specif;c sequences of the SEQ ID NO 1-2 and 1-3 and have a
length between 10 and 30 nucleotides, preferably between 15-25 nucleotides.
In a particularly preferred manner, the oligonucleotides have an identical
l4 ~2~63
length or are longer than the Listeria-specific segments of the oligonucleotidesof the SEQ ID NO. 1-2 or 1-3.
The preferred distance of the 3'-ends of the primer facing each other with
respect to the position of the corresponding nucleotides on the Listeria genome
are 20 to 500, particularly preferred is a distance of 100 to 350 nucleotides.
One or several primers (preferably at their 5'-ends), as well as the probe may - -
have additional nucleotides which are not Listeria-specific. Such nucleotides
may serve in the detection of the extension products. Suitable nucleotides are,
for example, promoter sequences (particularly for the primers in case of a
transcription amplification according to the method of the invention), or
nucleotide sequences which can hybridize to other, non-Listeria-specific
nucleic acids for the purpose of detection or immobilization.
Under tne hybridization conditions of the primer elongation, the primers are
specific for Listeria or preferably a species of Listeria (preferably
L. monocytogenes). In a preferred manner, the probe is rendered specific for
Listeria monocytogenes by using a DNA polymerase. In a particularly
preferred manner, the probe carries a label which allows immobilization to
occur.
The positions of the Listeria monocytogenes DNA to which the Listeria-
specific segments of the primers hybridize also allows another definition of theListeria primers. The following data refers to the sequence of the plasmid
pPLM 63 of WO 90/08197.
; . . .. . _ .
Position
_ ._
Primer 1 35 - 56
Primer 2 196 - 216
Probe S 162 - 180
Pl+ is the preferred primer 1, P2- is the preferred primer 2, and NAS 4 is the
preferred probe.
21 0~.g63
- 15-
The set of oligonucleotides of the invention allows a partisularly specific
amplification/detection of Listeria DN~. A method, primer, or probe is
referred to as specific, if detection of Listeria, especially Listeria
monocytogenes is possible without detecting nucleic acids from other
microorganisms which may occur in the sample to be examined.
Figure 1 is a representation of the reference numerals used in the description.
Figure la) is a diagrammatic representation of a hybrid of A- and Pl+ as it
will form after adding Pl+ to A- to generate an extension of Pl+ (arrow).
Figure lb) is a diagrammatic representation of the s~ucture of primer Pl+.
Figure lc) is a diagrammatic representation of the structure of B+, where the
extension direction of P2- is also indicated.
Figure ld) is a diagrammatic representation of the structure of B-.
Figure le) is a diagramrnatic representation of the structure of C+.
Figure lf) is a diagrammatic representation of the structure of D'-.
Figure lg) is a diagrammatic representation of the structure of the hybrids of
D+ and D-.
Figure 2 is a diagranunatic representation of a particularly preferred variant of
the method of the invention where all the reagents are added after the
denaturing of A.
Figure 3 shows a variant of the method of the invention where all the reagents
are added prior to step b), except for those necessary for the transcription. ~-
Figure 4 shows a variant where only NTPs and, if desired, RNAse H are added
after step b.
Figure S shows a variant where Pl+, P2- and nucleoside triphosphates are
added prior to or during the denaturing process of the DNA A, but where the
enzymes are added after step a, but prior to step b. -;
~ 2102963
- 16-
Figure 6 is a diagrammatic representation of the PIII/dthl4/dthl8 region of the
Listeria monocytogenes chromosomes and also shows the position of the
primer Pl+ (SEQ ID NO 1), P2- (SEQ ~D NO 2), as well as the capture probe
S (NAS 4) (SEQ ID NO 3) (all specific for L. monocytogenes).
Figure 7 shows an autoradiogram of the amplification products where the
products are separated according to size by agarose gel electrophoresis, then
blotted onto a nylon membrane and detected with a digoxigenin-labeled
oligonucleotide probe. The amplified ribonucleic acid C+ runs as a product
with a length of 181 nt. M refers to the molecule weight label. Lanes 1-9 carry
different amounts of chromosomal Listeria DNA (lane 1 50 ng, lane 2 5 ng,
lane 3 500 pg, lane 4 50 pg, lane 5 5 pg, lane 6 500 fg, lane 7 50 fg, lane 8
5 fg, lane 9 no chromosomal Listeria DNA).
The following examples explain the invention in greater detail:
Example 1
Oligonucleotides
The oligonucleotides of the sequences ID NO 1, 2, and 3 were produced with
the aid of a DNA synthesizer (Applied Biosystems) from unmodified and/or
digoxigenated mononucleotides (EP-A-O 324 474).
Denaturing chromosomal DNA
The denaturing reaction was allowed to occur in a volume of 16 ,~IL The
reaction mixture was composed as follows:
62.5 mM Tris-HCI, pH 8.5;
78.12S mM KCI;
17.75 mM MgC12;
1.5625 mM per dNTP (Pharmacia);
3.125 mM per NTP (Pharmacia) and 50 ng to 5 fg purified chromosomal DNA
of Listeria monocytogenes.
2102')63
- 17-
The reaction mixture was allowed to boil for 15 min and then immediately
cooled on ice.
Amplifving denatured chromosomal DNA
The amplification reaction was allowed to occur in a volume of 25 ~11 in an
Eppendorf vessel. For this reaction to occur, 9 1ll of a second mixture,
consisting of DTT, DMSO, primer Pl+ and Pl-, RNasin, RNase H, T7 RNA
polymerase, AMV reverse transcriptase, and BSA (all enzymes and BSA by
Boehringer Mannheim) was added to the denaturing tlux such that the final
concentration of the amplification mixture was as follows:
40 rnM Tris-HCI, pH 8.5;
50mMKCI;
12 mM MgClz;
10 mM DTT;
15 % DMSO;
0.2 ',lM primer Pl+;
0.2 ~,lM prirner Pl-;
1 mM per dNTP;
2 mM per NTP;
12.5 URNasin;
80 U T7 RNA polymerase;
4 U AMV reverse transcriptase; - -1 U RNase H and 0.1 ~,lg/lll BSA.
Then the reaction vessel was clo~ed and not opened again until the
amplification procedure was stopped. The reaction was allowed to occur for -~
90 min at 40C and finally stopped by adding 25 % formamide and heating it
up to 65 for 10 min.
Detection of the amplificates ;
a) Gel electrophoresis
15 ~ll of the above-listed reaction mixture containing the amplified nucleic
acids were added onto an 1.2 % agarose gel (according to Maniatis, T.,
- :` 21~2963
- 1 8 -
E.F. Fritsch and J. Sambrook, 1990. Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York),
then subject to electrophoresis (lO0 V, 3 h), and subsequently plotted onto
a nylon membrane (Boehringer Mannheim) in a vacuum blot apparatus
(manufactured by Phannacia).
b) Hybridization
The membrane was prehybridized for 1 h at 45C in 5 x SSC, 1 % blocking
reagent (Boehringer Mannheim), 0.1 % n-lauryl sarcosin (sodium salt) and
0.02 ~O SDS. For the hybridization procedure to occur, the membrane was
incubated overnight at 45C with 100 ng digoxigenin-labeled Nas 4-probe
per ml hybridization solution (see above).
Non-specifically bound probe was washed out as follows: ;
2 x with 2 x SSC; 0.2 % SDS at 20C
2 x with 0.1 x SSC; 0.1 % SDS at 45C
c) Detection
After incubation with aLtcaline phosphatase-labeled anti-digoxigenin
antibodies, the amplificates hybridized with digoxigenin-labeled NAS 4
probe were chemiluminometrically visualized with AMPPD (filrther details
see DIG Luminescent Detection Kit, Boehringer Mannheim, Cat. No.
1363514).
Using a a Polaroid b/w film, the membrane was subject to a 5 min
exposure. The result can be seen in Figure 7.
-" 2102963
- 19-
SEQUENCE LISTlNG
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Boehringer Mannheim GmbH
(B) STREET: Sandhoferstr. 116
(C) CITY: Mannheim
(E) COUNTRY: DE
(F) POSTAL CODE ~ZIP):68298
(G) TELEPHONE: 0621-759-4348
(H) TELEFAX: 0621-7S9-4457
(ii) TITLE OF INVENTION: Simple nucleic acid amplification process
(iii) N~IBER OF SEQUENCES: 3
(iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patent~n Release #1.0, Version #1.25 (EPO)
(2) INFORMATIQN FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS~
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single ~ ~ ::~. -
(D)TOPOLOGY: linear ;~
(ii)MOLECULETYPE: cDNA
. ~.
- .
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
AATTCTAATACGACTCACTATAGGGAGA 28
'
.
:~`` 2102~63
- 20 -
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
GTAATCATCC GAAACCGCTC A 21
(2) lNFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii)MOLECULETYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
CGTTTTACTT CTTGGACCG 19
