Note: Descriptions are shown in the official language in which they were submitted.
~093/1672~ ~ L3~g9~ PCT/US93/01716
EAR~Y ANTIGEN FOR AUTOIMMUNE DI~BETES
This work was supported in part by a grant from
the National Institutes of Health. The U.S. Government
has certain right~ in this invention.
~echnical Pield -
The invention relate~ to factor~ useful in
diagnosis and therapy of type I diabetes. More
specifically, it concerns markers in ~ islet cells that
mediate T-cell proliferation and stimNlation associated
with induction of the disease.
,
Back~round Art
Type I diabetes is known to be a chronic auto-
immune disea~e that manifest~ itself early in life. Thi8
condition, a}so called insulin-dependent diabete~
mellitus (IDDM) is considered a hereditary di~ease
although nonfamilial forms also occur. The nature of the
genetic cont$ol, of type I diabetes ha~ been studied in
detail. It appear~ clear that gene~ assoçiated with the
ma~or hictocompat~bility complex (MHC) are involved in
the hereditary tran~m~sQion of the di~ea~e tWicker~
et al., Exp ~ed (1987) 1~:1639-1654). Sev~ral groups
have demonstrated a correlation between the ab~ence of an
a~p~rtic reQidue at po~ition 57 of the ~-chain in the
human H~A-DQ class II MHC encoded glycoprote~n and the
occurrence of the disease (Parham, P. Nature (1990)
345:662-664; Todd, J.A. et al., ~S~ 1987) 32~:599-
604; Morel, P.A. e~ al., ~ g,L~, 8~ =L~ 1988)
85:8111-8115).
W093/1672~ PCT/US93/0171~
The most ubiquitou~ly used model for the human
fonm of type I diabetes i~ the nonobese diabetic (NOD)
mouqe model. The NOD strain of mice was ariginally
selected by Makino, S. e~ al., ExD Anim (Tokyo) (1980)
~2:1, for its predi~position to develop a spontaneous
fonm of diabetes. The disease as it manifests itself in
- this model i9 similàr to that found in humans. There is
a progressive infiltration of the pancreatic ielets by
mononuclear cells, mostly of T-cell origin, long prior ~o
the onset of the ~ymptoms of the disease which leads to
the destruction of the insulin-producing ~-cells. This
occurs in the similar ~B rat model system (see below) as
long as 8 weeks before the onset of IDDM. It ha~ been
demonstrated that the NOD disease is controlled by at
least three genes, one of which segregatee with the MHC
(Hattori, M. et al., ~SiS~9~ (1986) 21~:733; Prochaska,
M. et al., Science (19871 ~d:286; Wicker, ~. et al.,
~D Med (1987) 65:1639 ~supra)).
In the course of the disease, the insulin-
producing ~-cells of the pancreatic islets are
selectively destroyed; other endocrine islet cells, a
cells, such as those that produce glucagon or
somatostatin are unaffected. The destruction of the ~-
cells is mediated in part by T-cell proliferation, in an
induction phase, resulting in the production of effectors
of the ~-cell destruction, such as cytotoxic antibodies,
natural killer cells, macrophage and lymphokines
(Castano, ~. et al., Ann Rev Immunol (1990~ ~:617-679).
Thus, in general, the onset of type I diabetes
is believed to involve an induction phase common to~both
normal and autoimmune respon~es, which involves an
initial acti~atlon of helper CD4+ T-cell~ by engagement
of the T-cell antigen receptor (TCR) wlth MHC class II
associated peptides presented on antigen-presenting cells
(APC). This acti~ation results in secretion of
, ~
-
~!0 93/1672~; PCI'/US93/01716
r~ 1 3 0 ~3 9 7
lymphokines which in turn activate the effector ~-cells,
cytotoxic T-cells, natural killer cell~, macrophage, and
the l~ke. Indeed, it has been shown that removal of the
CD4+ T lymphocytes from the circulation u~ g an anti-CD4
antibody (GKl.5) blocks the development of type I
diabetes in the murine model system (Shizuru, J.S. et
al., Science (1988) ~Q:659-662).
The involvement of T-cells in the progress of
type I diabetes has also been verified by showing that
autoimmune diabetes can be transferred to nonsusceptible
strains using splenocytes from NOD mice (Wicker, ~.S. et
al., Diabetes (1986) ~:855-860); and the showing that
autoreactive T lymphocytes can cause diabetes in NOD mice
(Reich, E.-P. et al., Diabetes (1989) 38:1647-1651).
- 15 Pancreatic islet-specific T-cell clones have also been
prepared from NOD mice by HaskinR, K. et al., Proc Natl
Sc1 USA (1989) 86:8000-8004 and Nakano, N., et al.,
J Exp Med (1991) 173:1091-1097.
Using the NOD mouse model, ~ehuen, A. et al.,
Imm~Ql (1990) ~4:2147-2151, demon~trated tha~ the
humoral anomalies in the NOD strain are disco~nected from
the occurrence of diabete~ and insulitis. Nevertheless,
attempts have been made to ident~fy the antigen
associated with type I diabetes by identifying proteins
2S that bind to autoantibodiet pre~ent in IDDM-affected
sub~ects. All of these antigens are thus present at the
effector level, and may or may not be assQciated with the
progresq of the condition.
~aekkeskov, S. et al., ~cience (1984) 224:1348-
~350, showed that antibodies to a 64 kd i~let cell
protein were present in B~ xats (which spontaneously
develop a type I diabetes analogous to that in h~lmPn~)
for as long a~ eight weeks before the on~et of IDDM, and
suggested that the antibodies could be used to predict an
immune reaction against pancreatic ~^cells. The putative
Wo93/1672~ ~ ~3 0 3 ~ 4- PCT/US93/0171~
autoantigen waq subsequently characterized by this group
to be a glutamic acid decarboxylase (GAD) which i~
involved in the synthesis of ~-aminobutyric acid (GABA),
an inhibitory neural transmitter (Baekkeskov, S. et al.,
Nature (1990) ~47:151-156). In addition, a molecule
cress-reactive with the 6S kd heat shock protein (hsp65)
f My~Q~acterium tuberculosis was shown to be a ~-cell
antigen immunoreactive with diabetes-associated
autoantibodies in the NOD mouse model by Elias, D. et
al., Proc Natl Acad Sci USA ~1990) ~7:1576-1579. These
authors suggested that the hsp65 antigen could be used to
induce diabetes or to vaccinate against diabetes, using
the principle that proteins administered in adjuvants
tend to be immunogenic, while the same proteins in
- 15 soluble fonm are tolerogenic. Indeed, a ~inistration of
hsp65 in immunogenic or noni7mmunogenic fonms was reported
to produce re~ults consistent with this principle.
Castano, ~. et al. in an unpublished
7manuscript, described the use of antibodies fram a
prediabetic patient as probes to screen a rat islet ~gtll
expression library and identified a colony which produced
a protein immunoreactive with these antibodies. This
colony was found to contain an insert which encodes a 136
amino acid fragment of carboxypeptidase-H (enkephalih
converta~e). Eurther, the sera u~ed to ~creen the
library were shown to react with a 52 kd antigen
correspond~ng to the molecular weight of the me7mbrane
fonm of carboxypepti~a~e-H.
In addition to the 64 kd GABA carboxylase, the
hsp65 antigen, and the 52 kd carboxypeptidase-H, which
react with autoantigens a~sociated with type I diabetes,
it is also known that autoantibodie3 to insulin are
present in subjects affected by this condition.
Hu7man T-cell clones which are spec~fic for
insullnoma cell antlgens have been prepared by Von Yllet
'
~093/l672~ 5 ~1309a'! pcT/us93/nl7l6
et al., Eur J ImmNnol (1989) 19:213-216. These T-cell
clones were prepared using rat insulinoma membrane~ a~
antigen, and generating the cell lines from peripheral
blood mononuclear cells of patients with recent on~et of
S the disease. In addition, it has been shown that T-cell
clones from a type.I diabetes patient respond to an
integral membrane component of the insulin secretory
granules which has been purified 5000-fold and shown to
have a noner of molecular weight 38 kd (Roep, BØ et
al., ~ture (1990) 345:632-634).
All of the foregoing antigens are believed to
be associated with the effector phase of type I diabetes.
None of the foregoing has been demonstrated to be
as~ociated with the initial activation of CD4+ T helper
lS cell induction phase. The~e antigens are found after the
onset of symptQms of IDDM.
Thus, in all of these extensive ~tudie~, only
antigens which are evidenced by factors present after the
onset of the disease or very shortly preceding it have
been identified. The present invention provide~ antigens
which are responsible for the very early inductive stages
.:. in .the development of this condition. These antigen~ are
useful in diagnosis and design of immunotherapy.
Disclo~ure of the Invention
Antigens associated with the initial T-cell
induction pha~e leading to the onset of type I diabetes
have now been identified. These antigens are u~eful for
the early diagnosis of the development of the di~ease and
also can be used in immunotherapy of su~ceptible
s~bjects.
In one aspect, the invention i~ directed to an
antigen having a molecular weight in the range of 30-60kd
nonmally present in mammalian, particularly human or
murine, pancreatic islet ~-cell cytosol and/or membranes,
~ .
, . . . ~
W093/1672~ PCT/US93/0171~
9 ~ - 6-
and to antibodies or T-cells specifically immunoreactive
with this antigen. Human protein~ with this activity
have molecular weights of about 37 kd, 41 kd and 51 kd,
as detenmined by HEPC; murine proteins have molecular
weights of about 36 kd, 42 kd and 55 kd as determined by
gel electrophoresis. In other aspects, the invention is
directed to methods to diagnose susceptibility to type I
diabetes by asse~sing subjects for the presence or
absence of antibodies or T-cell~ responsive to thi~
antigen. In other aspects, the invention is directed to
methods to prevent the onset of type I diabetes by
rendering subjects unresponsive to the antigen of the
invention and by blocking immNne re~ponse to the antigen
using peptide subunits thereof alone or in combination
with immune modulating agents.
~rief De~cription of the Drawin~s
Figure l i8 a bar graph showing the results of
a T-cell proliferation a~say with respect to various
insulinQma extracts.
Figure 2 is a bar graph which shows the effect
of the presence and absence of antigen-presenting cells
on T-cell proliferation.
Figure 3 shows a nitrocellulose blot of
one-dimensional gel electrophoresis of in~ulinoma
membrane protein~ assayed for the ability of these
fractions to ~timulate the proliferation of T-cells from
NOD mice.
Figure 4 show~ an elution pattern of high
performance electrophoxetic chromatography (HP8C)
performed on a murine in~ulino~a extract as~ayed with
respect to T-cells isolated from NOD mice of ~ariou~
ages.
-J~`/O 93/1672~ 7 ~ ~ 3 o ~ ~ 7 PCT/US93/01716
Figure 5 shows the HPEC eluti~n pattern of
murine insulinoma whole cell extract3 a~ assayed using
NOD-mice T-cells.
Figure 6 shows the distribution of T- cell
proliferation stimulation activity between membrane and
cytosol fraction~ of a murine in~ulinoma.
Figure 7 show~ the results of two-dimen~ional
gel electrophoresis of a murine insulinoma extract as
a~Qayed for the ability to stimulate proliferation of
T-cells obtained from 30 day old NOD mice.
~ igure 8 shows the HPEC elution pattern of the
whole cell extracts of human islets as assayed by the
response of NOD splenocytes.
Figures 9A and 9B show the analyeis of antigen-
- 15 containing extracts separated by molecular weight
distribut~on using the T-cell clone~ LN-7 and LN~aM
respectively.
Figures lOA and lOB show stained pancreata from
a control mouse and from a mouse administered the T-cell
- 20 clone ~N-7.
~ode3 of ~arryinq Out the Invention
The invention provides antigen~ as~ociated with
early event~ connected with the i~ductive pha~e of type I
diabete~. ~8 ~uch, the antigen~ of the i~ve~tion offer
the opportunity for early ~creening of i~dividuals
developi~g the di~ease and offer the o~portu~ity for
i~tervention to prevent it9 developme~t and/or
perpetuation.
The antige~s of the invention are obtainable
from mammalian, such as the exemplified mNrine or huma~,
pancreatic islet ~-cells or cell lines derived therefrom.
Cross species reactivity of the relevant antigens has
been demonstrated, and there appear~ to be significant
homology between the mNrine and human antigens. Thus
WO 93/1672~ 30 39 - 8- PCr/US93/0171~i
similar a~tigen~ are belie~ed present and isolatable from
~ lets of other mammal9, such as bovine, porcine,
ovine, feline and the like.
The antigens may be obtained from eit~er the
S membrane fraction or the eytosol fraction of i~let ~-
cells or their derived eell line~, or the related
neuroblastoma or other neuroendoer~ne eells. The
antigens are present in both non-suseeptible individuals
and in individual~ suseeptible to type I diabetes.
merefore, the eells used as a souree of the antigen~
need not be derived from affeeted subjeets.
The antigens m2y initially be prepared by
extraetion and f~aetionation of the native material from
the ~-eells or their derived eell lines, but may more
eonveniently be prepared using reeombinant teehniques
from the eneoding DN~. Provision of the native protein
in purified and isolated fonm permits the decign of
probes useful for retrieval of the eDNA encoding the~e
antigens. In addition, expreYsion libraries obtained i~,
for example, ~gtll and transformed into E~ SQLi ean be
~ereened for the ability of the expression produets to
effeet proliferation of T-eells obtained from murine
model~ for type ~ diabete~, ~uch as NOD mice. Antibodie~
immNnoreaetive with the antige~s may al80 be u~ed to
~ereen expre~io~ librar~es.
~
The an~igens of the invention may be prepared
by ~uitable extraction of pancreatic ~ i~let eells from
mammalian sub~ects, e~pecially human or mNrine ~ubjects,
or from cell l~nes derived therefrom. The antigen~ are
present in the cytosol and/or membrane fractions of ~-
cell~ of both type I diabetes-susceptible sub~ects a~d
sub~ects not ~usceptible to IDDM. In addition, tumor
cell lines derived from ~-cells such as insulinomas may
~-~0g3/1672~ PCT/~S93/01716
h~ 1 3 U ~
be used a~ starting materials. It ha~ also been shown
hereinbelow that at least one of the antigens is present
in a human neuroblastoma cell line and human islets.
Extraction i9 generally conducted by homogenizing the
cells in the presence of appropriate membrane buffer at
about pH 7-8; removing the cellular materials by
centrifugation, recovering the supernatant, and then
centrifuging the supernatant at high speed to obtain the
membranes, as the pellet and the cytosol as the
supernatant. Whole cell extracts may also be used.
general procedure for preparation o~ membranes is
described by Fava and Cohen, J ~iol_Chem tl984)~2:2636-
2645.
The extract i~ preferably then subjected to
separation using generally known technique~, including
gel filtration, anion exchange chromatography,
polyacryla~ide gel ele~trophoresis, and other standard
procedures. Active fractions are recovered.
The fractions may be assayed for activity by
assessing their ability to effect the proliferation of T-
cells obtai~ed from type I diabetes-susceptible sub~ects,
including the NOD mouse or T-cell lines derived
therefrom, using a standard T-cell proliferation assay.
One such assay utilizes labeled thymidine incorporation
2S as a measure of proliferation and i8 generally conducted
as fol~ow~:
The T-cell preparation is obtained from single-
cell suspensions from ~pleen, lymph node~ or PB~ taken
from naive (untreated) NOD mice. Dead cells and red
blood cells are removed by Ficoll gradient centrifugation
by spinning in the gradient for 25 minute~ at 2SOO rpm at
room temperature. m is provides an enriched lymphocyte
population and contai~s antigen presenting cell~ tAPC).
e T-cells and APC are plated at 0.25-0.5 x 106/well in
96-well U-shaped plates (Costar) and incubated with the
, ~ .
~ ~3 0 ~ o PCT/~S93/017l~
sample to be tested at varying concentrations for 72
hours at 37C, 5% CO2. The plates are then pul~ed with 1
~Ci of tritiated thymidine per well and incubated or an
additional 16 hours. The cell~ are then harvested u~ing
S a microcell harvester (Skatron) and counted. Enhanced
uptake of the labeled thymidine indicates increased cell
proliferation. In lieu of the foregoing, cloned T-cell
lines can be used in the assay, along with separately
added APC.
The recovered fractions may then further be
purified using standard protein purification techniques.
A particularly useful technique which results in
~irtually pure protein is two-dimensional gel
electrophoresis. The fractions or extracts are adjusted
to 1~ Triton X-100, 15% glycerol and 6~ ampholines, pH
3-10. I~oelectric focu~ing i8 then performed according
to the method of O'Farrell, ~.H. J B~ol Chem ~1975)
~Q:4007-4021. The resulting one-dimensional separation
i8 then followed by loading each region onto a 10~
SDS-PAGB gel and electrophoresis conducted according to
~aemmli, U.R. Nature ~1970) ~2~:680-6~5.
~ he fractions identified are then recovered in
purified and isolated form. They can be further
characterized by determination of amino acid seguencé and
by retrieval of the encoding gene from cDNA libraries
prepared by re~er~e transcription of ~-~slet mRNA or from
a genetic library. The DNA librarie~ are prepared u ing
standard technique~, and can be screened u~ing probes
designed on the basi~ of to~al or partial amino acid
sequence of the recovered antigen. The recovered DNA
can, in turn, be used as a probe to reco~er DNA encoding
the corresponding antigens in other species.
In addition to recovering the. gene(~) encoding
the antigen(~) using DNA probes, the ~tarting cDNA
library may be prepared as an expression library in, for
093/l672~ PCT/US93/01716
3 0 ~ ~1 '.t
example, ~gtll, and the library then ~creened using
techniques which detect the ~ynthesized antigen. Two
means for screening the library to detect the antigen
produced are particularly preferred.
In one method, antibodies prepared against the
isolated antigen can be used ~n screening the library in
conventional techniques. In a second method, the library
may be screened by as~e~sing the ability of each of the
clones contained therein to produce an antigen which
stimulates proliferation of T-cells obtained from type
; diabetes-susceptible individuals, including NOD mice.
Tho~e colonies that produce proteins capable of
stimulating this proliferation contain the gene encoding
the stimulatory antigen.
- 15 Upon identification of one or more clones
containing a DNA encoding the antigen, a8 described
above, DNA can be isolated fram the clones and the
relevant inserts sequenced and/or rec~vered a~d used in
the subsequent production of the antigen. The seguenced
DNA and/or its de~enerate coding forms can be partially
or completely independently synthesized for use in such
expression systems.
For recombinant production of the antigens, the
encoding DNA is ligated into expression systems
campatible with a convenient ho~t. A wide variety of
host sy~tem~ a~d control ~eguences operable in said ho~t
are now available in the art. Suitable host~ include
prokaryotes such as E~ cnl; and eu~aryotes such as yeast,
a~ian cells, in~ect cell~, mammalian cells, and plant
cells; more recently, whole plant or animal organism~
have also been used. Technigue~ for constructing
expression syst~ and transfonming appropriate hosts
with the constructed systems are by now standard in the
art.
~, ,
WOg3/16725 l~g~ 12- PCT/US93/0171
For production of the desired antigen, the
recombinant host cell~ transformed with an expression
system containing the gene encoding the antigen operably
linked to control sequences are cultured under conditions
which permit the expre~sion of the encoding DNA, and the
antigen i9 recovered from the culture using standard
procedures. Construction syst~mq may be employed which
result in secretion of the antigen, which can then be
recovered from the medium, or the antigen may be produced
intracellularly, which will necessitate lysing the host
cells.
The ~-islet cell antigens of the invention,
when isolated and characterized, provide sequence
information for identification of peptides associated
with interaction with the TCR on the helper T-cell~.
The~e pep~ide segments are contiguous sequences of at
least about 7 amino acids that are associated with the
MHC class II glycoprotein present on the surface of
antigen-presenting cells, resulting in a complex that
interact~ with the TCR. The relevant peptides can be
systematically identified by testing overlapping regions
of the sequenced antigen in the presence of antigen-
presenting cells in T-cell proliferation assaye conducted
as described above. Technigue~ for such a screen aré
included in the report by ~ickli~g, J.~. et al., Eur J
Immunol ~submitted 1991, in press). Pept~de~ with
modified structures can then be designed which retain
their ability to complex with the MXC class II
glycoprotein but fail to effect reaction with the TCR by
assessing the ability ~f the~e mod~fied peptides to
inhibit the T-cell proliferation in the pre~ence of known
acti~atorQ in this assay. Peptide modifications include
extensions, deletions and substitutions, and combinations
thereof. Peptides that inhibit proliferation are
successful candidates.
~::
~093/1672~ ~ PCT/US93/01716
-13- ~f1 3 ~ 9~?'i'
aa~
Several forms of a convenient assay are
de~cribed herein, depending on whether the as~ay i8
directed to a purified antigen, a T-cell clone, or an
antigen preparation. In general, all assays may be
performed in microtiter wells wherein each well contains
l0,000-30,000 T cells, about l05-l06 histocompatible
antigen-presenting cells, and the antigen (for crude
extracts this amounts to about 0.3-20 ~g/ml). However,
for more purified antigen, lesq antigen would be
required; for splenocyte preparations used as a ~ource of
T cells, the APCs are already contained in the original
preparation. Variations of the nature and amounts of
cell~, hi~tocompatible APC~, and antigen will be
understood as routine matters of optimization and
experimental design. If tritium uptake i8 to be used as
a measure of proliferation, a conven ent protocol is
incubation for 72 hours in a suitable culture med~um ~uch
as RPMI-1640 supplemented with 5~ FCS, l0 U/ml l0-~trep,
and 200 ~M ~-glutamine, or other appropriate medium for
T-cell proliferation as i~ understood in the art. The
cell culture is then pul~ed with, for example, 1 ~Ci/well
of tritiated thymidi~e and the cells are harve~ted 6-l6
hours later and counted.
O~her method~ of measuring T-cell proliferation
and var~atio~s of thè ~oregoing protocol are known in ~he
art.
Generation of T-Cell I~L~nes
Spleen or lymph node cells from nai~e famale
30-40 day old NOD mice were stimNlated in ~tro with
insulinoma (B23720, see below) antigen extracts or
irradiated insulinoma cell~. Either whole cell extracts
or the extracts from membranes or cytosol were used at a
protein concentration of l0~g/ml. Alternatively,
.
w093/l672~ ~,39~ - Pcr/usg3/ol7!~ ~
irradiated insulinoma cells (5000 cells/ml~ in RPMI
medium containing 1~ NMS, Pen-Strep, glutamine and l~g/ml
Leuko-A ean be u~ed.
The spleen or lymph node cells used a~ a source
S of T-eells were incubated at 37C, 5~ C02 for 3-4 days,
then washed and requspended in RPMI medium eontaining 10~ -
FCS Pen-Strep, glutamine and 15~ rat Con-A supernatant or
20 U/ml rMI~-2 ~Genzyme)(eomplete medium), and ineubated
for 5 days. Stimulation of the T-eell line~ was repeated
2-3 time~ in cycles of ~-9 days: (3-4 day~ with the
antigen in the above ~eomplete~ medium and 5 days ~n
eomplete mediu ~ rI~-2 at 20 U/ml without antigen).
Single eell eloning of the T-eell line was -~
performed in eomplete medium in the presenee of lO ~g/ml
antigen (or 5000/ml live irradiated insulinoma eells)
with o.sxlo6 ~rradiated spleen eells ~as APC) in 96 well
plate (Costar flat bottom 1/2 area). Seven days later
the elones were restimulated again with the antigen ~ APC
as above. ~0-14 day8 afterwards, the wells were seored
for positi~e growth. Growing T eell e}ones were
traDsferred to 24 well Costar plates and expanded.
The eells were te~ted for proliferation using
20,000 T eells with 0.5 x 106 irradiated splenie (2000 R)
antigen-presenting eells in an a~say based on labele~
thymidi~e i~orporation. Culture~ of the T-eells and APC
eells were ~et up in triplieate in the presenee of
ant~gen extraets ~0.3-20 ~g/ml) and ineubated for 72
hours, then pulsed with l ~Cs/well of tr~tium-labeled
thymidine (Amersham, Ine.) and harvested 16 hours later.
The incorporated radioactivity wa3 determined using a ~-
plate scintillation counter and re~ult~ expressed as mean
cpm of incorporated thymidine. Standard deviation~ were
less than lO~. A number of T-cell clone~ were obtained,
including LN7 and ~N~aM T-cell clones.
~093/1672~ 4~ 1 3 ~ 9 ~ ~ PCT/US93/01716
T-cell clones were picked from the wells,
restimulated as above, and expanded for specificity
tests.
S Antibody Production
m e antigens including protein antigens of the
invention and the relevant peptide fragments can be
administered to mammalian subjects in standard
immunization protocol~ to prepare antibodies ~pecifically
immunoreactive with the antigen or peptide subunit
thereof. Techniqu~s for conferring immunogenicity on
peptide subunits by conjugation to carrier~ ie well known
in the art. The protein or carrier-coupled peptide is
injected into a suitable subject, preferably in the
- 15 presence of adjuvants, and the progress of immunization
c~n be monitored by detection of antibody tite~s in the
pl~sma or ~erum. Standard E~ISA or other immunoassays
may be used with the immunogen as antigen to assess the
level~ of`antibodies.
The antisera are separated from the red blood
cells and can then be used as polyclonal preparations or
antibody-~ecreting cell~ from the immunized host may be
immortalized u3ing ~ta~dard technique~ to obtain cell
lines that secrete mo~oclonal antibodie~ immu~ospecif;c
for the antigen~ or subun~t thereof. The antibodies per
se may also be ~eparated from other plasma protein~. In
addition to the polyclonal and monoclonal preparations,
immunologically reacti~e and specific fra~meatq ~uch as
Fab, Fab~, and the like, are also useful in immunoassay
techniques and are included in the antibodiea of the
in~ention. These antibodies or fragment~ may be purified
using standard techniques.
WO93/1672~ 3~ -16- PCT/US93/0171
,Proanosis for Onset of Ty~e I Diabetes
The antigen~ of the invention can be used in
early detPction of 8ubj ects who are developing type I
diabete~. The antigens themselves are present in both
normal and susceptible individuals; however, only those
individuals developing IDDM produce helper T-cell~ who~e
proliferation is stimulated by the presence of these
antigens. Thus, in one approach to early prognosis,
T-cells obtained from the subject to be tested are used
in the standard T-cell proliferation assays de~cribed
hereinabove to test for their response to the antigenQ of
the invention. Sub~ects whose T-cells proliferate in
these aq~ays are developing the disea~e.
It is not at present known whether these
- 15 individuals produce antibodies to the early antigen~ of
the invention; availability of these antigens will permit
the presence or absence of these antibodies to be
ascertained. In the event that sub~ect individuals are
show~n to produce antibodies prior to the onset of the
condition, the use of the antigen to detect the presence
, or'absence of these antibodies can also be used as a
prognostic tool. Standard immunoassays for the detection
of the presence or absence of these antibodie~ are well
known, and a variety of protocols involvi~g a variet~ of
labels can be used.
.
Thera~
The availability of the antigens of the
invention offers the pos~ibility of novel therapeutic
methods for blocking,the development and preventing the
onset of type I diabetes. Current strategies are
extremely aggressive and employ ~mmune system depressants
in general. A more benign therapy is offered by the
invention antigens which can be admini~tered under non-
~ ~ 35 immunogenic conditions that render the subject
; :~:
~vO 93/1672~ 3~ ~ ~ r~l PCl`/US93/01716
unresponsive to the antigens rather than eliciting animmune response thereto. General techniques for
administration of tolerizing doses of antigens or
relevant peptides thereof are known in the art, ~ncluding
introduction in the absence of adjuvant and
administration in soluble form. Use of the identified
peptides that form complexes with MHC cla~s II
glycoprotein on the ~urface of antigen presenting cells
and activate T-cells may also be employed for inducing
unresponsiveness, and a~m;nistration of small peptides
may be more amenable to this technique.
In addition to the known routes of $njection
subcutaneously, intravenously, or intraperitoneally, the
antigen or peptides of the invention may be administered
- 15 using other modes of formulation suitable for peptide-
containing cou.~ositions including transmucosal and
transdermal fonms of administration, and when properly
formulated, by oraI dosage. Suitable foDmulations that
i~clude phanmaceutically acceptable excipients for
introducing intact peptide~ or proteins to the
bloodstream by other than in~ection routes ~as well as by
in~ection) can be found in Reminaton~ Phar~ ceutical
55iSDS~ late8t edition) 8aston, PA. In partl~ular,
pumps which provide the act~ve ingredient in ~ may be
u~ed.
The antigen~ of the invention may be
administered alone or in concert with anti-CD4 antibodies
or other CD4 blockers and/or other immune modulati~g
substances. This approach to conferring tolerance is
disclosed in U.S. Pate~t~ 4,681,760 and 4,904,481. In
this approach, the antigen and the anti-CD4 antibodies or
immunoreactive fragments are administered concomitantly.
By ~concomitant~ administrat$on is meant ~ithin a time
fr~m~ which permitc the anti-CD4 component to block the
helper T-cell re-pon~e to the antigen. The nature of
, .
W093/1672~ 39~ - PCT/US93/0l7!~
~concomitant~ in this sense is described in the above-
referenced U.S. patents, incorporated herein by
reference.
Finally, therapeutic methods that utilize
modified peptides that behave as antagonists capable of
binding the MHC class II glycoprotein but resulting in a
complex which is not interactive with the T helper cells
can also be used. Modes of administration and
formulation for these peptides are similar to those
described above.
As the antigen~ of the invention provide a
relatively benign mode of intervention to prevent the
onset of IDDM, the methods of prognosis also provided may
be employed as a screening tool applied universally to
'- 15 infants and/or children. T~e assay methods described
herein reguire only a small blood sample; this provides a
relatively noninvasive screen. Individuals who test
positive by virtue of the ability of their T-cells or
antibodies to respond to the antigens of the in~ention
can then be treated as described above to prevent the
progression of the disease.
- ~ The followin~ examples are intended to
illustrate but not to limit the invention~
, ~
E~m~
AbilitY of B-cell Extracts to Effec~
Proliferation of NOD T-Cells
Test extracts were prepared using the method of
~ava and Cohen, ~ ~iol Chem (1984) ~2:2636-2645.
Briefly, confluent cell layer~ were washed three times
with phosphate buffered sali~e in the ab~ence of calcium
and magnesium ion. The remaining liquid was asp~rated
after the last wash and membrane buffer which consists of
20 mM HEPES, pH 7.5, 1.5 mM M~C12; 1 mM EGTA; 1 mM PMSF
and~l ~g/ml ~eupeptin was added. The cells were scraped
.,, ~ .
.,
, :~
~!093/l672~ -19-.~ 1 3 ~ 3 ~ 7
into the buffer and homogenized ~Dounce) and the
homogenate wa~ centr~fuged at 2s00 rpm in a Sorval S31
Centrifuge for 10 minutes at 4C. The pellet was
discarded. The supernatant was used a~ a ~whole cell
extract~ or centrifuged for 30 minutes at 48,000 xg to
separate the membrane from the eytosol. The membrane-
eontaining pellet was suspended in 20 mM HEPES and Erozen
- at -70C. The cytosol supernatant was also retained for
te~ting.
Similar extractions to obtain membrane
fraetions and eyto~ols were eondueted with respect to the
murine insulinoma eell line B23720 the glucagonoma
panereatie ~-eell line and the human neuroblastQma line
SY5Y (Goya, ~., et al., Neurochem Re~ (1991) ~:113-116).
The eyto~ol fraetion of the insulinoma cells
was further subjeeted to high perfonmanee eleetrophoretie
ehromatography (HPEC) using the Applied Biosystems, Inc.
HPEC 230A system. (The extraets are believed to contain
proteins derived from membrane as well as cyto801, and
eontain 400 ~g total protein as subjeeted to HPEC.)
For HPEC the extraets are ad~usted to a final
eoneentration of 7.5 mM tris-phosphate pH 7.5, 0.25~ SDS,
15~ glyeerol, and then loaded onto a 10~ SDS-trie
phosphate tube gel (3.5 x l0 em) and eleetrophoreRed in a
tris-phosphate buffer ~ystem. The protetn~ were eluted
from the bottom of the gel into 7.5 mM tri~-HCl, pH 7.5;
as~ayed for protein eoneentratton and analyzed on a 12.5~
SDS polyaerylamide gel. 80% of the protein was recovered
in theae fraetions.
These fraeti~n~ that induced the proliferative
re~ponse in the a~say de~cribed below were pooled. These
fractions eorre~ponded to a molecular weight range of 30-
60 kd and are labeled C-pool I in Figure 1. The C-pool I
and the eorre ponding pools obtained from the ~eytosol~
extraets (also eontaining some membrane portion) of the
WO93/167~ ~3~ 3 -20- PCT/US93/0171~-
a-cells and human neurobla~toma cell~ (labeled a-pool and
NB-pool in Figure 1, re~pectively) were compared using
the T-cell proliferative assay wherein T-cells were
prepared from the spleens of unprimed NOD f emale mice of
S 3-30 days of age. The T-cell preparation was obtained a~
described hereinabove wherein single cell suspensions
were prepared, in this case from spleen and lymph nodes,
and clarified by removing dead cells and red blood cells
using Ficoll gradient centrifugation. The resulting
preparation contains a full range of T-cell types, a~
well as antigen presenting cells.
As described above, the lymphocyte preparation
at each age was plated at 0.25-.5 x lo6 cells per well in
96 well U-shaped plates. The lymphocytes were obtained
- 15 from unfractionated (untreated) spleen and contained B-
cells and macrophages as a source for APC. The
splenocytes for each age group represented a pool of 3-8
mice. The wells were incubated with the protein
fractions (l0 ~g/ml). The reaction mixtures were
incubated for 72 hours at 37C at 5~ C02 and the plates
were then pulsed with 1 ~Ci of tritiated thymidine per
well and incubated for an additional 16 hours. The cells
were harvested and counted.
The results are shown in Figure l. As ~hown in
the figure, RPMI medium alone did not stimulate thymidine
uptake in thi~ assay under any condition~, nor did any of
the extract pools stimulate the proliferation of T-cells
derived in the manner described above from either BAL~/c
or C57Bl mice. This shows that response is ~pecific to
T-cells from NOD mice. Further, the pool from the alpha
cells shows no stimulation. These mice do not develop
type I diabetes-like symptoms. The susceptibility to
simulation of T-cells from NOD mice was tested at various
ages from 8-28 days.
-~093/1672~ PCT/US93/01716
-2~13U~'.~''I
As shown in Figure 1, the C-pool I derived from
~23720 murine insulinoma (~ islet~) was stimulatory to
T-cells from very young mice as well as from older mice.
The human neuroblastoma-corresponding pool stimulated
proliferation at all age~. However, the a-pool was not
capable of stimulating NOD T-cell proliferation, showing
a ~-cell-specific antigen. Controls using PHA as an
inducer showed the expected levels of stimulation of T-
cells from all of NOD, ~ALB/c and C57Bl/6 strains.
The T- cell assay described above was modified
by remo~ing antigen-presenting cell3 from the test NOD
T-cell preparation and assessing the effect of the
various extracts in the presence and absence of APC as
well as in the presence of fixed A*C.
In this T-cell preparation, a single-cell
suspension of spleen cell~ from NO~ mice was passed over
a nylon wool (Robin ~ab) c~lumn (Juliu~ et al., Eur J
Immunol (1973) ~:645) to enrich for T-cells and deplete
B-cellQ, plasma cells and accessory cells. The cells
were incubated in the column ~or 45 min at 37C in
complete medium (RPMI, lO~ FCS) and then washed slowly
with a large volume of medium. An average of 15-25~
yield was obtained, and the resulting cell~ contained no
effecti~e ~PC. For samples run in the presence of APC,
the APC were pre~ared from irradiated (4000 R) NOD spleen
cells; fixed AEC were prepared by ~reating A*C with 0.1%
glutaraldehyde for 60 sec.
As shown in Figure 2, the pre~ence of a~tigen-
presenting cells i8 required to elicit a re~po~e either
in the pre~ence of ~ i~let cyto801 extract~ or huma~
neurobla~toma cell cytoqols. Extract~ from a-cells
failed to elicit signifi~ant respon~e both with and
without the presence of APC. Using whole-cell extracts
as the ~ource of antigen, either APC or APC that had been
fixed only 4 hour~ after incubation with antigen were
`1~3~9 ~ ' - 22- PCT/US93/0171~
required for the ~timulation of T-cell proliferation by
either the in~ulinoma extract or the human neuroblastoma
SY5Y extract.
A~ shown from the foregoing results, human
antigen (derived from the neurobla~toma liIle) i~ cro~-
species-reactive with the NOD T-cell preparatio~, and the
antigen derived from both ~ i~lets and the human cell
line requires the presence of antigen-presenting cell~ in
order to be effective in stimNlating thymidine upta~e.
ExamDle 2
Purification and Characterization of t~ B Islet 8xtract
A. Murine Insulinoma.
'- 15 The membrane proteinq extracted from B23720
insulinoma were subjected to size separation using SDS-
PAGE, using 2 mg total load per gel. The elution pattern
is shown as a nitrocellulose blot in Figure 3. A~ shown
i~ Figure 3, discrete peaks at molecular weights 37.8,
41.9 and 55 were observed; it i~ believed that the ~mall
peak at 108.7 is a multiple of the 55 kd peak. The
elution pattern shown in Figure 3 is presented in terms
of the count~ per minute ob~erved of thymidine uptake by
the spleen~derived T-cell~ from 30-40 day old ~OD mice.
The cyto301 ~raction from mouse i~8uli~0ma
~23720 prepared as de~cribed i~ ~xample 1 wa~ ~ub~ected
~o high performance electrophoretic chromatography
~HPBC), conductad as d2scribed in Example 1. These
results are shown in Figure 4. Elution patterns assayed
with respect to T-cell~ deri~ed from NOD mice of ~arious
ages i8 shown. As ~een in Figure 4, the proliferation
respon~e _or the ~arious fraction~ increases steadily
over a period of 17-5~ day~.
The whole-cell extract of the rat insulinoma
was al~o sub~ected to HPEC under the conditions described
'~093/1672~ PCT/US93/0171h
23 ,~ 1 30.{3~
above. Figure S shows the elution pattern as determined
by the proliferative responqe of the insulinoma-specific
T-cell line NOD-F40 prepared from the spleen of a 40 day
old female NOD mou~e using the method described
S hereinabove. Three peakq of activity are ~hown.
A~ i~ apparent from the foregoing result~, the
antigen appear~ to be present in what are purportedly
cytosol extracts, whole-cell extracts and membrane
extracts of the murine insulinoma. Figure 6 shows a
comparison of the relative activities of the antigen in
each extract as assessed using NOD-F40 T-cell line
proliferation. As shown in Figure 6, the ma~ority of the
antigen appears to be present in the membrane.
~he membrane fraction of the insulinoma
- 15 prepare~ as described in Example 1 wa3 ~ubjected to two-
dimensional electrophoresis. The samples were ad~usted
to 1% Triton X-100, 15% glycerol and 6~ ampholines, pH 3-
10. Isoelectric focusing in one dimension was performed
according to O'Farrell, P.H., J Biol Chem (1975)
~Q:4007-4021, and after thi~ procedure, the gele were
removed from their gla~ tubes and loaded onto a 10% SDS
phage electrophoresed a~cording to ~aemmli, U.R., Nature
(1970) 227:680-685. The result~ are shown in Figure 7;
B. Human ~31et~ ~
Using the p~ocedures described in Example 1,
whole-cell extracts of human i~lets were obtained. HPEC
performed on ~hese extrac~s using the methods described
above re~ulted in the elution profile shown in Figure 8,
confinming that the corresponding ~uma~ antigen(s) have
molecular weight~ in the range of 30-60 kd. The elution
profile of Figure 8 was determined using fresh
splenocytes from 40 day old female NOD mice.
.
W093/1672~ 3~t~ ~ -24- PCT/US93/0171
As shown in Figure ~, the human i~let extract
contains three distinct peaks; one at about 37 kd, one at
about 41 kd, and one at about 51 kd.
The distinct nature of the three proteins was
studied using a panel of T-cell clones prepared as
described hereinabove. First, T-cell lines established
from lymph node cells of 30-day-old NOD female mlce,
selected on whole cell extracts of the insulinoma,
exhibited a T-cell reactivity Rimilar to that of unprimed
NOD lymphocytes -- that i8, there were three peaks of
response corresponding to the three antigen peaks in the
30-60 kd region. However, following two cycles of
antigenic restimulation, T-cell lines cloned by limiting
dilution showed differences in the antigen to which they
responded. m e T-cell clone ~N~CM responded to the
antigen of approximately 51 kd (Figure 9A), and the clone
~N7 responded to the antigen of approximately 37 kd
(Figure 9B). m us, the individual peaks of T-cell
activity presumably correspond to distinct proteins as
opposed to multimers or degradation products.
- ExamDle 3
To distinguish the antigens of the invention
from other proteins obtainable from islets, the standard
thymidine incorporation as~ay described above was used,
- with the te~t an~igens at 10 ~g/ml and cultures of 1-3 x
105 cells per well of ~ingle cell female mNrine NOD
splenocyte suspensions prepared in the RPMI-based medium.
The results are shown in Table 1.
~ ;' . .
~'0 93/1672~ PCI/US93/01716
~ ~ 3 1~
TABLE 1.
3~-Thymidlne lncor~oratlon
Antlg~s _C~MI S.D.
wholo cell extract~
beta insulinoma 31553l1862
alpha glucagonoma 1012l3~
islets (NOD mice) 13416~2178
islets ~human) 29032~2090
pa~creatlc hormones
rat insulin 899l105
bovine insulin 958~87
C-l peptide (mouse) ~54~119
C-1 peptide (rat) 997~6B
glucagon 1002~95
somatostatin 765~74
r comb~D~t ~roteln~ :
hsp65 1078~329
hsp70 932l119
carboxypeptidase-H 559~121
PM-1 669~9B
GAD-65 99~25
GAD-67 155~17
peripherin 67~78
, ", -, ,, , _ .
'.
The data in Table 1 ~how that ~-insulinama, islets fr~m
NOD mice, and i~lets from humans are successful in
~timulating thymidlne incorporation into ~plenocytes.
Extracts of a-glucagonoma are not. Other pancreatic
hormones, including insulin, C-peptides, glucagon and
somatostatin, are also not active. A1RO iDactive are
heat shock protein (hsp~ 65, hsp70, carboxypeptidase-H,
PM-l, GAD-65, GAD-67 and peripherin. None of these
protein~ are capable of showing the stimulatory effect of
the islet extracts.
; The proteins listed in Table 1 as recombinant
protein~ were prepared as follow~. The cDNA encoding
W093/l672~ ~ ~3~g ~ -26- PCT/U593/0l7l~
human hsp65 was cloned by PCR using polyA+ RNA isolated
from human EBV-transformed B cell line, post-incubation
at 42C for 2 hr. Following reverse transcription, the
hsp65-encoding fragment was amplified by PCR using the
primers 5~-CGGGG~TCCGCCAAAGATGTAAAATTTGGTGCAGATGCC and
5'-GTCCTCGAGTTAGAACATGCCACCTCCCATACCACCTCC (30 cycle~ of
30 sec at 94C, 30 sec at 55C and 1 min at 72C). The
cDNA encoding human carboxypep-tidase-H, PM-l (gifts from
G. Eisenbarth) and huma~ hsp70 (ATCC/clone pH 2.3), were
cloned into expression vector pTrc99A (Aman, E., et al.,
Gene (1988) ~2:301-315) (His6) which was constructed by
insertion of a synthetic DNA fragment encoding BiX
histidine residues into the polylinker of the pTrc99A
expression vector, to encode protein tagged with six
~- 15 histidine residues at the N-tenminus. Plasmid constructs
were transformed into E. coli-Tgl ~supB hsd~lac-
proAB)F'ttraD36prQAB~lacIqlacZ~ M15] and protein
expression was induced by addition of IPTG to the culture
medium. Bacteria were lysed in 100 mM Tris pH ~.0, 6M
GuHC~, and insoluble material was rem~ved by
centrifugation at 40 ~g for 30 m~n. Recombinant proteins
were purified using Ni-NTA-agarose (Qiagen, Chatsworth,
CA) in the presence of 6M GuHCl and dialyzed against PBS.
Protein concentration was determined using BCA assay
2S (Pierce). Mouse GAD-65, GAD-67 and peripherin expressed
in baculoviru~ sy~tem were gift~ from Dr. Roland Tisch
(H. McDe~itt lab, Stanford).
Exam~le 4
ili~y of T-Cell Clonea to Stimulate In~u~
The T-cell line ~N-7 was stimulated with
insulinoma antigen, and three days later 2-5 x 106
stimulated cells were injected intraperitoneally into 3-
week-old NOD female mice. Four weeks later, the
pancreata were removed, fixed in fonmalin buffer, and
~`1O 93/1672~ -27 ~ ¦ ~ U ~ S r~ PCl/US93/01716
stained with hematoxylin and eosin. Pancreata from age-
matched NOD female mice were used as controls.
The results of this experiment are shown in
Figure~ lOA and lOB. Figure lOA represent~ the control;
Figure lOB represents the mou~e injected with LN-7 T
cells. The injected mice showed acceleration.of
destructive insuliti~, as compared to controls. Similar
results were obtained with ~N~aM T cell clones.
"
~ .
, ~
.
- :
,~
~, :
,
