COMPOSITE ANTIBODIES OF HUMAN SUBGROUP IV LIGHT CHAIN CAPABLE OF BINDING TO TAG-72

ANTICORPS COMPOSITES DE LA CHAINE LEGERE HUMAINE DU SOUS-GROUPE IV CAPABLES DE SE LIER AU TAG-72

English Abstract

This invention concerns a subset of composite Hum4 V L, V H .alpha.TAG
antibody with high affinities to a high molecular
weight; tumor-associated sislylated glycoprotein antigen (TAG-72) of human
origin. These antibodies have variable regions with
(1) V L segments derived from the human subgroup IV germline gene and (2) a V
H segment which is capable of combining
with the V L to form a three dimensional structure having the ability to bind
TAG-72. in vivo methods of treatment and
diagnostic assay using these composite antibodies is also disclosed.

Claims

76

CLAIMS:

1. A Hum4 V L, V H antibody or an antigen-binding
fragment thereof which specifically binds to TAG-72 antigen,
said antibody fragment comprising at least one light chain
variable region (V L) and at least one heavy chain variable
region (V H), wherein
(a) the V L is a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4V L) amino
acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala
Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln
Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala
Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu
Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu
Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and
(b) the V H is an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H, at least the heavy
chain variable region of an antibody which specifically
binds TAG-72 antigen, said coding sequence being at least
90% homologous to the V H .alpha.TAG germline gene (V H .alpha.TAG) coding
sequence; and the V H is capable of combining with the V L to
form a three dimensional structure having the ability to
specifically bind TAG-72 antigen.

2. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 1, wherein the V L is further encoded by a human J gene
segment.


77

3. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 1, wherein the V H is encoded by a DNA coding sequence
which comprises the V H .alpha.TAG germline gene (V H .alpha.TAG) coding
sequence or a productively rearranged anti-TAG-72 V H-encoding
derivative thereof.

4. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 1, wherein the V H is further encoded by a mammalian D
gene segment.

5. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 1, wherein the V H is derived from the variable regions
of CC46, CC49, CC83, or CC92.

6. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 1, wherein the V H is a humanized anti-TAG-72 V H
comprising (1) anti-TAG-72 V H CDRs grafted into (2) human V H
framework regions.

7. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 1, wherein the light chain further comprises at least
a portion of a human constant region (C L) and the heavy chain
further comprises at least a portion of a mammalian constant
region (C H).

8. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 7, wherein the CH is human IgG1-4, IgM, IgA1, IgA2, IgD,
or IgE.

9. ~The Hum4 V L, V H antibody or fragment thereof of
Claim 7, wherein the C L is kappa or lambda.

10. ~A Hum4 V L, V H single chain antibody or an antigen-
binding fragment thereof which specifically binds to TAG-72
antigen, said antibody or fragment comprising



78

(a) at least one light chain having a variable
region (V L), said V L being a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4 V L)
amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala
Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln
Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala
Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu
Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu
Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and
(b) at least one heavy chain having a variable
region (V H), said V H being an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H, at least the heavy
chain variable region of an antibody which specifically
binds TAG-72 antigen, said coding sequence being at least
90% homologous to the V H.alpha.TAG germline gene (V H.alpha.TAG) coding
sequence; and at least one polypeptide linker linking the V H
and V L, wherein the V H is capable of combining with the V L to
form a three-dimensional structure having the ability to
bind TAG-72 antigen and the polypeptide linker allows the
proper folding of the V H and V L into a single chain antibody
which is capable of forming said three-dimensional
structure.

11. ~A Hum4 V L, V H antibody conjugate comprising the
Hum4 V L, V H antibody or fragment thereof of Claim 1
conjugated to an imaging marker or therapeutic agent.

12. ~The Hum4 V L, V H antibody conjugate of Claim 11,
wherein the imaging marker is selected from the group



79

consisting of 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga,
166Ho, 177Lu, 186Re, 188Re, and 99m Tc.

13. ~The Hum4 V L, V H antibody conjugate of Claim 11,
wherein the therapeutic agent is a drug or biological
response modifier, radionuclide, or toxin.

14. ~The Hum4 V L, V H antibody conjugate of Claim 13,
wherein the drug is methotrexate, adriamycin or interferon.

15. ~The Hum4 V L, V H antibody conjugate of Claim 13,
wherein the radionuclide is 131I, 90Y, 105Rh, 47Sc, 67Cu, 212Bi,
211At, 67Ga, 125I, 186Re, 188Re, 177Lu, 99m Tc, 153Sm, 123I, or 111In.

16. ~A composition for cancer treatment comprising a
pharmaceutically effective amount of the Hum4 V L, V H antibody
or fragment thereof of Claim 1 in a pharmaceutically
acceptable, non-toxic, sterile carrier.

17. ~A composition for cancer detection comprising a
pharmaceutically effective amount of the Hum4 V L, V H antibody
conjugate of Claim 12 in a pharmaceutically acceptable, non-
toxic, sterile carrier.

18. ~A composition for cancer treatment comprising a
pharmaceutically effective amount of the Hum4 V L, V H antibody
conjugate of any one of Claims 13 to 15 in a
pharmaceutically acceptable, non-toxic, sterile carrier.

19. ~A method for in vivo diagnosis of cancer which
comprises administering to a mammal a pharmaceutically
effective amount of the composition of Claim 17 for the in
situ detection of carcinoma lesions.

20. ~The method of Claim 19, wherein the mammal is a
human.




80


21. Use of the composition of Claim 18 for the
treatment of cancer in a mammal.

22. The use according to Claim 21, wherein the mammal
is a human.

23. Use of the composition of Claim 17 for localizing
a tumor in intraoperative therapy in a mammal.

24. The use of Claim 23, wherein the mammal is a
human.

25. A cell capable of expressing a Hum4 V L, V H antibody
or antigen-binding antibody fragment having binding affinity
for TAG-72 antigen, said antibody or fragment comprising at
least one light chain variable region (V L) and at least one
heavy chain variable region (V H), wherein
(A) the VL is a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4 V L)
amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala
Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln
Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala
Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu
Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu
Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and
(B) the V H is an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H, at least the heavy
chain variable region of an antibody which specifically
binds TAG-72 antigen, said coding sequence being at least




81


90% homologous to said V H.alpha.TAG germline gene coding sequence,
said VH being capable of combining with said V L to form a
three-dimensional structure having the ability to
specifically bind TAG-72 antigen;

said cell being transformed with

(C) a first DNA sequence encoding said V L; and
(D) a second DNA sequence encoding said V H.

26. The cell of Claim 25, wherein the first and second
DNA sequences are contained within at least one biologically
functional expression vector.

27. A process for producing a Hum4 V L, V H antibody or
antibody fragment having binding affinity for TAG-72
antigen, said fragment comprising at least the variable
domains of the antibody's heavy and light chains, in a
single host cell, the process comprising the steps of:

(A) transforming at least one host cell with
(i) a first DNA sequence encoding a
human kappa Subgroup IV light chain variable region (V L)
containing the human Subgroup IV germline gene (Hum4 V L)
amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala
Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln
Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala
Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu
Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu
Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys,
and


82


(ii) a second DNA sequence encoding an
anti-TAG-72 heavy chain variable region (V H) which is capable
of combining with the V L to form a three-dimensional
structure having the ability to bind TAG-72 antigen, the
coding sequence thereof being at least 90% homologous to the
V H.alpha.TAG germline gene (V H.alpha.TAG) coding sequence and
(B) independently expressing said first DNA
sequence and said second DNA sequence in said transformed
host cell.

28. The process according to Claim 27, wherein said
first and second DNA sequences are present in at least one
vector.

29. The process according to Claim 28, wherein the
antibody heavy and light chains of the Hum4 V L, V H antibody
or fragment that are expressed in the host cell are secreted
therefrom as an immunologically functional antibody molecule
or antibody fragment.

30. The process of Claim 27, wherein the second DNA
sequence encodes the V H of CC46, CC49, CC83 or CC92.

31. A process for preparing an antibody or antibody
fragment conjugate which comprises contacting with an
imaging marker or therapeutic agent:

a Hum4 V L, V H antibody or antibody fragment having
binding affinity for TAG-72 antigen and comprising at least
one light chain variable region (V L) and at least one heavy
chain variable region (V H) wherein
(A) the V L is a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4 V L)
amino acid sequence,


83

Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala
Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln
Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala
Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu
Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu
Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and
(B) the V H is an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H at least the heavy chain
variable region of an antibody which specifically binds
TAG-72 antigen, said coding sequence being at least 90%
homologous to said V H.alpha.TAG germline gene coding sequence, said
V H being capable of combining with said V L to form a three-
dimensional structure having the ability to specifically
bind TAG-72 antigen.

32. The process of Claim 31, wherein the imaging
marker is 125I, 131I, 123I, 111IN, 105Rh, 153Sm, 67Cy,m 67Ga, 166Ho,
177Lu, 186Re, 188Re or 99m Tc.

33. The process of Claim 31, wherein the therapeutic
agent is a radionuclide, drug or biological response
modifier, toxin or another antibody.

34. The Hum4 V L, V H antibody or fragment thereof of
Claim 1 wherein the antibody is MP1-44H produced by a cell
line having the identifying characteristics of ATCC HB 10426
or MP1-84H produced by a cell line having the identifying
characteristics of ATCC HB 10427.


84


35. The cell of Claim 25 wherein the Hum4 V L, V H
antibody or fragment has, at least one V H thereof, a V H
derived from a heavy chain of CC46, CC49, CC83, or CC92.

36. The cell of Claim 25 wherein the Hum4 V L, V H
antibody or fragment is MP1-44H produced by a cell line
having the identifying characteristics of ATCC H B 10426 or
MP1-84H produced by a cell line having the identifying
characteristics of ATCC H B 10427.

37. The cell of Claim 25 wherein the anti-TAG-72 V H of
the Hum4 V L, V H antibody or fragment is a humanized
anti-TAG-72 V H comprising (1) anti-TAG-72 V H complementarity
determining regions (CDRs) grafted into (2) human V H
framework regions.

38. The cell of Claim 25 wherein the Hum4 V L, V H
antibody or fragment has, as each light chain thereof, one
said V L covalently attached to a human light chain constant
domain (C L) and has, as each heavy chain thereof, one said V H
covalently attached to at least one mammalian heavy chain
constant domain (C H).

39. The cell of Claim 38 wherein the Hum4 V L, V H
antibody or fragment thereof has the C H selected from the
group consisting of IgG1-4, IgM, IgAl, IgA2, IgD or IgE.

40. The process of Claim 31 wherein the Hum4 V L, V H
antibody fragment has the V H derived from the variable
regions of CC46, CC49, CC83 or CC92.

41 The process of Claim 31 wherein the V H of the Hum4
V L, V H antibody or fragment is a humanized anti-TAG-72 V H
comprising (1) anti-TAG-72 V H complementarity determining
regions (CDRs) grafted into (2) human V H framework regions.


85


42. The process of Claim 31 wherein the Hum4 V L, V H
antibody or fragment has, as each light chain thereof, one
said V L covalently attached to a human light chain constant
domain (C L) and has, as each heavy chain thereof, one said V H
covalently attached to at least one mammalian heavy chain
constant domain (C H).

43. The process of Claim 42 wherein the Hum4 V L, V H
antibody or fragment thereof has the C H selected from the
group consisting of IgG1-4, IgM, IgAl, IgA2, IgD or IgE.

44. A process for preparing an antibody or antibody
fragment conjugate which comprises contacting with an
imaging marker or therapeutic agent:

a Hum4 V L, V H antibody or antibody fragment having
binding affinity for TAG-72 antigen;

wherein said Hum4 V L, V H antibody or fragment is
produced according to the process of any one of Claims
27-30.

Description

~G'1'1'JA1J91 /OOSg3
WO 93112231
...
x
COMPOSITE ANTIBODIES OF HUMAN SUBGPOUP IV LIGHT CHAIN
CAPABLE OF BINDING TO ':'AG-~72
The present invention is directed to the fields
of immunology and genetic engineering.
'd'he following information is provided for the
ourpo~se of making known information bel~eved by the
applicants to be opossible relevance to the present
invention. :~o admission is necessarily intended, nor
snouid be construed, that any of the Following
informat?on constitutes prior ar; agai.nst the present
invention. '
Antibodies are specific immunoglobulin (Ig?
poiypeptides produced by the vertebrate ?mmune syst2:n i:~
response to challenges by foreign proteins,
1~ gl~ycoproteins, cells, or other antigenic foreign
substances. The binding specificity of such
polypeptides to a aarticular antigen is highly refined,
with each antibody being almost exclusively directed -,o
the partiauLar antigen~which elicited l;,.
Two major methods oi" generating vertebrate
'~ ~ antibodies are presently utilized:generation insitu by
. the ma~aal=an 3 lymphocytes and Qeneration in cell
2~ culture by 3-cell hybrias. Antiaodies are generated in
SUBSTlTU'1P"E ~t-I~ET

WO 93/12231 '~ ~ ~ P~'f/AU91/0~583
situ as a result of the differentiation of immature B
lymphocytes into plasma cells (see Gough (1981), Trends
Q'
in Biochem Sci, b : 203 ( 1981 ) . Even when only a s ingle
antigen is introduced into the immune system for a ..
particular mammal, a uniform population of antioodies
does not result, l.c., the response is polyclonal.
The limited but inherent heterogeneity of
polyclonal antibodies is overcome by the use of
hybridoma technology to create '°a~onoclonal" antibodies
19 in cell cultures by B cell hybridomas (see Kohler and
Milstein (1975). Nature. 256:~~5-~97)a In this pa~ocess,
a mammal is injected with an antigen. and its relatively
short-lived, or mortal. splenocytes or lymphocytes are
fused with an immortal tumor cell line. The fusion
produces hybrid cells or "hybridomas" which are both
immortal and capable of producing the genetically-coded
antibody of the B cell.
2G In many applications, the. use of monoclonal
antibodies produced in non-human animals is severely
restricted where the monoclonal antibodies are to be
used in humans. Repea~:ed in,jectians in humans of a
"foreign" antibody, such as a mouse antibody, may lead
to harmful hypersensitivity reactions, l.c., an anti-
id3otypic,. or human anti-mouse antibody (HAL~iAA)
response, (see Shawler etal. (19$5), Journal of
Immunolo~y, 135:153~-1535. and Sear etal.. J. 3iol. Resn.
Modifiers, 3:138-150).
30.
Qarious attempts have already seen :rade to ..
manufacture human-derived monoclonal antibodies by using
l
human hybridomas (see Olsson etal.. °roc. ~~atl= dead.
Sci. G.S.A., 77:529 (1980) and 3oder etal. (~986a,
Methods in Enzvmolo~~, 121:x40-167. Unfortunately,
SUBSTITUTE SHEBT

;,~ ~ r,, _ ,. ,
WO 93/~223X F'CT/AU9R100583
--3-
yields of monoclonal antibodies from human hybridoma
cell lines are relatively low compared to mause
hybridomas. In addition, human cell lines express~Cng
immunoglobulins are relatively unstable compared to
mouse cell lines, and the antibody producing capability
of these human cell lines is transient. Thus, while
human immunoglobulins are highly desirable, human
hybridoma techniques have not yet reached the stage
where human monoclonal antibodies with required
antigenic specificities can be easily obtained.
Thus, antibodies of nonhuman origin have been
genetically engineered. or "humanized"> aumanized
antibodies reduce she HAMA response compared to that
expected after injection of a human patient with a mouse
antibody. Humanization of antibodies derived from
nonhumans, for example. has taken two principal forms,
i.e.,~ chimerization where non-human regions of
immunoglobulin constant sequences are replaced by
20 corresponding human ones (see for example. USP 4,816,567
to Cabilly et al. , Genenteeh) and grafting of
complementarily determining regions ((:DR) into human
frameworfc.regions (FR) (sep ruropean Patent Office
App.lieation (EPO) 0 239 X00 to Winter). Some
25~ researchers have produced Fv,antibodies (USP 4,62,334
to Moore, DNAX) and single chain Fv (SCFV) antibodies
(see JSP,4,946,778 to Ladn~r, Genex).
The above patent applications only show the
production pi" antibody tfragments in which 'some portion
of the variable domains is coded °or by nonhuman 'J gene
regions. Humanized antibodies to date still retain
various portions pt'' =:.ght end heavy chain variable
regions of nonhuman arigin: the chimeric. ;v and single
chain ,Fv antibodies retain the entire variable region of
3UBSTtTUTE SHEET

~Y(3 93/12231 '~ ~ '~ ~ ~ ~ ~ P~'lf'/AU91/110583
_u_
nonhuman origin and CDR-grafted antibodies retain CDR of
nonhuman origin.
Such nonhuanan-derived regions are expected to
elicit an immunogenic reaction when administered into a
human patient (see Bruggemann etul. (1989), J. EXD. Med.,
i7~:2153~2157~ and Lo Buglio (1991), Sixth International
Conference on Monoclonal Antibody Immunoconjugates for
Cancer, San Diego, Ca). Thus, it is most desirable to
obtain a human variable region which is capable of
binding to a selected antigen.
One known human carcinoma tumor antigen is
tumor-associated glycoprotein-72 (TAG-T2), as defined by
monoclonal antibody B72.3 (see Thor etal. (1986) Canaer
Res., X6:3118-31Z~: and Johnson, etal. (198b), Cancer
Res., x#6:850-857). TAG-72 is associated with the
surface of certain tumor cells of human origin,
specifically the LS17~T tumor cell line (American Type
ZO Culture Collection (ATCC) No. CL 188), which is a
variant of the LS180 (ATCC No. CL 187) colon adeno°
carcinoma line.
Numerous murine monoclonal antibodies have been
Z5 developed which have binding specificity for TAG-72.
Exemplary ~iurine monoclonal antibodies include the °'CC"
(colon cancer) monoclonal antibodies, which are a
library of murine monoclonal antibodies neveioped using
~A~°72 purified on an immunoa~finity column with an
3Q .~nobi?=zed anti-TAG-72 antibody, 372.3 (ATCC 3B°8108y
(see EP 3~~277, to Sehiom etal., Vational Cancer
institute). Certain CC antibodies were deposited with
the ATCC: CC~9 (ATGC No. :.B 9459) CC83 (ATCC No. :iB
~~,53) ~ CC~6 (ATCC No. '~ 958); CC92 (ATCC No. ;iB 9~5~);
CC30 (ATCC N0. B 9~57)a CG11 (ATCC No. a~55) and CCiS
8'IBSl'ITIJTE SHEET

WO 93/I223I ~ ~ ~ ~ ~ ~~ ~ P(:T/AU91/00583
_~_
(ATCC No. HB 9~b0). Jarious antibodies of the CC series
have been chimerized (see, for example, EPO 0 3b5 9g7 to
,~ Mezes etal., The Dow Chemical Company) .
It is thus of great interest to develop


antibodies against ':AG-72 containing a light and/or


heavy chain variable regions) derived from human


antibodies. However, the prior art simply does not


teach recombinant and immunologic techniques capable of


routinely producing an anti-TAG-72 antibody in which the


light chain and/or the heavy chain variable regions have


specificity and affinity for TAG-72 and which are


derived from human sequences so as to elicit expectedly


low or no HAMA response. It is known that the function


of an immunoglobulin molecule is dependent on its three


dimensional structure, which in turn is dependent on its


primary amino acid sequence. A change of a few or even


. one amino acid can drastically affect the binding


function of the antibody can drastically affect its the


20 bidning affinity of the antibody, l.c., the resultant


antibodies are generally presumed to be a non-specific


immunoglobulin (NSI), l.c.. lacking in antibody


character, (see. for example, USP x,816,567 to Cabilly


etad., Genentech) .


Z5


Surprisingly, the present invention is capable


of meeting aany of these above mentioned needs and


provides a method for supplying the desired antibodies.


For example, in one aspect, the present invention


~0 provides a cell'capable of expressing a composite



antibody having binding specificity for TAG-72, said


cell being transformed with (a) a DNA sequence encoding


'l at least a portion pi" a light chain variable region (VL)


effectively homologous to the human Subgroup IV germline


_ _ '.gene tvum~l VL); and a DNA sequence segment ancoding at


~UBST1TUTE a~-IE~'

;:.. . . ., ~: ,. . . ;:,~ ,, . . . ... .,,.
Wt~ 93/12231 ~ ~ ~ ~ ~ ~ PCT/AU9I/00583
_~_
least a portion of a heavy chain variable region (VH)
capable of combining with the VL into a three
dimensional structure having the ability to binii tow
TAG-72.
In another aspect, the present invention
provides a oomposite antibody or antibody having binding
specificity for TAG-72, comprising (a) a DNA sequence
encoding at least a portion of a light chain (VL)
variable region effectively homologous to the human
t4 Subgroup IV germline gene (cium4 VL); and a DNA sec_ruence
segment encoding at least a portion of a heavy ch2~in
variable region (VH) capable of combining with the VL
into a three dimensional structure having the ability to
bind TAG-7.
r
The invention further includes the
aforementioned antibody alone or conjugated to an
imagi:~g marker or therapeutic agent. The invention also
includes a composition comprising the aforementioned
antibody in unconjugated or conjugated form in a .
pharmaceutically acceptable, non-toxic, sterile carrier.
The invention is also directed to a method for
25 in.vivo diagnosis of cancer which comprises administering
to an animal containing a tumor expressing TAG-72 a
pharmaceutically eff eetive amount of the aforementioned
composition for the insatu detection of carcinoma
lesions.
. t
The ~nvent:on is also directed to a method for
intraoperative therapy which comprises (a) administering
i
to patient containing a tumor expressing TAG-72 a
aharmaeeutieally effective amount of the aforementioned
suss-rt~ru~ sH~~-

CA 02121041 2003-03-13
64693-5203
7
composition, whereby the tumor is localized, and (b)
excising the localized tumors.
Additionally, the invention also concerns a
process for preparing and expressing a composite antibody.
Some of these processes are as follows. A process which
comprises transforming a cell with a DNA sequence encoding
at least a portion of a light chain variable region (VL)
effectively homologous to the human Subgroup IV germline
gene (Hum4 VL); and a DNA sequence segment encoding at least
a portion of a heavy chain variable region (VH) which is
capable of combining with the VL to form a three-dimensional
structure having the ability to bind to TAG-72. A process
for preparing a composite antibody or antibody which
comprises culturing a cell containing a DNA sequence
encoding at least a portion of a light chain variable region
(VL) effectively homologous to the human Subgroup IV germline
gene (Hum4 VL); and a DNA sequence segment encoding at least
a portion of a heavy chain variable region (VH) capable of
combining with the VL into a three-dimensional structure
having the ability to bind to TAG-72 under sufficient
conditions for the cell to express the immunoglobulin light
chain and immunoglobulin heavy chain. A process for
preparing an antibody conjugate comprising contacting the
aforementioned antibody or antibody with an imaging marker
or therapeutic agent.
In another aspect, the invention provides a Hum4
VL, VH antibody or an antigen-binding fragment thereof which
specifically binds to TAG-72 antigen, said antibody
fragment comprising at least one light chain variable region
(VL) and at least one heavy chain variable region (VH),
wherein (a) the VL is a human kappa Subgroup IV VL containing
the human Subgroup IV germline gene (Hum4VL) amino acid
sequence,

6 II II, ( ~~
CA 02121041 2002-07-12
64693-5203
7a
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu
Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu
Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala
Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly
Gly Gly Thr Lys Val Val Ile Lys;
and (b) the VH is an anti-TAG-72 VH encoded by a DNA coding
sequence encoding, as said VH, at least the heavy chain
variable region of an antibody which specifically binds TAG-
72 antigen, said coding sequence being at least 90%
homologous to the VHaTAG germline gene (VHaTAG) coding
sequence; and the VH is capable of combining with the VL to
form a three dimensional structure having the ability to
specifically bind TAG-72 antigen.
In another aspect, the invention provides a Hum4
VL, VH single chain antibody or an antigen-binding fragment
thereof which specifically binds to TAG-72 antigen, said
antibody or fragment comprising (a) at least one light chain
having a variable region (VL), said VL being a human kappa
Subgroup IV VL containing the human Subgroup IV germline gene
(Hum4 VL) amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu
Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu
Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala
Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly
Gly Gly Thr Lys Val Val Ile Lys;

I'~~~ ~d w 1I I i1 ~ I
CA 02121041 2002-07-12
64693-5203
7b
and (b) at least one heavy chain having a variable region
(VH), said VH being an anti-TAG-72 VH encoded by a DNA coding
sequence encoding, as said VH, at least the heavy chain
variable region of an antibody which specifically binds
TAG-72 antigen, said coding sequence being at least 90%
homologous to the VHaTAG germline gene (VHaTAG) coding
sequence; and at least one polypeptide linker linking the VH
and VL, wherein the VH is capable of combining with the VL to
form a three-dimensional structure having the ability to
bind TAG-72 antigen and the polypeptide linker allows the
proper folding of the VH and VL into a single chain antibody
which is capable of forming said three dimensional
structure.
In another aspect, the invention provides a Hum4
VL, VH antibody conjugate comprising the Hum4 VL, VH antibody
or fragment thereof as described above conjugated to an
imaging marker or therapeutic agent.
In another aspect, the invention provides a cell
capable of expressing a Hum4 VL, VH antibody or antigen-
binding antibody fragment having binding affinity for TAG-72
antigen, said antibody or fragment comprising at least one
light chain variable region (VL) and at least one heavy chain
variable region (VH) , wherein (A) the VL is a human kappa
Subgroup IV VL containing the human Subgroup IV germline gene
(Hum4 VL) amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu
Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu
Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala

i . ,ri n ~ i
CA 02121041 2002-07-12
64693-5203
7c
Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly
Gly Gly Thr Lys Val Val Ile Lys;
and (B) the VH is an anti-TAG-72 VH encoded by a DNA coding
sequence encoding, as said VH, at least the heavy chain
variable region of an antibody which specifically binds
TAG-72 antigen, said coding sequence being at least 90%
homologous to said VHaTAG germline gene coding sequence, said
VH being capable of combining with said VL to form a three-
dimensional structure having the ability to specifically
bind TAG-72 antigen; said cell being transformed with (C) a
first DNA sequence encoding said VL; and (D) a second DNA
sequence encoding said VH.
In another aspect, the invention provides a
process for producing a Hum4 VL, VH antibody or antibody
fragment having binding affinity for TAG-72 antigen, said
fragment comprising at least the variable domains of the
antibody's heavy and light chains, in a single host cell,
the process comprising the steps of: (A) transforming at
least one host cell with (i) a first DNA sequence encoding a
human kappa Subgroup IV light chain variable region (VL)
containing the human Subgroup IV germline gene (Hum4 VL)
amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu
Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu
Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala
Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly
Gly Gly Thr Lys Val Val Ile Lys,
and ii) a second DNA sequence encoding an anti-TAG-72 heavy
chain variable region (VH) which is capable of combining with

II II FI I I
CA 02121041 2002-07-12
64693-5203
7d
the VL to form a three-dimensional structure having the
ability to bind TAG-72 antigen, the coding sequence thereof
being at least 90~ homologous to the VHaTAG germline gene
(VHaTAG) coding sequence and (B) independently expressing
said first DNA sequence and said second DNA sequence in said
transformed host cell.
In another aspect, the invention provides a
process for preparing an antibody or antibody fragment
conjugate which comprises contacting with an imaging marker
or therapeutic agent: a Hum4 VL, VH antibody or antibody
fragment having binding affinity for TAG-72 antigen and
comprising at least one light chain variable region (VL) and
at least one heavy chain variable region (VH) wherein (A) the
VL is a human kappa Subgroup IV VL containing the human
Subgroup IV germline gene (Hum4 VL) amino acid sequence,
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu
Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu
Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala
Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly
Gly Gly Thr Lys Val Val Ile Lys;
and (B) the VH is an anti-TAG-72 VH encoded by a DNA coding
sequence encoding, as said VH at least the heavy chain
variable region of an antibody which specifically binds
TAG-72 antigen, said coding sequence being at least 90%
homologous to said VHaTAG germline gene coding sequence, said
VH being capable of combining with said VL to form a three-
dimensional structure having the ability to specifically
bind TAG-72 antigen.

CA 02121041 2002-07-12
64693-5203
7e
Description of the Drawings
Figure 1 illustrates a basic immunoglobulin
structure.

31 ~~~~~'~~-~
WO 93!I22 PGTlAU91/005&3
_s~_
Figure 2 illustrates the nucleotide sequences
of VHca'fAG, CC~6 VH, CC~+9 VH, CC83 VH and CC92 VH.
...
Figure 3 illustrates the amino acid sequences
of VHccTAG, CC~6 VH, CC~l9 VHF CC83 VH and CC92 VH. :.
Figure ~ illustrates the VH nucleotide and
amino acid sequences of antibody B17X2.
Figure 5 illustrates the mouse germline J-H
genes from pNP9.
Figure 6 illustrates the plasmid map oi" p~9 g1-
2.3.
Figure T illustrates the plasmid map of p83 g1-
i5 2,3~
Figure $ illustrates the entire sequence of
HUMVL ( -~ ) and HUMVL ( - ) .
Figure 9 illustrates the human J~1 ( HJ~4 ~
nucleotide sequence and amino acid sequence.
Figure t0 illustrates the nucleotide sequences,
and the amino acid sequences of Hump VL, Clad-HindIII
segment.
Figure 11 illustrates a schematic representa-
Lion of the human germline Subgroup IV VL gene
(fium~ VL), as the target for the PCR.
",
figure 12 shows the results of agarose gel
electrophoresis of the PCR reaction to obtain the
Hump VL gene.
Figure 13 illustrates the restriction enzyme
map of pRL1000, and precursor plasmids pSV2neo,
SUBSTITUTE SHEET

WO 93/12231. ~ ~ ~ ~ Q 1~1 ~ PGT/AiJ91 /0U583
_o_
s
pSV2neo-101 and pSV2neo-102. "7C°° indicates where the
HindIII site of pSV2neo has been destroyed.
Figure 1u illustrates a polylinker segment made
by synthesizing two oligonucieotides: CH(+) and CH(-):
Figure 15 illustrates a primer, NE0102SEQ, used
for sequencing plasmid DNA from several clones of
pSV2neo-102.
Figure 16 illustrates an autoradiogram
depicting the DNA sequence of the polylinker region in
oSV2neo-102.
Figure 17 illustrates a partial nucleotide
sequence segment of pRL1000.
Figure 18 illustrates the restriction enzyme
map of pRL1001.
Figure 19 illustrates an autoradiogram of DNA
sequence for pRL1001 clones.
Figure 20 illustrates a competition assay for
binding to TAG-using a composite Hump V~,, VHaTAG
antibody.
Figure 21 illustrates a general DNA
construction of a single chain, composite Hump VL,
VHaTAG.
Figure 22 illustrates the nucleotide sequence
and amino acid sequence of SCFV1.
Figure 23 shows the construction of plasmid
pCGS515/SCFV1. .
su~s-rtTU-r~ s~E~-

p~7('/AU91/00583
WCs 93/12231
~1~~~~~
_.a_
Figure 2~ shows the construction of plasmid
pSCFV31 .
w r
Figure 25 shows the construction of E. cola
SCFV expression plasmids containing ~ium~ VL. - __
Figure 26 shows the DNA sequence and amino acid
sequence of Hump VL°CC~49UH SCFV present in pSCFVUHH.
Figure 27 shOWS the construction plasmid pSCFV
ID UHH and a schematic of a combinatorial library of Vg
genes c~ith Fium~+ VL
Figure 28 illustrates the nucleotide sequence
of FLAG peptide adapter in pATDFLAG.
1~ Figure 29 illustrates the construction of
pATDFLAG, pHumVL~HumVH (X) and pSC~9FLAG.
Figure 34 illustrates the nucleotide and amino
acid sequences of pSC~49FLAG.
Detailed Deserintion of the Invention
Nucleic acids, amino acids, peptides,
protective groups, active groups and so on, when
abbreviated, are abbreviated according to the IUPAC IUH
(Commission on Biological Nomenclature) or the practice
in the ffields concerned.
The basic immunogiobulin structural unit is set
forth in Figurw 1: T_h.e't~rms "constant" and "variable"
I'he variable regions of both
are used =unctionally.
light (VL) and heavy (?H) chains determine binding
recognition and specificity to the antigen. '~'he
constant region domains of light (CL) and heavy (Cg)
chains confer -important biological properties such as
SiU~S'fl'tU'T~ S1~EE'r


~VU 93/12231 PCf/AU91/00583
-11~
antibody chain association, secretion, transplacental
mobility, complement binding, binding to Fc receptors
and the like. .
v
The immunoglobulins of this invention have been
developed to address the problems of the priar art. The
methods of this invention produce, and the invention is
directed to, composite antibodies. By "composite
antibodies" is meant immunoglobulins comprising variable
regions not hitherto found associated with each other in
1d nature. gy, "composite Hump VL, VH antibody" means an
antibody or immunoreactive fragment thereof' which is
characterized by having at least a portion of the VL
region encoded by DNA derived from the Hum4 VL germline
gene and at least a portion of a VH region capable of
combining with the Vi, to form a three dimensional
structure having the ability to bind to TAG-72.
The composite Hum~l VL, VH antibodies of the
2G present invention assume a conformation having an
antigen binding site which binds specifically and with
sufficient strength to TAG-72 to form a complex capable
of being isolated by using standard assay technicxues
(e. g., enzyme-linked immunosorbent assay (ELISA),
radioimmunoassay (RIA), or flourescence-activated cell
sorter analysis (xAGS), immunohistochemistry and the
like). Preferably, the composite Hump 'IL, VH antibodies
. of ;he present invention have an antigen binding
afF.inity or avidity greater than lOs M°l, more
preTerably greater tzan;106 M'1 and most preferably
greater than 108 M°l. :or a discussion of the
techniques for generating and reviewing irlmunoglobuiin
"' binding affinities see Munson ( 1983) , Methods ~.:~zmmol . ,
SUBSTITUTE ~H~ET

WO 93/12231 ~ ~ ~ ~- ~ ~'~ 1 P~'/A.1191/~QS83
_12-
92;543-577 and Scatchard (1949), Ann. N.Y. Acad. Sci.,
51:660-672.
r
Human antibody kappa chains have been
classified into four subgroups on the basis of 'invariant
w
amino acid sequences (see, for example, Kabat etal.
(1991), Seauences of Proteins of ImmunoloRical Interest
{4th ed.), published by The U.S. Department of Health
and Human Services). There appear to be approximately
80 human VK genes, but only one Subgroup IV VK gene has
been identified in the human genome (see Klobeck, etal.
(1985), Nucleic Acids Research, 13:6516-6528). The
nucleotide sequence of Hump! VL is set forth in Kabat et
al. ( 1 X91 ) ~ supra; and Wang et a1. ( 19T3 ) 9 Nature , 243 : 126-
12T.
Tt has been found, quite surprisingly, that an
immunoglobulin having a light chain with at least a
portion of the VL encoded by a gene derived from Hum4 V~,
may, if combined with a suitable VH, have binding
specificity for TAG-72.
The type of JL gene segment selected is not
critical to the invention, in that it is expected that
~ 25 ,any JL' if present, can associate with the Hum4 VL. The
present invention obviously contemplates the Hum4 VL in
association with a human Jx sequence. The five human Jx
sequences are set forth in Heiter et at. C 1982) , The
_Journal oL Biological Che:nistrv_, 357:1516-1522.
however; the present inver:tion is not intended to be ,
Limited to the human JK. The present invention
specifically contemplates the Hum4 VL in association
:with any of the at Least six human JZ genes fsee Hoilis
etal. {1982), Nature, 296:321-325).
SUBS'T1TU'~E SHEF'~'

,~ . : .' :. ,. - .. , : ' . ~ . : ;. ,
,,.. , , . .
WO 93/12231 ~ ~ ~ ~ f~ ~~ ~ PCT/AU91/00583
An exemplary technique for engineering the Hump
VL with selected JL segments includes synthesizing a
primer having a so-called "wagging tail°', that ~daes not
hybridize with the target DNA; thereafter, the sequences
are amniified and spliced together by overlap extension
( see Norton st al. ( 19$9 ) , Gene, "T7: 61-68 ) .
The CL of the composite Hump U~,, VH antibodies
is not critical to the invention. To date, the Hum4 UL
has only been reported as having been naturally
rearranged with the single Ck gene (see Heiter ~tal.
(7980). Cell, 22:197-207). However, the present
invention is not intended to be limited to the CK light
chain constant domain. That is, the CL gene segment may
~ aiso be any of the at least six C~ genes (see Hollis et
al. , supra ) .
The DNA encoding the heavy chain variable
region consists roughly of a heavy chain variable ('JH)
gene sequence, a heavy chain diversity (DH) gene
sequence, and a heavy chain joining (JH) gene sequence.
;.
The present invention is directed to any VH
capable of combining with a light chain variable region
effectively homologous to the light chain variable
region encoded by the human Subgroup IV germline gene,
to form a three dimensional structure having the ability
to bind to TAG-72.
The choice o~ heavy chain diversity (DH)
segment and the hleavy chain joining (JH) segment of the
x
i
composite Hump VL, fH antibody are not critical to the
f- ~,
~~''' a . , present invention. Obviously, human and marine DH and
JH gene segments are contemplated, provided that a given
E combination does not significantly decrease binding to
SU~STtTUTE SHEET

WO 931x2231
PGT/AU91 /OOS8~
TAG-72. Specifically, when utilizing CC46 VH, CC49 VH,
CC83 VH and CC92 VH, the composite Hump UL, VH antibody
will, be designed to utilize the DH and JH segments~which -"
naturally associated with those VH of the respective
hybridomas (see Figures 2 and 3)~ Exemplary murine and
.human DH and JH sequences are set forth in Kabat etal.
(1991), supra. An exemplary technique for engineering
such selected DH and JH segments with a VH sequence of
choice includes synthesizing selected oligonucleotides,
annealing and ligating in a cloning procedure (see,
Horton etal., supra) .
In a specific embodiment the composite Hum4 Vr,
VH antibody will be a ''composite Hum4 VL, VHaTAG
~5 antibody", means an antibody or immunoreaetive t''ragment
thereof which is characterized by having at least a
Dortion of the VL region encoded by DNA derived from the
Hump VL ger~aline gene and at Ieast a portion of the VH
region encoded by DNA derived from the VHaTAG germline
20 gene, which is known in the art (see, for example, EPO 0
365 997 to Mezes etal., the Dow Chemical Company) .
Figure 2 shows the nucleotide sequence of VHaTAG, and
the nueleatide sequences encoding the VH of the CC46.
CC~9, CC83 and CC92 antibodies, respectively. Figure 3
25 shows the corresponding amino acid sequences of 'JHaTAG,
CC~l6 VH, CC49 VH,. CC83 VH and CC92 VH.
A comparison of the nucleotide and amino acid
sequences of V~aTAG, CC~6 VH, CC~9 VH, CC83 VH and CC92
'JH shows that those CC'antibodies are derived °rom '~
VHaTAG. Somatic mutations occurring during productive
r~earrangea~ent of the Vg derived from VHaTAG in a 9 cell
gave rise to soave n~,xcleotide changes that may or may not
SUSST1TUTE SHEET'

WO 93/1Z231 ~ ~ ? ~; ~ '~ ~ PGT/AU91/OOS83
-15_
result in a homolagous amino acid change between the
productively rearranged hybridamas (see, EP0 0 365 997).
M
Because the nucleotide sequences of UHa.TAG and
Hum~4 V~, germline genes have been provided herein, the
' 5 present invention is intended to include other antibody
genes which are productively rearranged from the VHaTAG
germline gene. Other antibodies encoded by DNA derived
from VHaTAG may be identified by using a hybridixation
probe made from the DNA or RNA of the VHaTAG or
rearranged genes containing the recombined VH~xTAG.
Specifically, the probe will. include of all or a part of
the VHaTAG germline gene and its flanking regions. Hy
"flanking regions" is meant to include those DNA
sequences from the 5' end or the VHaTAG to the 3' end of
the upstream gene, and from 3' end of the VHaTAG to the
5' end of the downstream gene.
The CDR from the variable region of antibodies
derived from VHcsTAG may be grafted onto the c R of
selected Vg, i.e., FR of a human antibody (see ~PO 0 239
X00 to Winter). For example, the cell line, B17X2,
expresses an antibody utilizing a variable light chain
encoded ~y a gene derived from Humid UL and a variable
heavy chain which makes a stable VL and VH combination
(see Marsh eta.l. (1985), Nueleie Acids Research, 13s6531-
65~~; and Polke eta~. (1982), immunobiol. 163:95-109.
The~nucleotide sequence of the VH chain for 817X2 is
shown in. Figure 4. The 317X2 cell line is publicly
available. from Dr~. Christine Polke. Universitats-
Kin.derklinik, Josef-Schne.ider-Str. 2, 8700 Wurzburg,
FRG). .817X2 is directed to N-Acetyl-D-Glueosamine and
is not specific far TAG-72.
BUBS'i'1TU'f~ SHEE'f

p(: f/A.U91 /00583
CVO 93/I2231
2~ ~~~~~~
-16-
However, consensus sequences of antibody
derived from the CDR1 of UHaTAG (amino acid residues 31
to 35 of Figure 3) may be inserted into B17X2 (amino '
acid residues 31 to 37 of Figure ~) and the CDR2 of
VgaTAG (amino residues 50 to 65 of Figure 3) may be ''
inserted into a17x2 (amino acid residues 52 to 67 of
Figure ~+). The CDR3 may be replaced by any DH and JH
sequence which does not affect the binding of the
antibody for TAG-72 but, specifically, may be replaced
by the CDR3 of an antibody having its VH derived from
VgaTAG, e.g., CC~6, CC49, CC83 and CC92. Exemplary
techniques far such repiacer~ent are set forth in Horton
et czl. ,. Supra .
z5 The CH domains of immunoglobulin heavy chain
derived from VHaTAG genes, for example may be changed to
a human sequence by known techniques (see, JSP 4,81&,567
to Cabilly, Genentech). Cg domains may be of various
complete or shortened human isotypes, i.e., IgG (e. g.,
IgG', IgG2, IgG3, and IgG~), IgA (e. g., IgA1 and IgA2),
IgD, IgE, IgM, as well as the various allotypes of the
individual groups (see Kabat et at. ( 199 ~ ) , supra ) .
Given the teachings oz" the present invention,
it should be apparent to the skilled artisan that human
ttg genes can be tested for their ability to produce an
anti-TAG-72 immunoglobiiin combination with whe Hump VL
gene. The VL may be used to isolate a gene encoding for
a VH having the ability ,to bind to TAG-72 to test myriad
combinations of Hump V~, and VH that may not ~ :aturally
occur in nature, e.g., by generating a combinatorial
library using the Hum~1 ~TL gene to select a suitable VH.
Examples oz" these enabling technologies include
screening of combinatorial =ibraries of 7L-fiH
combinations using an Fab or single chain antibody
suss~'-ru~ s~~~r

WO 93/12231 ~, ~ ~ ~ ~ i". ~ Pd:T/AU91/00583
_ 17_
(SCFV) format expressed on the surfaces or' fd phage
(Clackson, etal. (1991), Nature, 352:624-628), or using a
.~ phage system for expression of Fv's or Fabs (Hose, et
a
al. (1989), Seienee, 246:1275-1281). However, according
to the teachings set forth herein, it is now possible to
a C
J clone SCFV antibodies in E. coli, and express the SCFVs as
secreted' soluble proteins. SCFV proteins produced in E.
coli that contain a Hum4 V~, gene can be screened for
binding to TAG-72 using, for example, a two-membrane
filter screening system (Skerra, etel. (1991), Anaivtical
Hioehemistrv, 196:151-155).
The desired gene repertoire can be isolated
from human genetic material obtained from any suitable
Z5 source, e.g., peripheral blood lymphocytes, spleen cells
and lymph nodes of a patient with tumor expressing TAG-
72. In some cases, it is desirable to bias the
repertoire for a preselected activity, such as by using
as a s~urce of nucleic acid, cells (source cells) from
vertebrates in any one of various stages of age, health
and immune response.
Cells coding for the desired sequence may be
isolated, and genomic DNA fragmented by one or more
restriction enzymes. Tissue (e.g., primary and
secondary lymph organs, neoplastic tissue, white blood
cells ~rom peripheral blood and hybridomas) from an
animal exposed to TAG-72 may be probed for selected
antibody producing B cells. Variability among 3 cells
derived from a common~germline gene :nay result from
somatic mutations occurring during productive
rearrangement.
Generally, a probe made from the genomic ANA of
a germline gene or rearranged gene can be used ay t:-pose
SUBSTITUTE SHEET

~:.lw' . , . , ' , ' '
WO 93/12231
-1$-
P(~f/AU91/00~83
skilled in the art to find homologous sequences from
unknown cells. For example, sequence infor~aation
obtained from Hum~# V~, and VHaTAG may be used to generate
hybridization probes for naturally-occurring rearranged
V regions, including the 5' and 3' nontranslated
flanking regions. The genomic DNA may include
naturally-occurring introns for portions thereof,
provided that functional splice donor and splice
acceptor regions had been present in the case of
1G mammalian cell sources.
Additionally, the DNA may also be obtained from
a eDNA library. mRNA coding f or heavy or light chain
variable domain may be isolated from a suitable source,
17, either mature B cells or a hybridoma culture, employing
standard techniques of RNA isolation. The DNA or amino
acids also may be syntheticall~r synthesized and
constructed by standard techniques of annealing and
ligating fragments (see Jones, etal. (1986), Nature,
20 321:522-525; Reichmann etal., (1988), Nature, 332:323-
327; Sambrook et at. (1989), supra and Merrifield et al.
(j963), J. Amer. Chem. Soc., 85:219-2150 . ~ieavy and
light chains may be combined in vitro to gain antibody
activity (see Edelman, efal. (1963), Proc. Natl. Acad.
25 Sci . ETSA, 50: 753)
The present invention also contemplates a gene
library of VgaTAG homologs, preferably human homologs of
vHafiAG, By "homolog" is meant a gene coding for a VH
JG region (not necessar~.ly ,deri ved from, or e~ren
effectively homologous ~o, the VHaTAG germline gene)
s
capable of combining with a light chain variable region '
effectively homologous to the ?ight chain variable
region encoded by the human Subgroup IV germline gene.
SUBSTITUTE S!-~EET

r4
WO 93/I2231 PCTlAU91/005~3
-19-
to form a three dimensional structure having the ability
to bind to TAG-72.
Preferably, the gene library is produoed~by a
primer extension reaction or cambination of primer
extension reactions as described herein. The tIHaTAG
homologs are preferably in an isolated form, that is,
substantially free of materials such as, for example,
primer extension reaction agents andlor substrates,
genomic DNA segments, and the like. The present
invention thus is directed to cloning the VHaTAG-coding
DNA homologs from a repertoire comprised of polynucleo-
tide coding strands, such as genomic material containing
the gene expressing the variable region or the messenger
RNA (mRNA) which represents a transcript of the variable
region. Nucleic acids coding for UHaTAG-coding homologs
can be derived from cells producing IgA, igD, Ig~, IgG
or IgM, most preferably from IgM and IgG, producing
cells.
The vgaTAG-coding DNA h~mologs may be produced
by primer extension. The term "primer" as used herein
refers to a polynueleotide whether pirified from a
nucleic acid restriction digest or produced
synthetically, which is capable of acting as a point of
initiation of synthesis when placed under conditions in
which synthesis of a primer extension product which is
complimentary to a nucleic acid strand is induced, i.e.,
in the presence of nucleotides and an agent for polymer-
3G ization such as DNA polymerase, reverse transcr:.ptase
and the like, and at a suitable temoerat;are and aH.
Preferably, the ~lrinTAG-ceding DNA r.omologs may
be produced by polymerise chain reac~:.on (PCR) amplifi-
c.a~ion~of double stranded genomic or cDNA, ;wherein two
SUBSTITUTE SHEET

WO 93/12231
_20~
PCT/AU91 /00583
primers are used for each coding serand of nucleic acid
to be exponentially amplified. ~_'he first primer becomes
part of the nonsense (minus or complementary) strand and
hybridizes to a nucleotide sequence conserved among Va
(plus) strands within the repertoire. PCR is described
in Mullis etal. (1987), Meth. Gnz., 155:335-350; and PCR
Technology, Erlich (ed.) (1989). PCR amplification of
the mRNA from antibody-producing cells fs set forth in
Orlandi et al. ( 1989) . Prac. Natl. Aced. Sci. . USA,
86:3387-3837.
According to a pref erred method, the VgaTAG-
coding DNA homologs are connected nia linker to form a
SCFV hav~.ng a three dimensional structure capable of
15 binding TAG-72. The SCFV construct can be in a Vr_,-L-'IR
or Vg-~-U'~, configuration. ~'or a discussion of SCFV see
Bird etal. -(1958). Science, 242:423-426. The design of
suitable peptide ?inker regions is described in U.S.
Patent No. 4,704,692 to Ladner etal.. Genex.
The nucleotide sequence of a primer is selected
to hybridize with a plurality of '_mmunogiobulin heavy
chain genes at a site substantially adjacent to the
a; VgaTAG-coding DNA homolog so that a nucleotide seq'sence
25 coding for a functional (capable of binding) polygeptide
is obtained. The choice of a primer's nucleotide
sequence depends on factors such as the distance on the
nucleic acid from the region coding for ~he desired
a
receptor. its hybridization site on the nucleic acid
30 relat~.ve to any '~secor~d~~ primer to be used, .the number ; of
genes in the repertoire it is to hybridize to, and the
like. To hybridize to a pluralit:r of different nucleic a
acid strands of VKaTAG-cods..~.g DNA homolog, the primer
SUBSTITUTE SHEET'


i~'~.l 93/12231 P~:T/A1J91 /00583
must be a substantial complement of a nucleotide
sequence conserved among the different strands.
..,.
The peptide linker may be coded for by the


nucleic acid sequences that are part of the poly-


.5 nucleotide primers used to prepare the various gene


libraries. The nucleic acid sequence coding for the


' peptide linker can be made up or nucleic acids attached


to one of the primers or the nucleic acid sequence


coding for the peptide linker may be derived from


nucleic acid sequences that are attached to several


polynucleotide primers used to create the gene


libraries. Additionally, noncomplementary bases or


longer sequences can be interspersed into the primer,


15 provided the primer sequence has sufficient complemen-


tarily with the sequence oz' the strand to be synthesized


or amplified to non-randomly hybridize therewith and


thereby form an extension product under polynucleotide


' synthesizing conditions (see Horton etal. (1989), Gene,


20 77:61-68~.


Exemplary human t1H sequences from which


complementary primers may be synthesized a~e set forth


in Kabat et al. ( 1991 ? , supra:
Humphries et al. ( 1988 )


.
,


25 Nature, 331r446-449: Sdhroeder etal. (i990), Proe. Natl.


Acad. Sci . USA, 87:6 i46-6150; German et al. ( 1988 ) ,
EMBO


,Journal, 7:727-738: Lee stal. ( 1987), ~1. Mol. 3iol. ,


1'95:7fi 1-768) ; Marks et al. ( 7991 ) , Eur. ,; , immunol
. ,


21:985-991; Wille~s, etal. (1991), ,1. Immunol., 146:3646-


3651 ; and Person et al. (r1991' )
Proc' Natl
Acad
Sci
SSA


,
.
.
.
,
8~8:~432-2436. To produce V~ coding DNA homologs. irst


primer's are therefore chosen to hybridize to (l.c. be
'


e
complementary to) conserved :egions within the ~ region,


CHl reg~.on~ hinge region, CH2 region, or CH3 region of


immunogl.obulin genes and =:ne like. Second priers are


SUBSTITUTE SHBB't'

BYO 9311ZZ31 PCT/AU9110~583
~1~~.~ ~ ~.
therefore chosen to hydribinize with a conserved
nucleotide sequence at the 5' end of the ONaTAG-coning
DNA homolog such as is that area coding for the' leader
or first framework region.
Alternativellr, the nucleic acid sequences
coding for the peptide linker may be designed as part of
a suitable vector. As used herein, the term "expression
vector" refers to a nucleic acid molecule capable of
directing the expression of genes to which they are
1C operatively linked. The choice of vector to which a
~THaTAG-coding DNA homologs is operatively linked depends
directly, as is well :cnown in the art, on the functional
properties desired, e.~., replication or protein
expression, and the host cell (either procaryotie or
euearyotic) to be Transformed, these being limitations
inherent in the art pt" constructing recombinant DNA
molecules. In preferred embodiments, the eucaryotic
cell expression vectors used ineiude a selection marker
20 that is effective in an eucaryotic cell, preferably 3
drug resistant selection marker.
~xpressian rectors compatible with proearyotic
t
cells are well known in the art and are available from
25 several commercial sources. Typical of vector plasmids
suitable for procar~rotic cells are pUC8, pUC9, gBA322.
and pBR329 available :rpm 3ioRad Laboratories,
(Richmond, CA), and pPL and pi~K223 available from
Pharmacies, (Piscataway, :~J) .
x
expression nec"ors compatiole with aucaryot..c
cells, preferably those compatible with vertebrate
ce?ls, can also be used. ~ucaryotic cell oxprassion
vectors are well known .n the art and are aYaii2ble from
several commere=al sources. =ypically, such vectors are
sues-rtTU-rE sH~~r

WO 93!12231 '~ ~ ; '; r - PCTlAU91/0~583
YJ ~ ~~J ~..n
-?3-
provided containing convenient restriction sites for
insertion of the desired DNA homologue. Typical of
vector plasmids suitable for eucaryotic cells are.M
b
pSV2neo and pSV2gpt (ATCC), pSVL and pKSV-10
(Pharmacia), pBPU~1/PML2d (International
Bioteehnolo~gies, Ine.), and pTDT1 (ATCC).
The use of viral expression vectors to express
the genes of the vHaTAG-coding DNA homologs is also
contemplated. As used herein, the term "viral
expression vector" refers to a DNA molecule that
includes a promoter sequences derived from the long
terminal repeat (LTR) region of a viral genome.
Exemplary phage include a phage and fd phage (see,
Sambrook, etut. (1989), Molecular Cloning: A Laborator~t
Manual . ( 2nd ed. ) , and MeCaf f erty et at. ( 199~ ) , Mature ,
s~52-~5~.
The population of VgaTAG-coding DNA homologs
and vectors are then cleaved with an endonuclease at
shared restriction sites. A variety ox" methods have
been developed to operatively link DNA to vectors via
complementary eohesivp termini. ror instance,
complementary cohesive termini can be engineered into
the VgaTAG--coding DNA homologs during the primer
extension reaction by use of an appropriately designed
poiynucleotide synthesis primer, as previously
discussed. The complementary cohesive termini of the
- vector and the DNA homolog are then operatively linked
(Zigated)~ to produe~ a unitart' double stranded DNA
mo.l.ecule..
- .'he restriction fbagmenzs of Hum~4 VL-coding DNA
.and t he VHaTAG-coding DNA homologs population are
..raa~dom?y ligated to the cleaved rrector. 3 diverse,
~UBSTiTUTE SHEET

WO 93JI2231 ~ ~ ~ ~ ~ ~ ~ PCClAU91/OU583
_2t~_
random population is produced with each vector having a
~lgaTAG-coding DNA homolog and Hum~4 UL-coding DNA located
in the sane reading frame and under the control of"the
vector's promoter.
The resulting single chain construct is then
introduced into an appropriate host to provide amplifi-
cation and/or expression of a composite Hum4 VL, iTHaTAG
homolog single chain antibody. Transformation of
appropriate cell hosts with a recombinant DNA molecule
1C of the present invention is accomplished by method s that
typically depend on the type of vector used. With
regard to transz'ormation of procaryotic host cells, see,
for example. Cohen et aI. ( 1972 ) , Proceedinr~s National
Aeademv of Science. USA. 69:2110; and Sambrook, efal.
C1989), supra. ~Jith regard to the transformation oz'
vertebrate cells with retroviral vectors containing
rDNAs, see for example. Sorge efal. (i98~), Mol. Cell.
Biol . , ~l :1730-1737; Graham et a1. ( 1973 ) , Virol. , 52: 456 ;
and Wigler eful. (1979), Proceedina;s National Academv of
Sciences. ~SA,76:1373-1376.
Exemplary prokaryotic strains that may be used
as . hosts include ~. cali. Bacilli, and other antero-
bacteri aceae such as Salmonella fypF~imurium, and various
Pseudamonas. Common eukaryotic microbes include S.
cerer~isiae and Piehia pastaris. Common higher eukaryotie host
cells include Sp2/a, UERO and HeLa cells, Chinese
hamster ovary (CHO) cell lines, and W138, 3HK, COS-T and
3d MDCK cell ? fines. ~ ~ urthermore. it i s now ai'so e~rident
that any cell 1?ne producing Hum4 UL, e.g., the 817X2
human cell line, can be used as a.recipient human cell
? fine for i.~.troduction of a VH gene complementary to the
3um~ jfL which allows binding to ':AG-72. :or example.
the 3 iTX2 heavy chain may be genet=call; modii'ied to zot
SUBSTITUTE SHEET

WO 93/I2231 '~ ~ ~ 1 ~ '~ ~ PCT/AU91 /0583
_?~_
produce the endogenous heavy chain by well known
methods; in this way, glycosylation patterns of the
antibody produced would be human and not non-human
derived.
'' S Successfully transformed cells, i.e., cells


containing a gene encoding a composite Hum4 VL, VHaTAG


homolog single chain antibody operatively linked to a


vector, can be identified by any suitable well known


technique far detecting the binding of a receptor to a


1fl ligand. Preferred screening assays are those whers the


binding of the composite Hum~4 VL, VHaTAG homolog single


chain antibody to TAG-?2 produces a detectable signal,


either directly or indirectly. Screening for productive


15 Hump VL and VHaTAG homoiog combinations, or in other


words, tasting for effective antigen binding sites to


TAG-?2 is possible by using for example, a radiolabeled


or biotinylated screening agent, e.g., antigens, anti-


bodies (e. g., B?2.3, CC~19, CC83~ CC~6, CC92, CC30, CC1.1


20 and CClS) or anti-idiotypie antibodies (see Huse et~al.,


supra, and Sambraok etal., supra) ; or the use of marker


peptides to the NFi2- or COOH-terminus of the SCFV


construct (see Hopp etal. (1988). Siotechnolo~y, 6:',20~-


1210 ) .


25


Of course, the Hum4 VL-coding DNA and the


VHaTAG-coding DNA homologs may be expressed as


individual polypeptide chains (e. g.. Fv) or with whole


or fragmented constant regions (e. g., Fab, and Flab)
~).


30 _
Aecordirigly, the' aum~ 7~,--ending DNA and the JHaTAG-



codi,rg DNA homologs may be individually inserted ..~.~o a


Factor containing a CL or CH or fragment thereof,



resge.ct~~~ely. rr~or a teaching or 'sow to prepare suitable


SUBST1T'UT~E S!-IEE'T'

WO 93/12231 ~ ~ ~ ~' ~ L~ ~ PCT/A.U91/OOS83
.?6_
vectors see EPO Q 365 997 to Mezes et al., The Dow
Chemical Company.
a
.,. .
DNA sequences encoding the light chain and
heavy chain or" the composite ~ium~ VL, VH antibody may be
inserted into separate expression vehicles, or into the
same expression vehicle. When coexpressed within the
same organism, either on the same or the different
veetors, a functionally active Fv is produced. When the
VHaTAG~°coding DNA homolog and Hump tIL polypeptides are
'~ expressed in different organisms, the respective
polypeptides are isolated and then combined in an
appropriate medium to F"ora a Fv. See Greene etal.9.
Methods in Molecular 3iolo~y, Vol. 9, Wickner etal.
.~ 5 ( ed . ) ; and Sambrook et al. , supra ) .
Subsequent recombinations can be effected
through cleavage and removal of the Hum~+ Vr-coding DNA
secauence to use the VHaTAG-coding DNA aomologs to
2G .produce hump VL-coding DNA homologs. '~o produce a ~ium~4
- Vl,-coding DNA homolog, first primers are chosen to
hybridize with (i.e. be complementary co) a conserved
region within the J'region or constant region of
immunoglobulin light czain genes and the ?ike. Second
25 primers become part of the coding (plus) strand and
hybridize to a nucleotide secruence~ conserved among minus
strands. Hump VE-coding DNA homologs are 'iigated into
the vector containing she VHaTAG-coding DNA homolog,
Thereby creating a second population of expression
vectors.' 'Fhe present _avenbion thus is di~eeted to
cloning the Hum~t 7L-coding DNA homalogs from a
repertoire comprised os polynucleotide coding strands, ~ '
such as genomie mateHial containing the gene expressing
the ~:ar=able region or the messenger RNA (mRNA) which
represents a transcript of the variable region. =t is
~U~STI'~'IJTE SHEET

WO 93112231 ~ ' ~- P~,'f/A~J91/005g3
-27-
thus possible to use an iterative process to define yet
further, composite antibodies, using later generation
v~raTAG-coding DNA homologs and Hum~l UL-coding DNA.
homologs.
The present invention further contemalates
genetically modifying the antibody variable and constant
regions to include effectively homolagous variable
region and constant region amino acid sequences.
Generally, changes ~z the variable region will be made
in order to improve or otherwise modify antigen minding
properties of the receptor. Changes in the constant
regian of the antigen receptor will, in general, be made
in order to improve or otherwise modify biological
propertees, such as complement Lixation, interaction
with r~emnranes, and other effector cunctions.
"Effectively homologous" refers to the concept
that differences in the primary structure of the
zQ . variable region may not alter the binding
. characteristics of the antigen receptor. Normally, a
DNA sequence is effectively homologous to a second DNA
sequence if at least 70 percent, preferably at least 30
percent, and most preferably at least ~0 percent of the
active portions of the DNA sequence are homologous.
Such changes are permissable in effectively homologous
amino acid sequences so long as the resultant antigen
receptor retains its desired property.
?!3 If there, is on:l.y a conservative difference
between zomologous positions of sequences, they may be
regarded as equivalents under certain circumstances.
General categories of potentially equivalent amino acids
are set forth below, wherein, amino acids within a group
may be suDStituted .or other amino acids in that group:
BUSST1TUTE SHEET

WO X3/12231 ~ ~ ~ ~ ~' J" 1 PGT/AU91100583
-28-
(1) glutamie acid and aspartie acid; (2) hydrophobic
amino acids such as alanine, valine, leucine and
isoleucine; (3) asparagine and glutamine; (~4) lysine,
arginine; and C5) threonine and serine.
Exemplary techniques for nucleotide replacement
include the addition, deletion, or substitution of
various nucleotides, deletion or substitution of various
nucleotides, provided that the proper reading frame is
maintained. Exemplary techniques include using
polynucleotide-mediated, site-directed mutagenesis,
l.c., using a single strand as a template f or extension
of the oligonucleotide to produce a strand containing
the mutation (see Zoller etal. f19$2), Nuc. Acids Res.,
,0:6~$?-6500; Norris et al. (19$3), Nuc. Acids Res.,
1'i:5103-5172; Zoller et al. (19$u), DNA9 3~~?9-~$8!
a Kramer etal. (19$2), Nuc. Acids Res., 10:675-685 and
palymerase chain reaction, l.c., exponentially
amplifying DNA in vitro using sequence specified oligo-
20 nucleotides to incorporate selected changes (see PCR
Technolo~y: Principles and Applications for DNA
Amplification, Erlich, (ed.) (19$9~~ and Horton etal.
suFra ) .
25 Further, the antibodies may have their constant
region domain modified, lc., the CL, CHI, hinge, CH2,
CH3 and/or CHI domains of an antibody polypeptide chain
may be deleted, inserted or changed (see :.PO 3Z7~ 37$ A1
to Morrison etal., the TrusteES of Columbia University;
USP =~,f~~'2.33~ to ~Moore fetal.,. DNAX: and USP '4.04.692 to
Ladner et al., Genex ) .
Once a final ONA construct is obtained, the
composite Hump '~IL, UH antibadies may be produced in
large quantities by injecting the host cell into the
SUBSTITUTE S~-IEE'r

WO 93/12231 ~ ~ '~ ~ '~ ~ PCT/AL191/005~3
-
peritoneal, cavity of pristane-primed mice, and after an


appropriate time (about 1-2 weeks), harvesting ascites


fluid from the mice, which yields a very high t~it.~r of


homogeneous composite Hum~4 UL, VH antibodies, and


isolating the composite Hump YL, YH antibodies by


'' S methods well known in the art (see Stramignoni . et al.


(1983), Intl. J. Cancer, 31:548-552). The host cell are


grown anUivo, as tumors in animals, the serum or ascites


fluid of which can provide up to about 50 mg/mL of


composite Hum~+ VL, Vg antibodies. Usually, injection


(preferabl.y intraperitoneal) of about 10S to 107


histocompatible host cells into mice or rats will result


.in tumor formation after a few weeks. It is possible to


obtain the composite c:um~d VL, YH antibodies from a


fermentation culture broth of procaryotic and eucaryotic


cells, or from inclusion bodies pt'' ~.co~i cells (see


Buckholz and Gleeson (1991), BIOTECHNOLOGY, 9:1057-


1072. T.he composite Hum~t VL, VH antibodies can then be


collected and processed by well-known methods (see


generally, Immunolo~ical Methods, vols. I & II, eds.


. Lefkovits, I. and Pernis, B., (1979 & 1981) Academic


?ress, flew York, ~J.Y.: and Handbook of Hxoerimental


i~nmunolo~y, ed. ~Jeir, 0. , ( 1978 ) Blackwell Scientif
is


ubl?eations, St. Louis, M0.)


The composite Hump VL, VH antibodies can then
be~stored in various buffer solutions such as phosphate
. buffered saline (PHS), which gives a generally stable
antibody solution for further use.
Uses
The composite :ium~4 VL, 'JH antibodies provide
snique benefits for use in a variety pi' cancer
treat:aents. In addition to the ability to bind
SUBSTITUTE SHEET

p~'/A.U91/005~3
WO 93/I223d
-30-
specifically to malignant cells and to localize tumors
and not bind to normal cells such as fibroblasts,
endothelial cells, or epithelial cells in the major
organs, the composite Hum~+ tIL, vH antibodies may be used
to greatly minimize or eliminate ANHA respanses'thereto.
Moreover, TAG-72 contains a variety of epitopes and thus
it may be desirable to administer several different
composite Hump VL, Vg antibodies which utilize a variety
of 1TH in combination with Hump tlL~
SpeBifically, the composite Hum~4 VL, VH
antibodies are useful for, but not limited to, in. a~ivo and
in vitro uses in diagnostics, therapy, imaging and
biosensors.
~5
The composite Hump 'JL, VH antibodies may be
incorporated into a pharmaceutically acceptable, non-
-to~cie, sterile carrier. Tnjectable compositions of the
present invention may be either in suspension or
solution form. In solution form the complex (or when
desired the separate companents) is dissolved in a
pharmaceutically acceptable carrier. Such Barriers
comprise a suitable solvent, preservatives such as
benzyl alcohol, if needed, and buffers. iJseful solvents
include, for example, water. aqueous alcohols, glycols,
and phosphonate or carbonate esters. Such aqueous
solutions generally contain no more than 50 percent of
the organic solvent by volume.
Injectabl,e suspensions require a liquid
suspending medium, with or without adjuvants, as a
Bzrr_er. 'fhe suspending medium can be, for example,
aqueous polyvinyl-pyrroiidone, :pert oils such as
vegetable oils or highly refined mineral oils, or
aqueous carboxymethlycpllulose. Suitable physio-
SUBSTITUTE SHEET

Wfl 93/12~3I ~, ~'GT/AU91/OUS83
-3~-
logically-acceptable adjuvants, if necessary to keep the
complex in suspension, may be chosen from among
thickeners such as carboxymethylcellulose, polyvinyl-
pyrrolidone, gelatin, and the alginates. Many,
surfactants are also useful as suspending agents, for
example, lecithin, alkylphenol, polyethylene oxide
adducts, naphthalenesulfonates, alkylbenzenesulfonates,
and the polyoxyethylene sorbitan esters. Many
substances which effect the hydrophibicity, density, and
Surface tension of the liquid suspension medium can
assist in making injectable suspensions in individual
cases. For example, silicone antifoams, sorbitol, and
sugars are all useful suspending agents.
Methods of preparing and administering
conjugates of the composite Hum~4 VL, VH antibody, and a
therapeutic agent are well known to or readily
determined. Moreover, suitable dosages will depend on
the age and weight of the patient and the therapeutic
agent employed and are well known or readily determined.
Conjugates of a composite Hum4 VL, VH antibody
and 3n imaging marker may be administered in a pharma-
ceutically effective amount .for the in viuo diagnostic
assays of human carcinomas, or metastases thereof, in a
patient having a tumor that expresses ':AG-?2 and then
detecting the presence of the imaging marker by
appropriate detection means.
. Administ~at,ion:and detection of the conjugates
of the composite Iium~ VL, VH antebody and an imaging
. ~ marker, as well as methods of conjugating the composite
Hump VL, VH antibody to the imaging marker are
acc~ompl=shed by methods readily known or readily
determined. she dosage of such conjugate will vary
3ldBST~TI,BT'E SHEET

WO 93/12231 ~ ~ ~ ~ ~'i PGT/AU91/00583
_32_
depending upon the age and weight of the patient..
Generally, the dosage should be effective to visualize
or detect tumor sites, distinct from normal tissues. _
Preferably, a ape-time dosage will be between 0.1 mg to
200 mg of the conjugate of the composite Hum4 tTL anti- ,
body and imaging marker per patient.
Examples of imaging markers which can be
conjugated to the composite Hump VL antibody are well
known and include substances which can be detected by
diagnostic imaging using a gamma scanner or hand held
gamma probe, and substances which can be detected by
nuclear magnetic resonance imaging using a nuclear
magnetic resonance spectrometer.
Suitable, but not limiting, examples of
substances which can be detected using a gamma scanner
include lZSz' 13~I, 123I~ 111In~ 105Rh' 153Sm, S7Cu,
67Ga, I65Ho, lT7Lu, IB~Re, t88Re and 9~mTe. An example .
of a substance which can be detected using a nuclear
magnetic resonance spectrometer is gadolinium.
Conjugates of a composite aum~ YL, VIA anti-
bodies and a therapeutic agent may be administered in a
l
harmaceutica3ly effective amount for the in uivo
p
t treatment of human carcinomas, or metastases thereof, in
a patient having a tumor that expresses TAG-72. A
"pharmaceutically effective amount" of the composite
s Hump VL antibody means the amount of said antibody
~0 (whether unconjugated.,,i.e., a naked antibody, or
conjugated to atherapeutic agent? in the pharmaceutical
composition should be sui"ficient to achieve effective
.., _
binding to TAG-T2.
3~lBS'~'1'~'tJTE SHEE'?'

h~,F; ...~ . . . . . . ...
WO 93/12231 ~ ~ ~ ~ ~ ~~ ~ PCT/AU91/00583
-33-
Exemplary naked antibody therapy includes, for
example, administering heterobifunctional composite Hump
VL, VH antibodies coupled or combined with another...
antibody so that the complex binds both to the carcinoma
and effector cells, e.g., killer cells such as ~T cells,
or monocytes. In this method, the composite Hum4 VL
antibody-therapeutic agent conjugate can be delivered to
the carcinoma site thereby directly exposing the
carcinoma tissue to the therapeutic agent. Alter-
natively, naked antibody therapy is possible in which
antibody dependent cellular cytoxicity or complement
dependent cytotoxicity is mediated by the composite Hum4
VL antibody.
Examples of the antibody-therapeutic agent
conjugates which can be used in therapy include
antibodies coupled to radionuclides, such as 1811, 9
105Rh~ ~4'TSe, 6ZCu, 212Big 211At9 67Ca9 125I~ 186Re9
18$Re, l~7Lu, g9mTc, 153Sm, 1231 and 111In; to drugs,
2fl such as methotrexate, adriamycin; to biological response
modifiers, such as interferon and to toxins, such as
ricin.
Methods of preparing and administering
i
conjugates of the composite Hum~4 VL, VH antibodies and a
therapeutic agent are well known or readily determined.
Tie pharrnaceutieal composition may be administered in a
single dosage or multiple dosage form. Moreover,
suitable dosages will depend on the age and weight of
wthe patia:~t and the therapeutic agemt employed and are
well known or readily determined.
Composite Hump VL, JH antibodies, and parti-
cularly composite Hump ~L, lH single chain antibodies
hereof, are particularly suitable for radioimmunoguided
sues-rrTU-rE sH~~r

WO 93/I223I PCT/AU91/00583
~~~~~~. L
-3~-
surgery (RIGS). In RIGS, an antibody labeled with an
imaging marker i.s injected into a patient having a tumor
that expresses TAG-72. The antibody localizes to tYle
tumor and is deteeted by a hand-held gaumna detecting
probe (GDP). The tumor is then excised (see Martin etal.
(1g8$), Amer. d. Surg., 156:386-3~2~ and Martin etal.
(7986), Hvbridoma, 5:597-5108). An exemplary GIMP is the
Neoprobe~' scanner, commercially available from Neoprobe
Corporation, Columbus, OH. The relatively small size
and human character of the composite Hump vL, Vg single
chain antibodies will accelerate whole body clearance
and thus reduce the waiting period after injection
before surgery can be effeetively initiated.
Administration and detection oi" the composite
Hump VL, Vg antibody-imaging marker conjugate may be
accomplished by methods well-known or readily
determined.
The dosage will vary depending upon the age and
weight of the patient, but generally a one time dosage
of about 0.1 to 200 mg of antibody-marker conjugate per
patient is administered.
30 , a
SUBSTITUTE SHEET

CA 02121041 2000-04-20
64693-5203
-35-
EXA- PLES
The following nonlimiting examples are merely
far illustration of the construction and expression of
composite Fium4 YL, VH antibodies. All temperatures not
otherwise indicated are Centigrade. All percents not
otherwise indicated are by weight.
Example I
CCU9 and CC83 were isolated from their
respective hybridomas using pNP9 as a probe (see Figure
5). CC4g VH was obtained from p49 g1-2.3 (see cigure 6)
and CC83 VH was obtained from p83 g1-2.3 (see Figure 7),
following the procedures set forth in EPO 0 365 997.
DNA encoding an antibody light chain was
isolated from a sample of blood from a human following
the protocol of Madisen et. al. ( 1987 ) . Am. J . Med . Genet . ,
20 27:3T9-390) with several modifications. Two ~ ml
purple-cap Vacutainer~tubes (containing EDTA as an
anticoagulant) were filled with blood and stored at
ambient temperature for 2 hours. The samples were
transf er:~ed to two 4.5 mL centrifuge tubes. To each
25 tube was added 22.5 mL of filter-sterilized erythrocycte
lysate Suffer (0.155 M NH4C1 and 0.17 M Tris. ~H 7.65.
in a volume ratio of 9:1), and incubated at 37°C for 6.5
minutes. The t::bes became Nark red due to the iysed red
blood cells. The samples were centrifuged at 9°C for i0
30 minutes, using an SS-34 rotor and a Sorvall centrifuge
at 5.300 revolutions per minute trpm) ('3,400 X g). The
resulting white cel'_ pellets were ~esuspended in 25 .r.L
of 0.15 M NaCl solution. The white blood ells were
then centrifuged as before. The pellets were
resuspended in 500 ~L of 0.15 M NaCI and transferred to
*Trade-mark

WO 93/12231 PGT/AU91/OQ5~3
-36-
1.5 mL microeentrifuge tubas. The cells were pelleted
again for 3 minutes, this time in the microcentrifuge at
3,000 rpm. Very few red blood cells remained ~n the
pellet. After the supernatants were decanted from the
two microcentrifuge tubes, 0.6 mL high TE buffer (100 mM
firis, pH 8.0i was added. The tubes were hand-shaken for
and 15 minutes. The resulting viscous solution was
extracted with phenol, phenol-chloroform and finally
with just chloroform as described in Sambrook etal.,
10 supra. To 3.9 mL of pooled extracted DNA solution was
added 0.~6 mL NaOAe (3 M, pH 5), and 10 mL 100 percent
ethanol. A white stringy precipitate was recovered with
a yellow pipette tip, transferred into a new Epgendorf
tube, washed once with 70 percent ethanol, and finally
washed with 100 percent ethanol. The DNA was dried fn
vcrc~to for 1 minute and dissolved in 0.75 mL deionized
water. A 20 gL aliquot was diluted ~to 1.0 mL and the OD
260 nm value was measured and recorded. The
concentration of DNA in the original solution was
2Q calculated to be 0.30 mg/mL.
Oligonucleotides (aligns) were synthesized
using phosphoramidite chemistry on a 380A DNA
synthesizer (Applied Biosystems, Foster, CA) starting on
0.2 ~.M solid support columns. Protecting groups on the
final. products were removed by heating in concentrated
ammonia solution at 55°C for 12 hours. Crude mixtures
of oligonueleotides (approximately 12 OD 260 n~a units)
~0 :were applied to 16 percent polyaerylamide-urea gels and
y
electrvphoresed. 'DNA in :he gels was visualized by
short wave UV light. Bands were cut out and ~he DNA
- eluted by heating the gel gieces to 65°C for 2 hours.
Final purification was achieved by application of the
ejuted DNA solution onto C-18 Sep-Fae" columns
SUBSTITUTE SHEET

pC'f/AU91 /00583
WO 93/12231
°37-
(Millipore) and elution of the bound oligonucleotide
with a 60 percent methanol solution. The pure DNA was
dissolved in deionized distilled water (ddH20) and
quantitated by measuring OD 260 nm.
A GeneAmpTM DNA amplification kit (fetus Corp. ,
Emeryville, CA) was used to clone the Hum~# VL germline
gene by the PCR which was set up according to the
manufacturer°s directions. A thermal cycler was used
for the denaturation (9~ °C), annealing (45 °C) and
elongation (72 °C) steps. Each of the three steps in a
cycle were carried out for 4 minutes; there was a. total
of 3o cycles.
Upstream of the regulatory sequences i~ the
Hump V
L germline gene, there is a unique Vila I
restriction enzyme site. Therefore, the 5' end
oligonucleotide for the PCR technique, called HUMVL(+)
(Figure 8), was designed to include this Gla Z site.
. The 3' end oligonucleotide, called HUMVL(--)
(Figure 8), contained a unique Hind III site; sufficient
mouso intron sequence past the splicing site to permit
an effective splice donor function; a human J~ sequence
contiguous with the 3' end of the UL axon of Hum~l VL to
complete the CDR3 and FRS sequences of the UL domain
(see Figures 9 and 10); nucleotides to encode a tyrosine
residue at position ~~ in CDR3; and 29 nucleotides close
to the. 3' end of the VL axon of Hum4 VL (shown
underlined in the oligonucleotide HUMVL(-) in Figure 8)
to anneal with the zuman DNA target. in total, this ~°
end oligonucleotide for the PCR was 98 bases long with a
non-annealing segment (a "wagging tail") of 69
nucleotides. A schematic of the Hum4 JL gene target and
sues-r~-ru~ sHE~°r

PCflAU9I /00583
WO 93/12231
-38-
the oligonucleotides used for the PGR are shown in
Figure 11.
- ... _
A PCR reaction was set up with 1 ~g of total
human DNA in a reaction volume of 100 p.L. Primers
HUM1TL(-? and HUMVL(+) were each present at an initial
concentratiuon of 100 pmol. Prior to the addition of
T'aq polymerase (2.5 units/reaction) 100 gals of mineral
oil were used to overlay the samples. Control samples
were set up as outlined below. The samples were heated
t~ 95 °G for 3 minutes. When the PGR was complete, 20
gL samples were removed for analysis by agarose gel
electrophoresis.
Based on the known size~of the Hum4 VL DPNA
fragment to be cloned, and the size of the
oligonucleatides used to target the gene, a product of
1099 by was expected. A band corresponding to this size
was obtained in the reaction (shown in lane 7, Figure
0 12~.
To prepare a plasmid suitable for cloning and
subsequently expressing the :~ium~ ~lL gene, the plasmid
pSV2neo was obtained from ATCG and subsequently
modified. pSV2neo was modified as set forth below (see
Figure 13).
The preparation of pSV2neo-101 was as follows.


Ten micrograms of purified p5V2neo were digested with ~0


units of Find ICI at 37 'G for 1 hour. The lineari~ed



plasmid DNA was p recipitated
:with
ethanol,
washed,
dried


-:. and dissolved in 10 ~aL er. Two microliters each of
wat


.;
-:,: 10 mM dATP, dCTP, dGTP and dTTP were added, as well. as 2



gL of lOX iigase buffer. r i re units ( 1 p.L ) of DNA


polymerase 1" were added to make blunt the hind III


SUBST1'TU'fE SHEET

WO 93/12231 PCT/AU91/00583
~~.i~~~~~.
-39-
sticky ends. The reaction mixture was incubated at room
temperature for 30 minutes. The enzyme was inactivated
by heating the mixture to 65°C for 15 minutes. ~ The
reaction mixture was phenol extracted and ethanol
precipitated into a pellet. The pellet was dissolved in
20 g1 deionized, distilled water. A 2 p1 aliquot (ca. 1
gg) was then added to a standard 20 laL ligation
reaction, and incubated overnight at ~ °C.
Competent E.coli DH1 cells were transformed with
1 ~L and 10 gL aliquots of the ligation mix (Invitrogen,
San Diego, CA) according to the manufacturer's.
directions. Ampicillin resistant colonies were obtained
on LB plates containing 100 pg/mL ampieillin. Selected
clones grown in 2.O mL overnight cultures were prepared,
samples of plasmid DNA were digested with Hand III and
Bam HI separately, and a correct representative clone
selected.
The resulting plasmid pSV2neo-101 was verified
by size mapping and the lack of digestion with Hind III.
A sample of DNA from pSV2neo-10 mini-lysate was
prepared by digesting with 50 units of Bam HI at 37°C
for 2 hours. The linearized plasmid was purified from a
' ~i percent DNA polyacrylamide gel by electroelution. The
y . DNA ends were made blunt by filling in the Bam HI site
usiyg dNTPs and Klenow fragment, as described earlier
for the Hind III site of oSV2 neo-101.
3
A polylinker segment containing multiple
n
j el-oniwg sites was :.ncorporated at the Bam HI site of
pSV2neo-101 to create pSV2neo-102. Equimolar amounts of
two oligonucl.eotides. Ca(+) and CH(-) (shown in Figure
11t) were annealed by heati~g for 3 minutes at 90 °C and
sues-r~TU-rE steer


WO 93/iZ231 PGT/AU91l00583
~1.!~.~~°~~
1~ 0 .~
cooling to 50 °C. Annealed linker DNA and blunt ended
pSV2neo-101 were added, in a ~40a1 molar volume to a
standard 20 ~L ligation reaction. E, coIi DH1 was ""
transformed with 0.5 ~L and 5 ~L aliquots of the
ligation mixture (Invitrogen). Twelve ampicillin
resistant colonies were selected for analysis of plasmid
DNA to determine whether the linker had been
incorporated.
A Find III digest of mini-lysate plasmid DNA
revealed linker incorporation in six of the clones. The
plasmid DNA from several clones was sequenced, to
determine the number of linker units that were blunt-end
ligated to pSV2neo-101 as well as the relative
orientations) with the linker. Clones for sequencing
were selected on the basis of positirre digestion with
Hind III.
A SequenaseT~f sequencing kit (ITnited States
t 20 Biochemical Corp, Cleveland, 0H was used to sequecne
i the DNI~. A primer, NE0102SEQ, was used for sequencing
and is shown in Figure 15. It is complementary to a
E sequence located upstream fram the ,Bam HI site in the
vector. Between 3 ~g and 5 ~Zg of piasmid DNA isolated
from E. coli mini-? ysates were used for sequencing. The
DNA was denatured and precipitated prior to annealing,
as. according to the manufacturer's instructions.
Electrophoresis was carried out. at 1500 volts; gels were
dried prior to exposure, ~o,Kodak X-ray film. Data was
~0 processed~using Hi'tachi's DNASIS=" computer program.
Fro~a the DNA sequence data of ~ clones analyzed
(see~photograph of autoradiogram - Figure 16), compared
to the expected sequence in cigure 1~~ two clones having
SUBSTITUTE SHEET

i.~G..:- : . ' _- ~.,'.. :.. .. ..... '. ',.'. . ,~-:~..~' ..
WO 93/12231 ~ ~~ /~- ~' _' ~ PCT/AU91/00583
-'~ 1-
the desired orientationwere obtained. A representative
clone was selected and designated pSV2neo-102.
A human Cx gene was inserted into pSY2neo-102
to farm-pRL1000. The human Cx DNA was contained in a
' S 5.0 kb Hind III-Bam HT fragment (Hieter et al. (1980),
Cell , 221 197 200 0
A 3 pg sample of DNA from a mini-Iysate of
pSll2neo-102 was digested with Bam HI and Hind III. The
vector DNA was separated from the small Bam HI-~;~Iind III
linker fragment, generated in the reaction, by
electrophoresis on a 3.75 percent DNA polyacrylamide
gel,. The desired DNA fragment was recovered by
elec'troelution. A pBR322 clone containing the 5.0 kb
5 .Hind I I I-Bam HI f ragment of the human Cx gene ( see
Hieter ctal., supra) was designated.phumCx. The 5.0 kb
.Find III-Eam HI fragment was ligated with pSV2neo-102r
and intr~duced into E. coli DH1 ( Invitrogen) . rlmpieillin
z0 resistant colonies were screened and a clone containing
the human Gk gene was designated pRL1000.
Finally, pRL1000 clones were screened by
testing mini-lysate plasmid DNA from E.coli with Hind III
25 and Eam HI. A clone producing a plasmid which gave 2
bands, one at 5.8 Kb (representing the vector) and the
other at. 5.0 kb (representing the human Cx insert) was
.selected. Further characterization of pRL1000 was
achieved by sequencing downstream from the Hind III site
30 in the ;intron -region of the . human Cx insert . The
oligonucleoti.de used to prime the sequencing reaction
was NE0102SEQ (Figure 'S). Two hundred and seventeen
.~ bases were determined (see Ffigure 17). A new
bligonueleotide corresponding to the (-) strand near the
Hind ZZT site (shown is =figure 1?) was synthesized so
suesT~TU~ sHEE-r

. ,-,
WO 93/12231 ~ 1 ~ .~ ~ '~ -~~- PCTlAU91/00583
that clones, containing the HHum4 VL gene that were
cloned into the Cla I and Hind III sites in pRL1000 (see
Figure 13), could be sequenced. ~ ~w
A Cla I-Hand III DNA fragment containing Hump VL
obtained by PCR was cloned into the plasmid vector
pRL1000. DNA of pRL1000 and the Hump VL were treated
with Cla Z and Hand III and the fragments were gel
purified by electrophoresis, as described earlier.
The pRL1000 DNA fragment and fragment
containing Hump VL gene were ligated, and the ligation
mixture used to transform E.coli DH1 (Invitrogen),
following the manufacturer's protocol. Ampicillin
resistant clones were screened for the presence of the
Hum~t VL gene by restriction enzyme analysis and a
representative clone designated pRL1001 (shown in Figure
1~)s
Four piasmids having the correct Cla I-Hind III
restriction pattern were analyzed further by DNA
sequencing of the insert region (see Figure 19). Hind
III Cxt°) (shown in Figure 17), HUMLIN1(-) (shown in
Fagure 10), EIUMLIN2(-) (shown in Figure i0) were used as
the sequencing primers. Two out of the four' plasmids
analyzed had the expected sequence in the coding regions
(Figure 19, clones 2 and 9).
Clone 2 was chosen and used for generating
sufficient plasmid DNA for cell :ransformatians and
other analysis. This plasmid was used for sequencing
thraugh the Hum4 VL, and the upstream region to the Cla
T site. Only one change at nucleotide position 8~ from
a C to a G (Figure ~0) was observed, compared to a
SUBSTITUTE SHEET

WO 93112231 ~ ~ ~ ~ o l~ ~ PC'T/AU9~/005g3
-'~ 3 -
published sequence (Klobeck sfal. (19$5), supra). The
DNA sequence data also indicates that the
oligonucleotides used for the PCR had been correctly
incorporated in the target sequence.
The Biorad Gene Pulser"' apparatus was used to
transfect Sp2/0 cells with linearized plasmid DNAs
containing the light or heavy chain constructs. The
Hump vL was introduced in Sp2/0 cells along with
corresponding heavy chains by the co-transfection scheme
indicated in Table 1.
Table 1
DNA Added


Cell Line


Designation L Chain H Chain ~! Chain


pRL1001 P49 pB3


g1-2.3 g1-2.3


MP1-44H 20 ~g 1S pg 0 ~g


MPl-64H 20 pg 0 gg 15 ug



A total of 8.0 x 10b Sp210 cells were washed in
sterile PBS buffer (0.$ ml o~ 1 X 107 viable cells/mL)
and held on ice for 10 minutes. DNA o~'' pRL1001,
line.arized at the Cla I site, and the DNA of either p~9
g1-2.3 or p83 g1-2.3, linearized at their respective Nde
I sites, were added, in sterile PBS, to the cells (see
protocol - Table 2) and held at 0 °C for a further 10
minutes. A single 200 volt, 960 pF.electrical pulse
lasting between 20 and 30 milliseconds was used for the
'' electroporation. After holding the perturbed cells on
ice for 5 minutes, 25 ml of RPMI medium with 10 percent
fetal calf serum were ?ntroduced, and 1.0 ml samples
ali~uoted in a 24 well tissue culture plate. 1'he cells
were incubated at 37 °C in a ~ percent C02 atmosphere.
SUBSTITUTE SHEET

WO 93!I2231 ~ ~ ~ ~ ~ ~ ~ PGT/AL191/00583
_~1~_
After 48 hours, the media was exchanged with f rash
selection media, now containing both 1 mglmL Geneticin
(G~1~) (Difco) and 0.3 p.g/ml mycophenolic acid/gpt ~"
medium. Resistant cells were cultured for 7-10. days.
Supernatants from wells having drug resistant
colonies were tested on ELISA plates for aotivity
against TAG-72. A roughly 10 percent pure TAG-72
solution prepared from LS147fi tumor xenograft cells was
diluted 1:40 and used to coat flexible polyvinyl
chloride microtitration plates (Dynatech Laboratories,
Inc.). Wells were air-dried overnight, and blocked the
next day with 7 percent 3SA. supernatant samples to be
tested for anti-TAG-72 antibody were added to the washed
wells and incubated for between 1 and 2 hours at 37 °C.
Alkaline phosphatase labeled goat anti-human IgG
(diluted 1:250) (Southern Biotech Associates,
Hirmingham, AL) was used as the probe antibody.
Incubation was for 1 hour. The substrate used was p-
nitrophenylphosphate. Color development was terminated
by the addition of 1.0 N NaOH. The plates were read
spectrophotometrically at 405 nm and 450 rim, and the
values obtained were 405 nm-x+50 nm.
Those samples producing high values in the
assay were subcloned from the original 24 well~plate
onto 96 well plates. Plating was done at a cell density
of half a cell per well (nominally 50 cells) to get pure
monoclonal cell lines. Antibody produc;ng cell lines
were frozen down 'n media containing 10 percent DMSO.
Two cal? lines were procured having the
desi.gnations: ~iP 1-~4H and ;~P 3-34H. MP 1-44H has t:~e
ehimeric GC~9 ~1 heavy chain with the Hump ~TL light
SUBSTITUTE SHEET

WO 93/12231 PCT/~U91/OU583
2l~I~f~~.
_q5_
chain; and MP1-8~IH has the chimeric CC83 g1 heavy chain
with the Humvklf light chain.
'~ A 1.0 L spinner culture of the cell Iinew
MP1-~~H was grown at 37°C for 5 days far antibody
production. The culture supernatant was obtained free
of cells by centrifugation and filtration through a
0.22 micron filter apparatus. The clarified supernatant
was passed over a Protein A cartridge (Nygene, New
York). Immunoglobulin was eluted using 0.1 M sodium
citrate buffer pH 30. The pH of the eluting fractions
containing the antibody was raised to neutrality by the
addition of Tris base, pH 9Ø The antibody-containing
fractions were concentrated and passed over a Pharmacia
Superose 12 HR 10/30 gel filtration column. A protein
was judged to be homogeneous by SDS polyaerylamide gel
electra~horesis. Isoelectric focusing further
demonstrated the purity of MP1-~~H.
The biological performance of the human
composite antibody, MP1-~~H, was evaluated by comparing
immunohistochemistry results with two other anti-TAG-72
antibdoies CC~9 (ATCC No. H8 959) and Ch44 (ATCC No. H8
9$$~). Sections of human colorectal tumor embedded in
paraffin were tested with the three antibodies by
methods faniliar to those skilled in this art. All
threw antibodies gave roughly equivalent binding
recognition of the tumor antigen present on the tumor
tissue sample.
A further test of the affinity and biological
integrity of the human composite antibody MP1-~4~H was a
competition assay, based on cross~competing radioiodine-
-labeled versions of the antibody with CC~9 and Ch~4 in
all combinations. :rpm the data shown in Figure 20, it
SUBST1TlJTE SHEET

WO 93/12231 PGT/AU91 /00583
~i:~ ~ ~r~
is apparent that the affinity of all 3 antibodies is
equivalent and can bind effectively to tumor antigen.
.M
MP1-~+~H (ATCC HB 10426) and MP1-$4H (ATCC HH
1047) were deposited at the American Type Culture
Collection (ATCC).. The contract with ATCG provides for
permanent availability of the cell lines to the public
on the issuance of the U.S. patent describing and
identifying the deposit or the publications or upon the
laying open to the public of any U.S. or foreign patent
application, which ever comes first, and f or
availability of the cell line to one determined by the
II.S. Commissioner of Patents and Trademarks to be
entitled thereto according to 35 CFR X122 and the
Commissioner's rules pursuant thereto (including 3? CFR
~1.14 with particular reference to $86 0G 63$). The
assignee of the present application has agreed that if
the cell lines on deposit should die or be lost or
destroyed when cultivated under suitable conditions for
20 a period of thirty X30) years or five (5) years after
the last request, it will be promptly replaced on
notification with viable replacement cell lines.
example 2
Single-chain antibodies consist of a VL, VH
and a peptide linker joining the VL and VH domains to
produce SCF~Ts. A single chain antibody, SCFV1, was
constructed to have the Hum4 VL as V Domain 1 and CC49
VH as V..Domain. 2, ($ee Figure 27 ).
:he polypeptide linker which joins the two V
domains was encoded by the DNA introduced at the 3'~end
of the VL DNA during the 'CR. '.'he oligonucleotides
SCF~FIa and 5CFV2 were designed to obtain the DNA segment
SUBSTITUTE SHEET

WO 93/12231 PGT/AL191/00583
~ ,~ 1
Au7_
incorporating part of the yeast invertase leader
seauence, the Hum~1 VL and the SCFV linker.
..,.
The polypeptide linker for SCFV1 was encoded in
oligonucleotide SCFVIb (see below). The underlined
portions of the oligonucleotides SCFVIa and SCFVIb are
complementary to sequences in the Hum~l VL and linker
respectively. The sequences of SCFVIa and SCFVIb are as
follows, with the hybridizing sequences underlined:
SCFVIa with the HindIII in bold:
Hind I I I
5'CTGCAAGCTTCCTTTTGCTTTTGGCTGGTTTTGCAGCCAAAATATCTGCAG
ACATCGTGATGACCCAGTC~-3'
SCFVIb with the Aat II site in bold:
~2.0
5'-CGTAAGACGTCTAAGGAACGAAATTGGGCCAATTGTTCTGAG
GACGGAACCTGACTCCTTCACCTTGGTCCCTCCGCCG-3'
The target DNA in the PCR was pRL1001
shown in.Figure 1$). The PCR was performed pursuant to
the teachings of Mullis et al. supra. A DNA fragment
containing tl~e Hum~4 , VL-linker DNA component for the
. construction of SCFV1 was obtained and purified by
polyaerylamide gel electrophoresis according to the
teachings of Sambrook et al. , supra.
sues-rt-ru~ s~~E-r

WO 93!12231 ? ~ ~ ~ ~ '' ~ PcrC.A~lga/ooss~
p~E9 g1-2.3~ containing CG~9 VH, was the
target DNA in the PCR. PCR was performed according to
the methods of Mullis etal., supra. The oligonueleo~fdes
used for the PCR of CC~9 ~lH are as follows,, with the
hybridizing sequences underlined: _
SCFVi~c, with the Aat II site in bold:
5'-CCTTAGACGTCCAGTTGCAGCAGTCTGACGC-3'
SCFtTId,~ with the Flied III site in bold:
5'-GATCAAGCTTCACTAGGAGACGGTGACTGAGGTTCC-3'
The purified Hump VL-linker and Vg DNA
_fragments were treated with Aat II CNew England Biolabs,
Beverly, MA) according to the manufacturer's protoool,
and purified frbm a 5 percent polyaerylamide gel after
electrophoresis. An equimolar mixture of the Aat II
fragments was ligated overnight. Ths T4 DNA ligase was
heat inactivated by heating the ligation reaction
mixture ~.t 65 'v ' foz° 10 ' minutes. Sodium chloride was . r
added to the mixture to give a final concentration of 50
- mM and the mixture was further with Hind III. A Hind
III DNA fragment eras ssolated and purified from a ~1.~
percent polyacrylamide gel and cloned ynto a yeast
expression vector Csee Carter etal. C1987), In: DNA
~UBSTtTUTE SHEET

WO 93/12231 PC.'T/ALJ91/00583
~1~~~ ~'~~.
Cloning, A Practical Aneroach, Glover (ed.) Vol. III:
1~1-161). The sequence of the fragment, containing the
contiguous SCFV1 construct, is set forth in Figure...~2.
The anti-TAG-72 SCFV1 described herein
utilized the yeast invertase leader sequence (shown as
positions -19 to -1 of Figure ~2), the Hump V~, (shown as
positions 1 to 113 of Figure 22), an 18 amino acid
linker (shown as positions 114 to 132 of Figure 22) and
CC~9 VH~(shown as positions 133 to 248 of Figure 22).
The complete DNA and amino acid seqmence of
SCFV1 is given in Figure 22. The oligonucleotides used
to sequence the SCFV1 are set forth below.
TPI:
5'-CAATTTTTTGTTTGTATTCTTTTC-3'.
HUVKF3:
2D 5'-CCTGACCGATTCAGTGGCAG-3°.
DC113:
5'-TCCAATCCA'TTCCAGGCCCTGTTCAGG-3'.
SUC2T:
~'-CTTGAACAAAGTGATAAGTC-3'.
Examule 3
A plasmid, pCGS517 (Figure 23), containing
a proxennin gene was digested with Hind III and a 6.5 kb
fragmewt was isolated. The plasmid pCGS517 has a
triasephosphate isomerase promoter, invertase [SUC2]
signal sequence, the prorennin gene and a [SUC2]
SUBSTITUTE SHEET

WO 93/I2231 ~ ~ ~ ~ ~ ~ ~ P(:f/AL191/00583
-50~
terminator. The Hirxd IIIwdigested SCFV1 insert obtained
above (see Figure 23) was ligated overnight with the
Hind III fragment of pCG5517 using T~ DNA ligase -.-
(Stratagene, La Jolla, CA).
The correct orientation existed when the
Hind III site of the insert containing; part of the
invertase signal sequence ligated to the vectar DNA to
form a gene with a contiguous signal sequence. E'.coli.
DHI (Invitrogen) cells were transformed and colonies
screened using a filter-microwave technique (see
3uluwela, etczl: (1989), Nucleic Acids Research, 17r452).
From a transformation plate having several hundred
colonies, 3 positive clones were obtained. Digesting
°he candidate plasmids with .Sal I and Kpn I, each a
single cutter, differentiated between orientations by
the size of the DNA fragments produced. A single clone,
pDYSCF'~1 (Figure 23), had the correct orientation and
was used for further experimentation and cloning. The
20~ probe used was derived from pRL1001, which had been
digested with Kpn I and Cla I (see Figure 18). The
probe DNA was labeled with 3~P a-dGTP using a random
oligcnueleotide primer labeling kit (Pharmacia LKH
Biotechnology. Piscataway, NJ). -
The next step was to introduce the Bgl II-
~al 1 fragment from pDYSCFV1 into the same restriction
sites of another vector (ca. 9 kb), which was derived
t'rom PCGS515 (Figure 23). to give an autonomously
replicating pl2sm3d 'i n S. cer~visiae.
DNA from the vector and insert were
digested in separate reactions with Bgl II and Sal I
~ssing 14X buffer ncmber 3 (5Q MM Tris-HGI (pH 8.0), 100
mM NaCl, 3AL). The sDNA fragment from pDYSCF~II was run
SUBSTITUTE SHEEt

,,;? -,
1~Y0 93/12231. ~ ~ c~ .~ ~ ;~ ~ P(:T/AU91/00583
m:. a
- a 1--
in and electroeluted from a 5 percent polyacrylamide gel
and the insert DNA was run and electroeluted from a 3.75
.,, percent polyaerylamide gel. A standard ligationwsing
T11 DNA ligase (Stratagene) and a transformation using E.
coli DH1 (Invitrogen) was carried out. Out of 6 clones
selected for screening with Bgl Il and Sal II, all 6
we're carrectly oriented, and one was designated
pCGS5151SCFV1 (Figure 23).
DNA sequencing of pCGS515/SCFVI DNA was
done using a Sequenase~' kit (U. S. Biochemical,
Cleveland, OH) using pCGS515/SCFV1 DNA. The results
have been presented in Figure 22 and confirm the
sequence expected, based on the linker, the Huml4 VL and
the C~C~9 VH.
Transformation of yeast cells using the
autonomosly replicating plasmid pCGS515/SCFV1 was
. carried out using the lithium acetate procedures
z0 described in Ito et al. ( 1983) , J . Bacteriol. , 153: 163-
168'; and Treco (7987), In: Curent Protocols in Molecular
Biology, Ausebel et al. (eds), 2:13.71-13.7.6. The
recipient strain of S.eerevasiae was CGY128~ having the
- , genotype - MAT a (mating strain n), ura 3-52 (uracil
z
E 25 auxotrophy), SSCi-1 (supersecreting 1), and PEP4+
(peptidase ~ positive).
Transformed clones of CGY1284 carrying SCFV
plasmids were selected by their ability to grow on
30 minimal,:~edia in the absence of uracil. Transformed
colonies appeared within 3 to a days. The colonies were
transf erred, grown and plated in YEPD medium. shake
flasks were used to provide culture supernatant with
expressed product.
SUSST1TUTE SHEET

CA 02121041 2000-04-20
64693-5203
-52-
An ELISA procedure was used to detect
biological activity of the SCFV1. The assay was set up
such that the SCFV would compete with biotinylated CC4g
(biotin-CC~19) for binding to the TAG-T2.antigen on the
ELISA plate .
SCFV1 protein was partially purified from a
crude yeast culture supernatant, using a Superose~'12 gel
filtration column (Pharmacia LKB Biotechnology), and
found to compete with biotinylated CC4g in the
competition ELISA. These results demonstrate that ~he
SCFV1 had TAG-72 binding activity.
The SCFV1 protein has been detected by a
standard Western protocol (see Towbin etal. (1979), Proc.
Natl. Acad. Sci.. . .,
U.S A T6 u350-u354). The detecting
agent was biotinylated FAIDI~t (ATCC No. CRL 10256), an
anti-idiotypic monoclonal antibody prepared from mice
that had been immunized with CC49. A band was
visualized that had an apparent molecular weight of
approximately 26,000 daltons, the expected size of the
SCFV1. This result demonstrated that ~he SCFV1 had peen
secreted and properly processed.
Example 4
The following example demonstrates the cloning
of human 'lH genes into a SCFV plasmid construct
containing sequence coding for the ~um4 VL and a 25
amino acid linker called UNIHOPE.
J
A vector was prepared froc plasmid pRW 83
containing a chloramphenicol resistance (Camr) gens ~"or
clone selection, and a penP gene with a penP promoter
and terminator ( see Mezes , et al. ( 1983 ) , ,t . 8 i o 1 . Chem . .
258:11211-11218) and the pel B signal sequence (see Lei
*Trade-mark

WO 93/12231 ~ i ~ ~ 0 ~~ 1 P~.'f/AU91/~0583
-53-
etal. (1987) suprc). The vector was designated Fragment
A. (see Figure 2~). The penP gene was removed with a
Hind III/Sal I digest.
re
The penP promoter and pel B signal sequence were
obtained by a PCR using pRW 83 as a template and
oligonucleotides penP1 and penP2 as primers. The
fragment was designated Fragment B (see Figure 2~d), A
Nco I enzyme restriction site was introduced at the 3'
1G end of the signal sequence region by the penP2
oligonucleotide.
penP1:-
5'-CGATAAGCTTGAATTCCATCACTTCC-3'
15 penP2:
5'-GGCCATGGCTGGTTGGGCAGCGAGTAATAACAATCCAGCG GCT
GCCGTAGGCAATAGGTATTTCATCAAAATCGTCTCCCTCCGTTTGAA-3'
A SCFV comprised of a ~ium~ VL, a CCU9 VH, and
20 an 18 amino acid linker (Lys Glu Ser Gly Ser Val Ser Ser
Glu Gln Leu Ala Gln Phe Arg Ser Leu Asp) was obtained
from pCGS515/SCFV1 by PCR using oligonueleotides penP3
and penP6. This fragment was designated Fragment D (see
Figure 24). A Bcl I site was introduced at the 3' end
z5 of the V re ion b the
g g y penP6 oligonucleotide.
penP3:
5'-GCTGCCCAACCAGCCATGGCCGACATCGTGATGACCCAGTCTCC-3'
3o penPsc-):
a 5'-CTCTTGATCACCAAGTGACTTTATGTAAGATGATGTTTTG ACG
GATTGATCGCAATGTTTTTATTTGCCGGAGACGGTGACTGAGGTTCC-3'
Fragments B and D were joined by PCR using
oligonucleotides penP1 and penP6, v"ollowing the
3UBS?'1TllT'E SHEET

WO 93/1Z23I PG"I'IAU91/00583
5~
procedures of Harton etal., supra. The new fragment was
designated E (See Figure 2~4).
Fragment C captaining the penP termination~codon "'
was isolated by digesting pRW 83 with Pcl I and.,Sa1 I,
and designated Fragment G. pRW 83 was isolated from E. °
coli strain GM161, which is DNA methylase minus or dam".
Plasmid pSCFV 31 (see Figure 2~) was created
with a three part ligation Fragments A, C, and E.
The Nco I restriction enzyme site within the
Camr gene and the Mind III site located at the 5' end of
the penP promoter in pSCFY 31 were destroyed through a
PCR DNA amplification using oligonucleotides Ncol.1 and
Ncol.3(-) to generate an Eco RI-Nco I fragment and
oligonucleotides Ncoi.2 and Ncolr~e(-) to gen~rate a Nco
I to ~co RI fragme:~t. These two fragments were joined
by PCR-SOE using oligonucleotides Ncol.i'and Ncoi.~c(-).
The oligonucieotides are set forth below:
Neol.'1:
5°-TCCGGAATTCCGTATGGCAATGA-3'
Neo 1 r 3 ( ) r
5°-CTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGC-3°
Neol.2:
5'-ATGGGCAAATATTATACGCAAG-3'
Neol.~c(-):
5'-CACTGAATTCATGGATGATAAGCTGTCAAACATGAG-3' '
pSCFv 31 was digested with Eco RI and the larger
Fragment was isolated by polyacrylamide gel
electrophoresis. To prevent self ??gation, the DNA was
StJBSTITtJ'YE SHEET


WO 93/12231 P~'/AU91/00583
_~~_ 2~.2:~~~:~~
dephosphorylated using calf intestinal alkaline
phosphatase according to the teachings of Sambrook etal.9
Sll~l'a s
.,~
A two part ligation of the larger pSCFV 31
digested fragment and the PCR-SOE fragment, described
y
above-, resulted in the creation of pSCFV 31b (see Figure
25).
pSCFV 31b was digested with Nco I arid Sal I
and a fragment containing the Camr gene was isolated.
The Hump Vi, was obtained by PCR DNA
amplification using pCGS515lSCFVI as a template and
oligonucleotides 10~IBHi and 10~48H2(-) as primers.
10~8H1:
5°-CAGCCATGGCCGACATCGTGATGACCCAGTCTCCA-3'
lo~8H2(-):
5'-AAGGTTGCCCCATGCTGCTTTAACGTTAGTTTTATCTGCTGG
AGACAGAGTGCCTTCTGCCTCCACCTTGGTCCCTCCGCCGAAAG-3'
The CC~49 VH was obtained by PCR using p49
. g1-2.3 (Figure 5) as a template and oli onucleotides
a g
1083 and 10~B4(-) as primers. A Nhe I enzyme
restriction site was introduced just past the
termination colon in the 3' end (before the Bcl I site)
by oliganueleotide lo4B~6(-) .
3o io~a3:
t
x
5'-GTTAAAGCAGCATGGGGCAAGCTTATGACTCAGTTGCAGCAGTC':GACGC-3'
SUBSTiTt~TE SHEET

i ~ ~~
WO 93/12231 1~GT/AU91/005g3
d~6_
~0~~~(-):
~'-CTCTTGATCACCAAGTGACTTTATGTAAGATGATGTTTTGACGGATT
CATCGCTAGCTTTTTATTTGCCATAATAAGGGGAGACGGTGACTGAGGTTCC-3'
In the PCR which joined these two fragments -
using oligonucleotides T0~3H'1 and 104B~t(-) as primers, a
coding region for a 22 amino acid linker was formed.
A fragment C (same as above) containing the
penP termination codon was isolated from. pRW 83 digested
with ~c1 T and Sal I.
Plasmid pSCFV 33H (see figure 25) was
created with a three part ligation of the vector,
fragment C, and the SCFV fragment described above.
pSCFV 33H was digested with Ncol and lVhel,
and the DNA fragment containing the Camr Gene was
isolated as a vector.
Hump VL was obtained by PCR DNA
amplification using pRL1001 (see figure 18) as a
template and oligonucleotides UNIH1 and UNIH2(-) as
primers. Oligonucleotides for the PCR were:
UNIH'1
S'-CAGCCATGGCCGACATTGTGATGTCACAGTCTCC-3'
The .~Ico I site is in bold and the hybridising seauence
is underlined.
;.
UNIH2(-):
5'-GAGGTCCGTAAGATCTGCCTCGCTACCTAGCAAA _
AGGTCCTCAAGCTTGATCACGACCTTGGTCCCTCCGC-3'
The Bind III site is in bold.
SUBSTITUTE SHIEST

W0 93/I2231 . '~ ~ ? ~ ~ ~~ ~ PCT/AU9~/00583
The CC~69 VH was obtained by a PCR using p~49 81-
2.3 (see Figure 6) as a template and oligonucleotides
UNI3 and UNI~4 { - ) as primers . ~ ...
UNI3:
5'-AGCGAGGCAGATCTTACGGACCTCGAGGTTCAGTTGCAGCAGTCTGAC-3'.
The Xho I site is in bold and the hybridizing sequence
is underlined.
UNIT(-):
5'-CATCGCTAGCTTTTTATGAGGAGACGGTGACTGAGGTTCC-3'.
The Nhe I site is in bold and the hybridizing sequence
is underlined.
Oligonueleotides UNIH1 and UNIT(-) were used in
the PCR-SOE amplification which joined the Hump VL and
CC~9 VH fragments and formed a coding region for a
negatively charged fifteen amino acid linker. The DNA
was digested with Nh.e I and Nco I and ligated with the
20 vector fragment from the Neo I-Nhe I digest of pSCFV
33H. The resultant plasmid was designated pSCFV UNIH
(shown in Figure 25).
With the construction of pSCFV UNIH, a
25 universal vector for any SCFV was created with all the
desired restriction enzyme sites in place.
pSCFV UNIH was digested with Fffnd III/Xho I,
and the J.arge DNA'fragment containing the Camr gene.
Hump VL and CC~9 YH was isolated.
30.
A fragments coding for a 25 amino acid linker,
wa:S made by annealing the two oligonueleotides shown
below. The linker UNIHOPE is based on 20aC SCA'" linker
x
. {see Whitlow, (1990) Antibody En~:::eerinQ: Vew
~Teehnolos~y and Auolication Implications. IHC USA
SI~BSTiTtJ'fB SHEET


WO 93/I~23I ~ ~ ~ ~ ~ !~ ~ Pc~rAU~~r~u~s~
_~~~.
Conf erenees Inc, MA), but the first amino acid was
changed from serine to leucine and the twenty-fifth
amino acid were was changed from glycine to leueine, to
aecomodate the .Hcnd III and Xho I restriction sites.
The nucleotide sequence encoding the linker UNIHOPE is
set forth below:
UNIHOPE (Figure 26):
I0
5'-TATAAAGGTTAGTGCGGACGATGCGAAAAAGGATGCTGCGAAG
AAGGATGACGCTAAGAAAGACGATGCTAAAAAGGACCTCGAGTCTA-3'
UNIHOPE(--) (Figure 26):
5'TAGACTCGAGGTCCTTTTTAGCATCGTCTTTCTTAGCGT CAT
CGTTGTTCGCAGCATCCTTTTTCGCATCGTCCGCACTAAGCTTTATA-3'
I5 °The resulting strand was digested with F~ircd
IIIlXho I and Iigated into the vector, thus generating
the plasmid pSCFV UHH shown in Figure 27). Plasmid
pSGFV UHH expresses a biologically active, TAG-72
binding SCF~T consisting of the Hump v~, and CC49 ~IH. T_he
20 expression plasmid utilises the ~i-lactamase penP
promoter, pectate lyase pe~B signal sequence and the penP
terminator region. Different immunoglobulin light chain
variable regions can be inserted in the Nca I-Hind III
restriction sites, different SCFV linkers can be
25 inserted in the find III-Xha I sites and differewt
immunoglobulin heavy chain variable regions can be
inserted in the .~'ha I-a'Vhe T sites.
E.cali AGI (Stratagene) was transformed with the
3G ligation mix, and after screening, a single
chloramphenicol resistant clone, having DNA with the
correct restriction map, was used for further work.
The DNA sequence and deduced amino acid
sequence of the SCF~I gene .n the resulting plasmid are
shown in Figure 26.
~UBS'd°1"1'lJ'fE SHEET'

1~~'l'~3 93f~22~1 ~ ~ 2 ~ ~ '~~ ~, PCT/A~J9~1p05~3
.~. ~oli AG i containing pSCFV U~-iH were grown in 2


ml of LB broth with 20 ~xg/mL chloramphenicol (CAM 20).


The culture was sonicated and assayed using a


competition ELISA. The cells were found to produce


anti~TAG~72 binding material. The competition assay was


set up as follows: a 9b well plate was derivatized with


a TAG-72 preparation from LS17~T cells. Tkae plate was


blocked with 1~ H5A in PBS for 1 hour at 31 C and then


washed 3 times with 200 p.L of biotinylated CC~9


(1/20,000 dilution of a 1 mg/mL solution) were added to


the wells and the plate was incubated for 30 miwutes at


31 C. The relative amounts of TAG-72 bound to the


plate, biotinylated CC~t9, streptavidin-alkaB ne


phosphatase, and color development times were determined



empirically in order not to have excess of either


antigen or biotinylated CC~t9s yet have enough signal to


detect coaapetition by SCF'V. Positive controls were CC~d9


at 5 ~g/mL and CC~+9 Fab at 10 ~L/mL. Negative controls


were 1~ HSA in PHS and/or concentrated LB. Unbound


proteins were washed away.


Fifty mieroliters of a 1:1000 dilution of


streptavidin conjugated with alkaline phosphatase


(Southern Biotechnology Associates, Inc., Birmingham,


AL) were. added and the plate was incubated for 30


minutes at 31 C. The plate was washed 3 more times.


Fifty microliters of a pare-~nitrophenylphosphate


s:ol.ution (Kirkegaard & Perry Laboratories, Inc.,


Gaithersbur~, ~~.'0) were added and the color reaction was


t al?owed to develop or a minimum of 20 minutes. The


relative amount of SCFV binding was measured by optical


density scanning at ~05~~450 nm using a microplate reader


(Molecular Devices Corporation, Menlo Park, CA).


Hinding of the SCP'V resulted in decreased binding of the



W~ 93/I~,Z31 ~ ~ ~ ~ ~ ~~ ~ PCf/AL1~1/00583
_50--
biotinylated CC~9 with a concomitant decrease in color
development. The average value for triplicate test
samples is shorn in the table belowm . .~
Sample (50 ~ZL) 0D ~0~ nm .- OD 4~0 nm Ualue
(mixed 1e1 with CC~9 Biotin) at ~Q minutes
Sonicate E. colt AG1 / pSCFVUHH
clone 10 0.072
Sonicate .~. coli AG1 / pSCFvUHH 0 ~ 0~~
clone 71
CC~9 at ~ mglmL 7.076
CC~9 Fab at ~0 mg/mL 0.078
LB (negative control) 0~59
20 The data indicates that there was anti-TAG-72
activity present in the E.coli AGI/pSCFUUHH clone
sonicate.
Example 7
The plasmid pSCFPUHH may be used to host other
VH genes on Yho i.-N~~ I fragments and test in a SCFU
format, following the procedures set forth below. A
schematic for this process is shown here.
30 ;
~IJBST'1'Ct~T~ ~l~~E'f'

F~e J.. ~e.
W~ ~3/I2231 ~'~r/AU~3Y/005~3
Discodery of Hum4 V~,--VH combinations Chat camp~ete crith l~nown osototype
TAIy-binding antibodies or mimetics. .".
pSCFVUHH ~h0 I/N3te I
Vector DNA Fragment
(CC49 Vg removed)
or pATDFLAG XhoI,SPiheI Elector DHA Fragment
Lsolate mHtdA fr~m
peripheral blood lymphocytes
Synthesize cDNA
a
PCR amplify human Vg genQs
using oligos HVH135, HVH2A,
FiVH46 (as the 5° targeting
oligos) and JHl245, JH3 and
JH6 (as the 3' targeeing oligos)
in all 9 combinations.
gel purify D~1A
1
Digest with Xho I and ~Vl~e I
Cel. purify .OPtA (~~H inserts )
Ligate Vector
and Transform
VH insert c~NAs F.coli
s

W~ 93/12231
p~'I'/A1.J91/005~3
-
7
.M
Plate transformation mix onto hydrophilic membranes °
(137 mm) which are placed on LU CAM 20 agar plates
(150 mm) with a calony density of ~ 50,000 per plate.
Grav for 8-16 hours at 37 'C.1
m
SCFV is
secreted Transfer hydrophilic membrane onto fresh L8 CAM 20 plate
by E.cola having a TAG'-72-coated hydrophobic membrane (137 mm) already
and may placed on the agar surface. Incubate for 24-96 hours.
bind to TAG.
I
Process hydrophobic membrane using a prototype
biotinylated TAG-competing antibody, e.g. a72.3, CC49,
CC83 or biotinylated competing peptide or mimetic. tTse
assay stseptavidin conjugated with alkaline phosphatase to bind
to biotin and suitable substrate for alkaline phosphatase to
develop a color reacf~fon.
1
Co-relate clear zones on membrane assaq with calany(ies)
on hydrophilic membrane. Isolatefpurify correct clone
as necessary. Characterize DHA (sequence) and determine
binding afFinity of SCF'Y to TAG-72. Purify SCI'V and
perform in.occo animal biodistribucion studies.
Determine normal:tumor tissue binding profile by
immunohistocaemistry.
Utilize Hum4 VG and Vg in e~refesred antibody
farmers e.g. whole Ig (IgGl, IgE, IgM etc.) Fab or
F(ab')2 fragment, or SCFd.
~~~5~~~~~~~

CA 02121041 2000-04-20 -
" 64693-5203
-03-
Isolatinz total RNA f~om oerioheral blood lvmohocvtes:
3lood from a normal, healthy donor is drawn
into three 5 mL purple-cap Vacutainer tubes. Seven :nL
o~ blood are added to two 15 mL polypropylene tubes. An
equal volume of lymphoprep (cat# AN5501, Accurate) is
added and the solution is mixed by inversion. Both
tubes are centrifuged at 1000 rpm and 18 °C for 20
minutes. The resulting white area near the too of the
liquid (area not containing red blood cells) is removed
Iron each sample and placed into two sterile
polypropylene csntr'_fuge tube. Ten mL of sterile ?9S
are added and the tube mixed by inversion. The saaoles
are centrifuged at 1500 rim and 18 °C for 20 minutes
Total RNA is isolated from resulting pellet according to
the RNAzoi~B Method (Chomczynski and Sacchi (1987),
Analytical Biochemistry, 162:156-15g), Briefly, ~::e
cell pellets are lysed in 0.u mL RNAzol solution
(cat#:CS-105, Cinna/Biotecx). RNA is solubilized by
passing :he cell pellet through a t mL pipet tip. Sixty
p,L of chloroform are added and the solution is shaken
for 15 seconds. RNA solutions are then placed on ice
for 5 minutes. °hases are separated by centrifugation
at 12000 x g and a °C ~or 25 minutes. The upper
(aqueous) phases are transferred ;.o fresh RNase-free
microcentrifuge tubes. One volume of isoorooanol is
added and the samples placed at -20 °C for 1 hour. the
samples are then placed on dry ce for 5 ;ninutes and
,0 finally centrifuged for u0 seconds at 1,000 :< g and
J
°C. The resulting supernatant is removed from eac.~.
sampl-2 and the pellet is dissolved in 1:~4 u1, of ster;le
RNase-free Water. final n~olarity is brought to 0.2M
NaCL. The DNA is reprecipitated by adding 2 volumes of
100 ethanol. leavi.~.g on ar~_~ ice for 10 minutes. s:~d
*Trade-mark

CA 02121041 2000-04-20 _
64693-5203
-64-
centrifugation at 14,000 ram and 4 C for 15 Minutes.


The supernatants are tzen
removed, the pellets washed


with 75~ ethanol and centrifuged
for 8 minutes at '2000


x g and 4 C. The ethanol is then removed and the


pellets dried under vacuum. The resulting RNA is then


dissolved in 20 sterile watercontainin 1
g pi RNas in ~'


(cat~:N2511, ?romega).


cDNA svnthesis:


cDNA synthesis is performed
using a Gene Amp"


PCR kit (catl~: 'J808-0017 in clmer Cetus). RNasin'"
Perk


(cats: :2511. ?romega), and MV reverse transcriptase
A


(cat~t: :9004. ?romega). the following protocol 's used


for each sample:


Components Amount


MgCI= solution 4 p1


p 2 p1


PCR
buffer .I


c dATP 2 X11
0


dCTP 2 ~tl


dGTP 2 ~t 1


dTTP 2 ~t 1


3' primer 1 p1
c5


(random hexamers)


RNA sample 2 p1


RNasin 1 p1


AMV RT '_ . 5 ~t 1


~0
Samples are heated at 80 'C f or ? ~i::utes _:~
slowly cooled to ~8 'C. ':he samales are .hen
centr_:uged .or '0 seconds. :,MV ~~ve~se trar.scr:~tase
is added .o the saaples whic:~ are then _~cuoated °or ~0
minutes at 57 °C. ~f tar _~cuoat_on. 0.5 u1 o:' e_c;~ ~NT?
*Trade-mark

~2j:~~~~.~
w~ ~3i~zz~~
_~~_
and 0.75 reverse transcriptase (cat~:109118, ~oehringer
:Iannheim) are added. The samples are incubated for an
additional 15 minutes at 87 °C.
PCR Reaction:
0ligonucleotides are designed to amplify human
genes by polymerise chain reaction. The 5'
oligonucleotides are set forth below:
HVH 1,35:
5'-TATTCTCGAGGTGCA(AG)CTG(CG)TG(CG)AGTCTGG-3'
HVH2A :
5'-Tr?TTCTCGAGGTCAA(CG)TT(AG)A(AG)GGAGTCTGG-3'
HVH~l6 :
5'-TATTCTCGAGGTACAGCT(AG)CAG(CG)(AT)GTC(ACG)GG-3'
The 3' oligonucleotides are set forth below:
JH 125 :
5'-TTATGCTAGCTGAGGAGAC(AG)GTGACCAGGG-3'
2o JH3: '
5'-TTATGCTAGCTGAAGAGACGGTGACCATTG
JH6:
5'-TTATGCTAGCTGAGGAGACGGTGACCGTGG-3'
PCR reactions are performed with a GeneAmp'" ?CR
~cit (eat;~:N808-0017, Perkin ~lmer C~t~as) . Components
are listed below:
a
~~J~3ST~~~~E SHE

~W~ 9~1I223I ~ ~ ~ ~ ~ /~{ ~ PC7r/AU91 /0053
~06-~
Comvonents Amount


dc3H~0 75 ~xr . _"


1d x buffer LO ~x1


d.~I.TP 2 p,1
_



dCTP 2 ~.I


d~TP 2 ~t 1


dTTP ~ ~1


I* Target D~1.~ 1 ~C1


2* 5 ~ primer 2 . 5 ~tl


3' primer 2.0 ~xl


~* AmpliTaq'' l.3 ~,1


Polvmerase


*comz~onents addea in order at 92 °C
of first cycle
PCR prograr~a stern 1 9~ 'C for 30 see~nds
step 2 n0 °C for 1 minutes
~C step 3 T2 °C for ~5 seconds
Approximately 35 cycles are completed for each reaction.
All PCR reactions are performed using a Pericin ~lmer
CetuS PCR System 900 thermal cycier.
Treatment of ~iumaa~ V~, inserts with Yho I and Nhe I:
human V~ genes are digested ~aitt~ .Yho I ( cat~~:
~.31h,. New England Rio~abs) and a'Yhe I (cat~~: 14~L, New
RngLand Biolabs). The following protocoL.i.s used for
3C each samules
SL~~3S'~°~"~C!'~ ~~~E~'

~~ ~~i~zz3~ ~ .~ ~ ~ ~ ~% ~. ~~iA~~mo~s~3
--07°°
SU~3STANC~ At~IQUI~~'
DN,~ ~ d ~ 1 ' w
NEB Bu~~er ~2 4.S p1
Nhe i z ~tl
Xho I 2 p1
ddHzO 16.5 ~xl
1Q Samples are incubated at 37 °C for one hov.r.
After this incubation, an additional 1.5 ~aL, Nh.e I is
added. and samples are incubated an additional two hours
at 37 °C.
Purification of DNA:
After the restrictive en~y~ne digest DNA :i.s run
on a 5 percent golyaCrylamide gel (Saanbrook et al. (1989,,
supra) . Bands o.f 390--420 by i.n size are excised from
the gel. DNA is electroeluted and ethanol precipitated
according to standard ~arocedures.
PCR products resulting from oligoa~ucleotide
combinations are pooled togethero JHlz45 with HVH135,
HtIHZA- and HVH46; vH3 with HVH135, HvIH2A and ~i~1469 JH6
G5 with HVH135, H~IHZA and HVH4~a. 'the volume of the .
resulting pools are reduced under vacuum to 50
~icroliters. The pools are then purified from a 4
percent poiyacrylartide gel. ( Sambrook et al. ( 199 ) , sz~pra )
to isolate DNA fragments. Bands resultizsg at 390-42(3 by
3~ are excised from the ge3.. The DNA from excised gel
slices is electroeluted according to standard protocols
set forth in Sambrook, supraa
~ tJ ~ ~TI'~'l1'~°~ ~ Q~1 ~ "

CA 02121041 2000-04-20
64693-5203
-58-
Isolation of pSCFVUFiH Xho IlNhe I Vector Fraement
Approximately 5 ug is 1~ uL oz pSCFVUHH piasmid
is isolated using the Magic Mini-prep'" system
(Promega). To this is added 5.4 pL OF_ lOX Buffer r2
(New England Biolabs), 43 units of Xho I (New England
Biolabs), 15 units oz Nhe I and 24 pL of ddH20. The
reaction is allowed to proceed ~or 1 hour at 37 °C. The
sample is loaded on a 4X polyacrylamide gel,
electrophoresed and purified by electroelution, as
described earlier. The DNA pellet is dissolved in 20 uL
of ddH20.
One ::unared nanograms of pSCFVUHH digested with
Yho I lNhe I is ligated with a 1 : t :polar ratio of
>> ?urified human UH inserts digested with Xho I and Nhe I
using T4 DNA ligase (Stratagene). Aliquots are used to
;.ransform competent E. coli AG1 cells ( Stratagene )
according ~o the supplier's instructions.
GVWP hydrophilic membranes*(cat# GVWP1~250.
Millipore) are placed on CAM 20 LH agar plates (Samorook
etal., 1989), One membrane is added ~o each plate. Four
hundred microliters of the E.coli AG1 transformation
suspension from above are evenly spread over the surface
25 of each membrane. The plates are incubated for 16 hours
at 37 °C ambient =emperatures.
?reparation of TAG-72-coated mempranes:
A 1x dilution of partially ~urif:ed tumor
30 associated glycoprotein-72 !TAG-72) produced in LS174 'F-
cells is prepared is T3S (cattt 28376. Piercs). Ten
milliliters of t!~.e TAG dilution are placed to a Petri
plate (catty 3-7~7-1u. Fisher) for future use.
immooilon-P PVDF~'transfer mempranes (cant SE151103.
Millipore) are immersed in methanol. :"he memoranes are
*Trade-mark

CA 02121041 2000-04-20
64693-5203
-69-
:han rinsed three times in sterile double distilled
water. After the final wash, the excess water is
allowed to drain. Each of the membranes are placed :n
milliliters of dilute TAG-72. The memoranes are
incubated at ambient temperature from t hour with gentle
5 shaking. After incubation, the membranes are blocked
with Western blocking solution (25 mM Tris. 0.15 M NaCl,
pH 7.6; tx HSA) for about t hour at ambient temperature.
Blocking solution is drained from the TAG
membranes. With the side exposed to TAG-72 facing up.
~he membranes are placed onto fresh CAM 20 plates.
resulting air pocKets are removed. The oacter:~l
memoranes are then added, colony side up, to a TAG
t5 membrane. The agar plates are incubated for 24 to 96
hours at ambient Lemperatures.
The orientation of the TAG-72 and bacterial
membranes are marked with permanent ink. Soth membranes
are removed from the agar surface. T.he TAG-72 membrane
is placed in 20 ml of Western antibody buffer (T8S in
0.05: Tweeri 20. cats P-t379, Sigma Chemical Co.; t~ BSA,
cat~3203, Biocell Laboratories) contain=ng 0.2 ng of
CC49-Hiotin probe antibody. The Dact~r'_al membranes are
replaced on the agar surface in their prigiaal
orientation and set aside. CC49-3iotin is allowed to
bind to the TAG membranes for t hour at 3t °C with
gentle shaking. :he aembranes are then washed three
Limes with TTBS (TBS. 0.05 :weep-20) :or : minutes on
an orbital shaker at :00 rpm. Strepta~r:cin alkaline
anosphatase ( =at# 7100-v4. Southern ~io~ec.~..~,oiogy
associates) is added .c Western antibody ::::fer ~o
produce a 0. 1 ~ soiutiar.. :'he TAG-r 2 .Tinmbl'2~eS are eac~
:amersed in t5 milliliters o: Lhe strepcavicin solution
and allowed Lo incubate '_'ar =0 :~inuLes at , 'C with
*Trade-mark

CIO 93/I223I PCTlAU9I/00~83
_70_
gentle shaking. After incubation, the membranes are
washed as previously described. A final sash is then
performed using Western alkaline phosphate buffer (8.~4 g
NaC03, 0.203 g MgCl2~H?0, pF3 9.8), for 2 minutes at 200
rpm at ambient temperature. lo develop the membranes,
o Western blue stabilized substrate (cats S38~d~, Promega)
is added to each membrane surface. After 30 minutes at
ambient temperatures, development of the membranes is
stopped by rinsing the membranes three times with ddH20.
The membranes are then photographed. ';'he membranes are
then photograhed and clear zones are corelated with
colonies on the hydrophilic membrane, set aside ear lier.
Colony(ies) are isolated for growth in culture and used
to prepare plasmid ONA for sequencing and protein
preparation to evaluate specificity and affinity.
Identification of Hum4 Vr., human Vr~ combinations using
pATDFLAG.
In a second assay system, Hum4 VL - human Vg
~0 combinations are discovered that bind to TAG-72
according to the schematic, suprc, exeeat for the
following: at the assay step, IBI I~fII antibody is used
as a probe to detect any Hum4 VL - Vg SCFV combinations
5 that have bound to the hydrophobic membrane coated with
TAG-?2.
The plasmid pATDFLAG was generated from
pSCFVUHH (see Figure 29) to incorporate a flag-coating
sequence 3' of any human V~r genes to be expressed
,',0 continguously with Hum4 'J~. The plasmid pATDFLAG, when
digestzd raith mho I and sYhe I and nuritied becomes the
human C~ discogery piasmid containing Hum4 VL in this
SCFV format. The plasmid pATDFLAG was generated as -
follows. Plasmid pSCFVOH~i treated ;with ~:ho I and lVhe I
(isolated and described aboae) ;aas used in a ligation
SIUESTITUTE S!-~EET

~i'~ 93/12231 PC°I'/A'LJ9~/Ofl583
--71-°
reaction with the annealed FLAG and FLAGNC
oligonucleotides.
FLAGCs
5°~TCGAGACAATGTCGCTAGCGACTACAAGGACGATGATGACAAATAAAAAC~3'
FLAG~IC
5'--CTAGGTTTTTATTTGTCATCATCGTCCTTGTAGTCGCTAGCGACATTGTC~3'
Fquimolar amounts (1 x 10"x~ moles of each of
1Q the oligonucleotides FLAGC and FLAGNC were mixed
together using a ligation buffer (St.ratagene). '~,'he
sam.~le is heated to 94 °C and is allowed to cool to
below ~5 °C before use in the ligation reaction below.
~5 Li~ation Reaction to Obtain pATDFLAG
COt~PONEII~11'r AMG(JIeTTT
pSCF V U.Gdg ~~~ ~ ~~~P. ~ a 5 ~~
I vector
20 ANNFALED 0.X5 ~1
FL~1GC/F'LAGI~1C
lOX Ligation 2 ~1
buffer
T4 DNA LIGASE 1 p.1
25 ~,o ~ ATg 2 ~z
ddHzO 12.65 p1
~0 °~he zeaction is carried out using the following
components and amounts according the ligation protocol
disclosed above, Ecoli AG1 cells (Stratagene) are
traasformed with 3 p.1 of the above ?igation reaction and
c~lonies se~.ected using CAM 20 plates. Clones haring
~ t~J B ~'~'1~'L~?'l~ ~ ~-I ~ ~°t°


'W~ 93/12231 ~ ~ ~ ~ ~ ~ ~ PC~/AU9I/00583
-72-
appropriate Nhe x, Xho I and .Nhe IlXho I restriction
patterns are selected for DNA sequencing.
x
The oligonucleotide used to verify the sequence
of the FIaAG linker in PATDFLAG (see Figure 2S) is called .
PENPTSEQ: 5'-CTTTATGTAAGATGATGTTTTG-3. This
oligonucleotide is derived fro~aa the non-coding strand of
the peraP teraainator region. DNA sequencing is performed
using Sequenase"' sequencing kit (U. S. Eiochemical,
Cleveland, OH) following the manufacturer's directions.
~D The DNA and deduced amino acid sequences of the H:um4 VL
- UNI~OPE linker -- FLAG peptide is shown in Figure 2S.
Generating nSC49~ FLAG_
The GC49V~ is inserted into the sites of ~'~ho i
- N'he I gATDFLAG (see Figure 29) and evaluated. for
biological activity with the purpose of serving as a
positive control for the FLAG assay system to detect
binding to TAG-12. The new plasmid, called pSC49FLAG
(see Figure 29) is generated as follows. The plasmid
pATDFLAG C5 mg, purified from a 2.5 ml culture by the
Magic MinipreF~" system ~Promega) is treated ~~rith s~ho I
and l~he .I and the large vector fra~.gment purified as
described above for pSCFVtTHA. The CC49 V~ insert DNA
fragment ~.s obtained by gCR amplification from pSCFVUHH
and oligonucleotides ITNI3 as the ~' end oligonucleotide
and SC49FLAG as the 3' end oligonucleotide. The
resulting DNA and amino acid sequences of this SCFV
30 antibody, with the FLAG peptide at the C-Cera~inus~ °s
shown in Figure 30. The PCR reaction is carried out
using 100 pmol each of the oligonueleotides, 0.1 ng of _
pSCFtarget DNA (uncut) and the standard protocol
and reagents provided by Perkin Elm.er Cetus. The DNA is
first gel purfied, then treated with ~Yho I and. ~'~Tha I to
~ lJ ~ ~'f iTU'1'~ S H ~ ET


WO 93/1~2~~ ~ ~ ~ ~ ~ ~~ ~ PCT/ALJ91/005$3
_73~
generate sticky ends and purified from a ~~
polyacrylamide gel and electroeluted as described
earlier. The DNA vector (pATD~'LAG treated wraith :oho z
and Nhe T ) and the insert °( CC~9 Vg PCR product from.
' pSCFVLTFiH treated with ~~ho I and Nhe T ) are ligated in a
1:1 molar ratio, using 100 ng vector DNA (Stratagene
kit) and used to transform ~.coli AG1 competent cells
(Stratagene) according to the manufactureris directions.
A coi.ony with the correct plasuqid DNA is picked as the
pSC49FLAG clone.
Liaation of pATDFLAG Vector with PCFt Amplified H!.~m4 V
Inserts
The protocol for the ligation reaction is as
follows:
COMPO~I~NT AMOUNT
DNA vector : pATD.~ LAG X~ho 2 . 5 pL
I/Nhe I
Fium Vs (X) DNA inserts: Xho 6 ~aL
I/Nhe I
10 mM ATP (Stratagene) 2 pL
lOX buffer (Stratagene) 2 pL
T4 DNA ligase (Stratagene) 1 pL
ddH~o b.5 ~L
m 30 DNA vector, ATP, lOX buffer and ddH~,O are
combined. DNA insert and T4 DNA ligase are then added.
Ligation reactions are then placed in a 4 L beaker
containing H20 at 18 °C. The temperature of the water
~ll~S'~'ITtJ'TE S!-iEE'T'

WO ~~/12231 ~ ~ ~ _~ y ~ ~ PG"'f/AU91/00583
_T~
is gradually reduced by refrigeration at 4 °C overnight.
This ligation reaction generates p~ium~r V~, °~ hum.V~ (X).
Transzormat~.on of E. toll AG1 with Hum4 V~-~ium V.. (X )
Li~ati.on Mix
Transformation of pATDFLAG into competent E.cvli
.A.~Gl cells (Stratagene, La Jolla) is achieved following
the supplier's protocol.
TBT MTI Anti-FLAG Antibody Plate Assay
The first three steps, preparation of TAG~-
coated membranes, plating of bacterial membranes, 3:Id
assembly of TAG and bacterial membranes, are the same as
those described in the CC49-Biotin Competition ?hits
Assay.
After the 24 hour incubation at ambient
temperatures, the membranes are washed with TTBS three
times at 250 rpm for four minutes. The MIT antibody
(cats IB130't0, Tnternational Biotechnologies, Inc.) is
then diluted with TBS to a concentration ranging f:°om
T0.85 gg/ml to 0.03 ~Zg/ml. Ten millilters of the
diluted antibody are added to each membrane. The
membranes are then incubated for 1 hour at ambient
temperatures and shaken on a rotary shatter at 70 rpm.
After incubation, the MII antibody is removed and ~he
membranes are washed three times at 250 rpm and ambient
temperatures for a minutes. The final wash is removed
and 20 miliiters of a 1:2000 dilution oi" sheep anti-
mouse horseradish peroxidase .inked whole antivody .
(cat~~ NA931t Amersham) is prepared with TBS and added to
each membrane. The membranes are again incubated for 1
hour at ambient temperatures and 70 rpm. FO110W~.rag
incubation, the membranes are washed three Times _.. 250
8lIE3S'f1'fU'f E ~HE~'1'

CA 02121041 2000-04-20
64693-5203
-75-
rpm and ambient temperature for 5 minutes each.
Enzygraphie Webs~(cat~ IB821?05~. International
6iatechnologies. Inc.) are used according to develop the
memoranes, according to the manufacturer's instructions.
The membranes are then photographed:
Instead of seeing a clear zone on the developed
membrane for a positive Hum4 VL-VH (X) clone producing
an SCFV that binds to TAG-72, (as seen with the
competition screening assay) in this direct FLAG -
detectin assn
g y, a blue-purple spot is indicative of a
colony producing a SCFV that has bound to the TAG-72
coated membrane. The advantage of using the FLAG system
is that any Hum4 VL - V~ SCFV combination that has bound
to TAG-72 will be detected. Affinities can be measured
by Scatchard analysis (Seatchard (1949), supra) and
specificity by immunohistochemistry. These canidates
could then be checked for binding to a specific epitope
by using the competition assay, supra, and a competing
antibody or mimetic, if desired.
The present invention is not to be limited in
scope by the cell lines deposited since the deposited
embodiment is intended astwo illustration of one asoect
of the invention and all cell lines which are
functionally eauivalent are within the scope of the
invention. Indeed. while this invention has been
described in detail and with reference to specific
embodiments thereof. .t will be apparent .o one skilled
in_the art that various chances and modifications could
be made therein without ceparting °rom the spirit and
scope of the appended claims.
*Trade-mark