Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
U4 PRESENTS PARTiE DE CETTE DEMANDS OU CE BREVET
COMPREND PLUS D'UN TOME.
CSC! EST LE TOME ~ l DE
NOTE: Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
~ c~ sz~~
JUMBO APPLlCATIONS/PATENTS
THIS SECTION OF THE APPL1CAT10NlPATENT CONTAINS MORE
'THAN ONE VOLUME
. THtS 1S VOLUME ~ OF
NOTE: For additional volumes please contact the Canadian Patent Office
CA 02105277 2003-10-O1
77396-25
1
GENETTCALLY ENGINEERED VACCINE STRAIN
MELD OF THB INVENTION
The present invention relates to a modified poxvirus
and to methods of making and using the same. More in
particular, the invention relates to improved vectors for
the insertion and expression of foreign genes for use as
safe immunization vehicles to protect against a variety of
pathogens.
Several publications are referenced in this
application. Full citation to these references is found at
the end of the specification immediately preceding the
claims or where the publication is mentioned. These
publications relate to the art to which this invention
pertains.
8AC1CGROUND OF THF INVENTIOld
Vaccinia virus and more recently other poxviruses have
been used for the insertion and expression of foreign genes.
The basic technique of inserting foreign genes into live
infectious poxvirus involves recombination between pox DNA
sequences flanking a foreign genetic element in a donor
plasmid and homologous sequences present in the rescuing
poxvirus (Piccini et al., 1987).
specifically, the recombinant poxviruses are
constructed in two steps known in the art and analogous to
the methods for creating synthetic recombinants of the
vaccinia virus described in U.S. Patent Nos. 4,769,330,
4,772,848, and 4,603,112.
CA 02105277 2003-10-O1
77396-25
2
First, the DNA gene sequence to be inserted into the
virus, particularly an open reading frame from a non-pox
source, is placed into an E. coli plasmid construct into
which DNA homologous to a section of DNA of the poxvirus has
been inserted. Separately, the DNA gene sequence to be
inserted is ligated to a promoter. The promoter-gene
linkage is positioned in the plasmid construct so that the
promoter-gene linkage is flanked on both ends by DNA
homologous to a DNA sequence flanking a region of pox DNA
containing a nonessential locus. The resulting plasmid
construct is then amplified by growth within E. cola
bacteria. (Clewell, 1972) and isolated (Clewell et al., 1969;
Maniatis et al., 1982).
Second, the isolated plasmid containing the DNA gene
sequence to be inserted is transfected into a cell culture,
e.g. chick embryo fibroblasts, along with the poxvirus.
Recombination between homologous pox DNA in the plasmid and
the viral genome respectively gives a poxvirus modified by
the presence, in a nonessential region of its genome, of
foreign DNA sequences. The term "foreign" DNA designates
exogenous DNA, particularly DNA from a non-pox source, that
codes for gene products not ordinarily produced by the
genome into which the exogenous DNA is placed.
Genetic recombination is in general the exchange of
homologous sections of DNA between two strands of DNA. In
certain viruses RNA may replace DNA. Homologous sections of
nucleic acid are sections of nucleic acid (DNA or RNA) which
have the same sequence of nucleotide bases.
Genetic recombination may take place naturally during
the replication or manufacture of new viral genomes within
the infected host cell. Thus, genetic recombination between
viral genes may occur during the viral replication cycle
that takes place in a host cell which is co-infected with
two or more different viruses or other genetic constructs.
A section of DNA from a first genome is used- interchangeably
in constructing the section of the genome of a second co-
.~ a ; _f r~~
~'~'O 92/1672 ~, 1 ~ ~ ~; ~ ~ PCf/US92/O1906
-3-
infecting virus in which the DNA is homologous with that of
the first viral genome.
However, recombination can also take place between
sections of DNA in different genomes that are not perfectly
homologous. If one such section is from a first genome
homologous with a section of another genome except for the
presence within the first section of, for example, a genetic
marker or a gene coding for an antigenic determinant
inserted into a portion of the homologous DNA, recombination
can still take place and the products of that recombination
are then detectable by the presence of that genetic marker
or gene in the recombinant viral genome.
Successful expression of the inserted DNA genetic
sequence by the modified infectious virus requires two
conditions. First, the insertion must be into a
nonessential region of the virus in order that the modified
virus remain viable. The second condition for expression of
inserted DNA is the presence of a promoter in the proper
relationship to the inserted DNA. The promoter must be
placed so that it is located upstream from the DNA sequence
to be expressed.
Vaccinia virus has been used successfully to immunize
against smallpox, culminating in the worldwide eradication
of smallpox in 1980.. In the course of its history, many
strains of vaccinia have arisen. These different strains
demonstrate varying immunogenicity and are implicated to
varying degrees with potential complications, the most
serious of which are post-vaccinial encephalitis and
generalized vaccinia (Behbehani, 1983).
With the eradication of smallpox, a new role for
vaccinia became important, that of a genetically engineered
vector for the expression of foreign genes. Genes encoding
'a vast number of heterologous antigens have been expressed
in vaccinia, often resulting in protective immunity against
challenge by the corresponding pathogen (reviewed in
Tartaglia et al., 1990a).
The genetic background of the vaccinia vector has been
shown to affect the protective efficacy of the expressed
foreign immunogen. For example, expression of Epstein Barr
~1~;~~ ~ ~
V1'O 92/1672 PCT/US92/01906
.six
-4-
Virus (EBV) gp340 in the Wyeth vaccine strain of vaccinia
virus did not protect cottontop tamarins against EBV virus
induced lymphoma, while expression of the same gene in the
WR laboratory strain of vaccinia virus was protective
(Morgan et al., 1988).
A fine balance between the efficacy and the safety of a
vaccinia virus-based recombinant vaccine candidate is .
extremely important. The recombinant virus must present the
immunogen(s) in a manner that elicits a protective immune
response in the vaccinated animal but lacks any significant
pathogenic properties. Therefore attenuation of the vector
strain would be a highly desirable advance over the current
state of technology.
A number of vaccinia genes have been identified which
are non-essential for growth of the virus in tissue culture
and whose deletion or inactivation reduces virulence in a
variety of animal systems.
The gene encoding the vaccinia virus thymidine kinase
(TK) has been mapped (Hruby et al., 1982) and sequenced
(Hruby et al., 1983; Weir et al., 1983). Inactivation or
complete deletion of the thymidine kinase gene does not
prevent growth of vaccinia virus in a wide variety of cells
in tissue culture. TK- vaccinia virus is also capable of
replication in vivo at the site of inoculation in a variety
of hosts by a variety of routes.
It has been shown for herpes simplex virus type 2 that
intravaginal inoculation of guinea pigs with TK- virus
resulted in significantly lower virus titers in the spinal
cord than did inoculation with TK+ virus (Stanberry et al.,
1985). It has been demonstrated that herpesvirus encoded TK
activity in vitro was not important for virus growth in
actively metabolizing cells, but was required for virus
growth in quiescent cells (Jamieson et al., 1974).
Attenuation of TK- vaccinia has been shown in mice
inoculated by the intracerebral and intraperitoneal routes
(Buller et al., 1985). Attenuation was observed both for
the WR neurovirulent laboratory strain and for the Wyeth
vaccine strain. In, mice inoculated by the intradermal
route, TK- recombinant vaccinia generated equivalent anti-
VVO 92/1672 -~ ~ ~ ~ ~ ~ PCT/US92/01906
vaccinia neutralizing antibodies as compared with the
parental TK+ vaccinia virus, indicating that in this test
system the loss of TK function does not significantly
decrease immunogenicity of the vaccinia virus vector.
Following intranasal inoculation of mice with TK- and TK+
recombinant vaccinia virus (WR strain), significantly less
dissemination of virus to other locations, including the
brain, has been found (Taylor et al., 1991a).
Another enzyme involved with nucleotide metabolism is
ribonucleotide reductase. Loss of virally encoded
ribonucleotide reductase activity in herpes simplex virus
(HSV) by deletion of the gene encoding the large subunit was
shown to have no effect on viral growth and DNA synthesis in
dividing cells in vitro, but severely compromised the
ability of the virus to grow on serum starved cells
(Goldstein et al., 1988). Using a mouse model for acute HSV
infection of the eye and reactivatable latent infection in
the trigeminal ganglia, reduced virulence was demonstrated
for HSV deleted of the large subunit of ribonucleotide
reductase, compared to the virulence exhibited by wild type
HSV (Jacobson et al., 1989).
Both the small (Slabaugh et al., 1988) and large
(Schmitt et al., 1988) subunits of ribonucleotide reductase
have been identified in vaccinia virus. Insertional
inactivation of the large subunit of ribonucleotide
reductase in the WR strain of vaccinia virus leads to
attenuation of the virus as measured by intracranial
inoculation of mice (Child et al., 1990).
The vaccinia virus hemagglutinin gene (HA) has been
mapped and sequenced (Shida, 1986). The HA gene of vaccinia
virus is nonessential for growth in tissue culture
(Ichihashi et al., 1971). Inactivation of the HA gene of
vaccinia virus results in reduced neurovirulence in rabbits
inoculated by the intracranial route and smaller lesions in
rabbits at the site of intradermal inoculation (Shida et
al., 1988). The HA locus was used for the insertion of
foreign genes in the WR strain (Shida et al., 1987),
derivatives of the Lister strain (Shida et al., 1988) and
the Copenhagen strain (Guo et al., 1989) of vaccinia virus.
WO 92/15672 PCT/US92/01906 ...
_6_
Recombinant HA- vaccinia virus expressing foreign genes have
been~shown to be immunogenic (Guo et al., 1989; Itamura et
al., 1990; Shida et al., 1988; Shida et al., 1987) and
protective against challenge by the relevant pathogen (Guo
et al., 1989; Shida et al., 1987).
Cowpox virus (Brighton red strain) produces red
(hemorrhagic) pocks on the chorioallantoic membrane of
chicken eggs. Spontaneous deletions within the cowpox
genome generate mutants which produce white pocks (Pickup et
al., 1984). The hemorrhagic function (u) maps to a 38 kDa
protein encoded by an early gene (Pickup et al., 1986).
This gene, which has homology to serine protease inhibitors,
has been shown to inhibit the host inflammatory response to
cowpox virus (Palumbo et al., 1989) and is an inhibitor of
blood coagulation.
The a gene is present in WR strain of vaccinia virus
(Kotwal et al., 1989b). Mice inoculated with a WR vaccinia
virus recombinant in which the a region has been inactivated,
by insertion of a foreign gene produce higher antibody
levels to the foreign gene product compared to mice
inoculated with a similar recombinant vaccinia virus in
which the a gene is intact (Zhou et al., 1990). The a
region is present in a defective nonfunctional form in
Copenhagen strain of vaccinia virus (open reading frames B13
and B14 by the terminology reported in Goebel et al.,
1990a,b).
Cowpox virus is localized in infected cells in
cytoplasmic A type inclusion bodies (ATI) (Kato et al.,
1959). The function of ATI is thought to be the protection
of cowpox virus virions during dissemination from animal to
animal (Bergoin et al., 1971). The ATI region of the cowpox
genome encodes a 160 kDa protein which forms the matrix of
the ATI bodies (Funahashi et al., 1988; Patel et al., 1987).
Vaccinia virus, though containing a homologous region in its
genome, generally does not produce ATI. In WR strain of
vaccinia, the ATI region of the genome is translated as a 94
kDa protein (Patel et al., 1988). In Copenhagen strain of
vaccinia virus, most of the DNA sequences corresponding to,
the ATI region are deleted, with the remaining 3'_end of the
vV0 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
_7_
region fused with sequences upstream from the ATI region to
form~open reading frame (ORF) A26L (Goebel et al., 1990a,b).
A variety of spontaneous (Altenburger et al., 1989;
Drillien et al., 1981; Lai et al., 1989; Moss et al., 1981;
Paez et al., 1985; Panicali et al., 1981) and engineered
(Perkus et al., 1991; Perkus et al., 1989; Perkus et al.,
1986) deletions have been reported near the left end of the
vaccinia virus genome. A WR strain of vaccinia virus with a
kb spontaneous deletion (Moss et al., 1981; Panicali et
al., 1981) was shown to be attenuated by intracranial
inoculation in mice (Buller et al., 1985). This deletion
was later shown to include 17 potential ORFs (Kotwal et al.,
1988b). Specific genes within the deleted region include
the virokine N1L and a 35 kDa protein (C3L, by the
terminology reported in Goebel et al., 1990a,b).
Insertional inactivation of N1L reduces virulence by
intracranial inoculation for both normal and nude mice
(Kotwal et al., 1989a). The 35 kDa protein is secreted like
N1L into the medium of vaccinia virus infected cells. The
protein contains homology to the family of complement
control proteins, particularly the complement 4B binding
protein (C4bp) (Kotwal et al., 1988a). Like the cellular
C4bp, the vaccinia 35 kDa protein binds the fourth component
of complement and inhibits the classical complement cascade
(Kotwal et al., 1990). Thus the vaccinia 35 kDa protein
appears to be involved in aiding the virus in evading host
defense mechanisms.
The left end of the vaccinia genome includes two genes
which have been identified as host range genes, KiL (Gillard
et al., 1986) and C7L (Perkus et al., 1990). Deletion of
both of these genes reduces the ability of vaccinia virus to
grow on a variety of human cell lines (Perkus et al., 1990).
Fowlpox virus (FPV) is the prototypic virus of the
Avipox genus of the Poxvirus family. The virus causes an
economically important disease of poultry which has been
well controlled since the 1920's by the use of live
attenuated vaccines. Replication of the avipox viruses is
limited to avian species (Matthews, 1982b) and there are no
reports in the literature of the virus causing a productive
~~t~~~~ ~ 7
WO 92/15672 PCT/US92/01906
_8_
infection in any non-avian species including man. This host
restriction provides an inherent safety barrier to
transmission of the virus to other species and makes use of
FPV as a vaccine vector in poultry an attractive
proposition.
FPV has been used advantageously as a vector expressing
antigens from poultry pathogens. The hemagglutinin protein .
of a virulent avian influenza virus was expressed in an FPV
recombinant (Taylor et al., 1988a). After inoculation of
the recombinant into chickens and turkeys, an immune
response was induced which was protective against either a
homologous or a heterologous virulent influenza virus
challenge (Taylor et al., 1988a). FPV recombinants
expressing the surface glycoproteins of Newcastle Disease
Virus have also been developed (Taylor et al., 1990; Edbauer
et al., 1990).
The use of live attenuated vectored vaccines present a
number of potential advantages. The vaccines are
inexpensive to produce and a number of poultry pathogens can
potentially be incorporated into one vector. The immunogen
is presented to the immune system in an authentic manner
such that both humoral and cell mediated responses can be
invoked. Because the disease agent is not replicating, side
effects of vaccination are minimal and the continual re-
introduction of the disease agent into the environment is
eliminated.
It can be appreciated that provision of a novel vaccine
strains having enhanced safety would be a highly desirable
advance over the current state of technology. For instance,
so as to provide safer vaccines or safer products from the
expression of a gene or genes by a virus.
OBJECTS OF THE INVENTION
It is therefore an object of this invention to provide
modified recombinant viruses, which viruses have enhanced
safety, and to provide a method of making such recombinant
viruses.
It is an additional object of this invention to provide
a recombinant poxvirus vaccine having an increased level of
safety compared to known recombinant poxvirus vaccines.
WO 92/1672 ~ ~ ~ ~ ~ ~ ~ PC('/US92/01906
-9-
It is a further object of this invention to provide a
modified vector for expressing a gene product in a host,
wherein the vector is modified so that it has attenuated
virulence in the host.
It is another object of this invention to provide a
method for expressing a gene product in a cell cultured in
vitro using a modified recombinant virus or modified vector
having an increased level of safety.
These and other objects and advantages of the present
invention will become more readily apparent after
consideration of the following.
STATEMENT OF THE INVENTION
In one aspect, the present invention relates to a
modified recombinant virus having inactivated virus-encoded
genetic functions so that the recombinant virus has
attenuated virulence and enhanced safety. The functions can
be non-essential, or associated with virulence. The virus
is advantageously a poxvirus, particularly a vaccinia virus
or an avipox virus, such as fowlpox virus and canarypox
virus.
In another aspect, the present invention relates to a
vaccine for inducing an immunological response in a host
animal inoculated with the vaccine, said vaccine including a
carrier and a modified recombinant virus having inactivated
nonessential virus-encoded genetic functions so that the
recombinant virus has attenuated virulence and enhanced
safety. The virus used in the vaccine according to the
present invention is advantageously a poxvirus, particularly
a vaccinia virus or an avipox virus, such as fowlpox virus
and canarypox virus.
In yet another aspect, the present invention relates to
an immunogenic composition containing a modified recombinant
virus having inactivated nonessential virus-encoded genetic
functions so that the recombinant virus has attenuated
virulence and enhanced safety. The modified recombinant
virus includes, within a non-essential~region of the virus
genome, a heterologous DNA sequence which encodes an
antigenic protein derived from a pathogen wherein the
composition, when administered to a host, is capable of
CA 02105277 2006-06-07
77396-25
-10-
inducing an immunological response specific to the protein
encoded by the pathogen.
In a further aspect, the present invention relates
to a method for expressing a gene product in a cell cultured
in vitro by introducing into the cell a modified recombinant
virus having attenuated virulence and enhanced safety.
In a still further aspect, the present invention
relates to a modified recombinant virus having nonessential
virus-encoded genetic functions inactivated therein so that
the virus has attenuated virulence, and wherein the modified
recombinant virus further contains DNA from a heterologous
source in a nonessential region of the virus genome. In
particular, the genetic functions are inactivated by
deleting an open reading frame encoding a virulence factor
or by utilizing naturally host restricted viruses. The
virus used according to the present invention is
advantageously a poxvirus, particularly a vaccinia virus or
an avipox virus, such as fowlpox virus and canarypox virus.
Advantageously, the open reading frame is selected from the
group consisting of J2R, B13R + B14R, A26L, A56R, C7L - K1L,
and I4L (by the terminology reported in Goebel et al.,
1990a,b). In this respect, the open reading frame comprises
a thymidine kinase gene, a hemorrhagic region, an A type
inclusion body region, a hemagglutinin gene, a host range
gene region or a large subunit, ribonucleotide reductase.
According to yet another aspect of the present
invention, there is provided a recombinant vaccinia virus
having attenuated virulence and (a) having the genetic
functions encoded by the regions C7L-K1L, J2R, B13R+B14R,
A26L, A56R and I4L inactivated, or (b) having the open
reading frames for the host range gene region, the thymidine
kinase gene, the hemorrhagic region, the A type inclusion
CA 02105277 2006-06-07
77396-25
-10a-
body region, the hemagglutinin gene, and the large subunit,
ribonucleotide reductase inactivated.
According to a further aspect of the present
invention, there is provided a poxvirus having attenuated
virulence, and (a) having the genetic functions encoded by
regions C7L-K1L, J2R, B13R+B14R, A26L, A56R and I4L
inactivated, or (b) having the open reading frames for the
host range gene region, the thymidine kinase gene, the
hemorrhagic region, the A type inclusion body region, the
hemagglutinin gene, and the large subunit, ribonucleotide
reductase inactivated; said poxvirus being vaccinia and
comprising exogenous DNA from a non-poxvirus source, wherein
the exogeneous DNA is inserted by recombination in a
nonessential region of the poxvirus genome.
According to still a further aspect of the present
invention, there is provided a vaccine for inducing an
immunological response in a host animal inoculated with the
vaccine, said vaccine comprising a carrier and the
recombinant virus as described herein.
According to another aspect of the present
invention, there is provided a vaccine for inducing an
immunological response in a human inoculated with the
vaccine, said vaccine comprising a carrier and the
recombinant virus as described herein.
According to yet another aspect of the present
invention, there is provided a method for expressing a gene
product in a cell cultured in vitro, which method comprises
introducing into the cell the modified recombinant virus as
described herein.
CA 02105277 2006-06-07
77396-25
-lOb-
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description, given by way
of example, but not intended to limit the invention solely
to the specific embodiments described, may best be
understood in conjunction with the accompanying drawings, in
which:
FIG. 1 schematically shows a method for the
construction of plasmid pSD460 for deletion of thymidine
kinase gene and generation of recombinant vaccinia virus
vP410;
FIG. 2 schematically shows a method for the
construction of plasmid pSD486 for deletion of hemorrhagic
region and generation of recombinant vaccinia virus vP553;
~?1'O 92/15672
-~ ~ d ~ ~ ~ PCf/1JS92/01906
-11-
FIG. 3 schematically shows a method for the
construction of plasmid pMP494~ for deletion of ATI region
and generation of recombinant vaccinia virus vP618;
FIG. 4 schematically shows a method for the
construction of plasmid pSD467 for deletion of hemagglutinin
gene and generation of recombinant vaccinia virus vP723;
FIG. 5 schematically shows a method for the
construction of plasmid pMPCSKl~ for deletion of gene
cluster [C7L - K1L] and generation of recombinant vaccinia
virus vP804;
FIG. 6 schematically shows a method for the
construction of plasmid pSD548 for deletion of large
subunit, ribonucleotide reductase and generation of
recombinant
vaccinia virus vP866 (NYVAC);
FIG. 7 schematically shows a method for the
construction of plasmid pRW842 for insertion of rabies
glycoprotein G gene into the TK deletion locus and
generation of recombinant vaccinia virus vP879;
FIG. 8 is a map of the EBV coding regions inserted into
EBV Triple.l plasmid;
FIG. 9 shows the DNA sequence (SEQ ID N0:213) of the
synthetic spsAg gene and modified synthetic vaccinia virus
H6 early/late promoter with the predicted amino acid
sequence (SEQ ID N0:214);
FIG. 10 schematically shows a method for the
construction of recombinant vaccinia virus vP856;
FIG. 11 shows the DNA sequence (SEQ ID N0:215) of the a
promoter/lpsAg gene with the predicted amino acid sequence
(SEQ ID N0:216);
FIG. 12 schematically shows a method for the
construction of recombinant vaccinia virus vP896;
FIG. 13 shows the DNA sequence (SEQ ID N0:87) of the
I3L promoter/S12/core gene with the predicted amino acid
sequence (SEQ ID N0:217);
FIG. 14 schematically shows a method for the
construction of recombinant vaccinia virus vP919;
w 1 t! U r. S
WO 92/15672 PCT/US92/01906
~:,,
-12-
FIG. 15 shows the DNA sequence (SEQ ID N0:218) of the
EPV 42 kDa promoter/lpsAg gene with the predicted amino acid
sequence (SEQ ID N0:219);
FIG. 16 shows the DNA sequence (SEQ ID N0:217) of a
canarypox PvuII fragment containing the C5 ORF.
FIG. 17 schematically shows a method for the
construction of recombinant canarypox virus vCP65 (ALVAC-
RG ) ;
FIG. 18 is a schematic of the JEV coding regions
inserted in the vaccinia viruses vP555, vP825, vP908, vP923,
vP857 and vP864;
FIG. 19 is a schematic of the YF coding regions
inserted in the vaccinia viruses vP766, vP764, vP869, vP729
and vP725;
FIG. 20 is a schematic of the DEN coding regions
inserted in the vaccinia viruses vP867, vP962 and vP955;
FIG. 21 shows the nucleotide sequence (SEQ ID N0:221)
of a 3661 base pair fragment of TROVAC DNA containing the F8
ORF;
FIG. 22 shows the DNA sequence (SEQ ID N0:222) of a
2356 base pair fragment of TROVAC DNA containing the F7 ORF;
FIG. 23 shows the nucleotide sequence of EIV HA
(A1/Prague/56) (SEQ ID N0:279);
FIG. 24 shows the nucleotide sequence of EIV HA
(A2/Fontainebleu/79) (SEQ ID N0:284);
FIG. 25 shows the nucleotide sequence of EIV HA
(A2/Suffolk/89) (SEQ ID N0:300);
FIG. 26 shows the nucleotide sequence of FeLV-B
Envelope Gene (SEQ ID N0:310);
FIG. 27 shows the nucleotide sequence of FeLV-A aaa and
partial pol genes~(SEQ ID N0:324);
FIG. 28 shows the nucleotide sequence of the FHV-1 CO
strain gD homolog gene (SEQ ID N0:290);
FIG. 29 shows the consensus F nucleotide sequence
(mumps) represented by pURF3 (SEQ ID N0:370);
FIG. 30 shows the consensus HN nucleotide sequence
(mumps) represented by pURHNS (SEQ ID N0:371);
FIG. 31 shows the cytotoxic responses of spleen cells
of mice and immunized with vaccinia virus or canarypox virus
VVO 92/15672 ~ ~ ~ ~ N ~ ~ PCT/US92/01906
-13-
vectors (NYVAC, ALVAC) or with vaccinia virus or canarypox
virus recombinants expressing HIV III B env (vP911, vCP112);
FIG. 32 shows the sensitivity of the cytotoxic effector
cells from the spleens of mice immunized with vCP112 to
antibodies against cytotoxic T lymphocyte cell surface
antigens Thy 1.2 and Lyt 2.2;
FIG. 33 shows the specificity of cytotoxic T lymphocyte
antigen receptor for the HIV III B hypervariable V3 loop of
gp120, but not for the V3 loop of HIV MN or SF2;
FIG. 34 shows the antibody responses to HIV III B gp120
of mice immunized with vectors (NYVAC, ALVAC) or with
vaccinia virus recombinant vP911 or canarypox recombinant
vCP112 expressing HIV-1 env (inverted triangle indicates
time of administration of second inoculation);
FIG. 35 shows graph of rabies neutralizing antibody
titers (RFFIT, IU/ml), booster effect of HDC and vCP65
(105'5 TCID50) in volunteers previously immunized with
either the same or the alternate vaccine (vaccines given at
days 0, 28 and 180, antibody titers measured at days 0, 7,
28, 35, 56, 173, 187 and 208);
FIG. 36 shows JEV cDNA sequences contained in vP908,
vP555, vP923 and vP829;
FIG. 37 shows NEUT and HAI activities observed in swine
immunized on days 0 and 28 with vP908, vP923, vP866 and PBS
(arrows indicated days of inoculation);
FIG. 38 shows time course of viremia detected in
individual pigs of each group immunized with PBS, vP866,
vP908 or vP923 and then challenged with the B-2358/84 strain
of JEV;
Fig 39 shows schematically the ORFs deleted to generate
NYVAC;
DETAILED DESCRIPTION OF THE INVENTION
To develop a new vaccinia vaccine strain, NYVAC
(vP866), the Copenhagen vaccine strain of vaccinia virus was
modified by the deletion of six nonessential regions of the
genome encoding known or potential virulence factors. The
sequential deletions are detailed below. All designations
of vaccinia restriction fragments, open reading frames and
CA 02105277 2003-10-O1
77396-25
-14-
nucleotide positions are based on the terminology reported
in Goebel et al., 1990a,b.
The deletion loci were also engineered as recipient
loci for the insertion of foreign genes.
The regions deleted in NYVAC are listed below. Also
listed are the abbreviations and open reading frame
designations for the deleted regions (Goebel et al.,
1990a,b) and the designation of the vaccinia recombinant
(vP) containing all deletions through the deletion
specified:
(1) thymidine kinase gene (TK; J2R) vP410;
(2) hemorrhagic region (u_; 8138 + B14R) vP553;
(3) A type inclusion body region (ATI; A26L) vP618;
(4) hemagglutinin gene (HA; A56R) vP723;
(5) host range gene region (C7L - K1L) vP804; and
(6) large subunit, ribonucleotide reductase (I4L) vP866
(NYVAC).
DNA Cloning and Synthesis. Plasmids were constructed,
screened and grown by standard procedures (Maniatis et al.,
1982; Perkus et al., 1985; Piccini et al., 1987).
Restriction endonucleases were obtained from Bethesda
Research Laboratories, Gaithersburg, MD, New England
Hiolabs, Beverly, MA; and Boehringer Mannheim Biochemicals,
Indianapolis, IN. Klenow fragment of E. coli polymerase was
obtained from Boehringer Mannheim Biochemicals. BAL-31
exonuclease and phage T4 DNA ligase were obtained from New
England Biolabs. The reagents were used as specified by the
various suppliers.
Synthetic oligodeoxyribonucleotides were prepared on a
Biosearch 8750 or Applied Biosystems 380B DNA synthesizer as
previously described (Perkus et al., 1989). DNA sequencing
was performed by the dideoxy-chain termination method
(Sanger et al., 1977) using Sequenase (Tabor et al., 1987)
as previously described (Guo et al., 1989). DNA
amplification by polymerase chain reaction (PCR) for
sequence verification (Engelke et al., 1988) was performed
using custom synthesized oligonucleotide primers and GeneAmp*
DNA amplification Reagent Kit (Perkin Elmer Cetus, Norwalk,
CT) in an automated Perkin Elmer Cetus DNA Thermal Cycler.
*Trade-mark
' ~ ~ ~ ~ ~ '~ '~ PCT/US92/01906
_~y0 92/15672
-15-
Excess DNA sequences were deleted from plasmids by
restriction endonuclease digestion followed by limited
digestion by BAL-31 exonuclease and mutagenesis (Mandecki,
1986) using synthetic oligonucleotides.
Cells. Virus. and Transfection. The origins and
conditions of cultivation of the Copenhagen strain of
vaccinia virus has been previously described (Guo et al.,
1989). Generation of recombinant virus by recombination, in
situ hybridization of nitrocellulose filters and screening
for B-galactosidase activity are as previously described
(Panicali et al., 1982; Perkus et al., 1989).
A better understanding of the present invention and of
its many advantages will be had from the following examples,
given by way of illustration.
Example 1 - CONSTRUCTION OF PLASMID p8D460 FOR
DEhETION OF THYMIDINE RINASE GENE (J2R)
Referring now to FIG. 1, plasmid pSD406 contains
vaccinia HindIII J (pos. 83359 - 88377) cloned into pUC8.
pSD406 was cut with HindIII and PvuII, and the 1.7 kb
fragment from the left side of HindIII J cloned into pUC8
cut with HindIII/SmaI, forming pSD447. pSD447 contains the
entire gene for J2R (pos. 83855 - 84385). The initiation
codon is contained within an NIaIII site and the termination
codon is contained within an SSpI site. Direction of
transcription is indicated by an arrow in FIG. 1.
To obtain a left flanking arm, a 0.8 kb HindIII/EcoRI
fragment was isolated from pSD447, then digested with NIaIII
and a 0.5 kb HindIII/NIaIII fragment isolated. Annealed
synthetic oligonucleotides MPSYN43/MPSYN44 (SEQ ID NO:1/SEQ
ID N0:2)
SmaI
MPSYN43 5' TAATTAACTAGCTACCCGGG 3'
MPSYN44 3' GTACATTAATTGATCGATGGGCCCTTAA 5'
NIaIII EcoRI
were ligated with the 0.5 kb HindIII/NIaIII fragment into
pUCl8 vector plasmid cut with HindIII/EcoRI, generating
plasmid pSD449.
To obtain a restriction fragment containing a vaccinia
right flanking arm and pUC vector sequences, pSD447 was cut
with SspI (partial) within vaccinia sequences and HindIII at
~it~;~~ t l
WO 92/15672 PCT/US92/01906
,,<-:.
-16-
the pUC/vaccinia junction, and a 2.9 kb vector fragment
isolated. This vector fragment was ligated with annealed
synthetic oligonucleotides MPSYN45/MPSYN46 (SEQ ID N0:3/SEQ
ID N0:4)
HindIII SmaI
MPSYN45 5' AGCTTCCCGGGTAAGTAATACGTCAAGGAGAAAACGAA
MPSYN46 3' AGGGCCCATTCATTATGCAGTTCCTCTTTTGCTT
NotI SspI
ACGATCTGTAGTTAGCGGCCGCCTAATTAACTAAT 3' MPSYN45
TGCTAGACATCAATCGCCGGCGGATTAATTGATTA 5' MPSYN46
generating pSD459.
To combine the left and right flanking arms into one
plasmid, a 0.5 kb HindIII/SmaI fragment was isolated from
pSD449 and ligated with pSD459 vector plasmid cut with
HindIII/SmaI, generating plasmid pSD460. pSD460 was used as
donor plasmid for recombination with wild type parental
vaccinia virus Copenhagen strain VC-2. 32P labelled probe
was synthesized by primer extension using MPSYN45 (SEQ ID
N0:3) as template and the complementary 20mer
oligonucleotide MPSYN47 (SEQ ID N0:5)
(5' TTAGTTAATTAGGCGGCCGC 3') as primer. Recombinant virus
vP410 was identified by plaque hybridization.
Example 2 - CONBTRUCTION OF PLABMID pSD486 FOR
DELETION OF HEMORRHAGIC REGION (B13R + B14R)
Referring now to FIG. 2, plasmid pSD419 contains
vaccinia SalI G (pos. 160,744-173,351) cloned into pUC8.
pSD422 contains the contiguous vaccinia SalI fragment to the
right, SalI J (pos. 173,351-182,746) cloned into pUC8. To
construct a plasmid deleted for the hemorrhagic region, u,
B13R - B14R (pos. 172,549 - 173,552), pSD419 was used as the
source for the left flanking arm and pSD422 was used as the
source of the right flanking arm. The direction of
transcription for the a region is indicated by an arrow in
FIG. 2.
To remove unwanted sequences from pSD419, sequences to
the left of the NcoI site (pos. 172,253) were removed by
digestion of pSD419 with NcoI/SmaI followed by blunt ending
with Klenow fragment of E. coli polymerase and ligation
generating plasmid pSD476. A vaccinia right flanking arm
was obtained by digestion of pSD422 with H~aI at the
WO 92/15672
PCT/US92/01906
termination codon of B14R and by digestion with NruI 0.3 kb
to the right. This 0.3 kb fragment was isolated and ligated
with a 3.4 kb HincII vector fragment isolated from pSD476,
generating plasmid pSD477. The location of the partial
deletion of the vaccinia a region in pSD477 is indicated by
a triangle. The remaining B13R coding sequences in pSD477
were removed by digestion with ClaI/HpaI, and the resulting
vector fragment was ligated with annealed synthetic
oligonucleotides SD22mer/SD20mer (SEQ ID N0:6/SEQ ID N0:7)
ClaI BamHI HpaI
SD22mer 5' CGATTACTATGAAGGATCCGTT 3'
SD20mer 3' TAATGATACTTCCTAGGCAA 5'
generating pSD479. pSD479 contains an initiation codon
(underlined) followed by a BamHI site. To place E. coli
Beta-galactosidase in the B13-B14 (u) deletion locus under
the control. of the a promoter, a 3.2 kb BamHI fragment
containing the Beta-galactosidase gene (Shapira et al.,
1983) was inserted into the BamHI site of pSD479, generating
pSD479BG. pSD479BG was used as donor plasmid for
recombination with vaccinia virus vP410. Recombinant
vaccinia virus vP533 was isolated as a blue plaque in the
presence of chromogenic substrate X-gal. In vP533 the B13R-
B14R region is deleted and is replaced by Beta-
galactosidase.
To remove Beta-galactosidase sequences from vP533,
plasmid pSD486, a derivative of pSD477 containing a
polylinker _region but no initiation codon at the a deletion
junction, was utilized. First the ClaI/HpaI vector fragment
from pSD477 referred to above was ligated with annealed
synthetic oligonucleotides SD42mer/SD40mer (SEQ ID N0:8/SEQ
LD N0:9)
ClaI SacI XhoI HpaI
SD42mer 5' CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT 3'
SD40mer 3' TAATGATCTAGACTCGAGGGGCCCGAGCTCCCTAGGCAA 5'
BQ1II SmaI BamHI
generating plasmid pSD478. Next the EcoRI site at the
pUC/vaccinia junction was destroyed by digestion of pSD478
with EcoRI followed by blunt ending with Klenow fragment of
E. coli polymerase and ligation, generating plasmid
~i~'~~;~1 ~
WO 92/15672 PCT/US92/01906
-18-
pSD478E-. pSD478E- was digested with BamHI and HpaI and
ligated with annealed synthetic oligonucleotides HEMS/HEM6
(SEQ ID NO:10/SEQ ID NO:11)
BamHI EcoRI HpaI
HEMS 5' GATCCGAATTCTAGCT 3'
HEM6 3' GCTTAAGATCGA 5'
generating plasmid pSD486. pSD486 was used as donor plasmid
for recombination with recombinant vaccinia virus vP533,
generating vP553, which was isolated as a clear plaque in
the presence of X-gal.
Example 3 - CONBTRUCTION OF PLASMID pl~IP494~
FOR DELETION OF ATI REGION (A26L)
Referring now to FIG. 3, pSD414 contains SalI B cloned
into pUC8. To remove unwanted DNA sequences to the left of
the A26L region, pSD414 was cut with XbaI within vaccinia
sequences (pos. 137,079) and with HindIII at the
pUC/vaccinia junction, then blunt ended with Klenow fragment
of E. coli polymerase and ligated, resulting in plasmid
pSD483. To remove unwanted vaccinia DNA sequences to the
right of the A26L region, pSD483 was cut with EcoRI (pos.
140,665 and at the pUC/vaccinia junction) and ligated,
forming plasmid pSD484. To remove the A26L coding region,
pSD484 was cut with NdeI (partial) slightly upstream from
the A26L ORF (pos. 139,004) and with ~i~aI (pos. 137,889)
slightly downstream from the A26L ORF. The 5.2 kb vector
fragment was isolated and ligated with annealed synthetic
oligonucleotides ATI3/ATI4 (SEQ ID N0:12/SEQ ID N0:13)
NdeI
ATI3 5' TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTCAAAAAATAAGT
ATI4 3' ACTCATTGAATTGAGAAAACAATTAATTTTCATATAAGTTTTTTATTCA
BalII EcoRI HpaI
TATATAAATAGATCTGAATTCGTT 3' ATI3
ATATATTTATCTAGACTTAAGCAA 5' ATI4
reconstructing the region upstream from A26L and replacing
the A26L ORF with a short polylinker region containing the
restriction sites BalII, EcoRI and H_paI, as indicated above.
The resulting plasmid was designated pSD485. Since the
BalII and EcoRI sites in the polylinker region of pSD485 are
not unique, unwanted BQ1II andsEcoRI sites were removed from
plasmid pSD483 (described above) by digestion with BalII
V1'O 92/15612 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-19-
(pos. 140,136) and with EcoRI at the pUC/vaccinia junction,
followed by blunt ending with Klenow fragment of E. coli
polymerase and ligation. The resulting plasmid was
designated pSD489. The 1.8 kb ClaI (pos. 137,198)/EcoRV
(pos. 139,048) fragment from pSD489 containing the A26L ORF
was replaced with the corresponding 0.7 kb polylinker-
containing ClaI/EcoRV fragment from pSD485, generating
pSD492. The BQ1II and EcoRI sites in the polylinker region
of pSD492 are unique.
A 3.3 kb BalII cassette containing the E. coli Beta-
galactosidase gene (Shapira et al., 1983) under the control
of the vaccinia 11 kDa promoter (Bertholet et al., 1985;
Perkus et al., 1990) was inserted into the BalII site of
pSD492, forming pSD493KBG. Plasmid pSD493KBG was used in
recombination with rescuing virus vP553. Recombinant
vaccinia virus, vP581, containing Beta-galactosidase in the
A26L deletion region, was isolated as a blue plaque in the
presence of X-gal.
To generate a plasmid for the removal of Beta-
galactosidase sequences from vaccinia recombinant virus
vP581, the polylinker region of plasmid pSD492 was deleted
by mutagenesis (Mandecki, 1986) using synthetic
oligonucleotide MPSYN177 (SEQ ID N0:14)
(5' AAAATGGGCGTGGATTGTTAACTTTATATAACTTATTTTTTGAATATAC 3').
In the resulting plasmid, pMP494~, vaccinia DNA encompassing
positions [137,889 - 138,937], including the entire A26L ORF
is deleted. Recombination between the pMP494~ and the Beta-
galactosidase containing vaccinia recombinant, vP581,
resulted in vaccinia deletion mutant vP618, which was
isolated as a clear plaque in the presence of X-gal.
Example ~1 - CONBTRUCTION OF PLABMID p8D467 FOR
DELETION OF HEMAGGLUTININ GENE (A56R)
Referring now to FIG. 4, vaccinia SalI G restriction
fragment (pos. 160,744-173,351) crosses the HindIII A/B
junction (pos. 162,539). pSD419 contains vaccinia SalI G
cloned into pUC8. The direction of transcription for the
hemagglutinin (HA) gene is indicated by an arrow in FIG. 4.
Vaccinia sequences derived from HindIII B were removed by
digestion of pSD419-with HindIII within vaccinia sequences
fw i iJ ai ns i !
VVO 92/1672 PCT/LJS92/01906
::-~,.
-20-
and at the pUC/vaccinia junction followed by ligation. The
resulting plasmid, pSD456, contains the HA gene, A56R,
flanked by 0.4 kb of vaccinia sequences to the left and 0.4
kb of vaccinia sequences to the right. A56R coding , .
sequences were removed by cutting pSD456 with RsaI (partial; -
pos. 161,090) upstream from A56R coding sequences, and with
Ea~I (pos. 162,054) near the end of the gene. The 3.6 kb
RsaI/EagI vector fragment from pSD456 was isolated and
ligated with annealed synthetic oligonucleotides MPSYN59
(SEQ ID N0:15), MPSYN62 (SEQ ID.N0:16), MPSYN60 (SEQ ID
N0:17), and MPSYN 61
(SEQ ID N0:18)
RsaI
MPSYN59 5' ACACGAATGATTTTCTAAAGTATTTGGAAAGTTTTATAGGT
MPSYN62 3' TGTGCTTACTAAAAGATTTCATAAACCTTTCAAAATATCCA-
MPSYN59 AGTTGATAGAACAAAATACATAATTT 3'
MPSYN62 TCAACTATCT 5'
MPSYN60 5' TGTAAAAATAAATCACTTTTTATA-
MPSYN61 3' TGTTTTATGTATTAAAACATTTTTATTTAGTGAAAAATAT-
BalII SmaI PstI EacrI
MPSYN60 CTAAGATCTCCCGGGCTGCAGC 3'
MPSYN61 GATTCTAGAGGGCCCGACGTCGCCGG 5'
reconstructing the DNA sequences upstream from the A56R ORF
and replacing the A56R ORF with a polylinker region as
indicated above. The resulting plasmid is pSD466. The
vaccinia deletion in pSD466 encompasses positions [161,185-
162,053]. The site of the deletion in pSD466 is indicated
by a triangle in FIG. 4.
A 3.2 kb BQ1II/BamHI (partial) cassette containing the
E. coli Beta-galactosidase gene (Shapira et al., 1983) under
the control of the vaccinia 11 kDa promoter (Bertholet et
al., 1985; Guo et al., 1989) was inserted into the BalII
site of pSD466, forming pSD466KBG. Plasmid pSD466KBG was
used in recombination with rescuing virus vP618.
Recombinant vaccinia virus, vP708, containing Beta-
galactosidase in the A56R deletion, was isolated as a blue
plaque in the presence of X-gal.
Beta-galactosidase sequences were deleted from vP708
using donor plasmid pSD467. pSD467 is identical to pSD466,
except that EcoRI, SmaI and BamHI sites were removed from
W'O 92/15672 ~ -~ ~ ~ ~ ~ PCT/US92/01906
-21-
the pUC/vaccinia junction by digestion of pSD466 with
EcoRI/BamHI followed by blunt ending with Klenow fragment of
E. coli polymerase and legation. Recombination between
vP708 and pSD467 resulted in recombinant vaccinia deletion
mutant, vP723, which was isolated as a clear plaque in the
presence of X-gal.
_ ER3mQle 5 - CONSTRUCTION OF PLASI~iID plriPCBRl~
FOR DELETION OF OPEN READING FRAMES [C7L-R1L1
Referring now to FIG. 5, the following vaccinia clones
were utilized in the construction of pMPCSKl~. pSD420 is
SalI H cloned into pUC8. pSD435 is KpnI F cloned into
pUCl8. pSD435 was cut with SphI and relegated, forming
pSD451. In pSD451, DNA sequences to the left of the S~hI
site (pos. 27,416) in HindIII M are removed (Perkus et al.,
1990). pSD409 is HindIII M cloned into pUC8.
To provide a substrate for the deletion of the [C7L-
KiL] gene cluster from vaccinia, E. coli Beta-galactosidase
was first inserted into the vaccinia M2L deletion locus (Guo
et al., 1990) as follows. To eliminate the BalII site in
pSD409, the plasmid was cut with BalII in vaccinia sequences
(pos. 28,212) and with BamHI at the pUC/vaccinia junction,
then legated to form plasmid pMP409B. pMP409B was cut at
the unique S~hI site (pos. 27,416). M2L coding sequences
were removed by mutagenesis (Guo et al., 1990; Mandecki,
1986) using synthetic oligonucleotide
BalII
MPSYN82 (SEQ ID N0:19) 5' TTTCTGTATATTTGCACCAATTTAGATCTT-
ACTCAAAATATGTAACAATA 3'
The resulting plasmid, pMP409D, contains a unique BalII site
inserted into the M2L deletion locus as indicated above. A
3.2 kb BamHI (partial)/BalII cassette containing the E. coli
Beta-galactosidase gene (Shapira et al., 1983) under the
control of the 11 kDa promoter (Bertholet et al., 1985) was
inserted into pMP409D cut with BalII. The resulting
plasmid, pMP409DBG (Guo et al., 1990), was used as donor
plasmid for recombination with rescuing vaccinia virus
vP723. Recombinant vaccinia virus, vP784, containing Beta-
galactosidase inserted into the M2L deletion locus, was
isolated as a blue plaque in the presence of X-gal.
~~~~~~ E ~ _
WO 92/15672 PCT/US92/01906
-22-
A plasmid deleted.for vaccinia genes [C7L-K1L] was
assembled in pUC8 cut with SmaI, HindIII and blunt ended
with Klenow fragment of E. coli polymerase. The left
flanking arm consisting of vaccinia HindIII C sequences was
obtained by digestion of pSD420 with XbaI (pox. 18,628) .
followed by blunt ending with Klenow fragment of E. coli
polymerase and digestion with BQ1II (pox. 19,706). The ,
right flanking arm consisting of vaccinia HindIII K
sequences was obtained by digestion of pSD451 with BQ1II
(pox. 29,062) and EcoRV (pox. 29,778). The resulting
plasmid, pMP581CK is deleted for vaccinia sequences between
the BalII site (pox. 19,706) in HindIII C and the BalII site
(pox. 29,062) in HindIII K. The site of the deletion of
vaccinia sequences in plasmid pMP581CK.is indicated by a
triangle in FIG. 5.
To remove excess DNA at the vaccinia deletion junction,
plasmid pMP581CK, was cut at the NcoI sites within vaccinia
sequences (pox. 18,811; 19,655), treated with Bal-31
exonuclease and subjected to mutagenesis (Mandecki, 1986)
using synthetic oligonucleotide MPSYN233 (SEQ ID N0:20)
5'-TGTCATTTAACACTATACTCATATTAATAAAAATAATATTTATT-3'.
The resulting plasmid, pMPCSKl~, is deleted for vaccinia
sequences positions 18,805-29,108, encompassing 12 vaccinia
open reading frames [C7L - K1L]. Recombination between
pMPCSKl~ and the Beta-galactosidase containing vaccinia
recombinant, vP784, resulted in vaccinia deletion mutant,
vP804, which was isolated as a clear plaque in the presence
of X-gal.
Example 6 - CONSTRUCTION OF PLABMID p8D5l8 FOR DELETION OF
LARGE SUBUNIT. RIHONUCLEOTIDE REDDCTASE (I!L)
Referring now to FIG. 6, plasmid pSD405 contains
vaccinia HindIII I (pox. 63,875-70,367) cloned in pUC8.
pSD405 was digested with EcoRV within vaccinia sequences
(pox. 67,933) and with SmaI at the pUC/vaccinia junction,
and ligated, forming plasmid pSD518. pSD518 was used as the
source of all the vaccinia restriction fragments used in the
construction of pSD548.
The vaccinia I4L gene extends from position 67,371-
65,059. Direction of transcription for I4L is indicated by
V1!O 92/15672 ~ ~ ~ j ~ ~ ~ PCT/US92/01906
-23-
an arrow in FIG. 6. To obtain a vector plasmid fragment
deleted for a portion of the I4L coding sequences, pSD518
was digested with BamHI (pos. 65,381) and HDaI (pos. 67,001)
and blunt ended using Klenow fragment of E. coli polymerase.
This 4.8 kb vector fragment was ligated with a 3.2 kb SmaI
cassette containing the E. coli Beta-galactosidase gene
(Shapira et al., 1983) under the control of the vaccinia 11
kDa promoter (Bertholet et al., 1985; Perkus et al., 1990),
resulting in plasmid pSD524KBG. pSD524KBG was used as donor
plasmid for recombination with vaccinia virus vP804.
Recombinant vaccinia virus, vP855, containing Beta-
galactosidase in a partial deletion of the I4L gene, was
isolated as a blue plaque in the presence of X-gal.
To delete Beta-galactosidase and the remainder of the
I4L ORF from vP855, deletion plasmid pSD548 was constructed.
The left and right vaccinia flanking arms were assembled
separately in pUC8 as detailed below and presented
schematically in FIG. 6.
To construct a vector plasmid to accept the left
vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and
ligated with annealed synthetic oligonucleotides 518A1/518A2
(SEQ ID N0:21/SEQ ID N0:22)
BamHI RsaI
518A1 5' GATCCTGAGTACTTTGTAATATAATGATATATATTTTCACTTTATCTCAT
518A2 3' GACTCATGAAACATTATATTACTATATATAAAAGTGAAATAGAGTA
BalII EcoRI
TTGAGAATAAAAAGATCTTAGG 3' S18A1
AACTCTTATTTTTCTAGAATCCTTAA 5' 518A2
forming plasmid pSD531. pSD531 was cut with RsaI (partial)
and BamHI and a 2.7 kb vector fragment isolated. pSD518 was
cut with BqlII (pos. 64,459)/ RsaI (pos. 64,994) and a 0.5
kb fragment isolated. The two fragments were ligated
together, forming pSD537, which contains the complete
vaccinia flanking arm left of the I4L coding sequences.
To construct a vector plasmid to accept the right
vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and
~.. J. ll cJ n. t a
WO 92/15672 PCT/US92/01906
r_ ,:,..~
-24-
ligated with annealed synthetic oligonucleotides 518B1/518B2
(SEQ ID N0:23/SEQ ID N0:24)
BamHI BalII SmaI
518B1 5' GATCCAGATCTCCCGGGAAAAAAATTATTTAACTTTTCATTAATAG-
518B2 3' GTCTAGAGGGCCCTTTTTTTAATAAATTGAAAAGTAATTATC-
RsaI EcoRI
GGATTTGACGTATGTAGCGTACTAGG 3' S18B1
CCTAAACTGCATACTACGCATGATCCTTAA 5' 518B2
forming plasmid pSD532. pSD532 was cut with RsaI
(partial)/EcoRI and a 2.7 kb vector fragment isolated.
pSD518 was cut with RsaI within vaccinia sequences (pos.
67,436) and EcoRI at the vaccinia/pUC junction, and a 0.6 kb
fragment isolated. The two fragments were ligated together,
forming pSD538, which contains the complete vaccinia
flanking arm to the right of I4L coding sequences.
The right vaccinia flanking arm was isolated as a 0.6
kb EcoRI/BalII fragment from pSD538 and ligated into pSD537
vector plasmid cut with EcoRI/BQ1II. In the resulting
plasmid, pSD539, the I4L ORF (pos. 65,047-67,386) is
replaced by a polylinker region, which is flanked by 0.6 kb
vaccinia DNA to the left and 0.6 kb vaccinia DNA to the
right, all in a pUC background. The site of deletion within
vaccinia sequences is indicated by a triangle in FIG. 6. To
avoid possible recombination of Beta-galactosidase sequences
in the pUC-derived portion of pSD539 with Beta-galactosidase
sequences in recombinant vaccinia virus vP855, the vaccinia
I4L deletion cassette was moved from pSD539 into pRCll, a
pUC derivative from which all Beta-galactosidase sequences
have been removed and replaced with a polylinker region
(Colinas et al., 1990). pSD539 was cut with EcoRI/PstI and
the 1.2 kb fragment isolated. This fragment was ligated
into pRCll cut with EcoRI/PstI (2.35 kb), forming pSD548.
Recombination between pSD548 and the Beta-galactosidase
containing vaccinia recombinant, vP855, resulted in vaccinia
deletion mutant vP866, which was isolated as a clear plaque
in the presence of X-gal.
DNA from recombinant vaccinia virus vP866 was analyzed
by restriction digests followed by electrophoresis on an
agarose gel. The restriction patterns were as expected.
Polymerase chain reactions (PCR) (Engelke et al., 1988)
WO 92/ 1 X672
PCT/US92/01906
..;«.
-25-
using vP866 as template and primers flanking the six
deletion loci detailed above produced DNA fragments of the
expected sizes. Sequence analysis of the PCR generated
fragments around the areas of the deletion junctions
confirmed that the junctions were as expected. Recombinant
vaccinia virus vP866, containing the six engineered
deletions as described above, was designated vaccinia
vaccine strain "NYVAC."
Example 7 - INSERTION OF A RABIES GLYCOPROTEIN
G GENE INTO NYVAC
The gene encoding rabies glycoprotein G under the
control of the vaccinia H6 promoter (Taylor et al., 1988a,b)
was inserted into TK deletion plasmid pSD513. pSD513 is
identical to plasmid pSD460 (FIG. 1) except for the presence
of a polylinker region.
Referring now to FIG. 7, the polylinker region was
inserted by cutting pSD460 with SmaI and ligating the
plasmid vector with annealed synthetic oligonucleotides
VQ1A/VQ1B (SEQ ID N0:25/SEQ ID N0:26)
SmaI B_q111 XhoI PstI NarI BamHI
VQ1A 5' GGGAGATCTCTCGAGCTGCAGGGCGCCGGATCCTTTTTCT 3'
VQ1B 3' CCCTCTAGAGAGCTCGACGTCCCGCGGCCTAGGAAAAAGA 5'
to form vector plasmid pSD513. pSD513 was cut with SmaI and
ligated with a SmaI ended 1.8 kb cassette containing the
gene encoding the rabies glycoprotein G gene under the
control of the vaccinia H6 promoter (Taylor et al.,
1988a,b). The resulting plasmid was designated pRW842.
pRW842 was used as donor plasmid for recombination with
NYVAC rescuing virus (vP866). Recombinant vaccinia virus
vP879 was identified by plaque hybridization using 32P-
labelled DNA probe to rabies glycoprotein G coding
sequences.
The modified recombinant viruses of the present
invention provide advantages as recombinant vaccine vectors.
The attenuated virulence of the vector advantageously
reduces the opportunity for the possibility of a runaway
infection due to vaccination in the vaccinated individual
and also diminishes transmission from vaccinated to
unvaccinated individuals or contamination of the
environment.
~.~~i~w t ~
~'O 92/15672 PCT/US92/01906
-26-
The modified recombinant viruses are also
advantageously used in a method for expressing a gene
product in a cell cultured in vitro by introducing into the
cell the modified recombinant virus having foreign DNA which
codes far and expresses gene products in the cell. -
Example 8 - CONBTRUCTION OF TROVAC-NDV EgPRE88ING THE
FUSION AND HEMAGGLUTININ-NEURAMINIDABE
GLYCOPROTEINB OF NEWCABTLE DISEASE VIRUS
A fowlpox virus (FPV) vector expressing both F and HN
genes of the virulent NDV strain Texas was constructed. The
recombinant produced was designated TROVAC-NDV. TROVAC-NDV
expresses authentically processed NDV glycoproteins in avian
cells infected with the recombinant virus and inoculation of
day old chicks protects against subsequent virulent NDV
challenge.
Cells and Viruses. The Texas strain of NDV is a
velogenic strain. Preparation of cDNA clones of the F and
HN genes has been previously described (Taylor et al., 1990;
Edbauer et al., 1990). The strain of FPV designated FP-1
has been described previously (Taylor et al., 1988a). It is
an attenuated vaccine strain useful in vaccination of day
old chickens. The parental virus strain Duvette was
obtained in France as a fowlpox scab from a chicken. The
virus was attenuated by approximately 50 serial passages in
chicken embryonated eggs followed by 25 passages on chicken
embryo fibroblast cells. The virus was subjected to four
successive plaque purifications. One plaque isolate was
further amplified in primary CEF cells and a stock virus,
designated as TROVAC, established. The stock virus used in
the in vitro recombination test to produce TROVAC-NDV had
been subjected to twelve passages in primary CEF cells from
the plaque isolate.
Construction of a Cassette for NDV-F. A 1.8 kbp BamHI
fragment containing all but 22 nucleotides from the 5' end
of the F protein coding sequence was excised from pNDV81
(Taylor et al., 1990) and inserted at the BamHI site of
pUCl8 to form pCEl3. The vaccinia virus H6 promoter
previously described (Taylor et al., 1988a,b; Guo et al.,
1989; Perkus et al., 1989) was inserted into pCEl3 by
digesting pCEl3 with SalI, filling in the sticky ends with
H'O 92/16672 ~ ~ ~ ~ ~ $r'~ PCT/US92/01906
-27-
Klenow fragment of E. coli DNA polymerase and digesting with
HindIII. A HindIII - EcoRV fragment containing the H6
promoter sequence was then inserted into pCEl3 to form
pCE38. A perfect 5' end was generated by digesting pCE38
with KpnI and NruI and inserting the annealed and kinased
oligonucleotides CE75 (SEQ ID N0:27) and CE76 (SEQ ID N0:28)
to generate pCE47.
CE75:
CGATATCCGTTAAGTTTGTATCGTAATGGGCTCCAGATCTTCTACCAGGATCCCGGTAC
CE76:
CGGGATCCTGGTAGAAGATCTGGAGCCCATTACGATACAAACTTAACGGATATCG.
In order to remove non-coding sequence from the 3' end of
the NDV-F a SmaI to Pstl fragment from pCEl3 was inserted
into the SmaI and PstI sites of pUCl8 to form pCE23. The
non-coding sequences were removed by sequential digestion of
pCE23 with SacI, BamHI, Exonuclease III, SI nuclease and
EcoRI. The annealed and kinased oligonucleotides CE42 (SEQ
ID N0:29) and CE43 (SEQ ID N0:30) were then inserted to form,
pCE29.
CE42: AATTCGAGCTCCCCGGG
CE43: CCCGGGGAGCTCG
The 3' end of the NDV-F sequence was then inserted into
plasmid pCE20 already containing the 5' end of NDV-F by
cloning a ~stI - SacI fragment from pCE29 into the PstI and
SacI sites of pCE20 to form pCE32. Generation of pCE20 has
previously been described in Taylor et al., 1990.
In order to align the H6 promoter and NDV-F 5'
sequences contained in pCE47 with the 3' NDV-F sequences
contained in pCE32, a HindIII - PstI fragment of pCE47 was
inserted into the HindIII and PstI sites of pCE32 to form
pCE49. The H6 promoted NDV-F sequences were then
transferred to the de-ORFed F8 locus (described below) by
cloning a HindIII - NruI fragment from pCE49 into the
HindIII and SmaI sites of pJCA002 (described below) to form
pCE54. Transcription stop signals were inserted into pCE54
by digesting pCE54 with SacI, partially digesting with BamHI
and inserting the annealed and kinased oligonucleotides
CE166 (SEQ ID N0:31) and CE167 (SEQ ID N0:32) to generate
pCE58.
a 5e ~.'''
~~9 %15672 PCT/US92/01906
,~.
-28-
CE166: CTTTTTATAAAAAGTTAACTACGTAG
CE167: GATCCTACGTAGTTAACTTTTTATAAAAAGAGCT
A perfect 3' end for NDV-F was obtained by using the
polymerase chain reaction (PCR) with pCE54 as template and
oligonucleotides CE182 (SEQ ID N0:33) and CE183 (SEQ ID
N0:34) as primers.
CE182: CTTAACTCAGCTGACTATCC
CE183: TACGTAGTTAACTTTTTATAAAAATCATATTTTTGTAGTGGCTC
The PCR fragment was digested with PvuII and HpaI and cloned
into pCE58 that had been digested with HpaI and partially
digested with PvuII. The resulting plasmid was designated
pCE64. Translation stop signals were inserted by cloning a
HindIII - H~aI fragment which contains the complete H6
promoter and F coding sequence from pCE64 into the HindIII
and HpaI sites of pRW846 to generate pCE7l, the final
cassette for NDV-F. Plasmid pRW846 is essentially
equivalent to plasmid pJCA002 (described below) but
containing the H6 promoter and transcription and translation,
stop signals. Digestion of pRW846 with HindIII and HpaI
eliminates the H6 promoter but leaves the stop signals
intact.
Construction of Cassette for NDV-HN. Construction of
plasmid pRW802 was previously described in Edbauer et al.,
1990. This plasmid contains the NDV-HN sequences linked to
the 3' end of the vaccinia virus H6 promoter in a pUC9
vector. A HindIII - EcoRV fragment encompassing the 5' end
of the vaccinia virus H6 promoter was inserted into the
HindIII and EcoRV sites of pRW802 to form pRW830. A perfect
3' end for NDV-HN was obtained by inserting the annealed and
kinased oligonucleotides CE162
(SEQ ID N0:35) and CE163 (SEQ ID N0:36) into the EcoRI site
of pRW830 to form pCE59, the final cassette for NDV-HN.
CE162:
AATTCAGGATCGTTCCTTTACTAGTTGAGATTCTCAAGGATGATGGGATTTAATTTTTAT
AAGCTTG
CE163:
AATTCAAGCTTATAAAAATTAAATCCCATCATCCTTGAGAATCTCAACTAGTAAAGGAAC
GATCCTG
V1-'O 92/1672 ~ ~. ~ J ~ ( ~ PCT/L1S92/01906
-29-
Construction of FPV Insertion Vector. Plasmid pRW731-
15 contains a lOkb PvuII - PvuII fragment cloned from
genomic DNA. The nucleotide sequence was determined on both
strands for a 3660 by PvuII - EcoRV fragment. The limits of,
an open reading frame designated here as F8 were determined.
Plasmid pRW761 is a sub-clone of pRW731-15 containing a 2430
by EcoRV - EcoRV fragment. The F8 ORF was entirely
contained between an XbaI site and an SSt~I site in pRW761.
In order to create an insertion plasmid which on
recombination with TROVAC genomic DNA would eliminate the F8
ORF, the following steps were followed. Plasmid pRW761 was
completely digested with XbaI and partially digested with
SspI. A 3700 by XbaI - SSpI band was isolated from the gel
and ligated with the annealed double-stranded
oligonucleotides JCA017 (SEQ ID N0:37) and JCA018 (SEQ ID
N0:38).
JCA017:5'
CTAGACACTTTATGTTTTTTAATATCCGGTCTTAAAAGCTTCCCGGGGATCCTTATACGG
GGAATAAT
JCA018:5'
ATTATTCCCCGTATAAGGATCCCCCGGGAAGCTTTTAAGACCGGATATTAAAAAACATAA
AGTGT
The plasmid resulting from this ligation was designated
pJCA002.
Construction of Double Insertion Vector for NDV F and
HN. The H6 promoted NDV-HN sequence was inserted into the
H6 promoted NDV-F cassette by cloning a HindIII fragment
from pCE59 that had been filled in with Klenow fragment of
E. coli DNA polymerase into the HpaI site of pCE71 to form
pCE80. Plasmid pCE80 was completely digested with NdeI and
partially digested with BglII to generate an NdeI - BalII
4760 by fragment containing the NDV F and HN genes both
driven by the H6 promoter and linked to F8 flanking arms.
Plasmid pJCA021 was obtained by inserting a 4900 by PvuII -
HindII fragment from pRW731-15 into the SmaI and HindII
sites of pBSSK+. Plasmid pJCA021 was then digested with
NdeI and BalII and ligated to the 4760 by NdeI - BalII
fragment of pCE80 to form pJCA024. Plasmid pJCA024 ,
therefore contains the NDV-F and HN genes inserted in.
V1'O 92/15672 PCT/US92/01.906 r...
-30-
opposite orientation with 3' ends adjacent between FPV
flanking arms. Both genes are linked to the vaccinia virus
H6 promoter. The right flanking arm adjacent to the NDV-F
sequence consists of 2350 by of FPV sequence. The left
flanking arm adjacent to the NDV-HN sequence consists of
1700 by of FPV sequence.
Development of TROVAC-NDV. Plasmid pJCA024 was
transfected into TROVAC infected primary CEF cells by using
the calcium phosphate precipitation method previously
described (Panicali et al., 1982; Piccini et al., 1987).
Positive plaques were selected on the basis of hybridization
to specific NDV-F and HN radiolabelled probes and subjected
to five sequential rounds of plaque purification until a
pure population was achieved. One representative plaque was
then amplified and the resulting TROVAC recombinant was
designated TROVAC-NDV (vFP96).
Immunofluorescence. Indirect immunofluorescence was
performed as described (Taylor et al., 1990) using a
polyclonal anti-NDV serum and, as mono-specific reagents,
sera produced in rabbits against vaccinia virus recombinants
expressing NDV-F or NDV-HN.
ImmunopreciDitation. Immunoprecipitation reactions
were performed as described (Taylor et al., 1990) using a
polyclonal anti-NDV.serum obtained from SPAFAS Inc., Storrs,
CN.
The stock virus was screened by in situ plaque
hybridization to confirm that the F8 ORF was deleted. The
correct insertion of the NDV genes into the TROVAC genome
and the deletion of the F8 ORF was also confirmed by
Southern blot hybridization.
In NDV-infected cells, the F glycoprotein is anchored
in the membrane via a hydrophobic transmembrane region near
the carboxyl terminus and requires post-translational
cleavage of a precursor, Fo, into two disulfide linked
polypeptides F1 and F2. Cleavage of Fo is important in
determining the pathogenicity of a given NDV strain (Homma
and Ohuchi, 1973; Nagai et al., 1976; Nagai et al., 1980),
and the sequence of amino acids at the cleavage site is
therefore critical in determining viral virulence. It has
W.O 92/15672 ~ ~ ~ ~ " ~ ~ PCT/US92/01.906
-31-
been determined that amino acids at the cleavage site in the
NDV-F sequence inserted into FPV to form recombinant vFP29
had the sequence Arg - Arg - Gln - Arg - Arg (SEQ ID N0:39)
(Taylor et al., 1990) which conforms to the sequence found
to be a requirement for virulent NDV strains (Chambers et
al., 1986; Espion et al., 1987; Le et al., 1988; McGinnes
and Morrison, 1986; Toyoda et al., 1987). The HN
glycoprotein synthesized in cells infected with virulent
strains of NDV is an uncleaved glycoprotein of 74 kDa.
Extremely avirulent strains such as Ulster and Queensland
encode an HN precursor (HNo) which requires cleavage for
activation (Garten et al., 1980).
The expression of F and HN genes in TROVAC-NDV was
analyzed to confirm that the gene products were
authentically processed and presented. Indirect-
immunofluorescence using a polyclonal anti-NDV chicken serum
confirmed that immunoreactive proteins were presented on the
infected cell surface. To determine that both proteins were
presented on the plasma membrane, mono-specific rabbit sera
were produced against vaccinia recombinants expressing
either the F or HN glycoproteins. Indirect
immunofluorescence using these sera confirmed the surface
presentation of both proteins.
Immunoprecipitation experiments were performed by using
(35S) methionine labeled lysates of CEF cells infected with
parental and recombinant viruses. The expected values of
apparent molecular weights of the glycolysated forms of F1
and F2 are 54.7 and 10.3 kDa respectively (Chambers et al.,
1986). In the immunoprecipitation experiments using a
polyclonal anti-NDV serum, fusion specific products of the
appropriate size were detected from the NDV-F single
recombinant vFP29 (Taylor et al., 1990) and the TROVAC-NDV
double recombinant vFP96. The HN glycoprotein of
appropriate size was also detected from the NDV-HN single
recombinant VFP-47 (Edbauer et al., 1990) and TROVAC-NDV.
No NDV specific products were detected from uninfected and
parental TROVAC infected CEF cells.
I,n CEF cells, the F and HN glycoproteins are
appropriately presented on the infected cell surface where
iY :~ fy -
1(/
WO 92/15672 PCT/US92/01906
-32-
they are recognized by NDV immune serum.
Immunoprecipitation analysis indicated that the Fo protein
is authentically cleaved to the F1 and F2 components
required in virulent strains. Similarly, the HN
glycoprotein was authentically processed in CEF cells
infected with recombinant TROVAC-NDV.
Previous reports (Taylor et al., 1990; Edbauer et al.,
1990; Boursnell et al., 1990a,b,c; Ogawa et al., 1990) would
indicate that expression of either HN or F alone is
sufficient to elicit protective immunity against NDV
challenge. Work on other paramyxoviruses has indicated,
however, that antibody to both proteins may be required for
full protective immunity. It has been demonstrated that SV5
virus could spread in tissue culture in the presence of
antibody,to the HN glycoprotein but not to the F
glycoprotein (Merz et al., 1980). In addition, it has been
suggested that vaccine failures with killed measles virus
vaccines were due to inactivation of the fusion component
(Norrby et al., 1975). Since both NDV glycoproteins have
been shown to be responsible for eliciting virus
neutralizing antibody (Avery et al., 1979) and both
glycoproteins, when expressed individually in a fowlpox
vector are able to induce a protective immune response, it
can be appreciated that the most efficacious NDV vaccine
should express both glycoproteins.
Example 9 - CONSTRUCTION OF NYVAC-?IV RECOMBINANT
EYPRESSINGMEABLEB FOSION AND HEMAGGLtTTININ
GLYCOPROTEINS
cDNA copies of the sequences encoding the HA and F
proteins of measles virus MV (Ed~nonston strain) were
inserted into NYVAC to create a double recombinant
designated NYVAC-MV. The recombinant authentically
expressed both measles glycoproteins on the surface of
infected cells. Immunoprecipitation analysis demonstrated
correct processing of both F and HA glycoproteins. The
recombinant was also shown to induce syncytia formation.
Cells and Viruses. The rescuing virus used in the
production of NYVAC-MV was the modified Copenhagen strain of
vaccinia virus designated NYVAC. All viruses were grown and
titered on Vero cell monolayers.
WO 92/1;672 ~ ~ ~ J N '~ '~
PCT/US92/01906
-33-
.Plasmid Construction. Plasmid pSPM2LHA (Taylor et al.,
1991c) contains the entire measles HA gene linked in a
precise ATG to ATG configuration with the vaccinia virus H6
promoter which has been previously described (Taylor et al.,
1988a,b; Guo et al., 1989; Perkus et al., 1989). A l.8kpb
EcoRV/SmaI fragment containing the 3' most 24 by of the H6
promoter fused in a precise ATG:ATG configuration with the
HA gene lacking the 3' most 26 by was isolated from
pSPM2LHA. This fragment was used to replace the 1.8 kbp
EcoRV/SmaI fragment of pSPMHHAll (Taylor et al., 1991c) to
generate pRW803. Plasmid pRW803 contains the en- tire H6
promoter linked precisely to the entire measles HA gene.
In the confirmation of previous constructs with the
measles HA gene it was noted that the sequence for codon
18(CCC) was deleted as compared to the published sequence
(Alkhatib et al., 1986). The CCC sequence was replaced by
oligonucleotide mutagenesis via the Kunkel method (Kunkel,
1985) using oligonucleotide RW117 (SEQ ID N0:40)
(5'GACTATCCTACTTCCCTTGGGATGGGGGTTATCTTTGTA-3').
PRO 18
Single stranded template was derived from plasmid pRW819
which contains the H6/HA cassette from pRW803 in pIBI25
(International Biotechnologies, Inc., New Haven, CT). The
mutagenized plasmid containing the inserted (CCC) to encode
for a proline residue at codon 18 was designated pRW820.
The sequence between the HindIII and XbaI sites of pRW820
was confirmed by nucleotide sequence analysis. The HindIII
site is situated at the 5' border of the H6 promoter while
the XbaI site is located 230 by downstream from the
initiation codon of the HA gene. A 1.6 kbp XbaI/EcoRI
fragment from pRW803, containing the HA coding sequences
downstream from the XbaI (above) and including the
termination codon, was used to replace the equivalent
fragment of pRW820 resulting in the generation of pRW837.
The mutagenized expression cassette contained within pRW837
was derived by digestion with HindIII and EcoRI, blunt-ended
using the Klenow fragment of E. coli DNA polymerase in the
presence of 2mM dNTPs, and inserted into the S:aaI site of
pSD513 to yield pRW843. Plasmid pSD513 was derived from
~~u~~ 3 ~ 7
~'O 92/15672 PCT/US92/01906
-34-
plasmid pSD460 by the addition of polylinker sequences.
Plasmid pSD460 was derived to enable deletion of the
thymidine kinase gene from vaccinia virus.
To insert the measles virus F gene into the HA
insertion plasmid, manipulations were performed on pSPHMF7.
Plasmid pSPHMF7 (Taylor et al., 1991c) contains the measles
F gene juxtaposed 3' to the previously described vaccinia
virus H6 promoter. In order to attain a perfect ATG for ATG
configuration and remove intervening sequences between the
3' end of the promoter and the_ATG of the measles F gene
oligonucleotide directed mutagenesis was performed using
oligonucleotide SPMAD (SEQ ID N0:41).
SPMAD: 5'- TATCCGTTAAGTTTGTATCGTAATGGGTCTCAAGGTGAACGTCT-3'
The resultant plasmid was designated pSPMF75M20.
The plasmid pSPMF75M20 which contains the measles F
gene now linked in a precise ATG for ATG configuration with
the H6 promoter was digested with NruI and EagI. The
resulting 1.7 kbp blunt ended fragment containing the 3'
most 27 by of the H6 promoter and the entire fusion gene was
isolated and inserted into an intermediate plasmid pRW823
which had been digested with NruI and XbaI and blunt ended.
The resultant plasmid pRW841 contains the H6 promoter linked
to the measles F gene in the pIBI25 plasmid vector
(International Biotechnologies, Inc., New Haven, CT). The
H6/measles F cassette was excised from pRW841 by digestion
with SmaI and the resulting 1.8 kb fragment was inserted
into pRW843 (containing the measles HA gene). Plasmid
pRW843 was first digested with NotI and blunt-ended with
Klenow fragment of E. coli DNA polymerase in the presence of
2mM dNTPs. The resulting plasmid, pRW857, therefore
contains the measles virus F and HA genes linked in a tail
to tail configuration. Both genes are linked to the
vaccinia virus H6 promoter.
Development of NYVAC-MV. Plasmid pRW857 was
transfected into NYVAC infected Vero cells by using the
calcium phosphate precipitation method previously described
(Panicali et al., 1982; Piccini et al., 1987). Positive
° plaques were selected on the basis of in situ plaque
hybridization to specific MV F and HA radiolabelled probes
VVO 92/15672 ~ ~ ~ '~ ~ ~ ~ PCT/US92/01906
. -35-
and subjected to 6 sequential rounds of plaque purification
until a pure population was achieved. One representative
plaque was then amplified and the resulting recombinant was
designated NYVAC-MV (vP913).
Immunofluorescence. Indirect immunofluorescence was
performed as previously described (Taylor et al., 1990).
Mono-specific reagents used were sera generated by
inoculation of rabbits with canarypox recombinants
expressing either the measles F or HA genes.
Immunoprecipitation. Immunoprecipitation reactions
were performed as previously described (Taylor et al., 1990)
using a guinea-pig anti measles serum (Whittaker M.A.
Bioproducts, Walkersville, MD).
Cell Fusion Experiments. Vero cell monolayers in 60mm
dishes were inoculated at a multiplicity of 1 pfu per cell
with parental or recombinant viruses. After 1 h absorption
at 37°C the inoculum was removed, the overlay medium
replaced and the dishes inoculated overnight at 37°C. At 20
h post-infection, dishes were examined.
In order to determine that the expression products of
both measles virus F and HA genes were presented on the
infected cell surface, indirect immunofluorescence analysis
was performed using mono-specific sera generated in rabbits
against canarypox recombinants expressing either the measles
F or HA genes. The results indicated that both F and HA
gene products were expressed on the infected cell surface,
as demonstrated by strong surface fluorescence with both
mono-specific sera. No background staining was evident with
either sera on cells inoculated with the parental NYVAC
strain, nor was there cross-reactive staining when mono-
specific sera were tested against vaccinia single
recombinants expressing either the HA or F gene.
In order to demonstrate that the proteins expressed by
NYVAC-MV were immunoreactive with measles virus specific
sera and were authentically processed in the infected cell,
immunoprecipitation analysis was performed. Vero cell
monolayers were inoculated at a multiplicity of 10 pfu/cell
of parental or recombinant viruses in the presence of 35S-
methionine. Immunoprecipitation analysis revealed a HA
~. .L l1 ~1 ~ f
V1'O 92/15672 PCT/US92/01906 ,,~,
-36-
glycoprotein of approximately 76 kDa and the cleaved fusion
products F1 and F2 with molecular weights of 44 kDa and 23
kDa, respectively. No measles specific products were
detected in uninfected Vero cells or Vero cells infected
with the parental NYVAC virus.
A characteristic of MV cytopathology is the formation
of syncytia which arise by fusion of infected cells with .
surrounding infected or uninfected cells followed by
migration of the nuclei toward the center of the syncytium
(Norrby et al., 1982). This has been shown to be an
important method of viral spread, which for Paramyxoviruses,
can occur in the presence of HA-specific virus neutralizing
antibody (Merz et al., 1980). In order to determine that
the MV proteins expressed in vaccinia virus were
functionally active, Vero cell monolayers were inoculated
with NYVAC.and NYVAC-MV and observed for cytopathic effects.
Strong cell fusing activity was evident in NYVAC-MV infected
Vero cells at approximately 18 hours post infection. No
cell fusing activity was evident in cells infected with
parental NYVAC.
Example 10 - CONSTRUCTION OF NYVAC RECOMBINANTB EgPRE88ING
GLYCOPROTEINS OF P8EUDORABIEB VIRUS
It has been demonstrated that vaccinia virus
recombinants expressing the PRV gpII, gpIII, and gp50
glycoproteins either individually or in combination provide
efficacious vaccine candidates, in that, they protect swine
from a virulent challenge with live PRV. Considering the
inability of the NYVAC vector to productively replicate in
porcine cell cultures and the inherent safety of the vector
due to the deletion of known potential virulence genes,
NYVAC-based recombinants containing the PRV gpII, gpIII, and
gp50 either alone or in various combinations have been
generated. These recombinants were generated to provide
efficacious vaccine candidates against PRV that were safe
for swine and eliminated or severely limited transmission to
the environment.
Viruses and Cells. Manipulations of NYVAC and
molecular cloning were performed by standard techniques
(Piccini et al., 1987-; Maniatis et al., 1982). Cultivation
~~i~~w'~7
WO 92/15672 PCT/US92/01906
-37- _
of NYVAC and NYVAC-based recombinants was as previously
described (Piccini et al., 1987).
Cloning of the PRV qpII, gpIII, and qp50 Genes. The
growth of PRV, extraction of PRV genomic DNA, and the
identification of the PRV gpII, gpIII, and gp50 genes have
been described.
Cloning and Expression of the Pseudorabies Virus ~PRV1
Genes into NYVAC fvP866). The NYVAC deletion mutant lacking
a region encompassing the human and porcine host range genes
(C7L and K1L), vP866, was the basic vector used to insert
the PRV genes. This vector also lacks the vaccinia virus tk
gene, hemagglutinin gene, hemorrhagic gene, ribonucleotide
reductase (large subunit) gene, and A-type inclusion gene.
Importantly, vP866 does not replicate efficiently, if at
all, on human or pig kidney (LLC-PK1) cells. PRV genes
gpII, gpIII, and gp50, which are homologous to the herpes
simplex virus gB (Robbins et al., 1987), gC (Bobbins et al.,
1986b), and gD (Wathen and Wathen, 1984), respectively, were
inserted into vP866 as outlined below.
Insertion of the PRV qpII Gene into the Hemaqalutinin
Locus of vP866. The DNA sequence encoding the PRV gpII gene
resides in the BamHI fragment 1 of the PRV genome
(Mettenleiter et al., 1986).
The plasmid designated pPR9.25, containing the PRV
BamHI fragment 1 inserted into the BamHI site of pBR322 was
digested with NcoI. The resultant restriction fragments
were fractionated on a 0.8% agarose gel and a 6.2 kb NcoI
DNA fragment was purified using Geneclean (Bio101, Inc.,
LaJolla, CA) and subsequently inserted into the NcoI site of
pBR328 (Boehringer Mannheim Biochemicals, Indianapolis, IN)
treated with CiAP. The resulting plasmid, pPR2.15, was
digested with S~hI and fractionated on an agarose gel. The
2.7 kb and 1.8 kb fragments were purified and inserted into
the SphI site of pUCl8 to create pPRl and pPR2,
respectively.
The 1060 by PRV SphI/NheI fragment from pPRl was
isolated from an agarose gel and inserted into the
BamHI/SphI sites of pIBI25 with annealed oligonucleotides
MRSYN1 (SEQ ID N0:42) (5'-GATCCATTCCATGGTTG-3') and MRSYN2
V1'O 92/15672 PCT/LJS92/01906 .,..,..~
-38-
(SEQ ID N0:43) (5'-TAGCAACCATGGAATG-3') to generate pPR6.
pPR6 was digested with HindIII and ApaI. The A~aI site is
located 32 by downstream from the ATG initiation codon of
PRV gpII. This 3920 by fragment was ligated to annealed
oligonucleotides MRSYN3 (SEQ ID N0:44) (5'- ,
AGCTTGATATCCGTTAAGTTTGTATCGTAATGCCCGCTGGTGGCGGTCTTTGGCGCGGGC
C-3') and MRSYN4 (SEQ ID N0:45) (5'- ,
CGCGCCAAAGACCGCCAACCAGCGGGATTACGATACAAACTTAACGGATATCA-3') to
generate pPR9. These annealed oligonucleotides provide the
DNA sequences specifying the vaccinia virus H6 promoter from
the EcoRV site through the ATG, followed by the PRV gpII
coding sequences. The plasmid pPR9 was digested with BamHI
and NheI and treated with Calf Intestinal Alkaline
Phosphatase (CiAP), and ligated to annealed oligonucleotides
MRSYN7 (SEQ ID N0:46) (5'-CCCAGATCTCCTTG-3') and MRSYN8 (SEQ
ID N0:47) (5'-GTACGGGTCTAGAGGAACCTAG-3') and a 1640 by
SphI/NheI fragment obtained from pPRl generating plasmid
pPRl2.
The 1030 by HindII/S~hI fragment from pPR2 was isolated
from an agarose gel and inserted into a HincII/S~hI pUCl8
vector. The resulting plasmid, pPRlO, was digested with
HindIII and NaeI and treated with CiAP. The NaeI site is
located 44 by upstream of the termination codon (TAG).
Annealed oligonucleotides MRSYN9 (SEQ ID N0:48) (5'-GGCACT
ACCAGCGCCTCGAGAGCGAGGACCCCGACGCCCTGTAGAATTTTTATCGGCCGA-3')
and MRSYN10 (SEQ ID N0:49) (5'-AGCTTCGGCCGATAAAAATTCTA
CAGGGCGTCGGGGTCCTCGCTCTCGAGGCGTAGTGCC-3') were ligated to
the 3720 by NaeI/HindIII fragment of pPRlO to yield plasmid
pPRll. A 770 by SphI/HincII fragment from pPR2 was purified
from an agarose gel and inserted using the BamHI/SphI
phosphorylated linker MRSYN7 (SEQ ID N0:46) and MRSYN8 (SEQ
ID N0:47) into the BamHI/HincII sites of CiAP treated pPRll
to generate pPRl3. Plasmid pPRl2 digested with EcoRI and
SphI was ligated using MRSYN19 (SEQ ID N0:50) (5'-AGCTTCTGC
AGCCATGGCGATCGG-3') and MRSYN20 (SEQ ID N0:51) (5'-AATTCCG
ATCGCCATGGCTGCAGA-3') to a 990 by HindIII/St~hI fragment from
pPRl3 to yield plasmid pPRl5. Plasmid, pPRl5, was digested
with HindIII/EcoRV to yield a 2780 by fragment. This
fragment was inserted into pTPlS (Guo et al., 1989) which
WO 92/15672 ~ 1 ~ ~ N
PCT/L1S92/01906
-3g-
was digested with XmaIII and EcbRV to generate pPRl8. In
pPRlB, the PRVgpII is linked with the vaccinia virus H6
promoter in a HA deletion plasmid. pPRl8 was used in in
vitro recombination experiments with vP866 as the rescue
virus to generate vP881.
Insertion of the PRV qpIII gene into the TK Locus of
NYVAC. The sequences encoding the PRV gpIII gene map to the
BamHI 2 and 9 fragments of the PRV genome (Robbins et al.,
1986b). Plasmids pPR9.9 and pPR7.35 contain the PRV BamHI
fragments 2 and 9, respectively, inserted into the BamHI
site of pBR322. An S,phI/BamHI fragment containing the 5'
end of the PRV gpIII gene was isolated from pPR9.9. An
NcoI/BamHI fragment containing the remainder of the gpIII
gene was isolated from pPR7:35. The entire PRV gpIII gene
was assembled by the ligation of these two fragments into
pIBI25 to yield pPRl7.
The PRV gpIII gene was manipulated to be expressed
under the control of the early vaccinia virus hemorrhagic
promoter, located in the HindIII B region (Goebel et al.,
1990a,b). Using site-directed mutagenesis, an NsiI site was
introduced by changing the sequence CGC (bases 192-194) in
PRV gpIII to ATG and an XbaI site was introduced by changing
the sequence GTCACGT to TTCTAGA (bases 1632-1638). To
perform the mutagenesis reactions, single-stranded DNA was
generated from plasmid pPRl7 using the helper phage 8408
(Stratagene, LaJolla, CA). The site-directed mutagenesis
was done using MRSYN5 (SEQ ID N0:52) (5'-GCGAGCGAGGCCATGC
ATCGTGCGAATGGCCCC-3') and MRSYN6 (SEQ ID N0:53) (5'-GGGGG
GACGCGCGGGTCTAGAAGGCCCCGCCTGGCGG-3') and selection on E.
coli dut- unQ- strain. CJ236 (International
Biotechnologies, Inc., New Haven, CT). Mutagenesis was
performed according to the protocols of Kunkel (1985).
These mutations resulted in the generation of plasmid pPR28.
Plasmid pPR28 was digested with NsiI and XbaI and
treated with Mung bean nuclease. A 1440 by fragment was
purified and inserted into a BcrlII/H~aI digested pSD478VC
after treatment with Mung bean nuclease and calf-intestine
alkaline phosphatase. The resultant plasmid was designated
as pPR24.
PCT/US92/01906
. :r'~,:.
-4 ~- .. . ..
The plasmid pPR24 was digested with SnaBi and DraI to
liberate a 1500 by blunt-ended fragment containing the a
promoter and PRV gpIII gene. This fragment was ligated into
SmaI digested pSD513VC to yield pPRVIIIVCTK. In vitro
recombination experiments were performed with pPRVIIIVCTK ,
and vP866 as the rescue virus to generate vP883. In vP883,
the vaccinia tk coding sequences are replaced by the PRV ,
gpIII gene inserted in a right to left orientation, with
respect to the genome, under the control of the 120 by
vaccinia a promoter element.
Insertion of the PRV gp50 Gene into the ATI Locus of
NYVAC. DNA encoding the gene for the PRV glycoprotein gp50
is located on the BamHI fragment 7 of the PRV genome
(Petrovskis et al., 1986a,b). Plasmid pPR7.1 contains the
PRV BamHI fragment 7 inserted into the BamHI site of pBR322.
A StuI/NdeI subfragment of pPR7.1 containing the entire gp50
gene was subcloned into pIBI25 to yield plasmid ,856.
The coding sequences for PRV gp50 were placed under the ,
control of the early/intermediate vaccinia promoter, I3L
(Schmitt and Stunnenberg, 1988; Vos and Stunnenberg, 1988).
This promoter element has been used previously to express
foreign genes in vaccinia recombinants (Perkus et al., 1985;
Bucher et al., 1989). DNA corresponding to promoter
sequences upstream from the I3L open reading frame (Schmitt
and Stunnenberg, 1988) was derived by PCR (Saiki et al.,
1988) using synthetic oligonucleotides P50PPBAM (SEQ ID
N0:54) (5'-ATCATCGGATCCGGTGGTTTGCCATTCCG-3') and P50PPATG
(SEQ ID N0:55) (5'-GATTAAACCTAAATAATTG-3') and pMPIVC, a
subclone of the Copenhagen HindIII I region, as template.
The resulting 126 by fragment was digested with BamHI to
generate a BamHI cohesive end at the 5' end of the promoter
sequence. The 3' end remained blunt-ended.
The PRV gp50 coding region was excised from plasmid
,856. Plasmid X856 was initially digested with NsiI, which
cuts 7 by upstream from the ATG and results in a 3'
overhang. The 3' overhang was blunt-ended with T4 DNA
polymerase in the presence of 2mM dNTPs. The resulting DNA
was partially digested with B~lII, and a l.3kb blunt/BQlII
fragment containing the PRV gp50 gene was isolated.
c '~ ,~y
N'O 92/15672 ~ ~ ~ ~i ~ ~ ~ PCT/US92/01906
-41-
The 126 by I3L promoter fragment (BamHI/blunt) and the
l.3kb gp50 gene containing fragment (blunt/BalII) were
ligated into pBS-SK (Stratagene, La Jolla, CA) digested with
BamHI. The resultant plasmid was designated as pBSPRV50I3.
The expression cassette containing the I3L promoter linked
to the PRV gp50 gene was excised by a BamHl/partial SmaI
digestion. A 1.4 kb fragment containing the I3L
promoter/PRV gp50 gene was isolated and blunt-ended using
the Klenow fragment of the E. coli DNA polymerase in the
presence of 2mM dNTPs.
The 1.4 kb blunt-ended fragment containing the I3L
promoter/PRV gp50 gene was inserted into the ATI insertion
plasmid pSD541. Flanking arms for the ATI region were
generated by PCR using subclones of the Copenhagen HindIII A
region as template. Oligonucleotides MPSYN267 (SEQ ID
N0:56) (5'-GGGCTGAAGCTTGCGGCCGCTCATTAGACAAGCGAATGAGGGAC-3')
and MPSYN268 (SEQ ID N0:57) (5'-
AGATCTCCCGGGCTCGAGTAATTAATTAATTTTTATTACACCAGAAAGACGGCTTGAGAT
C-3') were used to derive the 420 by vaccinia arm to the
right of the ATI deletion. Synthetic oligonucleotides
MPSYN269 (SEQ ID N0:58) (5'-
TAATTACTGAGCCCGGGAGATATAATTTAATTTAATTTATATAACTCATTTTTTCCCC-
3') and MPSYN270 (SEQ ID N0:59) (5'-
TATCTCGAATTCCCGCGGCTTTAAATGGACGGAACTCTTTTCCC-3') were used
to derive the 420 by vaccinia arm to the left of the
deletion. The left and right arms were fused together by
PCR and are separated by a polylinker region specifying
restriction sites for BglII, Smal, and XhoI. The PCR-
generated fragment was digested with HindIII and EcoRI to
yield sticky ends, and ligated into pUC8 digested with
HindIII and EcoRI to generate pSD541.
The pSD541 plasmid containing the I3L/PRV gp50 gene was
designated as pATIgp50. This plasmid was used in in vitro
recombination experiments to generate vP900. vP900 contains
the PRV gp50 gene in place of the ATI gene.
Generation of Double and Triple PRV Recombinants in
NYVAC. In vitro recombination experiments were performed to
generate NYVAC-based recombinants containing multiple PRV
genes. In vitro recombination experiments using the donor
2~~~l'~
V1'O 92/15672 PCT/US92101906
-42-
plasmid, pATIP50, were performed with vP881, vP883, and
vP915 to generate vP912, vP916, and vP925, respectively
(Table 1). Experiments were done with plasmid pPRl8 and
vP883 as rescue virus to yield vP915 (Table 1).
Immunoprecipitation from NYVAC/PRV Recombinant Infected
Cells. Vero cells were infected at an m.o.i. of 10 pfu per
cell with the individual recombinant viruses, with the NYVAC
parent virus, or were mock infected. After a 1 hr
absorption period, the inoculum was removed and infected
cells were overlaid with methionine-free media containing
35S-methionine (20uCi/ml). All samples were harvested at 8
hr post infection. For samples analyzed with the sheep
anti-gpII sera, cells were harvested by centrifugation and
were dissociated with RIPA buffer (1% NP-40, 1% Na-
deoxycholate, 0.1% SDS, O.O1M methionine, 5mM EDTA, 5mM 2-
mercapto-ethanol, lm/ml BSA, and 100 u/ml aprotinin).
Samples analyzed with sheep anti-gpIII and a monoclonal
specific for gp50 were lysed in 1X Buffer A (1% NP40, lOmM ,
Tris (pH7.4), 150mM NaCl, 1mM EDTA, 0.0% Na Azide, 0.2mg/ml
PMSF). All sera was preadsorbed with vP866 infected Vero
cells and all lysates were preadsorbed with normal sera
(sheep or mouse) and protein A-sepharose linked to the
secondary antibody.
Lysates from the infected cells were analyzed for PRV
gpII expression using a sheep anti-gpII serum. This primary
antiserum was incubated with protein A-sepharose conjugated
with rabbit anti-sheep IgG (Boehringer-Mannheim). After an
overnight incubation at 4°C, samples were washed 4 times
with 1 x RIPA buffer, 2 times with LiCl-urea (0.2M LiCl, 2M
urea, lOmM Tris, ph 8.0). Precipitates were harvested by
micro centrifugation. Precipitated protein was dissociated
from the immune complexes by the addition of 2X Laemmli's
buffer (125 mM Tris (pH 6.8), 4% (SDS), 20% glycerol, 10% 2
mercapto-ethanol) and boiling for 5 min. Proteins were
fractionated on a 10% Dreyfuss gel system (Dreyfuss et al.,
1984), fixed and treated with 1M Na-Salicylate for
fluorography.
Lysates were analyzed for PRV gpIII expression using a ,
sheep-anti gpIII sera. This primary antisera was incubated
VVO 92/15672 ~ ~ ~ ~.~ ~ ~ ~ PCT/US92/01906
-43-
with Protein A-Sepharose conjugated with rabbit anti-sheep
IgG (Boehringer-Mannhein). After an overnight incubation at
4°C, samples were washed 4 times with 1X Buffer A and 2
times with the LiCl-urea buffer. Precipitates were treated
and analyzed by flurography as described above.
Lysates were analyzed for PRV gp50 expression using
monoclonal antibody, 22M4 (provided by Rhone Merieux, Lyon,
France). This primary antibody was incubated with Protein
A-Sepharose conjugated with goat anti-mouse IgG and IgM
(Boehringer-Mannheim). The precipitates were recovered and
analyzed as described above for the PRV gpIII
immunoprecipitations.
Expression of the PRV Glyco_proteins in Cells Infected
with the NYVAC~/PRV Recombinants. The PRV gpII, gpIII, and
gp50 products are typical glycoproteins associated with
membranous structures in PRV infected cells. Anti-gpII,
anti-gpIII and anti-gp50 specific monoclonal antibodies
followed by fluorescein-conjugated goat anti-mouse IgG were,
used to analyze the PRV glycoprotein expression on the
surface of recombinant infected Vero cells. Surface
expression of neither gplI, gpIII, nor gp50 was detectable
on the surface of mock infected cells or cells infected with
the NYVAC (vP866) parent virus. PRV gpII expression was
observed on the surface of vP881, vP912, vP915, and vP925
infected cells. PRV gpIII surface expression was observed
in vP883, vP915, vP916, and vP925 infected cells. PRV gp50
surface expression was observed in vP900, vP912, vP916, and
vP925 infected cells. In summary, the surface expression of
the particular PRV glycoproteins was only detectable in
cells infected with NYVAC/PRV recombinants containing the
appropriate PRV gene(s).
Immunoprecipitation of PRV Glycoproteins from Cells
Infected with the NYVAC/PRV Recombinants. The authenticity
of the expressed PRV gpII, gpIII, and gp50 glycoproteins in
Vero cells infected with the NYVAC/PRV recombinants was
analyzed by immunoprecipitation. The PRV gpII gene product
represents one of the major glycoproteins encoded in PRV-
infected cells. The mature protein consists of a complex of
glycoproteins linked by disulfide bonds (Hamplet al., 1984;
WO 92/15672 PCT/US92/01906
-44-
Lukacs et al., 1985). Under reducing conditions, three
species are resolved from this complex. These species (IIa-
IIc) migrate with apparent size of 120 kDa, 74-67 kDa, and
58 kDa, respectively, on an SDS-polyacrylamide gel (Hampl et
al., 1984).
In immunoprecipitation analyses using the anti-PRVgpII
specific serum, no PRV-specific protein species were
precipitated from mock infected cells or cells infected with
the NYVAC (vP866) parent virus. PRV gpII was also not
detectable in cells infected with the non-gpII containing
NYVAC/PRV recombinants vP916, vP883, and vP900. It is
evident that PRV gpII was expressed in all the NYVAC/PRV
recombinants which harbor the PRV gpII gene. These are
vP925, vP912, vP915 and vP881. Lysates from Vero cells
infected with the PRV gpII containing recombinants all
contained protein species consistent with the proper
expression and processing of gpII to gpIIa (120 kDa), gpIIb
(74-67 kDa), and gIIc (58 kDa). Two additional protein
species of 45 kDa and 10 kDa were specifically precipitated
with the anti-gpII serum. These protein species appear to
emerge by an aberrant proteolytic processing of PRV gpII at
late times in recombinant infected cells.
The PRV gpIII product is another major PRV
glycoprotein. The gpIII exists as a monomer not complexed
with other viral proteins that migrates with an apparent
molecular weight of 92 kDa (Hampl et al., 1984; Robbins et
al., 1986b). In immunoprecipitation analyses from NYVAC/PRV
recombinant infected cells using antisera specif is for
gpIII, no anti-gpIII specific protein species were present
in lysates from mock infected cells, nonrecombinant infected
cells, or cells infected with NYVAC/PRV recombinants not
containing gpIII (vP912, vP881, and vP900, respectively).
Lysates from vP925, vP915, vP916, and vP883 infected cells
all contained the 92 kDa PRV gpIII gene product.
The mature PRV gp50 gene product is approximately 50 to
60 kDa (Petrovskis et al., 1986a; Wathen et al., 1984), that
most likely contains O-linked carbohydrate (Petrovskis et
al,., 1986b). In immunoprecipitations from lysates of cells
infected with the NYVAC/PRV recombinants using antisera
WO 92/1,672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-45- -
specific to the PRV gp50 gene product, gp50 was not present
in lysates from mock infected cells, nonrecombinant infected
cells, and cells infected with the recombinants not
containing the gp50 gene (vP915, vP881, and vP883,
respectively). Lysates from cells infected with recombinant
NYVAC viruses containing the PRV gp50 gene (vP925, vP912,
vP916, and vP900, respectively) all expressed a 50-60 kDa
protein species which was specifically precipitated with the
anti-PRV gp50 serum.
Table 1. NYVAC Recombinants Expressing PRV glycoproteins
gplI, gpIII and gp50
Recombinant Parent Donor Plasmid PRV Glycoprotein
vP881 VP866 pPRl8 gpII
vP883 vP866 pPRVIIIVCTK gpIII
vP900 vP866 pATIgp50 gp50
vP912 vP881 pATIgp50 gpII, gp50
vP915 VP883 pPRl8 gpII, gpIII
vP916 vP883 pATIgp50 gpIII, gp50'
vP925 vP915 pATIgp50 gpII, gpIII, gp50
EgamQle 11 - CONSTRUCTION OF NYVAC RECOMBINANTS EXPRESSING
THE gp340, gB and gH GENES OF EPBTEIN-BARB
VIRUS
A NYVAC donor plasmid containing the EBV gp340, gB, and
gH genes was constructed. This donor plasmid was used to
generate two recombinants: vP941 and vP944.
Restriction enzymes were obtained from Bethesda
Research Laboratories, Inc. (Gaithersburg, MD), New England
BioLabs, Inc. (Beverly, MA) or Boehringer-Mannheim
(Indianapolis, IN). T4 DNA ligase and DNA polymerase I
Klenow fragment were obtained from New England BioLabs, Inc.
Standard recombinant DNA techniques were used (Maniatis et
al., 1982) with minor modifications for cloning, screening
and plasmid purification. Nucleic acid sequences were
confirmed using standard dideoxychain-termination reactions
(Sanger, 1977) on alkaline-denatured double-stranded plasmid
templates. M13mp18 phage, pIBI24 and pIBI25 plasmids were
obtained from International Biotechnologies, Inc., CT.
' Cell Lines and Virus Strains. NYVAC was used as a
rescue virus to generate recombinants. All vaccinia virus
~~~Jr ~7
WO 92/15672 PCT/US92/01906 ~ j.;..,
-46-
stocks were produced in Vero (ATCC CCL81) cells in Eagles
MEM medium supplemented with 5-10% newborn calf serum (Flow
Laboratories, Mclean, VI).
OliQOnucleotide-Directed MutaQenesis. The uracil-
substituted single-stranded DNA template used for the
mutagenesis reactions was from CJ236 transformed cells. The
mutations were achieved by using the protocol of Kunkel et
al. (1987). The various oligonucleotides were synthesized
using standard chemistries (Biosearch 8700, San Rafael, CA;
Applied Biosystems 380B, Foster City, CA)
Construction of Vaccinia Virus Recombinants.
Procedures for transfection of recombinant donor plasmids
into tissue culture cells infected with a rescuing vaccinia
virus and identification of recombinants by in situ
hybridization on nitrocellulose filters were as previously
described (Panicali et al., 1982; Piccini et al., 1987).
Modifications and Expression in Vaccinia Recombinants
of EBV Genes qp340, gB, and cxH. The gp340 gene corresponds.
to the open reading frame BLLFla of the complete EBV
sequence (Baer et al., 1984). The gp220 gene derives from
the gp340 mRNA by an internal splicing event (open reading
frame BLLFlb). The gp340 and gp220 genes were isolated from
cDNA clones (plasmids pMLPgp340 and pMLPgp220, respectively)
provided by Dr. Perricaudet (Centre de Recherche sur 1e
Cancer-IRSG, 7 rue Guy Mocquet, 94802 Villejuif, France).
The 2100 by XmaI/ClaI fragment of pMLPgp220 was
inserted into XmaI/ClaI M13 mpl8, and the resulting plasmid
was called mp18gp220. By in vitro mutagenesis using the
oligonucleotides CM4 and CM5 the 5' and 3' extremities of
gp220 gene were modified for expression under the control of
the vaccinia H6 promoter. The plasmid containing the
modified gp220 gene was called mp18gp220(4+5). The
nucleotide composition of CM4 (SEQ ID N0:60) and CM5 (SEQ ID
N0:61) were as follows:
CM4: TAAAGTCAATAAATTTTTATTGCGGCCGCTACCGAGCTCGAATTCG
NotI
CMS: GCTTGCATGCCTGCAGATATCCGTTAAGTTTGTATCGTAATGGAGGCAGCCTTGC
EcoRV , Met
WO 92/15672 ~ ~ ~ ~ N'~ ~ PC'I'/LS92/01906
-47-
The 2300 by NarI/EcoRV fragment of mp18gp220(4+5) was
cloned into the NarI/EcoRV plasmid SP131NotI. SP131NotI
contains the complete H6 vaccinia promoter as previously
deffined (Taylor et al., 1988a, b). The resulting plasmid
was called SP131gp220.
The 2360 by ScaI/XhoI fragment of pMLPgp340 was cloned
into the Scal/XhoI SP131gp220 plasmid. The resulting
plasmid was called SP131gp340.
The 2800 by NotI/NotI fragment of SP131gp340 was cloned
into the SmaI digested vaccinia donor plasmid pSD486. The
resulting plasmid was called 486H6340.
The EBV gB gene corresponds to the open reading frame
BALF4 of the complete EBV sequence (Baer et al., 1984). A
3500 by EcoRI/XmnI fragment was isolated from the EBV BamHI
A fragment and cloned into the HincII/EcoRI plasmid pIBI25.
The resulting plasmid was called p25gB.
By in vitro mutagenesis, using the oligonucleotides
EBVM5 (SEQ ID N0:62) and EBVM3 (SEQ ID N0:63), the EBV gB
gene was adapted for expression under the control of the
vaccinia H6 promoter. The nucleotide composition of EBVM5
(SEQ ID N0:62) and EBVM3 (SEQ ID N0:63) were as follows:
EBVMS:
CCCTACGCCGAGTCATTACGATACAAACTTAACGGATATCAGAGTCGTACGTAGG
EBVM3: CTGGAAACACTTGGGAATTCAAGCTTCATAAAAAGGGTTATAGAAGAGTCC
The resulting plasmid was called p25gB(5+3).
The 2600 by EcoRV/EcoRI fragment of p25gB(5+3) was
cloned into the EcoRV/EcoRI Sp131 plasmid. The resulting
plasmid was called SP131gB.
The EBV gH gene corresponds to the BXLF2 open reading
frame of the complete EBV sequence (Baer et al., 1984). The
complete BXLF2 open reading frame is contained in two BamHI
EBV fragments: BamHI X and BamHI T. The complete BXLF2 open
reading frame was reconstituted by cloning the 830 by
SmaI/BamHI fragment of EBV BamHI T fragment into the
SmaI/BamHI pIBI24 plasmid; the resulting plasmid was called
24gH5. The 1850 by BamHI/HindIII fragment of EBV BamHI X
fragment was cloned into the BamHI/HindIII 24gH5 plasmid.
The resulting plasmid was called 24gH.
~lu~~s!
V1'0 92/15672 PCT/~1S92/01906 .
_48_
By in vitro mutagenesis using the oligonucleotides HMS,
HM4, and HM3 the EBV gH gene was modified to be expressed
under the control of the vaccinia B13R hemorrhagic promoter
(Goebel et al., 1990a,b). The oligonucleotide HM4 was used
to modify a sequence corresponding to a vaccinia early
transcription termination signal. The nucleotide
compositions of HM5 (SEQ ID N0:64), HM4 (SEQ ID N0:65), and
HM3 (SEQ ID N0:66) were as follows:
HMS: ACACAGAGCAACTGCAGATCTCCCGATTTCCCCTCT
HM4: GGGCAAAGCCACAAAATATGCAGGATTTCTGCG
HM3: GCCAGGGTTTTCCCAGATCTGATAAAAACGACGGCCAGTG
The resulting plasmid containing the modified gH was called
24gH(5+4+3).
The vaccinia hemorrhagic promoter does not appear to be
a strong promoter when compared with other pox promoters.
The EBV gH gene has been placed under the control of the 42
kDa entomopox promoter. This was achieved by using the
polymerase chain reaction (PCR), specific oligonucleotides
42gH (SEQ ID N0:67) and BAMgH (SEQ ID N0:68) and the plasmid
24gH(5+4+3) as template.
42gH: GGGTCAAAATTGAAAATATATAATTACAATATAAAATGCAGTTGCTCTGTGTT
Met
BAMgH: ATGGATCCTTCAGAGACAG (The first A residue
corresponds to position 292 of
the gH coding sequence)
The PCR reaction was processed in a Thermal Cycler (Perkin
Elmer Cetus, Norwalk, CT) with 36 cycles at 94°C for 1
minute, 42°C for 1.5 minutes, and 72°C for 3 minutes, and a
final extension step at 72°C for 5 minutes. The PCR product
was purified, digested with BamHI and cloned into the 4550
by SmaI/BamHI fragment of 24gH(5+4+3). The resulting
plasmid was called 24BXLF2.42K.
Insertion of EBV qp340, qB, and gH Genes into the
Vaccinia Donor Plasmid pSD542 and Isolation of vP941 and
vP944. The vaccinia donor plasmid pSD542 is a derivative
of pSD460 with an expanded polylinker region; it is used to
recombine foreign genes into the vaccinia TK locus.
WO 92/15672 ~ ~ ~ ~ PCT/US92/0.1906
-49_
_ The 2820 by BamHI/BalII fragment of 486H6340 plasmid
was cloned into the BamHI/BQlII pSD542 plasmid. The
resulting plasmid was called 542.340.
The 2150 by SmaI/BalII fragment of 248XLF2.42K plasmid
was cloned into the SmaI/BalII 542.340 plasmid. The
resulting plasmid was called 542.340gH.
The 2700 by HindIII/HindIII fragment of SP131gB plasmid
was cloned into the BalII 542.340gH plasmid. The resulting
plasmid was called EBV Triple. 1. A map of the EBV coding
regions inserted into EBV Triple.l plasmid is presented in
FIG. 8. The direction of transcription is indicated by the
arrows in FIG. 8.
EBV Triple.l plasmid was digested by NotI and
transfected into Vero cells infected with NYVAC or vP919, a
NYVAC based vaccinia recombinant containing three HBV genes.
The corresponding recombinant vaccinia viruses vP944 and
vP941 were isolated.
Example 12 - CONBTROCTION OF NYPAC RECOMBINANTB $XPRESSING
THE gB, gC and gD GENES OF HERPES SIMPLEg
VIRUS TYPE 2
A recombinant vaccinia virus that expresses the HSV2
gB, gC and gD genes was constructed.
Cells and Viruses. HSV 2 (strain G) was propagated in
VERO cells (ATCC CCL81) and purified by centrifugation on a
sucrose gradient (Powell et al., 1975).
Vaccinia virus (Copenhagen) and recombinants derived
therefrom were propagated in VERO cells (ATCC CCL81) as
previously described (Panicali et al., 1982; Guo et al.,
1989).
Isolation of the HSV2 gB Gene. A 12 kb BalII fragment,
containing the HSV2 gB gene, was isolated from HSV2 genomic
DNA and inserted into the BamHI site ofsite of pSD48 pUCl9.
The resulting plasmid was designated pJ4.
The gB gene was then cloned between vaccinia virus
flanking arms. This was accomplished by cloning the 2,700
by SstII-SacI (partial) fragment of pJ4 into the SstII-SacI
fragment of pMP409DVC (Guo et al., 1989). This placed the
gB gene between the vaccinia virus sequences flanking the
M2L gene. The plasmid generated by this manipulation was
designated pGBl.
c! t~ ~ r1
WO 92/15672 PCT/US92/01906
-50-
An in-frame termination codon was then added to the 3'-
end of the gB gene. This was accomplished by cloning the
oligonucleotides, GBL3 (SEQ ID N0:69) 5'-CTAATAG-3' and GBL4
(SEQ ID N0:70) 5'-GATCCTATTAGAGCT-3', into the 6,300 by
BamHI-SacI (partial) fragment of pGBl. The plasmid
generated by this manipulation was designated pGB2.
The vaccinia virus H6 promoter (Taylor et al., 1988a,
b; Perkus et al., 1989) was then cloned upstream of the gB
gene. This was accomplished by cloning the 370 by BcrlII
fragment of pBLVHI4 (Portetelle et al., 1991), containing
the H6 promoter, into the BQ1II site of pGB2. The plasmid
generated by this manipulation was designated pGB3.
The initiation codon of the H6 promoter was then
aligned with the initiation codon of the gB gene. This was
accomplished by cloning the oligonucleotides, GBL1 (SEQ ID
N0:71) 5'-
ATCCGTTAAGTTTGTATCGTAATGCGCGGGGGGGGCTTGATTTGCGCGCTGGTCGTGGGG
GCGCTGGTGGCCGC-3' and GBL2 (SEQ ID N0:72) 5'-
GGCCACCAGCGCCCCCACGACCAGCGCGCAAATCAAGCCCCCCCCGCGCATTACGATACA
AACTTAACGGAT-3', into the 6,300 by SstII-EcoRV (partial)
fragment of pGB3. The plasmid generated by this
manipulation was designated pGB5.
The H6-promoted gB gene was then cloned into a
different vaccinia virus donor plasmid. This was
accomplished by cloning the 2,800 by BalII-BamHI fragment of
pGB5, containing the H6- promoted gB gene, into the BalII
site of pSD513VCVQ. (pSD513VCVQ is a subclone of the
vaccinia virus HindIII J fragment in which the thymidine
kinase (tk) gene is replaced by a polylinker region.) This
placed the H6-promoted gB gene between the vaccinia virus
sequences flanking the tk gene. The plasmid generated by
this manipulation was designated pGB6.
Isolation of the HSV2 ctC Gene. A 2,900 by SalI
fragment, containing the HSV2 gC gene, was isolated from
HSV2 genomic DNA and inserted into the SalI site of pIBI25.
The resulting plasmid was designated pGC3.
The gC gene was then cloned between vaccinia virus
flanking arms. This was accomplished by cloning the 2,900
by XhoI-BamHI fragment of pGC3 into the XhoI-BamHI site of
~~~v~~~
WO 92/15672 PCT/US92/01906
-51-
pGC2. pGC2 was generated by cloning the 370 by BalII
fragment of pBLVHI4 (Portetelle et al., 1991), containing
the H6 promoter, into the BalII site of pSD486 (FIG. 2).
This placed the gC gene between the vaccinia virus sequences
flanking the a gene. The plasmid generated by this
manipulation was designated pGC5.
The initiation colon of the H6 promoter was then
aligned with the initiation colon of the gC gene. This was
accomplished by cloning the oligonucleotides, GCL1 (SEQ ID
N0:73) 5'-
ATCCGTTAAGTTTGTATCGTAATGGCCCTTGGACGGGTGGGCCTAGCCGTGGGCCTGTG-
3' and GCL2 (SEQ ID N0:74) 5'-
AGGCCCACGGCTAGGCCCACCCGTCCAAGGGCCATTACGATACAAACTTAACGGAT-3',
into the 5,400 by NruI-SfiI fragment of pGC5. The plasmid
generated by this manipulation was designated pGClO.
Extraneous 3'-noncoding sequence was then eliminated
from pGClO. This was accomplished by recircularizing the E.
coli DNA polymerase I (Klenow fragment) filled-in 4,900 by
SalI-SmaI (partial) fragment of pGClO. The plasmid
generated by this manipulation was designated pGCll.
Additional 3'-noncoding sequence was then eliminated
from pGCll. This was accomplished by cloning the
oligonucleotide, GCL3 5'-CTAGGGCC-3', into the 4,900 by
XbaI-ApaI (partial) fragment of pGCll. The plasmid
generated by this manipulation was designated pGCl2.
Isolation of the HSV2 gD Gene. A 7.5 kb XbaI fragment,
containing the HSV2 gD gene, was isolated from HSV2 genomic
DNA and inserted into the XbaI site of pIBI25. The
resulting plasmid was designated pGDl.
The gD gene was then cloned downstream of the H6
promoter and between vaccinia virus flanking arms. This was
accomplished by cloning the 1,500 by DraI-Pstl fragment of
pGDl into the 3,700 by SmaI-PstI fragment of pTPlS (Guo et
al., 1989). This placed the gD gene downstream of the H6
promoter and between the vaccinia virus sequences flanking
the HA gene. The plasmid generated by this manipulation was
designated pGD2.
The initiation colon of the H6 promoter was then
aligned with-the initiation colon of the gD gene. This was
~~i~'~~~~'~
V1'O 92/15672 PCT/US92/01906
-52-
accomplished by cloning the oligonucleotides, GDL1 (SEQ ID
N0:75) 5'-ATCCGTTAAGTTTGTATCGTAATGGGGCGTTTGACCTCCGG-3' and
GDL2 (SEQ ID N0:76) 5'-
CGCCGGAGGTCAAACGCCCCATTACGATACAAACTTAACGGAT-3', into the
5,100 by EcoRV-AhaII (partial) fragment of pGD2. The
plasmid generated by this manipulation was designated pGDS.
Extraneous 3'-noncoding sequence was then eliminated.
This was accomplished by cloning the oligonucleotides, GDL3
(SEQ ID N0:77) 5'-
GGCAGTACCCTGGCGGCGCTGGTCATCGGCGGTATTGCGTTTTGGGTACGCCGCCGGCGC
TCAGTGGCCCCCAAGCGCCTACGTCTCCCCCACATCCGGGATGACGACGCGCCCCCCTCG
CACCAGCCATTGTTTTACTAGCTGCA-3' and GDL4 (SEQ ID N0:78) 5'-
GCTAGTAAAACAATGGCTGGTGCGAGGGGGGCGCGTCGTCATCCCGGATGTGGGGGAGAC
GTAGGCGCTTGGGGGCCACTGAGCGCCGGCGGCGTACCCAAAACGCAATACCGCCGATGA
CCAGCGCCGCCAGGGTACTGCC-3', into the 4,800 by NaeI-PstI '
fragment of pGD5. The plasmid generated by this
manipulation was designated pGD7.
Additional sequence was then added upstream of the H6
promoter. This was accomplished by cloning the 150 by
BctlII-EcoRV fragment of pGB6 (see above) into the 4,800 by
BalII-EcoRV fragment of pGD7. The plasmid generated by this
manipulation was designated pGD8.
Construction of a Vaccinia Virus Donor Plasmid
Containing the HSV2 cxB, gC and QD Genes. A plasmid.
containing the gC and gD genes was constructed. This was
accomplished by cloning the 1,850 by PstI fragment of pGCl2,
containing the H6-promoted gC gene, into the PstI site of
pGD8. The plasmid generated by this manipulation was
designated pGCDl.
A plasmid containing the gB, gC and gD genes was then
constructed. This was accomplished by cloning the 2,800 by
BalII-BamHI fragment of pGB6, containing the H6-promoted gB
gene, into the 6,800 by BamHI (partial) fragment of pGCDl.
The plasmid generated by this manipulation was designated
pGBCDl.
Extraneous DNA was then eliminated. This was
accomplished by cloning the E. coli DNA polymerase I (Klenow
fragment) filled-in 6,000 by HindIII-BamHI (partial)
fragment of pGBCDl, containing the H6-promoted gB, gC and gD
V1'O 92/ I X672 ~ '~ ~ ~ ) '~ '~ PCT/US92/Ol 906
-53-
genes, into the SmaI site of pMP831. The plasmid generated
by this manipulation was designated pGBCDCl.
The H6-promoted gB, gC and gD genes were then cloned
between vaccinia virus flanking arms. This was accomplished
by cloning the oligonucleotides, HSVL1 (SEQ ID N0:79) 5'-
TCGATCTAGA-3' and HSVL2 (SEQ ID N0:80) 5'-AGCTTCTAGA-3', and
the 5,700 by HindIII-BamHI (partial) fragment of pGBCDCl,
containing the H6-promoted gB, gC and gD genes, into the
3,600 by XhoI-BQ1II fragment of pSD541. This placed the H6-
promoted gB, gC and gD genes between the vaccinia virus
sequences flanking the ATI gene. The plasmid generated by
this manipulation was designated pGBCD4.
Construction of vP914. A vaccinia virus recombinant,
vP914, containing the HSV2 gB, gC and gD genes, was
constructed. The procedures used to construct vaccinia
virus recombinants have been described previously (Panicali
et al., 1982; Guo et al., 1989; Guo et al., 1990). The
vaccinia virus recombinant, vP914, was generated by
transfecting pGBCD4 into vP866 (NYVAC) infected cells. The
HSV2 genes in this recombinant are under the transcriptional
control of the vaccinia virus H6 promoter.
Immunofluorescence and Immunoprecipitation of vP914
Infected Cells. Immunofluorescence and immunoprecipitations
were performed as previously described (Guo et al., 1989).
Rabbit antisera against HSV2 was obtained from DAKO Corp.
(code no. B116). Monoclonal antibodies against HSV2 gB
(H233) and HSV2 gD (HD1) (Meignier et al., 1987) were
obtained from B. Meignier (Institut Merieux, Lyon, France).
In HSV2 infected cells, gB, gC and gD (as well as other
HSV2 glycoproteins) are expressed on the cell surface.
Immunofluorescence studies with vP914 infected cells, using
monoclonal antibodies specific for HSV2 gB (H233) and HSV2
gD (HD1), indicated that the HSV2 gB and gD glycoproteins
produced in these cells were also expressed on the cell
surface .
In HSV2 infected cells, gB, gC and gD have molecular
weights of approximately 117 kDa, 63 kDa and 51 kDa,
respectively (Marsden et al., 1978; Marsden et al., 1984; ,
Zweig et al., 1983). Immunoprecipitation of vP914 infected
V1'O 92/1672 PCT/US92/01906
-54-
cells with a gB-specific monoclonal antibody (H233)
precipitated three major proteins with molecular weights of
approximately 117 kDa, 110 kDa and 100 kDa, as well as other
minor proteins. Immunoprecipitation with a gD-specific
monoclonal antibody (HD1) precipitated a major protein with
a molecular weight of approximately 51 kDa and minor
proteins with molecular weights of approximately 55 kDa and
46 kDa. Additionally, immunoprecipitation of vP914 infected
cells with polyclonal antisera against HSV2 precipitated a
protein with a molecular weight similar to gC, 63 kDa, (as
well as an 85 kDa protein) and proteins corresponding in
size to gB and gD. Therefore, cells infected with vP914
appeared to express HSV2 proteins with molecular weights
similar to gB, gC and gD.
Example 13 - CONSTRUCTION OF NYVAC RECOMBINANTS EgPRE88ING
HEPATITIS B VIRUS GENES
DNA Cloning and Synthesis. Plasmids were constructed,
screened and grown by standard procedures (Maniatis et al.,.
1982; Perkus et al., 1985; Piccini et al., 1987).
Restriction endonucleases were obtained from Bethesda
Research Laboratories (Gaithersburg, MD), New England
Biolabs (Beverly, MA) and Boehringer Mannheim Biochemicals
(Indianapolis, IN). T4 DNA ligase was obtained from New
England Biolabs. T4 polynucleotide kinase was obtained from
Bethesda Research Laboratories. Plasmid pGEM-3Z was
obtained from Promega (Madison, WI). The origin of plasmid
pTHBV containing the HBV genome cloned in pBR322 has been
previously described (Paoletti et al., 1984).
Synthetic oligodeoxyribonucleotides were prepared on a
Biosearch 8750 or Applied Biosystems 380B DNA synthesizer as
previously described (Perkus et al., 1989). DNA sequencing
was performed by the dideoxy-chain terminating method
(Singer et al., 1977) using Sequenase (Tabor and Richardson,
1987) as previously described (Guo et al., 1989). DNA
amplification by polymerise chain reaction (PCR) for cloning
and sequence verification (Engelke et al., 1988) was
performed using custom synthesized oligonucleotide primers
and GeneAmp DNA amplification Reagent Kit (Perkin Elmer
VVO 92/1,672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
.,
.l J r.i
-55-
Cetus, Norwalk, CT) in an automated Perkin Elmer Cetus DNA
Thermal Cycler.
Virus and Transfection. The NYVAC strain of vaccinia
virus and its intermediate ancestor, vP804 (FIG. 5), were
used. Generation and processing of recombinant virus are as
previously described (Panicali et al., 1982).
Immunoprecipitation. Vero cells were infected at an
m.o.i. of 10 pfu per cell with recombinant vaccinia virus,
with the NYVAC parent virus (vP866) or were mock infected.
After a 1 hour adsorption period, the inoculum was removed
and infected cells were overlayed with methionine-free media
containing 35S-methionine (20 uCi/ml). All samples were
harvested at 8 hours post infection. Samples were lysed in
3x buffer A containing triton and DOC (3~ NP-40, 3$ triton,
3~ DOC,,30 mM Tris pH 7.4, 450 mM NaCl, 3 mM EDTA, 0.03
NaAzide, 0.6 mg/ml PMSF) containing 50 u1 aprotinin (Sigma
Chemical Co., St. Louis, MO, # A6279). All lysates were
precleared against normal rabbit sera linked to protein A-
sepharose.
Rabbit antisera raised to HBV core antigen and to HBV
S2 peptide (aa 120-153) were obtained from R. Neurath (The
Lindsley F. Kimball Research Institute of the New York Blood
Center). .Anti-S2 antiserum was preadsorbed with vP866
infected Vero cells. HBV proteins were immunoprecipitated
using anti-core or anti-S2 antiserum and resuspended in 2x
Laemmli sample buffer (Laemmli, 1970) for electrophoresis
and subsequent autoradiography.
Serolocty. Rabbits and guinea pigs were inoculated with
108 pfu recombinant vaccinia virus vP919 in sets of two by
intradermal, subcutaneous or intramuscular route. Six weeks
after the primary inoculation, rabbits were boosted once by
the same route and dose. Seven weeks after the primary
inoculation, guinea pigs were boosted once by the same route
and dose. Groups of 12 mice were inoculated with 10~ pfu
recombinant vaccinia virus vP919 by intradermal,
subcutaneous or intramuscular route. Seven weeks after the
primary inoculation, mice were boosted once by the same
route. Sera were collected at weekly intervals. Weekly
bleedings from each group of mice were pooled. All sera
~lUJ~.~d
WO 92/1672
PCT/US92/01906
~>2.
-56-
were analyzed for antibody to HBV surface antigen using the
AUSAB radioimmunoassay kit (Abbott, North Chicago, IL). All
sera were analyzed for antibody to HBV core antigen using
the CORAB competitive radioimmunoassay kit (Abbott) using
standard techniques.
Construction of vP919. Vaccinia recombinant vP919
contains three genes from Hepatitis B°.Virus inserted into
NYVAC vaccinia virus vector. The genes were inserted
individually into three different'sites of the virus. The
three HBV genes encode the following protein products: (1)
HBV M protein, (referred to here as small pre S antigen, or
spsAg), (2) HBV L protein (referred to here as large pre S
antigen, or lpsAg) and (3) a fusion protein, (referred to
here as S12/core) composed of the entire pre-S region (S1 +
S2) linked onto the amino terminus of the core antigen.
Vaccinia virus does not maintain multiple copies of the
same heterologous DNA sequences inserted contiguously into a
single vaccinia genome (Panicali et al., 1982) Since coding
sequences for the spsAg are contained within coding
sequences for the lpsAg, insertion of both genes into a
single vaccinia genome would be expected to lead to
instability of the genome. Similarly, an S1+S2 DNA region
present in a hybrid S12/core gene could undergo
recombination with the equivalent S1+S2 region of lpsAg.
These potential problems were prevented in two ways. (1)
The three genes were inserted into three different loci in
the vaccinia genome, separated from each other by large
regions of vaccinia DNA containing essential genes. Thus,
any recombination between the HBV genes would lead to
incomplete vaccinia genomes which would not produce viable
vaccinia progeny. (2) DNAs encoding the spsAg gene and the
S1+S2 region of the S12/core hybrid gene were synthesized
chemically with different codon usage to minimize DNA
homology with the native HBV gene encoding the lpsAg and
with each other. The native HBV gene encoding the lpsAg and
the synthetic gene encoding the spsAg are of the ayw
subtype; the S1+S2 region for the fusion S12/core gene was
synthesized to correspond to the adw2 subtype (Valenzuela et
al., 1979).
~'O 92/15672 ~ s" ~ PCT/tJS92/01906
~~~~~~7
-57-
Cassettes containing the three individual HBV genes
under the control of poxvirus promoters were assembled in
different vaccinia donor plasmids and inserted sequentially
into vaccinia virus as detailed below.
The synthetic version of the gene encoding the HBV
spsAg was synthesized using vaccinia favored codons with the
following deviations. (1) The TSNT early transcription
terminator TTTTTCT occurring in amino acids 19 through 21 of
the sAg (HBV S protein) was modified to TTCTTTC, and codon
utilization was adjusted to prevent the generation of other
TSNT termination signals (Yuen et al., 1987). (2) To avoid
possible aberrant translation products, codon usage was
adjusted to prevent the generation of any out of frame ATG
initiation codons in either direction. The synthetic spsAg
gene was linked precisely to the modified synthetic vaccinia
virus H6 early/late promoter (Perkus et al., 1989). The
complete sequence of promoter and gene is given in FIG. 9.
Amino acid sequence is based on the sequence in plasmid
pTHBV, which differs from the published ayw sequence
(Galibert et al., 1979) at two amino acid positions in the
S2 region: Galibert, as 31 thr; as 36 leu; pTHBV, as 31 ala;
as 36 pro.
Plasmid pGJl5 contains the H6 promoter/synthetic spsAg
gene in the vaccinia ATI insertion locus (Perkus et al.,
1990). pGJlS was constructed by assembling portions of the
synthetic spsAg gene in pGEM-3Z, then transferring the
assembled gene to insertion plasmid pMP494H, a derivative of
pSD492 which contains the synthetic H6 promoter in the ATI
deletion locus.
Referring now to FIG. 10, the synthetic HBV spsAg was
assembled in three parts. Plasmids pGJS, pGJ3, and pGJ7
were generated from 6, 5, and 8 pairs of complementary
oligonucleotides respectively as follows. Complementary
oligonucleotide pairs synthesized with standard chemistries
were kinased under standard conditions followed by heating
at 65°C and allowed to cool slowly to room temperature to
effect annealing. Aliquots of the annealed pairs comprising
each fragment were combined with appropriately digested
pGEM-3Z (Promega) and ligated under standard conditions.
WO 92/15672 PC1'/US92/01906
-58-
Fragment SX (indicated with a solid box), bounded by SphI
and XbaI restriction sites, was ligated to pGEM-3Z vector
plasmid digested with those enzymes creating plasmid pGJ5.
Vector plasmid sequences are indicated with open regions.
Similarly, fragments XB (diagonal cross-hatch) and BH .
(horizontal cross-hatch), were assembled in plasmid pGEM-3Z
digested with either XbaI and BamHI, or BamHI and HindIII,
respectively, generating plasmids pGJ3 and pGJ7. The
integrity of the insert in each plasmid was verified by
determination of the DNA sequence.
Synthetic HBV gene fragments were isolated by digestion
of the plasmids pGJ5, pGJ3 and pGJ7 with the appropriate
.restriction enzymes flanking the SX, XB and BH gene segments
and subsequently ligated to pGEM-3Z digested with SphI and
HindIII generating plasmid pGJ9 which contains the
contiguous HBV synthetic spsAg sequence. Oligonucleotides
H6LINK (SEQ ID N0:81)
(5'-CTCGCGATATCCGTTAAGTTTGTATCGTAATGCAGTGG-3') and H6LINK2 .
(SEQ ID N0:82)
(5'-AATTCCACTGCATTACGATACAAACTTAACGGATATCGCGAGGTAC-3')
containing the 3' 28 by of the H6 promoter (diagonal hatch)
appended to the synthetic spsAg at the initiating methionine
through the EcoRI site 9 by downstream from the first codon,
were ligated to pGJ9 digested with K~nI (5' to the St~hI site
within the multiple cloning region derived from pGEM-3Z) and
with EcoRI, generating plasmid pGJl2. A NruI/H~aI fragment
was isolated from pGJl2 and ligated to similarly digested
pMP494H, generating plasmid pGJlS. pMP494H is an ATI
insertion plasmid containing the vaccinia H6 promoter in the
ATI deletion region. pGJlS contains the H6 promoter-driven
HBV synthetic spsAg gene flanked by vaccinia sequences
(stippled) surrounding the ATI locus.
pGJlS was used as donor plasmid for recombination with
vaccinia recombinant vP804, generating recombinant vaccinia
virus vP856. vP804 contains the NYVAC deletions for the TK,
HA, a and [C7L - K11]. Recombinant virus vP856 contains the
above deletions with the insertion of the HBV synthetic
spsAg gene replacing the ATI region. Progeny virus
recombina-nt described below containing an insert in the I4L
WO 92/15672 ~ ~ ~i ~ ~ ~ ~ PCT/US92/01906
-59-
region will be equivalent to NYVAC in terms of deletions
(TK, HA, ATI, I4L, u, [C7L - K1L]).
The gene encoding the HBV lpsAg was derived from
plasmid pTHBV. In addition to the amino acid changes in the
S2 region referred to above, pTHBV differs from the
published ayw subtype at one amino acid position in the S1
region: Galibert et al., 1979, as 90 ser; pTHBV as 90 thr.
The early translational termination signal in sAg referred
to above was modified from TTTTTCT to TTCTTCT. The entire
lpsAg gene was placed under the control of the 105 by cowpox
a promoter (Pickup et al., 1986) The entire sequence of
the a promoter/lpsAg gene cassette is given in FIG. 11.
Plasmid pMP550ulps contains the a promoter/lpsAg gene
in the vaccinia I4L deletion locus. The construction of
pMP550ulps is presented schematically in FIG. 12. The I4L
deletion in pMP550ulps is equivalent to the I4L deletion in
NYVAC.
Referring now to FIG. 12(A), by PCR using synthetic
oligonucleotide primers MPSYN322 (SEQ ID N0:83), MPSYN323
(SEQ ID N0:84) and template plasmid pBScow, the 5' end of
the HBV lpsAg gene was added to the cowpox a promoter
(orientation indicated by an arrow) generating pMPuSl. (The
dark box indicates the a promoter and the striped box
indicates HBV sequences.) pSD550 is a vaccinia insertion
plasmid for the I4L deletion region. (The triangle
indicates the site of deletion and the open box indicates
vaccinia sequences.) A SnaBI/BamHI fragment containing the
a promoter/HBV junction was isolated and inserted into
pSD550 cut with SmaI/BamHI, forming pMP550u.
Referring now to FIG. 12(B), a 1.1 kb DraI fragment
containing the entire HBV lpsAg was isolated from pTHBV and
inserted into pUC8, generating pMPBS. Translation
- initiating codon and stop codon are indicated. (*)
indicates the site of TSNT transcriptional termination
signal (Yuen et al., 1987). The transcriptional termination
signal was removed from pMPBS by PCR mutagenesis as
indicated, generating pMPBST. A 1.1 kb BamHI (partial)
fragment containing the bulk of the lpsAg gene was isolated
from pMPBST and inserted into plasmid pMP550u cut with
~~~~ ~7
WO 92/1672 PCT/US92/01906
-60-
BamHI, generating pMP550ulps, pMP550ulps was used for
recombination with vaccinia recombinant vP856, generating
vP896. Synthetic oligonucleotide sequences are as follows:
BalII ClaI
MPSYN322 (SEQ ID N0:83) 5' CCCAGATCTATCGATTGCCATGGGGCAGA 3'
BamHI
MPSYN323 (SEQ ID N0:84) 5' TCTGAAGGCTGGATCCAACT 3'
XhoI
MPSYN330 (SEQ ID N0:85) 5' CAATCTTCTCGAGGATT 3'
HincII
MPSYN331 (SEQ ID N0:86) 5' AACAAGAAGAACCCCGCC 3'
The HBV initiation codon in MPSYN322 (SEQ ID N0:83) is
underlined, the mutated base in MPSYN331 (SEQ ID N0:86) is
underlined and restriction sites are indicated.
pMP550ulps was used as donor plasmid for recombination
with rescuing virus vP856 described above to generate
recombinant virus vP896. vP896 contains both the genes for
HBV spsAg and HBV lpsAg in a NYVAC background (deletion of~
TK, HA, ATI, I4L, u, [C7L - K1L]). To generate a
recombinant containing only the HBV lpsAg gene for purposes
of comparison with multivalent HBV vaccinia recombinants,
pMP550ulps was also used in recombination with vP866
(NYVAC), generating recombinant virus vP897.
The third HBV gene inserted into vaccinia virus encodes
a fusion protein. Synthetic DNA specifying the HBV S1 and
S2 regions was cloned onto the 5' end of the gene specifying
the HBV core antigen. Synthetic DNA was designed to encode
the S1 + S2 regions of the adw subtype (Valenzuela et al.,
1979), starting with the met at as position 12 (equivalent
to position 1 of the ayw subtype) (Galibert et al., 1979).
Total translation region of S1 + S2 is 163 codons. To
prevent unwanted intramolecular recombination among HBV
genes in a multivalent HBV vaccinia recombinant virus, codon
utilization was adjusted to minimize DNA homology of the
synthetic S1 + S2 region with the native ayw S1 + S2 region
present in pTHBV and as well as the synthetic S2 region in
pGJlS.
The entire gene encoding the core antigen was obtained '
from pTHBV. The amino acid sequence of the core antigen
WO 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-61-
encoded by pTHBV agrees with the published ayw sequence
(Galibert et al., 1979). The hepatitis fusion gene encoding
S12/core was placed under the control of the vaccinia I3L
early/intermediate promoter (Vos et al., 1988; Goebel et
al., 1990b positions 64,973 - 65,074). The entire sequence
of the I3L promoter/S12/core gene cassette is given in FIG.
13 (SEQ ID N0:87).
Plasmid pMP544I3S12C contains the I3L
promoter/S1+S2/core gene in the HA deletion locus (Guo et
al., 1989). The construction of pMP544I3S12C is presented
schematically in FIG. 14.
Referring now to FIG. 14, plasmid pMPCA-B contains a 1
kb HhaI fragment from pTHBV inserted into the SmaI site of
pUC9. pMP9CA-B contains the entire coding sequences for the
HBV core antigen, as well as flanking HBV DNA upstream and
downstream from the gene. pMP9CA-B was cut with BQ1II
(partial) 30 by upstream from the 3' end of the gene and
with EcoRI in the polylinker region at the HBV/pUC junction.
The 3.4 kb vector fragment containing the bulk of the HBV
gene was isolated and ligated with annealed synthetic
oligonucleotides MPSYN275/MPSYN276, (SEQ ID N0:88/SEQ ID
N0:89)
BalII
MPSYN275 (SEQ ID N0:88) 5'GATCTCAATCTCGGGAATCTCAATGTTAGAT-
SmaI
AACTAATTTTTATCCCGGGT 3'
MPSYN276 (SEQ ID N0:89) 3' AGTTAGAGCCCTTAGAGTTACA-
ATCTATTGATTAAAAATAGGGCCCATTAA 5'
generating pMP9CA-C. Restriction sites are indicated, the
translational stop codon is underlined and the early
vaccinia transcriptional terminator is overlined.
pMP9CA-C contains the entire coding sequence for the
HBV core antigen, and was used as the source for the bulk of
the gene as indicated above.
The synthetic S1+S2 region was assembled in five double
stranded sections A through E as indicated above using
synthetic oligonucleotides, MPSYN290 through MPSYN308 (SEQ
ID N0:90)-(SEQ ID N0:99), as set out below.
Oligonucleotides ranged in size from 46mer through 7lmer,
H'O 92/15672
PCT/US92/01906
-62- a:
with 4 to 8 by sticky ends. 5' ends of oligonucleotides
which were at internal positions within a section were
kinased before annealing of the section. Sequence of
synthetic oligonucleotides used to construct sections A
through E are given below. Only the coding strand is shown.
Relevant restriction sites are noted. Initiation codons for
S1 (section A), S2 (section C) and core (section E) are
underlined.
Section A, MPSYN290-294 (SEQ ID N0:90)-(SEQ ID N0:92)
HindIII RsaI (I3L) (S1)
MPSYN290 (SEQ ID N0:90) 5'AGCTTGTACAATTATTTAGGTTTAATCATGGGAA
CGAACCTATCTGTT 3'
MPSYN292 (SEQ ID N0:91) 5'CCCAACCCACTTGGATTTTTTCCTGATCATCAGT
TAGACCCTGCTTTC 3'
MPSYN294 (SEQ ID N0:92) 5'GGAGCCAACTCAAACAATCCTGACTGGGATTT
PstI
TAACCCCGTCAAAGACGATTGGCCTGCA 3'
Section B, MPSYN296-299
PstI
MPSYN296 (SEQ ID N0:93) 5'GCCAACCAAGTAGGTGTGGGAGCTTTCGGACC-
AAGGCTCACTCCTCCACACGGCGGT 3'
MPSYN298 (SEQ ID N0:94) 5'ATATTAGGTTGGTCTCCACAAGCTCAAGG-
HincII EcoRI
CATATTGACCACAGTGTCAACCCG 3'
Section C, MPSYN300-303
HindIII HincII
MPSYN300 (SEQ ID N0:95) 5' AGCTTGTCAACAATTCCTCCACCAGCCTCT-
ACTAATCGGCAGTCTGGT 3'
MPSYN302 (SEQ ID N0:96) 5' AGACAGCCAACTCCCATCTCTCCTCCTCTA- _
(S2) EcoRI
AGAGACAGTCACCCACAAGCTATGCAGTGG 3'
Section D, MPSYN304-305
HindIII EcoRI
MPSYN304 (SEQ ID N0:97) 5' AGCTTGGGAATTCAACTGCTTTTCACCAG-
WO 92/15672 Z ~ ~ ~ ~ ~ ~ PCT/US92/01906
-63-
PstI
ACACTTCAAGACCCTAGAGTCAGGGGTCTATATCTTCCTGCA 3'
Section E, MPSYN306-308
PstI
MPSYN306 (SEQ ID N0:98) 5'GGTGGATCTAGTTCTGGAACTGTAAACCCAGCT-
CCGAATATTGCCAGTCACATCTC 3'
MPSYN308 (SEQ ID N0:99) 5' GTCTATCTCCGCGAGGACTGGAGACCCAGTGAC
(core) TaaI
GAACATGGACAT 3'
The vaccinia I3L promoter was synthesized using pMPl, a
subclone of HindIII I, as template and synthetic
oligonucleotides MPSYN310 (SEQ ID NO:100), MPSYN311 (SEQ ID
NO:101) as PCR primers. Restriction sites are indicated.
MPSYN310 (SEQ ID NO:100) 5'
HindIII SmaI
CCCCCCAAGCTTCCCGGGCTACATCATGCAGTGGTTAAAC 3'
RsaI
MPSYN311 (SEQ ID NO:101) 5' ACTTTGTAATATAATGAT 3'
The I3 promoter/HBV S1+S2/core expression cassette was
assembled in pUC8 and pUC9 in steps, using the intermediate
plasmid clones detailed above, resulting in pMP9I3S12core.
Restriction sites are indicated only where relevant.
Plasmid pMP9I3S12core was digested with SmaI and a 1.2 kb
fragment containing the entire promoter/gene cassette was
isolated. Vaccinia HA deletion plasmid pSD544 was cut with
SmaI and ligated with the 1.2 kb fragment, producing plasmid
pMP544I3S12C.
pMP544I3S12C was used as donor plasmid for
recombination with vaccinia recombinant vP896 described
above to generate recombinant vaccinia virus vP919. vP919
contains all three HBV inserts: spsAg, lpsAg and S12/core
fusion in the NYVAC background. The sequence of all HBV
insertions in vP919 was confirmed by polymerase chain
reaction (PCR) using vP919 as template, followed by dideoxy
sequencing of PCR generated material. In addition,
pMP544I3S12C was used in recombination with vP804 described
above to generate recombinant vaccinia virus vP858
containing only the HBV S12/core fusion. pMP544I3S12C was
if el i.r 1 I
~~ 92/1672
PCT/US92/01906
-64-
also used in recombination with recombinant vaccinia virus
vP856 to generate recombinant vaccinia virus vP891. vP891
contains two HBV gene insertions, spsAg and S12/core.
Expression of HBV Proteins by vP919. To assay for the
various HBV proteins synthesized by the triple HBV
recombinant, metabolically labelled lysates from cells
infected with vP919 and appropriate waccinia recombinants
containing single and double HBV gene insertions were
subjected to immunoprecipitation and analyzed by SDS-
polyacrylamide gel electrophoresis followed by
radioautography. Proteins in uninfected cells and cells
infected with vP866 (NYVAC), vP856 (spsAg), vP896 (spsAg +
lpsAg) or vP919 (spsAg, lpsAg, S12/core) were
immunoprecipitated using rabbit anti-S2 antiserum. Proteins
in additional uninfected cells and additional cells infected
with vP919_(spsAg, lpsAg, S12/core), vP858 (S12/core) or
vP866 (NYVAC) were immunoprecipitated using rabbit anti-core
antiserum. Anti-S2 serum precipitates a major protein of 33
kDa from vaccinia single recombinant vP856 containing the
gene for spsAg. This corresponds to the expected size for
the singly glycosylated form of HBV spsAg. A protein 36
kDa, corresponding to the expected size for the doubly
glycosylated form of spsAg is precipitated in lesser amount.
Anti-S2 serum precipitates the same proteins from vaccinia
double recombinant vP896, containing the genes for spsAg and
lpsAg. In addition, two larger proteins of 38 and 41 kDa
are precipitated, which correspond well to the expected
sizes of lpsAg (39 kDa unglycosylated and 42 kDa
glycosylated). All proteins precipitated by anti-S2 serum
from vP856 and vP896 are also precipitated from vaccinia HBV
triple recombinant vP919.
The predicted size for the HBV S12/core fusion protein
is 38 kDa. Rabbit anti-core antiserum precipitated a
protein of the predicted size as well as a variety of
smaller proteins from vP858, the vaccinia single recombinant
containing the HBV fusion gene S12/core. The most abundant
protein precipitated from vP858 by anti-core serum had a
size of 27 kDa. This corresponds in size to the translation
product which would be predicted if translation of the
V1'O 92/1;672
PCI'/US92/01906
-65-
fusion protein gene began at the second (S2) ATG. The 29
kDa protein precipitated from vP858 may be the glycosylated
form of the 27 kDa protein. A smaller protein of 20 kDa,
corresponding in size to the translation product for core
protein alone, was also precipitated from vP858 in lesser
amounts. Vaccinia recombinant vP919, containing all three
HBV genes (spsAg, lpsAg and S12/core fusion), gave an
identical pattern to that observed with vP858 following
immunoprecipitation with anti-core antiserum. The 27 kDa
and 29 kDa proteins precipitated from vP858 and vP919 by
anti-core antiserum were, as expected, also precipitated
from vP919 by anti-S2 antiserum.
Antibody Response to vP919. To test for serological
response to HBV proteins produced by vP919, the virus was
inoculated into rabbits, guinea pigs and mice. Rabbits and
guinea pigs were inoculated with 108 pfu recombinant
vaccinia virus vP919 in sets of two by intradermal,
subcutaneous or intramuscular route. Six weeks after the
primary inoculation, rabbits were boosted once by the same
route and dose. Seven weeks after the primary inoculation,
guinea pigs were boosted once by the same route and dose.
Groups of 12 mice were inoculated with 10~ pfu recombinant
vaccinia virus vP919 by intradermal, subcutaneous or
intramuscular route. Seven weeks after the primary
inoculation, mice were boosted once by the same route. Sera
were collected at weekly intervals. Weekly bleedings from
each group of mice were pooled. All sera were analyzed for
antibody to HBV surface antigen using the AUSAB
radioimmunoassay kit (Abbott). All sera were analyzed for
antibody to HBV core antigen using the CORAB competitive
radioimmunoassay kit (Abbott). Assays were performed using
standard techniques. The results of these analyses are
presented in Tables 2 (rabbits), 3 (guinea pigs) and 4
(mice) .
Summarizing the results presented in Table 2, all six
rabbits exhibited an anti-core antibody response following a
single inoculation with vP919. In five of the six rabbits,
the anti-core antibody response was boosted by a second
inoculation of vP919. Four of six rabbits exhibited an anti
Z~~~~~7
WO 92/1672
PCT/US92/01906 ~.",.
-66-
sAg response following a single inoculation of vP919. These
four rabbits, plus one additional rabbit, showed an increase
in the anti sAg response following the second inoculation.
Summarizing the results presented in Table 3, one
guinea pig exhibited an anti-core response following an
initial inoculation with vP919; following the boost at 7
weeks, a total of three guinea pigs showed an anti-core
response. One of these animals showed an anti-sAg antibody
response in week eight only.
Summarizing the results presented in Table 4, all three
groups of mice showed anti-core antibody responses at
various times after inoculation with vP919; two of the three
groups also showed anti-sAg responses.
AUSRIA Assav. Expression of particulate HBV surface
antigen from cells infected with HBV-containing vaccinia
recombinants was assayed using the commercially available
AUSRIA II-125 kit (Abbott Laboratories, North Chicago, IL).
Dishes containing 2 x 106 Vero cells were infected in
triplicate with recombinant vaccinia virus at 2 pfu/cell.
After 24 h, culture medium was removed, cells were washed
with 2 ml PBS and the wash combined with the medium and
centrifuged at 1000 rpm for 10 min. The supernatant was
designated the medium fraction. The cell fraction was
prepared by adding 2 ml PBS to the dish, scraping off the
cells and combining with the cell pellet from above. The
final volume of both medium and cell fractions were adjusted
to 4 ml with PBS. Cell fractions were sonicated for 2 min
before assay. Cell fractions and medium fractions were
assayed for the presence of HBV surface antigen.at a 1:5
dilution using the AUSRIA kit. Samples below the cutoff
value of 2.1 x the negative control supplied in the kit were
considered negative. Output virus of cell and medium
fractions from all dishes were titered on Vero cells.
Results are shown in Table 5.
Construction of Vaccinia Recombinants E ressin the
HBV lpsAct under the Control of the EPV 42 kDa Promoter.
Vaccinia recombinant vP919 contains three distinct HBV genes
under the control of three different poxvirus promoters
which function at early times post infection. To compare
N'4 92/1;672 ~ ~ ~ ,"~ ~' "°
PCT/ US92/01906
-67-
the relative strength of various poxvirus promoters
expressing a foreign gene at early times post infection in
the same vaccinia background, a sandwich ELISA assay was
developed, utilizing the rabies glycoprotein G gene as the
test gene. Using this test system, the vaccinia H6 promoter
and the vaccinia I3L promoter were found to be stronger
promoters than the cowpox a promoter. In vP919 the H6
promoter directs expression of the HBV spsAg, the I3L
promoter directs expression of the HBV S12/core fusion, and
the a promoter directs expression of the HBV lpsAg. The
relatively weak a promoter was purposely selected for
expression of HBV lpsAg, since it has been shown that
coexpression of lpsAg interferes with particle formation and
secretion of sAg or spsAg (0u et al., 1987; Cheng et al.,
1986; McLachlan et al., 1987; Chisari et al., 1986).
The AUSRIA radioimmunoassay kit was used to measure the
in vitro production of particles containing sAg or spsAg by
recombinant vaccinia virus expressing HBV genes.
Preliminary investigation showed that AUSRIA-reactive
particle formation and secretion occurred in vP856
(containing spsAg), vP896 (containing spsAg + lpsAg) and
vP919 (containing spsAg + lpsAg + S12/core). In vP896 and
vP919, the relative levels of secretion of AUSRIA-reactive
particles were lower than that observed with vP856.
To determine whether formation and secretion of AUSRIA-
reactive particles could be observed in the presence of
higher levels of lpsAg expression, the lpsAg gene was placed
under the control of the entomopox (EPV) 42 kDa promoter.
By the comparative ELISA test described above, the EPV 42
kDa promoter in a vaccinia recombinant virus directed the
expression of a foreign gene at a level equivalent to that
observed with the vaccinia H6 promoter or the vaccinia I3L
promoter.
Plasmid pMP550ulps contains the lpsAg gene under the
control of the cowpox a promoter in the vaccinia I4L
deletion locus (FIG. 12). The cowpox a promoter present in
plasmid pMP550ulps was replaced by the EPV 42 kDa promoter
as follows: Complementary oligonucleotides MPSYN371-374
were kinased at the internal 5' ends (MPSYN372; -MPSYN373),
N 1 V V n i
WO 92/1672
PCT/L'S92/01906 ' ,."
annealed, and cloned into pUC8 cut with EcoRI/BamHI, forming
plasmid pMP371/374. MPSYN371 (SEQ ID N0:102), MPSYN373 (SEQ
ID N0:103) MPSYN372 (SEQ ID N0:104), and MPSYN374 (SEQ ID
NO: 105) .
EcoRI BalII
MPSYN371 5' AATTCAGATCTCAAAATTGAAAATATATAATTACAATA
TAAAATGGGGC 3'
MPSYN373 3' GTCTAGAGTTTTAACTTTTATATATTAATGTTATAT
TTTACCCCGTCTT 5'
MPSYN372 5' AGAATCTTTCCACCAGCAATCCTCTGGGATTCTTTCCCGACC
BamHI
ACCAGTTG 3'
MPSYN374 3' AGAAAGGTGGTCGTTAGGAGACCCTAAGAAAGGGCTGGTGGTC
AACCTAG 5'
contain a 31 by EPV 42 kDa promoter element, followed by HBV
S1 region (ATG underlined) to the BamHI site. Following DNA
sequence confirmation, the insert was isolated from
pMP371/374 by digestion with BamHI/BglII, and used to
replace the corresponding _u promoter/HBV sequence in
pMP550ulps as follows: pMP550ulps was digested with BamHI
(partial)/BqlII, and the appropriate 5 kb vector fragment
isolated and ligated with the BamHI/BglII fragment from
pMP371/374. In the resulting plasmid, pMP550E311ps, the HBV
lpsAg is under the control of the EPV 42 kDa promoter. The
entire sequence of the EPV 42 kDa promoter/lpsAg gene
cassette is given in FIG. 15.
pMP550E311ps was used as donor plasmid with vaccinia
recombinant vP856, containing the spsAg gene, to generate
the double,HBV recombinant vaccinia virus vP932. vP932 was
used as rescuing virus with donor plasmid pMP544I3S12C
containing the S12/core fusion to generate a triple HBV
recombinant vaccinia virus vP975. To generate a vaccinia
recombinant containing only the EPV 42 kDa promoter/lpsAg,
pMP550E311ps was used as donor plasmid with vP866,
generating recombinant vaccinia virus vP930.
Secretion of HBV Surface Anticren In Vitro by
Recombinant Vaccinia Viruses. Dishes containing Vero cells
~.'O 92/ 1 X672 ~ ~ ~ ~ ~ ~ ~ p~/LrS92/01906
-69-
were infected in triplicate with NYVAC (vP866) or
recombinant vaccinia virus expressing HBV spsAg and/or HBV
lpsAg. The relative amounts of HBV surface antigen
particles associated with infected cells were compared with
the amounts secreted into the medium using the AUSRIA II-125
kit (Table 5). The presence of HBV surface antigen in the
medium was not due to lysis of infected cells because more
than 99.8 % of viral infectivity remained cell associated.
Volumes of cell pellets and medium were equalized to allow
for direct comparison. In cells infected with recombinant
vaccinia virus vP856, expressing the spsAg, 42% of the
AUSRIA reactive surface antigen was secreted into the
medium. Coexpression of lpsAg under the control of the
relatively weak a promoter (vP896) did not dramatically
change the amount of cell associated AUSRIA reactive
material, but decreased the relative amount of secreted
material to 24% of the total. Coexpression of lpsAg under
the control of the relatively strong EPV 42 kDa promoter
(vP932) lowered the relative amount of secreted material to
6% of the total. As with vP896, coexpression of lpsAg with
spsAg in vP932 did not lower the amount of AUSRIA reactive
cell associated material. Interestingly, expression of
lpsAg alone under the control of the EPV 42 kDa promoter
(vP930) resulted in the production of a level of cell
associated AUSRIA reactive material significantly above
background for the assay, whereas expression of lpsAg under
the control of the a promoter (vP897) did not. This is most
likely due to the higher levels of spsAg or sAg produced in
vP930 infected cells due to initiation at internal (S2 or S)
initiation codons.
~ 3 ~i ,v ~~ J( ~~
WO 92/15672 PCT/US92/01906
-7 0-
m
m >
N O (I] O _
~ N
O
T tO c~
o ~ U c c
~ ~ ~ ~ ~c m _
~. >
_
~ MN et m~ 'n ~ m
~~
o
~~
C 3 c
DO
O
~, m o a
r~
~a .o ?' ~ a
W A ~ i
m ~ ~ Z7
~
~
C p N p Q
D 0 T ~
0
'~t ~ O U O m
O m '
U
O ca
N ~ g C ~ 3 ~ m
~ ~
~
m ~
C C7 ~ M (D C (n =
0 '~
-
- c
m
E m .
a
...
tD tn tt) r r r ~ In ~1p i~ U ~ ~ O f3 O
. ,
~ co ~' 3 ~ a
4 ~ .~ m
css
U
T _
_C a
--
~ u ~ r ,n ~ r m , . ~' N r '~
cc E
w ' '~ r '' > ~ C ~ > >,
3 . cc m
m
,~ c
v ~,~n-T-~ ,~~N , , a~ o
~
o .o o
o .
m
_ _
v 3 s H ~ o:0 E ~
.r .a '
co ~n ~n .- r , r- , ~ co . '3 0 ~- Q E
~ ~
~ ~
N _ '
~ _ '~ :)
~ tn ~
cL3
" r ~C c0 m
~
N 1L7 tn L(7 r .- . N ~ . . V ~ m cp (~
~ N m
~
.,.. O
~ ~
T ~ ~ ~ r r In m C C
f~ , , N m E m ~-
3 ;~ ~ E:'
o '
,~ c n E m is
Y
i!1 C1 " " . r ~ .. t4 ~
m
n , . " , m a ..
ca ~ e c
3 o c
' ~_- ' c .
.. ~
m ' c~
Q o ~c ~n ,
as > ~
_
-
o m ~ m N 3 E
o a
-c
~n ~ - as
a m ~D~~~uj UU m ~ m
~ ~ E
N O ~ ~~~~ C!~ ~ ~ ~ Cn O
!~ tn cu
Q m ._
.a ~ '
QaQaQQ Q
a aa
aaa
o 0
SIJBSTITiJT~ 5~~~-
N'n 92/1672 ~ ~ ~ ~ ~ d ~ PCT/US92/01906
-71-
H
ro N
!~
O O
r-1 ltd Lf7I I t!7 I
)~ !~
o ~ 41 O O
~ ? ~
.Ct - H
O~ tf~ tf11 1 lf1 I
ro ~ ~ .j-J
rl
b -~ N ~ -~, s~ a
ai
~ g ro
o
- ar
~ x
m w tc1I ' U O v 4, >,r
U
I u 1
p, 1 U v l; O
N
3 U w
> ~ d x
H +~ 7
tf1 tf1I I I N v ro ~ ~'
1
I t ,N -
t
p
~ ~ ~
roN N -
N
U O O
D I t17I ! o ~'O G1
y I 1 H N
'L3 .4
b
r~ Qy
+~ ~ ro '~ C
N
-.~ ro n~ -.~
3 tn I tn s I a~ ..I
I I $ ~ ~ N ~.l .--i
O
+~ .~ >,
ro
~ O ~
rt
- b
I I t ~ ~ G O ~
~
I I I - N
-.-1 ~i c>a
-i
G4 ~ D ~ 'C a N
H
O row atpr-.~
ro t"1 1 I 1 N
I I
~ a
fn N
ri Q1 C)
ro~ m-.~ a~ v
ro
i~ L4 i.~
.1J .~
O
N I I I I I I O N
3 ~ ~ ~ ~ ~
w
~ d > ~
N 3
27
r-i I 1 t ~ v N
I I 1 G ~.1 tt1
~
QJ d-1 N ~ ro N ~1
m
O r-i -.-1
.-1 G
CT
w O I I I G
I ! I
-rl O TS 1.~ w ~
ro ~J
ro
~ v ~w
a
~x m
I I ~ o o~ o
~
I t I I o a~
-
'1
ro
+~ ~ ~ ~ ~ w
..a s~
O ro ~ 3 ~ ~
~ 3
-~1
O -i 't~
N
N .~ .. ro ro
-~1
O D O ~ ~ U U ~ ~
U P
l~ I
1 H H H H U7 VJ CL t I
V) ' ' G
' V
- J 1.1 r-1
~ ~ N
ri
t~ 00 01 O e-i N
ro O V' s! ~!' tt1tf'1tf1
E'~ 'ale O O O O O O b y~ V
t":~ ~ ~~ «. ~...s.- i.
4 ~ V.J
~ro~. l~~ ~'.;
iritlJ~ l
WO 92/15672 PCT/US92/01906 ,~.;-.,
-72-
m
tt~ U1 tn N ~ 1 N 4J ?,
ld +l ri w
~aro00 .,
a o cu
1 N 1 1 ~ I ~
~ O
a d i.a
U
i-~ b
~
~
row
~
,~
r
o
Tt
ro~oo
b ~ lr tn d GL U .C1
Ia
00 !f7 tn t11 + tf1 1 -'~ ~ T! N .-1 .i
U ~ 4! ~ ?~ U 2s >
o' a u1 ~
U -~-1 :C .-i ~ 01
~
~c +~ o ro s~ ~, .~
+~ In
I I lf1 I + 1 >~
U
~
~
N
~
~ ~ ~ ~
.~
~
,
.
-,
.~
-1
w
H o at E-~ >; 2! +.~
_
~
~
~ 3 3
o ~
~
i
!fl 1 I 1 r-i I
t
n
~
O 1~! N .~. U ~ N
r"1 O Gr tI~ y t~
> !C +
~
~
' -~ ~~~; tr~~
~
~ I I in 1 ~ o
u
a
I .-~ ~e Tt tr~ .C ~i
-.wn
ri ro
3~ ro
~a
~
0 .~
~.~
W
~r 1 1 I 1 + 1 ~ d ~
~
"i
-
rt1
~
~
~
~
-r
?~ i
'
~'~oo
Na
~
.~?,
~
1 I I I o ~w
a
~o c
I I n cbaH ro
w ~ x ~. c tn -~1 cn
cx v
o '., ~ ~ ~ ~ o
~
~ a r~ i
cV 1 I 1 ~
3 v t7
1 1 I .~
1
c
V
G) 4l~m
~m.ilT3
tn ~
3 it o
-t
o
o
~
..-~
~ b l
n
i
W r"1 I I 1
O 1 1 1 _
;~ ~ A
~.. y
x
a
~
~
.
4
!
-
-1 i
.~ ~, f
-a
> U 3
~~
o N
I 1 I O
d ~ ~.N
I I I r1 J,.1 .G ~ 41 dl
i~ ~ b
c a a ~ > a~ ~o n~
~
c o ~ o
~
~
a~ .
~ ,
c -~ ~ ro n~
~
~ d
~
3
!'.
~7
.
C ~
~~
C O U
N ~
et ~ ~ ',~ 'C1
4 d t ~ ~ Ill
!-1 4l N J~ d O ~
1 ~ -.-1 O
'
U
~ ~ i-i m0 tn U i~ = tJ~
H G1.
1- H N
1 f~ D
b
E
a
SUBSTIT~JTE SHEET
W,f) 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-73-
as a
H H H T1 ''t~ >.,
'l'3
. O x x x n~ ro a~ ,o
N ~
co b a a a 1d -
to
~ dPdP dP dP dP dP C4 ~ ~ U U N G
,..~u1~r co r~ o cn N
>
~
G
~
~ N
.
t
.1~
.G
0 .
!a w
~'
0 0 0 0 o p 3 ~ ~
~
~ N
tr~
?~
> ~
N~ >~ ~x
ro
b ~
p~ ~ N ~ -.~ b~ 3 .~ a~ ~
r ~ r t~ ,.. U O U ~ ~ G C ~ ..1 O
O o o p o p y f-1 ~ t~ G U r-1 N ro rt
T! f.1
.~-1.-~IH r-I ,..~ O ~ ~ frl U Cl T3 Ol G ri
U
W G r1 W N G1W r1 -r1 U ,'F.,'
b x x x x x x .j',
CL
U > G ~r d p, ~ ~ N U
H ~ ~'to ~ t~ ~ ~ N
~ ~ ~ ~ N U ~ ~
"p Zf
~ ?~ 41
W o ,- -I ,-1 y~ ~ G G f-1 ~r d rt r-I
H 1 >
N ro ~ ro o G ~ v N .~ a~ -.~
3 ~ ~ tr
U ~
~ ~
~
'J Cl .-I -
a~
~
~
+~ f1 ?~ ~ "~,y" -'i U .4"
U r-W
> H ~ ~ o ro O r'i r-1 .-1 +1 .~, tU
+~ 4J
~ ~ U C! -.~ 'C3 G ~ W G1
U 41 G
ro > ~ 0 0 0 ~ o _
ro U
~
-
O +~ N x
~' ~
~'
'~ ' ' 'o ~' ~' '
x x x x x x .
,
o
U G t~ W W O
U H , " fr U ::L ~ b ro a ~o O w
,
U N . ~ ~ O ~
. ~
. 1 . . . ~ ~ N ro ~ ~
N
~ > O O Cl
> H e 00 v-i 00 ri W
N
0
O
N
U ~ i~
r
-i 'C~
~ ro -i
'
'p N ~ r-1
J ro O U ~ ro d
~ ro w ~ux'w ~~
v
+~
w c b
ro
v
~
~
>
' t
n s~
e
.
a
tr
tn N
O N G tU .G N O +~ .-i O G d
U .-.I G W
U ro W ~
-~ ~
d w
~
~
G. i-~ 'C3
~
O
<V ~ Y~ ~ N U O U G f-a U
> ~
y~ as d 1~ d ~ ~r ro O LL
G
~x 3 G1 ~ N dfr p,d O O2f
U
. 3 ro
aW ~ ~+ ~ N
3
a ~ ~ ~ ~N
b
to
G +~ O~ . N C C N ' G ~ ~ . ~ ~ tC
.r~
"
t~ ~, ,.,..per O T
O O f1 ~ .. ro .~~ f-1 ri r-i
'
1 .w t~ r--~ C
" -ri O . ..~ O ro .-1 G
r-1
~ V
~ O ~ U O ~ O
O
H ~ ro U ~ .~.
lr
+~ ro U N +W ~ a~ H ro ~
p G ~ t0 tU rtt U ~ _ "G
w 'D 41
., O W 1..~ .i -.-I e0 i-i
V1 ~ 1f1 O 1~ ~ O. G .Cl
r-1 Qy U W ~r U W O fr rti
~ o
~
' * t * O * ~!1 N ~ ~ .i~ N G 'O O W ~ ro
O '~ T1 la
~W
Nb
~ ~ ~ ~
~ 3
o
.
.
Nbzl
H -.-1 Gl 'Cy O 1 i~ fd N
o' n1 ~ W 0
> ~ a~ .o ~ ~ ..a a~ a ..a
N ~, b
p x
.~. ro r-I r-I U '.~' ri
ri 41 U ~ .N
-~ ~ oo b ~ cn a v -~ o .-, ro a~
+~ o G -.~
b o ~ n N -.~ ~ ca 2s U 2s N ro ~
..~ -.~ N .., x
a~ * * ~ G ro W G .i~ N > .tJ ~ N
ro
m U ~ _ p ~
ro
O
n
ro
Ov U r-I ,G
O
.
C
a N ~ N
r-1 -.-I U .-1 ~.J r-1 ~l W ~
r1 H G f3 ~ r~ O .-I
tr~ tr~ C ro a~ ~ ~ .Q ~ cx o 3 ~
i
W ro a ..i > U 3 a~ a ~ >, a~ cn
.i m c~ N H
N N td UvGL~lU~i~CYNUGIH
N '~
G O~ t1 ~ +~ +~ G U a U a ~
L1.
ro a~ a a~ a . a c G ~ o ~ ~ 2s N or .-~ ~
rn -~ ~ c .~-~ a
_ _ O~aww~a.~~n~OGWro..a~abH
d N N
d Cl~ 1r: t1 U G +~ O x --i .-1 W ro G
rtf > > GJ > Q.,'
tit N D, N D N .a ,C U T3 .-1 ~ -.'1 ~ u1
tL D
-- ~ ~. x -- N r~ ro -.~ .n N a, m ~ .
~ x a +~ a ~
~ -- ~ ~o a~ ~ ~ s~ > N a~ -.~ ~ N
-- H a ~ H a
w x a~ x N ~N ,c oNw.~.-~ ~~ ~ ~ ~a a,rotx
~~
. ~~ v v v y. N V ~'~ ~ r-I e-1 r-1 O ~.1
v ~ tI~ ~ ~1 V~ QI
-~ ar~.~ GH ro ~ ro N-~~
111 v " ~ ovx
~ ~ ~I a ~. H H '~ F, > W >
a ~ i~ a ~
01 (A ~Dtt) t~ ~C O N
ri tGtn O1 p~ th c-1
47CO CO W 01 C1
H > > > > > > > b ~ ~ *
:~~~~T!'~'~JTc SHEET ~
~1~~ X77
WO 92/15672 PCT/US92/01906
-74-
Example 14 - CONBTRUCTION OF NYVAC RECOMBINANTB EgPRE88ING
HEPATITIS H VIRUB AND EP8TEIN BARR VIROS
Since Epstein Barr Virus (EBV) and Hepatitis B Virus
(HBV) are endemic over similar geographical areas, including
Africa, it would be advantageous to produce a recombinant
vaccinia virus expressing immunogens for both pathogens. To
this end, vP941, a recombinant vaccinia virus containing
three EBV genes and three HBV genes in a NYVAC background
was generated.
Immunoprecipitation of HBV Proteins. Metabolic
labelling and immunoprecipitation of HBV proteins were as
described for vP919 in Example 13 with the following
modifications. Infections with recombinant vaccinia virus,
parental NYVAC virus (vP866) and mock infections were
performed on RK-13 cells, rather than Vero cells. Both
anti-S2 and anti-core antisera were preadsorbed with vP866
infected RK-13 cells.
Generation of Recombinant Vaccinia Virus vP941.
Plasmid EBV Triple.l, the donor plasmid containing three EBV
genes which was used to generate the vaccinia virus
recombinant EBV triplet vP944, was used in recombination
with vP919, the vaccinia virus recombinant HBV triplet, as
rescuing virus. The resulting virus, vP941, was identified
by 32P-labelled EBV DNA. Like vP944, vP941 contained EBV
genes gH under the control of the Entomopox virus 42 kDa
promoter, gB under the control of the vaccinia H6 promoter
and gp340 under the control of the vaccinia H6 promoter, all
inserted in the vaccinia TK deletion locus. Like vP919,
vP941 contained the synthetic HBV spsAg under the control of
the vaccinia H6 promoter inserted into the ATI deletion
locus, the HBV lpsAg under the control of the cowpox a
promoter inserted into the I4L deletion locus, and the HBV
S12/core fusion gene under the control of the I3L promoter
inserted into the HA deletion locus. The integrity of the
genome of recombinant vaccinia virus vP941 was confirmed by
restriction analysis of the DNA.
W~ 92/15672 ~ i ~ ~ ~ j ~~ PCT/US92/O1906
-75-
Expression of HBV Proteins by vP941. To assay for the
various HBV proteins synthesized by sextuplet HBV/EBV
vaccinia recombinant vP941, metabolically labelled proteins
synthesized in RK-13 cells infected with vP941 and
appropriate single, double and triple HBV recombinants were
subjected to immunoprecipitation. Proteins in uninfected
cells and cells infected with vP866 (NYVAC), vP856 (spsAg),
vP896 (spsAg + lpsAg), vP919 (spsAg + lpsAg + S12/core), or
vP941 were immunoprecipitated using rabbit anti-S2
antiserum. Proteins in additional uninfected cells and
additional cells infected with vP941, vP919, vP858
(S12/core), or vP866 were immunoprecipitated using anti-core
antiserum.
Anti-S2 serum precipitates two proteins of 33 kDa and
36 kDa from vaccinia single recombinant vP856 containing the
gene for spsAg. These correspond to the expected sizes for
the singly and doubly glycosylated forms of HBV spsAg.
Anti-S2 serum precipitates the same proteins from vaccinia
double recombinant vP896, containing the genes for spsAg and
lpsAg. In addition, a protein of 42 kDa, corresponding to
the singly glycosylated form of lpsAg is precipitated, as
well as larger proteins of 45 kDa and 48 kDa. The 39 kDa
protein corresponding to the nonglycosylated form of lpsAg
is precipitated in minor amounts compared to the
glycosylated forms. All proteins precipitated by anti-S2
serum from vP856 and vP896 are also precipitated from HBV
triple recombinant vP919 and the HBV/EBV sextuplet, vP941.
In the radioautogram, HBV proteins are immunoprecipitated by
anti-S2 serum from RK-13 cells infected with vaccinia
recombinants. When HBV proteins were immunoprecipitated
from Vero cells infected with the same vaccinia recombinants
(vP856, vP896 and vP919) the same proteins were observed but
in different relative amounts. In general, both spsAg and
lpsAg expressed by these recombinant vaccinia virus seems to
be more fully glycosylated in RK-13 cells than in Vero
cells.
~~.~~'~ ~7
WO 92/1672 PCT/US92/01906 .
-76-
As was seen with Vero cells infected with vP858, the
most abundant protein precipitated by anti-core serum from , .
RK-13 cells infected with vP858 has a size of 27 kDa. This
corresponds to the size of the translation product which
would be predicted if translation of the S12/core fusion _
gene began at the second (S2) ATG. Unlike the situation
observed following vP858 infection of Vero cells, vP858
infection of RK-13 cells followed by immunoprecipitation
with anti-core serum does not result in a visible band
corresponding in size to the 38 kDa expected for the
complete S12/core translation product. All proteins
precipitated by anti-core serum from HBV single recombinant
vP858 are also precipitated from HBV triple recombinant
vP919 and HBV/EBV sextuplet vP941.
Example 15 - CONSTRUCTION OF ALVAC RECOMBINANTB E8PRE88ING
RABIES VIRUB GLYCOPROTEIN G
This example describes the development of a canarypox-
rabies recombinant designated as ALVAC-RG (vCP65) and its
safety and efficacy.
Cells and Viruses. The parental canarypox virus
(Rentschler strain) is a vaccinal strain for canaries. The
vaccine strain was obtained from a wild type isolate and
attenuated through more than 200 serial passages on chick
embryo fibroblasts. A master viral seed was subjected to
four successive plaque purifications under agar and one
plaque clone was amplified through five additional passages
after which the stock virus was used as the parental virus
in in vitro recombination tests. The plaque purified
canarypox isolate is designated ALVAC.
Construction of a Canar.~r~ox Insertion Vector. An 880
by canarypox PvuII fragment was cloned between the PvuII
sites of pUC9 to form pRW764.5. The sequence of this
fragment is shown in FIG. 16 between positions 1372 and
2251. The limits of an open reading frame designated as C5
were defined. It was determined that the open reading frame
was initiated at position 166 within the fragment and ,
N'~ 92/1672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
_77_
terminated at position 487. The C5 deletion was made
without interruption of open reading frames. Bases from
position 167 through position 455 were replaced with the
sequence (SEQ ID N0:106) GCTTCCCGGGAATTCTAGCTAGCTAGTTT.
This replacement sequence contains HindIII, SmaI and EcoRI
insertion sites followed by translation stops and a
transcription termination signal recognized by vaccinia
virus RNA polymerase (Yuen et al., 1987). Deletion of the
C5 ORF was performed as described below. Plasmid pRW764.5
was partially cut with RsaI and the linear product was
isolated. The RsaI linear fragment was recut with BglII and
the pRW764.5 fragment now with a RsaI to BQ1II deletion from
position 156 to position 462 was isolated and used as a
vector for the following synthetic oligonucleotides:
RW145 (SEQ ID N0:107):
ACTCTCAAAAGCTTCCCGGGAATTCTAGCTAGCTAGTTTTTATAAA
RW146 (SEQ ID N0:108):
GATCTTTATAAAAACTAGCTAGCTAGAATTCCCGGGAAGCTTTTGAGAGT
Oligonucleotides RW145 and RW146 were annealed and inserted
into the pRW 764.5 RsaI and BalII vector described above.
The resulting plasmid is designated pRW831.
Construction of Insertion Vector Containing the Rabies
G Gene. Construction of pRW838 is illustrated below.
Oligonucleotides A through E, which overlap the translation
initiation codon of the H6 promoter with the ATG of rabies
G, were cloned into pUC9 as pRW737. Oligonucleotides A
through E contain the H6 promoter, starting at NruI, through
the HindIII site of rabies G followed by BQ1II. Sequences
of oligonucleotides A through E (SEQ ID N0:109)-(SEQ ID NO.
113) are:
A (SEQ ID N0:109): CTGAAATTATTTCATTATCGCGATATCCGTTAA
GTTTGTATCGTAATGGTTCCTCAGGCTCTCCTGTTTGT
B (SEQ ID NO:110): CATTACGATACAAACTTAACGGATATCGCGATAA
TGAAATAATTTCAG
s. , ~, ; .l :~ :~
1 ~ a N
WO 92/1672 PCf/US92/01906 ,~->
-78_
C (SEQ ID NO:111): ACCCCTTCTGGTTTTTCCGTTGTGTTTT
GGGAAATTCCCTATTTACACGATCCCAGACA
AGCTTAGATCTCAG
D (SEQ ID N0:112): CTGAGATCTAAGCTTGTCTGGGATCGTGTAAATA
GGGAATTTCCCAAAACA
E (SEQ ID N0:113): CAACGGAAAAACCAGAAGGGGTACAAACAGGAGA
GCCTGAGGAAC
The diagram of annealed oligonucleotides A through E is as
follows:
A C
B E D
Oligonucleotides A through E were kinased, annealed
(95°C for 5 minutes, then cooled to room temperature), and
inserted between the PvuII sites of pUC9. The resulting
plasmid, pRW737, was cut with HindIII and BalII and used as
a vector for the 1.6 kbp HindIII-BalII fragment of ptg155PR0
(Kieny et al., 1984) generating pRW739. The ptg155PR0
HindIII site is 86 by downstream of the rabies G translation
initiation codon. BalII is downstream of the rabies G
translation stop codon in ptg155PR0. pRW739 was partially
cut with NruI, completely cut with BalII, and a 1.7 kbp
NruI-BalII fragment, containing the 3' end of the H6
promoter previously described (Taylor et al., 1988a,b; Guo
et al., 1989; Perkus et al., 1989) through the entire rabies
G gene, was inserted between the NruI and BamHI sites of
pRW824. The resulting plasmid is designated pRW832.
Insertion into pRW824 added the H6 promoter 5' of NruI. The
pRW824 sequence of BamHI followed by SmaI is: GGATCCCCGGG.
pRW824 is a plasmid that contains a nonpertinent gene linked
precisely to the vaccinia virus H6 promoter. Digestion with
NruI and BamHI completely excised this nonpertinent gene.
The 1.8 kbp pRW832 SmaI fragment, containing H6 promoted
rabies G, was inserted into the SmaI of pRW831, to form
plasmid pRW838.
V~t.~l 92/15672 ~ ~ ~ ~ ~ ~' ~ PCT/US92/01906
-79-
Development of ALVAC-RG. Plasmid pRW838 was
transfected into ALVAC infected primary CEF cells by using
the calcium phosphate precipitation method previously
described (Panicali et al., 1982; Piccini et al., 1987).
Positive plaques were selected on the basis of hybridization
to a specific rabies G probe and subjected to 6 sequential
rounds of plaque purification until a pure population was
achieved. One representative plaque was then amplified and
the resulting ALVAC recombinant was designated ALVAC-RG
(vCP65). The correct insertion of the rabies G gene into
the ALVAC genome without subsequent mutation was confirmed
by sequence analysis.
Immunofluorescence. During the final stages of
assembly of mature rabies virus particles, the glycoprotein
component is transported from the golgi apparatus to the
plasma membrane where it accumulates with the carboxy
terminus extending into the cytoplasm and the bulk of the
protein on the external surface of the cell membrane. In
order to confirm that the rabies glycoprotein expressed in
ALVAC-RG was correctly presented, immunofluorescence was
performed on primary CEF cells infected with ALVAC or ALVAC-
RG. Immunofluorescence was performed as previously
described (Taylor et al., 1990) using a rabies G monoclonal
antibody. Strong surface fluorescence was detected on CEF
cells infected with ALVAC-RG but not with the parental
ALVAC.
Immunopreci~itation. Preformed monolayers of primary
CEF, Vero (a line of African Green monkey kidney cells ATCC
# CCL81) and MRC-5 cells (a fibroblast-like cell line
derived from normal human fetal lung tissue ATCC # CCL171)
were inoculated at 10 pfu per cell with parental virus ALVAC
and recombinant virus ALVAC-RG in the presence of
radiolabelled 35S-methionine and treated as previously
described (Taylor et al., 1990). Immunoprecipitation
reactions were performed using a rabies G specif is
monoclonal antibody. Efficient expression of a rabies
~,~.~1~~, ~~
WO 92/1672 PCT/US92/01906
-80-
specific glycoprotein with a molecular weight of
approximately 67 kDa was detected with the recombinant
ALVAC-RG. No rabies specific products were detected in
uninfected cells or cells infected with the parental ALVAC
virus.
Sectuential Passaging Experiment. In studies with ALVAC
virus in a range of non-avian species no proliferative
infection or overt disease was observed (Taylor et al.,
1991b). However, in order to establish that neither the
parental nor recombinant virus could be adapted to grow in
non-avian cells, a sequential passaging experiment was
performed.
The two viruses, ALVAC and ALVAC-RG, were inoculated in
sequential blind passages in three cell lines:
(1) Primary chick embryo fibroblast (CEF) cells
produced from 11 day old white leghorn embryos;
(2) Vero cells - a continuous line of African Green
monkey kidney cells (ATCC # CCL81); and
(3) MRC-5 cells - a diploid cell line derived from
human fetal lung tissue (ATCC # CCL171).
The initial inoculation was performed at an m.o.i. of 0.1
pfu per cell using three 60mm dishes of each cell line
containing 2 X 106 cells per dish. One dish was inoculated
in the presence of 40~cg/ml of Cytosine arabinoside (Ara C),
an inhibitor of DNA replication. After an absorption period
of 1 hour at 37°C, the inoculum was removed and the
monolayer washed to remove unabsorbed virus. At this time
the medium was replaced with 5m1 of EMEM + 2% NBCS on two
dishes (samples t0 and t7) and 5m1 of EMEM + 2% NBCS
containing 40 ~g/ml Ara C on the third (sample t7A). Sample
t0 was frozen at -70°C to provide an indication of the
residual input virus. Samples t7 and t7A were incubated at
37°C for 7 days, after which time the contents were
harvested and the cells disrupted by indirect sonication.
One ml of sample t7 of each cell line was inoculated
undiluted onto three dishes of the same cell line (to
v!",1 92/15672 ~ ~ ~ ~ ~ ~ PCT/US92/01906
-81-
provide samples t0, t7 and t7A) and onto one dish of primary
CEF cells. Samples t0, t7 and t7A were treated as for
passage one. The additional inoculation on CEF cells was
included to provide an amplification step for more sensitive
detection of virus which might be present in the non-avian
cells.
This procedure was repeated for 10 (CEF and MRC-5) or 8
(Vero) sequential blind passages. Samples were then frozen
and thawed three times and assayed by titration on primary
CEF monolayers.
Virus yield in each sample was then determined by
plaque titration on CEF monolayers under agarose.
Summarized results of the experiment are shown in Tables 6
and 7.
The results indicate that both the parental ALVAC and
the recombinant ALVAC-RG are capable of sustained
replication on CEF monolayers with no loss of titer. In
Vero cells, levels of virus fell below the level of
detection after 2 passages for ALVAC and 1 passage for
ALVAC-RG. In MRC-5 cells, a similar result was evident, and
no virus was detected after 1 passage. Although the results
for only four passages are shown in Tables 6 and 7 the
series was continued for 8 (Vero) and 10 (MRC-5) passages
with no detectable adaptation of either virus to growth in
the non-avian cells.
In passage 1 relatively high levels of virus were
present in the t7 sample in MRC-5 and Vero cells. However
this level of virus was equivalent to that seen in the t0
sample and the t7A sample incubated in the presence of
Cytosine arabinoside in which no viral replication can
occur. This demonstrated that the levels of virus seen at 7
days in non-avian cells represented residual virus and not
newly replicated virus.
In order to make the assay more sensitive, a portion of
the 7 day harvest from each cell line was inoculated onto a
permissive CEF monolayer and harvested at cytopathic effect
~~9~~ 6 2
PCT/US92/01906
_82_
(CPE) or at 7 days if no CPE was evident. The results of
this experiment are shown in Table 8. Even after
amplification through a permissive cell line, virus was only
detected in MRC-5 and Vero cells for two additional
passages. These results indicated that under the conditions
used, there was no adaptation of either'virus to growth in
Vero or MRC-5 cells.
Inoculation of Macactues. Four HIV seropositive
macaques were initially inoculated with ALVAC-RG as
described in Table 9. After 100 days these animals were re-
inoculated to determine a booster effect, and an additional
seven animals were inoculated with a range of doses. Blood
was drawn at appropriate intervals and sera analyzed, after
heat inactivation at 56°C for 30 minutes, for the presence
of anti-rabies antibody using the Rapid Fluorescent Focus
Inhibition Assay (Smith et al., 1973).
Inoculation of Chimpanzees. Two adult male chimpanzees
(50 to 65 kg weight range) were inoculated intramuscularly
or subcutaneously with 1 X 10~ pfu of vCP65. Animals were
monitored for reactions and bled at regular intervals for
analysis for the presence of anti-rabies antibody with the
RFFI test (Smith et al., 1973). Animals were re-inoculated
with an equivalent dose 13 weeks after the initial
inoculation.
Inoculation of Mice. Groups of mice were inoculated
with 50 to 100 ~1 of a range of dilutions of different
batches of vCP65. Mice were inoculated in the footpad. On
day 14, mice were challenged by intracranial inoculation of
from 15 to 43 mouse LDSO of the virulent CVS strain of
rabies virus. Survival of mice was monitored and a
protective dose 50% (PDSO) calculated at 28 days post-
inoculation.
Inoculation of DoQS and Cats. Ten beagle dogs, 5
months old, and 10 cats, 4 months old, were inoculated
subcutaneously with either 6.7 or 7.7 loglo TCIDSO of ALVAC-
RG. Four dogs and four cats were not inoculated. Animals
V!1!O 92/15672 ~ ~ ~ ;:j ~ ~ ~ PC1'/US92/01906
-83-
were bled at 14 and 28 days post-inoculation and anti-rabies
antibody assessed in an RFFI test. The animals receiving
6.7 loglo TCIDSp of ALVAC-RG were challenged at 29 days
post-vaccination with 3.7 loglo mouse LDSO (dogs) or 4.3
1og10 mouse LD50 (cats) of the NYGS rabies virus challenge
strain.
Inoculation of Squirrel Monkeys. Three groups of four
squirrel monkeys (Saimiri sciureus) were inoculated with one
of three viruses (a) ALVAC, the parental canarypox virus,
(b) ALVAC-RG, the recombinant expressing the rabies G
glycoprotein or (c) vCP37, a canarypox recombinant
expressing the envelope glycoprotein of feline leukemia
virus. Inoculations were performed under ketamine
anaesthesia. Each animal received at the same time: (1) 20
~1 instilled on the surface of the right eye without
scarification; (2) 100 ~,1 as several droplets in the mouth;
(3) 100 ~C1 in each of two intradermal injection sites in the
shaven skin of the external face of the right arm; and (4)
100 ~l in the anterior muscle of the right thigh.
Four monkeys were inoculated with each virus, two with
a total of 5.0 loglo pfu and two with a total of 7.0 loglo
pfu. Animals were bled at regular intervals and sera
analyzed for the presence of antirabies antibody using an
RFFI test (Smith et al., 1973). Animals were monitored
daily for reactions to vaccination. Six months after the
initial inoculation the four monkeys receiving ALVAC-RG, two
monkeys initially receiving vCP37, and two monkeys initially
receiving ALVAC, as well as one naive monkey were inoculated
with 6.5 loglo pfu of ALVAC-RG subcutaneously. Sera were
monitored for the presence of rabies neutralizing antibody
in an RFFI test (Smith et al., 1973).
Inoculation of Human Cell Lines with ALVAC-RG. In
order to determine whether efficient expression of a foreign
gene could be obtained in non-avian cells in which the virus
does not productively replicate, five cell types, one avian
aad four non-avian, were analyzed for virus yield,
V1'O 92/15672
PCT/US92/01906
-84-
expression of the foreign rabies G gene and viral specific
DNA accumulation. The cells inoculated were:
(a) Vero, African Green monkey kidney cells, ATCC #
CCL81;
(b) MRC-5, human embryonic lung, ATCC # CCL 171;
(c) WISH human amnion, ATCC # CCL 25;
(d) Detroit-532, human foreskin, Downs~s syndrome,
ATCC # CCL 54; and
(e) Primary CEF cells.
Chicken embryo fibroblast cells produced from 11 day
old white leghorn embryos were included as a positive
control. All inoculations were performed on preformed
monolayers of 2 X 106 cells as discussed below.
A. Methods for DNA analysis.
Three dishes of each cell line were inoculated at 5
pfu/cell of the virus under test, allowing one extra
dish of each cell line un-inoculated. One dish was
incubated in the presence of 40 ~g/ml of cytosine
arabinoside (Ara C). After an adsorption period of 60
minutes at 37°C, the inoculum was removed and the
monolayer washed twice to remove unadsorbed virus.
Medium (with or without Ara C) was then replaced.
Cells from one dish (without Ara C) were harvested as a
time zero sample. The remaining dishes were incubated
at 37°C for 72 hours, at which time the cells were
harvested and used to analyze DNA accumulation. Each
sample of 2 X 106 cells was resuspended in 0.5 ml
phosphate buffered saline (PBS) containing 40 mM EDTA
and incubated for 5 minutes at 37°C. An equal volume
of 1.5% agarose prewarmed at 42°C and containing 12o mM
EDTA was added to the cell suspension and gently mixed.
The suspension was transferred to an agarose plug mold
and allowed to harden for at least 15 min. The agarose
plugs were then removed and incubated for 12-16 hours
at 50°C in a volume of lysis buffer (1% sarkosyl, 100
~Cg/ml proteinase K, 10 mM Tris HC1 pH 7.5, 200 mM EDTA)
"~ 92/1672
PCT/US92/01906
-85-
that completely covers the plug. The lysis buffer was
then replaced with 5.0 ml sterile 0.5 X TBE (44.5 mM
Tris-borate, 44.5 mM boric acid, 0.5 mM EDTA) and
equilibrated at 4°C for 6 hours with 3 changes of TBE
buffer. The viral DNA within the plug was fractionated
from cellular RNA and DNA using a pulse field
electrophoresis system. Electrophoresis was performed
for 20 hours at 180 V with a ramp of 50-90 sec at 15°C
in 0.5 X TBE. The DNA was run with lambda DNA
molecular weight standards. After electrophoresis the
viral DNA band was visualized by staining with ethidium
bromide. The DNA was then transferred to a
nitrocellulose membrane and probed with a radiolabelled
probe prepared from purified ALVAC genomic DNA.
B. Estimation of virus yield.
Dishes were inoculated exactly as described above, with
the exception that input multiplicity was 0.1 pfu/cell.
At 72 hours post infection, cells were lysed by three
successive cycles of freezing and thawing. Virus yield
was assessed by plaque titration on CEF monolayers.
C. Analysis of expression of Rabies G gene.
Dishes were inoculated with recombinant or parental
virus at a multiplicity of 10 pfu/cell, allowing an
additional dish as an uninfected virus control. After
a one hour absorption period, the medium was removed
and replaced with methionine free medium. After a 30
minute period, this medium was replaced with
methionine-free medium containing 25 uCi/ml of 35S-
Methionine. Infected cells were labelled overnight
(approximately 16 hours), then lysed by the addition of
buffer A lysis buffer. Immunoprecipitation was
performed as previously described (Taylor et al., 1990)
using a rabies G specific monoclonal antibody.
Results: Estimation of Viral Yield. The results of
titration for yield at 72 hours after inoculation at 0.1 pfu
per ~~ell are shown in Table 10. The results indicate that
~~.~s~~~ ~~1
WO 92/1672 PCT/US92/0~906 ~~-;.
-86-
while a productive infection can be attained in the avian
cells, no increase in virus yield can be detected by this
method in the four non-avian cell systems. .
Analysis of Viral DNA Accumulation. In order to
determine whether the block to productive viral replication
in the non-avian cells occurred before or after DNA
replication, DNA from the cell lysates was fractionated by
electrophoresis, transferred to nitrocellulose and probed
for the presence of viral specific DNA. DNA from uninfected
CEF cells, ALVAC-RG infected CEF cells at time zero, ALVAC-
.RG infected CEF cells at 72 hours post-infection and ALVAC-
RG infected CEF cells at 72 hours post-infection in the
presence of 40 ~g/ml of cytosine arabinoside all showed some
background activity, probably due to contaminating CEF
cellular DNA in the radiolabelled ALVAC DNA probe
preparation. However, ALVAC-RG infected CEF cells at 72
hours post-infection exhibited a strong band in the region
of approximately 350 kbp representing ALVAC-specific viral
DNA accumulation. No such band is detectable when the
culture is incubated in the presence of the DNA synthesis
inhibitor, cytosine arabinoside. Equivalent samples
produced in Vero cells showed a very faint band at
approximately 350 kbp in the ALVAC-RG infected Vero cells at
time zero. This level represented residual virus. The
intensity of the band was amplified at 72 hours post-
infection indicating that some level of viral specific DNA
replication had occurred in Vero cells which had not
resulted in an increase in viral progeny. Equivalent
samples produced in MRC-5 cells indicated that no viral
specific DNA accumulation was detected under these
conditions in this cell line. This experiment was then
extended to include additional human cell lines,
specifically WISH and Detroit-532 cells. ALVAC infected CEF
cells served as a positive control. No viral specific DNA
accumulation was detected in either WISH or Detroit cells
inoculated with ALVAC-RG. It should be noted that the
"'t) 92/15672 ~ r '~ PCT/US92/01906
-g7_
limits of detection of this method have not been fully
ascertained and viral DNA accumulation may be occurring, but
at a level below the sensitivity of the method. Other
experiments in which viral DNA replication was measured by
3H-thymidine incorporation support the results obtained with
Vero and MRC-5 cells.
Analysis of Rabies Gene Epression. To determine if any
viral gene expression, particularly that of the inserted
foreign gene, was occurring in the human cell lines even in
the absence of viral DNA replication, immunoprecipitation
.experiments were performed on 35S-methionine labelled
lysates of avian and non-avian cells infected with ALVAC and
ALVAC-RG. The results of immunoprecipitation using a rabies
G specific monoclonal antibody illustrated specific
immunoprecipitation of a 67 kDa glycoprotein in CEF, Vero
and MRC-5, WISH and Detroit cells infected with ALVAC-RG.
No such specific rabies gene products were detected in any
of the uninfected and parentally infected cell lysates.
The results of this experiment indicated that in the
human cell lines analyzed, although the ALVAC-RG recombinant
was able to initiate an infection and express a foreign gene
product under the transcriptional control of the H6
early/late vaccinia virus promoter, the replication did not
proceed through DNA replication, nor was there any
detectable viral progeny produced. In the Vero cells,
although some level of ALVAC-RG specific DNA accumulation
was observed, no viral progeny was detected by these
methods. These results would indicate that in the human
cell lines analyzed the block to viral replication occurs
prior to the onset of DNA replication, while in Vero cells,
'the block occurs following the onset of viral DNA
replication.
In order to determine whether the rabies glycoprotein
expressed in ALVAC-RG was immunogenic, a number of animal
species were tested by inoculation of the recombinant. The
efficacy of esrrent rabies vaccines is evaluated in a mouse
WO 92/15672
PCT/US92/01906 ,<-:=~-,
_88_
model system. A similar test was therefore performed using
ALVAC-RG. Nine different preparations of virus (including
one vaccine batch (J) produced after 10 serial tissue .
culture passages of the seed virus) with infectious titers
ranging from 6.7 to 8.4 loglo TCID50 per ml were serially
diluted and 50 to 100 ~l of dilutions inoculated into the
footpad of four to six week old mice. Mice were challenged
14 days later by the intracranial route with 300 ~,1 of the
CVS strain of rabies virus containing from 15 to 43 mouse
LDSO as determined by lethality titration in a control group
of mice. Potency, expressed as the PD50 (Protective dose
50%), was calculated at 14 days post-challenge. The results
of the experiment are shown in Table 11. The results
indicated that ALVAC-RG was consistently able to protect
mice against rabies virus challenge with a PDSO value
ranging from 3.33 to 4.56 with a mean value of 3.73 (STD
0.48). As an extension of this study, male mice were
inoculated intracranially with 50 ~C1 of virus containing 6.0
loglo TCIDSO of ALVAC-RG or with an equivalent volume of an
uninfected cell suspension. Mice were sacrificed on days 1,
3 and 6 post-inoculation and their brains removed, ffixed and
sectioned. Histopathological examination showed no evidence
for neurovirulence of ALVAC-RG in mice.
In order to evaluate the safety and efficacy of ALVAC-
RG for dogs and cats, a group of 14, 5 month old beagles and
14, 4 month old cats were analyzed. Four animals in each
species were not vaccinated. Five animals received 6.7
loglo TCID5o subcutaneously and five animals received 7.7
1og10 TCID50 by the same route. Animals were bled for
analysis for anti-rabies antibody. Animals receiving no
inoculation or 6.7 loglo TCIDSO of ALVAC-RG were challenged
at 29 days post-vaccination with 3.7 loglo mouse LDSO (dogs,
in the temporal muscle) or 4.3 loglo mouse LDSO (cats, in
the neck) of the NYGS rabies virus challenge strain. The
results of the experiment are shown in Table 12.
?'::~ 92/15672
PCT/US92/01906
-89_
No adverse reactions to inoculation were seen in either
cats or dogs with either dose of inoculum virus. Four of 5
dogs immunized with 6.7 loglo TCIDSO had antibody titers on
day 14 post-vaccination and all dogs had titers at 29 days.
All dogs were protected from a challenge which killed three
out of four controls. In cats, three of five cats receiving
6.7 loglo TCIDSO had specific antibody titers on day 14 and
all cats were positive on day 29 although the mean antibody
titer was low at 2.9 IU. Three of five cats survived a
challenge which killed all controls. All cats immunized
with 7.7 loglo TCIDSO had antibody titers on day 14 and at
day 29 the Geometric Mean Titer was calculated as 8.1
International Units.
The immune response of squirrel monkeys (Saimiri
sciureus) to inoculation with ALVAC, ALVAC-RG and an
unrelated canarypox virus recombinant was examined. Groups
of monkeys were inoculated as described above and sera
analyzed for the presence of rabies specific antibody.
Apart from minor typical skin reactions to inoculation by
the intradermal route, no adverse reactivity was seen in any
of the monkeys. Small amounts of residual virus were
isolated from skin lesions after intradermal inoculation on
days two and four post-inoculation only. All specimens were
negative on day seven and later. There was no local
reaction to intra-muscular injection. All four monkeys
inoculated with ALVAC-RG developed anti-rabies serum
neutralizing antibodies as measured in an RFFI test.
Approximately six months after the initial inoculation all
monkeys and one additional naive monkey were re-inoculated
by the subcutaneous route on the external face of the left
thigh with 6.5 loglo TCIDS~ of ALVAC-RG. Sera were analyzed
for the presence of anti-rabies antibody. The results are
shown in Table 13.
Four of the five monkeys naive to rabies developed a
serological response by seven days post-inoculation with
ALVAC-RG. All~five monkeys had detectable antibody by 11
~1~~~f l
WO 92/15672 PCT/US92/01906 t';-~,>.
-90-
days post-inoculation. Of the four monkeys with previous
exposure to the rabies glycoprotein, all showed a
significant increase in serum neutralization titer between
days 3 and 7 post-vaccination. The results indicate that
vaccination of squirrel monkeys with ALVAC-RG does not
produce adverse side-effects and a primary neutralizing
antibody response can be induced. An amnanestic response is
also induced on re-vaccination. Prior exposure to ALVAC or
to a canarypox recombinant expressing an unrelated foreign
gene does not interfere with induction of an anti-rabies
immune response upon re-vaccination.
The immunological response of HIV-2 seropositive
macaques to inoculation with ALVAC-RG was assessed. Animals
were inoculated as described above and the presence of anti-
rabies serum neutrali,~ing antibody assessed in an RFFI test.
The results, shown in Table 14, indicated that HIV-2
positive animals inoculated by the subcutaneous route
developed anti-rabies antibody by 11 days after one
inoculation. An anamnestic response was detected after a
booster inoculation given approximately three months after
the first inoculation. No response was detected in animals
receiving the recombinant by the oral route. In addition, a
series of six animals were inoculated with decreasing doses
of ALVAC-RG given by either the intra-muscular or
subcutaneous routes. Five of the six animals inoculated
responded by 14 days post-vaccination with no significant
difference in antibody titer.
Two chimpanzees with prior exposure to HIV were
inoculated with 7.0 logy pfu of ALVAC-RG by the
subcutaneous or intra-muscular route. At 3 months post-
inoculations both animals were re-vaccinated in an identical
fashion. The results are shown in Table 15.
No adverse reactivity to inoculation was noted by
either intramuscular or subcutaneous routes. Both
chimpanzees responded to primary inoculation by 14 days and
~':'~ 92/15672 ,~ ~ :d ~ PCT/US92/01906
-91-
a strongly rising response was detected following re-
vaccination.
~ .i ~J ~ ~d ~
VVO 92/1672 PCT/US92/01906 ,r~.;~~
-92-
Table 6. Sequential Passage of ALVAC in Avian and non-Avian
Cells.
CEF Vero MRC-5
Pass 1
Sample toa 2.4 3.0 2.6
t7b 7.0 1.4 0.4
t7A~ 1.2 1.2 0.4
Pass
2
Sample to 5,p 0.4 N.D.d
t7 7.3 0.4 N.D.
t7A 3.9 N.D. N.D.
Pass
3
Sample to 5.4 0.4 N.D.
t7 7.4 N.D. N.D.
t7A 3.8 N.D. N.D.
Pass
4
Sample to 5.2 N.D. N.D.
t~ ~1 N.D. N.D.
t7A 3.9 N.D. N.D.
a: This sample was harvested at zero time and represents
the residual input virus. The titer is expressed as
loglopfu per ml.
b: This sample was harvested at 7 days post-infection.
c: This sample was inoculated in the presence of 40 ~cg/ml
of Cytosine arabinoside and harvested at 7 days post
infection.
d: Not detectable
v ') 92/ 1 X672 ~ ~ ~ '~ '" ~ ~ PCT/US92/01906
-93-
Table 7. Sequential Passage of ALVAC-RG in Avian and non-
Avian Cells
CEF Vero MRC-5
Pass 1
Sample t0a 3.0 2.9 2.9
t7b 7.1 1.0 1.4
t7A~ 1.8 1.4 1.2
Pass 2
Sample t0 5.1 0.4 0.4
t7 7.1 N.D.d N.D.
t7A 3.8 N.D. N.D.
Pass 3
Sample t0 5.1 0.4 N.D.
t7 7.2 N.D. N.D.
t7A 3.6 N.D. N.D.
Pass 4
Sample t0 5.1 N.D. N.D.
t7 7.0 N.D. N.D.
t7A 4.0 N.D. N.D
a: This sample was harvested at zero time and represents
the residual input virus. The titer is expressed as
loglopfu per ml.
b: This sample was harvested at 7 days post-infection.
c: This sample was inoculated in the presence of 40 ~g/ml
of Cytosine arabinoside and harvested at 7 days post-
infection.
d: Not detectable.
~;~.u,~~ i r
WO 92/15672 PCT/US92/01906 ;_,
-94-
Table 8. Amplification of residual virus by passage in CEF
cells
CEF Vero MRC-5
a) ALVAC
Pass 2a 7.0b 6.0 5.2
3 7.5 4.1 4.9
4 7.5 N.D.~ N.D.
7.1 N.D. N.D.
b) ALVAC-RG
Pass 2a 7.2 5.5 5.5
3 7.2 5.0 5.1
4 7.2 N.D. N.D.
5 7.2 N.D. N.D.
a: Pass 2 represents the amplification in CEF cells of the
7 day sample from Pass 1.
b: Titer expressed as loglo pfu per ml
c: Not Detectable
~'-") 92/15672 ~ ~ ~ ~3 ~ ~ ~ PCT/US92/01906
- -95-
Table 9. Schedule of inoculation of rhesus macaques with
ALVAC-RG (vCP65)
Animal Inoculation
176L Primary: 1 X 108 pfu of vCP65 orally in TANG
Secondary: 1 X 10~ pfu of vCP65 plus 1 X 10~
pfu vCP82a
of by
SC
route
185 L Primary: 1 X 108 pfu of vCP65 orally in Tang
Secondary: 1 X 10~ pfu of vCP65 plus 1 X 10~
pfu vCP82 SC route
of by
177 L Primary: 5 X 10~ pfu SC of
vCP65
by
SC
route
Secondary: 1 X 10' pfu of vCP65 plus 1 X 10~
pfu vCP82 SC route
of by
186L Primary: 5 X 10~ pfu of vCP65 by SC route
Secondary: 1 X l0~ pfu of vCP65 plus 1 X l0'
pfu vCP82 SC route
of by
178L Primary: 1 X 10~ pfu of vCP65 by SC route
182L Primary: 1 X 10~ pfu of vCP65 by IM route
179L Primary: 1 X 106 pfu of vCP65 by SC route
183L Primary: 1 X 106 pfu of vCP65 by IM route
180L Primary: 1 X 106 pfu of vCP65 by SC route
184L Primary: 1 X 105 pfu of vCP65 by IM route
187L Primary 1 X l0~ pfu of vCP65 orally
a: vCP82 is a canarypox virus recombinant expressing the
measles virus fusion and hemagglutinin genes.
fa 1 l! c: r.. i 1
V1'O 92/15672 PCT/US92/01906 ~:v:,-'.:;
-g
Table 10. Analysis of yield in avian and non-avian cells
inoculated with ALVAC-RG
Sample Time
Cell Type t0 t72 t72Ab
Expt 1
CEF 3.3a 7.4 1.7
Vero 3.0 1.4 1.7
MRC-5 3.4 2.0 1.7
Expt 2
CEF 2.9 7.5 <1.7
WISH 3.3 2.2 2.0
Detroit-532 2.8 1.7 <1.7
a: Titer expressed as loglo pfu per ml
b: Culture incubated in the presence of 40 ~Cg/ml of
Cytosine arabinoside
!'.'1 92/1672 PCT/US92/01906
-97-
Table 11. Potency of ALVAC-RG as tested in mice
Test Challenge Dosea PDSOb
Initialseed 43 4.56
Primaryseed 23 3.34
VaccineBatch H 23 4.52
VaccineBatch I 23 3.33
VaccineBatch K 15 3.64
Vaccine.Batch L 15 4.03
VaccineBatch M 15 3.32
VaccineBatch N 15 3.39
VaccineBatch J 23 3.42
a: Expressed as mouse LD50
b: Expressed as loglo TCID5o
~~.i~~;:, i l
WO 92/15672 PCT/US92/01906
_9g_
Table 12. Efficacy of ALVAC-RG in dogs and cats
Doors Cats
Dose Antibodya Survivalb Antibody Survival
6.7 11.9 5/5 2.9 3/5
7.7 10.1 N.T. 8.1 N.T.
a: Antibody at day 29 post inoculation expressed as the
geometric mean titer in International Units.
b: Expressed as a ratio of survivors over animals
challenged
'.'.'.~ 92/1672 ~ ~ ~ ~ ~ ~ 7 PCT/US92/01906
_99_
N Q' .d
1 N H H N s! (~~p M
N
~0 OD 1
'
?v N 1 N x x M f'1x l'1N
N
'C7 I
.~ I
~ I N N r-1Ifs~O ~pO 1~
~-I ~J -~it~
v I . . . . . ,
~ N . N N N C7r1 '~
i "7t N
N
N I
ro -..,
W T I
C 1 N r1N tf110 ~pN f~ ~[$ Q
e-I
,
N -.-I.-i1
!n N r-1I N N N f'1f"1M .~ N
.i~ N
W .~-t ~ rt! p1 U c~ U
~ U
~ ~ ; t1 t~1~ N 1D N ~O t~ a
N
- ~ i i ~ , W o ~ a a a
N ~ i r' r ,- c ~ r -i ~ a > a
~ v
O I
N W W W W
U C N O O O O
I M ; N N N N N
N
ro it
d ~
( e-1r1r-Ie-W H ~-1e-1 'L1 ~C3
r-1 -i
Q Q
i V V V V V y V V
V
H H H H
~ O
H
U
H
U
ro ( N N N N N ~ ~ N ~
>'~ N ~"
'~
E
"~
U N O I +~ W
~r
O o 0 0
.-1 ~ ( .-Ir-1.--1.~ir-1H H N
ro .-~1 -
.
p ~ i V V V V V y V V i .-1
~ V
~ ~ p
O O O
U
O Qi ( .-1 r-1 .-i .--1
'O H
~ ~ ~ ~
y N O O O O
"~
~:~: I;~: N
n~nlnr
a
~
i i x
Z H H H y
,
x x N N N " x ~o~ ~d~~
.
a
a ~ i x x a b .-,
x a~ ro la
>N O ~ 1 v .
~ U
b p I I I 1 :; ~ p, ~ U U
t -.~ N I U t~t~ U U U U U U
~ U
-.i O ~ O d ~
.-1 > O I s.~r1cn a a a a a~ 41 d ~
U ~
~ 1r .1 l.yr 1r
i.1 d ~ 1 > CLOr > > > D C la ~
O ''r 7
~
1
,aJ
w i ~ > > a ~ .i.
~ ~
w a a a a x ~ ~o G
~~~~ v
1 ,
a~ h ~ .,i la
ro ro it ~
M 1 ~
~
~
S
~
1~ ~, U -
1
-
-
W
aNo>a
~~az
i a
~"'
~ i
IC O 1 ~i p~lf11~M np~ n .. .. . .. ..
H N ..
~ 1 In M In M In M In In ro ,~ U 'o a~
N W tr
~'~'f~STfTUTE SHEET
1
~,~~~i::~ 1 1
WO 92/1672 PCT/US92/01906
,:.,.~.
-100-
w
0 0
w
'' c ,~
a
~
y
'~ C H
U
N b
p
h a
'i b
d
a
lr U
GL G
'O U
C m
a a
<r w
b a~ a
I I I I I I
E
o
a
H I I I I 1 I ..a
~ y
~ C
1 1 I thc~'1e-1 H
GD -.1
d'
o a
a
~ O
~
jJ W N N f'1 3
a
.C rtf r, I I t ,-I,-~ m a o
H ~ a h aC
..-1~ 'r.7 y n n~ m
3 U Uf 1 ~rN vo .-i c
ay I I
~ ~I 1 1 1 ~c1ch .-1.C ~
h O
N ~ ..
',. a
U H ' ~1 a y
a
te
a' ~ ~
N d' N .
H ..
a
fC f.1 Op I ( c"7tp e'1 a0 Tf
~ o
U ~
o tn ,.a y
b
~ i a ro
~ ,~ 1 I ~ ~ ~ .
~~
N ~ 1 I I 1 ,
~w
~~~~
O
N w
C .o E ..7 .-a
O V pp00 N 1D CD~p ~DN N 10 pp -i C! C -.i
1 ( ~t a
O ( t1 N N e-iLC1N ~ tn'1 r-1!n N >
/~ ~ b ~
w ..
~-1H !nN e-1N N lf1tf7N v-i1
O
y
O m
W O Ir
O
0 o a~ d c oa a
1 1 t1 t0
N N ~ aT.~ N N N ~D ~p -~ it O w O~
-i' ' U
r f f ~O ~O10 N ~ N ' G .1 f
7 1
toN .I r
O ,. ~ ~
O
U ~ ~
y ~7 a
1 I I 1 I 1 1 m
~ ~
I I I I 1 10N N '~ b
'o
rit1 r1 ~ C y~ -~ .1
C!
U 'o a o v m
o a ~; a a~
I l l t l l l l a
Q > m
'
oh l I l W p tp 1p ~
t
"
,1,1 ,,~m .i ~ d .1
x
1 .c mw'' m m
O
+~ a .-r a w ..-~
-rl m
~r N H a o0 b s~
~
b m~ o;
e~
~
d c o a c-a
o v~~t~aaE~
H N
U
.Q ?~
O
H O ' ~ o, Inrn ~ o~ ~ ow n h
H 1
"
I f r-1H f'1In h 01 N tp e-1N tn111a l7 V 'L7
1 1G
a~r,.'y~;;:~Vi ~W A t ~ ~~~v~~L
'.,: 92/1 X672
PCT/US92/01906
-101-
Table 15. Inoculation of chimpanzees with ALVAC-RG
Weeks post- Animal 431 Animal 457
Inoculation I.M. S.C.
0 <8a <8
1 <8 <8
2 8 32
4 16 32
8 16 ~ 32
12b/0 16 8
13/1 128 128
15/3 256 512
20/8 64 128
26/12 32 128
a: Titer expressed as reciprocal of last dilution showing
inhibition of fluorescence in an RFFI test
b: Day of re-inoculation
~~.a~~ E
~'O 92/15672 PCT/US92/01906
-102-
Example 16 - CONBTRUCTION OF NYVAC RECOMBINANTS EgPREBBING
FhAVIVIRUB PROTEINS
This example describes the construction of NYVAC donor
plasmids containing genes from Japanese encephalitis virus
(JEV), yellow fever virus (YF) and Dengue type 1, the
isolation of the corresponding NYVAC Flavivirus recombinants
and the ability of vaccinia recombinants expressing portions -
of the genomes of JEV or YF to protect mice against lethal
challenge with the homologous virus.
Cell Lines and Virus Strains. A thymidine kinase
mutant of the Copenhagen strain of vaccinia virus vP410 (Guo
et al., 1989) was used to generate recombinants vP825,
vP829, vP857 and vP864 (see below). The generation of vP555
has previously been described (Mason et al., 1991).
Biosynthetic studies were performed using HeLa cells grown
at 37°C in Eagle's minimal essential medium supplemented
with FBS and antibiotics. The JEV virus used in all in
vitro experiments was a clarified culture fluid prepared
from C6/36 cells infected with a passage 55 suckling mouse
brain suspension of the Nakayama strain of JEV (Mason,
1989). Animal challenge experiments were performed using
the highly pathogenic P3 strain of JEV (see below).
Cloninct of JEV Genes Into a Vaccinia Virus Donor
Plasmid. The JEV cDNAs used to construct the JEV-vaccinia
recombinant viruses were derived from the Nakayama str-.in of
JEV (McAda et al., 1987).
Plasmid pDr20 containing JEV cDNA (nucleotides -28 to
1000) in the SmaI and EcoRI sites of pUCl8, was digested
with BamHI and EcoRI and the JEV cDNA insert cloned into
pIBI25 (International Biotechnologies, Inc., New Haven, CT)
generating plasmid JEV18. JEV18 was digested with ApaI
within the JE sequence (nucleotide 23) and XhoI within
~pIBI25 and ligated to annealed oligonucleotides J90 (SEQ ID
N0:114) and J91 (SEQ ID N0:115) (containing an XhoI sticky
end, SmaI site, and JE nucleotides 1 to 23) generating
plasmid JEV19. JEV19 was digested with XhoI within pIBI25
and AccI within JE sequences (nucleotide 602) and the
,resulting 613 by fragment was cloned into the XhoI and AccI
fragment of JEV2 (Mason et al., 1991) containing the plasmid
~'~ 92/15672
PCT/US92/01906
-103-
origin and JEV cDNA encoding the carboxy-terminal 40% prM
and'amino-terminal two thirds of E (nucleotides 602 to
2124), generating plasmid JEV20 containing JE sequences from
the ATG of C through the SacI site (nucleotide 2124) found
in the last third of E.
The SmaI-SacI fragment from JEV8 (a plasmid analogous
to JEVL Mason et al., 1991) in which TTTTTGT nucleotides
1304 to 1310 were changed to TCTTTGT), containing JE
sequences from the last third of E through the first two
amino acids of NS2B (nucleotides 2124 to 4126), the plasmid
origin and vaccinia sequences, was ligated to the purified
SmaI-SacI insert from JEV20 yielding JEV22-1. The 6 by
'corresponding to the unique SmaI site used to construct
JEV22-1 were removed using oligonucleotide-directed double-
strand break mutagenesis (Mandecki, 1986) creating JEV24 in
which the H6 promoter immediately preceded the ATG start
codon.
Plasmid JEV7 (Mason et al., 1991) was digested with
SphI within JE sequences (nucleotide 2180) and HindIII
within IBI24. Ligation to annealed oligonucleotides J94 and
J95 [containing a SphI sticky end, translation stop, a
vaccinia early transcription termination signal (TTTTTAT;
Yuen et al., 1987) a translation stop, an EactI site and a
HindIII sticky end] generated plasmid JEV25 which contains
JE cDNA extending from the SacI site (nucleotide 2124) in
the last third of E through the carboxy-terminus of E. The
SacI-EactI fragment from JEV25 was ligated to the SacI-Ea~cI
fragment of JEV8 (containing JE cDNA encoding 15 as C, prM
and amino-terminal two thirds of E nucleotides 337 to 2124,
the plasmid origin and vaccinia sequences) yielding plasmid
JEV26. A unique SmaI site preceding the ATG start codon was
removed as described above, creating JEV27 in which the H6
promoter immediately preceded the ATG start codon.
Oligonucleotides J96, J97, J98 and J99 (containing JE
nucleotides 2243 to 2380 with an SphI sticky end) were
kinased, annealed and ligated to SmaI-SphI digested and
alkaline phosphatase treated pIBI25 generating plasmid
JEV28. JEV28 was digested with HpaI within the JE sequence
(nucleotide 2301) and with HindIII within the pIBI25
WO 92/15672 PCC/US92/01906
-104-
sequence and alkaline phosphatase treated. Ligation to the
HpaI-HindIII fragment from JEV1 or HpaI-HindIII fragment
from JEV7 (Mason et al., 1991) yielded JEV29 (containing a
SmaI site followed by JE cDNA encoding 30 as E, NS1, NS2A
nucleotides 2293 to 4126) and JEV30 (containing a SmaI site
followed by JE cDNA encoding 30 as E, NS1, NS2A, NS2B
nucleotides 2293 to 4512). ,
The SmaI-EagI fragment from JEV29 was ligated to SmaI-
EagI digested pTPlS (Mason et al., 1991) yielding JEV31.
The 6 by corresponding to the unique SmaI site used to
produce JEV31 were removed as described above creating JEV33
in which the H6 promoter immediately preceded the ATG start
codon.
The SmaI-EadI fragment from JEV30 was ligated to SmaI-
EagI digested pTPlS yielding JEV32. The 6 by corresponding
to the unique SmaI site used to produce JEV32 were removed
as described above creating JEV34 in which the H6 promoter
immediately preceded the ATG start codon. Oligonucleotides.
J90 (SEQ ID N0:114), J91 (SEQ ID N0:115), J94 (SEQ ID
N0:116), J95 (SEQ ID N0:117), J96 and J97 (SEQ ID N0:118),
and J99 and J98 (SEQ ID N0:119) are as follows:
J90 5'-TCGAG CCCGGG atg ACTAAAAAACCAGGA GGGCC-3'
J91 3'- C GGGCCC TAC TGATTTTTTGGTCCT C -5'
XhoI SmaI Apal
J94 5'- C T tga tttttat tga CGGCCG A -3'
J95 3'-GTACG A ACT AAAAATA ACT GCCGGC TTCGA-5'
Sphl EagI HindIII
J96+J97 5'-GGG atg GGCGTTAACGCACGAGACCGATCAATTGCTTTGGCC
J99+J98 3'-CCC TAC CCGCAATTGCGTGCTCTGGCTAGTTAACGAAACCGG
TTCTTAGCCACAGGAGGTGTGCTCGTGTTCTTAGCGACCAATGT GCATG-3'
AAGAATCGGTGTCCTCCACACGAGCACAAGAATCGCTGGTTACA C -5'
SphI
Construction of Vaccinia Virus JEV Recombinants.
Plasmids JEV24, JEV27, JEV33 and JEV34 were transfected into
vP410 infected cells to generate the vaccinia recombinants
vP825, vP829, vP857 and vP864 respectively (FIG. 18).
In Vitro Virus Infection and Radiolabelinct. HeLa cell
monolayers were prepared in 35 mm diameter dishes and
infected with vaccinia viruses (m.o.i. of 2 pfu per cell) or
JEV (m.o.i. of 5 pfu per cell) before radiolabeling. Cells
'?-:-:'1 92/15672 ~ ~ ~ ~j N ~ ~ PCT/US92/01906
-105-
were pulse labeled with medium containing 35S-Met and chased
for'6 hr in the presence of excess unlabeled Met exactly as
described by Mason et al. (1991).
Radioimmunoprecipitations, Polvacrylamide Gel
Electrophoresis, and Endoglycosidase Treatment.
Radiolabeled cell lysates and culture fluids were harvested
and the viral proteins were immunoprecipitated, digested
with endoglycosidases, and separated in SDS-containing
polyacrylamide gels (SDS-PAGE) exactly as described by Mason
(1989).
Animal Protection Experiments. Mouse protection
experiments were performed exactly as described by Mason et
al. (1991). Briefly, groups of 3-week-old mice were
immunized by intraperitoneal (ip) injection with 10~ pfu of
vaccinia virus recombinants, and 3 weeks later sera were
collected from selected mice. Mice were then either re-
inoculated with the recombinant virus or challenged with 1.3
x 103 LDSO by intraperitoneal injection with a suspension of.
suckling mouse brain infected with the P3 strain of JEV.
Three weeks later, the boosted animals were rebled and
challenged with 4.9 x 105 LDSO of the P3 strain of JEV.
Following challenge, mice were observed at daily intervals
for three weeks and lethal-dose titrations were performed in
each challenge experiment using litter-mates of the
experimental animals. In addition, sera were collected from
all surviving animals 4 weeks after challenge.
Evaluation of Immune Response to the Recombinant
Vaccinia Viruses. Sera were tested for their ability to
precipitate JEV proteins from detergent-treated cell lysates
or culture fluids obtained from 35S-Met-labeled JEV-infected
cells exactly as described by Mason et al. (1991).
Hemagglutination inhibition (HAI) and neutralization (NEUT)
tests were performed as described by Mason et al. (1991)
except carboxymethylcellulose was used in the overlay medium
for the NEUT test.
Structure of Recombinant Vaccinia Viruses. Four
different vaccinia recombinants (in the HA locus) were
constructed that expressed portions>of the JEV coding region
extending from C through NS2B. The JEV cDNA sequences
f,: 1 U cJ .y. i i
V1'O 92/15672 ' ~ PCT/US92/01906
-106-
contained in these recombinant viruses are shown in FIG. 18.
In all four recombinant viruses the sense strand of the JEV
cDNA was positioned behind the vaccinia virus early/late H6
promoter, and translation was expected to be initiated from
naturally occuring JEV Met codons located at the 5' ends of
the viral cDNA sequences. ,
Recombinant vP825 encoded the capsid protein,
structural protein precursor prM, the structural
glycoprotein E, the nonstructural glycoprotein NS1, and the
nonstructural protein NS2A (McAda et al., 1987).
Recombinant vP829 encoded the putative l5~aa signal sequence
preceding the amino-terminus of prM, as well as prM, and E
(McAda et al., 1987). Recombinant vP857 contained a cDNA
encoding the 30 as hydrophobic carboxy-terminus of E,
followed by NS1 and NS2A. Recombinant vP864 contained a
cDNA encoding the same proteins as vP857 with the addition
of NS2B. In recombinants vP825 and vP829 a potential
vaccinia virus early transcription termination signal in E .
(TTTTTGT; nucleotides 1304-1310) was modified to TCTTTGT
without altering the as sequence. This change was made in
an attempt to increase the level of expression of E since
this sequence has been shown to increase transcription
termination in in vitro transcription assays (Yuen et al.,
1987).
E and prM Are Correctly Processed When Expressed By
Recombinant Vaccinia Viruses. Pulse-chase experiments
demonstrate that proteins identical in size to E were
synthesized in cells infected with all recombinant vaccinia
viruses containing the E gene (Table 16). In the case of
cells infected with JEV, vP555 and vP829, an E protein that
migrated slower in SDS-PAGE was also detected in the culture
fluid harvested from the infected cells (Table 16). This
extracellular form of E produced by JEV- and vP555-infected
cells contained mature N-linked glycans (Mason, 1989; Mason
et al., 1991), as confirmed for the extracellular forms of E
produced by vP829-infected cells. Interestingly, vP825,
which contained the C coding region in addition to prM and E
specified the synthesis of E in a form that is not released
into the extracellular fluid (Table 16).
'','1 92/15672
PCT/US92/01906
-107-
Immunoprecipitations prepared from radiolabeled recombinant
vaccinia-infected cells using a MAb specific for M (and prM)
revealed that prM was synthesized in cells infected with
vP555, vP825, and vP829, and M was detected in the culture
fluid of cells infected with vP555 or vP829 (Table 16).
The extracellular fluid harvested from cells infected
with vP555 and vP829 contained an HA activity that was not
detected in the culture fluid of cells infected with vP410,
vP825, vP857 or vP864. This HA appeared similar to the HA
produced in JEV infected cells based on its inhibition by
anti-JEV antibodies and its pH optimum (Mason et al., 1991).
Sucrose density gradients were prepared with culture fluids
from cells infected with vaccinia virus JEV recombinants
vP829, vP825, vP857 and vP864. Analysis of the gradients
identified a peak of HA activity in the vP829 infected
sample that co-migrated with the peak of slowly-sedimenting
hemagglutinin (SHA) found in the JEV culture fluids (data
not shown). This result indicated that vP829 infected cells.
produce extracellular particles similar to the empty viral
envelopes containing E and M observed in the culture fluids
harvested from vP555 infected cells (Table 16 and Mason et
al., 1991).
NS1 Is Correctly Processed and Secreted When Expressed
Bv Recombinant Vaccinia Virus. The results of pulse-chase
experiments demonstrated that proteins identical in size to
authentic NS1 and NS1' were synthesized in cells infected
with vP555, vP825, vP857 and vP864. NS1 produced by vP555-
infected cells was released into the culture fluid of
infected cells in a higher molecular weight form. NS1 was
also released into the culture fluid of cells infected with
vP857 and vP864, whereas NS1 was not released from cells
infected with vP825 (Table 16). Comparison of the synthesis
of NS1 from recombinant vaccinia viruses containing either
the NS2A (vP857) or both the NS2A and NS2B coding regions
showed that the presence or absence of the NS2B coding
region had no affect on NS1 expression, consistent with
previous data showing that only the NS2A gene is needed for
the authentic processing of NS1 (Falgout et,al., 1989; Mason
et al., 1991).
~~~v~~
VVO 92/1,672 PCT/US92/01906 tv:
-108-
Recombinant Vaccinia Viruses Induced Immune Responses
To JEV Antigens. Pre-challenge sera pooled from selected
animals in each group were tested for their ability to
immunoprecipitate radiolabeled E and NS1. The results of
these studies (Table 16) demonstrated that: (1) the
magnitude of immune response induced to E was
vP829>vP555>vP825, (2) all viruses encoding NS1 and NS2A
induced antibodies to NS1, and (3) all immune responses were
increased by a second inoculation with the recombinant
viruses. Analysis of the neutralization and HAI data for
the sera collected from these animals (Table 17) confirmed
the results of the immunoprecipitation analyses, showing
that the immune response to E as demonstrated by RIP
correlated well with these other serological tests (Table
17) .
Vaccination With the Recombinant Viruses Provided
Protection From Lethal JEV Infection. All of the
recombinant vaccinia viruses were able to provide mice with
some protection from lethal infection by the peripherally
pathogenic P3 strain of JEV (Huang, 1982) (Table 17). These
studies confirmed the protective potential of vP555 (Mason
et al., 1991) and demonstrated similar protection in animals
inoculated with vP825 and vP829. Recombinant viruses vP857
and vP864 which induced strong immune responses to NS1
showed much lower levels of protection, but mice inoculated
with these recombinants were still significantly protected
when compared to mice inoculated with the control virus,
vP410 (Table 17).
Post-Challenge Immune Responses Document the Level of
JEV Replication. In order to obtain a better understanding
of the mechanism of protection from lethal challenge in
animals inoculated with these recombinant viruses, the
ability of antibodies in post-challenge sera to recognize
JEV antigens was evaluated. For these studies antigen
present in lysates of radiolabeled JEV-infected cells was
utilized, and the response to the NS3 protein which induces
high levels of antibodies in hyperimmunized mice (Mason et
al., 1987a) was exTmined. The results of these studies
(Table 18) correlates with the survival data in that groups
~.'y 92/1672 ~ ~ ~ s.! ~ ~ ~ PCT/US92/01906
-109-
of animals vaccinated with recombinant viruses that induced
high levels of protection (vP829, vP555, and vP825) showed
low post-challenge responses to NS3, whereas the sera from
survivors of groups vaccinated with recombinants that
expressed NS1 alone (vP857 and vP864) showed much higher
post-challenge responses to NS3.
7
WO 92/1672 PCT/US92/01906 ~~~~;'"4'~;
-110-
~ I
m ,..I ,--I
I '
~ ' x x z z 'ro h
~
ro . N
U ~ ~ r
C
C 't7
-.I ro ro
U > W ~
i.~
~ TJ
b i ~ b
~ t ~ > t7 Gr
n O U
> m .-I ,.~ O ~ +~ .i ro >
~C .-r
i~ GL ~ V1 I U7 W ~ ~ '"W-1
't3
> x z ~ N 0
z z ~ .C~ ro 1 U
N
~
b ~ ro
ro
m
N
~
N u, w w ~ .~ >~ ro
r~ ~
' U .i . ~ O .C
W
f-1 CO ''' f~ U N . ~
d
~ t o
n x a~ 3 ~ 3 w .c
r~.z s~ z w a UN
Nb N
~ ~~~ ~
N ~ 3~
U U V ro
~
~. -
s
a o~ W w .fir -~ U
h ~
o ' ~ ~ a'
tr~ o W ~
ro+~ U ~ U
~ O ~
C1~- > ~ ~ t W w
~ W
l:7.
W ~
N
O .i~ C. ri O W ~.
~ O .F.,
tn ~,..r ro .~1 ~ C ~ O
:~
W ~
a 'fir ~ r1 ~ ~.i
z ~ ~ .~
, ~
> ~ c0 W U .~ N
+ w z I ~~' O
ro o,z ~ ro,,
N
N ~ .-1 .-1 f'.1 d >r
.4~ N V
h
W
~ U O ~
4 b ~ '~ ~ 3 N 3
l C ~ N
~
d
a~ ro
O ~
~
~ CJ O W N r-1
N G l.
r
~ f-1 O ~ ~ 1.~
O ~ 1-1 )~ -.-i .-1
f1 Q! r- W'i -~ U
t1 1 ro O >
ro y,., ,~ .d ~ ~ ~ 41 C
U TJ
N
U ~ ~ O b ~ R
~ O ~ O d
i.r ? y h . v
1r C U R
41 ro ~ W N 4j ~ '""~ W i.l fa i-~
~"~ .i r-I
C
, ,. ~ ro ~
.~ U
~
~ C~ .C1 ~ U C
U ~ 1 ~
U
~ ~ ~ ~ 't3 la N W -.i
Q1 r-I U
r ,. O ro r1 O ~ !;
N -1 .I G1. V1 ~ N ro
~ ~ N 27 C4 > N f=. h .a
z 2f ~ >
i~
O
O
ro ~ ~
E p ro
,, , W N
b .C
.:~~~:y'i°iTUT~ SHEET
':r:'~ 92/15672 ~ ~ ~ '~ w ~ ~ PCT/US92/01906
-111-
Table 17. Protection of mice and immune response following
single or double inoculations with recombinant
vaccinia virus expressing JEV proteins
Immunizing Viruses
Protectionb vP555 vP829 vP825 vP857 vP864
single inoculation 7/10 10/10 8/10 0/10 1/10
double inoculation 10/10 9/10 9/10 5/10 6/10
Neut titer
single inoculation 1:20 1:160 1:10 <1:10 <1:10
double inoculation 1:320 1:2560 1:320 <1:10 <1:10
HAI titers
single inoculation 1:20 1:40 1:10 <1:10 <1:10
double inoculation 1:80 1:160 1:40 <1:10 <1:10
Groups of 20 mice were inoculated by ip route with 10~
pfu of the indicated vaccinia virus JEV recombinant.
Sera were collected after three weeks. At this time, 10
mice per group were challenged with JEV as indicated in
the text (single inoculation). The remaining 10 mice in
each group were boosted with the same vaccinia virus
JEV recombinant (double inoculation). After three
weeks, sera were collected and the mice were challenged
with JEV. All mice were observed for 21 days post
challenge.
Protection is expressed as number os mice surviving at
21 days post challenge/total.
Neutralization titer is expressed as the reciprocal of
the highest dilution that gives 90~ JEV plaque
reduction.
HAI titer is expressed as the reciprocal of the highest
dilution that gives measurable inhibition of
hemagglutination of red blood cells.
M t V v ... i ~
V1'O 92/15672
PCT/US92/01906 ~;=.,;;.
-112-
Table 18. Post challenge immune response following single or
- double inoculation with recombinant vaccinia virus
expressing JEV proteins.
Immunizing Virus
vP555 vP829 vP825 vP857 vP864
single ++ + ++ -a ++++ ,
double +/-b - - ++ +++
+ NS3 antibodies present in post-challenge sera
a No surviving mice
b Very low level NS3 antibodies present in post-challenge
sera
21 day post challenge sera from mice surviving JEV challenge
following single or double inoculation with vaccinia virus
JEV recombinants (Table 17) were analyzed for the presence
of antibodies to JEV NS3.
~i~~~~7
'':-? 92/1672 PCT/US92/01906
-113-
Cloning of JEV Genes Into a Vaccinia ~NYVAC) Donor
Plasmid. Plasmid pMP2VCL (containing a polylinker region
within vaccinia sequences upstream of the K1L host range
gene) was digested within the polylinker with HindIII and
XhoI and ligated to annealed oligonucleotides SPHPRHA A
through D generating SP126 containing a HindIII site, H6
promoter -124 through -1 (Perkus et al., 1989) and XhoI,
KpnI, SmaI, SacI and EcoRI sites.
Plasmid pSD544VC (containing vaccinia sequences
surrounding the site of the HA gene which was replaced with
a polylinker region and translation termination codons in
six reading frames) was digested with XhoI within the
polylinker, filled in with the Klenow fragment of DNA
polymerase I and treated with alkaline phosphatase. SP126
was digested with HindIII, treated with Klenow and the H6
promoter isolated by digestion with SmaI. Ligation of the
H6 promoter fragment to pSD544VC generated SPHA-H6 which
contained the H6 promoter in the polylinker region (in the
direction of HA transcription).
Plasmid'JEVL14VC was digested with EcoRV in the H6
promoter and SacI in JEV sequences (nucleotide 2124) and a
1789 by fragment isolated. JEVL14VC (Mason et al., 1991)
was digested with EclXI at the EagI site following the TSNT,
filled in with the Klenow fragment of DNA polymerase I and
digested with SacI in JEV sequences (nucleotide 2124)
generating a 2005 by fragment. The 1789 by EcoRV-SacI and
2005 by (SacI-filled EclXI) fragments were ligated to EcoRV
(within H6) and SmaI digested (within polylinker) and
alkaline phosphatase treated SPHA-H6 generating JEV35.
JEV35 was transfected into vP866 (NYVAC) infected cells to
generate the vaccinia recombinant vP908 (FIG. 18).
JEV35 was digested with SacI (within JE sequences
nucleotide 2124) and EclXI (after TSNT) a 5497 by fragment
isolated and ligated to a SacI (JEV nucleotide 2124) to EaQI
fragment of JEV25 (containing the remaining two thirds of E,
translation stop and TSNT) generating JEV36. JEV36 was
transfected into vP866 (NYVAC) infected cells to generate
the vaccinia recombinant vP923 (FIG. 18). ,
/w 1 U' cj ~.. 6
WO 92/1,6'2 PCT/US92/01906 St'=i'a
-114-
SPHPRHA A through D Oligonucleotides SPHPRHA:A+B (SEQ ID
N0:120) and SPHPRHA:C+D (SEQ ID N0:121)
are as follows
HindIII
5'- AGCTTCTTTATTCTATACTTAAAAAGTGAAAATAAATACAAAGGTTCTTGA
3'- AGAAATAAGATATGAATTTTTCACTTTTATTTATGTTTCCAAGAACT
EcoRV
GGGTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATTATTTCATTATCGCGATATCCG
CCCAACACAATTTAACTTTCGCTCTTTATTAGTATTTAATAAAGTAATAGCGCTATAGGC
TTAAGTTTGTATCGTAC -3'
AATTCAAACATAGCATGAGCT -5'
XhoI
Construction of Plasmids Containing YF Genes. The YF
17D cDNA clones used to construct the YF vaccinia
recombinant viruses (clone lOIII and clone 28III), were
obtained from Charles Rice (Washington University School of
Medicine, St. Louis, MO). All nucleotide coordinates are
derived from the sequence data presented in Rice et al.,
1985.
Plasmid YFO containing YF cDNA encoding the carboxy-
terminal 80% prM, E and amino-terminal 80% NS1 (nucleotides
537-3266) was derived by cloning an AvaI to NsiI fragment of
YF cDNA (nucleotides 537-1659) and an NsiI to KpnI fragment
of YF cDNA (nucleotides 1660-3266) into AvaI and KpnI
digested IBI25 (International Biotechnologies, Inc., New
Haven, CT). Plasmid YF1 containing YF cDNA encoding C and
amino-terminal 20% prM (nucleotides 119-536) was derived by
cloning a RsaI to AvaI fragment of YF cDNA (nucleotides 166-
536) and annealed oligonucleotides SP46 and SP47 (containing
a disabled HindIII sticky end, XhoI and ClaI sites and YF
nucleotides 119-165) into AvaI and HindIII digested IBI25.
Plasmid YF3 containing YF cDNA encoding the carboxy-terminal
60% of E and amino-terminal 25% of NS1 was generated by
cloning an ApaI to BamHI fragment of YF cDNA (nucleotides
1604-2725) into'ApaI and BamHI digested IBI25. Plasmid YF8
containing YF cDNA encoding the carboxy-terminal 20% NS1
NS2a, NS2B and amino-terminal 20% NS3 was derived by cloning
a KpnI to XbaI fragment of YF cDNA (nucleotides 3267-4940)
into KQnI and XbaI digested TBI25. Plasmid YF9 containing
YF cDNA encoding the carboxy-terminal 60% NS2B and amino-
~i~~~~~
' -.',~1 92/ 15672 PCT/US92/01906
-115-
terminal 20% NS3 was generated by cloning a SacI to XbaI
fragment of YF cDNA (nucleotides 4339-4940) into SacI and
XbaI digested IBI25. Plasmid YF13 containing YF cDNA
encoding the carboxy-terminal 25% of C, prM and amino-
terminal 40% of E was derived by cloning a Ball to ApaI
fragment of YF cDNA (nucleotides 384-1603) into ApaI and
SmaI digested IBI25.
Oligonucleotide-directed mutagenesis (Kunkel, 1985) was
used to change the following potential vaccinia virus early
transcription termination signals (Yuen et al., 1987) (1) 49
as from the amino-terminus of the C gene in YF1 (TTTTTCT
nucleotides 263-269 and TTTTTGT nucleotides 269-275) to (SEQ
ID N0:122) TTCTTCTTCTTGT creating plasmid YF1B, (2) in the E
gene in YF3 (nucleotides 1886-1893 TTTTTTGT to TTCTTTGT 189
as from the carboxy-terminus and nucleotides 2429-2435
TTTTTGT to TTCTTGT 8 as from the carboxy-terminus) creating
plasmids YF3B and YF3C, respectively. A PstI to BamHI
fragment from YF3C (nucleotides 1965-2725) was exchanged for.
the corresponding fragment of YF3B generating YF4 containing
YF cDNA encoding the carboxy-terminal 60% E and amino-
terminal 25% NS1 (nucleotides 1604-2725) with both
mutagenized transcription termination signals. An ApaI to
BamHI fragment from YF4 (nucleotides 1604-2725) was
substituted for the equivalent region in YFO creating
plasmid YF6 containing YF cDNA encoding the carboxy-terminal
80% prM, E and amino-terminal 80% NS1 (nucleotides 537-3266)
with both mutagenized transcription termination signals.
Plasmid YF6 was digested with EcoRV within the IBI25
sequences and AvaI at nucleotide 537 and ligated to an EcoRV
to AvaI fragment from YF1B (EcoRV within IBI25 to AvaI at
nucleotide 536) generating YF2 containing YF cDNA encoding C
through the amino-terminal 80% of NS1 (nucleotides 119-3266)
with an XhoI and ClaI site at 119 and four mutagenized
transcription termination signals.
Oligonucleotide-directed mutagenesis described above
was used (1) to insert XhoI and ClaI sites preceding the ATG
17 as from the carboxy-terminus of E (nucleotides 2402-2404)
in plasmid YF3C creating YF5, (2) to insert XhoI and ClaI
sites preceding the ATG 19 as from the carboxy-terminus of
~I~~~;~ .
WO 92/1672 PCT/US92/01906
-116-
prM (nucleotides 917=919) in plasmid YF13 creating YF14, (3)
to~insert an XhoI site preceding the ATG 23 as from the
carboxy-terminus of E (nucleotides 2384-2386) in plasmid
YF3C creating plasmid YF25, (4) and to insert an XhoI site
and ATG (nucleotide 419) in plasmid YF1 21 as from the
carboxy-terminus of C generating YF45.
An A.paI to BamHI fragment from YF5 (nucleotides 1604- .
2725) was exchanged for the corresponding region of YFO
creating YF7 containing YF cDNA encoding the carboxy-
terminal 80% prM, E and amino-terminal 80% NS1 (nucleotides
537-3266) with XhoI and ClaI sites at 2402 (17 as from the
carboxy-terminus of E) and a mutagenized transcription
termination signal at 2429-2435 (8 as from the carboxy-
terminus of E). The ApaI to BamHI fragment from YF25
(nucleotides 1604-2725) was exchanged for the corresponding
region of YFO generating YF26 containing YF cDNA encoding
the carboxy-terminal 80% prM, E and amino-terminal 80% NS1
(nucleotides 537-3266) with an XhoI site at nucleotide 2384.
(23 as from the carboxy-terminus of E) and mutagenized
transcription termination signal at 2428-2435 (8 as from the
carboxy-terminus of E).
An AvaI to ApaI fragment from YF14 (nucleotides 537-
1603) was substituted for the corresponding region in YF6
generating YF15 containing YF cDNA encoding the carboxy-
terminal 80% prM, E and amino-terminal 80% NS1 (nucleotides
537-3266) with XhoI and ClaI sites at nucleotide 917 (19 as
from the carboxy-terminus of prM) and two mutagenized
transcription termination signals. YF6 was digested within
IBI25 with EcoRV and within YF at nucleotide 537 with AvaI
and ligated to an EcoRV (within IBI25) to Aval fragment of
YF45 generating YF46 containing YF cDNA encoding C through
the amino-terminal 80% NS1 (nucleotides 119-3266) with an
XhoI site at 419 (21 as from the carboxy-terminus of C) and
two transcription termination signals removed.
Oligonucleotide-directed mutagenesis described above
was used to insert a SmaI site at the carboxy-terminus of
NS2B (nucleotide 4569) in plasmid YF9 creating YF11, and to
insert a SmaI site at the carboxy-terminus of NS2A
(nucleotide 4180) in plasmid YF8 creating YF10. A SacI to
92/1~67~
' ~ ~ ~ J H ~ 7 pCT/US92/01906
-117-
XbaI fragment from YF11 (nucleotides 4339-4940) and ASQ718
to SacI fragment from YF8 (nucleotides 3262-4338) were
ligated to Asp718 and XbaI digested IBI25 creating YF12
containing YF cDNA encoding the carboxy-terminal 20% NS1,
NS2A, NS2B and amino-terminal 20% NS2B (nucleotides 3262-
4940) with a SmaI site after the carboxy-terminus of NS2B
(nucleotide 4569).
Cloning of YF Genes into a ~HES System Vaccinia Virus
Donor Plasmid. Prior to insertion of YF cloning sequences
into a NYVAC donor plasmid, YF coding sequences were
inserted into vaccinia plasmid pHES4 (Perkus et al., 1989).
A KpnI to SmaI fragment from YF12 encoding carboxy-terminal
20% NS1, NS2A and NS2B (nucleotides 3267-4569), XhoI to KpnI
fragment from YF15 encoding 19 as prM, E and amino-terminal
80% NS1 (nucleotides 917-3266) and XhoI-SmaI digested pHES4
were ligated generating YF23. An XhoI to BamHI fragment
from YF26 encoding 23 as E, amino-terminal 25% NS1
(nucleotides 2384-2725) was ligated to an XhoI to BamHI ,
fragment from YF23 (containing the carboxy-terminal 75% NS1,
NS2A and NS2B, the origin of replication and vaccinia
sequences) generating YF28.
XhoI-SmaI digested pHES4 was ligated to a purified XhoI
to KpnI fragment from YF7 encoding 17 as E and amino-
terminal 80% NS1 (nucleotides 2402-3266) plus a KpnI to SmaI
fragment from YF10 encoding the carboxy-terminal 20% NS1 and
NS2A (nucleotides 3267-4180) creating YF18. An XhoI to
BamHI fragment from YF2 encoding C, prM, E and amino-
terminal 25% NS1 (nucleotides 119-2725) was ligated to a
XhoI to BamHI fragment of YF18 (containing the carboxy-
terminal 75% NS1 and NS2A, the origin of replication and
vaccinia sequences) generating YF19. The same XhoI to BamHI
fragment from YF2 was ligated to a XhoI to BamHI fragment
from YF28 (containing the carboxy-terminal 75% NS1 and NS2A,
the origin of replication and vaccinia sequences) generating
YF20. A XhoI to BamHI fragment from YF46 encoding 21 as C,
prM, E and amino-terminal 25% NS1 (nucleotides 419-2725) was
ligated to the XhoI to BamHI fragment from YF18 generating
YF47. Oligonucleotide SP46 (SEQ ID N0:123) AND SP47 (SEQ ID
N0:124) are as follows: _
~1~~~'~( l
WO 92/1672
PCT/US92/01906 r~r'~;
-118-
HindIII
SP46 5'- AGCTT CTCGAGCATCGATTACT atg TCTGGTCGTAAAGCTCAGGG
SP47 3'- A GAGCTCGTAGCTAATGA TAC AGACCAGCATTTCGAGTCCC
AAAAACCCTGGGCGTCAATATGGT -3'
TTTTTGGGACCCGCAGTTATACCA -5'
Construction of Recombinant YF Vaccinia Viruses. Five
different vaccinia virus recombinants that expressed
portions of the YF coding region extending from C through
NS2B were constructed utilizing a host range selection
system (Perkus et al., 1989). Plasmids YF18, YF23, YF20,
YF19 and YF47 were transfected into vP293.infected cells to
generate the vaccinia recombinants vP725, vP729, vP764,
vP766 and vP869. The YF cDNA sequences contained in these
recombinants are shown in FIG. 19. In all five recombinant
viruses the sense strand of YF cDNA was positioned behind
the vaccinia virus early/late H6 promoter, and translation
was expected to be initiated from Met codons located at the
5' ends of the viral cDNA sequences (FIG. 19).
Recombinant vP725 encoded the putative 17-as signal
sequence preceding the N terminus of the nonstructural
protein NS1 and the nonstructural proteins NS1 and NS2A
(Rice et al., 1985). Recombinant vP729 encoded the putative
19-as signal sequence preceding the N terminus of E, E, NS1,
NS2A and NS2B (Rice et al., 1985). Recombinant vP764
encoded C, prM, E, NSl, NS2A and NS2B (Rice et al., 1985).
Recombinant vP766 encoded C, prM, E, NS1 and NS2A (Rice et
al., 1985). Recombinant vP869 encoded the putative 21-as
signal sequence preceding the N terminus of the prM
structural protein precursor as well as prM, E, NS1 and NS2A
(Rice et al., 1985).
Protection From Lethal YF Challencte. vP869 secreted an
HA activity not found in the culture fluid of cells infected
with any of the other recombinants. This HA appeared
similar to the HA produced in YF infected cells based on its
inhibition by anti-YF antibodies and pH optimum.
Three-week-old mice were inoculated intraperitoneally
with 10~ pfu vP869, vP764 or YF-17D and challenged three
weeks later with 100 LDS~ of French neurotropic strain of
YF. vP869 provided significant protection (Table 19)
'e;;'~ 92/15672 ~ ~ (~ J ~ '~ ~ PCT/US92/01906
-119-
whereas vP764 offered no better protection than a control
vaccinia virus lacking YF genes (vP457).
Table 19. Protection of mice by recombinant vaccinia viruses
from YF challenge
Immunizing Virus Survival/total
vP457 2/10
vP764 2/10
vP869 9/10
17D 5/10
Cloning of YF Genes Into a NYVAC Donor Plasmid. A XhoI
to SmaI fragment from YF47 (nucleotides 419-4180) containing
YF cDNA encoding 21 amino acids C, prM, E, NS1, NS2A (with
nucleotide 2962 missing in NS1) was ligated to XhoI-SmaI
digested SPHA-H6 (HA region donor plasmid) generating YF48.
YF48 was digested with SacI (nucleotide 2490) and partially
digested with Asp718 (nucleotide 3262) and a 6700 by
fragment isolated (containing the plasmid origin of
replication, vaccinia sequences, 21 amino acids C, prM, E,
amino-terminal 3.5% NS1, carboxy-terminal 23% NS1, NS2A) and
ligated to a SacI-AsD718 fragment from YF18 (containing the
remainder of NS1 with the base present at 2962) generating
YF51. The 6 by corresponding to the unique XhoI site in
YF51 were removed using oligonucleotide-directed double-
strand break mutagenesis (Mandecki, 1986) creating plasmid
YF50 encoding YF 21 amino acids C, prM, E, NS1, NS2A in the
HA locus donor plasmid. Donor plasmid YF50 was transfected
into vP866 (NYVAC) infected cells to generate vaccinia
recombinant vP984.
The 6 by corresponding to the unique XhoI site in YF48
were removed using oligonucleotide-directed double-strand
break mutagenesis creating YF49. Oligonucleotide-directed
mutagenesis (Kunkel, 1985) was used to insert a SmaI site at
the carboxy-terminus of E (nucleotide 2452) in YF4 creating
YF16. An A~aI-SmaI fragment of YF49 (containing the plasmid
origin of replication, vaccinia sequences and YF cDNA
encoding 21 amino acid C, prM, and amino-terminal 43% E) was
ligated to an ADaI-SmaI fragment from YF16 (nucleotides
V1'O 92/15672 PCT/US92/01906
-120-
1604-2452 containing the carboxy-terminal 57% E) generating
YF53 containing 21 amino acids of C, prM, E in the HA locus.
Donor plasmid YF53 was transfected into vP913 (NYVAC-MV)
infected cells to generate the vaccinia recombinant vP997.
Cloninct of Denctue Type 1 Into a Vaccinia Virus Donor
Plasmid. Plasmid DEN1 containing DEN cDNA encoding the
carboxy-terminal 84% NS1 and amino-terminal 45% NS2A
(nucleotides 2559-3745, Mason et al., 1987b) was derived by
cloning an EcoRI-XbaI fragment of DEN cDNA (nucleotides
2559-3740) and annealed oligonucleotides DEN1 (SEQ ID
N0:125) and DEN2 (SEQ ID N0:126) (containing a XbaI sticky
end, translation termination codon, TSAT vaccinia virus
early transcription termination signal (Yuen et al. 1987),
EacrI site and HindIII sticky end) into HindIII-EcoRI
digested pUC8. An EcoRI-HindIII fragment from DEN1
(nucleotides 2559-3745) and SacI-EcoRI fragment of DEN cDNA
encoding the carboxy-terminal 36% of E and amino-terminal
16% NS1 (nucleotides 1447-2559, Mason et al., 1987b) were
ligated to HindIII -SacI digested IBI24 (International
Biotechnologies, Inc., New Haven, CT) generating DENS
encoding the carboxy-terminal 64% E through amino-terminal
45% NS2A with a base missing in NS1 (nucleotide 2467).
HindIII-XbaI digested IBI24 was ligated to annealed
oligonucleotides DENS (SEQ ID N0:127) and DEN10 (SEQ ID
N0:128) [containing a HindIII sticky end, SmaI site, DEN
nucleotides 377-428 (Mason et al., 1987b) and XbaI sticky
end] generating SPD910. SPD910 was digested with SacI
(within IBI24) and AvaI (within DEN at nucleotide 423) and
ligated to an AvaI-SacI fragment of DEN cDNA (nucleotides
424-1447 Mason et al., 1987) generating DEN4 encoding the
carboxy-terminal 11 as C, prM and amino-terminal 36% E.
Plasmid DEN6 containing DEN cDNA encoding the carboxy-
terminal 64% E and amino-terminal 18% NS1 (nucleotides 1447-
2579 with nucleotide 2467 present Mason et al., 1987b) was
derived by cloning a SacI-XhoI fragment of DEN cDNA into
IBI25 (International Biotechnologies, Inc., New Haven, CT).
Plasmid DEN.15 containing DEN cDNA encoding 51 bases of the
DEN 5' untranslated region, C, prM and amino-terminal 36% E
was derived by cloning a HindIII-SacI fragment of DEN cDNA
i :<':'192/1~672 ~ ~ ~} ~ ~ PCT/US92/01906
-121-
(nucleotides 20-1447, Mason et al., 1987b) into HindIII-SacI
digested IBI25. Plasmid DEN23 containing DEN cDNA encoding
the carboxy-terminal 55% NS2A and amino-terminal 28% NS2B
(nucleotides 3745-4213) was derived by cloning a XbaI-S~hI
fragment of DEN cDNA into Xbal-SphI digested IBI25. Plasmid
DEN20 containing DEN cDNA encoding the carboxy-terminal 55%
NS2A, NS2B and amino-terminal 24 amino acids NS3
(nucleotides 3745-4563) was derived by cloning a XbaI to
EcoRI fragment of DEN cDNA into XbaI-EcoRI digested IBI25.
Oligonucleotide-directed mutagenesis (Kunkel, 1985) was
used to change the following potential vaccinia virus early
transcription termination signals (Yuen et al., 1987). The
'two TSNT seqeunces in the prM gene in DEN4 were mutagenized
(1) 29 as from the carboxy-terminus (nucleotides 822-828
TTTTTCT to TATTTCT) and (2) 13 as from the carboxy-terminus
(nucleotides 870-875 TTTTTAT to TATTTAT) creating plasmid
DEN47. The single TSNT sequence in the NS1 gene in DEN6 17
as from the amino-terminus was mutagenized (nucleotides
2448-2454 TTTTTGT to TATTTGT) creating plasmid DEN7.
Oligonucleotide-directed mutagenesis as described above
was used (1) to insert an Ea~I and EcoRI site at the
carboxy-terminus of NS2A (nucleotide 4102) in plasmid DEN23
creating DEN24, (2) to insert a SmaI site and ATG 15 as from
the carboxy-terminus of E in DEN7 (nucleotide 2348) creating
DEN10, (3) to insert an EagI and HindIII site at the
carboxy-terminus of NS2B (nucleotide 4492) in plasmid DEN20
creating plasmid DEN21, and (4) to replace nucleotides 63-67
in plasmid DEN15 with part of the vaccinia virus early/late
H6 promoter (positions -1 to -21, Perkus et al., 1989)
creating DEN16 (containing DEN nucleotides 20-59, EcoRV site
to -1 of the H6 promoter and DEN nucleotides 68-1447).
A SacI-XhoI fragment from DEN7 (nucleotides 1447-2579)
was substituted for the corresponding region in DEN3
generating DEN19 containing DEN cDNA encoding the carboxy-
terminal 64% E and amino-terminal 45% NS2A (nucleotides
1447-3745) with nucleotide 2467 present and the modified
transcription termination signal (nucleotides 2448-2454). A
XhoI-XbaI fragment from DEN19 (nucleotides 2579-3745) and a
XbaI-HindIII fragment from DEN24 (XbaI nucleotide 3745 DEN
~;. l ti t! r.. i I
V~'O 92/15672 PCT/US92/01906
-122-
through HindIII in IBI25) were ligated to XhoI-HindIII
digested IBI25 creating DEN25 containing DEN cDNA encoding
the carboxy-terminal 82% NSl, NS2A and amino-terminal 28%
NS2B (nucleotides 2579-4213) with a Eactl site at 4102,
nucleotide 2467 present and mutagenized transcription
termination signal (nucleotides 2448-2454). The XhoI-XbaI
fragment from DEN19 (nucleotides 2579-3745) was ligated to
XhoI (within IBI25) and XbaI (DEN nucleotide 3745) digested
DEN21 creating DEN22 encoding the carboxy-terminal 82% NS1,
NS2A, NS2B and amino-terminal 24 as NS3 (nucleotides 2579-
4564) with nucleotide 2467 present, modified transcription
termination signal (nucleotides 2448-2454) and EactI site at
4492.
A HindIII-PstI fragment of DEN16 (nucleotides 20-494)
was ligated to a HindIII-PstI fragment from DEN47 (encoding
the carboxy-terminal 83% prM and amino-terminal 36% of E
nucleotides 494-1447 and plasmid origin of replication)
generating DEN17 encoding C, prM and amino-terminal 36% E
with part of the H6 promoter and EcoRV site preceding the
amino-terminus of C. A HindIII-BalII fragment from DEN17
encoding the carboxy-terminal 13 as C, prM and amino-
terminal 36% E (nucleotides 370-1447) was ligated to
annealed oligonucleotides SP111 and SP112 (containing a
disabled HindIII sticky end, EcoRV site to -1 of the H6
promoter, and DEN nucleotides 350-369 with a BalII sticky
end) creating DEN33 encoding the EcoRV site to -1 of the H6
promoter, carboxy-terminal 20 as C, prM and amino-terminal
36% E.
SmaI-EagI digested pTPlS (Mason et al., 1991) was
ligated to a SmaI-SacI fragment from DEN4 encoding the
carboxy-terminal 11 as C, prM and amino-terminal 36% E
(nucleotides 377-1447) and SacI-EagI fragment from DEN3
encoding the carboxy-terminal 64% E, NS1 and amino-terminal
45% NS2A generating DENL. The SacI-XhoI fragment from DEN7
encoding the carboxy-terminal 64% E and amino-terminal 18%
NS1 (nucleotides 1447-2579) was ligated to a BstEII-SacI
fragment from DEN47 (encoding the carboxy-terminal 55% prM
and amino-terminal 36% E nucleotides 631-1447) and a BstEII-
XhoI fragment from DENL (containing the carboxy-terminal 11
~~ H, t.~ r
\'-::.:'~y 92/15672 ~ ~ ~ ~ ~ PCT/US92/01906
-123-
as C, amino-terminal 45% prM, carboxy-terminal 82% NS1,
carboxy-terminal 45% NS2A, origin of replication and
vaccinia sequences) generating DEN8. A unique SmaI site
(located between the H6 promoter and ATG) was removed using
oligonucleotide-directed double-strand break mutagenesis
(Mandecki, 1986) creating DENBVC in which the H6 promoter
immediately preceded the ATG start codon.
An EcoRV-SacI fragment from DEN17 (positions -21 to -1
H6 promoter DEN nucleotides 68-1447) was ligated to an EcoRV
-SacI fragment of DENBVC (containing vaccinia sequences, H6
promoter from -21 to -124, origin of replication and amino-
terminal 64% E, NS1, amino-terminal 45% NS2A nucleotides
1447-3745) generating DEN18. A XhoI-Ea-~c.I fragment from
DEN25 (nucleotides 2579-4102) was ligated to an XhoI-EagI
fragment of DEN18 (containing the origin of replication,
vaccinia sequences and DEN C, prM, E and amino-terminal 18%
NS1 nucleotides 68-2579) generating DEN26. An EcoRV-SacI
fragment from DENBVC (positions -21 to -1 H6 promoter DEN
nucleotides 377-1447) was ligated to an EcoRV-SacI fragment
of DEN26 (containing the origin of replication, vaccinia
sequences and DEN region encoding the carboxy-terminal 64%
E, NS1 and NS2A with a base missing in NS1 at nucleotide
2894) generating DEN32. DEN32 was transfected into vP410
infected cells to generate the recombinant vP867 (FIG. 20).
A SacI-XhoI fragment from DEN10 (nucleotides 1447-2579)
was substituted for the corresponding region in DEN3
generating DEN11 containing DEN cDNA encoding the carboxy-
terminal 64% E, NS1 and amino-terminal 45% NS2A with a SmaI
site and ATG 15 as from the carboxy-terminus of E. A SmaI-
EagI fragment from DEN11 (encoding the carboxy-terminal 15
as E, NS1 and amino-terminal 45% NS2A nucleotides 2348-3745)
was ligated to SmaI-Ea~cI digested pTPlS generating DEN12.
A XhoI-Ea~I fragment from DEN22 (nucleotides 2579-4492)
was ligated to the XhoI-Ea~cI fragment from DEN18 described
above generating DEN27. An EcoRV-PstI fragment from DEN12
(positions -21 to -1 H6 promoter DEN nucleotides 2348-3447)
~o~as ligated to an EcoRV-PstI fragment~from DEN27 (containing
the origin of replication, vaccinia sequences, H6 promoter -
w
PCT/US92/01906 ~
-124-
21 to -124 and DEN cDNA encoding NS2A and NS2B) generating
DEN31.
An EcoRV-XhoI fragment from DENBVC (positions -21 to -1
H6 promoter DEN nucleotides 377-2579 encoding the carboxy-
terminal 11 as C, prM E, amino-terminal 18% NS1) was ligated
to an EcoRV-XhoI fragment from DEN31 (containing the origin
of replication, vaccinia sequences and DEN cDNA encoding the
carboxy-terminal 82% NS1, NS2A, NS2B with the base present
in NS1 at position 2894) generating DEN35. DEN35 was
transfected into vP410 infected cells generating the
recombinant vP955 (FIG. 20). An EcoRV-SacI fragment from
DEN33 (positions -21 to -1 H6 promoter DEN nucleotides 350-
1447 encoding the carboxy-terminal 20 as C, prM and amino-
terminal 36% E) and a SacI-XhoI fragment from DEN32
(encoding the carboxy-terminal 64% E and amino-terminal 18%
NS1 nucleotides 1447-2579) were ligated to the EcoRV-SacI
fragment from DEN31 described above generating DEN34. DEN34
was transfected into vP410 infected cells generating the .
recombinant vP962 (FIG. 20). Oligonucleotides DEN 1 (SEQ ID
N0:125), DEN 2 (SEQ ID N0:126), DEN9 (SEQ ID N0:127), DEN10
(SEQ ID N0:128), SP111 (SEQ ID N0:129), and SP112 (SEQ ID
N0:130) are as follows:
DEN1 5'- CTAGA tga TTTTTAT CGGCCG A -3'
DEN2 3'- T ACT AAAAATA GCCGGC TTCGA -5'
XbaI EacrI HindIII
DENS 5' AGCTT CCCGGG atg CTCCTCATGCTGCTGCCC
DEN10 3' A GGGCCC TAC GAGGAGTACGACGACGGG
HindIII SmaI
ACAGCCCTGGCGTTCCATCTGACCACCCGAG T -3'
TGTCGGGACCGCAAGGTAGACTGGTGGGCTC AGATC -5'
AvaI XbaI
-24 H6 -1
SP111 5' AGCT GATATCCGTTAAGTTTGTATCGTA atg AACAGGA
SP112 3' A CTATAGGCAATTCAAACATAGCAT TAC TTGTCCT
HindIII EcoRV
GGAAA A -3'
CCTTT TCTAG-5'
Bc~lII
Example 17 - CONSTRUCTION OF MODIFIED NYVAC VIRUSES
NYVAC was modified by increasing to different extents
the size of the [C7L - K1L] deletion near the left terminus
of vaccinia and by introducing a deletion near the right
y,:~;:92/15672 ~ ~ N ~ ~ PC'T/US92/01906
-125-
terminus. All deletions were accomplished using the E. coli
guanine phosphoribosyl transferase gene and mycophenolic
acid in a transient selection system.
Transient Dominant Selection. Using circular donor
plasmid, recombination with vaccinia virus was performed by
the standard method of transfection of calcium phosphate
precipitated plasmid DNA into vaccinia-infected Vero cells.
After 24 h, the infected cells were harvested and the lysate
plated in the presence of 1 microgram/ml mycophenolic acid
(MPA). Individual plaques were picked and amplified on Vero
cells in the presence of MPA. Virus was harvested and
plaque purified by two rounds of plaque picking in the
absence of MPA. Plaques picked from each round without MPA
were plated on Vero cells and filters hybridized for the
presence of pertinent genes.
NYVAC.1. The [C7L - K1L] deletion present in vP866
(NYVAC) was expanded to include the next two ORFs to the
right, K2L and K3L. The putative translation product for
the K2L ORF shows homology to the family of serine protease
inhibitors (Boursnell et al., 1988). However,
transcriptional mapping of this region of the vaccinia
genome suggests that the K2L ORF is not expressed (Morgan et
al., 1984).
The translation product for K3L shows 28 % homology to
eukaryotic initiation factor 2 alpha (eIF-2 alpha) over an
87 amino acid overlap spanning the serine (amino acid 51)
phosphorylation site. Phosphorylation of eIF-2 alpha is a
step in the antiviral state induced by interferon,
suggesting that the vaccinia K3L gene product may be
involved in the mechanism by which vaccinia evades the
effects of interferon. The K3L gene from Copenhagen strain
of vaccinia has been deleted (Beattie et al., 1991). The
resulting virus exhibited heightened sensitivity to
interferon in vitro as measured both by inhibition of viral
induction of protein synthesis and inhibitioB of viral
replication. This suggests that deletion of K3L from
vaccinia virus could result in a safer vaccine strain which
could be controlled by interferon treatment in the event of
vaccination complications.
~ ~. lj ci :.. i i
WO 92/15672 PCT/US92/01906 F
~a::-;a
-126-
Construction of Plasmid pMPC7K3GPT for Deletion of C7L
Through K3L. The left and right vaccinia arms flanking the
[C7L - K3L] deletion were assembled separately. The left
arm was derived from pSD420 (Perkus et al., 1990) and
assembled in intermediate deletion plasmid pMP256/257
(Perkus et al., 1991). Synthetic oligonucleotides MPSYN379
(SEQ ID N0:131), MPSYN380 (SEQ ID'N0:132)
HindIII SalI BamHI
MPSYN379 5' TTCCCAAGCTTGTCGACGATAATATGGATCCTCATGAC 3'
BQ1II
MPSYN380 5' TTCCCAGATCTATGAGTATAGTGTTAAATGAC 3'
were used as primers in a PCR reaction using plasmid pSD420
as template. The resulting 0.14 kb fragment was cut with
HindIII/BalII and inserted into pMP256/257, replacing the
left arm of the plasmid. The resulting plasmid was
designated pMP379/380. A 0.7 kb SalI/BamHI fragment was
isolated from pSD420 and ligated into pMP379/380 cut with
SalI/BamHI, forming plasmid pMPC7F4.
To construct a right deletion junction containing
sequences to the right of K3L, synthetic oligonucleotides
MPSYN381/MPSYN382 (SEQ ID N0:133/SEQ ID N0:134)
BamHI HpaI EcoRV SmaI EcoRI
MPSYN381 5' GATCCTTGTTAACCCGATATCCCGGG 3'
MPSYN382 3' GAACAATTGGGCTATAGGGCCCTTAA 5'
were annealed and ligated into pUC8 cut with BamHI/EcoRI,
forming plasmid pMP381/382. A 1.0 kb HpaI (partial) /EcoRV
fragment was isolated from cloned vaccinia HindIII K and
ligated into pMP381/382, forming plasmid pMPK3R, which
contains the entire right vaccinia flankinct arm. The left
vaccinia flanking arm was isolated from pNy~C7F4 as a 0.8 kb
BQlII(partial)/HindIII fragment, and inserted into pMPK3R
cut with BamHI/HindIII. The resulting plasmid, pMPC7K3, is
deleted for 14 genes [C7L - K3L].
For use as a selectable marker, the E. coli gene
encoding guanine phosphoribosyl transferase (Ecogpt) (Pratt
et al., 1983) was placed under the control of a poxvirus
!~;';'=', 92/ 1 X672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/Ol 906
-127-
promoter. A 31 by promoter element immediately upstream
from a gene encoding an entomopox 42 kDa protein can
function as a strong promoter in recombinant vaccinia virus
at early time post infection. Annealed synthetic
oligonucleotides MPSYN369/370 (SEQ ID N0:135/SEQ ID N0:136)
XhoI EcoRI SmaI
MPSYN369 5' TCGAGAATTCCCGGGTCAAAATTGAAAATATATAATTACAA
BQ1II
TATAAAATA 3'
MPSYN370 3' CTTAAGGGCCCAGTTTTAACTTTTATATATTAATGTTA
TATTTTATCTAG 5'
containing the 31 by EPV 42 kDa promoter were ligated
upstream from the Ecogpt gene in a pBS-SK background,
resulting in plasmid pMP42GPT. A SmaI fragment containing
the 42 kDa promoter/Ecogpt gene expression cassette was
isolated from pMP42GPT and inserted into vaccinia deletion
plasmid pMPC7K3 in the SmaI site at the pUC/vaccinia
junction. The resulting plasmid, pMPC7K3GPT was transfected~
into vP866 (NYVAC). Mycophenolic acid was used in the
culture medium for selection of intermediate products of
recombination in a transient dominant selection system
(Falkner et al., 1990). After removal of selective
pressure, progeny virus were screened by plaque
hybridization for loss of K2L DNA sequences and retention of
K4L. The fidelity of the deletion junction was verified by
PCR and DNA restriction and sequence analysis. Recombinant
vaccinia virus vP954 (NYVAC.1) contains the [C7L - K3L]
deletion, as well the other deletions present in NYVAC (TK,
HA, ATI, I4L, [B13 - B14]).
NYVAC.2. The [C7L - K1L] deletion present in NYVAC was
expanded in both directions to include a total of 38 ORFs,
[C23L - F4L]. This is the same deletion previously reported
in vaccinia deletion mutant vP796 (Perkus et al., 1991).
Noteworthy ORFs removed in the expanded deletion region
include the vaccinia growth factor (VGF; C11R) located to
the left of the NYVAC deletion. In contrast to WR strain of
vaccinia which contains two copies of the VGF, C11R is the
only ORF encoding the VGF in Copenhagen strain of vaccinia.
Deletion of both copies of the vaccinia growth factor from
l i~ ~ ~: ( l
WO 92/1672 PCT1US92/01906 e-:
r..:~ :.
-128
WR has been shown to reduce the severity of skin lesions
upon intradermal inoculation of rabbits and to reduce
neurovirulence of the virus in mice (Buller et al., 1988).
The rightmost ORF in the [C23L - F4L] deletion, F4L, encodes
the gene for the small subunit of ribonucleotide reductase
(Slabaugh et al., 1988). Also included in this deletion is
ORF F2L, which shows homology to E. coli dUTPase, another
enzyme involved in nucleotide metabolism (Goebel et al.,
1990a,b). F2L also shows homology to retroviral protease
(Slabaugh et al., 1989).
Construction of Plasmid pMPTRF4GPT for Deletion of C23L
Throucxh F4L. Plasmid pMPLEND~, which was used as an
intermediate in the generation of vaccinia deletion mutant
vP796 (Perkus et al., 1991) was modified by the addition of
the SmaI expression cassette containing the EPV 42 kDa
promoter/Ecogpt gene at the pUC/vaccinia junction. The
resulting plasmid, pMPTRF4GPT, was transfected into NYVAC.
Following selection using MPA, progeny virus were screened .
by plaque hybridization for loss of F4L DNA sequences and
retention of FSL. Fidelity of the deletion junction was
verified by PCR and DNA restriction analysis. Recombinant
virus vP938 (NYVAC.2) contains the [C23L - F4L] deletion as
well as the other deletions present in NYVAC.
Deletion of ORFs B13R - B29R. The a deletion [B13R -
B14R] present in NYVAC was expanded to include all ORFs to
the right, a total of 17 ORFs [B13R - B29R]. This is the
same deletion previously reported in vaccinia deletion
mutant vP759 (Perkus et al., 1991). The expanded deletion
region includes two genes whose products show 20 $ amino
acid identity with each other (Smith et al., 1991). The
ORFs encoding these gene products are designated B16R and
B19R in Copenhagen (Goebel et al., 1990a,b), which
correspond to ORFs B15R and B18R, respectively, in the WR
strain (Smith et al., 1991). Unlike the WR strain of
vaccinia, in which both gene products contain typical signal
sequences, the predicted translation product of Copenhagen
ORF B16 is truncated at the amino terminus and does not
contain a signal sequence. B19R encodes a vaccinia surface
protein (S antigen) expressed at early times post infection
''~''? 92/1672 PCT/US92/01906
-129-
(Ueda et al., 1990). Both B16R and B19R show homology to
the immunoglobin superfamily, especially the IL-1 receptor.
It has been suggested that one or both of the vaccinia gene
products may help vaccinia evade the immune system by .
binding cytokines and thus diminishing the host inflammatory
' response (Smith et al., 1991).
Construction of Plasmid ~MPTRB13GPT for Deletion of
B13R Through B29R. Plasmid pMPRENDA, which was used as an
intermediate in the generation of vaccinia deletion mutants
vP759 and vP811 (Perkus et al., 1991) was modified by the
addition of the SmaI expression cassette.containing the EPV
42 kDa promoter/Ecogot gene at the pUC/vaccinia junction.
The resulting plasmid, pMPTRB13GPT, was transfected into
NYVAC. Following selection using MPA, progeny virus were
screened by plaque hybridization for loss of B15 DNA
sequences and retention of B12. Fidelity of the deletion
junction was verified by PCR and DNA restriction analysis.
Recombinant virus vP953 contains the [B13R - B29R] deletion,
as well as the other deletions present in NYVAC.
Combininct the Left jC23L - F4L~ and Rictht jBl3R - B29R1
Deletions. The generation of vaccinia deletion mutant
vP811, which contains deletions at both the left [C23L -
F4L] and right [B13R - B29R] termini of vaccinia virus has
been described (Perkus et al., 1991). vP811 contains both
the vaccinia host range gene, C7L, and the selectable marker
Ecogpt. To generate a virus containing the large terminal
deletions without C7L or Ecogpt in a NYVAC background,
pMPTRF4GPT was used as donor plasmid for recombination with
vP953. Progeny virus is being selected by MPA in the
transient dominant selection system described above and
screened by plaque hybridization for loss of F4L DNA
sequences and retention of FSL. Recombinant virus vP977
contains deletions for [B13R-B29R] and [C23L-F4L] as well as
the other deletions present in NYVAC. Like vP811, vP977 is
deleted for all genes from both copies of the vaccinia
terminal repeats.
~i~~N~l
WO 92/1672 PCT/US92/01906 ,=,~:
-130-
Example 18 - EgPRE88ION OF HIV GENE PRODUCTS HY
HO8T-RESTRICTED pOBVIRU8E8
This Example describes the generation of host-
restricted poxviruses that express HIV-1 gene products. The
vectors employed are NYVAC and ALVAC.
Cells and Virus. NYVAC and ALVAC viral vectors and
their derivatives were propagated as described previously
(Piccini et al., 1989; Taylor et al., 1988a, b). Vero cells
and primary chick embryo fibroblasts (CEF) were propagated
as described previously (Taylor et al., 1988a, b). P815
murine mastocytoma cells (H-2d) were obtained from ATCC
(#TIB64) and maintained in Eagles MEM supplemented with 10%
fetal bovine serum CFBS and 100 Iu/ml penicillin and 100 ~cg
streptomycin per ml.
Mice. Female BALB/cJ (H-2d) mice were purchased from
Jackson Laboratories (Bar Harbor, ME) and maintained on
mouse chow and water ad libitum. All mice were used between
the ages of 6 and 15 weeks of age.
Media. Assay Medium for immunological assays was
comprised of RPMI 1640 medium supplemented with 10% FBS, 4
mM L-glutamine, 20 mM HEPES (N-2-hydroxyethylpiperazine-N'-
2-ethanesulfonate), 5x10-5 M 2-mercaptoethanol, 100 IU
penicillin per ml, and 100 ~cg/ml streptomycin. Stim Medium
was comprised of Eagle's Minimum Essential Medium
supplemented with 10% FBS, 4 mM L-glutamine, 10-4 M
2-mercaptoethanol, 100 IU penicillin per ml, and 100 ~cg
streptomycin per ml.
ALVAC and NYVAC Recombinants Containing the V3 Loop and
Epitope 88 of the HIV-1 (IIIB, Envelope. A 150 by fragment
encompassing the V3 loop (amino acids 299-344; Javeherian et
al., 1989) of HIV-1 (IIIB) was derived by PCR using
oligonucleotides HIV3BL5 (SEQ ID N0:137) (5'-ATGGTAGAAA
~ZTAATTGTAC-3') ar:3 HIV3BL3 (SEQ ID N0:138) (5'-ATCATCGAATTCA
AGCTTATTATTTTGCTCTACTAATGTTAC-3') with pHXB.2D (III) as
template (provided by Dr. R. C. Gallo, NCI-NIH, Bethesda,
MD). Oligonucleotides HIV88A (SEQ ID N0:139) (5'-
ATGAATGTGACAGAAAATTTTAACATGTGGAAAAATGTAGAAATTAATTGTACAAGACCC
-3') and HIV88B (SEQ ID N0:140) (5'-
GGGTCTTGTACAATTAATTTCTACATTTTTCCACATGTTAAAATTTTCTGTCACATTCAT
Z~.~'~v''~'
'"';~ 92/15672 '' ~ j ~ pCT/US92/0~1906
-131-
-3') were annealed together to produce a double-stranded
fragment containing the HIV-1 epitope 88 (amino acids 95-
105, Shaffermann et al., 1989). The 150 by V3-containing
PCR fragment containing the epitope and the 42 by fragment
containing the 88 epitope sequences were fused together by
PCR by virtue of the existence of complementary sequences.
The reactions were performed using oligonucleotides HIV88C
(SEQ ID N0:141) (5'-AGTAATGTGACAGAAAATTTTAAC-3') and HIV3BL3
(SEQ ID N0:138). The 192 by PCR-derived fragment contains
the epitope 88 sequences fused upstream to the V3 loop
sequences. A termination codon (TAA) was, incorporated into
oligonucleotide HIV3BL3P to terminate translation of the
open reading frame and an initiation codon was incorporated
into oligonucleotide HIV88C to serve as the start of
translation to express the epitope 88/V3 loop fusion
protein. Additionally, oligonucleotide HIV3BL3 was
synthesized so that an EcoRI site existed at the 3'-end of
the 192 by PCR fragment.
The entomopoxvirus 42 kDa (early) promoter was
generated by PCR using oligonucleotides RG273 (SEQ ID
N0:142) (5'-AGGCAAGCTTTCAAAAAAATATAAATGATTC-3') and RG274
(SEQ ID N0:143) (5'-TTTATATTGTAATTATATATTTTC-3') with
plasmid, pAMl2, as template. The 108 by fragment containing
the 42 kDa promoter was synthesized to contain a HindIII
site at the 5'-end. The 42 kDa promoter containing segment
was kinased and digested with HindIII prior to ligation to
the epitope 88/V3 fragment digested with EcoRI and pRW831
digested with HindIII and EcoRI. The resultant plasmid was
designated as pCSHIVL88. This plasmid was used in in vitro
recombination assays with CPpp as rescue virus to generate
vCP95. ALVAC recombinant, vCP95, contains the epitope 88/V3
loop in the de-ORFed C5 locus of CPpp.
The plasmid pCSHIVL88 was digested with HindIII and
EcoRI to liberate a 300 by fragment containing the epitope
88/V3 expression cassette described above. This fragment
was excised from a LMP-agarose gel and isolated by phenol
extraction (2X) and ether extraction (1X). The isolated
fragment was blunt-ended using the Klenow fragment of the E.
coli DNA polymerase in the presence of 2mM dNTPs. The
~i~v~ ~ ~ ___
WO 92/15672 PCT/US92/01906
-132-
fragment was ligated to pSD550, a derivative of pSD548 (FIG.
6) digested with SmaI to yield plasmid pHIVL88VC. This
plasmid was used with vP866 as the rescue virus to generate
vP878. vP878 contains the epitope 88/V3 loop cassette in
the de-ORFed I4L locus of NYVAC.
ALVAC- and NYVAC-Based Recombinants Expressing the HIV-
1 (IIIB) Envelope Glycoproteins. An expression cassette
composed of the HIV-1 (IIIB) env gene juxtaposed 3' to the
vaccinia virus H6 promoter (Guo et al., 1989; Taylor et al.,
1988a, b) was engineered for expression of gp160 from HIV-1
by the ALVAC and NYVAC vectors. A 1.4 kb fragment was
amplified from pHXB.2D (III) (provided by Dr. R.C. Gallo,
NCI-NIH, Bethesda, MD) using oligonucleotides HIV3B1 (SEQ ID
N0:144) (5'-GTTTTAATTGTGGAGGGGAATTCTTCTACTGTAATTC-3') and
HIV3B5 (SEQ ID N0:145) (5'-
ATCATCTCTAGAATAAAAATTATAGCAAAATCCTTTC-3'). This fragment
contains the 3' portion of the env gene. PCR amplification
with these primers placed a vaccinia virus early
transcription termination TSNT sequence motif following the
coding sequence and removed the TSNT motif situated at
w position 6146 to 6152 (Ratner et al., 1985) without altering
the amino acid sequence. This change (T to C) creates an
EcoRI (GAATTC) at this position. This 1.4 kb fragment was
digested with EcoRI (5'- end) and XbaI (3'- end) and
inserted into EcoRI and XbaI digested pBS-SK (Stratagene, La
Jolla, CA). The resultant plasmid was designated as
pBSHIVENV1,5. Nucleotide sequence analysis of this fragment
demonstrated that the sequence was entirely correct except
for a T to C transition at position 7848. This transition
was corrected as follows: A 250 by fragment was derived by
PCR using oligonucleotides HIV3B1 (SEQ ID N0:144) (5'-
GTTTTAATTGTGGAGGGGAATTCTTCTACTGTAATTC-3') and HIV3B17 (SEQ
ID N0:146) (5'-TGCTACTCCTAATGGTTC-3') with pHXB.2D (III) as
template. This fragment was digested with BalII and EcoRI.
The fragment was inserted into pBSHIV3B1,5, digested with
BQ1II and EcoRI and thus substituted for the region with the
incorrect nucleotide to yield plasmid pBSHIV3BBP.
PCR was utilized to derive a 150 by fragment containing
the 5' portion of the env gene with oligonucleotides HIV3B9
,.:.z
~ ~ ~ '~ '~ ~ ~ PCT/US92/01906
~":=~. 92/ 15672
-133-
(SEQ ID N0:147) (5'-CATATGCTTTAGCATCTGATG-3') and HIV3B10
(SEQ ID N0:148) (5'-ATGAAAGAGCAGAAGACAGTG-3') with pHXB.2D
(III) as template. PCR was also used to generate a 128 by
fragment containing the vaccinia virus H6 promoter from
pC3FGAG using oligonucleotides VVH65P (SEQ ID N0:149) (5'-
ATCATCGGTACCGATTCTTTATTCTATAC-3') and VVH63P (SEQ ID N0:150)
(5'-TACGATACAAACTTAACGG-3'). Both fragments were digested
with KpnI and the 150 by fragment was kinased prior to co-
insertion of these fragments into pBS-SK digested with KpnI.
The resultant plasmid was designated as pBSH6HIV3B5P.
PCR was used to generate a 600 by fragment from pHXB.2D
(III) with oligonucleotides HIV3B2 (SEQ ID N0:151) (5'-
GAATTACAGTAGAAGAATTCCCCTCCACAATTAAAAC-3') and HIV3B7 (SEQ ID
N0:152) (5'-CAATAGATAATGATACTAC-3'). This fragment was
digested with EcoRI and kinased. PCR was also used to
derive a 500 by fragment with the same template but with
oligonucleotides HIV3B6 (SEQ ID N0:153) (5'-
GTATTATATCAAGTTTATATAATAATGCATATTC-3') and HIV3B8 (SEQ ID
N0:154) (5'-GTTGATGATCTGTAGTGC-3'). This fragment was
digested with KpnI. These fragments together correspond to
nucleotide 5878 to 6368 (Ratner et al., 1985). The
engineering of these fragments with these primers also
removes a TSNT sequence positioned at nucleotide 6322 to
6328 without altering the amino acid sequence. These two
fragments were inserted into pBSHIV3B3P digested with KpnI
and EcoRI. This plasmid was designated as pBSHIV3BP2768.
Plasmid pBSH6HIV3B5P was digested with K_pnI to liberate
a 360 by fragment containing the H6 promoter and the 5'
portion (150 bp) of the HIV-1 env gene. This K_pnI fragment
was ligated into pBSHIV3B3P2768 digested with K_pnI to yield
plasmid pBSHIV3BEAII. A 2.8 kb fragment was derived from
pBSHIV3BEAII by digestion with XbaI followed by a partial
KpnI digestion. This fragment was blunt-ended and inserted
into SmaI digested pSD550. The plasmid pI4LH6HIV3B was
generated and used in in vitro recombination experiments
with vP866 as the rescue virus. This generated vP911 which
contains the HIV-1 env gene in the I4L locus of the NYVAC
genom>~ .
iv ~ ~J tt r., 1 1
WO 92/1672
-134-
PCT/US92/01906
To insert the HIV-1 env gene into an ALVAC vector,
pBSHIV3BEAII was digested with NruI and XbaI. The derived
2.7 kb fragment was blunt-ended with the Klenow fragment of
the E. coli DNA polymerase in the presence of 2mM dNTPs.
This fragment contains the entire HIV-1 env gene juxtaposed
3' to the 3'-most 21 by (to NruI site) of the vaccinia H6
promoter. This fragment was ligated to a 3.1 kb fragment
derived by digestion of pRW838 with NruI and EcoRI with
subsequent blunt-ending with Klenow. The pRW838 derived
fragment contains the homologous arms derived from canarypox
to irect the foreign gene to the C5 locus. It also
cof:~.:ains the 5'-most 100 by of the H6 promoter. Therefore,
ligation of these fragments resulted in an insertion plasmid
containing an expression cassette for the HIV-1 env gene and
was designated pC5HIV3BE. This plasmid was used in in vitro
recombination experiments with ALVAC as the rescue virus to
generate vCP112.
NYVAC-Based Recombinants Expressing the HIV-1 (IIIB~
gp120. The plasmid pBSHIV3BEAII was digested with EcoRI and
XbaI to liberate a 4.3 kb fragment. This fragment contains
the vaccinia virus H6 promoter linked to the HIV-1 env gene
to nucleotide 6946 (Ratner et al., 1985). The 4.3 kb
fragment was ligated to 300 by EcoRI/XbaI digested PCR-
derived fragment corresponding to the 3' portion of the
gp120 coding sequence. The 307 by PCR fragment was derived
using oligonucleotides HIV1-120A (SEQ ID N0:155) (5'
-ATCATCTCTAGAATAA.AAATTATGGTTCAATTTTTACTACTTTTATATTATATATTTC-
3') and HIV1-120B (SEQ ID N0:156) (5'-
CAATAATCTTTAAGCAAATCCTC-3') with pHXB.2D as template. The
ligation of the 4.3 kb XbaI/EcoRI fragment and the 300 by
XbaI/EcoRI fragment yielded plasmid pBSHIVB120.
A 1.6 kb KpnI/XbaI fragment was derived from pBSHIVB120
by initially linearizing the plasmid with XbaI followed by a
partial KpnI digestion. The 1.6 kb fragment was blunt-ended
by treatment with the Klenow fragment of the E. coli DNA
polymerase in the presence of 2mM dNTPs. This fragment was
inserted into pSD54IVC digested with SmaI to yield
pATIHIVB120. This plasmid was used in in vitro
recombination experiments to generate vP921. This
~1~~~7'~
!':;;:::.92/15672 PCT/US92/01906
-135-
recombinant contains the portion of the HIV-1 env gene
encoding gp120 in the ATI locus of NYVAC.
Immunoprecipitation. To determine the authenticity of
the HIV-1 gene products expressed by vP911, vP921 and
vCP112, immunoprecipitation analyses were performed. Vero
cells monolayers were either mock infected, infected with
the parental virus vP866, or infected with recombinant virus
at an m.o.i. of 10 PFU/cell. Following a 1 hr adsorption
period, the inoculum was aspirated and the cells were
overlayed with 2 mls of MEM (minus methionine containing 2%
FBS and [35S]-methionine (20 uCi/ml). Cells were harvested
at 18 hr post infection by the addition of 1 ml of 3X Buffer
A (3% NP-40, 30mM Tris pH 7.4, 150 mM NaCl, 3mM EDTA, 0.03%
Na Azide, and 0.6 mg/ml PMSF) with subsequent scraping of
the cell monolayers.
Lysates derived from the infected cells were analyzed
for HIV-1 env gene expression using pooled serum from HIV-1
seropositive individuals (obtained from Dr. Genoveffa
Franchini NCI-NIH, Bethesda MD). The sera was preadsorbed
with vP866-infected Vero cells. The preadsorbed human sera
was bound to protein A-sepharose in an overnight incubation
at 4°C. In some cases a monoclonal antiserum specific to
gp120 (Dupont) was used as the primary serum and a rat anti-
mouse as the second antibody. Following this incubation
period, the material was washed 4 times with 1X Buffer A.
Lysates precleared with normal human sera and protein A-
Sepharose were then incubated overnight at 4°C with the
human sera from seropositive individuals bound to protein A-
Sepharose. Following the overnight incubation period, the
samples were washed four times with 1X Buffer A and 2X with
LiCl2/urea buffer. Precipitated proteins were dissociated
from the immune complexes by the addition of 2X Laemmli's
buffer (125 mM Tris (pH6.8), 4% SDS, 20% glycerol; 10% 2-
mercaptoethanol) and boiling for 5 minutes. Proteins were
fractionated on a 10% Dreyfuss gel system (Dreyfuss et al.,
1984), fixed and treated with 1M Na - salicylate for
fluorography.
ThP results of immunoprecipitation using sera pooled
from HIV-1 seropositive individuals showed specific
re. .: v ~tr ..r i
VVO 92/1672
PCT/US92/01906
-136-
precipitation of the gp120 and gp41 mature forms of the
gp160 envelope glycoprotein from vP911 infected cell
lysates. No such specific gene products were detected in
the parentally (NYVAC; vP866) infected cell lysates.
Specific precipitation of gp120 was also found in vP921
infected cell lysates.
Immunofluorescence analysis with the same sera
illustrated that the gp160 and gp120 species expressed by
vP911 and vP921, respectively, were present on the surface
of infected cells.
Immunoprecipitation was also performed with vCP112
infected CEF cells. No HIV-specific polypeptides were
precipitated with a monoclonal antibody directed against the
gp120 extracellular moiety from cells infected with the
ALVAC parental virus and uninfected CEF cells. Two HIV-
specific polypeptides species were, however, precipitated
from vCPil2 infected cells. These species migrated with
apparent mobilities of 160 kDa and 120 kDa, corresponding to
the precursor env gene product and the mature extracellular
form, respectively.
Inoculations. Mice were intravenously inoculated with
5x10 plaque forming units (PFU) in 0.1 ml of phosphate-
buffered saline via the lateral tail vein.
Spleen Cell Preparations. Following euthanasia by
cervical dislocation, the spleens of mice were aseptically
transferred to a sterile plastic bag containing Hank's
Balanced Salt Solution. Individual spleens or pooled
spleens from a single experimental group were processed to
single cell suspensions by a 1 minute cycle in a Stomacher
blender. The spleen cell suspensions were washed several
times in either Assay Medium or Stim Medium, as appropriate.
The spleen cells were enumerated by the use of a Coulter
Counter or by trypan blue dye exclusion using a
hemacytometer and microscope.
Sera. Mice were lightly anesthetized with ether and
blood was collected from the retroorbital plexus. Blood
from mice comprising an experimental group was pooled and
allowed to clot. The serum was collected and stored at -
70°C until use.
~"~ ~ 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
.i ,';:::
-137-
In Vitro Stimulation for the Generation of Secondary
Cytotoxic T Lymphocytes yCTL~~. The pooled spleen cells from
the various experimental groups (responders) were diluted to
5x106 cells/ml in Stim Medium. The spleen cells from
syngeneic, naive mice (stimulators) were diluted to 1x10
' cells per ml and infected for 1 hour in tissue culture
medium containing 2% FBS at 37°C with the appropriate
vaccinia virus at a m.o.i. of 25 pfu per cell. Following
infection, the stimulator cells were washed several times in
Stim Medium and diluted to 1x106 cells per ml with Stim
Medium. Five mls of stimulator cells and 5 mls of responder
cells were added to a 25 cm3 tissue culture flask and
incubated upright at 37°C, in 5% C02 for 5 days. On the day
of the assay, the spleen cells were washed several times in
Assay Medium and counted on a hemacytometer in trypan blue
with the use of a microscope.
Target Cell Preparation. For vaccinia specific CTL
activity, tissue culture cells were infected overnight by
incubation at 1x10 cells per ml in tissue culture medium
containing 2% FBS at a m.o.i. of 25 pfu per cell for 1 hour
at 37°C. Following incubation, the cells were diluted to
between 1 - 2x106 cells per ml with tissue culture medium
containing 10% FBS and further incubated at 37°C, in 5% COz
until use. For HIV specific CTL activity, tissue culture
cells were incubated overnight with 20 ~,g/ml of peptide HBX2
(American Biotechnologies, Cambridge, MA), SF2 (American
Biotechnologies, Cambridge, MA) or MN (American
Biotechnologies, Cambridge, MA) corresponding to the V3 loop
region of gp120 of HIV-1 isolates IIIB, SF2, and MN,
respectively. On the day of the assay, the targets were
washed several times by centrifugation in Assay Medium.
After the final wash, the cells were resuspended in
approximately 100 uCi of Na251Cr04 (5lCr). Following
incubation at 37°C for 1 hr, the cells were washed at least
3 times in Assay Medium by centrifugation, counted on a
hemacytometer, and diluted to 1x105/ml in Assay Medium.
Cytotoxicity Assays. For primary CTL assays, freshly
prepared spleen cells were diluted with Assay Medium to
lxlfl~ cells per ml. For secondary CTL assays (following
WO 92/15672 PCT/US92/01906 r~~M
-138-
either in vivo inoculation or in vitro stimulation), the
spleen cells were diluted to 2x106/ml in Assay Medium. One
tenth ml of spleen cell suspension was added to 5lCr
labelled target cells in the wells of a 96 well, round-
bottom microtiter plate (EXP). In most cases, the spleen
cells being assayed for primary CTL activity were further 2-
fold diluted in the wells of the microtiter plate prior to
the addition of the target cells. As a measure of
spontaneous release of 5lCr (SR), target cells were
incubated in only Assay Medium. To determine the maximum
release of 5lCr (MAX), target cells were deliberately lysed
at the beginning of the assay by adding 0.1 ml of 10% sodium
dodecyl sulfate to the appropriate wells. To initiate the
assay, the microtiter plates were centrifuged at 200 x g for
2 min and incubated for 4 or 5 hrs at 37°C, in 5% C02.
Following incubation, the culture supernatants of each wel l
were collected using the Skatron Supernatant Collection
System. Released 5lCr was determined by a Beckman 5500B .
gamma counter. The percent specific cytotoxicity was
determined from the counts by the following formula:
% CYTOTOXICITY = (EXP-SR)/(MAX-SR) X 100
Depletion of T Helper Cells and Cytotoxic T Lymphocytes
Usinct Monoclonal Anti-CD4 and Monoclonal Anti-CD8. Spleen
cell suspensions were diluted to a density of 10~/ml in
cytotoxicity medium (RPMI 1640 containing 0.2% BSA and 5 mM
HEPES) containing a 1:5 dilution of anti-CD4 (monoclonal
antibody 172.4) or a 1:200 dilution of anti-CD8 (monoclonal
antibody anti-Lyt 2.2) and a 1:16 dilution of Cedar Lane
Low-Tox rabbit complement. Appropriate controls for the
single components (complement, anti-CD4, anti-CD8) were
included.
Anti-HIV-1 gp160 ELISA. The wells of ELISA plates
(Immulon II) were coated overnight at 4°C with 100 ng of
purified HIV-1 gp160 (provided by Dr. D. Bolognesi, Duke
University, Durham NC) in carbonate buffer, pH 9.6. The
plates were then washed with phosphate-buffered saline
containing 0.05% Tween 20 (PBST). The plates were then
blocked for 2 hrs at 37°C with PBST containing 1% bovine
serum albumin (BSA). After washing with PBST, sera were
'-;~~ 92/15672 ~ ~ ~ J ~ ~ ~ PCT/US92/01906
-139-
initially diluted 1:20 with PBST containing 0.1$ BSA
(dilution buffer). The sera were further 2-fold serially
diluted in the wells of the ELISA plate. The plates were
incubated at 37°C for 2 hrs and washed with PBST.
Horseradish peroxidase conjugated rabbit anti-mouse
immunoglobulins (DAKO) was diluted 1:2000 in dilution buffer
and added to the wells of the ELISA plate and incubated at
37°C for 1 hour. After washing with PBST, OPD (o-
phenylenediamine dihydrochloride) in substrate buffer was
added and the color was allowed to develop at ambient
temperature for about 20 minutes. The reaction was
extinguished by the addition of 2.5 M H2S04. The absorbance
at 490 nm was determined on a Bio-Tek EL-309 ELISA reader.
The serum endpoint was defined as the reciprocal of the
dilution giving an absorbance value of 1Ø
Lymphocyte Proliferation Assays. Single cell
suspensions of the spleen cells of individual mice were
diluted to 2x106/ml in Assay Medium and 0.1 ml was added to .
the wells of 96 well, flat-bottom microtiter plates
containing Assay Medium alone, 1, 5, or 10 ~Cg of HIV-1
peptide T1, 1, 5, or 10 beg of HIV-1 peptide T2, and 1 or l0
~,g of purified HIV-1 gp160 (Immuno). The cells were
incubated for 5 days at 37°C, in 5$ C02. To each well was
added 1.0 ~,Ci of [3H]-thymidine for the final 6 hrs of
incubation and then harvested onto Beckman Ready Filters
using a Cambridge PHD cell harvester. The filter disks were
dry-counted in a liquid scintillation counter.
STIMULATION INDEX = CPMsEXp/CPMst"~DIUM
Results: A Recombinant Vaccinia Virus Expressing HIV qp120
Elicits Primary HIV-specific Cytotoxic T Lymphocyte
Activity. Following iv administration with 5x10 PFUs of
vaccinia virus recombinants vP878, vP911, or vP921, or, as a
control, with NYVAC, the vector, splenic CTL activity of
BALB/c mice was assessed against syngeneic P815 cells which
had been incubated overnight with peptide HBX2 (Table 20).
Modest, but significant (P<0.05) primary CTL activity was
generated in the spleens of mice administered vP921,
expressing HI« gp120. No other recombinant vaccinia virus
nor the NYVAC parent vector was able to elicit primary HIV-
~~.~:~ ~ l~
WO 92/15672 PCT/US92/0'1906
-140-
specific CTL activity. This was not due to inadequate
infection as each group of mice administered a vaccinia
virus responded with primary vaccinia-specific CTL activity.
Control, unimmunized mice responded to neither target.
Recombinant Poxviruses Expressing HIV env Peptides
Generate HIV-Specific Memory Cytotoxic T Lymphocytes. At
least one month following a single inoculation with one of
the recombinant vaccinia viruses, mouse spleen cells were
stimulated in vitro with syngeneic, naive spleen cells
previously infected with NYVAC or with each of the HIV
recombinant vaccinia viruses (Table 21). Strong HIV-
specific CTL activity was detected only in the spleen cell
'cultures of mice immunized with vP878, vP911, and vP921
which were restimulated in vitro by cells infected with one
of the same vaccinia virus HIV recombinants (vP878, vP911,
or vP921). The vaccinia virus recombinants expressing HIV
gp120 or gp160 were better able to generate memory CTLs than
the vaccinia virus recombinant expressing only the V3 loop
fused to the 88 epitope. HIV-specif is memory CTL activity
could not be elicited from unimmunized control or NYVAC
immunized spleen cells. The absence of HIV-specific CTL
activity from vector immunized mice could not be attributed
to poor immunization since vaccinia-specific memory CTL
activity was apparent after in vitro stimulation with spleen
cells infected with any of the vaccinia viruses used.
In a similar study, the ability of a canarypox
recombinant expressing the V3 loop region fused to the 88
epitope (vCP95) to generate HIV-specific memory CTLs was
examined (Table 22). Three weeks following a single
inoculation of 108 PFUs of vCP95 or the ALVAC vector, CPpp,
HIV-specific memory CTL responses were compared to that
elicited by the recombinant vaccinia virus analog, vP878.
Vaccinia and canarypox CTL responses were included as
controls for proper immunization. Only spleen cells from
vP878 and vCP95 immunized mice produced HIV-specific memory
CTL activity which could be stimulated by vP878. The
inability of vCP95 to stimulate existing memory CTLs to
functional cytolytic CTLs may have been related to the in
vitro conditions employed which were maximized based upon
s:.:, 92/1j672 c .
j PCf/US92/01906
-141-
the use of vaccinia virus recombinants. Nonetheless, vCP95
was'fully capable of generating significant HIV-specific
memory CTLs in the spleens of immunized mice.
Characterization of the In Vitro Stimulated Cytotoxic
Cells. It is conceivable that the cells mediating
cytotoxicity against the HIV peptide-pulsed target cells
represent a population of nonspecific effector cells
unrelated to CTLs, such as natural killer cells. To test
this, the spleen cells of mice immunized with vP921 and
restimulated in vitro with vP921 infected spleen cells were
depleted of T-lymphocytes bearing surface~antigens
characteristic of T helper lymphocytes (CD4) or of cytotoxic
T lymphocytes (CD8) and assayed against V3 loop peptide
pulsed target cells (Table 23). As before, only vP921
immunized mice generated memory HIV-specific CTL activity
which could be stimulated in vitro with vP921 infected
syngeneic spleen cells. Although the complement preparation
(C') and the-monoclonal anti-CD4 and anti-CD8 produced some
toxic effects, only the cultures depleted of CD8-bearing
cells (anti-CD8 + C') were also depleted of HIV-specific
cytotoxic effector cells. Thus, the cells mediating
cytolytic activity against the HIV peptide-pulsed target
cells possessed CD8 antigens on their cell membranes, a
characteristic of MHC class I restricted CTLs.
Specificity of CTL Antigen Receptor Recocrnition of the
V3 Loop Region of HIV qp120. T lymphocyte antigen receptors
are exquisitely sensitive to small alterations in the
primary amino acid sequence of the epitope fragment. The V3
loop region of HIV gp120 is hypervariable and differs
immunologically among HIV isolates. The hypervariability
resides in substitutions and additions of only a few amino
acids. To examine the specificity of cytotoxic cells
generated by HIV vaccinia virus recombinants, susceptibility
to CTL activity was compared among P815 target cells pulsed
with peptides corresponding the V3 loop region of HIV
isolates IIIB, SF2, and MN. Only immunization with vP911
and vP921 induced HIV specific primary CTL activity (Table
24). Furthermore" HIV specific CTL activity was confined
only to-P815 target cells pulsed with peptide corresponding
~r Je ~J .J' ~ ~E 1
WO 92/15672 , PCT/US92/01906
-142-
to the V3 loop of HIV isolate IIIB. Similar results were
obtained with in vitro stimulated, HIV specific secondary
CTL activity induced by immunization with the vaccinia virus
recombinants vP$78, vP911, and vP921 (Table 25). Thus, HIV
specific CTLs elicited by recombinant vaccinia viruses
expressing various portions of the env gene of HIV isolate
IIIB recognize only target epitopes derived from the same
antigenic isolate.
Lymt~hocyte Proliferation Responses to HIV Epitopes
Followincr Immunization with Vaccinia Virus HIV Recombinants.
Lymphocyte proliferation to antigens is an in vitro
correlate of cell-mediated immunity. Presentation of the
appropriate antigen induces cellular proliferation in the
immune population of cells expressing receptors for the
antigen. The initiation and continuation of proliferation
requires the involvement of T helper lymphocytes via soluble
mediators. To evaluate cell-mediated immunity to HIV
antigens in mice immunized with recombinant vaccinia viruses.
expressing HIV antigens, spleen cells from mice immunized 27
days earlier were incubated for 5 days with peptides
correlating to T helper lymphocyte epitopes designated T1
and T2, as well as with purified HIV gp160 (Table 26). No
proliferative responses to the T helper cell epitopes T1 and
T2 were observed in any of the spleen cell cultures.
However, the spleen cells of mice previously immunized with
vP921 vigorously responded to HIV gp160 as determined by the
incorporation of [3H]-thymidine. A stimulation index (SI)
of greater than 2.0 is considered indicative of immunity.
Thus, inoculation of mice with vP921 elicited cell-mediated
immunity to HIV gp160.
Antibodv Responses of Mice Inoculated with Vaccinia
Virus HIV Recombinants. To evaluate humoral responses to .
HIV, mice were immunized at day 0 with one of the vaccinia
virus HIV recombinants and received a secondary immunization
at week 5. The mice were bled at various intervals through
9 weeks after the initial immunization. Pooled sera from
each treatment group were assayed for antibodies to HIV by
ELISA employing purified gp160 as antigen (Table 27).
Primary antibody responses were generally modest, but
~'-'~~ 92/1672 ~ ~ ~j ~ ~ ~ ~ PCT/US92/01906
-143-
detectable with the highest levels induced by vP911.
Following the secondary immunization, the antibody titers of
mice immunized with vP911 and vP921 increased and peaked at
week 7 with titers of over 4,600 and 3,200, respectively,
before declining slightly by week 9. Thus, two vaccinia
virus HIV recombinants, vP911 and vP921, were capable of
inducing a significant antibody response.
V ~ P
WO 92/1672
PC 1'/US92/01906
-144-
Table 20. Primary CTL activity of spleen cells from mice
immunized with vaccinia virus recombinants against
vaccinia virus infected targets and targets pulsed
with peptide corresponding to the V3 loop region
of HIV-1 gp120.
PERCENT CYTOTOXICITY
TARGET
IMMITNIZATION P815 VAC HIV V3
NONE -3.5 -0.6 -4.8
t 2.0 1.5 1.6
NYVAC -4.4 9.5 -5.9
~
1.9 3.2 1.7
vP878 -4.9 7.1 -4.0
~
1.8 2.2 1.2
vP911 -4.0 4.6 1.4
~
2-5 2.0 5.1
vP921 -3.4 10.7 15.5 ~
~
0.9 1.5 2.8
~; : ~r = m o :1
P<0.05 vs appropriate controls, Student's t-test
''~>w'°.~ 92/15672 ~ ~ ~ ~ ~ "'~ ~CT/US92/01906
-145-
Table 21. Secondary CTL activity of spleen cells
following in vitro stimulation with
vaccinia virus recombinants.
PERCENT CYTOTOXICITY
IMMONI ZATION TARGET
in vivo in vitro P815 VAC HIV V3
NONE NONE -0.1 1.9 0.5
NYVAC 3.7 8.9 3.8
vP878 4.6 9.0 5.5
vP911 -1.7 2.9 4.8
vP921 2.9 2.9 1.5
NYVAC NONE 0.0 4.4 1.1
NYVAC 3.5 47.8 ~ 9.2
vP878 6.3 44.1 ~ 14.4
vP911 7.9 48.6 ~ 10.6
vP921 6.8 50.8 ~ 7.9
vP878 NONE 0.1 1.7 1.3
NYVAC 10.2 58.5 ~ 13.0
vP878 11.6 57.9 ~ 59.9
vP911 7.8 56.2 ~ 40.8
vP921 4.9 42.0 ~ 14.8
vP911 NONE 0.3 2.9 4.0
NYVAC 6.2 50.7 ~ 8.5
vP878 5.9 50.9 ~ 77.4
vP911 5.0 54.2 ~ 82.6
vP921 10.9 55.0 ~ 87.8
vP921 NONE 2.9 5.0 9.4
NYVAC 8.3 54.4 ~ 22.7
vP878 10.4 56.2 ~ 85.6
vP911 8.7 58.2 ~ 86.5
vP921 7.8 55.2 ~ 81.0
BALB/cJ spleen cells from mice immunized approximately 1 month
earlier with the indicated vaccinia virus recombinants were
incubated with infected syngeneic spleen cells for 5 days and
assayed for cytotoxicity at an effector to target cell ratio of
20:1.
~s P<0.05 compared to controls, Student's t-test.
~-~ ,,J~
OJ91~/~5~72 PCT/US92/01906
-146-
Table 22. Anamnestic CTL responses of the spleen
cells of mice administered a single
inoculation of recombinant vaccinia or
canarypox virus expressing the V3 loop of
HIV gp120.
PERCENT
CYTOTORICITY
IMMtJNI ZATION
TARGET
PRIMARY BOOSTER
in vivo in vitro P815 Vac CP HIV V3
NONE NONE 0.4 -2.5 -2.3 -1.5
vP804 0.5 8.8 0.7 0.8
vP878 1.8 6.1 0.4 1.6
CP 5.8 4.2 ~4.9 0.4
vCP95 4.4 2.6 6.1 0.1
SB135 -0.2 -0.7 -0.4 0.5
vP804 NONE 0.7 1.7 0.1 1.3
vP804 5.5 43.5 ~ 5.8 3.5
vP878 3.6 42.5 ~ 1.6 -0.3
CP 8.5 7.0 5.6 3.9
vCP95 5.8 5.3 4.4 4.0
SB135 1.2 -0.9 -0.5 -0.2
vP878 NONE 0.2 -2.9 -0.8 -0.2
vP804 5.3 56.4 ~ 7.5 4.1
vP878 6.7 60.2 ~ 7.7 41.7
CP 8.7 13.4 9.4 4.7
vCP95 7.1 10.5 8.7 19.0
SB135 1.9 -0.7 -0.2 -1.4
CP NONE 4.6 -0.6 2.3 -0.0
vP804 11.0 17.7 ~ 5.7 6.1
vP878 7.1 14.6 ~ 12.3 5.5
CP 7.4 5.9 19.3 ~ 3.1
vCP95 6.8 5.4 20.4 ~ 2.8
SB135 1.4 -0.4 0.8 -1.4
vCP95 NONE -0:8 -2.2 -1.3 0.3
vP804 9.4 26.4 ~ 9.3 6.6
vP878 10.4 22.5 ~ 16.9 32.1
CP 8.8 7.2 20.0 ~ 3.2
vCP95 5.1 4.2 19.6 ~ 7.8
SB135 1.9 -1.5 -0.3 -1.2
Twenty-three days after immunization, the spleen cells were
stimulated in vitro for 5 days with virus infected or peptide-
pulsed syngeneic spleen cells and then assayed for specific
cytotoxicity against virus infected or peptide-pulsed P815
target cells at an effector to target cell ratio of 20:1.
P<0.05 compared to appropriate controls, Student's t-test.
,:;:,:,92/1672 ~ ~ ~': ~ w r ~ PC1'/US92/01906
-147-
Table 23. Depletion of cytotoxic activity with monoclonal
antibodies to CD8 plus complement.
PERCENT
CYTOTOXICITY
TARGETS
IMMUN IZATION
in vivo in vitro TREATMENT P815 VAC HIV V3
NONE NONE NONE 1.1 1.5 -0.3
NONE NYVAC NONE -7.4 0.4 -0.4
NONE vP921 NONE -0.2 1.1 -0.7
NYVAC NONE NONE -3.1 -0.3 -1.4
NYVAC NYVAC NONE -2.6 40.5 -0.3
NYVAC vP921 NONE 3.3 31.4 -2.9
vP921 NONE NONE 3.0 -1.3 -0.1
vP921 NYVAC NONE -4.9 25.9 12.2
vP921 vP921 NONE -0.2 21.3 30.5
vP921 vP921 C' 4.6 20.1 22.9
vP921 vP921 anti-CD4 4.2 22.6 23.2
vP921 vP921 anti-CD8 -5.0 22.5 26.9
vP921 vP921 anti-CD4+C' 10.0 26.6 30.1
vP921 vP921 anti-CD8+C' 9.2 7.1 2.3
~i~~~l~
WO 92/1672 '
PCT/US92/01906
-148-
Table 24. Specificity of primary CTL activity for the V3 loop
- of HIV-1 isolate IIIB following a single inoculation
with HIV recombinant vaccinia viruses.
PERC$NT CYTOTOBICITY
TARGET
V3 PEPTIDE
IMMUNIZATION P815 IIIB SF2 MN
NONE -2.7 -1.9 -0.9 -1.2
0-5 0.5 0.5 0.5
NYVAC -1.6 -0.3 -0.6 -0.3
0.5 0.8 0.7 0.2
vP878 -2.8 0.5 -0.5 -1.2
0.8 1.0 0.6 0.5
vP911 -2.6 7.5 ~ -0.5 -1.1
0.2 3.2 0.5 0.4
vP921 -2.5 12.5 ~ -0.1 -1.2
0.7 3.6 0.5 0.5
Mice were administered a single iv inoculation with
the indicated vaccinia virus recombinant and assayed
for CTL activity 7 days later against P815 targets
and P815 targets pulsed with one of three peptides
corresponding to the V3 loop region of HIV-1 isolates
IIIB, SF2, and MN. Although assayed at effector to
target cell ratios of 100:1, 50:1, and 25:1, only the
100:1 data are shown.
P<0.05 vs appropriate controls, Student's t-test
', . ; 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-149-
Table 25. Specificity of secondary CTL activity for
the V3 loop of HIV-1 isolate IIIB
following a single inoculation with HIV
recombinant vaccinia viruses.
PERCENT CYTOTOXICITY
TARGET
IMMUNIZATION V3 PEPTIDE
in vivo in vitro P815 IIIB SF2 MN
NONE NONE 1.0 1.1 0.5 -0.0
NYVAC 0.4 0.5 -0.6 -0.3
vP878 0.2 0.2 -0.5 -1.0
vP911 -1.5 0.3 -0.5 0.2
vP921 -0.6 1.4 0.1 -0.5
NYVAC NONE -2.2 0.2 0.5 -1.0
NYVAC 3.2 2.2 3.9 2.5
vP878 4.4 5.9 5.0 6.1
vP911 5.8 11.1 5.0 5.3
vP921 5.0 6.5 2.9 2.9
vP878 NONE 0.1 -0.2 -0.9 -1.0
NYVAC 3.0 4.8 4.4 4.5
vP878 7.9 20.2 7.8 8.6
vP911 4.8 7.8 4.5 4.7
vP921 2.7 6.9 2.8 3.0
vP911 NONE 0.9 1.8 1.4 0.5
NYVAC 8.8 8.3 8.1 6.6
vP878 6.6 57.2 6.8 8.2
vP911 4.6 63.7 2.9 4.2
vP921 7.2 63.6 4.1 4.9
vP921 NONE 0.5 0.8 1.2 0.6
NYVAC 4.4 7.9 7.5 6.0
vP878 8.1 59.0 7.1 7.5
vP911 6.4 71.4 7.9 6.6
vP921 9.3 63.4 9.0 8.1
me i
V1'O 92/15672 PCT/US92/01906
-150-
N h ~ o
Ip P M ~ Q
r- O P O 0
M ~O ~
~ O
p
V1 O V O
O ~ 1
O
~0 p O~ O K7
N ~- ~ N
0 ~
~~~ "~ ~~~ ~~'' N
~E M
v, . .
N V .
r' N O
~- N
N
-
A P ~ ' ~
~ r- r M P
N
.
rUl ~~. ~~ ~v, .oc o.,c
N . . ~
G) M t Yr- ~
tv M
y n-
~
~ w
N ~ ~ ~
N
G7~ ~ P~p ~f A
h J ~
N
O h H W O b
0 b n ~ ~
.- r- ~ ~
N
ro ~
'~ = r r ~ ~ N
~ ~ ~0 A
~i~ ~
d t
t,'
'rI 7 ~l ~ ~ ~ O A
lMv1 ~ ~ 1~ y\
~ ~ N
OU ~, " ~~ .oo~ .oN.-~ n~~ ~~
_
r
1O ~ b ~ .-
U N N
~ M
e'~ H
Id
n ~ ~ ~ O
' ~ ~ A ~ f~
O O O O
r N M ~ V an
~ ~ N CI ~
r ~ ~
H!0 ~'~ : ~ ~ oM
~
x~
O u; ~~u, ~v,o r~N.-~
t1 ~ n
~
_ m
o ~ .r
p ~ ~ M M ~
N N
~-
d Q)
O ~ Ir 1n D p 1.1
N Y .W ,O
NU ~ ~ ~~~ ~N a
~'
P ~ ~ ~ a
A N M A ~1
~i n ~; M ~
,~
r.. ~ M iIV ~ If1 N V
r. M ~
r. ~ ~
_O' .0 ~ ~ ~ .p r1
- N Y1 ~- P V1
P
M
~x Y O
N
_ IH A .0
O M P
O O 0
NV
bG.- ~.O
M N M
; V1 ~- r-
~
ac .- o o ' o- G
u ~ ~ ' ~;
~
t7
zo-
C~ t t t t
~ N ~ ~
H H
N N t
H
N
a
W E
N
~ ..
r1 ~ to V ~ .,
N
rl~r1 ~ ~ P m
O
_
1~
a
d
C
11
TS
m
d
O
H~
O y
O~ w
i~
o
'
p,~ ,
m
-
E
U
r~
a~ ~o
m
m.
o
a
' '
w
v
N H
of
o
41
.A
Id
H
SUSSTiTUT~ S~-IEET
v:.:; .92/15672
PCT/ US92/01906
-151-
eo
U
U vv ~ tn c~r~ cv
Q1 c1er ~D~C O
> N ~O
M ri
b
C h ~DO Insr er
~1 r'11n ~Cri ri
~ O
U ~ N
H
~, ea
H
,'7 ~sr COOD t~N1 h
H c1N sftf1h
x
,~ H
3
.'d N N h h O tn
f'7f~ N 01 N
N
~i
C 14
a0
s
H N t0 e1O tD
G7 f"1f"1V' N
U
W
O
1!1 O N CO O O O
f.1 N C1 N
d
x
..~ o
H
H
a a
H H a
~
W 4ia ~ ri N
N ~ aovv vv
N V x > > >
H
x
h
N
d1
ri
b
E
SUBSTITUTE SHEET
Gw .~ t1 cl ~ l
~'O 92/15672
PCT/US92/01906 i.:,;..,
-152-
EgamDle 19 - EXPRESSION OF THE HIP-1 (ARP-2 OR SF-2
STRAIN) env GENE IN ALpAC, TROVAC AND NYpAC
VECTORS
Plasmid Constructions. The lambda clone containing the
entire HIV-1 (ARV-2 or SF-2 strain) genome was provided by
J. Levy and was described previously (Sanchez-Pescador et
al., 1985). The env sequences were subcloned into pUCl3,
creating plasmid pMP7MX373, which contains the sequences
from -1 relative to the initiation codon (ATG) of the env
gene product to 715 by downstream of the termination codon
(TAA) of the env gene. These env sequences were excised
from pMP7MX373 by digestion with EcoRI and HindIII and
inserted into the plasmid vector, pIBI25 (International
Biotechnologies, Inc., New Haven, CT), generating plasmid
pIBI25env.
Recombinant plasmid pIBI25env was used to transform
competent E. coli CJ236 (dut- ung-) cells. Single-stranded
DNA was isolated from phage derived by infection of the
transformed E. coli CJ236 cells with the helper phage,
MG408. This single-stranded template was used in vitro
mutagenesis reactions (Kunkel et al., 1985) with
oligonucleotide MUENVT12 (SEQ ID N0:157) (5'-AGAGGGG
AATTCTTCTACTGCAATACA-3'). Mutagenesis with this
oligonucleotide generates a T to C transition and disrupts
the TSCT motif at nucleotide positions 6929-6935 of the ARV-
2 genome (Sanchez-Pescador et al, 1985). This mutation does
not alter the amino acid sequence of the env gene and
creates an EcoRI site, which was used to screen for
mutagenized plasmid clones. Sequence of confirmation was
done by the dideoxynucleotide chain termination method
(Sanger et al., 1977). The resultant mutagenized plasmid
was designated as pIBI25mutenvll.
A 1.45 kb BalII fragment was derived from
pIBI25mutenvll. This fragment contained the mutated env
sequences. It was used to substitute for the corresponding
unmutated fragment in pIBIenv. The resultant plasmid was
designated as pIBI25mutenv8. Further modifications were
made to pIBImutenv8. In vitro mutageneses were performed to
remove the sequence coding for the rex protein and'the LTR
sequence (LTR region) from the 3'-end of the gene and to
CA 02105277 2003-10-O1
77396-25
-153-
delete the putative immuno-suppressive (IS) region amino
acids 583 through 599) (SEQ ID N0:158) Leu-Gln-Ala-Arg-Val-
Leu-Ala-Val-Glu-Arg-Tyr-Leu-Arg-Asp-Gln-Gln-Leu) (Klasse et
al., 1988). These reactions were done with the single-
stranded template derived from pIBImutenv8 with
oligonucleotides LTR2 (SEQ ID N0:159) (5'-TTGGAAAGGCTTTTG-
GCATGCCACGCGTC-3') and MUENSVISR (SEQ ID N0:160) (5'-ACAG
TCTGGGGCATCAAGCAGCTAGGGATTTGGGGTTGCTCT-3'). Mutagenized
clones were identified by hybridization and restriction
analysis. A clone mutagenized such that it was deleted both
of the IS and the LTR region and another deleted of the LTR
was confirmed by nucleotide sequence analysis and designated
pIBI25mut3env40 and pIBI25mut2env22, respectively.
A 3.4 kb s_maI/ indIII fragment containing the entire
env gene was derived from pIBI25mut3env40 and from
pIBImut2env22 and inserted into pCPCVl, digested with
SmaI/ indIII. The plasmid pCPCVl is an insertion plasmid
which enables the generation of CP recombinants. The
foreign genes were directed to the C3 insertion locus.
Plasmids pCPCVi and pFPCV2 have been described previously in
PCT International Publication No. WO 89/03429 published
April 20, 1989.
Oligonucleotide PROVECNS (SEQ ID N0:161) (5'-CCGTTA
AGTTTGTATCGTAATGAAAGTGAAGGGGACCAGG-3') was used for in vitro
mutagenesis reactions via the method of Mandecki (1986) to
made a precise ATG:ATG construction with the WH6 promoter
and the env sequences. Potential mutants were screened for
the loss of the SmaI site. Plasmid clones devoid of a SmaI
site were identified and confirmed by nucleotide sequence
analysis. Properly mutagenized plasmid clones were
identified and designated as pCPenvIS+ or pCVenvIS- and
pFPenvIS+ or pFPenvIS-.
The HIV-1 env genes were excised from pCPenvIS- by
digestion with I~uI and ~dIII. The two env fragments of
2.5 kb (e~ivIS+) and 2.4 kb (envIS-), respectively, were
isolated and blunt-ended by reaction with the Klenow
fragment of the E. coli DNA polymerise in the presence of 2
mMdNTPs. These fragments were ligated with the 3.5 kb
fragment derived by digestion of pSIVenyW with I~I and
W~~~ ~~'2~
PCT/US92/01906
-154-
PstI with a subsequent blunting step with the Klenow
fragment of the E. coli DNA polymerase in the presence of
2mM dNTPs. The plasmid pSIVenvW contains the SIV env gene
expression cassette regulated by the vaccinia virus H6
promoter in the ATI insertion locus. Digestion of pSIV env
W with NruI and PstI excises the entire SIV env coding
sequences and the 3'-most 20 by of the promoter element.
Ligation to the env IS- and env IS+ fragments restores the
20 by of the H6 promoter and inserts the HIV-1 env gene into
the ATI insertion plasmid. The resultant plasmids were
designated as pARSW+ and pAR6W- for env IS+ and env IS-,
respectively.
In Vitro Recombination and Purification of
Recombinants. Recombination was performed introducing
plasmid DNA into infected cells by calcium phosphate
precipitation both for CP (ALVAC) and for FP (TROVAC)
recombinants, as previously described (Piccini et al.,
1987). Plasmids pCPenvIS+ and pCPenvIS- (C5 locus, FIG. 16)
were used to make recombinants vCP61 and vCP60 respectively.
Plasmids pFPenvIS+ and pFPenvIS- (F7 locus, FIG. 22) were
used to make recombinants vFP63 and vFP62, respectively.
The plasmids pARSW+ and pAR6W were used in in vitro
recombination experiments with vP866 (NYVAC) as rescue to
yield vP939 and vP940, respectively. Recombinant plaques
were selected by autoradiography after hybridization with a
32P_labeled env specific probe and passaged serially three
times to assure purity, as previously described (Piccini et
al., 1987).
Radioimmunoprecipitation Analysis. Cell monolayers
were infected at 10 pfu/cell in modified Eagle's methionine-
free medium (MEM met-). At 2 hours post-infection, 20
uCi/ml of [35S]-methionine were added in MEM (-met)
containing 2% dialysed fetal bovine serum (Flow). Cells
were harvested at 15 hrs post-infection by resuspending them
in lysis buffer (150 mM NaCl, 1mM EDTA pH 8, 10 mM Tris-HC1
pH 7.4, 0.2 mg/ml PMSF, 1% NP40, 0.01% Na Azide) and 50 ~C1
aprotinin, scraped into eppendorf tubes and the lysate was
clarified by spinning 20 minutes at 4°C. One third of the
supernatant of a 60 mm diameter Petri dish was incubated
W.O 92/1672 ~ ~ ~ ~ ~ 7 ~ PCT/US92/01906
-155- -
with 1 ~1 normal human serum and 100 ~1 of protein A-
Sepharose CL-4B (SPA) (Pharmacia) for 2 hours at room
temperature. After spinning for 1 minute, the supernatant
was incubated for 1 h 30 minutes at 4°C with 2 ~C1
preadsorbed human serum from HIV seropositive individuals
(heat-inactivated) and 100 ~.1 SPA.
The pellet was washed four times with lysis buffer and
two times with lithium chloride/urea buffer (0.2 M LiCl, 2 M
urea, 10 mM Tris-HCl pH 8) and the precipitated proteins
were dissolved in 60 u1 Laemmli buffer (Laemmli, 1970).
After heating for 5 minutes at 100°C and spinning for 1
minute to remove Sepharose, proteins in the supernatant were
resolved on an SDS 10% polyacrylamide gel and f luorographed.
Expression of the HIV-1 env Gene. Six different
recombinant viruses were prepared where the HIV env gene of
the ARV-2 or SF-2 strain was inserted downstream from a
vaccinia early-late promoter, H6. For simplicity, the two
ALVAC-based recombinant viruses, vCP61 and vCP60, will be
referred to as CPIS+ and CPIS-, the two TROVAC-based
recombinants, vFP63 and vFP62, as FPIS+ and FPIS-, and the
two NYVAC-based recombinants vP939 and vp940 as W- and W+,
respectively.
All the constructs were precise, in that, the ATG
initiation codon of the HIV-1 env gene was superimposed on
the ATG of the vaccinia H6 promoter. Moreover, all
extraneous genetic information 3' to the termination codon
was eliminated. CPIS-, FPIS-, and W- were all obtained by
deletion of a 51 by region, corresponding to amino acids
583-599, located near the 5' portion of the gp41 gene
product. This region shares homology with putative
immunosuppressive regions (Klasse et al., 1988, Ruegg et
al., 1989b) occurring in the transmembrane polypeptide of
other retrovirus glycoproteins (Cianciolo et al., 1985;
Ruegg et al., 1989a,b).
Expression analyses with all six recombinant viruses
were performed in CEF, Vero, and MRC-5 cell monolayers.
Immuno-precipitation experiments using sera pooled from HIV
seropositive individuals were performed as described in
Materials and Methods. All six recombinants directed the
LW.. t3 J rr i 1
WO 92/1672
PCT/ US92/01906 ;.-.,
-156-
synthesis of the HIV-1 gp161 envelope precursor. The
efficiency of processing of gp160 to gp120 and gp4l,
however, varied between cell types and was also affected by
deletion of the immunosuppressive region. Recognition of
gp41 by the pooled sera from HIV seropositive individuals
also varied with the virus background and the cell type.
Egam~le 20 - EgpRE88ION OF THE HIV-2 (IBSY STRAIN) env
GENE IN NYDAC
Expression of crDl6O. Oligonucleotides HIV25PA (SEQ ID
NO. 162) (5'-
ATGAGTGGTAAAATTCAGCTGCTTGTTGCCTTTCTGCTAACTAGTGCTTGCTTA-3')
and HIV25PB (SEQ ID N0:163) (5~-
TAAGCAAGCACTAGTTAGCAGAAAGGCAACAAGCAGCTGAATTTTACCACTCAT-3')
were annealed to constitute the initial 54 by of the HIV-2
SBL/ISY isolate (Franchini et al., 1989) env coding
sequence. This fragment was fused 3' to a 129 by fragment
derived by PCR with oligonucleotides H65PH (SEQ ID N0:164)
(5'-ATCATCAAGCTTGATTCTTTATTCTATAC-3') and H63PHIV2 (SEQ ID
N0:165) (5'-CAGCTGAATTTTACCACTCATTACGATACAAACTTAACG-3')
using pTPlS (Guo et al., 1989) as template. The fusion of
these two fragments was done by PCR using oligonucleotides
HIV25PC (SEQ ID N0:166) (5'-TAAGCAAGCACTAGTTAG-3') and H65PH
(SEQ ID N0:164). The 174 by PCR derived fragment was
digested with HindIII and SacI and inserted into pBS-SK
(Stratagene, La Jolla, CA) digested with HindIII and SacI.
The resultant fragment was designated pBSH6HIV2. The insert
was confirmed by nucleotide sequence analysis.
The 3' portion of the HIV-2 env gene was also derived
by PCR. In this reaction a 270 by fragment was amplified
with oligonucleotides HIV2B1 (SEQ ID N0:167) (5'-
CCGCCTCTTGACCAGAC-3') and HIV2B2 (SEQ ID N0:168) (5'-
ATCATCTCTAGAATAAAP,ATTACAGGAGGGCAATTTCTG-3') using pISSY-KPN
(provided by Dr. Genoveffa Franchini, NCI-NIH, Bethesda, MD)
as template. This fragment was digested with BamHI and
XbaI. The 150 by fragment derived from this digestion
contained a 5' BamHI and a 3' XbaI cohesive end. The
fragment was engineered to contain a TSNT sequence motif
known to be recognized as vaccinia virus early transcription
W'~ 92/ 1 X672
P /tJS92/01906
-157-
termination signal (Yuen et al., 1987), following the
termination codon (TAA).
The majority of the HIV-2 env gene was obtained from
pISSY-KPN by digestion with SacI and BamHI. The 2.7 kb
fragment generated by this digestion was coinserted into
pBS-SK digested with SacI and XbaI with the 150 by
BamHI/XbaI fragment corresponding to the 3' end of the
gene. The resultant plasmid was designated pBSHIV2ENV.
The 174 by SpeI/HindIII fragment from pBSH6HIV2 and the
2.5 kb SpeI/XbaI fragment from pBSHIV2ENV were ligated into
pBS-SK digested with HindIII and XbaI to yield pBSH6HIV2ENV.
The 2.7 kb HindIII/XbaI insert from pBSH6HIV2ENV was
isolated and blunt-ended with the Klenow fragment of the E.
coli DNA polymerase in the presence of 2mM dNTP. The blunt-
ended fragment was inserted into a SmaI digested pSDSHIVC
insertion vector. The resultant plasmid was designated as
pATIHIV2ENV. This plasmid was used in vitro recombination
experiments with vP866 (NYVAC) as the rescuing virus to
yield vP920.
Immunoprecipitation analysis was performed to determine
whether vP920 expresses authentic HIV-2 gp160. Vero cell
monolayers were either mock infected, infected with the
parental virus vP866, or infected with vP920 at an m.o.i. of
PFU/cell. Following an hour adsorption period, the
inoculum was aspirated and the cells were overlayed with 2
mls of modified Eagle's medium (minus methionine) containing
2% fetal bovine serum and [35S]-methionine (20 ~Ci/ml).
Cells were harvested at 18 hrs post-infection by the
addition of 1 ml 3X buffer A (3% NP-40, 30 mM Tris pH 7.4,
150 mM NaCl, 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF)
with subsequent scraping of the cell monolayers.
Lysates from the infected cells were analyzed for HIV-2
env gene expression using pooled serum from HIV-2
seropositive individuals (obtained from Dr. Genoveffa
Franchini). The sera was preadsorbed with vP866 infected
Vero cells. The preadsorbed human sera was bound to Protein
A-sepharose in an overnight incubation at 4°C. Following
this incubation period, the material was washed 4X with 1X
buffer A. Lysates precleared with normal human sera and
~lt~~~; t l
WO 92/ 1 X672 PCT/US92/019.06
-158-
protein A-sepharose were then incubated overnight at 4°C
with~the human sera from seropositive individuals bound to
protein A-sepharose. After the overnight incubation period,
the samples were washed 4X with 1X buffer A and 2X with a
LiCl2/urea buffer. Precipitated proteins were dissociated
from the immune complexes by the addition of 2X Laemmlis
buffer (125mM Tris(pH6.8), 4% SDS, 20% glycerol, 10% 2-
mercaptoethanol) and boiling for 5 min. Proteins were
fractionated on a 10% Dreyfuss gel system (Dreyfuss et al.,
1984), fixed and treated with 1M Na-salicylate for
fluorography.
Human sera from HIV-2 seropositive individuals
specifically precipitated the HIV-2 gp160 envelope
glycoprotein from vP920 infected cells. Furthermore, the
authenticity of the expressed HIV-2 env gene product was
confirmed, since the gp160 polyprotein is processed to the
mature gp120 and gp41 protein species. No HIV-specific
protein species were precipitated from mock-infected cells
or cells infected with the NYVAC parental virus. Also,
supportive of the proper expression of the HIV-2 env by
vP920 was the observation that the gene product is expressed
on the surface of vP920 infected cells.
Expression of qp120. The plasmid pBSH6HIV2 containing
the vaccinia virus H6 promoter fused to the 5'-end of the
HIV-2 env gene was digested with SpeI and HindIII to
liberate the 180 by fragment containing these sequences.
This fragment was ligated into pBS-SK digested with HindIII
and XbaI along with the 1.4 kb SDeI/XbaI fragment of
pBSHIV2120A to yield pSHIV2120B.
The plasmid pBSHIV2120A was derived by initially
deriving the 3' portion of the gp120 coding sequence by PCR.
The PCR was performed using oligonucleotides HIV2120A (SEQ
ID N0:169) (5'-ATCATCTCTAGAATAAAAATTATCTCTTATGTCTCCCTGG-3')
and HIV2120B (SEQ ID N0:170) (5'-AATTAACTTTACAGCACC-3') with
pISSY-KPN as template. The PCR-derived fragment was
digested with EcoRI and XbaI to yield a 300 by fragment
which contained a 5'-EcoRI cohesive end and a 3'-XbaI
cohesive end. The fragment was engineered with a
translation termination sequence (TAA) anda TSNT sequence
W.~,? 92/15672 ~ ~ ~ J ~ ~ ~ p~'/US92/01,906 ___-_-__-_
-159- _
motif just 5' to the XbaI site. The 300 by XbaI/EcoRI PCR
fragment was ligated into pBS-SK digested with SacI/XbaI
along with a 1.4 kb SacI/EcoRI fragment derived from pISSY-
KPN to generate pBSHIV2120A.
The plasmid pBSHIV2120B was digested with HindIII and
XbaI to generate a 1.8 kb fragment containing the HIV-2
gp120 coding sequence juxtaposed 3' to the vaccinia virus H6
promoter. This fragment was blunted with the Klenow
fragment of the E, coli DNA polymerase in the presence of 2
mM dNTPs. The blunt-ended fragment was ligated to SmaI
digested pSDSHIVC to generate pATI HIV 2120. This plasmid
was used in in vitro recombination experiments to yield
vP922.
Immunoprecipitation experiments with vP922 infected
cells were performed as described above for the expression
of the entire HIV-2 env gene. No HIV-specific species were
precipitated from mock infected or vP866 infected Vero
cells. A protein species of 120 kDa was, however,
precipitated from lysates derived from cells infected with
vP922. The HIV-2 gp120 expressed by vP920 was found to be
present on the cell surface of vP920 infected Vero cells.
EBample 21 - ERFRESSION OF SIV GENES IN NYVAC
Generation of NYVAC,/SIV cro140 Recombinant. A plasmid
pSSIIE containing the SIV (Mac142) env gene was obtained
from Dr. Genoveffa Franchini (NCI-NIH, Bethesda, MD). This
plasmid was digested with HindIII and PstI to liberate a 2.2
kbp fragment containing from nucleotide 220 of the SIV env
gene to a region 160 by downstream from the translation
termination codon. It should be noted that an expression
cassette containing this fragment will result in the
expression of a gp140 protein species rather that a gp160
species. This 40% deletion of the transmembrane region
.results from a premature termination at nucleotide 7,934 of
the genome (Franchini et al., 1987). Such premature
terminations of the env gene product are noted after
propagation of SIV in culture (Kodama et al., 1989).
The amino portion of the gene was derived by PCR using
pSSIIE as template and oligonucleotides SIVENV1 (SEQ ID
N0:171) (5'-CGATATCCGTTAAGTTTGTATCGTAATGGGATGTCTTGGGAATC-3')
WO 92/15672 ~ 4~ PCT/US92/~J1906 a;-,---.:
-160-
and SIVENV2 (SEQ ID N0:172) (5'-CAAGGCTTTATTGAGGTCTC-3').
The resultant 250 by fragment contains the 5'-most 230 by of
the SIV env gene juxtaposed downstream from the 3'-most 20
by of the vaccinia virus H6 promoter (3'-end of NruI site).
A 170 by fragment was obtained by digestion of the fragment
with HindIII, which removes 80 by of SIV env sequences.
The sequences containing the remainder of the SIV env
gene following the premature termination signal were derived
by PCR from pSS35E (obtained from Dr. Genoveffa Franchini).
This plasmid contains sequences containing the C-terminal
portion of the SIV env gene into the LTR region downstream
from the env gene. The oligonucleotides used to derive the
360 by fragment were SIVENV3 (SEQ ID N0:173) (5'-
CCTGGCCTTGGCAGATAG-3') and SIVENV4A (SEQ ID N0:174) (5'-
ATCATCGAATTCAAA.AATATTACAAAGAGCGTGAGCTCAAGTCCTTGCCTAATCCTCC-
3'). This fragment was digested with PstI and EcoRI to
generate a 260 by fragment having a 5' PstI cohesive end and
a 3' EcoRI cohesive end.
The 2.2 kb HindIII/PstI fragment from pSSIIE, the 170
by NruI/HindIII fragment containing the 5' end of the gene,
. and the 260 by PstI/EcoRI containing the 3' end of the gene
were ligated with a 3.1 kb NruI/EcoRI fragment derived from
pRW838. pRW838 contains the vaccinia virus H6 promoter
linked to the rabies G gene flanked by canarypox virus
sequences which enable the insertion of genes into the C5
locus. Digestion with NruI and EcoRI liberates the rabies G
gene and removes the 3'-most 20 by of the H6 promoter. The
resultant C5 insertion plasmid containing the SIV env gene
linked to the vaccinia H6 promoter was designated as
pCSSIVENV.
The plasmid, pCSSIVENV, was digested with HindIII and
EcoRI to liberate a 2.2 kb fragment, containing from
nucleotide 150 of the SIV env gene to the end of the entire
gene. PCR was used to derive the vaccinia H6 promoter/SIV
env linkage from pCSSIVENV with oligonucleotides MPSYN286
(SEQ ID N0:175) (5'-CCCCCCAAGCTTFTTTATTCTATACTT-3') and
SIVENV2 (SEQ ID N0:176) (5'-CAAGGCTTTATTGAGGTCTC-3'). The
320 by fragment was digested with HindIII to derive a 240 b~
fragment. The 2.2 kb HindIII/EcoRI and the 240 by HindIII
Wn, 92/15672 ~ ~ ~ ~ Z. ~ ~ p~/US92/01906
-161-
fragment were coligated into pC3I digested with HindIII and
EcoRI. The resultant plasmid containing the HindIII
fragment in the proper orientation relative to the SIVenv
coding sequence was designated pC3SIVEM. The plasmid pC3I
was derived as follows. The nucleotide sequence analysis of
an 2.5 kb BalII canarypoxvirus genomic fragment revealed the
entire C3 open reading frame and the 5' and 3' noncoding
regions. In order to construct a donor plasmid for
insertion of foreign genes into the C3 locus with the
complete excision of the C3 open reading frame, PCR primers
were used to amplify the 5' and 3' sequences relative to C3.
Primers for the 5' sequences were RG277 (SEQ ID N0:177) (5'-
CAGTTGGTACCACTGGTATTTTATTTCAG-3') and RG278 (SEQ ID N0:178)
(5'-TATCTGAATTCCTGCAGCCCGGGTTTTTATAGCTAATTAGTCAAATGTGAG
TTAATATTAG-3').
Primers for the 3' sequences were RG279 (SEQ ID N0:179)
(5'-TCGCTGAATTCGATATCAAGCTTATCGATTTTTATGACTAGTTAATCAAATA
AAAAGCATACAAGC-3') and RG280 (SEQ ID N0:180) (5'-
TTATCGAGCTCTGTAACATCAGTATCTAAC-3'). The primers were
designed to include a multiple cloning site flanked by
vaccinia transcriptional and translation termination
signals. Also included at the 5'-end and 3'-end of the left
arm and right arm were appropriate restriction sites (Asp718
and EcoRI for left arm and EcoRI and SacI for right arm)
which enabled the two arms to ligate into Asn718/SacI
digested pBS-SK plasmid vector. The resultant plasmid was
designated as pC3I.
The plasmid pC3SIVEM was linearized by digestion with
EcoRI. Subsequent partial digestion with HindIII liberated
a 2.7 kb HindIII/EcoRI fragment. This fragment was blunt-
ended by treatment with Klenow fragment of the E. coli DNA
polymerase in the presence of 2mM dNTPs. The fragment was
ligated into pSD550VC digested with SmaI. The resultant
plasmid was designated as pSIVEMVC. This plasmid was used
in in vitro recombination experiments with vP866 as rescue
virus to generate vP873. vP873 contains the SIV env gene in
the I4L locus.
Generation of a NYVACJQag(pol and gag Recombinants. A
plasmid, pSIVAGSSIIG, containing the SIV cDNA sequence
WO 92/15672
~ ~ ~~ ~ PCT/US92/01906 _;.-,..
-162-
encompassing the gag and pol genes was obtained from Dr.
Genoveffa Franchini (NCI-NIH, Bethesda, MD). The gag and
pol genes from this plasmid were juxtaposed 3' to the
vaccinia I3L promoter between vaccinia tk flanking arms.
This was accomplished by cloning the 4,800 by CfoI/TaQI
fragment of pSIVGAGSSIIG, containing the QaQ and the
oligonucleotides :SIVLl (SEQ ID N0:181) (5'-
TCGAGTGAGATAAAGTGAAAATATATATCATTATATTACAAGTA
CAATTATTTAGGTTTAATCATGGGCG-3') and SIVL2 (SEQ ID N0:182)
(5'-CCCATGATTAAACCTAAATAATTGTACTTTGTAATATAATGCTATATATTTT
CACTTTATCTCAC-3') corresponding to the I3L promoter into the
4,070 by XhoI/AccI fragment of pSD542, a derivative of
pSD460 (FIG. 1). The plasmid generated by this manipulation
was designated pSIVGl.
To eliminate the p01 gene, a 215 by PCR fragment was
derived from pSIVGAGSSIIG using oligonucleotides SIVP5 (SEQ
ID N0:183) (5'-AATCAGAGAGCAGGCT-3') and SIVP6 (SEQ ID
N0:184) (5'-TTGGATCCCTATGCCACCTCTCT-3'). The PCR-derived
fragment was digested with BamHI and StuI and ligated with
the 5,370 by partial BamHI/StuI fragment of SIVG1. This
resulted in the generation of pSIVG2. pSIVG2 was used in in
vitro recombination experiments with vP873 as rescue virus
to yield vP948.
The plasmid to insert both aaQ and pol into NYVAC-based
vectors was engineered in the following manner. pSIVGl,
described above, contains extraneous 3'-noncoding sequences
which were eliminated using a 1 kb PCR fragment. This
fragment was generated from plasmid pSIVGAGSSIIG with the
oligonucleotides SIVPS and SIVP6. This PCR derived fragment
containing the 3' end of the bol gene was digested with
BamHI and HpaI. The 1 kb BamHI/Hpal fragment was ligated to
the 7,400 by partial BamHI/Hpal fragment of pSIVGl to yield
pSIVG4.
Sequence analysis of pSIVG4 revealed a single base pair
deletion within the p01 gene. To correct this error the
2,300 by BctlII/StuI fragment from pSIVGl was inserted into
the 6,100 by partial BctlII/StuI fragment of pSIVG4 to yield
pSIVGS. The plasmid, pSIVGS, was used in in vitro
Wn 92/15672 ~ ~ ~ j ~ ~~ ~ p~/~S92/01906
-163-
recombination experiments with vP873 as rescue to generate
vP943.
Generation of NYVAC/SIV D16 and p28 Recombinants. The
bol gene and the portion of the tract gene encoding p28, p2,
p8, p1, and p6 were eliminated from pSIVGl. This was
accomplished by cloning the oligonucleotides SIVL10 (SEQ ID
N0:185) (5'-AGACCAACAGCACCATCTAGCGGCAGAGGAGGAAATTACTAATTTTT
ATTCTAGAG-3') and SIVL11 (SEQ ID N0:186) (5'-GATCCTCTA
GAATAAAAATTAGTAATTTCCTCCTCTGCCGCTAGATGGTGCTGTTGGT-3') into
the 4,430 by AccI/BamHI fragment of pSIVGl to generate
pSIVGl to generate pSIVG3. This plasmid contains an
expression cassette for the SIV p17 gene product expressed
by the vaccinia I3L promoter.
The entomopoxvirus 42 kDa-promoted SIV p28 gene (5' end
only) was inserted downstream from the I3L-promoted p17
gene. This was accomplished by cloning the 360 by
BSpMI/BamHI fragment of- pSIVGI, containing the 5' end of the
p28 gene, the oligonucleotides pSIVLI4 (SEQ ID N0:187) (5'-
TAGACAAAATTGAAAATATATAATTACAATATAAAATGCCAGTACAACAAATAGGTGGTA
ACTATGTCCACCTGCCATT-3') and SIVL15 (SEQ ID N0:188) (5'-
GCTTAATGGCAGGTGGACATAGTTACCACCTATTTGTTGTACTGGCATTTTATATTGTAA
TTATATATTTTCAATTTTGT-3'), containing the entomopox 42 kDa
promoter into the 4,470 by partial XbaI/BamHI fragment of
pSIVG3. The resultant plasmid was designated as pSIVG6.
The 3' portion of the p28 gene was then inserted into
pSIVG6. A 290 by PCR fragment, containing the 3' end of the
SIV p28 gene, was derived from pSIVGI using oligonucleotides
SIVP12 (SEQ ID N0:189) (5'-TGGATGTACAGACAAC-3') and SIVP13
(SEQ ID N0:190) (5'-AAGGATCCGAATTCTTACATTAATCTAGCCTTC-3').
This fragment was digested with BamHI and ligated to the
4,830 by BamHI fragment of pSIVG7, was used in in vitro
recombination experiments with vP866 and vP873 as rescue
experiments to generate vP942 and vP952, respectively.
Expression Analyses. The SIV gp140 env gene product is
a typical glycoprotein associated with the plasma membrane
of infected cells. It is expressed as a polyprotein of 140
kDa that is proteolytically cleaved to an extracellular
species of 112 kDa and a transmembrane region of 28 kDa
(Franchini et al., 1987). Immunofluorescence analysis using
WO 92/15672
PCT/US92/01906 i-...~
-164-
sera from rhesus macaques seropositive for SIV followed by
fluorescein conjugated rabbit anti-monkey IgG demonstrated
expression of the env gene product on the surface of
recombinant infected Vero cells. Surface expression was not
detectable on the surface of mock infected cells or cells
infected with the NYVAC (vP866) parent virus. Furthermore,
cells infected with recombinants containing only QaQ genes
were not shown to express any SIV components on the surface.
Surface expression in cells infected with vP873, vP943,
vP948 and vP952 all demonstrated surface expression and
significantly, all contain the SIV env gene.
The authenticity of the expressed SIV gene products
(env and QaQ) in Vero cells infected with the NYVAC/HIV
recombinants was analyzed by immunoprecipitation. Vero
cells were infected at an m.o.i. of 10 with the individual
recombinant viruses, with the NYVAC parent virus, or were
mock infected. After a 1 hour adsorption period, the
inoculum was removed and infected cells were overlayed with
2 ml methionine-free media containing [35S]-methionine (20
~CCi/ml). All samples were harvested at 17 hours post
infection by the addition of 1 ml of 3X Buffer A. Lysates
from the infected cells were analyzed with pooled sera from
SIV seropositive rhesus macaques or a monoclonal antibody
specific for cxact p24 gene product (both obtained from Dr.
Genoveffa Franchini, NCI-NIH, Bethesda MD).
Immunoprecipitation with the SIV seropositive macaque
sera was performed in the following manner. The macaque
sera were incubated with protein A-sepharose at 4°C for 16
hours. After washing with buffer A, the sera bound to
protein A sepharose were added to lysates precleared with
normal monkey sera and protein A sepharose. Following an
overnight incubation at 4°C the precipitates were washed 4 x
with buffer A and 2 x with LiCl/urea buffer. To dissociate
the precipitated protein from the antibody, the samples were
boiled in 80 ~1 2 x Laemmli buffer for 5 minutes. The
samples were fractionated on a 12.5 gel using the Dreyfuss
gel system (Dreyfuss et al., 1984). The gel was fixed and
treated with 1 M Na-salycate for fluorography.
WO 92/15672
r,.::,~.,; 1 v ~ '~ ~ PCT/US92/01906
-165-
All the recombinants containing SIV genes were expressing
the pertinent gene products. The NYVAC recombinants vP873,
vP943, vP948 and vP952 which contain the SIV env gene all
expressed the authentic gp140. However, it is difficult to
assess the processing of the gp140 protein to the 112 kDa
and 28 kDa mature forms. No species with an apparent
molecular weight of 140 kDa was precipitated by macaque
anti-SIV sera from mock infected Vero cells, vP866 infected
Vero cells and Vero cells infected with a NYVAC/SIV
recombinant not containing the SIV env gene. Expression of
the SIV gag encoded gene products by vP942, vp943, vp948,
and vP952 was demonstrated using the pooled sera from
macaques infected with SIV and the monoclonal antibody
specific to the p28 gag component. Expression of the entire
p55 gag protein without the pol region, which contains the
protease function, by NYVAC (vP948) in Vero cells is
evident. These results demonstrate that lack of SIV
protease expression prevents the complete proteolysis of p55
into its mature form. This is demonstrated much more
clearly when a monoclonal antibody specific to p28 was used
to precipitate g~ag specific gene products from vP948
infected Vero cells. Contrary to this result, expression of
SIV QaQ with the pol gene (includes protease) in vP943
infected Vero cells enabled the expressed p55 fag precursor
polypeptide to be proteolytically cleaved to its mature
forms.
Expression of both the p16 and p28 SIV gene products in
vP942 and vP952 infected Vero cells was demonstrated using
the pooled sera from macaques infected with SIV. Using the
monoclonal antibody specific to p28 obviously only
recognized the p28 expressed component.
Example 22 - CONBTRUCTION OF TROVAC RECOMBINANTS
EXPRESSING THE HEMAGGLUTININ GLYCOPROTEINS OF
AVIAN INFLUENZA VIRUSES
This Example describes the development of fowlpox virus
recombinants expressing the hemagglutinin genes of three
serotypes of avian influenza virus.
Cells and Viruses. Plasmids containing cDNA clones of
' the H4,-H5 and H7 hemagglutinin genes were obtained from Dr.
Robert Webster, St. Jude Children's Research Hospital,
V1'O 92/ 1 X672 ~ ~ ~ ~,
PCT/US92/01906
F:~;~
-166-
Memphis, Tennessee. The strain of FPV designated FP-1 has
been described previously (Taylor et al., 1988a, b). It is
an attenuated vaccine strain useful in vaccination of day
old chickens. The parental virus strain Duvette was
obtained in France as a fowlpox scab from a chicken. The
virus was attenuated by approximately 50 serial passages in
chicken embryonated eggs followed by 25 passages on chick
embryo fibroblast (CEF) cells. This virus was obtained in
September 1980 by Rhone Merieux, Lyon, France, and a master
viral seed established. The virus was received by
Virogenetics in September 1989, where it was subjected to
four successive plaque purifications. One plaque isolate
was further amplified in primary CEF cells and a stock
virus, designated as TROVAC, was established. The stock
virus used in the in vitro recombination test to produce
TROVAC-AIHS (vFP89) and TROVAC-AIH4 (vFP92) had been further
amplified though 8 passages in primary CEF cells. The stock
virus used to produce TROVAC-AIH7 (vFP100) had been further
amplified through 12 passages in primary CEF cells.
Construction of Fowlpox Insertion Plasmid at F8 Locus.
Plasmid pRW731.15 contains a 10 kbp PvuII-PvuII fragment
cloned from TROVAC genomic DNA. The nucleotide sequence was
determined on both strands for a 3661 by PvuII-EcoRV
fragment. This sequence is shown in FIG. 21. The limits of
an open reading frame designated in this laboratory as F8
were determined within this sequence. The open reading
frame is initiated at position 704 and terminates at
position 1888. In order not to interfere with neighboring
open reading frames, the deletion was made from position 781
to position 1928, as described below.
Plasmid pRW761 is a sub-clone of pRW731.15 containing a
2430 by EcoRV-EcoRV fragment. The F8 ORF was entirely
contained between an XbaI site and an SSpI site in PRW761.
In order to create an insertion plasmid which, on
recombination with TROVAC genomic DNA would eliminate the F8
ORF, the following steps were followed. Plasmid pRW761 was
completely digested with XbaI and partially digested with
SSDI. A 3700 by XbaI-SSDI band was isolated and ligated
~'O 92/15672 ~ ~ ~ J ~'~ '~ PCT/US92/01906
-167-
with the annealed double-stranded oligonucleotides JCA017
(SEQ ID N0:191) and JCA018 (SEQ ID N0:192).
JCA017 (SEQ ID N0:191) 5' CTAGACACTTTATGTTTTTTAATATCCGGTCTT
AAAAGCTTCCCGGGGATCCTTATACGGGGAATAAT 3'
JCA018 (SEQ ID N0:192) 5' ATTATTCCCCGTATAAGGATCCCCCGGGAA
GCTTTTAAGACCGGATATTAAAAAACATAAAGTGT 3'
The plasmid resulting from this ligation was designated
pJCA002. Plasmid pJCA004 contains a non-pertinent gene
linked to the vaccinia virus H6 promoter in plasmid pJCA002.
The sequence of the vaccinia virus H6 promoter has been
previously described (Taylor et al., 1988a, b; Guo et al.
1989; Perkus et al., 1989). Plasmid pJCA004 was digested
with EcoRV and BamHI which deletes the non-pertinent gene
and a portion of the 3' end of the H6 promoter. Annealed
oligonucleotides RW178 (SEQ ID N0:193) and RW179 (SEQ ID
N0:194) were cut with EcoRV and BamHI and inserted between
the EcoRV and BamHI sites of JCA004 to form pRW846.
RW178 (SEQ ID ND:193): 5' TCATTATCGCGATATCCGTGTTAACTAGCTA
GCTAATTTTTATTCCCGGGATCCTTATCA 3'
RW179 (SEQ ID N0:194): 5' GTATAAGGATCCCGGGAATAAAAATTAGCT
AGCTAGTTAACACGGATATCGCGATAATGA 3'
Plasmid pRW846 therefore contains the H6 promoter 5' of
EcoRV in the de-ORFed F8 locus. The HincII site 3' of the
H6 promoter in pRW846 is followed by translation stop
codons, a transcriptional stop sequence recognized by
vaccinia virus early promoters (Yuen et al., 1987) and a
SmaI site.
Construction of Fowlpox Insertion Plasmid at F7 Locus.
The original F7 non-de-ORFed insertion plasmid, pRW731.13,
contained a 5.5 kb FP genomic PvuII fragment in the PvuII
site of pUC9. The insertion site was a unique HincII site
within these sequences. The nucleotide sequence shown in
FIG. 22 was determined for a 2356 by region encompassing the
unique HincII site. Analysis of this sequence revealed that
the unique HincII site (FIG. 22, underlined) was situated
within an ORF encoding a polypeptide of 90 amino acids. The
ORF begins with an ATG at position 1531 and terminates at
' position 898 (positions marked by arrows in FIG. 22).
WO 92/1672
PCT/US92/01906
-168-
The arms for the de-ORFed insertion plasmid were
derived by PCR using pRW731.13 as template. A 596 by arm
(designated as HB) corresponding to the region upstream from
the ORF was amplified with oligonucleotides F73PH2 (SEQ ID
N0:195) (5'-GACAATCTAAGTCCTATATTAGAC-3') and F73PB (SEQ ID
N0:196) (5'-GGATTTTTAGGTAGACAC-3'). A 270 by arm
(designated as EH) corresponding to the region downstream
from the ORF was amplified using oligonucleotides F75PE (SEQ
ID N0:197) (5'-TCATCGTCTTCATCATCG-3') and F73PH1 (SEQ ID
N0:198) (5'-GTCTTAAACTTATTGTAAGGGTATACCTG-3').
Fragment EH was digested with EcoRV to generate a 126
by fragment. The EcoRV site is at the 3'-end and the 5'-end
was formed, by PCR, to contain the 3' end of a HincII site.
This fragment was inserted into pBS-SK (Stratagene, La
Jolla, CA) digested with HincII to form plasmid pF7Dl. The
sequence was confirmed by dideoxynucleotide sequence
analysis. The plasmid pF7D1 was linearized with ApaI,
blunt-ended using T4 DNA polymerase, and ligated to the 596
by HB fragment. The resultant plasmid was designated as
pF7D2. The entire sequence and orientation were confirmed
by nucleotide sequence analysis.
The plasmid pF7D2 was digested with EcoRV and BalII to
generate a 600 by fragment. This fragment was inserted into
pBS-SK that was digested with A_pal, blunt-ended with T4 DNA
polymerase, and subsequently digested with BamHI. The
resultant plasmid was designated as pF7D3. This plasmid
contains an HB arm of 404 by and a EH arm of 126 bp.
The plasmid pF7D3 was linearized with XhoI and blunt-
ended with the Klenow fragment of the E. coli DNA polymerase
in the presence of 2mM dNTPs. This linearized plasmid was
ligated with annealed oligonucleotides F7MCSB (SEQ ID
N0:199) (5'-AACGATTAGTTAGTTACTAAAAGCTTGCTGCAGCCCGGGTTT
~TTTATTAGTTTAGTTAGTC-3') and F7MCSA (SEQ ID N0:200) (5'-
GACTAACTAACTAATAAAAAACCCGGGCTGCAGCAAGCTTTTTGTAACTAACTAA
TCGTT-3'). This was performed to insert a multiple cloning
region containing the restriction sites for HindIII, PstI
and SmaI between the EH and HB arms. The resultant plasmid
was designated as pF7D0.
WO 92/15672 J ~ ~ ~ PCT/US92/01906
-169-
Construction of Insertion Plasmid for the H4
HemacrQlutinin at the F8 Locus. A cDNA copy encoding the
avian influenza H4 derived from A/Ty/Min/833/80 was obtained
from Dr. R. Webster in plasmid pTM4H833. The plasmid was
digested with HindIII and NruI and blunt-ended using the
Klenow fragment of DNA polymerase in the presence of dNTPs.
The blunt-ended 2.5 kbp HindIII-NruI fragment containing the
H4 coding region was inserted into the HincII site of pIBI25
(International Biotechnologies, Inc., New Haven, CT). The
resulting plasmid pRW828 was partially cut with BanII, the
linear product isolated and recut with HindIII. Plasmid
pRW828 now with a 100 by HindIII-BanII deletion was used as
a vector for the synthetic oligonucleotides RW152 (SEQ ID
N0:201) and RW153 (SEQ ID N0:202). These oligonucleotides
represent the 3' portion of the H6 promoter from the EcoRV
site and align the ATG of the promoter with the ATG of the
H4 cDNA.
RW 152 (SEQ ID N0:201): 5' GCACGGAACAAAGCTTATCGCGATATCCGTTA
AGTTTGTATCGTAATGCTATCAATCACGATTCTGT.
TCCTGCTCATAGCAGAGGGCTCATCTCAGAAT 3'
. RW 153 (SEQ ID N0:202): 5' ATTCTGAGATGAGCCCTCTGCTATGAGCAGGA
ACAGAATCGTGATTGATAGCATTACGATACAAACT
TAACGGATATCGCGATAAGCTTTGTTCCGTGC 3'
The oligonucleotides were annealed, cut with BanII and
HindIII and inserted into the HindIII-BanII deleted pRW828
vector described above. The resulting plasmid pRW844 was
cut with EcoRV and DraI and the 1.7 kbp fragment containing
the 3' H6 promoted H4 coding sequence was inserted between
the EcoRV and HincII sites of pRW846 (described previously)
forming plasmid pRW848. Plasmid pRW848 therefore contains
the H4 coding sequence linked to the vaccinia virus H6
promoter in the de-ORFed F8 locus of fowlpox virus.
Construction of Insertion Plasmid for H5 Hemaq_ctlutinin
at the F8 Locus. A cDNA clone of avian influenza H5 derived
from A/Turkey/Ireland/1378/83 was received in plasmid pTH29
from Dr. R. Webster. Synthetic oligonucleotides RW10 (SEQ
ID N0:203) through RW13 (SEQ ID N0:206) were designed to
overlap the translation initiation codon of the previously
described vaccinia virus H6 promoter with the ATG of the H5
V1-'O 92/ I X672
PCT/US92/01906
-170- _
gene. The sequence continues through the 5' SalI site of
the H5 gene and begins again at the 3' H5 DraI site
containing the H5 stop codon.
RW10 (SEQ ID N0:203): 5' GAAAAATTTAAAGTCGACCTGTTTTGTTGAGT
TGTTTGCGTGGTAACCAATGCAAATCTGGTC
ACT 3'
RW11 (SEQ ID N0:204): 5' TCTAGCAA6ACTGACTATTGCAAAAAGAAGCA
CTATTTCCTCCATTACGATACAAACTTAACG
GAT 3'
RW12 (SEQ ID N0:205): 5' ATCCGTTAAGTTTGTATCGTAATGGAGGAAA
TAGTGCTTCTTTTTGCAATAGTCAGTCTTGCTAGA
AGTGACCAGATTTGCATTGGT 3'
RW13 (SEQ ID N0:206): 5' TACCACGCAAACAACTCAACAAAACAGGTCG
ACTTTAAATTTTTCTGCA 3'
The oligonucleotides were annealed at 95°C for three
minutes followed by slow cooling at room temperature. This
results in the following double strand structure with the
indicated ends.
EcoRV PstI
RW12 a RW13
RW11 i RW10
Cloning of oligonucleotides between the EcoRV and PstI
sites of pRW742B resulted in pRW744. Plasmid pRW742B
contains the vaccinia virus H6 promoter linked to a non-
pertinent gene inserted at the HincII site of pRW731.15
described previously. Digestion with PstI and EcoRV
eliminates the non-pertinent gene and the 3'-end of the H6
promoter. Plasmid pRW744 now contains the 3' portion of the
H6 promoter overlapping the ATG of avian influenza H5. The
plasmid also contains the H5 sequence through the 5' SalI
site and the 3' sequence from the H5 stop codon (containing
a DraI site). Use of the DraI site removes the H5 3' non-
coding end. The oligonucleotides add a transcription
termination signal recognized by early vaccinia virus RNA
polymerase (Yuen et al., 1987). To complete the H6 promoted
H5 construct, the H5 coding region was isolated as a 1.6 kpb
SalI-DraI fragment from pTH29. Plasmid pRWT44 was partially
digested with DraI, the linear fragment isolated, recut with
VVO 92/15672
~ ~ j ~ ~ ~ PCT/LS92/01906
-171-
SalI and the plasmid now with eight bases deleted between
SalI~and DraI was used as a vector for the 1.6 kpb pTH29
SalI and DraI fragment. The resulting plasmid pRW759 was
cut with EcoRV and DraI. The 1.7 kbp PRW759 EcoRV-DraI
fragment containing the 3' H6 promoter and the H5 gene was
inserted between the EcoRV and HincII sites of pRW846
(previously described). The resulting plasmid pRW849
contains the H6 promoted avian influenza virus H5 gene in
the de-ORFed F8 locus.
Construction of Insertion Vector for H7 Hema lutinin
at the F7 Locus. Plasmid pCVH71 containing the H7
hemagglutinin from A/CK/VIC/1/85 was received from Dr. R.
Webster. An EcoRI-BamHI fragment containing the H7 gene was
blunt-ended with the Klenow fragment of DNA polymerase and
inserted into the HincII site of pIBI25 as PRW827.
Synthetic oligonucleotides RW165 (SEQ ID N0:207) and RW166
(SEQ ID N0:208) were annealed, cut with HincII and SCI and
inserted between the EcoRV and Styl sites of pRW827 to
generate pRW845. '
RW165 (SEQ ID N0:207): 5' GTACAGGTCGACAAGCTTCCCGGGTATCGCG
ATATCCGTTAAGTTTGTATCGTAATGAATACTCAA
ATTCTAATACTCACTCTTGTGGCAGCCATTCACAC
AAATGCAGACAAAATCTGCCTTGGACATCAT 3'
RW166 (SEQ ID N0:208): 5' ATGATGTCCAAGGCAGATTTTGTCTGCATTTG
TGTGAATGGCTGCCACAAGAGTGAGTATTAGAATT
TGAGTATTCATTACGATACAAACTTAACGGATATC
GCGATACCCGGGAAGCTTGTCGACCTGTAC 3'
Oligonucleotides RW165 (SEQ ID N0:207) and RW166 (SEQ
ID N0:208) link the 3' portion of the H6 promoter to the H7
gene. The 3' non-coding end of the H7 gene was removed by
isolating the linear product of an A~aLI digestion of
pRW845, recutting it with EcoRI, isolating the largest
fragment and annealing with synthetic oligonucleotides RW227
(SEQ ID N0:209) and RW228 (SEQ ID N0:210). The resulting
plasmid was pRW854.
RW227 (SEQ ID N0:209): 5' ATAACATGCGGTGCACCATTTGTATAT
AAGTTAACGAATTCCAAGTCAAGC 3'
RW228 (SEQ ID N0:210): 5' GCTTGACTTGGAATTCGTTAACTTATA
TACAAATGGTGCACCGCATGTTAT 3' '
WO 92/15672
PCT/US92/01906 ~~;,_;~
-172-
The stop codon of H7 in PRW854 is followed by an HpaI site.
The-intermediate H6 promoted H7 construct in the de-ORFed F7
locus (described below) was generated by moving the pRW854
EcoRV-Hpal fragment into pRW858 which had been cut with
EcoRV and blunt-ended at its PstI site. Plasmid pRW858
(described below) contains the H6 promoter in an F7 de-ORFed
insertion plasmid.
The plasmid pRW858 was constructed by insertion of an
850 by SmaI/Hpal fragment, containing the H6 promoter linked
to a non-pertinent gene, into the SmaI site of pF7D0
described previously. The non-pertinent sequences were
excised by digestion of pRW858 with EcoRV (site 24 by
upstream of the 3'-end of the H6 promoter) and PstI. The
3.5 kb resultant fragment was isolated and blunt-ended using
the Klenow fragment of the E. coli DNA polymerase in the
presence of 2mM dNTPs. This blunt-ended fragment was
ligated to a 1700 by EcoRV/H~?aI fragment derived from pRW854
(described previously). This EcoRV/Ht?aI fragment contains
the entire AIV HA (H7) gene juxtaposed 3' to the 3'-most 24
by of the VV H6 promoter. The resultant plasmid was
designated pRW861.
The 126 by EH arm (defined previously) was lengthened
in pRW861 to increase the recombination frequency with
genomic TROVAC DNA. To accomplish this, a 575 by AccI/SnaBI
fragment was derived from pRW 731.13 (defined previously).
The fragment was isolated and inserted between the AccI and
NaeI sites of pRW861. The resultant plasmid, containing an
EH arm of 725 by and a HB arm of 404 by flanking the AIV H7
gene, was designated as pRW869. Plasmid pRW869 therefore
consists of the H7 coding sequence linked at its 5' end to
the vaccinia virus H6 promoter. The left flanking arm
consists of 404 by of TROVAC sequence and the right flanking
arm of 725 by of TROVAC sequence which directs insertion to
the de-ORFed F7 locus.
Development of TROVAC-Avian Influenza Virus
Recombinants. Insertion plasmids containing the avian
influenza virus HA coding sequences were individually
transfected into TROVAC infected primary CEF cells by using
the calcium phosphate precipitation method previously
W.n 92/ 1 X672
PCT/US92/01906
-173-
described (Panicali et al., 1982; Piccini et al., 1987).
Positive plaques were selected on the basis of hybridization
to HA specific radiolabelled probes and subjected to
- sequential rounds of plaque purification until a pure
population was achieved. One representative plaque was then
amplified to produce a stock virus. Plasmid pRW849 was used
in an in vitro recombination test to produce recombinant
TROVAC-AIHS (vFP89) expressing the H5 hemagglutinin.
Plasmid pRW848 was used to produce recombinant TROVAC-AIH4
(vFP92) expressing the H4 hemagglutinin. Plasmid pRW869 was
used to produce recombinant TROVAC-AIH7 (vFP100) expressing
the H7 hemagglutinin.
Immunofluorescence. In influenza virus infectedlcells,
the HA molecule is synthesized and glycosylated as a
precursor molecule at the rough endoplasmic reticulum.
During passage to the plasma membrane it undergoes extensive
post-translational modification culminating in proteolytic
cleavage into the disulphide linked HAl and HA2 subunits and,
insertion into the host cell membrane where it is
subsequently incorporated into mature viral envelopes. To
determine whether the HA molecules produced in cells
infected with the TROVAC-AIV recombinant viruses were
expressed ~on the cell surface, immunofluorescence studies
were performed. Indirect immunofluorescence was performed
as described (Taylor et al., 1990). Surface expression of
the H5 hemagglutinin in TROVAC-AIH5, H4 hemagglutinin in
TROVAC-AIH4 and H7 hemagglutinin in TROVAC-AIH7 was
confirmed by indirect immunofluorescence. Expression of the
H5 hemagglutinin was detected using a pool of monoclonal
antibodies specific for the H5HA. Expression of the H4HA
was analyzed using a goat monospecific anti-H4 serum.
Expression of the H7HA was analyzed using a H7 specific
monoclonal antibody preparation.
Immunoprecipitation. It has been determined that the
sequence at and around the cleavage site of the
hemagglutinin molecule plays an important role in
determining viral virulence since cleavage of the
hemagglutinin polypeptide is necessary for virus particles
to be infectious. The hemagglutinin proteins of the
WO 92/ 1 X672
PCT/US92/01906
-174-
virulent H5 and H7 viruses possess more than one basic amino
acid at the carboxy terminus of HA1. It is thought that
this allows cellular proteases which recognize a series of
basic amino acids to cleave the hemagglutinin and allow the
infectious virus to spread both in vitro and in vivo. The
hemagglutinin molecules of H4 avirulent strains are not
cleaved in tissue culture unless exogenous trypsin is added.
In order to determine that the hemagglutinin molecules
expressed by the TROVAC recombinants were authentically
processed, immunoprecipitation experiments were performed as
described (Taylor et al., 1990) using the specific reagents
described above.
Immunoprecipitation analysis of the H5 hemagglutinin
expressed by TROVAC-AIHS (vFP89) showed that the
glycoprotein is evident as the two cleavage products HA1 and
HA2 with approximate molecular weights of 44 and 23 kDa,
respectively. No such proteins were precipitated from
uninfected cells or cells infected with parental TROVAC.
Similarly immunoprecipitation analysis of the hemagglutinin
expressed by TROVAC-AIH7 (vFP100) showed specific
precipitation of the HA2 cleavage product. The HAl cleavage
product was not recognized. No proteins were specifically
precipitated from uninfected CEF cells or TROVAC infected
CEF cells. In contrast, immunoprecipitation analysis of the
expression product of TROVAC-AIH4 (vFP92) showed expression
of only the precursor protein HAo. This is in agreement
with the lack of cleavage of the hemagglutinins of avirulent
subtypes in tissue culture. No H4 specific proteins were
detected in uninfected CEF cells or cells infected with
TROVAC.
Euam~le 23 - DEVELOPMENT OF A TRIPLE RECOMBINANT
EXPRESSING THREE AVIAN INFLUENZA GENES
Plasmid Construction. Plasmid pRW849 has been
discussed previously and contains the H6 promoted avian
influenza H5 gene. This plasmid was used for the
development of vFP89. Plasmid pRW861 was an intermediate
plasmid, described previously used in the development of
vFP100. The plasmid contains the H6 promoted avian
influenza H7 gene. Plasmid pRW849 was digested with SmaI
WO 92/1672
PCT/US92/01906
-175-
and the resulting 1.9 kbp fragment from the 5' end of the H6
promoter through the H5 gene was inserted at the SmaI site
of pRW861 to produce pRW865. In order to insert the H4
coding sequence, plasmid pRW848 was utilized. Plasmid
pRW848 was used in the development of vFP92 and contains the
H6 promoted H4 gene (previously described). Plasmid pRW848
was digested with SmaI and a 1.9 kbp fragment containing the
H6 promoted H4 coding sequence was then inserted into pRW865
at the SmaI site 5' of the H6 promoted H5 sequence. The
resulting plasmid pRW872 therefore contains the H4, H5 and
H7 coding sequences in the F7 de-ORFed insertion plasmid.
In order to direct insertion of the genes to the de-
ORFed F8 locus, pRW872 was partially digested with SmaI, the
linear fragment isolated and recut with HindIII. The 5.7
kbp SmaI to HindIII pRW872 fragment containing all three H6
promoted avian influenza genes was blunt-ended and inserted
into pCEN100 which had been cut with HincII. Plasmid
pCEN100 is a de-ORFed F8 insertion vector containing
transcription and translation stop signals and multiple
insertion sites. Plasmid pCEN100 was generated as described
below. Synthetic oligonucleotides CE205 (SEQ ID N0:211) and
CE206 (SEQ ID N0:212) were annealed, phosphorylated and
inserted into the BamHI and HindIII sites of pJCA002
(previously described) to form pCE72. A BalII to EcoRI
fragment from pCE72 was inserted into the BalII and EcoRI
sites of pJCA021 to form pCEN100.
CE205 (SEQ ID N0:211): 5' GATCAGAAAAACTAGCTAGCTAGTACGTAGTT
AACGTCGACCTGCAGAAGCTTCTAGCTAGCTAGTT
TTTAT 3'
CE206 (SEQ ID N0:212): 5' AGCTATAAAAACTAGCTAGCTAGAAGCTTCTG
CAGGTCGACGTTAACTACGTACTAGCTAGCTAGTT
TTTCT 3'
Plasmid pJCA021 was obtained by inserting a 4900 by PvuII-
HindII fragment from pRW731-15 (previously described) into
the SmaI and HindII sites of pBSSKT.
The final insertion plasmid pRW874 had the three avian
influenza HA genes transcribed in the same direction as the
deleted F8 ORF. The left flanking arm of the plasmid
adjacent to the H4 gene consisted of 2350 by of fowlpox
WO 92/1672
2'~'~ PCT/US92/01906
-176-
sequence. The right flanking arm adjacent to the H7 gene
consisted of 1700 by of fowlpox sequence. A linear
representation of the plasmid is shown below.
2350bp FP H6 H4HA H6 HSHA H6 H7HA 170obn Fp
Develot~ment of Recombinant vFP122. Plasmid pRW874 was
transfected into TROVAC infected primary CEF cells by using
the calcium phosphate precipitation method previously
described (Panicali et al., 1982; Piccini et al., 1987).
Positive plaques were selected on the basis of hybridization
to specific H4, H5 and H7 radiolabelled probes and subjected
to 5 sequential rounds of plaque purification until a pure
population was achieved. Surface expression of all three
glycoproteins was confirmed by plaque immunoscreen using
specific reagents previously described. Stability of
inserted genes was confirmed after two rounds of
amplification and the recombinant was designated as vFP122.
Example 24 - COMPARI80N OF THE LDS~ OF ALVAC AND NYVAC
Mice. Male outbred Swiss Webster mice were purchased
from Taconic Farms (Germantown, NY) and maintained on mouse
chow and water ad libitum until use at 3 weeks of age
("normal" mice). Newborn outbred Swiss Webster mice were of
both sexes and were obtained following timed pregnancies
performed by Taconic Farms. All newborn mice used were
delivered within a two day period.
Viruses. ALVAC was derived by plague purification of a
canarypox virus population and was prepared in primary chick
embryo fibroblast cells (CEF). Following purification by
centrifugation over sucrose density gradients, ALVAC was
enumerated for plaque forming units in CEF cells. The WR(L)
variant of vaccinia virus was derived by selection of large
plaque phenotypes of WR (Panicali et al., 1981). The Wyeth
New York State Board of Health vaccine strain of vaccinia
virus was obtained from Pharmaceuticals Calf Lymph Type
vaccine Dryvax, control number 302001B. Copenhagen strain
vaccinia virus VC-2 was obtained from Institut Merieux,
France. Vaccinia virus strain NYVAC was derived from
~'O 92/15672
j ~ ~ ~ PCT/US92/0 ~ 906
-177-
Copenhagen VC-2. All vaccinia virus strains except the
Wyeth strain were cultivated in Vero African green monkey
kidney cells, purified by sucrose gradient density
centrifugation and enumerated for plaque forming units on
Vero cells. The Wyeth strain was grown in CEF cells and
enumerated in CEF cells.
Inoculations. Groups of 10 normal mice were inoculated
intracranially (ic) with 0.05 ml of one of several dilutions
of virus prepared by 10-fold serially diluting the stock
preparations in sterile phosphate-buffered saline. In some
instances, undiluted stock virus preparation was used for
inoculation.
Groups of 10 newborn mice, 1 to 2 days old, were
inoculated is similarly to the normal mice except that an
injection volume of 0.03 ml was used.
All mice were observed daily for mortality for a period
of 14 days (newborn mice) or 21 days (normal mice) after
inoculation. Mice found dead the morning following
inoculation were excluded due to potential death by trauma.
The lethal dose required to produce mortality for 50%
of the experimental population (LDSO) was determined by the
proportional method of Reed and Muench.
Comparison of the LDSO of ALVAC and NYVAC with Various
Vaccinia Virus Strains for Normal Youn Outbred Mice b the
is Route. In young, normal mice, the virulence of NYVAC and
ALVAC were several orders of magnitude lower than the other
vaccinia virus strains tested (Table 28). NYVAC and ALVAC
were found to be over 3,000 times less virulent in normal
mice than the Wyeth strain; over 12,500 times less virulent
than the parental VC-2 strain; and over 63,000,000 times
less virulent than the WR(L) variant. These results would
suggest that NYVAC is highly attenuated compared to other
.vaccinia strains, and that ALVAC is generally nonvirulent
for young mice when administered intracranially, although
both may cause mortality in mice at extremely high doses
(3.85x108 PFUs, ALVAC and 3x108 PFUs, NYVAC) by an
undetermined mechanism by this route of inoculation.
Comparison of the LDS,o of ALVAC and NYVAC with Various
Vaccinia Virus Strains for Newborn Outbred Mice by the is
WO 92/15672 ~ ~~ ~ ~ PCT/LS92/01906
-178-
Route. The relative virulence of 5 poxvirus strains for
normal, newborn mice was tested by titration in an
intracranial (ic) challenge model system (Table 29). With
mortality as the endpoint, LDS~ values indicated that ALVAC
is over 100,000 times less virulent than the Wyeth vaccine
strain of vaccinia virus; over 200,000 times less virulent
than the Copenhagen VC-2 strain of vaccinia virus; and over
25,000,000 times less virulent than the.WR-L variant of
vaccinia virus. Nonetheless, at the highest dose tested,
6.3x10 PFUs, 100% mortality resulted. Mortality rates of
33.3% were observed at 6.3x106 PFUs. The cause of death,
while not actually determined, was not likely of
toxicological or traumatic nature since the mean survival
time (MST), of mice of the highest dosage group
(approximately 6.3 LD5o) was 6.7 ~ 1.5 days. When compared
to WR(L) at a challenge dose of 5 LDSO, wherein MST is 4.8 ~
0.6 days, the MST of ALVAC challenged mice was significantly
longer (P=0.001).
Relative to NYVAC, Wyeth was found to be over 15,000
times more virulent; VC-2, greater than 35,000 times more
virulent; and WR(L), over 3,000,000 times more virulent.
Similar to ALVAC, the two highest doses of NYVAC, 6x108 and
6x10 PFUs, caused 100% mortality. However, the MST of mice
challenged with the highest dose, corresponding to 380 LDSO,
was only 2 days (9 deaths on day 2 and 1 on day 4). In
contrast, all mice challenged with the highest dose of WR-L,
equivalent to 500 LDSO, survived to day 4.
VVO 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/O1906
::a::,
-179-
Table 28. Calculated 50% Lethal
Dose for mice by
various vaccinia
virus strains and for
canarypox virus
(ALVAC) by the is
route.
POXVIRUS CALCULATED
STRAIN LDSO (PFUs)
WR(L) 2.5
VC-2 1.26x104
WYETH 5.00x104
NYVAC 1.58x108
ALVAC 1.58x108
i
Table 29. Calculated 50% Lethal
Dose for newborn mice
by various vaccinia
virus strains and for
canarypox virus
(ALVAC) by the is
route.
POXVIRUS CALCULATED
STRAIN LDSO (PFUs)
WR(L) 0.4
VC-2 0.1
WYETH 1.6
NYVAC 1.58x106
ALVAC l.OOxlO~
i
Iw Jv. V v rr y
WO 92/15672 PCT/US92/01906
-180-
Example 25 - GENERATION OF NYVAC-BASED RECOMBINANTS
ERPREBSING THE EHV-1 gB, gC AND gD
GLYCOPROTEINS HOMOhOGS
Expression of the EHV-1 gB glycoprotein was
accomplished by putting the EHV-1 gB homolog gene under the
control of the vaccinia virus I3L promoter. Expression of
the EHV-1 gC glycoprotein was accomplished by putting the
EHV-1 gC homolog gene under the control of the vaccinia
virus H6 promoter. Expression of the EHV-1 gD glycoprotein
was accomplished by putting the EHV-1 gD homolog gene under
the control of the entomopox virus 42K gene promoter.
Generation of vP1025 j,_gB and gC in ATI locus; gD in HA
locus
Generation of donor plasmid gJCA042. The 430 by 5'-
most region of the EHV-1 gB coding sequence was PCR-derived
using the plasmid pJCA011 (cassette H6-EHV-1 gB in ATI
locus) as template and oligonucleotides JCA156 (SEQ ID
N0:223) (5'-ATGTCCTCTGGTTGCCGTTCT-3') and JCA157 (SEQ ID
N0:224) (5'-GACGGTGGATCCGGTAGGCGG-3'), digested with BamHI
and kinased. This 430 by fragment was fused to a 120 by
PCR-derived fragment containing the I3L promoter element
obtained using plasmid pMP691 (I3L101RAB) as template and
oligonucleotides JCA158 (SEQ ID N0:225) (5'-
TTTTTCTAGACTGCAGCCCGGGACATCATGCAGTGGTTAAAC-3') and MP287
(SEQ ID N0:226) (5'-GATTAAACCTAAATAATTGT-3'). This 120 by
fragment was digested with XbaI and kinased prior to be
ligated with the 430 by 5'-most region of EHV-1 gB fragment.
The resulting plasmid was designated pJCA034. Sequences of
the I3L promoter, of the junction I3L-ATG and of the EHV-1
5'-most region were confirmed by direct sequencing of
pJCA034. Plasmid pJCA034 was digested with SmaI and BamHI
to excise the 550 by SmaI-I3L-EHV-1 gB 5'-BamHI fragment
(A). Plasmid pMP665 (cassette H6-EHV-1 gB in COPCS system)
was digested with BamHI and XhoI to excise the 2530 by
BamHI-EHV-1 gB 3' fragment (B). Fragments A and B were then
ligated together into vector pSD541VC (ATI deorfed locus)
digested with SmaI and XhoI to produce pJCA037. Plasmid
pJCA037 is the donor plasmid containing the cassette I3L-
EHV-1 gB in the ATI deorfed locus. Plasmid pJCA037 was
digested with SmaI and XhoI to isolate the 3050 by SmaI-I3L-
WO 92/1672 ~ ,~ (j ~ ~ ~ ~ PCT/US92/01906
-181-
EHV-1 gB-XhoI fragment (C). The 225 by KpnI-EHV-1 gC 3'end
cleaned up-HindIII fragment was PCR-derived using plasmid
pVHAH6g13 (cassette H6-EHV-1 gC in HA deorfed locus) and
oligonucleotides JCA154 (SEQ ID N0:227) (5'-
TATAGCTGCATAATAGAG-3') and JCA163 (SEQ ID N0:228) (5'-
_ . AATTAAGCTTGATATCACAAAAACTAAAAAGTCAGACTTCTTG-3'), digested
with K_pnI and HindIII, and ligated into vector pBS-SK+
digested with KpnI and HindIII to produce pJCA033. Sequence
of the cloned PCR fragment was confirmed by direct
sequencing of pJCA033. Plasmid pJCA033 was digested with
KpnI and EcoRV to isolate the 220 by KpnI-EHV-1 gC 3'end-
EcoRV fragment (D). Plasmid pVHAH6g13 was digested with
BQ1II and KpnI to isolate the 1330 by BalII-H6-EHV-1 gC 5'-
K~nI fragment (E) .
Fragments C, D and E were finally ligated together into
vector pSD541VC digested with BalII and XhoI to produce
plasmid pJCA042. Plasmid pJCA042 is the donor plasmid to
insert the I3L-EHV-1 gB -- H6-EHV-1 gC double construction
in the NYVAC ATI deorfed locus. Plasmid pJCA042 was
linearized using NotI prior to IVR.
In vitro recombination experiment was performed on Vero
cells using pJCA042 as the donor plasmid and vP866 (NYVAC)
as the rescue virus. Standard protocols were used to
identify and purify the recombinant virus (Piccini et al.,
1987). The NYVAC-based recombinant containing the EHV-1 gB
and gC genes in the ATI deorfed locus was designated vP956.
Generation of Donor Plasmid ~JCA064. Plasmid
pEHVIBamHID (containing the EHV-1 BamHI D fragment) was
digested with HindIII to excise the 1240 by HindIII-HindIII
containing the entire EHV-1 gD coding sequence but the 15
5'-most bp. The 1240 by HindIII-HindIII fragment was blunt-
ended with Klenow polymerase and ligated into vector
pCOPCS657 digested with SmaI and phosphatased. The
resulting plasmid was designated pJCA006. Plasmid pJCA006
was digested with BalII and HindIII to excise the 1500 by
HindIII-H6--EHV-1 gD-BglII fragment. This fragment was
ligated into vector pIBI24 digested with BamHI and HindIII
to produce plasmid pEHV1gp50a. Plasmid pEHV1gp50a was
digested with EcoRV and NcoI which are both unique sites to
f.~ i l3 eJ i.~ i
WO 92/1672 PCT/US92/01906
-182-
excise the 4100 by fragment. This fragment was ligated with
a synthetic double strand oligonucleotide obtained by
hybridization between oligonucleotides JCA052 (SEQ ID
N0:229) (5'-ATCCGTTAAGTTTGTATCGTAATGTCTACCTTCAAGCTTATGA
TGGATGGACGTTTGGTTTTTGC-3') and JCA053 (SEQ ID N0:230) (5'-
CATGGCAAAAACCAAACGTCCATCCATCATAAGCTTGAAGGTAGACATTACGATACAAAC
TTAAGCGAT-3'). The resulting plasmid was designated '
pgp50a3-2. The 490 by EcoRI-EHV-1 gD 3'end cleaned up -HpaI
was PCR-derived using plasmid pJCA006 as template and
oligonucleotides JCA041 (SEQ ID N0:231) (5'-TGTGTGA
TGAGAGATCAG-3') and JCA099 (SEQ ID N0:232) (5'-AACTC
GAGTTAACAA.AAATTACGGAAGCTGGGTATATTTAACAT-3'). Plasmid
pgp50a3-2 was digested with EcoRI and partially digested
with HindIII to excise the 850 by HindIII-H6-EHV-1 gD 5'-
EcoRI fragment. This fragment was ligated with the 490 by
EcoRI-HpaI fragment into vector pBS-SK+ digested with
HindIII and SmaI to produce plasmid pJCA020. Plasmid
pJCA020 contains the cassette H6-EHV-1 gD.
The 720 by 5'-most region of the EHV-1 gD coding
sequence was PCR-derived using plasmid pJCA020 as template
and oligonucleotides JCA044 (SEQ ID N0:233) (5'-CTCTAT
GACCTCATCCAC-3') and JCA165 (SEQ ID N0:234) (5'-ATGTCTA
CCTTCAAGCTTATG-3'). This fragment was digested with EcoRI
and kinased. The 107 by 42K promoter element was PCR-
derived using plasmid pAMl2 as template and oligonucleotides
RG286 (SEQ ID N0:235) (5'-TTTATATTGTAATTATA-3') and JCA164
(SEQ ID N0:236) (5'-TTTGGATCCGTTAACTCAAAAAAATAAATG-3').
This fragment was digested with BamHI, kinased, and ligated
with the 720 by ATG-EHV-1 gD 5'-EcoRI fragment into vector
pBS-SK+ digested with BamHI and EcoRI to produce plasmid
pJCA035. Sequences of the 42K promoter, of the junction
42K-EHV-1 gD and of the EHV-1 gD 5' portion were confirmed
by direct sequencing of pJCA035.
Plasmid pJCA035 was digested with BamHI and EcoRI to
isolate the 830 by BamHI-42K-EHV-1 gD 5'portion-EcoRI
fragment (F). Plasmid pJCA020 was digested with EcoRI and
XbaI to isolate the 500 by EcoRI-EHV-1 gD 3'end cleaned up-
XbaI fragment (G). Fragments F and G were then ligated
together into vector pBS-SK+ digested with BamHI and XbaI to~
VVO 92/ 15672 ~ ~ ~ ~ N '~ '~ PCT/US92/01906
-183-
produce plasmid pJCA038. Plasmid pJCA038 is containing the
cassette 42K-EHV-1 gD into vector pBS-SK+. Plasmid pJCA038
was digested with BamHI and HpaI to isolate the 1340 by
HpaI-42K-EHV-1 gD-BamHI fragment. This fragment was ligated
into plasmid pSD544 (HA deorfed locus) digested with BamHI
and SmaI to produce plasmid pJCA064. Plasmid pJCA064 is the
donor plasmid to insert the cassette 42K-EHV-1 gD into the
NYVAC HA deorfed locus. Plasmid pJCA064 was linearized
using NotI prior to IVR.
In vitro experiment was performed on Vero cells using
pJCA064 as the donor plasmid and recombinant vaccinia virus
vP956 (NYVAC background) as the rescue virus. This was
performed with standard procedures (Piccini et al., 1987).
The NYVAC-based recombinant containing the EHV-1 gB and gC
genes in the ATI deorfed locus and the EHV-1 gD gene in the
HA deorfed locus was designated vP1025.
Generation of donor plasmid pJCA043. The 220 by
HindIII-EHV-1 gB 3'-most region was PCR-derived using
plasmid pJCA011 and oligonucleotides JCA159 (SEQ ID N0:237)
(5'-AGGCCAAGCTTGAAGAGGCTC-3') and JCA160 (SEQ ID N0:238)
(5'-AAAGGATCCGTTAACACAAAAATTAAACCATTTTTTCATT-3'). This
fragment was digested with BamHI and HindIII and ligated
into vector pBS-SK+ digested with BamHI and HindIII to
produce plasmid pJCA036. Sequence of the EHV-1 gB 3'-most
region PCR fragment was confirmed by direct sequencing of
pJCA036.
Plasmid pJCA033 was digested with EcoRV and KpnI to
isolate the K~nI-EHV-1 gC 3'-most region-EcoRV fragment (H).
Plasmid pJCA038 was digested with BamHI and H_~aI to isolate
the 1360 by HpaI-42K-EHV-1 gD -BamHI fragment (I). Plasmid
pVHAH6g13 was digested with KpnI and XhoI to isolate the 900
by XhoI-EHV-1 gC central portion-KpnI fragment (J).
Fragments H, L and J were then ligated together into vector
pBS-SK+ digested with BamHI and XhoI to produce plasmid
pJCA041.
Plasmid pJCA034 was digested with HindIII and XhoI to
isolate the 5900 by linearized vector XhoI-pBS-SK+-I3L-EHV-1
gB -HindIII fragment {K). Plasmid pJCA036 was digested with
BamHI and HindIII to isolate the 220 by indIII-EHV-1 gB 3--
~m;~N ~ l
VVO 92/15672 PCT/US92/01906
-184-
most region-BamHI fragment (L). Plasmid pVHAH6g13 was
digested with BQ1II and XhoI to isolate the 440 by BQ1II-H6-
EHV-1 gC 5'portion-XhoI fragment (M). Fragments K, L and M
were then ligated together to produce plasmid pJCA040.
Plasmid pJCA040 was digested with SmaI and XhoI to
isolate the 3550 by SmaI-I3L-EHV-1 gB -- H6-EHV-1 gC
5'portion-XhoI fragment (N). Plasmid pJCA041 was digested
with BamHI and XhoI to isolate the 2460 by XhoI-EHV-1 gC
3'portion -- 42K-EHV-1 gD -BamHI fragment (O). Fragments N
and O were finally ligated together into plasmid pSD541VC
(NYVAC ATI deorfed locus) digested with BalII and SmaI to
produce plasmid pJCA043. Plasmid pJCA043 is the donor
plasmid to insert the I3L-EHV-1 gB -- H6-EHV-1 gC -- 42K-
EHV-1 gD triple construction in the NYVAC ATI deorfed locus.
Plasmid pJCA043 was linearized using NotI prior to IVR.
In vitro experiment was performed on primary chick
embryo fibroblasts using pJCA043 as the donor plasmid and
vP866 (NYVAC) as the rescue virus. Standard procedures were
used to identify and purify the generated recombinant
(Piccini et al., 1987). The NYVAC-based recombinant
containing the EHV-1 gB, gC and gD genes in the ATI deorfed
locus was designated vP1043.
Example 26 - GENERATION OF ALVAC-BAKED RECOMBINANTS
EXPRESSING THE EHV-1 gB, gC AND gD
GLYCOPROTEINS HOMOLOGS
Generation of donor plasmid pJCA049. Plasmid pJCA040
was digested with SmaI and XhoI to isolate the 3550 by SmaI-
I3L-EHV-1 gB -- H6-EHV-1 gC 5'portion-XhoI fragment (A).
Plasmid pJCA041 was digested with BamHI and XhoI to isolate
the 2460 by XhoI-EHV-1 gC 3'portion -- 42K-EHV-1 gD -BamHI
fragment (B). Fragments A and B were ligated together into
plasmid pSPVQC3L digested with BamHI and SmaI to produce
plasmid pJCA049. Plasmid pJCA049 is the donor plasmid to
insert the I3L-EHV-1 gB -- H6-EHV-1 gC -- 42K-EHV-1 gD
triple construction in the ALVAC C3 deorfed locus. Plasmid
pJCA049 was linearized using NotI prior to IVR.
In vitro experiment was performed on primary chick
embryo fibroblasts using pJCA049 as the donor plasmid and
CPpp (ALVAC) as the rescue virus. Standard procedures were '
followed to identify and purify the generated recombinant
WO 92/15672 ~ i ~ j N ~ ~ PCT/US92/01906
-185- f.
(Piccini et al., 1987). The ALVAC-based recombinant
containing the EHV-1 gB, gC and gD genes in the C3 deorfed
locus was designated vCP132.
Essmple 27 - ERPRESSION ANALY8I8 OF THE NYVAC- AND ALVAC- , .
BASED EQUINE HERPESVIRUS TYPE 1 TRIPLE
RECOMBINANTS
Immunofluorescence assays were performed as described
previously (Taylor et al., 1990) using monoclonal antibodies
specific to EHV-1 gB (16G5 or 3F6), EHV-1 gC (14H7) and EHV-
1 gD (20C4). All anti-EHV-1 monoclonals were obtained from
George Allen (Department of Veterinary Science, University
of Kentucky, Lexington, Kentucky, 40546-0076). Expression
of all three EHV-1 specific products was detectable
internally in cells infected with either vP1025, vP1043 or
vCP132. Only the EHV-1 gC glycoprotein was well expressed
on the surface of infected cells. Surface expression for
EHV-1 gB glycoprotein was much weaker and surface expression
of EHV-1 gD glycoprotein was questionable.
Immunoprecipitations were done using the same
monoclonal antibodies to determine the authenticity of the
expressed EHV-1 gB, gC and gD gene products. Monoclonal 3F6
specific for EHV-1 gB glycoprotein precipitated proteins
with apparent molecular masses on an SDS-PAGE gel system of
138 kDa, 70 kDa and 54 kDa from lysates derived from cells
infected with the recombinant viruses vP956, vP1025, vP1043
or vCP132. No protein was precipitated from lysates derived
from uninfected cells or from either parental virus (NYVAC
and ALVAC) infected cells. Monoclonal 14H7 specific for
EHV-1 gC glycoprotein precipitated a glycoprotein with an
apparent molecular mass of 90 kDa from lysates derived from
cells infected either with vP956, vP1025 or vP1043. The
EHV-1 gC glycoprotein expressed by recombinant vCP132 has an
apparent molecular mass slightly smaller (about 2 kDa less)
than that expressed by recombinants vP956, vP1025 or vP1043.
Monoclonal antibody 20C4 specific for EHV-1 gD glycoprotein
precipitated a glycoprotein with an apparent molecular mass
of 55 kDa from lysates derived from cells infected with
vP1025, vP1043 or vCP132.
Immunoprecipitations were also done using a rabbit
anti-EHV-1 hyperimmune serum obtained from G. Allen. This
it ,L V v r.. i J
WO 92/15672 PCf/US92/01906
-186-
serum precipitated all three EHV-1 products from lysates
derived from cells infected either with vP1025, vP1043 or
vCPl32.
Example 28 - PROTECTION DATA OBTAINED USING THE HAMSTER
CHALLENGE MODEL
Challenge experiments (hamster model) have been done at
Rhone-Merieux (Lyon, France) to assess the relative level of
protection induced by poxvirus EHV-1 recombinants vP956,
vP1025 and vCP132. Hamsters were vaccinated on day 0 and
boosted on day 14 with various dilutions of the EHV-1
recombinants. All, immunized and control animals were
challenged on day 28 with a hamster-adapted EHV-1 challenge
strain. Final count of dead animals was made on day 35 (7
days post challenge). Results of the challenge experiment
are shown below in Table 30:
Table 30
Recombinant EHV-1 genes Dose TCID50 loglo /dead/total
vP956 gB + gC 7.6 5.6 3.6
0/4 3/4 2/4
vP1025 gB + gC + gD 7.8 5.8 3.8
2/4 3/4 3/4
vCP132 gB + gC + gD 8.8 6.8 4.8
0/4 0/4 2/4
Control none 4/4
F
WO 92/1672 ' ~ ' '1 PCT/US92/01906
~ll~~ ~~~
-187-
Example 29 - DURATION OF IMMUNITY BTUDIE8 IN DOGS
The aim of this study was to determine how long a
protective immune response would be maintained in dogs after
a single inoculation with ALVAC-RG (vCP65). Forty-one
beagle dogs of 8 months of age which were free of anti-
rabies antibody were inoculated with one dose of 6.7 loglo
TCIDSO of ALVAC-RG by the subcutaneous route. Dogs were
bled on day 0 and at 1, 2, 3, 6 and 12 months after
vaccination and sera assayed for the presence of anti-rabies
antibody using the RFFI test. All animals were monitored
for side-effects of vaccination.
At 6 months post-vaccination, 5 dogs were challenged by
intra-muscular inoculation of the virulent NYGS strain of
rabies virus. Animals received 103-4 50~ mouse lethal doses
in the temporal muscle. Three uninoculated control animals
received the same inoculation. A second group of 11
vaccinated dogs and 3 non-vaccinated control dogs were
challenged in an identical manner at 12 months post-
vaccination. The serological results and results of
challenge at 6 and 12 months are shown below in Table 31.
None of the dogs vaccinated with ALVAC-RG (vCP65)
exhibited adverse reaction to vaccination. All dogs
vaccinated with ALVAC-RG (vCP65) demonstrated the induction
of rabies virus neutralizing antibody by 7 days post-
vaccination. Maximal titers were achieved between 14 and 28
days post-vaccination after which titers decreased. At the
time of challenge at 6 or 12 months post-vaccination titers
were low and in some animals, approaching zero. Despite the
low titers, all animals survived a lethal rabies challenge
in which unvaccinated control dogs succumbed. RFFI titers
of animals that survived challenge at 6 months post-
vaccination were assessed at 8 months (2 months post-
.challenge). The serum titers in these animals were 7.4,
7.4, 2.3, 1.8 and 7.4. International Units. These elevated
and maintained levels of rabies neutralizing antibody
indicate that animals were efficiently primed by the initial
single inoculation. The experiment is on-going and the
remaining animals will be challenged at 2 or 3 years
following vaccination; however, to date, the experiment is
~ltl~E:. E
V1'O 92/1672 PCT/US92/01906
-188-
successful and illustrates the utility of the present
invention.
__--_
__
----__-_
V1'O 92/1672 PCT/US92/01906 . -____._
~~~i~~7~
-189-
.. O
,..,i vo sr
p n
H N ri
v~v
V '''i c~ tn p p p p cn v1 tl~ v~ tn c~
O cn t~1 c~ tl~ cn try v~
a
~o
N
0
3
b
ro C
O
enc~ow~co nnn ownnmnuwnoowNm
U ~ b N
,C
N N tC1 O O O O r-1 O O .-~ .-~1
b ~ ri e1 f"'f e-1 r-1
~ . . . . r1
o a V 00000 000 00000000000
O
O ~
N
'a
ri
-rl
~
ro
>,
N
a~
~ +~ a0
t~ ~ ~ N
lC
H
nny vne~oowowncwn~
O ~~~
'
~
~b o ~ro~r ~r~nnv~ne~,.a.n~ro,
. '~
o
. . . .
.
. . . . . . . .
O ~ n~rnoon 00o nneno,nooN~~ro
O
O
~
b
U E
W
Ow H
_
O ~ ~ ' O n 01 N CO N
N N
et et tf7 st
U OWf1 ~ '
N N
01 01 C1 N C1 N
O cx b~ ~ E-~ > > .r w f N r-1 H et ~-1
m 3 3
c0 > > > 3 > 3 3 > >
O W N C7 ~' cx >
!f) n
C~ 01 e-1 e'~'1 N t'1 eT
v a xxxxx 01 ri CO 00 n r-1 O~
~
~~, xxxxxxxxxxz
an
pa
0
C9
O U CG
~
O U > U
a
E H O
x
UBSTITUTE
SHEET
WO 92/15672
PCC/US92/01906
-190-
d
N
a
0
0
0
w ni
o +~
a
a~ o
N
i~
a
b
~. r. ~ Q
... ~
r-1 et c~
Q et "~ a!
ri ri
ri
"
... w.
~ D C7 3
~
N ~, U
~ D ~ ~
~
-. O
C C
~
'~ .
-.i
a
U
~
?
c
~ + '"
w
o ' o
V ~
N ' "i ~n tc1 O
~n p
b o 0 o ' H
'o N
' m
V o00 a
'
a o o> o
'A
~ ~ r
' N
o ~ a~
r/ (~ N
-rl
~J ri 1D
.A
a
v w
N
s~ ~ o
aw
N 1p ~
N ~
~r
et 01
et
wn ~
xa
. . .
~ o00
w
~z
a~ ~ .:
a ~ a
U U rt!
O T3
fx a, ~ D ~c1 .p
p ~ 'a' m ~ c!
I~ !
x~z ~ ~ ' ~
m
,o . o
~' a
~
a
U
O A D
C
O
.. .. .. ..
A .Q ~ ~
SI:~STITUTE SHEET
_____
~1'O 92/15672 PCT/US92/01906
-191-
Example 30 - EgPRE88ION OF BOVINE HERPEBVIRUB TYPE 1 BHV1
GENES IN NYVAC
Generation of NYVAC_JBHV1 gIV recombinant. A plasmid,
pBHVgIV, was obtained from Rhone Merieux. This plasmid
contains the BHV1 gIV gene (Straub strain), encoded on a 3.9
kb PstI fragment, cloned into the PstI site of pBS-SK+. The
gIV gene (Tikoo et al., J. Virol. (1990) 6:5132) from this
plasmid was cloned between vaccinia virus flanking arms.
This was accomplished by cloning the 2,000 by PstI-XhoI
fragment of pBHVgIV, containing the gIV gene, into the PstI-
XhoI site of pSD542 (defined in Example 32). The plasmid
generated by this manipulation is called pBHVl.
The 3'-end of the n promoter was then cloned upstream
of the gIV gene. This was accomplished by cloning the
oligonucleotides, BHVL7 (SEQ ID N0:239) (5'-TCGAGCTTAA
GTCTTATTAATATGCAAGGGCCGACATTGGCCGTGCTGGGCGCGCTGCTCGCCGTTGCGG
TGAGCTTGCCTACACCCGCGCCGC-3') and BHVL8 (SEQ ID N0:240)
(5'-GGCGCGGGTGTAGGCAAGCTCACCGCAACGGCGAGCAGCGCGCCCAGCAC
GGCCAATGTCGGCCCTTGCATATTAATAAGACTTAAGC-3'), encoding the 3'-
end of the n promoter and the 5'-end of the gIV gene, into
the 5,500 by partial SstII-XhoI fragment of pBHVl. The
plasmid generated by this manipulation is called pBHV3.
Extraneous 3'-noncoding sequence was then eliminated.
This was accomplished by cloning the oligonucleotides, BHVL5
(SEQ ID N0:241) (5'-GGGTGACTGCA-3') and BHVL6 (SEQ ID
N0:242) (5'-GTCACCC-3'), into the 5,200 by partial SmaI-PstI
fragment of pBHV3. The plasmid generated by this
manipulation is called pBHV4.
Extraneous linker sequence was then eliminated. This
was accomplished by ligating the 5,200 by PstI fragment of
pBHV4. The plasmid generated by this manipulation is called
pBHVS.
The 5'-end of the n promoter was then cloned into
pBHV5. This was accomplished by cloning the 130 by AflII-
XhoI fragment of pPI4, containing the 5'-end of the rr
promoter, into the 5,200 by AflII-XhoI fragment of pBHV5.
The plasmid generated by this manipulation is called pBHV6.
pBHV6 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1051.
VVO 92/1567?
PCT/US92/01906
-192-
Immunoprecipitation analysis was performed to determine
whether vP1051 expresses an authentic BHV1 gIV glycoprotein.
Vero cell monolayers were either mock infected, infected
with NYVAC or infected with vP1051 at an m.o.i. of 10
PFU/cell. Following an hour~adsorption period, the inoculum
was aspirated and the cells were overlayed with 2 mls of
modified Eagle's medium (minus methionine) containing 2%
fetal bovine serum and [35S]-methionine (20 ~Ci/ml). Cells
were harvested at 7 hrs post-infection by the addition of 1
ml 3X buffer A (3% NP-40, 30mM Tris (pH7.4), 3mM EDTA, 0.03%
Na Azide and 0.6 mg/ml PMSF) and 50 mls aprotinin, with
subsequent scraping of the cell monolayers.
Lysates were then analyzed for BHV1 gIV expression
using the BHV1 gIV-specific monoclonal antibody, 3402
(obtained from Dr. Geoffrey Letchworth, U. of Wisconsin,
Madison, WI). This was accomplished by the following
procedure: rat anti-mouse sera was bound to protein-A
sepharose at room temperature for 4 hours. After washing
the material 5X with 1X buffer A, the protein A-sepharose
bound rat anti-mouse antibody was bound to the gIV-specific
monoclonal antibody, 3402. The lysates, meanwhile, were
precleared by incubating normal mouse sera and the protein
A-sepharose bound rat anti-mouse antibody overnight at 4°C.
After washing this material 5X with 1X buffer A, the BHV1
gIV-specific monoclonal antibody, rat anti-mouse, protein A-
sepharose conjugate was added to the lysate and incubated
overnight at 4°C. After washing the samples 4X with 1X
buffer A and 2X with a LiCl2/urea buffer., the precipitated
proteins were dissociated from the immune complexes by the
addition of 2X Laemmli's buffer (125 mM Tris (pH6.8), 4%
SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5
min. Proteins were then fractionated on a 10% Dreyfuss gel
system (Dreyfuss et al., 1984), fixed and treated with 1M
Na-salicylate for fluorography.
The BHV1 gIV-specific monoclonal antibody, 3402,
specifically precipitated the BHV1 gIV glycoprotein from
vP1051 infected cells, but did not precipitate BHV1-specific
proteins from NYVAC or mock infected cells.
Generation of N'YVAC/BHV1 qI and QIV Recombinant. A
f..::;:, 92/1672
'~ '~ PCl'/US92/01906
-193-
plasmid, pBHVgIV, containing the BHV1 gIV gene, was obtained
from Rhone Merieux. The gIV gene from this plasmid was
cloned between vaccinia virus flanking arms. This was
accomplished by cloning the 2,000 by PstI-XhoI fragment of
pBHVgIV, containing the gIV gene, into the PstI-XhoI site of
pSD542. The plasmid generated by this manipulation is
called pBHVl.
The 3'-end of the n promoter was then cloned upstream
of the gIV gene. This was accomplished by cloning the
oligonucleotides, BHVL7 (SEQ ID N0:239) and BHVLB (SEQ ID
N0:240), encoding the 3'-end of the n promoter and the 5'-
end of the gIV gene, into the 5,500 by partial SstII-XhoI
fragment of pBHVl. The plasmid generated by this
manipulation is called pBHV3.
Extraneous 3'-noncoding sequence was then eliminated.
This was accomplished by cloning the oligonucleotides, BHVI,S
(SEQ ID N0:241) and BHVL6 (SEQ ID N0:242), into the 5,200 by
partial SmaI-PstI fragment of pBHV3. The plasmid generated
by this manipulation is called pBHV4.
Extraneous linker sequence was then eliminated. This
was accomplished by ligating the 5,200 by PstI fragment of
pBHV4. The plasmid generated by this manipulation is called
pBHV5.
The 5'-end of the ~r promoter was then cloned into
pBHV5. This was accomplished by cloning the 130 by AflII-
XhoI fragment of pPI4, containing the 5'-end of the rr
promoter, into the 5,200 by AflII-XhoI fragment of pBHVS.
The plasmid generated by this manipulation is called pBHV6.
The BHV1 gI gene was then cloned into pBHV6. This was
accomplished by cloning the 2,900 by BalII fragment of
pBHV8, containing the H6-promoted gI gene, into the BalI2
site of pBHV6. The plasmid generated by this manipulation
is called pBHV9.
pBHV8 was generated by the following procedure: a
plasmid, pIBRS6, was received from Rhone Merieux. The
plasmid contains a 6.6 kb SalI fragment, containing the BHV1
gI gene (Straub strain). The 5'-end of the gI gene
(Whitbec3~ et al., J. Virol. (1988) 62:3319) was cloned
downstream of the H6 promoter and between vaccinia virus HA
N 1 U v' r..
VVO 92/1,672
PCT/US92/01906
-194-
flanking arms. This was accomplished by cloning the 540 by
SalI-PstI fragment of pIBRS6 into the 4,400 by SalI-PstI
fragment of pGDS. The plasmid generated by this
manipulation is called pIBR2.
The initiation codon of the H6 promoter was then
aligned with the initiation codon of the gI gene. This was
accomplished by cloning the oligonucleotides, IBRL1 (SEQ ID
N0:243) (5'-ATCCGTTAAGTTTGTATCGTAATGGCCGCTCGCGGCGGTGCTGAA
CGCGCCGC-3') and IBRL2 (SEQ ID N0:244) (5'-GGCGCGTTCAGCA
CCGCCGCGAGCGGCCATTACGATACAAACTTAACGGAT-3'), into the 3,800
by NruI-SstII fragment of pIBR2. The plasmid generated by
this manipulation is called pIBR4.
An NcoI site, necessary for future manipulations, was
then generated downstream from the gI sequence. This was
accomplished by cloning the oligonucleotides, IBRL3 (SEQ ID
N0:245) (5'-CCATGGTTTAATGCA-3') and IBRL4 (SEQ ID N0:246)
(5'-TTAAACCATGGTGCA-3'), into the PstI site of pIBR4. The
plasmid generated by this manipulation is called pIBR5.
Additional gI sequence was then cloned into pIBR5.
This was accomplished by cloning the 1,740 by Tth111I-NcoI
fragment of pIBRS6 into the 3,700 by Tth111I-NcoI fragment
of pIBR5. The plasmid generated by this manipulation is
called pIBR7.
A BalII site, necessary for future manipulations, was
then generated downstream from the gI sequence. This was
accomplished by cloning the oligonucleotides, IBRL5 (SEQ ID
N0:247) (5'-CATGGTTTAAGATCTC-3') and IBRL6 (SEQ ID N0:248)
(5'-CATGGAGATCTTAAAC-3'), into the NcoI site of pIBR7. The
plasmid generated by this manipulation is called pIBR8.
The 3'-end of the gI gene was then cloned into pIBR8.
This was accomplished by cloning the 2,285 by StuI fragment
of pIBRS6 into the E, coli DNA polymerase I (Klenow
fragment) filled-in 4,300 by StuI-BalII (partial) fragment
of pIBR8. The plasmid generated by this manipulation is
called pIBR20.
The H6-promoted BHV1 gI gene was then moved to a
vaccinia virus donor plasmid. This was accomplished by
cloning the E. coli DNA polymerase I (Klenow fragment)
filled-in 2,900 by BQ1II-NcoI (partial) fragment of pIBR20
WO 92/15672
PCT/US92/01906
-195- '~
into the SmaI site of pSD542. This places the H6-promoted
gI gene between tk flanking arms. The plasmid generated by
this manipulation is called pIBR22.
A BcxlII site was then created upstream from the H6
promoter. This was accomplished by cloning the 2,800 by
HindIII-EcoRV fragment of pIBR22 into the 3,500 by HindIII-
EcoRV fragment of pGD3. (pGD3 is a plasmid that contains a
BcrlII site upstream from an H6-promoted herpes simplex virus
type 2 (HSV2) gD gene. This manipulation repalces the
HSV2gD sequence with the BHVIgI gene, thereby creating a
BalII site upstream from the H6-promoted gI gene). The
plasmid generated by this manipulation is called pBHV8.
pBHV9 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1074.
Immunoprecipitation analysis was performed to determine
whether vP1074 expresses authentic BHV1 gI and gIV
glycoproteins. Vero cell monolayers were either mock
infected, infected with NYVAC or infected with vP1074 at an
m.o.i. of 10 PFU/cell. Following an hour adsorption period,
the inoculum was aspirated and the cells were overlayed with
2 mls of modified Eagle's medium (minus methionine)
containing 2% fetal bovine serum and [35S]-methionine (20
~.Ci/ml). Cells were harvested at 7 hrs post-infection by
the addition of 1 ml 3X buffer A (3% NP-40, 30mM Tris
(pH7.4), 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF) and 50
mls aprotinin, with subsequent scraping of the cell
monolayers.
Lysates were then analyzed for BHV1 gI and gIV
expression using the BHV1 gI-specific monoclonal antibody,
5106, and the gIV-specific monoclonal antibody, 3402
(obtained from Dr. Geoffrey Letchworth, U. of Wisconsin,
Madison, WI). This was accomplished by the following
procedure: rat anti-mouse sera was bound to protein-A
sepharose at room temperature for 4 hours. After washing
the material 5X with 1X buffer A, the protein A-sepharose
bound rat anti-mouse antibody was bound to the gI-specific
monoclonal antibody and the gIV-specific monoclonal
antibody., The lysates, meanwhile, were precleared by
incubating normal mouse sera and the protein A-sepharose
~1~~~11
WO 92/15672
PCT/US92/01.906 ~-_
t-,~~~,
-196-
bound rat anti-mouse antibody overnight at 4°C. After
washing this material 5X with 1X buffer A, the gI or gIV-
specific monoclonal antibody, rat anti-mouse, protein A-
sepharose conjugate was added to the lysate and incubated
overnight at 4°C. After washing the samples 4X with 1X
buffer A and 2X with a LiCl2/urea buffer, the precipitated
proteins were dissociated from the immune complexes by the
addition of 2X Laemmli's buffer (125 mM Tris (pH6.8), 4%
SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5
min. Proteins were then fractionated on a 10% Dreyfuss gel
system (Dreyfuss et al., 1984), fixed and treated with 1M
Na-salicylate for fluorography.
The BHV1 gI and gIV-specific monoclonal antibodies,
5106 and 3402, specifically precipitated the BHV1 gI and gIV
glycoproteins from vP1074 infected cells, but did not
precipitate BHV1-specific proteins from mock or NYVAC
infected cells.
Generation of NYVAC/BHV1 gIII recombinant. A plasmid,
pBHVgIII, was obtained from Rhone Merieux. This plasmid
contains the BHV1 gIII gene (Straub strain), encoded on a
3.4 kb BamHI/HindIII fragment cloned into the BamHI/HindIII
site of pBSK+. The gIII gene (Fitzpatrick et al., Virology
(1989) 173:146) from this plasmid was cloned between
vaccinia virus flanking arms. This was accompslished by
cloning the 1,000 by NcoI-XhoI fragment of pBHVgIII,
containing the 5'-end of the gIII gene, and the
oligonucleotides, BHVL1 (SEQ ID N0:249) (5'-GATCCTGAGAT
AAAGTGAAAATATATATCATTATATTACAAAGTACAATTATTTAGGTTTAAT-3') and
BHVL2 (SEQ ID N0:250) (5'-CATGATTAAACCTAAATAATTGT
ACTTTGTAATATAATGATATATATTTTCACTTTATCTCAG-3'), encoding the
I3L promoter, into the BamHI-XhoI site of pSD544. The
plasmid generated by this manipulation is called pBHV2.
The 3'-end of the gIII gene was then cloned into pBHV2.
This was accomplished by cloning the oligonucleotides,
BHVL15 (SEQ ID N0:251) (5'-TCGAGCCCGGGTAATCCAACCCGGTC
TTACTCGCGCTCGCGCCCTCGGCTCCGCGCCCTAGG-3') and BHVL16 (SEQ ID
N0:252) (5'-GTACCCTAGGGCGCGGAGCCGAGGGCGCGAGCGCGAG
TAAGACCGGGTTGGATTACCCGGGC-3'), encoding the 3'-end of the
gIII gene, into the 4,700 by XhoI-Asp718 fragment of pBHV2.
W,O 92/1672 ~ ~ ~ j ) ~ ~ PCT/US92/01906
-197- _
The plasmid generated by this manipulation is called pBHV7.
The rest of the gIII gene was then cloned into pBHV7.
This was accomplished by cloning the 500 by partial SmaI-
XhoI fragment of pBHVgIII, containing an interior portion of
the gIII gene, into the 4,750 by partial SmaI-XhoI fragment
of pBHV7. The plasmid generated by this manipulation is
called pBHVlO.
pBHVlO was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1073.
Immunoprecipitation analysis was performed to determine
whether vP1073 expresses an authentic BHV1 gIII
glycoprotein. Vero cell monolayers were either mock
infected, infected with NYVAC or infected with vP1073 at an
m.o.i. of 10 PFU/cell. Following an hour adsorption period,
.the inoculum was aspirated and the cells were overlayed with
2 mls of modified Eagle's medium (minus methionine)
containing 2% fetal bovine serum and [35S]-methionine (20
~,Ci/ml). Cells were harvested at 7 hrs post-infection by
the addition of 1 ml 3X buffer A (3% NP-40, 30mM Tris
(pH7.4), 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF) and 50
_ mls aprotinin, with subsequent scraping of the cell
monolayers.
Lysates were then analyzed for BHV1 gIII expression
using the BHV1 gIII-specific monoclonal antibody, 1507
(obtained from Dr. Geoffrey Letchworth, U. of Wisconsin,
Madison, WI). This was accomplished by the following
procedure: rat anti-mouse sera was bound to protein-A
sepharose at room temperature for 4 hours. After washing
the material 5X with 1X buffer A, the protein A-sepharose
bound rat anti-mouse antibody was bound to the gIII-specific
monoclonal antibody, 1507. The lysates, meanwhile, were
precleared by incubating normal mouse sera and the protein
A-sepharose bound rat anti-mouse antibody overnight at 4°C.
After washing this material 5X with 1X buffer A, the gIII-
specific monoclonal antibody, rat anti-mouse, protein A-
sepharose conjugate was added to the lysate and incubated
overnight at 4°C. After washing the samples 4X with 1X
buffer A and 2X with a LiCl2/urea buffer, the precipitated
proteins were dissociated from the immune complexes by the
laaUaJ~.. i 1
VVO 92/1672 PCT/US92/01906
-198-
addition of 2X Laemmli's buffer (125 mM Tris (pH6.8), 4%
SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5
min. Proteins were then fractionated on a 10% Dreyfuss gel
system (Dreyfuss et al., 1984), fixed and treated with 1M
Na-salicylate for fluorography.
The BHV1 gIII-specific monoclonal antibody, 1507,
specifically precipitated the BHV1 gIII glycoprotein from
vP1073 infected cells, but did not precipitate BHV1-specific
proteins from mock or NYVAC infected cells.
Generation of NYVAC/BHV1 gIII AND QIV recombinant. A
plasmid, pBHVgIV, containing the BHV1 gIV gene, was obtained
from Rhone Merieux. The gIV gene from this plasmid was
cloned between vaccinia virus flanking arms. This was
accomplished by cloning the 2,000 by ~PstI-XhoI fragment of
pBHVgIV, containing the gIV gene, into the PstI-XhoI site of
pSD542. The plasmid generated by this manipulation is
called pBHVl.
The 3'-end of the n promoter was then cloned upstream,
of the gIV gene. This was accomplished by cloning the
oligonucleotides, BHVL7 (SEQ ID N0:239) and BHVL8 (SEQ ID
N0:240), encoding the 3'-end of the n promoter and the 5'-
end of the gIV gene, into the 5,500 by partial SstII-XhoI
fragment of pBHVl. The plasmid generated by this
manipulation is called pBHV3.
Extraneous 3'-noncoding sequence was then eliminated.
This was accomplished by cloning the oligonucleotides, BHVLS
(SEQ ID N0:241) and BHVL6 (SEQ ID N0:242), into the 5,200 by
partial SmaI-PstI fragment of pBHV3. The plasmid generated
by this manipulation is called pBHV4.
Extraneous linker sequence was then eliminated. This
was accomplished by ligating the 5,200 by PstI fragment of
pBHV4. The plasmid generated by this manipulation is called
pBHV5.
The 5'-end of the rr promoter was then cloned into
pBHV5. This was accomplished by cloning the 130 by AflII-
XhoI fragment of pPI4, containing the 5'-end of the ~r
promoter, into the 5,200 by AflII-XhoI fragment of pBHV5.
The plasmid generated by this manipulation is called pBHV6.
' The BHV1 gIII gene was then cloned into pBHV6. This
«'O 92/1672 ~ ~ ~ ~ ~ ~ ~ per/ US92/01906
-199-
was accomplished by cloning the 1,600 by As~718-BamHI
fragment of pBHVlO, containing the I3L-promoted gIII gene,
into the 5,300 by partial BamHI-Asp718 fragment of pBHV6.
The plasmid generated by this manipulation is called pBHVll.
pBHVll was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1083.
Immunoprecipitation analysis was performed to determine
whether vP1083 expresses authentic BHV1 gIII and gIV
glycoproteins. Vero cell monolayers were either mock
infected, infected with NYVAC or infected with vP1083 at an
m.o.i. of 10 PFU/cell. Following an hour adsorption period,
the inoculum was aspirated and the cells were overlayed with
2 mls of modified Eagle's medium (minus methionine)
containing 2% fetal bovine serum and (35S)-methionine (20
~Ci/ml). Cells were harvested at 7 hrs post-infection by
the addition of 1 ml 3X buffer A (3% NP-40, 30mM Tris
(pH7.4), 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF) and 50
mls aprotinin, with subsequent scraping of the cell
monolayers. '
Lysates were then analyzed for BHV1 gIII and gIV
expression using the BHV1 gIII-specific monoclonal antibody,
1507, and the gIV-specific monoclonal antibody, 3402
(obtained from Dr. Geoffrey Letchworth, U. of Wisconsin,
Madison, WI). This was accomplished by the following
procedure: rat anti-mouse sera was bound to protein-A
sepharose at room temperature for 4 hours. After washing
the material 5X with 1X buffer A, the protein A-sepharose
bound rat anti-mouse antibody was bound to the gIII-specific
monoclonal antibody and the gIV-specific monoclonal
antibody. The lysates, meanwhile, were precleared by
incubating normal mouse sera and the protein A-sepharose
bound rat anti-mouse antibody overnight at 4°C. After
washing this material 5X with 1X buffer A, the BHV1 gIII or
gIV-specific monoclonal antibody, rat anti-mouse, protein A-
sepharose conjugate was added to the lysate and incubated
overnight at 4°C. After washing the samples 4X with 1X
buffer A and 2X with a LiCl2/urea buffer, the precipitated
proteins were dissociated from the immune complexes by the
addition of 2X Laemmli's buffer (125 mM Tris (pH6.8), 4%
~;i~~~ r l
WO 92/15672 PCT/US92/01906
-200-
SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5
min. Proteins were then fractionated on a 10% Dreyfuss gel
system (Dreyfuss et al., 1984), fixed and treated with 1M
Na-salicylate for fluorography.
The BHV1 gIII and gIV-specific monoclonal antibodies,
1507 and 3402, specifically precipitated the BHV1 gIII and
gIV glycoproteins from vP1083 infected cells, but did not
precipitate BHV1-specific proteins from mock or NYVAC
infected cells.
Generation of NYVAC/BHV1 QI and gIII recombinant. A
plasmid, pBHVgIII, containing the BHV1 gIII gene was
obtained from Rhone Merieux. The gIII gene from this
plasmid was cloned between vaccinia virus flanking arms.
This was accomplished by cloning the 1,000 by NcoI-XhoI
fragment of pBHVgIII, containing the 5'-end of the gIII
gene, and the oligonucleotides, BHVL1 (SEQ ID N0:249) and
BHVL2 (SEQ ID N0:250), encoding the I3L promoter, into the
BamHI-XhoI site of pSD544VC. The plasmid generated by this
manipulation is called pBHV2.
The 3'-end of the gIII gene was then cloned into pBHV2.
This was accomplished by cloning the oligonucleotides,
BHVL15 (SEQ ID N0:251) and BHVL16 (SEQ ID N0:252), encoding
the 3'-end of the gIII gene, into the 4,700 by XhoI-As~718
fragment of pBHV2. The plasmid generated by this
manipulation is called pBHV7.
The rest of the gIII gene was then cloned into pBHV7.
This was accomplished by cloning the 500 by partial SmaI-
XhoI fragment of pBHVgIII, containing an interior portion of
the gIII gene, into the 4,750 by partial SmaI-XhoI fragment
of pBHV7. The plasmid generated by this manipulation is
called pBHVlO.
The BHV1 gI gene was then cloned into pBHVlO. This was
accomplished by cloning the 2,900 by BalII fragment of
pBHV8, containing the H6-promoted gI gene, into the BamHI
site of pBHVlO. The plasmid generated by this manipulation
is called pBHVl2.
pBHVl2 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1087.
Immunoprecipitation analysis was performed to determine
1f O 92/ I 5672
PCT/US92/01906
-201-
whether vP1087 expresses authentic BHV1 gI and gIII
glycoproteins. Vero cell monolayers were either mock
infected, infected with NYVAC or infected with vP1087 at an
m.o:i. of 10 PFU/cell. Following an hour adsorption period,
the inoculum was aspirated and the cells were overlayed with
2 mls of modified Eagle's medium (minus methionine)
containing 2% fetal bovine serum and [35S]-methionine (20
~,Ci/ml). Cells were harvested at 7 hrs post-infection by
the addition of 1 ml 3X buffer A (3% NP-40, 30mM Tris
(pH7.4), 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF) and 50
mls aprotinin, with subsequent scraping of the cell
monolayers.
Lysates were then analyzed for BHV1 gI and gIII
expression using the BHV1 gI-specific monoclonal antibody,
5106, and the gIII-specific monoclonal antibody, 1507
(obtained from Dr. Geoffrey Letchworth, U. of Wisconsin,
Madison, WI). This was accomplished by the following
procedure: rat anti-mouse sera was bound to protein-A
sepharose at room temperature for 4 hours. After washing ,
the material 5X with 1X buffer A, the protein A-sepharose
bound rat anti-mouse antibody was bound to the gI-specific
monoclonal antibody and the gIII-specific monoclonal
antibody. The lysates, meanwhile, were precleared by
incubating normal mouse sera and the protein A-sepharose
bound rat anti-mouse antibody overnight at 4°C. After
washing this material 5X with 1X buffer A, the BHV1 gI or
gIII-specific monoclonal antibody, rat anti-mouse, protein
A-sepharose conjugate was added to the lysate and incubated
overnight at 4°C. After washing the samples 4X with 1X
buffer A and 2X with a LiCl2/urea buffer, the precipitated
proteins were dissociated from the immune complexes by the
addition of 2X Laemmli's buffer (125 mM Tris (pH6.8), 4%
SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5
min. Proteins were then fractionated on a 10% Dreyfuss gel
system (Dreyfuss et al., 1984), fixed and treated with 1M
Na-salicylate for fluorography.
The BHV1 gI and gIII-specific monoclonal antibodies,
5106 and 1507, specifically precipitated the BHV1 gI and
gIII glycoproteins from vP1087 infected cells, but did not
VVO 92/1672
PCT/US92/01906 :,~"
202
precipitate BHV1-specific proteins from mock or NYVAC
infected cells.
Generation of NYVAC BHV1 I III and IV recombinant.
A plasmid, pBHVgIV, containing the BHV1 gIV gene, was
obtained from Rhone Merieux. The gIV gene from this plasmid
was cloned between vaccinia virus flanking arms. This was
accomplished by cloning the 2,000 by PstI-Xhol fragment of
pBHVgIV, containing the gIV gene, into the PstI-XhoI site of
pSD542VCVQ. The plasmid generated by this manipulation is
calleo pB~l ,
The 3'-end of the n promoter was then cloned upstream
of the gIV gene. This was accomplished'by cloning the
oligonucleotides, BHVL7 and BHVLg, encoding the 3'-end of
the n promoter and the 5'-end of the gIV gene, into the
.5,500 by partial SstII-XhoI fragment of pBHVl. The plasmid
generated by this manipulation is called pBHV3,
Extraneous 3'-noncoding sequence was then eliminated.
This was accomplished by cloning the oligonucleotides, BHVLS
(SEQ ID NO':241) and BHVL6 (SEQ ID N0:242), into the 5,200 by
partial SmaI-PstI fragment of pBHV3. The plasmid generated
by this manipulation is called pBHV4.
Extraneous linker sequences were then eliminated. This
was accomplished by ligating the 5,200 by PstI fragment of
pBHV4. The plasmid generated by this manipulation is called
pBHVS.
The 5'-end of the ~r promoter was then cloned into
pBHV5. This was accomplished by cloning the 130 by AflII-
XhoI fragment of pPI4, containing the 5'-end of the n
promoter, into the 5,200 by AflII-XhoI fragment of pBHVS,
The plasmid generated by this manipulation is called pBHV6.
The BHV1 gIII gene was then cloned into pBHV6. This
was accomplished by cloning the 1,600 by Asn718-BamHI
fragment of pBHVlO, containing the I3L-promoted gIII gene,
into the 5,300 by partial $amHl-~sp718 fragment of- pBHV6.
The plasmid generated by this manipulation is called pBHVll.
The BHV1 gI gene was then cloned into pBHVll. This was
accomplished by cloning the 2,900 by BcxlII fragment of
pBHV8, containing the H6-promoted gI gene, into the BQ1II
site of pBHVli. The plasmid generated by this manipulation
s r ~- c1
WO 92/15672 ~ ~ ~ ~j N ~ '~ p~'/US92/01906
-203-
is called pBHVl3.
- pBHVl3 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1079.
Immunoprecipitation analysis was performed to determine
whether vP1079 expresses authentic BHV1 gI, gIII and gIV
. glycoproteins. Vero cell monolayers were either mock
infected, infected with NYVAC or infected with vP1079 at an
m.o.i. of 10 PFU/cell. Following an hour adsorption period,
the inoculum was aspirated and the cells were overlayed with
2 mls of modified Eagle's medium (minus methionine)
containing 2% fetal bovine serum and [35S]-methionine (20
~Ci/ml). Cells were harvested at 7 hrs post-infection by
the addition of 1 ml 3X buffer A (3% NP-40, 30mM Tris
(pH7.4), 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF) and 50
xnls aprotinin, with subsequent scraping of the cell
monolayers.
Lysates were then analyzed for BHV1 gI, gIII, and gIV
expression-using the BHV1 gI-specific monoclonal antibody,
5106, the gIII-specific monoclonal antibody, 1507, and the.
gIV-specific monoclonal antibody, 3402 (obtained from Dr.
. Geoffrey Letchworth, U. of Wisconsin, Madison, WI). This
was accomplished by the following procedure: rat anti-mouse
sera was bound to protein-A sepharose at room temperature
for 4 hours. After washing the material 5X with 1X buffer
A, the protein A-sepharose bound rat anti-mouse antibody was
bound to the gI, gIII and gIV-specific monoclonal
antibodies. The lysates, meanwhile, were precleared by
incubating normal mouse sera and the protein A-sepharose
bound rat anti-mouse antibody overnight at 4°C. After
washing this material 5X with 1X buffer A, the BHV1 gI, gIII
and gIV-specific monoclonal antibody, rat anti-mouse,
protein A-sepharose conjugate was added to the lysate and
incubated overnight at 4°C. After washing the samples 4X
with 1X buffer A and 2X with a LiCl2/urea buffer, the
precipitated proteins were dissociated from the immune
complexes by the addition of 2X Laemmli's buffer (125 mM
Tris (pH6.8), 4% SDS, 20% glycerol, 10% 2-mercaptoethanol)
and boiling for 5 min. Proteins were then fractionated on a
10% Dreyfuss gel system (Dreyfuss et al., 1984), fixed and
WO 92/15672 ~' -~ ~ ~ N '[~ PCT/US92/01906
-204-
treated with 1M Na,-salicylate for fluorography.
The BHV1 gI, gIII and gIV-specific monoclonal
antibodies, 5106, 1507 and 3402, specifically precipitated
the BHV1 gI, gIII and gIV glycoproteins from vP1079 infected
cells, but did not precipitate BHV1-specific proteins from
mock or NYVAC infected cells.
Example 31 - EXPRESSION OF BOVINE VIRAh DIARRHEA VIRUS
~BVDV) GENE8 IN NYVAC
Generation of NYVAC/BVDV gEl,/gE2 recombinant. The BVDV
gEl (gp48/gp25) "gene" (Osloss strain) was cloned into
pIBI25. This was accomplished by blunt-ending the 1,370 by
EcoRI-BamHI fragment of pSP65-gEl (obtained from Eurogentec,
Liege, Belgium; Renard et al., European Patent Application
No:86870095) with E. coli DNA polymerase I (Klenow
fragment), ligating XhoI linkers onto the ends and cloning
the resulting fragment into the XhoI site of pIBI25. The
plasmid generated by this manipulation is called pBDVl.
The initiation codon of the H6 promoter was then ,
aligned with the "initiation codon" of the gEl "gene". This
was accomplished by cloning the oligonucleotides, BDVM4 (SEQ
ID N0:253) (5'-AGCTTGATATCCGTTAAGTTTGTATCGTAATGGGCAAAC
TAGAGAAAGCCCTGT-3') and BDVM5 (SEQ ID N0:254)
(5'-GGGCTTTCTCTAGTTTGCCCATTACGATACAAACTTAACGGATATCA-3'),
encoding the 3'-end of the H6 promoter and the 5'-end of the
gEl "gene", into the 4,250 by HindIII-BQlI (partial)
fragment of pBDVl. The plasmid generated by this
manipulation is called pBDV6.
The gEl "gene" was then cloned downstream of the
H6+ATI+HA triple promoter (Portetelle et al., Vaccine (1991)
9:194) and between HA flanking arms. This was accomplished
by cloning the 1,380 by EcoRV-PstI (partial) fragment of
pBDV6, containing the gEl "gene", into the 3,700 by EcoRV-
PstI fragment of pATI25. The plasmid generated by this
manipulation is called pBDV7.
A BamHI site, necessary for future manipulations, was
then generated downstream of the BVDV sequence. This was
accomplished by cloning the oligonucleotide, BDVM6 (SEQ ID
N0:255) (5'-TCGAGGATCC-3'), into the XhoI site of pBDV7.
The plasmid generated by this manipulation is called pBDV8.
WO 92/15672 ~ ~ ~ ~ ) .~ ,~ PCT/US92/01906
-205-
Approximately 830 by of gE2 (gp53) sequence (Osloss
strain) was then cloned downstream of the gEl sequence.
This was accomplished by cloning the 980 by BQlII-BamHI
fragment of p7F2 (obtained from Eurogentec, Liege, Belgium;
Renard et al., European Patent Application No:86870095),
containing the gE2 sequence, into the 5,100 by BamHI-BalII
(partial) fragment of pBDV8. The plasmid generated by this
manipulation is called pBDV9.
The H6 promoted-gEl/gE2 sequence was then cloned
between ATI flanking arms. This was accomplished by cloning
the 2,200 by NruI-BamHI fragment of pBDV9, containing the
gEl/gE2 sequence, into the 4,900 by NruI-BamHI fragment of
pPGI7. This places the gEl/gE2 sequence under the
transcriptional control of the H6 promoter and into an
insertion vector. The plasmid generated by this
manipulation is called pBDV23.
Approximately 270 by of additional gE2 sequence (Osloss
strain) was then cloned downstream of the existing BVDV
sequence. This was accomplished by cloning the 1,260 by
BQ1II-BamHI fragment of pSP65E1+E2-1 (obtained from
Eurogentec, Liege, Belgium; Renard et al., European Patent
Application No:86870095), containing the gE2 sequence, into
the 6,100 by fragment of pBDV23. The plasmid generated by
this manipulation is called pBDV24.
pBDV24 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP972.
Immunoprecipitation analysis was performed to determine
whether vP972 expresses authentic BVDV gEl and gE2
glycoproteins. Vero cell monolayers were either mock
infected, infected with NYVAC or infected with vP972 at an
m.o.i. of 10 PFU/cell. Following an hour adsorption period,
the inoculum was aspirated and the cells were overlayed with
2 mls of modified Eagle's medium (minus methionine)
containing 2% fetal bovine serum and (3~S]-methionine (20
~,Ci/ml). Cells were harvested at 18 hrs post-infection by
the addition of 1 ml 3X buffer A (3% NP-40, 30mM Tris
(pH7.4), 3mM EDTA, 0.03% Na Azide and 0.6 mg/ml PMSF) and 50
mls aprotinin, with subsequent scraping of the cell
monolayers. ,
- u_ v v m i i
WO 92/1672
PCT/US92/01906 -r.,
-206-
Lysates were then analyzed for BVDV gEl and gE2
expression using the BVDV gp48-specific monoclonal
antibodies, NYC16 and NY12B1, and the BVDV gp53-specific
monoclonal antibody, 209D3 (obtained from Rhone Merieux,
Lyon, France). This was accomplished by the following
procedure: rat anti-mouse sera was bound to protein-A
sepharose at room temperature for 4 hours. After washing
the material 5X with 1X buffer A, protein A-sepharose bound
rat anti-mouse antibody was bound to the gEl-specific
monoclonal antibodies, NYC16 and NY12B1, and the gE2-
specific monoclonal antibody, 209D3. The lysates,
meanwhile, were precleared by incubating normal mouse sera
and the protein A-sepharose bound rat anti-mouse antibody
overnight at 4°C. After washing this material 5X with 1X
buffer A, the BVDV gEl or gE2-specific monoclonal antibody,
rat anti-mouse, protein A-sepharose conjugate was,added to
the lysate and incubated overnight at 4°C. After washing
the samples 4X with 1X buffer A and 2X with a LiCl2/urea .
buffer, the precipitated proteins were dissociated from the
immune complexes by the addition of 2X Laemmli's buffer (125
mM Tris (pH6.8), 4% SDS, 20% glycerol, 10% 2-
mercaptoethanol) and boiling for 5 min. Proteins were then
fractionated on a 10% Dreyfuss gel system (Dreyfuss et al.,
1984), fixed and treated with 1M Na-salicylate for
fluorography.
The BVDV gEl or gE2-specific monoclonal antibodies
precipitated BVDV-specific glycoproteins from vP972 infected
cells, but did not precipitate BVDV-specific proteins from
NYVAC or mock infected cells.
Generation of NYVAC/BVDV CAPSID/gEljQE2 recombinant.
The BVDV gEl "gene" was cloned into pIBI25. This was
accomplished by blunt-ending the 1,370 by EcoRI-BamHI
fragment of pSP65-gEl, containing the gEl "gene", with E.
coli DNA polymerase I (Klenow fragment), ligating XhoI
linkers onto the ends and cloning the resulting fragment
into the XhoI site of pIBI25. The plasmid generated by this
manipulation is called pBDVl.
The gEl "gene" was then cloned between a flanking arms.
This was accomplished by cloning the 1,400 by XhoI fragment
WO 92/15672 ~ .~. ~ J N ~ ~ PCT/US92/01906
-207-
of pBDVl, containing the gEl sequence, into the XhoI site of
pSD486. The plasmid generated by this manipulation is
called pBDVll.
The "initiation codon" of the gEl "gene" was then
aligned with the initiation codon of a promoter. This was
accomplished by cloning the oligonucleotides, BDVM7 (SEQ ID
N0:256) (5'-CGATTACTATGGGCAAACTAGAGAAAGCCCTGT-3') and BDVM8
(SEQ ID N0:257) (5'-GGGCTTTCTCTAGTTTGCCCATAGTAAT-3'),
encoding the 3'-end of the a promoter and the 5'-end of the
gEl sequence, into the 4,800 by partial Ball-ClaI fragment
of pBDVll. The plasmid generated by this manipulation is
called pBDVl2.
Part of the BVDV gE2 "gene" was then cloned into
pBDVl2, downstream from the gEl sequence. This was
accomplished by cloning the 1,000 by BalII-BamHI fragment of
p7F2, containing the gE2 sequence, into the 4,650,bp BalII-
BamHI fragment of pBDVl2. The plasmid generated by this
manipulation is called pBDVl4.
The rest of the gE2 "gene" was then cloned into pBDVl4.
This was accomplished by cloning the 1,260 by BalII-BamHI
fragment of pSP65E1+E2-1, containing the gE2 "gene", into
the 4,650 by BalII-BamHI fragment of pBDVl4. The plasmid
generated by this manipulation is called pBDVl7.
The capsid "gene" (Osloss strain) was then cloned into
pBDVl7, upstream from the gEl sequence. This was
' . accomplished in 2 steps. The first step aligned the
initiation codon of the a promoter with the "initiation
codon" of the capsid "gene". This was accomplished by
cloning the oligonucleotides, BDVL12 (SEQ ID N0:258)
(5'-CGATTACTATGGAGTTGATTACAAATGAACTTTTATACAAAACATACAAAC
AAAAACCCGCTGGAGTGGAGGAACCAGTATATAACCAAGCAGGTGACCCT-3') and
BDVL13 (SEQ ID N0:259) (5'-CTAGAGGGTCACCTGCTTGGTTATATA
CTGGTTCCTCCACTCCAGCGGGTTTTTGTTTGTATGTTTTGTATAAAAGTTCATTTGTAA
TCAACTCCATAGTAAT-3'), encoding the 3'-end of the a promoter
and the 5'-end of the capsid sequence, into the 5,200 by
ClaI-XbaI fragment of pBDVl7. The plasmid generated by this
manipulation is called pBDV25. The second step cloned the
rest of the capsid "gene" into pBDV25. This was
accomplished by-cloning the 1,870 by BstEII-BqlII fragment
WO 92/1 X672 ~ ~ ~ a ~ r. ~~ PCT/US92/01906
-208-
of pSP65C-E1-E2 (obtained from Eurogentec, Liege, Belgium;
'Renard et al., European Patent Application No:86870095),
containing the capsid "gene", into the 4,700 by BstEII-BcxlII
fragment of pBDV25. The plasmid generated by this
manipulation is called pBDV26.
The u-promoted capsid/gEl/gE2 sequence was then cloned
between tk flanking arms. This was accomplished by cloning
the 3,200 by SnaBI-BamHI fragment of pBDV26, containing the
u-promoted capsid/gEl/gE2 sequence, into the 4,000 by SmaI-
BamHI fragment of pSD542. The plasmid generated by this
manipulation is called pBDV27.
pBDV27 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1017.
Immunoprecipitation experiments with vP1017 infected
cells were performed as described above for the expression
of vP972. No BVDV-specific proteins were precipitated from
mock infected or NYVAC infected Vero cells. BVDV-specific
proteins were precipitated, however, from lysates of vP1o17.
Generation of NYVAC/BVDV crE2 recombinant. The BVDV gEl
"gene" was cloned into pIBI25. This was accomplished by
blunt-ending the 1,370 by EcoRI-BamHI fragment of pSP65-gEl,
containing the gEl "gene", with E. coli DNA polymerase I
(Klenow fragment), ligating XhoI linkers onto the ends and
cloning the resulting fragment into the XhoI site of pIBI25.
The plasmid generated by this manipulation is called pBDVl.
The initiation codon of the H6 promoter was then
aligned with the putative "initiation codon" of the gEl
"gene". This was accomplished by cloning the
oligonucleotides, BDVM4 (SEQ ID N0:253) and BDVMS (SEQ ID
N0:254), encoding the 3'-end of the H6 promoter and the 5'-
end of the gEl "gene", into the 4,250 by HindIII-Ball
(partial) fragment of pBDVi. The plasmid generated by this
manipulation is called pBDV6.
The gEl "gene" was then cloned downstream of the
H6+ATI+HA triple promoter and between HA flanking arms.
This was accomplished by cloning the 1,380 by EcoRV-PstI
(partial) fragment of pBDV6, containing the gEl "gene", into
the 3,700 by EcoRV-PstI fragment of pATI25. The plasmid
generated by this manipulation is called pBDV7.
VVO 92/15672 ~ ~ N ~ ~ p~'/US92/01906
-209-
A BamHI site, necessary for future manipulations, was
then generated downstream of the BVDV sequence. This was
accomplished by cloning the oligonucleotide, BDVM6 (SEQ ID
N0:255), into the XhoI site of pBDV7. The plasmid generated
by this manipulation is called pBDV8.
Approximately 830 by of BVDV gE2 sequence was then
cloned downstream of the gEl "gene". This was accomplished'
by cloning the 980 by BQlII-~mHI fragment of p7F2,
containing the gE2 sequence, into the 5,100 by BamHI-BglII
(partial) fragment of pBDV8. The plasmid generated by this
manipulation is called pBDV9.
The gEl/gE2 sequence was then cloned between ATI
flanking arms. This was accomplished by cloning the 2,200
by NruI-BamHI fragment of pBDV9, containing the H6-promoted
gEl/gE2 "genes", into the 4,900 by NruI-BamHI fragment of
pPGI7. The plasmid generated by this manipulation is called
pBDV23.
Approximately 270 by of additional gE2 sequence was
then cloned downstream of the existing BVDV sequence. This
was accomplished by cloning the 1,260 by BalII-BamHI
fragment of pSP65El+E2-1, containing the additional gE2
sequence, into the 6,100 by BamHI-BQ1II (partial) fragment
of pBDV23. The plasmid generated by this manipulation is
called pBDV24.
The gEl sequence was then deleted from BDV24. This was
accomplished by cloning a 130 by NruI-PstI PCR fragment,
containing the 3'-end of the H6 promoter and the 5'-end of
the gE2 "gene", into the 5,900 by NruI-PstI fragment of
pBDV24. This PCR fragment was generated from the plasmid,
pBDVl7, with the oligonucleotides, BDVP14 (SEQ ID N0:260)
(5'-TTTCGCGATATCCGTTAAGTTTGTATCGTAATGCTCCCAGTTTGCAAACCC-3')
and BDVP15 (SEQ ID N0:261) (5'-TCTCCACCTTTACACCACACT-3').
The plasmid generated by this manipulation is called pBDV28.
Sequence analysis revealed that the H6 promoter in
pBDV28 contains a 2 by insertion. To correct this error,
the 130 by NruI-PstI fragment of pBDV28, containing the 3'-
end of the H6 promoter and the 5'-end of the gE2 "gene", was
cloned into the 5,900 by NruI-PstI fragment of pBDV24. The
plasmid generated by this manipulation is called pBDV29.
WO 92/15672 ~ 1 ~ ~j N ~ ~ PCT/LJS92/01906 ~,.a..",
-210-
pBDV29 was used in in vitro recombination experiments
with vP866 (NYVAC) as the rescuing virus to yield vP1097.
Immunoprecipitation experiments with vP1097 infected
cells are performed as described above to yield BVDV
proteins from cells or lysates.
Example 32 - CLONING AND $gPRE88ION OF HUMAN
CYTOMEGALOVIRUB (HCMVj GLYCOPROTEIN ANTIGENS
IN POxVIRUB VECTORS
Cloninct of the HCMV QB gene into the NYVAC donor
plasmid. pSD542. The 4800 by HindIII-BamHI fragment of the
HindIII D fragment of the HCMV DNA was cloned into the 2800
by HindIII-BamHI fragment of the plasmid pIBI24. By in vitro
mutagenesis (Kunkel, 1985; Russel et al., 1986) using the
oligonucleotides CMVMS (SEQ ID N0:262) (5'-GCCTCATCGCTGCT
GGATATCCGTTAAGTTTGTATCGTAATGGAATCCAGGATCTG-3') and CMVM3
(SEQ ID N0:263) (5'-GACAGATTGTGATTTTTATAAGCATCGTAAGC
TGTCA-3'), the gB gene was modified to be expressed under
the control of the vaccinia H6 promoter (Taylor et al.,
1988a,b; Perkus et al., 1989). The plasmid containing the
modified gB was designated 24CMVgB(5+3).
The 2900 by EcoRV-BamHI fragment of 24CMVgB(5+3) was
cloned into the 3100 by EcoRV-BalII fragment of pSP131. This
cloning step put the gB gene under the control of the H6
promoter. The resulting plasmid was designated SP131gB.
To modify the restriction sites flanking the H6
promoted gB in SP131gB the following steps were performed.
Plasmid pMP22BHP contains a subclone of the HindIII F
fragment of Vaccinia (WR strain) containing a portion of the
HBV sAg in a polylinker region at the BamHI site. pMP22BHP
was digested within the polylinker with HindIII and ligated
to a HindIII fragment from SP131CMVgB (containing the H6
promoted gB gene) generating plasmid SAg22CMVgB. SAg22CMVgB
was digested with BamHI and partially digested with HindIII
and ligated to a polylinker derived from pIBI24 by BamHI and
HindIII digestion creating plasmid 22CMVgB which contains
the H6 promoted gB gene without the HBV sAg.
Plasmid pSD542 (a NYVAC TK locus donor plasmid) was
derived from plasmid pSD460 (Tartaglia et al., 1992) by
,forming vector plasmid pSD513 as described above in Example
7. The polylinker region in pSD513 was modified by cutting
V1'O 92/15672 ~ ~ ~ ~ ~ ~ ~ pCT/US92/01906
-211-
with PstI/BamHI and ligating to annealed synthetic
ol~igonucleotides MPSYN288 (SEQ ID N0:264)
(5' GGTCGACGGATCCT 3') and MPSYN289 (SEQ ID N0:265)
(5' GATCAGGATCCGTCGACCTGCA 3') resulting in plasmid pSD542.
22CMVgB was digested with BamHI and NsiI to generate a
fragment containing the H6 promoter and part of the gB gene,
and with NsiI and PstI to generate a fragment containing the
remainder of the gB gene. These two fragments were ligated
to pSD542 that had been digested with BamHI and PstI within
its' polylinker creating the NYVAC donor plasmid 542CMVgB.
Clonincr of the HCMV gB size into the ALVAC donor
plasmid CP3LVOH6. An 8.5kb canarypox BalII fragment was
cloned in the BamHI site of pBS-SK plasmid vector to form
pWW5. Nucleotide sequence analysis revealed a reading frame
designated C3. In order to construct a donor plasmid for
insertion of foreign genes into the C3 locus with the
complete excision of the C3 open reading frame, PCR primers
were used to amplify the 5' and 3' sequences relative to C3.
Primers for the 5' sequence were RG277 (SEQ ID N0:177) and
RG278 (SEQ ID N0:178).
Primers for the 3' sequences were RG279 (SEQ ID N0:179)
and RG280 (SEQ ID N0:180). The primers were designed to
include a multiple cloning site flanked by vaccinia
transcriptional and translational termination signals. Also
included at the 5'-end and 3'-end of the left arm and right
arm were appropriate restriction sites (As~718 and EcoRI for
left arm and EcoRI and SacI for right arm) which enabled the
two arms to ligate into Ast~718/SacI digested pBS-SK plasmid
vector. The resultant plasmid was designated as pC3I.
A 908 by fragment of canarypox DNA, immediately
upstream of the~C3 locus was obtained by digestion of
plasmid pWW5 with NsiI and SSDI. A 604 by fragment of
canarypox and DNA was derived by PCR (Engelke et al., 1988)
using plasmid pWW5 as template and oligonucleotides CP16
(SEQ ID N0:266) (5'-TCCGGTACCGCGGCCGCAGATATTTGTTAGCTTC
TGC-3') and CP17 (SEQ ID N0:267) (5'-TCGCTCGAGTAG
GATACCTACCTACTACCTACG-3'). The 604 by fragment was digested
with Asp718 and XhoI (sites present at the 5' ends of
oligonucleotides CP16 and CP17, respectively) and cloned
WO 92/15672 ~ ~ ~ H ~ ~' PCT/US92/01906
s::~'v'~
-212-
into Asp718-XhoI digested and alkaline phosphatase treated
IBI25 (International Biotechnologies, Inc., New Haven, CT)
generating plasmid SPC3LA. SPC3LA was digested within IBI25
with EcoRV and within canarypox DNA with NsiI and ligated to
the 908 by NsiI-SSDI fragment generating SPCPLAX which
contains 1444 by of canarypox DNA upstream of the C3 locus.
A 2178 by BcrlII-SCI fragment of canarypox DNA was
isolated from plasmids pXX4 (which contains a 6.5 kb NsiI
fragnent of canarypox DNA cloned into the PstI site of pBS-
SK. A 279 by fragment of canarypox DNA was isolated by PCR
(Engelke et al., 1988) using plasmid pXX4 as template and
oligonucleotides CP19 (SEQ ID N0:268) (5'-TCGCTCGAGCTTTC
TTGACAATAACATAG-3') and CP20 (SEQ ID N0:269) (5'-TAGGAGC
TCTTTATACTACTGGGTTACAAC-3'). The 279 by fragment was
digested with XhoI and SacI (sites present at the 5' ends of
oligonucleotides CP19 and CP20, respectively) and, cloned
into SacI-XhoI digested and alkaline phosphatase treated
IBI25 generating plasmid SPC3RA.
To add additional unique sites to the polylinker, pC3I
was digested within the polylinker region with EcoRI and
ClaI, treated with alkaline phosphatase and ligated to
kinased and annealed oligonucleotides CP12 (SEQ ID N0:272)
and CP13 (SEQ ID N0:273) (containing an EcoRI sticky end,
XhoI site, BamHI site and a sticky end compatible with ClaI)
generating plasmid SPCP3S.
CP12 (SEQ ID N0:272) 5'-AATTCCTCGAGGGATCC -3'
CP13 (SEQ ID N0:273) 3'- GGAGCTCCCTAGGGC-5'
EcoRI XhoI BamHI
SPCP3S was digested within the canarypox sequences
downstream of the C3 locus with SCI and SacI (pBS-SK) and
ligated to a 261 by BalII-SacI fragment from SPC3RA and the
2178 by BQlII-StvI fragment from pXX4 generating plasmid
CPRAL containing 2572 by of canarypox DNA downstream of the
C3 locus. SPCP3S was digested within the canarypox sequences
upstream of the C3 locus with As~,718 (in pBS-SK) and AccI
and ligated to a 1436 by As~718-AccI fragment from SPCPLAX
generating plasmid CPLAL containing 1457 by of canarypox DNA
upstream of the C3 locus. CPLAL was digested within the
canarypox sequences downstream of the C3 locus with S.tvI and
SacI (in pBS-SK) and ligated to a 2438 by SCI-SacI fragment
WO 92/15672 ~ ~ ~ ;j ~ ~ ~ PC1'/US92/01906
-213-
from CPRAL generating plasmid CP3L containing 1457 by of
canarypox DNA upstream of the C3 locus, stop codons in six
reading frames, early transcription termination signal, a
polylinker region, early transcription termination signal,
stop codons in six reading frames, and 2572 by of canarypox
DNA downstream of the C3 locus. The resulting plasmid was
designated SPCP3L.
The early/late H6 vaccinia virus promoter (Guo et al.,
1989; Perkus et al., 1989) was derived by PCR (Engelke et
al., 1988) using pRW838 as template and oligonucleotides
CP21 (SEQ ID N0:270) (5'-TCGGGATCCGGGTTAATTAAT
TAGTTATTAGACAAGGTG-3') and CP22 (SEQ ID N0:271)
(5'-TAGGAATTCCTCGAGTACGATACAAACTTAAGCGGATATCG-3'). The PCR
product was digested with BamHI and EcoRI (sites present at
the 5' ends of oligonucleotides CP21 and CP22, respectively)
and ligated to CP3L that was digested with BamHI and EcoRI
in the polylinker generating plasmid VQH6CP3L.
ALVAC donor plasmid VQH6CP3L was digested within the
polylinker with XhoI and within the H6 promoter with NruI ,
and ligated to a NruI/HindIII fragment from 22CMgB
containing part of the H6 promoter and gB gene and a
polylinker derived from pIBI24 by XhoI and HindIII digestion
generating the ALVAC donor plasmid CP3LCMVgB.
Example 33 - CONSTRUCTION OF RECOMBINANT VIRU8E8:
CYTOMEGALOVIRUS
The CMV (cytomegalovirus) gB gene was inserted into the
TK site of NYVAC. The recombinant virus was designated
vP1001. The CMV gB gene was inserted into the C3 site of
ALVAC. The recombinant was designated vCP139.
Example 34 - IMMBNOFLUORESCENCE OF CMV GB PROTEIN IN
RECOMBINANT VIRUS INFECTED CELLS
Immunofluorescence studies were performed as described
previously (Taylor et al., 1990) using guinea pig polyclonal
serum followed by fluorescein isothiocyanate goat anti-
guinea pig. Cells infected with vP1001 showed gB expressed
on the plasma membrane. Weak internal expression was
detected within cells infected with vCP139.
WO 92/15672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-214-
Example 35 - IMMUNOPRECIPITATION OF CMV GB IN RECOMBINANT
INFECTED-CELLS
Immunoprecipitation experiments were performed as
described previously (Taylor et al., 1990). The CMV gB
glycoprotein produced in CMV infected cells has a molecular
weight of 55 kDa with a precursor form of 130 kDa (Gretch et
al., 1988). Cells infected with vP1001 and vCP139 produce
two CMV gB coded proteins of approximately 116 kDa and 55
kDa.
Example 36 - NEUTRALIZING ANTIBODIES
Following immunization of CBA mice with vP1001 (NYVAC-
HCMV gB), neutralizing antibody titers of the sera of
inoculated mice were assessed (Gonczol et al., 1986).
Antibodies capable of neutralizing human cytomegalovirus
were detected in the sera of mice 14-21 days later
(geometric mean titers of 1:16) and between 28 and 60 days
post-immunization (gmt=1:26). Immunization of CBA mice with
ALVAC-HCMV gB generated HCMV neutralizing antibody titers of
1:64 gmt (14-21 days pi, 1:91 gmt between 21 and 28 days
pi), and 1:111 between 28 and 60 days pi. Thus, immunization
of mice with vaccinia virus or canarypox virus recombinants
expressing HCMV gB elicited antibodies able to neutralize
the infectivity of HCMV.
Example 37 - CELL MEDIATED IMMUNITY
Besides HCMV neutralizing antibody titers, vCP139 is
also capable of eliciting cytotoxic T lymphocytes capable of
killing murine L929 cells infected with a recombinant
vaccinia virus expressing HCMV gB (vaccinia WR-gB). CBA mice
were immunized intraperitoneally with 2.5x108 pfu of vCP139.
Sixteen to 30 days later, spleen cell suspensions of the
mice were re-stimulated in vitro by co-incubation with
syngeneic spleen cells previously infected with vP1001 at a
ratio of 2:1. After 5 days, the spleen cells were counted
and, using the 5lCr-release assay (Zinkernagel et al.,
1984), assessed for cytotoxicity against uninfected L929
cells or L929 cells infected with adenovirus Ad5d1E3,
recombinant adenovirus expressing HCMV g8 (Ad-gB), vaccinia
virus, and recombinant vaccinia virus expressing HCMV g8.
Only background levels of reactivity were measured against
VI'O 92/15672 ~ ~. ~ J ~ ~ ~ PCT/US92/01906
-215-
the uninfected targets as well as the targets infected with
Ad5d1E3. In contrast, the in vitro stimulated spleen cells
readily killed L929 cells infected with Ad-gB expressing
HCMV gB. Although some lytic reactivity was observed against
targets infected with the vaccinia virus vector, much higher
cytolysis was measured against targets infected with the
recombinant vaccinia virus expressing gB. This clearly
demonstrated that cytotoxic T lymphocytes specific for
epitopes located within HCMV gB were generated by
inoculation with the recombinant canarypox virus expressing
HCMV gB (vCP139).
Example 38 - NYVAC AND ALVAC DONOR PhABMID CONSTRUCTION:
CANIN$ PARVOVIROS
In order to generate poxvirus recombinants expressing
the canine parvovirus VP2 capsid gene, donor plasmids were
constructed in which the VP2 gene was amplified from the
genome of the CPV-d isolate (CPV-2 antigenic type), coupled
to the vaccinia H6 promoter (Perkus et al., 1989) and
inserted into NYVAC or ALVAC insertion vectors. The NYVAC~
insertion site is the deorfed ATI locus while the ALVAC
insertion site is the deorfed C3 locus.
The VP2 gene sequences were obtained by PCR from
the plasmid pBI265(1). This plasmid, obtained from Dr.
Colin R. Parrish, James A. Baker Institute, Cornell
University, Ithaca, NY, contains the genome of the CPV-d
isolate (Cornell 790320)(antigenic type CPV-2). The DNA
sequence of the VP2 gene from this isolate has been
published (Parrish et al., 1988).
Using pBI265(1) as template and synthetic
oligonucleotides RG451 (SEQ ID N0:274) (5'-TCGGGT
ACCTCGCGATATCCGTTAAGTTTGTATCGTAATGAGTGATGGAGCAGT-3') and
RG452 (SEQ ID N0:275) (5'-TAGGAATTCCTCGAGTTAA
TATAATTTTCTAGGTGC-3') as primers, the complete VP2 open
reading frame (ORF) was amplified by PCR. The purified DNA
fragment was cut with As~718 and EcoRI and cloned into the
Asp718 and EcoRI sites in pBluescript SK+, resulting in
pDT4. The VP2 gene was confirmed by DNA sequence analysis.
The VP2 gene contains two TTTTTNT sequences within the
ORF which could function as early transcriptional stop
___
WO 92/15672 PCf/US92/01906
-216-
signals (Yuen et al., 1987). To eliminate these signals,
PCR site-directed mutagenesis was used to change the
nucleotide sequence while retaining the correct amino acid
sequence. A 250 bp.fragment was amplified from pBI265(1)
using synthetic oligonucleotides RG453 (SEQ ID N0:276)
(5'-ATCAGATCTGAGACATTGGGTTTCTATCCATG-3') and RG454 (SEQ ID
N0:277) (5'-TTAGTCTACATGGTTTACAATCAAAGAAGAATGTTCCTG-3').
The purified fragment was digested with BalII and AccI, and
used to replace the BQ1II/AccI VP2 fragment in pDT4. The
resulting plasmid, pED3, contains the modified VP2 gene in
which the TTTTTNT sequences have been changed to TTTCTAT and
TTCTTCT.
A NYVAC donor plasmid containing the CPV VP2 capsid
gene was constructed as follows. The modified VP2 gene was
excised from pED3 with NruI and XhoI and cloned into
pMPATIH6HSVTK cut with NruI/XhoI. pMPATIH6HSVTK ~s a
derivative of pSD552 (described elsewhere in this
disclosure) in which an expression cassette containing the
coding sequences for the HSV-1 thymidine kinase gene under
control of the H6 promoter is inserted between the H~aI and
XhoI sites in the polylinker region. Cutting this plasmid
with NruI and XhoI excises the tk gene, but retains the
5'end of~the H6 promoter. Insertion of the modified VP2
gene into this vector as described above generates pATI-VP2.
This NYVAC donor plasmid contains the H6 promoted VP2 gene
flanked by the ATI insertion arms.
An ALVAC donor plasmid containing the CPV VP2 capsid
gene was constructed as follows. The modified VP2 gene was
excised from pED3 with NruI and XhoI and the purified
fragment was cloned into pVQH6CP3L (plasmid described in
Flavivirus section) cut with NruI and XhoI. The resulting
plasmid, pC3-VP2, contains the H6 promoted VP2 gene flanked
by the C3 insertion arms.
Exampl8 39 - GENERATION OF NYVAC AND AhVAC RECOMBINANTS:
CANINE PARVOVIROS (CPV)
The donor plasmid pATI-VP2 was used in in vitro
recombination experiments in VERO cells with NYVAC (vP866)
and NYVAC-RG (vP879) as rescue viruses to yield vP998 and
vP999 respectively (Tartaglia et al., 1992). Recombinant
WO 92/15672 ~ i ~ J ~ '~'~ / PCT/US92/01906
-217-
viruses were identified by in situ hybridization procedures
(Piccini et al., 1987) using a radiolabelled VP2 specific
DNA probe. Recombinant plaques were purified by three
rounds of plaque purification and amplified for further
analysis.
The donor plasmid pC3-VP2 was used in in vitro
recombination experiments in CEF cells with ALVAC (CPpp) and
ALVAC-RG (vCP65A) as rescue viruses to yield vCPl23 and
vCP136 respectively (Taylor et al., 1992). Recombinant
viruses were identified by in situ hybridization procedures
(Piccini et al., 1987) using a radiolabelled VP2 specific
probe (positive signal) and C3 ORF specific probe (negative
signal). Recombinant plaques were purified by three rounds
of plaque purification and amplified for further analysis.
EBample 40 - EXPRESSION ANALY8I8 OF THE HYVAC- AND ALVAC-
BA8ED CPV QP2 RECOMBINANTS
All the recombinants containing the CPV VP2 gene were
tested for expression by immunofluorescence as previously
described (Taylor et al., 1990) using monoclonal antibodies
specif is for VP2 epitopes or polyclonal CPV dog serum. All
sera were obtained from Dr. Colin R. Parrish, James A. Baker
Institute, Cornell University, Ithaca, NY. The NYVAC-based
recombinants were tested on VERO cells while the ALVAC-based
recombinants were tested on CEF cells. Recombinants vP998,
vP999, vCP123, and vCP136 all displayed internal
fluorescence, with localization in the nucleus. No surface
fluorescence was detected. In addition, the two
recombinants containing the rabies G gene (vP999 and vCP136)
were screened with monoclonal antibodies specific for rabies
G epitopes. Both displayed strong fluorescence on the
surface of the cell.
To further characterize expression of an authenic VP2
gene product in the above recombinants, immunoprecipitation
analysis was done using the same antisera (Taylor et al.,
1990). The NYVAC-based recombinants were tested on VERO
cells while the ALVAC-based recombinants were tested on CEF
cells. In all recombinants (vP998, vP999, vCP123, and
vCP136) the antisera precipitated a protein of 65 kDa, which
is consistent with the size of the native VP2 gene. No
WO 92/15672 ~ ~ ~ ~ ~ ~'~ PC1'/US92/01906
-218-
protein of this size was detected from cell lysates or from
,either parental virus (NYVAC or ALVAC).
Esamnle 41 - INSERTION OF EPSTEIN BARR VIRUS (EHV) GENES
INTO AhVAC
Construction of donor lasmid EBV Tri 1e.2. Plasmid .
EBV Triple.l (Example 11) contains expression cassettes for
EBV genes gH, gB and gp340 all inserted into a vaccinia TK
locus insertion plasmid. Plasmid EBV Triple.l was digested
with SmaI/BamHI and a 0.3 kb fragment containing the 42kDa
Entomopox virus promoter and the 5' end of the EBV gH gene
was isolated. EBV Triple.l plasmid was also digested with
BamHI and a 7.3 kb fragment containing the 3' end of the EBV
gH gene, the EBV gB expression cassette, and the EBV gp340
expression cassette was isolated. These two fragments were
then ligated into the ALVAC C5 locus insertion plasmid
pNVQC5LSP7 (described herein, see Tetanus example) which had
been cut with SmaI/BamHI. The resulting plasmid was
designated EBV Triple.2.
Insertion of EBV crenes into ALVAC. Plasmid EBV
Triple.2, containing expression cassettes for the three EBV
genes, gH, gB and gp340, in the C5 insertion locus, was used
as donor plasmid for recombination with ALVAC, generating
ALVAC recombinant vCP167.
Expression of EBV Droteins by vP944 and vCP157.
Metabolically labelled lysates from cells infected with
ALVAC recombinant vCP167 and vP944, the NYVAC-based
recombinant containing the same three genes (Example 11),
were subjected to immunoprecipitation using human polyclonal
serum to EBV as well as mouse monoclonal antibodies to EBV
gB and gp340. Precipitates were analyzed by SDS-
polyacrylamide gel electrophoresis followed by
radioautography. Proteins of the correct molecular weights
and specificities for EBV gB, gH and gp340 were observed for
both NYVAC-based recombinant vP944 and ALVAC-based
recombinant vCP167.
EsamDle 42 - CONSTRUCTION OF AN EgpRE88ION CA88ETTE FOR
INSERTION ON EQUINE INFhUENZA HA
~A1/pRAGUE/56) INTO NYDAC AND AI,pAC
Purified EIV (A1/Prague/56) genomic RNA was provided by
Rhone-Merieux (Lyon, France). EIV-specific cDNA was
WO 92/15672 ~ i ~ '~ ~' r ~ PCT/US92/01906
-219- _
prepared as described by Gubler and Hoffman (1983).
Oligonucleotide EIVSIP (SEQ ID N0:278) (5'-ATCATCCT
GCAGAGCAAAAGCAGG-3') was used to synthesize first strand
cDNA. This oligonucleotide (SEQ ID N0:278) is complementary
to the 3'-end of each genomic RNA segment. As per Gubler.
and Hoffman (1983), the cDNA is dG-tailed and inserted into
pMGS digested with EcoRV and dC-tailed. Insertion of the
cDNA in this manner in pMGS creates a BamHI site on both
plasmid/cDNA sequence borders.
Five hundred colonies from this EIV cDNA library were
transferred in duplicate to LB-agar plates containing
ampicillin (50 ~g/ml). The colonies were transferred to
nitrocellulose for hybridization with a radiolabeled EIV HA-
specific probe. This probe was derived by using
radiolabeled first strand cDNA synthesized with
oligonucleotide EIVSIP (SEQ ID N0:278) and purified HA
genomic RNA as template. The HA genomic segment was
purified from a 1.2% low melting point agarose gel (Bethesda
Research Laboratories, Gaithersburg, MD). Total genomic RNA
was fractionated in this gel system run at 2 volts/cm in 1X
TBE. HA RNA was recovered by excising the HA band and
melting the agarose at 75°C followed by two cycles of phenol
extraction, one ether extraction, and ETOH precipitation.
Colony hybridization was performed according to
standard procedures (Maniatis et al., 1991) and a cDNA clone
containing a 1.4 kb HA cDNA insert was identified. The
clone was confirmed to be HA-specific by Northern blot
analysis versus genomic RNA and nucleotide sequence
analysis. This 1.4 kb fragment was used to generate a
radiolabeled HA-specific DNA probe for subsequent cDNA
library screenings.
Using the probe, other HA-specific cDNA clones were
identified. The largest were of 1.0 kb, 1.2 kb, and 1.4 kb
and they were designated as pEIVAIPHA-1, -10, and -8,
respectively. Collectively, these clones contain an entire
EIV HA coding sequence as determined by nucleotide sequence
analysis. The entire sequence of the EIV HA (A1/Prague/56)
determined from these analyses is provided in FIG. 23 (SEQ
ID N0:279). o
WO 92/1672
~1 ~ ~ '~ t ~ PCT/US92/01906
-220-
A full-length cDNA clone of the EIV HA was next
,generated by splicing segments from different cDNA clones.
The 5'-most 1200 by of the HA coding sequence was derived
from pEIVAIPHA-8 by PCR using this plasmid as template and
oligonucleotides EIVSIP (SEQ ID N0:278) and EIVAIP7A (SEQ ID
N0:280) (5'-GTTGGTTTTTTCTATTAG-3'). This 1200 by fragment
was digested with PstI creating PstI cohesive ends at both
the 5' and 3' termini. The 3'-most 600 by of the HA coding
sequence was derived from pEIVAIPHA-10 by digestion with
BamHI and PstI. These two fragments-were inserted into pBS-
SK (Stratagene, La Jolla, CA) digested with PstI and BamHI.
The plasmid generated containing the entire EIV HA
(A1/Prague/56) coding sequence was designated as
pBSEIVAIPHA.
The EIV HA coding sequence (ATG to TAA) was derived by
PCR from pBSEIVAIPHA using oligonucleotides EIVAIPHASP (SEQ
ID N0:281) (5'-CGATATCCGTTAAGTTTGTATCGTAATGAA
GACTCAAATTCTAATATTAGCC-3') and EIVAIPHA3P (SEQ ID N0:282)
(5'-ATCATCGGATCCATAAAAATTATATACAAATAGTGCACCG-3'). The
oligonucleotide EIVAIPHASP (SEQ ID N0:281) provides the 3'-
most 26 by (from NruI site) of the vaccinia virus H6
promoter (Goebel et al., 1990a,b). The 1.7 kb PCR-derived
fragment was inserted into NruI digested pCPCVi to yield
pC3EIVAIPHA. pCPCVl is an insertion vector which contains
the H6 promoter. Insertion of the 1.7 kb blunt-ended
fragment in the proper orientation places the EIV HA 3' to
the H6 promoter. The plasmid pCPCVl was derived as follows.
Plasmid pFeLVIA, which contains a 2.4 kb fragment containing
the FeLV env gene (Guilhot et al., 1987) in the PstI site of
pTPl5 (Guo et al., 1989) was digested with PstI to excise
the FeLV sequences and religated to yield plasmid pFeLVF4.
The vaccinia virus H6 promoter element followed by a
polylinker region were liberated from pFeLVF4 by digestion
with KpnI and HnaI. The 150 by fragment was blunt-ended
using T4 DNA polymerase and inserted into pRW764.2, a
plasmid containing a 3.3kb PvuII genomic fragment of
canarypox DNA. pRW764.2 was linearized with EcoRI, which
recognizes a unique EcoRI site within the canarypox
sequences, and blunt-ended using the Klenow fragment of the
~''~' 92/1672 ~ ~ ~ ~ ~ ~ ~ PCT/US92/01906
-221-
E. coli DNA polymerase. The resultant plasmid was
designated as pCPCVl. This plasmid contains the vaccinia
virus H6 promoter followed by a polylinker region and
flanked by canarypoxvirus homologous sequences.
Example 43 - CONSTRUCTION OF AN EgPRESSION CASSETTE FOR
INSERTION OF EIV HA (AZ/FONTAINEBLEAD/79)
INTO NYVAC AND ALPAC
Purified EIV (A2/Fontainebleau/79) genomic RNA was
provided by Rhone-Merieux (Lyon, France). EIV-specific cDNA
was prepared as described by Gubler and Hoffman (1983) and
as described for the EIV (A1/Prague/56) cDNA preparation.
The oligonucleotide EIVSIP (SEQ ID N0:278) was used for
first-strand cDNA synthesis.
To screen bacterial colonies containing full-length
cDNA clones of the HA gene, eight pools of transformed
colonies were amplified in 500 ml cultures and plasmid DNA
preparations obtained by standard procedures (Sambrook et
al., 1989)' Total plasmid DNA was used as template in
standard PCR reactions with oligonucleotides EIVSIP (SEQ ID
N0:278) and EIVS2H (SEQ ID N0:283) (5'-ATCATCAAGCTTAGTAGAAA
CAAGG-3'). Such a reaction would potentially amplify only
full-length cDNA sequences of all eight EIV genomic
segments, since these primers were complementary to
conserved sequences at the 5' and 3' ends of these eight
segments.
Plasmid preparation, pPEIVA2F-5, as template generated
a 1.8 kb PCR-derived fragment consistent with the size of a
full-length HA-specific fragment. This PCR-derived fragment
was re-amplified by PCR for use as a probe against the
remainder of the cDNA library. Using this probe, clones
pEIVA2FHA-7 and -8 were identified and the cDNA insert
analyzed by nucleotide sequence analysis using custom
synthesized oligonucleotides (Goebel et al., 1990a).
Nucleotide sequence analysis demonstrated that clones
#7 and #8 represented the 3'-most 1200 by of the EIV
(A2/Fontainebleau/79) HA coding sequence (FIG. 24) (SEQ ID
N0:284).
The 1200 by EIV sequence was amplified from clone #7 by
PCR using oligonucleotides A2F3P (SEQ ID N0:285)
V1'O 92/15672 ~ ~ U ~ N ~ ~ PCT/US92/01906
-222-
(5'-ATCATCACTAGTATAAAAATCAAATGCAAATGTTGCATCTGATGTTGCC-3')
,and A2FBAM2 (SEQ ID N0:286) (5'-ATCATCGGATCCATCACCCG
AGCACAAACAATGAGCAG-3.'). The 5'-end of this 1200 by fragment
after digestion with BamHI corresponds to nucleotide 617 of
the complete EIV (A2/Fontainebleau/79) HA coding sequence in
FIG. 24 (SEQ ID N0:284). This fragment was also digested
with SpeI which was engineered 3' to the coding sequence
using oligonucleotide A2F3P (SEQ ID N0:285). This 1200 by
fragment was to be co-inserted into SmaI/SpeI digested pBS-
SK (Stratagene, La Jolla, CA) with a fragment containing the
5'-most 616 by (defined below). However, screening of
potential transformants demonstrated that only the 1200 by
fragment was inserted. Numerous clones were chosen for
nucleotide sequence analysis.
After nucleotide sequence analysis of numerous clones,
pBSEIVA2FHA-19 was chosen for further manipulation. This
clone contained errors near the BamHI site at nucleotide 617
(FIG. 24) (SEQ ID N0:284) and at nucleotide 1570 (FIG. 24)
(SEQ ID N0:284). To correct these errors, the following
manipulations were made. Plasmid pBSEIVA2FHA-19 was
digested with BamHI and SphI and the excised 900 by fragment
was isolated. This fragment was co-inserted into pBS-SK
digested with SpeI/BamHI with a 250 by SphI/Spel fragment
encompassing the 3'-most region of the HA coding sequence.
This 250 by PCR fragment was derived using clone #7 (above)
as template and oligonucleotides A2F3P (SEQ ID N0:285) and
A2F6 (SEQ ID N0:287) (5'-TTGACTTAACAGATGCAG-3'). The
resultant plasmid was designated as pEIVH33P.
The 5'-most 616 by of the HA coding sequence for the
EIV HA was generated in the following manner. First, first-
stand cDNA was generated as above. This first-strand cDNA
preparation was then used as template to amplify these
sequences by PCR using oligonucleotides A2F5P (SEQ ID
N0:288) (5'-ATGAAGACAACCATTATTTTG-3') and A2FBAM1 (SEQ ID
N0:289) (5'-TGTTGAGACTGTTACTCG-3'). This fragment was
inserted into HincII digested pBS-SK (Stratagene, La Jolla,
CA) and the resultant plasmid called pEIVH35P.
The vaccinia virus H6 promoter sequence (Goebel et al.,
1990a,b) and the 5'-most region of the HA coding sequence
~~~~i~~ f
~'.~'~! 92/1672 PCT/US92/01906
-223-
were amplified and fused in the following manner. The H6
sequences were derived from a pBS-based plasmid containing
the HIV-1 (IIIB) env gene linked precisely to the H6
promoter called pBSH6IIIBE. These sequences were amplified
by PCR using oligonucleotides H65PH (SEQ ID N0:164)
(5'-ATCATCAAGCTTGATTCTTTATTCTATAC-3') and H63P (SEQ ID
N0:291) (5'-TACGATACAAACTTAACGG-3'). The 120 by H6 fragment
was used as template with oligonucleotides H65PH (SEQ ID
N0:164) and EIVSPACC (SEQ ID N0:292) (5'-GGTTGGGTTTTGAC
TGTAGACCCAATGGGTCAGTAGTATCAAAATAATGGTTGTCTTCATTACGATACAAACTT
AACGG-3') to yield a 161 by fragment containing the H6
promoter and the initial 41 by of the HA coding sequence to
the AccI restriction site. This fragment was digested with
HindIII and AccI and co-inserted into HindIII/BamHI digested
pBS-SK with the 550 by AccI/BamHI fragment from pEIVH35P.
The resultant plasmid was designated as pH6EIVH35P.
The entire HA expression cassette was derived by co-
insertion of the 710 by HindIII/BamHI fragment from
pH6EIVH35P and the 1200 by BamHI/SpeI fragment from pEIVH33P
into pBS-SK digested with HindIII and SpeI. The derived
plasmid was designated as pBSA2FHAB.
To correct the base change noted above near the BamHI
site at nucleotide position 617, the Mandecki procedure
(Mandecki, 1986) was employed. pBSA2FHAB was linearized
with BamHI and the mutagenesis procedure performed using
oligonucleotide A2F7 (SEQ ID N0:293) (5'-CAATTTCGATAAAC
TATACATCTGGGGCATCCATCACCCGAGCACAAACAATGAGCAGACAAAATTG-3').
The plasmid containing the corrected version of the HA was
designated pBSA2FHA.
EgamDle 44 - CONSTRUCTION OF THE INSERTION PLASMIDS
pEIVCSL AND pEIVHAVQV'V USED TO GENERATE
vCP128 and vP961, RESPECTIVELY
Plasmid pC3EIVAIPHA was digested with NruI and HindIII
to excise the l.7kb fragment containing the 3'-most 26 by of
the H6 promoter and the entire EIV (A1/Prague/56) HA coding
sequence. Following blunt-ending with Klenow, this fragment
was inserted into plasmid pRW838 digested with NruI/EcoRI
and blunt-ended with Klenow to provide plasmid pCSAIPHA.
The plasmid pRW838 contains the rabies G gene (Kieny et al.,
1984) fused to the vaccinia H6 promoter in a canarypox
WO 92/15672
PCT/US92/01906 ._
~;~~;.i
-224
insertion plasmid (C5 locus). Digestion with NruI and EcoRI
excises the rabies G gene leaving behind the 5'-most 100 by
of the H6 promoter and the CS flanking arms.
The plasmid pCSAIPHA was digested with SmaI and SacI to
excise an 820 by fragment containing the H6 promoter and the
5'-most 645 by of the EIV (A1/Prague/56) coding sequence.
This fragment was co-inserted into pBS-SK digested with
HindIII and SmaI with a 1.1 kb SacI/HindIII fragment from
pC3EIVAIPHA containing the remainder of the HA coding
sequence. The resultant plasmid was designated as
pBSAIPHAVQ.
Plasmid pBSAIPHAVQ was then linearized with SpeI and
SmaI. This 4.7 kb fragment was ligated to a 1.8 kb
S_peI/partial HincII fragment derived from pBSA2FHA. The
resultant pBS-based plasmid, containing the EIV
(A1/Prague/56) and (A2/Fontainebleau/79) HA genes in a head
to head configuration, was designated as pBSAIPA2FHAVQ.
A NotI/XhoI fragment (3.5 kb) derived from pBSAIP2FHAVQ
containing the two HA genes was isolated and inserted into
pSD542 (described below for EIV (A2/Suffolk/89) and pCSL to
provide the insertion plasmids pEIVHAVQW and pEIVCSL,
respectively.
The C5L insertion plasmid was derived as follows.
Using the cosmid vector pVK102 (Knauf and Nester, 1982), a
genomic library for vCP65 (ALVAC-based rabies G recombinant
with rabies in C5 locus) was constructed. This library was
probed with the 0.9 kb PvuII canarypoxvirus genomic fragment
contained within pRW764.5 (C5 locus). These canarypox DNA
sequences contain the original insertion locus. A clone
containing a 29 kb insert was grown up and designated
pHCOSi. From this cosmid containing C5 sequences, a 3.3 kb
Cla fragment was subcloned. Sequence analysis from this
ClaI fragment was used to extend the map of the C5 locus
from 1-1372.
The C5 insertion vector, pCSL, was constructed in two
steps. The 1535 by left arm was generated by PCR
amplification using oligonucleotides C5A (SEQ ID N0:294)
(5'-ATCATCGAATTCTGAATGTTAAATGTTATACTTTG) and C5B (SEQ ID
N0:~295) (GGGGGTACCTTTGAGAGTACCACTTCAG-3'). The template DNA
WO 92/1672 ~ . - ° PCT/US92/01906
~1~~~'~'~
-225-
was vCP65 genomic DNA. This fragment was cloned into
EcoRI/SmaI digested pUC8. The sequence was confirmed by
standard sequencing protocols. The 404 by right arm was
generated by PCR amplification using oligonucleotides C5C
(SEQ ID N0:296) (5'-ATCATCCTGCAGGTATTCTAAACTAGGAATAGATG-3')
and CSDA (SEQ ID N0:297) (5'-ATCATCCTGCAGGTATTC
TAAACTAGGAATAGATG-3'). This fragment was then cloned into
the vector previously generated containing the left arm
digested with SmaI/PstI. The entire construct was confirmed
by standard sequence analysis and designated pCSL. This
insertion plasmid enables the insertion of foreign genes
into the C5 locus.
EuamDle 45 - CONBTROCTION OF INSERTION pLABMIDB TO
GENERATE ALVAC- AND NYVAC-BASED RECOMBINANTS
EBPREBBING INFLUENZA VIRUS (A2/BUFFOLK/89)
HEMAGGLUTININ GENE
An M13 clone containing the hemagglutinin (HA) gene
from equine influenza virus (A2/Suffolk/89) was provided by
Dr. M. Binns (Animal Health Trust, P.O. Box 5, Newmarket,
Suffolk, CB8 7DW, United Kingdom). This clone contains a
full-length 1.7 kb cDNA fragment containing this HA gene
inserted into the M13 vector via the HindIII site.
Initially, the equine influenza virus (EIV) HA gene was
amplified from the above M13 clone by PCR using
oligonucleotides EIVS1 (SEQ ID N0:298) (5'-ATGAAGACAACC
ATTATTTTG-3') and EIVS2 (SEQ ID N0:299) (5'-TCAAATGCAAA
TGTTGCATCT-3'). This 1.7 kb fragment was ligated into pBS-
SK (Stratagene, La Jolla, CA) digested with SmaI. Two
positive clones were derived and analyzed by nucleotide
sequence analysis (Goebel et al., 1990a). Clone A contained
one non-conserved base change while clone B contained three
such changes compared to the sequence provided in FIG. 25
(SEQ ID N0:300). To generate a full-length correct version
of the EIVHA gene, clone B was digested with SacI and MscI
to excise a 390 by fragment. This fragment was ligated into
a 4.3 kb MscI/partial SacI fragment derived from clone A.
This provided a corrected EIVHA and was designated as
pBSEIVHS.
The 5'-most 360 by of the EIVHA coding sequence was
derived from pBSEIVHS by PCR using oligonucleotides I3L5EIV
PCT/US91/01906 .
-226-
(SEQ ID N0:301) (5'-GTTTAATCATGAAGACAACCATTATTTTGATAC-3')
and EIVPVU (SEQ ID N0:302) (5'-AGCAATTGCTGAAAGCGC-3'). The
entire I3L promoter region (Goebel et al., 1990a,b) was
derived from pMPI3L101 by PCR using oligonucleotides I3L5B5
(SEQ ID N0:303) (5'-ATCATCGGATCCCGGGACATCATGCAGTGGTTAAAC-3')
and EIV5I3L (SEQ ID N0:304) (5'-CAAAATAATGGTTGTCTTCATGAT
TAAACCTAAATAATTGTAC-3'). These fragments were fused due to
the complementary conferred by the engineering of
oligonucleotides I3L5EIV (SEQ ID N0:301) and EIV5I3L (SEQ ID
N0:304) by PCR with oligonucleotides I3L5B5 (SEQ ID N0:303)
and EIVPVU (SEQ ID N0:302) to yield a 480 by fragment.
Plasmid pMPI3L101 contains an expression cassette
consisting of the gene encoding the rabies glycoprotein
under the control of the I3L promoter, all inserted into a
vaccinia insertion plasmid deleted for ORFS C6L-K1L (Goebel
et al., 1990a,b). The I3L promoter consists of lOl.bases
(nt 64,973-65,074 Goebel et al., 1990a,b) immediately
upstream from the initiation codon of the ORF I3L.
The above derived fusion fragment linking the I3L
promoter precisely to the 5' region of the EIVI3A coding
sequence was digested with BamHI (5'-end) and AccI (3'-end)
and the 400 by fragment isolated. This fragment was ligated
to a 4.6 kb BamHI/partial Accl fragment derived from
pBSEIVHS and the resultant plasmid designated as
pBSEIVHSI3L.
A 1.8 kb SmaI/XhoI fragment containing the EIVFiA
expression cassette was derived from pBSEIVHSI3L. This
fragment was inserted into a SmaI/XhoI digested pSD542
(described in Example 32) insertion vector to yield
pTKEIVHSI3L.
The 1.8 kb SmaI/XhoI fragment from pBSEIVHEI3L (above)
was inserted into the CPpp (ALVAC) insertion plasmid,
VQCP3L, digested with SmaI/XhoI. The resultant plasmid was
designated as pC3EIVHSI3L.
Insertion plasmid VQCP3L was derived as follows.
VQCPCP3L was derived from pSPCP3L (defined in Example 32) by
digestion with XmaI, phosphatase treating the linearized
plasmid, and ligation to annealed, kinased oligonucleotides
CP23 (S~Q ID'N0:305) (5'-CCGGTTAATTAATTAGTTATTAGACAAGG
V1'O 92/16'2
PCT/US92/01906
~~.~'JN~7
-227-
TGAAAACGAAACTATTTGTAGCTTAATTAATTp,GGTCACC-3') and CP24 (SEQ
ID N0:306) (5'-CCGGGGTCGACCTAATTAATTAAGCTACAAATAGTTTCGTTT
TCACCTTGTCTAATAACTAATTAATTAA-3').
Example 46 - DEVELOPMENT OF ALVAC-EQUINE INFLUENZA VIRUS
RECOMBINANTS
Plasmid pEIVCSL contains the hemagglutinin coding
sequences for equine-1, A1/Prague/56 (H7) and equine-2,
A2/Fontainebleau/79 (H3). Both genes are linked to the
vaccinia virus H6 promoter and inserted at the de-orfed C5
locus. ALVAC virus was used as the rescuing virus in in
vitro recombination to rescue the inserted DNA. Positive
plaques were selected on the basis of hybridization to H7
and H3 coding sequences. Recombinant plaques were plaque
purified until a pure population containing both foreign
genes was achieved. At this time the recombinant was
declared vCP128 and a stock virus was established.
Immunofluorescence analysis was performed using a monoclonal
antibody specific for the H3 hemagglutinin and a polyclonal
anti-H7 serum from horse. Surface fluorescence was detected
on vCP128 infected VERO cells using both reagents indicating
that both antigens were appropriately presented on the
infected cell surface.
Immunoprecipitation analysis using the H3 specific
monoclonal antibodies demonstrated the presence of a protein
of approximately 75 kd in vCP128 infected CEF cells. This
potentially represents the HAo precursor glycoprotein. No
cleavage products were detected. Immunoprecipitation
analysis using the H7 specific polyclonal serum demonstrated
the presence of a precursor glycoprotein of approximately 75
kd. The HA1 and HA2 cleavage products with molecular
weights of approximately 45 and 30 kd respectively were also
visualized.
Plasmid pC3EIVHS13L contains the hemagglutinin coding
sequence of the equine-2 A2/Suffolk/89 subtype. The gene is
linked to the vaccinia virus I3L promoter and inserted at
the de-orfed C3 insertion site. ALVAC virus was used as the
rescuing virus in in vitro recombination to rescue the
foreign gene. Recombinant plaques were selected on the
basis of hybridization to a H3 specific radiolabelled probe.
WO 92/156?2 p~./US92/01906
2~~~z7'~ .
-228-
Positive plaques were plaque purified until a pure
recombinant population was achieved. At this time the
recombinant was declared vCP159 and a virus stock
established. Immunofluorescence analysis on vCP159 infected
CEF cells using an H3 specific serum polyclonal from chicken.
indicated that an immunologically recognized protein was
expressed on the infected cell surface.
Euample 47 - DEVELOPMENT OF NYVAC RECOMBINANTS CONTAINING
THE HEMAGGLUTININ GLYCOPROTEINB OF EQUINE
INFLUENZA VIRUS SUBTYPES
Plasmid pEIVHAVQW contains the sequences encoding
equine-1, A1/Prague/56 (H7) and equine-2 A2/Fontainebleau/79
(H3). Both genes are linked to the vaccinia virus H6
promoter and inserted at the TK site. NYVAC (vP866) was
used as the rescuing virus in in vitro recombination to
rescue the foreign genes. Recombinant plaques were selected
on the basis of hybridization to radiolabelled H3 and H7
specific proteins. Recombinant progeny virus was plaque
purified until a pure population was achieved. At this time
the recombinant was declared vP961 and a virus stock
established. Immunofluorescence analysis using a H3
specific monoclonal antibody and a polyclonal anti-H7 serum
indicated that both glycoproteins were expressed on the
infected cell surface. Immunoprecipitation analysis with
the same reagents indicated that the H3 glycoprotein was
expressed as a precursor glycoprotein with a molecular
weight of approximately 75 kd. No cleavage products were
evidenced. The H7 glycoprotein was evident as a precursor
glycoprotein of approximately 75 kd and HA1 and HA2 cleavage
products with molecular weights of approximately 45 and 30
kd, respectively.
Plasmid pTKEIVHSI3L contains the coding sequence of the
equine-2 A2/Suffolk/89 hemagglutinin glycoprotein. The
coding sequence is linked to the I3L promoter and inserted
at the TK site. NYVAC (vP866) was used as the rescuing
virus and recombinant plaques selected on the basis of
hybridization to a H3 specific radiolabelled probe.
Recombinant plaque progeny were plaque purified until a pure
' population was achieved. At this time the recombinant was
declared vP1063 and a virus stock established.
WO 9Z/15672 ~l ~ ~ v N '~ PCT/US9
-229-
Immunofluorescence analysis using a polyclonal anti-H3 serum
from chicken indicated that an immunologically recognized
protein was expressed on the infected cell surface.
Esam~le 48 - CON8TROCTION OF PACCINIA VIRUS/FEhV
INSERTION PLABMIDS
_ ~ FeLV (Feline Leukemia Virus) env DNA sequences were
supplied by Dr. F. Galibert (Laboratories d'Hematologie
Experimentale Hospital Saint-Luis, Paris, France) in the
form of a 2.4 kbp FeSV-SM DNA (Guilhot et al.., 1987)
fragment inserted into an M13mp8 vector (Messing, 1983).
This 2.4 by PstI/KpnI fragment containing,the entire open
reading frame (FeLV p70 + pl3E) was isolated and inserted
.into pUCl8 (Messing, 1983) for convenience. The KpnI site
at the 3' end of the env sequences were converted to a PstI
site and the 2.4 kbp PstI fragment was isolated and ligated
into PstI digested pTplS (Guo et al., 1989). The resultant
plasmid was designated pFeLVIA.
In vitro mutagenesis (Mandecki, 1986) was used to
convert pFeLVIA to pFeLVIB. This was done using
oligonucleotide SPBGLD (SEQ ID N0:307) (5'-AATAAATCAC
TTTTTATACTAATTCTTTATTCTATACTTAAAAAGT-3'). Mutagenesis with
this oligonucleotide enabled the removal of the BQ1II site
at the border of the H6 promoter and HA sequences. This
provides the actual. sequences of these DNA segments as found
in the virus.
Plasmid pFeLVIB was then mutagenized with
oligonucleotide FeLVSP (SEQ ID N0:308) (5'-CGCTATAGG
CAATTCAAACATAGCATGGAAGGTCCAAACGCACCCA-3') to create pFeLVIC.
In vitro mutagenesis was done as described by Mandecki
(1986) with the following modification. Following digestion
of pFeLVIB at the unique SmaI site, the DNA was digested
with Ba131. At times 5 sec., 10 sec., 20 sec., 40 sec., and
~80 sec., aliquots were taken and the reaction terminated by
adding EGTA to a final concentration of 20mM. The aliquots
were pooled and used in the mutagenesis reaction. Resultant
plasmid, pFeLVIC, contained the FeLV env gene juxtaposed 3'
to the vaccinia virus H6 promoter such that there exists and
ATG to ATG substitution. The plasmid, pFeLVIC, was used in
in vitro recombination tests with vP425 as the rescuing
PCT/US92/01906 .
-230-
virus to construct a recombinant vaccinia virus (vP453)
which expresses the entire FeLV envelope glycoprotein.
The plasmid pFeLVIC was used as a reagent to generate
pFeLVID. This recombinant plasmid contains the entire FeLV
env gene except it lacks the putative immunosuppressive
region (Cianciolo et al., 1985; Mathes et al., 1978). The
sequence encoding the immunosuppressive region (nucleotide
2252-2332 of sequence in Guihot et al., 1987) was deleted by
in vitro mutagenesis (Mandecki, 1986) in the following
manner. The plasmid, pFeLVIC, was linearized with BsmI.
The linearized plasmid was treated with Ba131 and aliquots
were taken at 1 min., 2 min., 4 min., and 8 min. and pooled
for use in the mutagenesis reaction. In vitro mutagenesis
was done using oligonucleotide FeLVISD (SEQ ID N0:309)
(5.'-ACCTCCCTCTCTGAGGTAGTCTATGCAGATCACACCGGACTCG
TCCGAGACAATATGGCTAAATTAAGAGAAAGACTAAAACAGCGGCAGCAACTGTTTGACT
CCCAACAG-3'). The resultant plasmid, pFeLVID, was used in
in vitro recombination tests with vP410 as the rescuing
virus to generate vP456. This vaccinia virus recombinant
was generated to express the entire envelope glycoprotein
lacking the putative immunosuppressive region.
Example 49 - CONBTRUCTIOH OF AVIPOgVIRUB/FeLV
INSERTION PLA8MID8
For construction of the FP-1 recombinants, the 2.4 kbp
H6/FeLV env sequences were excised from pFELVIA (described
above) with B~lII and by partial digestion with PstI. The
BalII site is at the 5' border of the H6 promote sequence.
The PstI site is located 420 by downstream from the
translation termination signal for the envelope glycoprotein
open reading frame.
The 2.4 kbp H6/FeLV env sequence was inserted into
pCEll digested with BamHi and PstI. The FP-1 insertion
vector pCEll, was derived from pRW731.13 by insertion of a
multiple cloning site into the nonessential HindII site.
This insertion vector allows for the generation of FP-1
genome. The recombinant FP-1/FeLV insertion plasmid was
then designated pFeLVFl. This FP-1/FeLV insertion plasmid
was then designated pFeLVFl. This construction does not
provide a precise ATG for ATG substitution.
WO 92/1672
PCf/US92/01906
J
-231-
To achieve the precise ATG:ATG construction, a
NruI/SstII fragment of approximately 1.4 kbp was derived
from the vaccinia virus insertion vector pFeLVIC (described
herein). The NruI site occurs within the H6 promoter at a
positive 24 by upstream from the ATG. The SstII site is
located 1.4 kbp downstream from the ATG and 1 kbp upstream
from the translation termination codon. The NruI/SstII
fragment was ligated to a 9.9 kbp fragment which was
generated by digestion of pFeLVFl with SstII and by partial
digestion with NruI. This 9.9 kbp fragment contains the 5.5
kbp FP-1 flanking arms, the pUC vector sequences, 1.4 kbP of
FeLV sequence corresponding to the downstream portions of
the env gene, and the 5'-most portion (approximately 100 bp)
of the H6 promoter. The resultant plasmid was designated
pF.eLVF2. The precise ATG:ATG construction was confirmed by
nucleotide sequence analysis. ,
A further FP-1 insertion vector, pFeLVF3, was derived
from FeLVF2 by removing the FeLV env sequences corresponding
to the putative immunosuppressive region (described above).
This was accomplished by isolating a PstI/SstII fragment of
approximately 1 kbp obtained from the vaccinia virus
insertion vector, pFeLVID (described above), and inserting
this fragment into a 10.4 kbp PstI/SstII fragment containing
the remaining H6/FeLV env gene derived by digestion of
pFeLVF2 with PstI and SstII.
The insertion plasmids, pFeLVF2 and pFeLVF3, were using
in in vitro recombination tests with FP-1 as the rescuing
virus. Progeny virus was plated on primary chick embryo
fibroblast (CEF) monolayers obtained from 10 day old
embryonated eggs (SPAFAS, Storrs, CT) and recombinant virus
screened for by plaque hybridization on CEF monolayers.
Recombinant progeny identified by hybridization analyses
were selected and subjected to four round of plaque
purification to achieve a homogeneous population. An FP-1
recombinant harboring the entire FeLV env gene has been
designated vFP25 and an FP-1 recombinant containing
designated vFP32.
For construction of the CP recombinants, a 2.2 by
fragment containing the H6/FeLV env sequences were excised
WO 92/15672 ~ ~ ~ ~. E~
PCf/US92/01906
r.:,:' :,
-232-
from pFeLVF2 and pFeLVF3 by digestion with KpnI and HpaI.
The KpnI site is at the 5' border of the H6 promoter
sequence. The H,~aI site is located 180 by downstream from
the translation termination signal for the envelope
glycoprotein open reading frame. These isolated fragments
were blunt-ended. These 2.2 kbp H6/FeLV env sequences were
inserted into the nonessential EcoRI site of the insertion
plasmid pRW764.2 following blunt-ending of the EcoRI site.
This insertion vector enables the generation of CP
recombinants harboring foreign genes in the C3 locus of the
CP genome. The recombinant CP insertion plasmid was then
designated pFeLVCP2 and pFeLVCP3, respectively.
The insertion plasmids, pFeLVCP2 and pFeLVCP3, were
used in in vitro recombination tests with CP as the rescuing
virus. Progeny of the recombination were plated on primary
CEF monolayers obtained from 10 day old embryonated eggs
(SPAFAS, Storrs, CT) and recombinant virus selected by
hybridization using radiolabeled FeLV DNA as a probe.
Positive hybridizing plaques were selected and subjected to
four rounds of plaque purification to achieve a homogeneous
population. A recombinant expressing the entire FeLV env
gene has been designated vCP35 and a recombinant expressing
the entire env gene lacking the immunosuppressive region was
designated vCP37.
Example 50 - aSNERATION OF AN aLVAC-BASED RECOMBINANT
CONTAINING THE FeLV-H env GENE
Plasmid pFeLV env 24 was obtained from Rhone-Merieux
(Lyon, France) and contains the FeLV-B env gene. The
plasmid contains a 4.2 kb cDNA derived fragment derived from
the NCE161 FeLV strain. Plasmid pFeLV env 34 contains the
4.2 kb FeLV-B-specific insert in the SmaI site of pBS-SK
(Strategene, La Jolla, CA). The sequence of the FeLV-B env
gene is presented in FIG. 26 (SEQ ID N0:310). In this
sequence the initiation codon (ATG) and termination codon
(TGA) are underlined.
The expression cassette for the FeLV-B env was
constructed as follows. The vaccinia virus H6 promoter was
derived from plasmid pI4LH6HIV3B (described herein with
respect to HIV) by PCR using oligonucleotides H65PH (SEQ ID
VI'O 92/15672 PCT/US92/O1
~1~~ ~ ~'~
-233-
N0:164) (5'-ATCATCAAGCTTGATTCTTTATTCTATAC-3') and H63PFB
(SEQ ID N0:311) (5'-GGGTGCGTTGGACCTTCCATTACGATAGAAACTTA
ACGG-3'). Amplification of these sequences with these
oligonucleotides generated an H6 promoter with a 5' HindIII
site and a 3'-end containing the initial 20 by of the FeLV-B
env coding sequence.
The 5'-portion of the FeLV-B env gene was derived by
PCR from pFeLV-B env 34 using oligonucleotides FBSP (SEQ ID
N0:312) (5'-CCGTTAAGTTTGTATCGTAATGGAAGGTCCAAGCG-3') and
FBSPA (SEQ ID N0:313) (5'-GGGTAAATTGCAAGATCAAGG-3'). This
PCR-derived fragment contains homology to.the 3'-most 23 by
of the H6 promoter (5'-end) and a unique ApaI site at
position 546. The H6 promoter was fused to the 5'-end of
the FeLV-B env gene by PCR using the two PCR fragments
defined above as template and oligonucleotides FBSPA (SEQ ID
N0:313) and H65PH (SEQ ID N0:164). The PCR fusion.fragment
was digested with HindIII and A_paI to yield a 680 by
fragment.
Plasmid pFeLV-B env 34 was digested with A_paI and NcoI .
to liberate a 740 by fragment containing the middle portion
of the env gene (FIG. 26). The 3'-end of the gene was
derived by PCR using pFeLV-b env 34 as template and
oligonucleotides FBTSD (SEQ ID N0:314) (5'-CCCCATGCATTT
CCATGGCAGTGCTCAATTGGACCTCTGATTTCTGTGTCTTAATAG-3') and FB3PX
(SEQ ID N0:315) (5'-ATCATCTCTAGAATAAAAATCATGGTCGGTCCG
GATC-3'). PCR amplification of the 3' portion of the env
gene with these oligonucleotides eliminated a TSNT element
at position 1326-1332. This sequence was altered by making
a T to C substitution at position 1329 (FIG. 26). This
change does not alter the amino acid sequence of the env
gene product. The 3'-end of the gene was engineered with an
XbaI site and a TSNT sequence. The 5'-end of this PCR-
derived fragment also contains a unique NcoI site
(corresponds with that at position 1298; FIG. 26). This
fragment was digested with NcoI and XbaI to generate a 707
by fragment.
The 740 by NcoI/ApaI and 707 by NcoI/XbaI fragments
' were co-inserted into pBS-SK digested with ApaI and XbaI.
The resultant plasmid was designated as pBSFB3P. The 1.5 kb
PCT/US92/01906
-234-
A_paI/XbaI fragment from pBSFB3P was then co-inserted into
pBS-SK, digested with HindIII and XbaI, with the 680 by PCR
fragment containing the H6 promoted 5'-end of the FeLV-B env
gene (above). The resultant plasmid was designated as
pBSFEB.
The 2.2 kb HindIII/XbaI fragment from pBSFEB,
containing the H6 promoted FeLV-B env gene, was isolated and
blunt-ended with the Klenow fragment. This blunt-ended
fragment was inserted into pCSL (see discussion regarding
HIV herein) digested with SmaI to yield pCSLFEB.
Plasmid pCSLFEB was used in standard in vitro
recombination assays with ALVAC(CPpp) as the rescue virus.
Recombinant plaques were identified using FeLV-B env
specific DNA probes. Following three round of plaque
purification, the virus was propagated and designated as
vCP177.
Example 51 - GENERATION OF AN ALVAC-FeLV-A ENV
RECOMBINANT VIRUB
The plasmid pFGA-5 from which the FeLV-A env sequences
were derived was provided by Dr. J. Neil (University of
Glasgow) and described previously (Stewart et al., 1986).
Initially,, the 531 by PstI/HindIII fragment corresponding to
nucleotides 1 to 531 (Stewart et al., 1986) was excised and
ligated into pCPCVl digested with PstI and HindIII and
designated as pC3FA-1. The plasmid pCPCVl was derived as
follows. Plasmid pFeLVIA was digested with PstI to excise
the FeLV sequences and religated to yield plasmid pFeLVF4.
The vaccinia virus H6 promoter element (Taylor et al., 1988)
followed by a polylinker region were liberated from pFeLVF4
by digestion with KpnI and H~aI. The 150 by fragment was
blunt-ended using T4 DNA polymerase and inserted into
pRW764.2, a plasmid containing a 3.3kb PvuII genomic
fragment of canarypox DNA. pRW764.2 was linearized with
EcoRI, which recognizes a unique EcoRI site within the
canarypox sequences, and blunt-ended using the Klenow
fragment of the E. coli DNA polymerase. The resultant
plasmid was designated as pCPCVl. This plasmid contains the
vaccinia virus H6 promoter followed by a polylinker region
and flanked by canarypoxvirus homologous sequences.
WO 92/1672 ,~ ,~ ;~, tr PCT/US92/01906
-235-
The plasmid pC3FA-1 was linearized with PstI and
mutagenized in an in vitro reaction via the Mandecki
procedure (1986) using oligonucleotide FENVAH6-1 (SEQ ID
N0:316) (5'-CCGTTAAGTTTGTATCGTAATGGAAAGTCCAACGCAC-3'). The
in vitro mutagenesis procedure removed extraneous 5'-
. ~ noncoding sequences resulting in a precise ATG:ATG
configuration of the vaccinia H6 promoter element and the
FeLV-A env sequences. The resultant plasmid was designated
as pH6FA-1.
The remainder of the FeLV-A env gene was derived from
pFGA-5 by standard PCR using custom synthesized
oligonucleotides (Applied Biosystems, San Rafael, CA). An
836 by PCR fragment was derived using pFGA-5 as template and
the oligonucleotides FENVA-2 (SEQ ID N0:317) (5'-CCATAATTCG
ATTAAGACACAGAATTCAGAGGTCCAATTGAGCACC-3') and FENVAH (SEQ ID
N0:318) (5'-CAAGATGGGTTTTGTGCG-3'). This fragment .
corresponds to nucleotides 488 to 1327 of the FeLV-A env
gene (Stewart et al., 1986). The use of oligonucleotide
FENVA-2 (SEQ ID N0:317) alters the nucleotide sequence at
positions 1301 to 1309 from GATSGT to GAATTCTGT. This
alteration eliminates the TSNT sequence motif known to be
recognized as a poxvirus early transcription termination
signal (Yuen and Moss, 1987) and introduces an EcoRI
restriction site at this position. These nucleotide
manipulations change amino acid 414 from glutamic acid to
. the conserved amino acid aspartic acid (Stewart et al.,
1986). Amino acid 415 is not altered by these nucleotide
changes. This 836 by fragment was digested with HindIII and
EcoRI to generate a 770 by fragment corresponding to
nucleotides 532 to 1302 of the FeLV-A env gene.
A 709 by PCR fragment was derived using pFGA-5 as
template and the oligonucleotides FENVA-3 (SEQ ID N0:319)
(5'-GGTGCTCAATTGGACCTCTGAATTCTGTGTCTTAATCGAATTATGG-3') and
FENVA-4 (SEQ ID N0:320) (5'-ATCATCAAGCTTTCATGGTCGGTCCGG-3').
This fragment corresponds to nucleotides 1281 to 1990 of the
FeLV-A env gene (Stewart et al., 1986). Using
oligonucleotide FENVA-3 (SEQ ID N0:319) to amplify this
fragment also alters the TSNT element and introduces an
EcoRI site as above for the 836 by PCR derived fragment.
WO 92/15672 ~ ~ l~ v ~ 4 pCf/US92/01906
-236-
The 709 by fragment was digested with EcoRI/HindIII and the
resultant fragment was co-inserted with the 770 by
HindIII/EcoRI fragment, derived from the 836 by fragment
(above), into pBS-SK (Stratagene, La Jolla, CA) digested
with HindIII. The resultant plasmid was designated as
pF3BS1-B and the FeLV env sequences were confirmed by
nucleotide sequence analysis.
To reconstruct the entire FeLV-A env gene linked
precisely to the vaccinia virus H6 promoter, a 1.5 kb
HindIII fragment was isolated from pF3BS1-B. This fragment
corresponds to nucleotides 532 to 1990 of the FeLV-A env
(Stewart et al., 1986). The 1.5 kb HindIII fragment was
ligated to pH6FA-1 digested with HindIII. Plasmid
constructs containing the 1.5 kb HindIII fragment were
screened for the proper orientation by restriction analysis
and a plasmid clone containing the entire intact FeLV-A env
gene linked to the H6 promoter was designated as pH6FA-3.
The 2.2 kb H6/FeLV-A env expression cassette was
excised from pH6FA-3 by partial digestion with EcoRI
followed by a partial digestion with HindIII. The fragment
was inserted into pRW831 digested with HindIII and EcoRI.
The resultant plasmid was designated as pCSFA.
pRW831 refers to an ALVAC (CPpp) insertion plasmid
which enables the insertion of foreign genes into the C5
open reading frame. In the process of insertion into this
' region, the use of pRW831 causes the deletion of most of the
C5 open reading frame. To generate pRW831 the following
manipulations were done. An 880 by PvuII genomic fragment
from the canarypoxvirus genome was inserted between the
PvuII sites of pUC9. The canarypox sequences contained
within the resultant plasmid, pRW764.5, was analyzed by
nucleotide sequence analysis and the C5 open reading frame
was defined. Previously, insertion between a pair of BglII
sites situated within the C5 ORF was used to engineer
recombinants at this locus (Taylor et al., 1992). The
sequence of the entire region is provided in FIG. 16 (SEQ ID
N0:220). The nucleotide sequence begins (SEQ ID N0:220) at
the PvuII site. The C5 ORF initiates at position 166 and
terminates at nucleotide 487. Precise manipulation of these
V1'O 92/1672 PCT/US92/ - ___ __
~~~Jr.'~~~~
-237- a
sequences enabled the deletion of nucleotides 167 through
455. 'Such a deletion was made so as not to interrupt the
expression of other viral genes.
The procedure to derive pRW831 is as follows. pRW764.5
was partially digested with RsaI and the linearized fragment.
was isolated. The RsaI linear fragment was redigested with
BalIII. The resultant 2.9 kb RsaI/BQlII fragment (deleted
of nucleotides 156 through 462) was isolated and ligated to
annealed oligonucleotides RW145 (SEQ ID N0:107) and RW146
(SEQ ID N0:108). The resultant plasmid was designated as
pRW831 and contains a sequence with unique HindIII, SmaI,
and EcoRI sites in place of the C5 sequences.
Plasmid pCSFA was used in recombination experiments
with ALVAC(CPpp) as the rescuing virus. Recombinant viruses
were identified by in situ plague hybridization using a
radiolabeled FeLV-A env-specific probe. Following,three
cycles of plaque purification with subsequent hybridization
confirmation, the recombinant was designated as vCP83.
Example 52 - GENERATION OF AN ALYAC-FeLV-A BNV RECOMBINANT,
VIRUB LACKING THE PUTATIV$ II~B~iUNOBUPPRE88IVE
REGION OF plSE
The putative immunosuppressive region is situated
within the pl5E transmembrane region of the FeLV envelope
glycoprotein (Cianciolo et al., 1986; Mathes et al., 1978).
This region was deleted in the following manner. The FeLV-A
env sequences from nucleotide 1282 to 1602 (Stewart et al.,
1986) were amplified by PCR from pFGA-5 using
oligonucleotides FENVA-3 (SEQ ID N0:320) and IS-A (SEQ ID
N0:468) (5'-TAAGACTACTTCAGAAAG-3'). The env sequences from
nucleotide 1684 to 1990 (Stewart et al., 1986) were
amplified by PCR from pFGA-5 using oligonucleotides FENVA-4
(SEQ ID N0:320) and IS-B (SEQ ID N0:323) (5'-GCGGATCACA
CCGGACTC-3'). The former PCR-derived fragment was digested
with EcoRI and the latter with HindIII and was subsequently
kinased with ATP and T4 kinase. These fragments were co-
ligated into pBS-SK digested with HindIII and EcoRI. The
resultant plasmid was confirmed by nucleotide sequence
analysis and designated as pBSFAIS-. Ligation of the above
fragments joins the sequences 5' and 3' to the 81 by DNA
segment encoding the putative immunosuppressive region and,
I ~ ~ ~ t~ ~ ~ ~~ ~~ PCT/US92/01906
-238-
therefore, deletes the sequences encoding the
immunosuppressive peptide.
The FeLV-A sequences lacking the region encoding the
immunosuppressive region were excised from pCSFA by
digestion with SstII/ADaI. This 381 by fragment was
replaced by the 300 by SstII/A~aI fragment from- pBSFAIS-.
The ligation that was done was with a 4.8kb SstII/ApaI
fragment from pCSFA and the 300 by fragment described above.
The resultant plasmid was designated pCSFAISD.
The plasmid pCSFAISD was employed in recombination
experiments with ALVAC (CPpp) as the rescuing virus.
Recombinant viruses were identified by in situ hybridization
using a radiolabeled FeLV-A env specific probe. Following
three cycles of plaque purification, the recombinant was
designated as vCP87. This recombinant contains the FeLV-A
env gene lacking the region encoding the putative 27 amino
acid immunosuppressive region. The gene was inserted into
the C5 locus.
Tsxam~le 53 - GENERATION OF ALQAC-FeLV-A gag
RECOMBINANT VIRUSES
The FeLV-A aaQ/pol sequences were derived from plasmid
pFGA-2 QaQ This plasmid was derived from the FeLV-A
infectious clone pFGA-2 (Stewart et al., 1986) by subcloning
the 3.5 kb PstI subfragment containing a portion of the LTR
(651 bp) sequences, the entire aaa gene, and 1272 by of the
pol gene. The 3.5 kb fragment was inserted into PstI
digested pUC8 (Bethesda Research Laboratories, Gaithersburg,
MD). Initially, this 3.5 kb PstI FeLV-A DNA fragment was
isolated and inserted into pBS-SK (Stratagene, La Jolla,
CA). The resultant plasmid was designated as pBSGAG. The
entire 3.5 kb insert was analyzed by nucleotide sequence
(SEQ ID N0:324) (FIG. 27) analysis to confirm position of
the initiation codon (nucleotide 652 to 654 underlined in
FIG. 27) and pertinent restriction sites defined in the
nucleotide sequence of the aaa region previously reported
for FeLV-B (Leprevotte et al., 1984).
The plasmid pFGA-2 QaQ was digested with BcxlII and PstI
to liberate a 2.5 kb fragment. BalII recognizes a site at
nucleotide position 1076 (SEQ ID N0:324) while PstI
WO 92/156'2 PCT/LS92/01906
~~~~i~~7
-239-
recognizes a site at the end of the FeLV-A insert. The 2.5
kb fragment was isolated and redigested with HindIII and
PstI which recognize sites within the co-migrating plasmid
sequences. This eliminated the ability of the plasmid
sequences to compete in subsequent ligation reactions.
PCR was used to derive the 5' portion of the FeLV-A gaa
coding sequences. The plasmid pFGA2 gag was used as
template with oligonucleotides FGAGBGL (SEQ ID N0:325)
(5'-GATCTCCATGTAGTAATG-3') and FGAGATG (SEQ ID N0:326)
(5'-CGATATCCGTTAAGTTTGTATCGTAATGTCTGGAGCCTCTAGTG).
Oligonucleotide FGAGATG (SEQ ID N0:326) contains the 3'-
most 25 nucleotides of the vaccinia virus H6 promoter and
includes the 3'-most 3 by of the NruI site at its' S'-end.
These H6 sequences are precisely joined at the ATG
(initiation codon) and the nucleotides corresponding to the
initial 16 nucleotides of the gaq coding sequence. .
Oligonucleotide FGAGBGL (SEQ ID N0:325) corresponds to the
reverse complement of sequences 59 by downstream from the
unique BalII site in the fag sequences (Leprevotte et al.,
1984). PCR using these reagents yielded a 500 by fragment
which was subsequently digested with BalII to generate a 450
by fragment.
The 450 by BQ1II digested PCR-derived fragment was
coligated with the 2.5 kb BalII/PstI fragment, containing
the remainder of the fag gene and a portion of the pol gene,
- . and pCPCVl (above in env construction) digested with NruI
and PstI. pCPCVl (NruI/PstI) contains the 5' portion of the
vaccinia virus H6 promoter including the 5'-most 3 by of the
NruI recognition signal. The resultant plasmid was
designated as pC3FGAG.
The plasmid pC3FGAG was linearized with PstI, blunt-
ended with T4 DNA polymerise and ligated to a 100 by
SSDI/SmaI fragment excised from pSD513 (defined in Example
7). The 100 by SSpI/SmaI fragment provides termination
codons at the 3' end of the FeLV-A gag/pol sequences. The
resultant plasmid was designated as pC3FGAGVQ.
The FeLV-A qaq/pol expression cassette was excised from
pC3FGAGVQ by digestion with EcoRI and HindIII. The
resultant 3.4 kb fragment was isolated and~ligated with pC3I
WO 92/156?2 PCT/US92/01906
~~~DJt~~~~
-240-
(defined in Example 32) digested with EcoRI and HindIII to
yield pC3DOFGAGVQ.
The plasmid pC3DOFGAGVQ was used in in vitro
recombination experiments with vCP83 and vCP87 as rescue
viruses. The recombinant containing the FeLV-A gag/pol
sequences and the entire FeLV-A env gene was designated as
vCP97 while the recombinant containing the same g~/pol
sequences and the entire FeLV-A env lacking the
immunosuppressive region was designated vCP93.
Example 54 - INSERTION OF FeLV-A gag INTO A VACCINIA
VIRUS BACKGROUND
The insertion plasmid pCEN151 was generated by cloning
a 3.3 kb EcoRI/HindIII fragment from pC3FGAG (above) into
the SmaI site of pSD553. This insertion was performed
following blunt-ending the fragment with the Klenow fragment
of the E. coli DNA polymerase in the presence of 2mM dNTPs.
Plasmid pSD553 is a vaccinia deletion/insertion plasmid
of the COPAK series. It contains the vaccinia K1L host
range gene (Gillard et al., 1986; Perkus et al., 1990)
within flanking Copenhagen vaccinia arms, replacing the ATI
region (ORFS A25L, A26L; Goebel et al., 1990a,b). pSD553
was constructed as follows. The polylinker region located
at the vaccinia ATI deletion locus of plasmid pSD541
(defined in Example 10) was expanded as follows. pSD541 was
cut with BalII/XhoI and ligated with annealed complementary
synthetic deoxyoligonucleotides MPSYN333 (SEQ ID N0:329)
(5'-GATCTTTTGTTAACAAAP.ACTAATCAGCTATCGCGAATCGATT
CCCGGGGGATCCGGTACCC-3') and MPSYN334 (SEQ ID N0:330)
(5'-TCGAGGGTACCGGATCCCCCGGGAATCGATTCGCGATAGCTGATTAG
TTTTTGTTAACAAAA-3') generating plasmid pSD552. The K1L host
range gene was isolated as a 1 kb B~lII(partial)/HpaI
fragment from plasmid pSD452 (Perkus et al., 1990). pSD552
was cut with BqlII/HpaI and ligated with the K1L containing
fragment, generating pSD553.
Plasmid pCEN151 was used in in vitro recombination
experiments with vP866 as rescue virus to generate vP1011.
Example 55 - IMMUNOFLUOREBCENC$ AND IMMUNOPRECIPITATION
ANALYSIS OF FeLV ENV AND gag GENES IN ALVAC
RECOMBINANT VIRU8E8
Immunoprecipitation. Vero cell monolayers were
WO 92/15672 PCT/U -__ .. _._.__ _. _
i.~ d
-241-
infected at an m.o.i. equal to 10 pfu/cell with parental or
recombinant viruses. At 1 hr post-infection, the inoculum
was aspirated and methionine-free medium supplemented with
(3sS)-methionine (DuPont, Boston, MA; 1000 Ci/mmol), 20
~Ci/ml was added and further incubated till 18 hr post-
infection. Immunoprecipitation and immunofluorescence
analyses were performed as described previously (Taylor et
al., 1990) using a bovine anti-FeLV serum (Antibodies, Inc.,
La Jolla, CA) or a monoclonal antibody specific for the p27
core protein (provided by Rhone-Merieux, Inc., Athens, GA).
FeLV Virus Isolation. On day one, 3x104 QN10
cells/well were plated in a 12-well plate'in 1 ml of
Dulbecco's MEM containing HEPES buffer (DFB), 10% FBS, and 4
~g/ml polybrene. The cells were incubated overnight at
37°C. Without removing the medium, 200 ~cl of sample (cat
plasma) was added to each well. Following a 2 hr incubation
at 37°C, the medium as replaced with 1.5 ml of fresh DFB and
allowed to further incubate at 37°C. On day five, plates
were examined for transformation. If negative, medium was
replaced with 1.5 ml of fresh DFB and again allowed to
further incubate at 37°C. On day eight, plates were re-
examined for transformation. If negative, cells were
subcultured in 5 cm plates by dispersing cells by two washes
with trypsin-EDTA and placing in 4 ml DFB for inoculation
into a 5 cm plate. Cells were allowed to incubate for four
days at 37°C prior to examination for transformation.
Detection of FeLV Antigen Bv Immunofluorescence. Blood
smears were fixed for five min in MeOH at -20°C, washed in
dH20, and then air dried. A volume of 24 ~1 of rabbit anti-
FeLV antibody was applied to the blood smear within a circle
inscribed on the smear with a diamond pen. The smear was
incubated in the presence of the antibody for 1 hr at 37°C
in a humidified chamber prior to washing three times with
PBS and one time with dH20. The smear was then air dried.
A volume of 25 ~C1 of goat anti-cat IgG-FITC was applied to
the circle and incubated as above with the primary
antiserum. The sample was washed and dried as above for the
primary antiserum prior to examination for
immunofluorescence in a microscope with'a ultra violet light
' PCT/US92/01906
~i N i
-242-
source.
FeLV Antibody Neutrals ation Assay. On day one, 5x104
QN10 cells/well were plated in a 12-well plate in 1 ml DFB
plus 4 ~Cg/ml polybrene. The cells were inoculated at 37°C.
Serum dilutions were prepared in round bottom 96 well plates
from 1:2 to 1:256 using 50 u1 volumes of Leibowitz medium.
Added 50 ~,1 FeLV-A at 4x105 focus forming units (ffu) per
ml. Two wells were included with medium without serum as a
virus control. Plates were incubated for 2 hr at 37°C.
Following the 2 hrs adsorption period, 25 ~1 of each
dilution was placed into a well of QN10 cells. Virus
control was titrated by diluting 1:2, 1:4, 1:8, and 1:6 in
50 ~C1 volumes of Leibowitz medium in the 96-well plate prior
to inoculation of QN10 cells with 25 ~tl onto QN10 cells.
Plates were inoculated at 37°C for three days. On day day,
medium was replaced with 1 ml of DFB/well. Two days later,
foci were counted under a microscope. Neutralizing antibody
titers were estimated as the dilution of serum producing 75%.
reduction in focus count compared to virus control.
In order to determine whether the env gene product
expressed by vCP83 and vCP87 was transported to the plasma
membrane of infected cells, immunofluorescence experiments
were performed as described previously (Taylor et al.,
1990). Primary CEF monolayers were infected with parental
(ALVAC) or recombinant viruses, vCP83 and vCP87 and
immunofluorescence was performed at 24 hr post-infection
using a bovine anti-FeLV serum. The results demonstrate
that cells infected with vCP83 showed strong surface
fluorescent staining, whereas cells infected with vCP87 or
parental ALVAC virus showed no significant surface staining.
Expression of the FeLV env gene product was also
analyzed in immunoprecipitation assays using the bovine
anti-FeLV serum. No FeLV-specific protein species were
precipitated from lysates derived from uninfected CEFs or
CEFs infected with the parental ALVAC virus. Three FeLV-
specific proteins were precipitated from vCP83 infected
cells with apparent molecular weights of 85 kDa, 70 kDa, and
15 kDa. This result is consistent with expression of the
precursor env gene product (85 kDa) and the mature cleavage
WO 92/1672 PCf/US92/019~6
~~~J~~~~
-243-
products p70 and plSE. Immunoprecipitation from lysates
derived form vCP88 infected cells demonstrated a single
FeLV-specific protein species with an apparent molecular
weight of 83 kDa. This is consistent with expression of a
non-proteolytically processed env gene product of the size
expected following deletion of the putative
immunosuppressive region. So, in short, expression of the
env lacking the immunosuppressive region was apparently not
properly transported to the surface of infected cells nor
was it proteolytically cleaved to mature env specific
protein forms.
Expression of the FeLV QaQ-specific gene products was
analyzed by immunoprecipitation using monoclonal antibodies
specific to an epitope within the p27 core protein (D5) and
the bovine anti-FeLV serum. No FeLV-specific proteins were
precipitated from lysates derived from uninfected cells or
cells infected with parental viruses. Clearly, from vP1011,
vCP93, and vCP97 infected cells, FeLV specific protein
species of 55kDa were precipitated with the D5 and bovine
anti-FeLV serum. Protein species of these apparent
molecular weights are consistent with g~act-specif is precursor
forms. Low levels of a 27 kDa protein species consistent
with the size of the mature p27 core protein were also
apparent.
EgamDle 56 - IN VIVO EVAhUATION OF vCP93 AND vCP97
The protective efficacy of vCP93 and vCP97 were
evaluated by a live FeLV challenge of cats following two
inoculations of the recombinant viruses. The ALVAC-based
FeLV recombinants were administered via the subcutaneous
route with 108 PFU on days 0 and 28. Cats were challenged
by an oronasal administration of an homologous FeLV-A strain
(Glasgow-1) at seven days following the booster inoculation.
Blood samples were obtained pre- and post-challenge for
evaluation of FeLV antigenemia (p27 detection), FeLV
isolation, the presence FeLV antigen in white blood cell
(WBC) smears by immunofluorescence, and the induction of
FeLV neutralizing activity.
No adverse reactions were observed following
vaccination with the ALVAC (canarypoxvirus)-based
WO 92/15672
' PCT/US92/01906
.:,
-244-
recombinant viruses, vCP93 and vCP97. All six non-
vaccinated controls succumbed to the FeLV challenge and
developed a persistent viremia by three weeks following the
challenge exposure. This was evidenced by detection of p27
antigen in the blood, FeLV isolation and detection of FeLV
antigen by immunofluorescent analysis of WBC smears (Table
32). The non-vaccinated controls remained persistently
infected for the remainder of the study (until 12 weeks
post-challenge).
A persistent viremia developed in three of six cats
vaccinated with vCP93 at three weeks post-challenge. At
this timepoint, blood samplings from these three cats were
shown to contain p27 antigen and/or live FeLV (Table.32).
One of these cats (No. 2) resolved this infection by six
weeks post-infection and remained free of viremia through 12
weeks post-challenge. The other two cats (No. 1 and 5)
remained persistently infected by the three criteria, p27
antigenemia, FeLV isolation, and FeLV antigen detection in
WBCs. Three of six cats vaccinated with vCP93 (No. 3, 4,
and 6) were free of persistent viremia through nine weeks
post-challenge (Table 32). Two of these cats (No. 3 and 6)
remained free of circulating virus through week 12 post-
challenge,~while one cat (No. 4) became suddenly infected at
12 weeks. So, partial protection (three of six cats) was
afforded protection against persistent viremia by
vaccination with vCP93.
Most impressively, all six cats vaccinated with vCP97
were fully protected against the homologous challenge with
FeLV-A (Glasgow-1). Only one of these cats (No. 12)
evidenced any suggestion of persistent viremia. This
occurred at three weeks post-challenge when p27 antigen was
detected in the blood sample (Table 32). No live FeLV was
ever isolated from the blood of this cat following
challenge. All other cats were free of p27 antigenemia,
free of live FeLV, and never demonstrated any FeLV antigen
in WBC smears for 12 weeks following challenge exposure
(Table 32).
Evolution of FeLV Neutralizing Antibodies. Due to the
potential role of neutralizing antibodies in protection
V1'O 92/1672 PCT/US92/01906
~:~G~?7'~
-245-
against FeLV infection (Russell and Jarrett, 1978; Lutz et
a1.,~1980), the generation of such a response was monitored
pre- and post-challenge. None of the cats in the study,
whether vaccinated with vCP93 or vCP97, demonstrated any
neutralizing antibody titers prior to FeLV challenge (Table
33). Following challenge, none of the cats which developed
a persistent viremia had any detectable neutralizing
antibody titers. Significantly, cats protected against a
persistent infection developed FeLV-specific serum
neutralizing titers (Table 33). These titers increased in
magnitude in all protected cats following challenge, with
the highest level being observed at the terminal time point
of the study, at 12 weeks post-challenge (Table 33).
WO 92/16'2 ~ ~ ~ J ) ~ PCT/US92/01906
-246-
Table 32.
Response of cats to challenge with feline leukemia virus
Time (weeks) relative to e
challeng
Group Cat -5 -2 0 +3 +6 +9 +12
No. E'V2 EV EV EV F3EV FEV FEV
1. vCP 93: 1 -- -- '- -
++ ++ +++ +++
Felv-A 2 -- __ __ _+ ___ ___ ___
env(IS-) 3 __ __ __ __ ___ ___ ___
+~~~ 4 __ __ __ __ ___ ___
_
++
5 '- -' -- ++ -++ +++ +++
g __ __ __ __ ___ ___ ___
2. vCP 97: 7 __ __ __ __ ___ ___ ___
Felv-A g __ __ __ __ ___ ___ ___
env(IS+) g -- __ __ __ ___ ___ ___
+gag/Qol 10 __ __ __ __ ___ ___ ___
11 -- __ __ __ ___ ___ ___
12 __ __ __ +_ ___ ___ ___
~LIBSTtTUTE BHEET
DEMANDES OU BREVETS VOi.UMINEUX
LA PRESENTS PARTiE DE CETTE DEMANDS OU CE BREVET
COMPREND PLUS D'UN TOME. -
CECt EST L~ TOME l DE Z
NOTE: Pour les tomes additionels, veuillez contacter !e Bureau canadien des
brevets
__________~_a ~? ~ z ~ ~ __
JUMBO APPLlCATIONS/PATENTS
THIS SECTION OF THE APPLfCATION/PATENT CONTAINS MORE
THAN ONE VOLUME
THIS !S VOLUME ~ - OF
NOTE: For additional volumes please contact the Canadian Patent Office
