Note: Descriptions are shown in the official language in which they were submitted.
W094~00569 ~ 3 PCT/U~93/~5873
M~THODS FOR PRODUCIN~ TR~NSGENIC NON-HUMAN ANIMALS
HARBORING A YEAST ARTIFICIAL CHROMOSOME
1 0 '
TECHNICAL FI~rn ::
The invention relates to transgenic non-human
animals capab'~ of e~pressing xenogenic polypeptides, ~. :
transgenes use~ ~0 produce such transgenic animals,
transgenes capable of expressing xenogenic polypeptides, yeast
artificial chromosomes comprising a polynucleotide sequence
encoding a human protein such as a human immunoglobulin or
amyloid precurso~ protein (~PP), methods and transgenes for
transferring large polynucleotide sequences into cells0 and
mekhods for co-lipo~ection of discontinuous polynucleotide
s~quences into cells.
BACK~ROUND OF THE INVENTION
Transferring exogenous genetic material into cells
is the basis f or modern molecular biology . The contirluing
development of novel methods f or improving the ef î iciency,
specificity, and/or size limitations of the transfer proces
has broadened the scope of research and product development by
enablin~ the production of polynucleotide clones and
recombinant organisms that previously were impractical or
im~ossible to construct. Calcium phosphate precipitation,
electroporation, lipofection, ballistic transfer~ DEAE-dextran
transfection, microinjection, and viral-based transfer
methods, among others, have been described for introducing
~or~ign DNA fra~ments into mammalian cells.
The art al~o has de~el~ped yeast arti~icial
chrom~some (i'YAC") cloning vec~ors which are capable of
propagating large (50 to more than 1000 kilobases) cloned
inserts (U.S. Patent 4,889,806) o~ xenogenic DNA. YAC clone
WV94/00569 2 i ~ 5 3 1 3 PCT/VS93/05P-~
libraries have been used to identify, map, and propagate large
fragments of mammalian genomic DNA. YAC cloning is especially
useful for isolating intact genes, particularly large genes
having exons spanning several tens of kilobases or more, and
genes having distal regulatory elements located tens of
kilobases or more upstream or downstream from the exonic
sequences. YAC cloning is particularly advantageous for
isolating large complex gene loci, such as unrearranged
immunoglobulin gene loci, and genes which have been inexactly
mapped to an approximate chromosomal region (e.g., a
Huntington's chorea gene). Y~C cloning is also well-suited
for making vectors for performing targeted homologous
recombination in mammalian cells, since YACs allow the cloning
of large conti~uous sequences useful as recombinogenic
homology regions in homologous targeting vectors. Moreo~er,
YACs afford a system for doing targeted homologous
recombination in a yeast host cell to create novel, large
: transgenes (e~g., large minigenes, tandem gene arrays, etc.)
in YAC constructs which could then be ~ran ferred to mammalian
host cells.
Unfortunately, manipulation of large polynucleotides
is problematic. Large polynucleotides are susceptible to
breakage by shearin~ forces and form highly viscous solutions
even at relatively dilute concentrations, making in vitro
manipulation exceedingly difficult. For these reasons, and
: others, it is desirable to reduce the amount of manipulation
that YAC clones and other large DNA fragments ara sub~ected to
in the process o~ constructing large transgene constructs or
homologous recombination constructs.
More problematic is the fact that the transfer of
large, intact polynucleotides into mammalian cells is
typically ine ficient or provides a restriction on the siz~ of
the polynucleotide transferred. ~or example, Schedl et al.
~ (1992) Nuclei~ ACids Res! 20: 3073, describe transferring a 35
kilobase YAC clone into the mouse genome by pronuclear
injec~ion of murine embryos; however, the shear forces
produced in the injection micropipette will almost certainly
preclude the efficient transfer of significantly larger YAC
~ ~ ~ J ~
W094/00569 P~T/VS93/05873
clones in an intact form. Many large genes likely could not
be transferred efficiently into mammalian cells by current
microin,~ction methods~
Spheroplast fusion has b~en used to introduce YAC
DNA into fibroblasts, embryonal carcinoma cells, and CHO cells
(Pachnie et al. (1990) Proc. Natl. Acad. Sci. (U.S.A.~ 87:
5109; Payan et al. (19~0) Mol. Cell. Biol. lO: 4163; Chirke et
al~ (1991) E~aQ_~ 10: 1629; Davies et al. (1992) Nucleic
Acids Res. 20: 2693)~ Alternative transfection methods such
as calcium phosphate precipitation and lipofection have been
used to transfer YAC DNA into mammalian cells ~Eticciri et al.
(1991) Proc. Natl. Acad. Sci. fU.S~A ) 88: 2179; Strauss W and
.Jaenisch R (1992) EMBO J. 11: 417).
Thus, there exists a need in the art for an
efficient method for transferring large seyments of DNA, such
as large YAC clones, into mammalian cells, such as embryonic
stem ~ells for making transgenic animals, with a minimum of
manipulation and cloning procedures. In partlcular, it would
be highly advantageous if it were possible to isolate a large
cloned mammalian genomic fragment from a YAC library, either
linked to YAC yeast sequenoes or purified away from YAC yeast
sequences, and transfer it intact into a mammalian host cell
(e.g.5 an ES cell~ with a second polynucleotide sequence
(e.g., a selectable marker such as a neo~ expression cassette)
without additional cloning or manipulation ~e~g., ligation of
the sequences ~o each other). Such a method would allow the
efficient construction of transgenic cells, transgenic
animals, and homologously targeted cells and ani~als. These ~:
transgenic/homologously targeted cells and animals could
provide useful models of, for example, human genetic diseases
such as Huntington's chorea and Alzheimers disease, among
others.
Alzheimer's Disease
~ At present there is no known therapy for the various
forms of Alzheimer's disease (AD)~ H9wever, th~r~ are several
disea~e states for which effective treat~ent i5 a~ailable and
which give rise to progressive intellectual dete~ioration
W094/00569 % 1 ~ 5 3 ~ ., P~T/US93/05~
closely resembling the dementia associated with Alzheimer's
disease.
Alzheimer's diseas~ is a progr~ssive disease known
gen rally as senile dementia. Broadly speaking the disease
falls into two categories, namely late onset and early onset.
Late onset, which occurs in old age (65 + years), may be
caused by the natural atrophy of the brain occurring at a
faster rate and t~ a more severe degree than normal. Early
onse~ Alzheimer's disease is much more infrequent but shows a
pathologically identical dementia with brain-atrophy which
develops well before the senile period, i.e., between the ages
of 35 and 60 years. There is evidence that one form of this
. type o~ Alzheimer's disease is inherited and is therefore
known as familial Alzheimer's disease (FAD).
In both types of Alzheimer's disease the pathology
is the same but the abnormalities tend to be more se~ere and
more widespread in cases beginning at an earlier agP- The
disease i5 characterized by four types of lesions in the
: brain, thes2 are: amyloid plaques around neurons (senile
: 20 plaques), amyloid deposits around cerebral blood vessels,
neurofibrillary tangle-~ inside neurons, and neuronal cell
death. Senile plaques are areas of disorganized neuropil up
to 150~m across with extracellular amyloid deposits at the
center. C~rebrovascular amyloid deposits are amyloid material
surrounding cerebral blood vessels. Neurofibrillary tangles
are intracellular deposits of amyloid protein consisting of
: two filament-~ twisted about each other in pairs.
The major protein subunit, amyloid ~ protein, is
: found in amyloid filaments of both the neurofibrillary tangle ~
and the senile plaque and is a highly aggregating small :
polypeptide of approximate relati~e molecular mass 4,000.
This protein is a cleavage product of a much larger precursvr
protein called amyloid precursor protein (APP).
Th~ APP gene is known to be located on human
chromo~ome 21~ A locu~ segregating with familial Alzheimer's
dis~ase has been mapped to ohromosome 21 ~St. George Hyslop et
al (1987) Science 235: 885) close to the APP gene.
Recombinants between the APP gene and the AD locus have been
~-13~3~ ~
WO9~/0~69 PCT/US93/05873
previously reported (Schellenberg et al. (1988] Science 241:
1507; Schellenberg et al. (1991) Am. J._Hum. Genetics 48: 563;
Srhellenberg et al. (19gl~ Am. J. Hum. Genetics 49: 511,
incorporated herein by reference). The development of
experimental models of Alzheimer's disease that can be used to
define further the underlying biochemical events involved in
AD pathogenesis would be highly desirable. Such models could
presumably be employed~ in one application, to screen for
agents that alter the degeneratiYe course of Alzheimer's
disease. For example, a model system of Alzheimer's disease
could be used to screen for environmental factors that induce
or accelerate the pathogenesis of AD. In contradistinc~ion,
. an experimental model could be used to screen for agents that
inhibit, pre~ent, or r2verse the progression of AD.
Presumably, such models could be employed to develop
pharmaceuticals that are effective i~ preventing, arrestin~
or reversing AD~
Unfortunately, only humans and aged non-human
primates develop any of the pathological features of AD; the
expense and difficulty of using primates and the length of
time required for developin~ the AD pathology makes extensive
research on such animals prohibiti~e. Rodents do not develop
AD, even at an extreme age. It has been reported that the
injection of ~-amyloid protein (~AP) or cytotoxic ~AP
fragments into rodent brain results in cell loss and induces
an antigenic marker for neurofibrillary tangle components
(Kowall et al. (19913 Proc. Natl._ Acad. Sci. (U.S~A.~ 88:
7247 ) . Mice which carry an extra copy of the APP gene as a
r~sult of partial trisomy of chromosome 1~ die before birth
(Coyle et al. (1988~ Trends in Neurosci. 11: 390~. Since the
cloning of the APP gene, there have been several attempts to
produce a mouse model for AD using transgenes that include all
or part of the APP gene, ur~f ortunately much of the work
remains unpublished since the mice were nonviable or f ailed to
3 5 show AD-like patholo~y; two publish~d reports were retract~d
because o~ irregularities in reported results (2~arx J Science
255: 120~),
W094J0~s69 ~ 3 ~ ~ PCT/~S93/05~-~
Thus, there is also a need in the art for
transgenic nonhuman animals harboring an intact human APP
gene, either a wild-typP allele, a disease-associated allele,
or a combination of these, or a mutated rodent ~e.g., murine)
allele which comprises sequence modifications which correspond
to a human ~PP sequence. Cell strains and cell lines (e.g.,
astroslial cells) derived from such transgenic animals would
also find wide application in the art as experimental mod~ls
for developing AD therapeutics.
Nonhuman Transqenic Animals Exressinq Human Immunoqlobulin
Making human monoclonal antibodies that bind
pred~termined antigens is difficult, requiring a source of
. viable lymphocytes from a human that has b~en immunized with
an antigen of choice and which has made a substantial humoral
immune response to the immunogen. In particular, humans
general~y are incapable of making a substantial antibody
response to a chall~nge with a human (sel~ antigen,
un~ortunately, many such human antigens are promising targets
for therapeutic strategies involving h-uman monoclonal
~0 antibodies. On~ approach to making human antibodi e3 that are -~
specifically reactive with predetermined human antigens
involves producing transgenic mice harboring unrearranged
human i ~ unoglobulin transgenes and having functionally
disrupted endogenous immunoglobulin gene~s) (Lonberg and Xay,
WO 92~03918, Kucherlapati and Jakobovits, WO 91J10741). ~:~
However, efficiently transferring large DNA segments, such as
those spanning significant port}ons of a human light or heavy
chain immunoglobulin gene locus, presents a potential o~sta le
and/or reduces the efficiency of the process of generating th~
transgenic animals.
Based on the foregoing, it is clear that a need
exists for nonhuman cells and nonhuman animals h~rboring one
or more large, intact transgenes, particularly a human APP
ge~e or ~ human immunogl9bulin transgene(s~. Thus, it is an
object of ~he invention her~in to provide method and
compositions ~or transfPrring large transgenes and large
homologous recombination constructs, usually cloned as YACs,
into mammalian cells, especially into embr~onic stem cells.
~l~ 3~
W094/~0s69 PCT/US93/05873
It is ~so an object of the invention to provide transgenic
nonhuman cells and transgenic nonhuman animals harboring one
or more APP transgenes of the invention.
The references discussed herein are provided solely
for their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an
admission that the inventvrs arP not entitled to antedate such
disclosure by virtue of prior invention. All citations are
incorporated herein by reference.
SUMMARY OF THE INVENTION
In accordance with the foregoing objects, in one
.aspect of thP invention methods for transferring larye
transgenes and large homologous targeting constructs,
typicall.y propagated as YACs and preferably spanning at least
one complete transcriptional complex, into mammalian cells,
such as ES cells, are provided. In one asp~ct, the methods
pro~ide for transferring the large transgenes and large
homologous targeting constructs by a lipofection method, such
as ~o-lipofection, wherein a second unlinked polynucleotide is
transferred into ~he mammalian cells along with the large
transgene and/or large homolog~u targeting construct.
Preferably, the s~cond po~ynucleotide confers a s~lectable
phenotype (e.g., resistance to G418 selecti~n) to cells which
Aave taken up and integrated the polynucleotide sequence~s).
Usually, the large transgene or homologous targeting construct
i5 transferred with yeast-derived YAC sequences in
polynucleotide linkage, but yeast-derived YAC sequences may be
removed by restriction enzyme digestion and separation (~.g, ::
pulsed gel elec~rophoresis). TAe l~rge tran~gene(s) and/or
homologous targeting construct~s~ are generally mixed with the ~-
~unlinked second polynucleotide (e.g., a neoR expression
cassett~ to confer a selectable phenotype) and contacted with
a cationic lipid (e.g., DOGS, DOTMA, DOTAP) to form cationic
lipid-DNA complexe~ which are ~-ontacted with mammalian cells
(e.gO, ES cells) in conditions suitable for uptake o~ the DNA
into the cells (e.g., cul~ure medium, physiological phosphate
bu~fered saline, serumfree ES medium). Generally, cells
WO9~/0~69 ~ 3~ 3 PCT/US93/oS~
harboring the large transgene or large homologous targeting
construct concomitantly harbor at least one copy of the second
polynucleotide, so that selection for cells harboring the
second polynu lPotide have a significant probability of also
harboring at least one copy of the large transgene or large
homologous targeting construct, generally as an integrated or
homologously recombined segment of an endogenous chromosomal
locus. Hence selection for the second polynucleotide (e.g.,
neoR expression cassette) generally also selects cells
harboxing the large transgene or large homo~ogo~s targeting
construct without requiring cumbersome polynucleotide linkage
(i.e., ligation) of the large transgene or large homologous
.targeting construct to the second polynucleotide prior to
lipofection. According to the co-lipofection methods of the
invention, large segments of xenogenic DNA are rapidly and
efficiently transferred into mammalian cells (e.g., murine ~S
cells) without requiring linkage of a selectable marker gene
and subsequent cloning.
The invention also provides mammalian cells,
preferably ES cells, harboring at least one copy of integrated
or homologously recombined large xenogenic ~preferably
heterologous) mammalian genomic DNA sequences linked to yeast-
derived YAC sequences. Preferably, the large xenogenic
(preferably heterologous~ mammalian genomic DNA sequences
comprise a complete structural gene, more preferably a
- complete trans~.riptional unit, and in one embodiment a
complete human APP gene. Typically, the resultant transganic
mammalian cells also comprise at least one integrated copy o
the unlin~ed second polynucleotide (e.g., the selectable
marker), which is usually nonhomologously integrated into at
~east one chromosomal locus, sometimes at a chromosomal locus
distinct from that a~ which the large transgene(s) or large
homologous targeting construct(s) has been incorporated.
During the transfection process and shortly thereafter, novel
mammalian cells, such as ES c~lls, comprising large foreign
DNA sequences, an unlinked selectable marker gene, and a
suitable cationic lipid are formed, such novel m~mmalian cells
are one aspect of the present invention.
W~94~00569 PCT/~S93~05873
The invent~on also provides transgenic nonhuman
animals comprising a genome having at least one copy of
integrated or homologously recombined large xenogenic
(preferably heterologous) mammalian genomic DNA sequences
linked to yeast-derived YAC sequences. Preferably, the large
xenogenic (preferably heterologous) mammalian genomic DNA
sequences comprise a complete structural gene, more preferably
a complete transcrip~ional unit, and in one embodiment a
complete human APP gene. Typically, the resultant transgenic
nonhuman ma~al also comprises a genome having at least one
integrated copy of the unlinked second polynucleotide (e.g.,
the selectable marker), which is usually nonhomologously
integrated into at least one chromosomal locus, sometimes at a
chromosomal locus/loci distinct from that at which the large
transgene~s) or large homologous targeting construct(s)
has/~ave been incorporated. Pre~erably, the large transgene
and/or large homologous targeting construct which has been
incorporated into a chromosomal locus (or loci) of the
nonhuman ani~al is expressed, more preferably is expressed
similarly to the naturally-occurring homolog gene in the non-
human animal species (e.g., in a similar tissue-specific
pattern and/or developmental pattern).
The invention also provides compositions for co-
llpofection: transgenesis compositions and homologous
targeting compositions for transferring xenogenic, typically
heterologous, large (i.e., 50 kb or more) polynucleotide~ into -
~
-~ mammalian cells, such as ES cells for making transgenic .;
: nonhuman animals harboring at least one copy of at least one
integrated large foreign transgene and/or harboring at least
one homologously targeted construct in its genome. A
transgenesis composition comprises: (1) at least one large
transgene species, (2) at leas~ one unlinked second
polynucleotide species (such as an expression cassette
containing the selectable marker gene neoR), and (3) at least
one species of suitable cationic lipid. A homologous
targ~ting composition co~prises~ at least one large
homologous targeting construct species, (2) at l~ast o~e
unlinked second polynucleotide species (such as an exp ~ssion
W~4/~0569 ~ 3 ~ ~ ~CT/U~93/05~
cassette containing the selectable marker gene neoR), and (3)
at least one species of suitable cationic lipid. Preferably
the large transgene or large homologous targeting construct
spans an entire transcriptional unit. One preferred
embodiment of a co-lipofection composition is a composition
comprising: (-) a human APP gene sequence ~or a modified
murine or rat APP gene having a non-naturally occurring
sequence corresponding to a human APP sequence) linked to
yeast derived YAC sequences, (2~ an expression cassette
encoding a selectable marker, and (3) a suitable cationic
lipid. Another preferred embodiment of a co-lipofection
composition is a composition comprising: (13 a human
. unrearranged immunoglobulin gene sequence (heavy or light
chain gene sequence comprising at least two V gene complete
segment, at least one complete D segment (if heavy chain
gene)~ at least one complete J segment, and at least one
constant region gene) linked to yeast-derived YAC sequences,
: (2~ an expression cassette encoding a selectable marker, and
(3) a suitable cationic lipid.
In one aspect of the invention, multiple species of
unlinked polynucleotide sequences are co lipofect~d into
murine embryonic stem cells andfor other mammalian cells,
wherein at leas~ one species of the unlinked polyn~cleotide
sequences ~omprises a selectable marker gene which confers a
selectable phenotype to cells which have incorporated it. The
resultant cells are selected for the presence of the
selecta~le marker; such selected cells have a signif icant
probability of romprising at least one integrated copy of the
other species of polynucleotide sequence(s) introduced into
the cells.
BRIEF DESCRIPTION OF THE FIGUR~S
Fig. 1: Chemical structures of representative
cationic lipid~ for forming co-lipofection complexes of the
present in~ention.
Fig. 2: PCR analysis of ES clones co-lipof ected with
the human APP transgene. Shaded circl s denote wells which
were not used . Row pools (A-P~ contained 18 (A-H) or 16 ( ~ P)
~ l ~ 3~
W094/00569 PCT/US93/05$73
11
clones each. Column pools (P1-P18) contained 16 (P1-P12) or 8
(P13-P18) clones each.
Fig. 3: PCR analysis of ES clones co-lipofected with
the human APP transgene. Pools P3, P4, P9, P10, P11, and P12
and pools G, H, K, M, N, 0, and P were candidates for
containing clones with both promoter and exon 17 sequences.
Fig. 4: PCR analysis of ES clones co-lipofected with
the human ~PP transgene.
Fig. 5: Southern blot analysis of YAC clone DNA
using a human ~lu sequence probe.
Fig. 6: Partial restriction digest mapping of hum~n
APP YAC.
Fig. 7: PCR analysis of RNA transcripts expressed
from intsgra~ed human APP transgene.
Fig. 8: Quantitative RNase protection assay for
detecting APP ~NA txanscripts from human APP transgene.
DefinitionS
Unless defined otherwise, all technical and
scientific terms used herein have the same meaning as commonly
understood by one of ordinary ~kill in the art to which this
inven ion belo~gs. Although any methods and materials similar
or equivalent to those described herein can be used in the
practice or testing of the present invention, the preferred
methods and materials are described. For purposes of the
present invention, the following terms are defined below.
The term "corresponds to" is used herein to mean
that a polynucleotide sequence is homologous (i.e., is
identical r not strictly evolutionarily related) to all or a
portion of a reference polynucleotide se~uence, or that a .,
polypeptide sequ~nce is identical to a reference polypep~ide
seguence. In contradistinction, the term ~'complementary to"
is used herein to mean that the complemsntary sequence is
homologous to all or a portion of a reference polynucleotide
sequence. For illustration, the nucleo~ide sequence "TATAC"
corresponds to a reference seguence "TATAC" and is
complementary to a reference sequence "GT~TA."
The terms " ubstantially corresponds to",
"substantially homologous", or "substantial identity" as u~d
WO94/0056g ~ ;-c~ PCT/US93/05~
herein denotes a characteristic of a nucleic acid sequence,
wherein a nucleic acid sequence has at least 70 percent
se~uence identity as compared to a reference sequence,
typically at least 85 percent sequence identity, and
preferably at least 95 percent sequence identity as compared
to a reference sequence. The percentage of sequence identity
is calculated excluding small deletions or additions which
total less than 25 percent of the reference sequence. The
reference sequence may be a subset of a larger sequence, such
as a portion of a gene or flanking sequence, or a repetitive
portion of a chromo~ome. However, the reference sequenGe is
at least 18 nucleotides long, typically at least 30 `:
.nucleotides long, and preferably at least 50 to 100
nucleotides long. "Substantially complementary" as used
herein refers to a sequence that is complementary to a `
sequence that substantially corresponds to a reference
sequence.
Specific hybrîdization is defined herein as the
formation o~ hybrids between a targeting transgene seguence
(e.g., a polynucleotide of the invention which may include :~
substitutions, deletion, and/or additions) and a speci~ic
target DNA sequence (eO~., a human APP gene sequence or human
imm~noglobulin gene sequence), wherein a labeled targeting
trans~ene seguence preferentially hybridizes to the targ~t
s~ch that, for example, a single band corresponding to a
: restriction fragment of a gene can be identified on a Southern
: blot of DNA prepared from cells using ~aid labeled targeting
transgene sequence as a probe. It is eviden~ that optimal
hybridization conditions will vary depending upon the saquence
c~mposition and length(s) of the targeting transgene(s) and
endogenous taryet(s), and the experimental method selected by
the practitioner. Various guidelines may be used to select
appropriate hybridization condition~ (~ee, Maniatis et al.,
- Molec~lar Clonin~ A Laboratory Manual (19893, 2nd Ed., Cold
Spring Harbor, N.Y. and Berger and Kimmel, M~thod5 in
EnzYmoloov~ Volume 152~ Guide tD Molecular Cloninq Techniques
(1987), Academic Press, Inc., San Diego, CA., which are
incorporated herein by reference.
W094/00s69 PCT/US93/05873
The ~erm "naturally-occurring" as used herein as
applied to an object refers to the fact that an object can be
found in nature. For example, a polypeptide or polynucleotide
sequence that is present in an organism (including viruses)
that can be isolated from a source in nature and which has not
been intentionally modified by man in the laboratory is
naturally-occurring. ~s used herein, laboratory strains o~
rodents which may have been selectively bred according to
classical genetics are considered naturally-occurring animals.
The term t'cognate" a-~ used herein refers to a gene
~ sequence that i5 evolutionarily and functionally related
between species. For example but not limitation, in the human
,genome, the human immunoglobulin hea~y chain gene locus is the :~
cognate gene to the mouse immunoglobulin hea~y chain gene
locus, since the sequences and structures of these two ~enes ~
indicate that they are highly homologous and both genes encode ~: :
a protein which unctions to bind antigens specifically.
As used herein, the term l'xenogenic" is defined in
r lation ~ a recipient mammalian host cell or nonhuman animal
and means that an amino acid sequence or polynucleotide
sequence is not encoded by or present in, respectively, the
naturally-occurring genome of the recipient mammalian host
cell or nonhuman animal. Xenogenic DNA sequences are foreign
DNA s~.quences; for example, human APP genes or immunoglobulin
Z5 genes are xenogenic with respect to murine ES cells, also, for
illustration, a human cystic fibrosis~associated CFTR allele
is xenogenic with respect to a human cell line that is
homozygous for wild-type ~normal) CFTR alleles. Thus, a
cloned murine nucleic acid sequence that has been mutated
(e.g., by site directed mutagenesis) is xenogenic with respect
to the murine genome from which the se~lence was originally
derived, if the mutated sequence does ~`IOt naturally occur in
the ~urine genome.
As used herein, a "heterologous gene" or
"heterologous polynucleotide sequence" is defined in relation
to the tranægenic nonhuman organism producing such a gene
product. A heterologous polypeptide, also referred t~ as a
xenogeneic polypeptide, is defined as a polypeptide having an
W094/0~569 ~ 3 1 ~ PCT/VS~3/0587
14
amino acid sequence or an encoding DNA sequence corresponding
to that of a cognate gene found in an organism not consisting
of the transgenic nonhuman animal~ Thus, a transgenic mouse
harboring a human APP gene can be described as har~oring a
heterologous APP gene. A transgenic mouse harboring a human
immunoglobulin gene can be described as harboring a
heterologous immunoglobulin gene. A transgene containing
various gene segments encoding a heterologous protein sequence
may be readily identified, e.g. by hybridization or DNA
19 sequencing, as being from a species of organism other than the
transgenic animal. For example, expression of human APP amino
acid sequence9 may be detected in the transgenic nonhuman
, animals of the invention with antibodies specific for human
APP epitopes encoded by human AP gene se~ments. A cognate ;
heterologous gene refers to a corresponding gene from another
species; thus, if murine APP is the reference, human APP is a
cognate heterologous gene (as is porcine, o~ine, or rat APP~
along with AP genes from other species).
~s used herein, the term "t~rgeting construct"
refers t~ a polynucleotide which comprises: (1) at least one
homology region having a sequence that is substantially
identical to or substantially complementary to a sequence
present in a host cell endogenous gene locus, and ( 2 ) a
: targeting region which becomes integrated into a host cell
endogenous gen:e locus by homologous recombination between a
targeting construc~ homology region and said endogenous gene
lscus sequence. If the targeting construct is a 'thit-and-run"
or "in-and-outt' typ2 construct (Valancius and Smithies 51991)
Mol. Cell. Biol~ 1402; Donehower et al. (1992~ Nature 356:
215; (1991~ J NIH Res. 3: 59; Hasty et al. (1991) Nature 350;
243, which are incorporated herein by reference), the
targeting region is only transiently incorporated into the
endogenous gene locus and is eliminated from the host genome
by selectîon. A targeting region may comprise a seguence that
is substantially homologous to an endogenous gen~ sequenc~
and/or may comprise a nonhomologous se~uence, such a~ a
s~lectable marker (e.g., neo, tk, gpt). The term "targeting
construct" does not necessarily indicate that the
~ 1 3 ~ 3 1 t~
W094/00~69 PCT/US~3/05873
polynucleotide comprises a gene which becomes integrated into
the host genome, nor does it necessarily indicate that the
polynucleotide comprises a complete structural gene sequence.
As used in the art, the term "targeting construct" is
synonymous with the term "targeting transgene" as used herein. -~
The terms "homology region" and "homology clamp" as
used herein refer to a segment (i.e., a portion) of a
targeting construct having a sequence that substantially
~orresponds to, or is substantially complementary to, a
prede~ermined endogenous gene sequence, which can include
sequences flanking said gene. A homology region is generally
at least about 100 nucleotides long, preferably at least about
.25Q to 500 nucleotides long, typically at least about lOOQ
nucleotides long or longer. Although there is no demonstrated
theoretical minimum length for a homology clamp to mediate
homologous recombination, it is believed that homologous
recombi~ation efficiency generally increases with the length
of the homology clamp. Similarly, the recombination
efficiency increases with the degree of sequence homology
between a targeting construct homology region and the
endoyenous target sequence, with optimal recombination
efficiency occurring when a homology clamp is isogenic with
: the endogenous target se~uence. The terms "homology clamp"
: and "homology region" are interchangeable as used here , and
the alternative terminology is offered-for clarity, i ew -.^
the inconsistent usage of similar terms in the art.
homology clamp does not necessarily connote formation a
base-pair~d hybrid structure with an endogenous sequence.
Endogenous gene sequences that substantially correspond to, or
are substan~ially complementary to, a transgene homology
region are referred to herein as "crossover target sequences"
or "endogenous target sequences."
As used herein, the term "minigene" or "minilocus"
refers to a heterologous gene construct wherein one or more
nonessential segments of a gene are deleted with r~pect to ::
the naturallyToccurring gene. Typica}ly, del~ted segments ar~ -
i~tronic sequence~ of at least about 100 basepai~s to several
- kilobases, and may span up to several tens of kilobases or
W094/00569 , PCT/US93/0587
16
more. Isolation and manipulation of large (i.e., greater than
about 50 kilobases) targeting constructs is frequently
difficult and may reduce the efficiency of transferring the
targeting construct into a host cell. Thus, it is fre~uently
desirable to reduce the size of a targeting onstruct by
deleting one or more nonessential portions of the gene.
Typically, intronic sequences that do not encompass essential
regulatory elements may be deleted. For example, a human
immunoglobulin heavy chain minigene may compxise a deletion of
an intro~ic segment between the J gene segments and the ~
constant region exons of the human heavy chain immunoglobulin
gene locus. Frequently, if convenient re^ctriction sites bound
. a nonessential intronic sequence of a cloned gene sequence, a
deletion of the intronic sequence may be produced by: (1)
diyesting the cloned DNA with the appropriate restriction
en~ymes, (2) separating the restriction fragments (eOg., by
electrophoresis~, (3) isolating the restriction fragments
encompassing the essential exons and regulatory elements, and
(4) ligating the isolated restriction ~ragments to form a
minigene wherein the exons are in the same linear order as is
present in the germline copy of the naturally-occurrin~ gene.
Alternate methods for producing a minigene will be apparent to
those of skill in the art (e.g., ligation of partial genomic
clones which encompass essential exons but which lack portions
of intronic sequence). Most typically, the gene segments
comprising a minigene will be arranged in the same linear
order as is present in the germline gene, however~ this will
not always be the case. Some desired regulatory elements
(e.g., enhancers, silencers) may be relatively position-
insensitive, so that the regulatory element will functioncorrectly even if positioned differently in a minigene than in
the corresponding ge~mline gene. For example, an enhancer may
be located at a different distance from a promoterl in a
differ~nt orientation, and/or in a different linear order. For
example, an enhancer that is located 3' to a promoter in
germline configuration might be located 5' to the promoter in
a minigene. Similarly, some genes may have exons which are
alternatively spliced at the RNA level, and thus a minigene
W094/00s69 PCT/US93/OSB73
may have fewer exons and/or exons in a different linear order
than the corresponding germline gene and still encode a
functional gene product. A cDNA encoding a gene pro~uct may
also be used to construct a minigene. However, since it is
generally desirable that the heterologous minigene be
expressed similarly to the cognate naturally-occurring
nonhuman gene, transcription of a cDNA minigene typically is
driven by a linked gPne promoter and enhancer from the
naturally-occurring gene.
A~ used herein, the term l'large transgene" or "large
homologous targeting construct" generally refers to
polynucleotides that are larger than 50 kb, usually larger
.than 100 kb, frequently larger than 260 kb, occasionally as
large as 500 kb, and sometimes as large as 1000 kb or larger.
As used herein, the term "transcriptional unit" or
"transcriptional complex" refers to a polynucleotide s2quence
that comprises a structural gene ~exons), a cis-acting linked
promoter and other cis-acting sequences necessary for
efficient transcription of the structural sequences, distal
regulatory elements necessary for appropriate tissue-specific
and de~elopmental transcription of the structural sequences,
and additional cis se~uences important for efficient
transcription and translation (e.g., polyadenylation site,
mRNA stability controlling-sequences).
As used herein, "linkedl~ means in polynucleotide
linkage (i.e~, phosphodiester linkage). "Unlinked" means not
linked to another polynucleotide sequence; hence, two
sequences are unlinked if each sequence has a free 51 terminus
and a free 3' terminus.
DET~ILED DESCRIPTION OF THE INVENTION
Generally~ the nomenclature used hereafter and the
laboratory procedures in cell culture, molecular genetics, and
nucl~ic acid chemis-ry and hybridization described below are
those well known and commonly employed in the art. Standard
techniques are used for recombinant nucleic acid mekhods,
polynucieotide synthesis, cell culture, and transgene
incorporation (e.g., lipofection protocols). Generally
W094J0~569 2 1 ~ ~ 3 1~ PCT/US93/~587
enzymatic reactions, oligonucleotide synthesis, and
purification steps are performed according to the
manufacturer's specifications. The techniques and procedures
are generally pexformed according to conventional methods in :
the art and various general references which are provided
throughout this document. The procedures therein are believed
to be well known in the art and are provided for the
convenience of the reader. All the information contained
therein is incorp~rated herein by reference.
Chimeric targeted mice are derived according to
Hogan, et al., Manipulatinq the Mouse_Embr~o: A Laboratory
Manual, Cold Spring Harbor Laboratory (1988) and
. Teratocar~inomas and Embryonic Stem Cells: A Practical
Ap~roach, E.J. Robertson, ed., IRL Pr~ss, Washington, D.C.,
(1987) which are incorporated herein ~y reference.
Embryonic stem cells are manipulated according to
published procedures (Teratocarcin~mas and Embryonic 5tem
Cells_ ~A Practical Approach, E.J. Robertson, ed., IRL Press,
Washington, D.C. (1987); Zjilstra et 2~., Nature 342:435 438
(1989); and Schwartzberg et al., Science 246:79~-803 (1989),
each of which is incorporated herein by reference).
Oligonucleotides can be synthesized on an Applied
: ~ Bio Systems oligonucleotide synthesizer according to
specifications provided by the manufacturer.
25 : It has often been observed that cDNA-based
transgenes are poorly expressed or inappropriately regulated.
Genomic DNA-based transgenes (i.e., constructed from cloned
: genomic DNA sequences) which substantially retain ~he cQntent
and organization of the naturally-occurring ge~e locus are
more likely to be correctly expressed, but are limited in size
by the cloning capacity of bacteriophage and plasmid/cosmid ~ ;
vectors. The yeast artificial chromosome (YAC) i~ a recently ~ :
developed cloning vehicle with a capacity of approximately 2
megabases (Mb~ (Burke et al. (1987) Science 236: 806). The
ability to reproducibly and effici~ntly introduce YACs into
transgenic mic~ can significantly surpass current transgen~
size limit~
2135.~
W094/00569 PCT/US93/~5873
19
In general, the invention is based on the unexpected
finding that large (i.e.~ greater than about 50 kb) cloned
polynucleotides can be efficiently transferred into mammalian
cells, such as ES cells, and are incorporated into at least
one chromosomal location and stably replicated as a segment of
a chromosome. Further, it was found that large cloned
polynucleotides comprising a complete transcriptional unit can
be transferred into mammalian cells (e.g., ES cells~,
incorporated into a chromosomal location, and transcribed to
produce a detectable concentration of RNA transcripts of the
struc~ural gene sequences. It was also found that
unrearranged immunoglobulin genes cloned in YACs can be
,introduced into ES cells and developed to form a transgenic
animal in which productive VDJ rearrangement occurs, and
expression of immunoglob~lin chains also occurs. It has also
been found that large transgenes can be cloned in YACs and,
after isolation from ~ e host yeast cells, efficiently
transferred into mammalian cells (e.g., ES cells3 without
prior separation of the desired transgene sequences from
yeast-derived YAC sequences, and that the presence of such
:~ yeast-derived YAC sequences can be non-interfering (i.e.,
: compatible with efficient transgene integration and
: transcription of a transgene transcriptional unit).
Unexpe tedly, it also has been fou~d that large transgenes,
with or without linked yeastderived YAC sequences, can be
efficiently co-transfected into mammalian cells ~e.g., ES
cells) with unlinked polynucleotides containing a selectable
marker, such as, for example, a ~eoR expression cassette; and
that selection for cells harboring the selectable marker gene
30 and expressing the selectable marker are are highly likely to
also harbor the large transgene species which has been co-
lipofected, thus allowing efficient selection for large
transgene DNA sequences without requiring prior ligation (and
cloning) of a selectable marker gene. The finding that large
DNA segments, such as YAC clones, can be efficiently co-
lipo~ected with a selectable marker gene permits, for the
first time, the construction of transgenic mammalian cells and
.transgenic nonhuman animals harboring large xenogenic DNA
wo g~oos~g 2 ~ 5:~ 1 3 PCT/US93/0587~
segments that are typically difficult to manipulate. Thus,
large polynucleotides, typically 50 to 100 kb in size,
frequently more than 250 kb in size, occasionally more than
about 500 kb, and sometimes 1000 kb or larger, may be
efficiently introduced into mammalian cells. The mammalian
cells may be ES cells, such as murine ES cells (e.g., the AB-l
line), so that the resultant transgenic cells can be injected
into blastocyst~ to generate tran~genic nonhuman animals, such
as transgenic mice or transgenic rats, harboring large DNA
10 transgenes, which are preferably expressed in the nonhuman
transyenic animals. The present methods may also be carried
out with somatic cells, such as epithelial cells ~e.g.,
keratinocytes), endothelial cells, hematopoietic cells, and
myocytes, for example.
Embryonic Stem Cells
If embryonic stem (ES) cells are used as the
transgene recipients, it is possible to develop a transgenic
animal harboring the targeted gene(s) which comprise the
integrated targetlng transgene(s~. Briefly, this technology
involves the introduction of a gene, by nonhomologous
~integration or homologous recombination, in a pluripotent cell
line (eOg., a murine ES cell line) that is capable of
differentiating into germ cell tissue.
: A large transgene can be nonhomoloyously integrated
into a chromosomal location of the host genome. Alternatively,
a homologous targeti~g construct (which may comprise a
transgen~) that contains at least one altered copy of a :~:
~portion of a germline gene or a xenogenic cognate gene
(including heterologous genes) can be introduced into the
3 0 genome of embryonic stem cells . In a portion of the cells,
the introduced DNA is either nonhomologously integrated into a :
chromosomal location or homologously recQmbines with the
endogenous ~i~e., naturally occurring) copy of the mouse g~ne,
- replacing it with the altered construct~ Cells containing the
35 newly engineered genetic sequence(s) ar~ jec:~ed into a host
mouse blastocyst, which is reimplanted into a recipient
female. Some of these embryos develop into chimeric mice that
possess a population of germ cells partially derived from the
~094/00569 2 1`3 5:3 1 ~ PCT/U~93/~873
mutant cell line. Therefore, by breeding the chimeric mice it
is possible to obtain a new line of mice containing the
introduced genetic lesion ~reviewed by Capecchi et al. (1989)
Science 244: 1288, incorporated herein by referenc~).
For homologous targeting constructs, targeting
efficiency generally increases with the length of the
targeting transgene portion (i.e., homology region) that i5
.substantially complementary to a reference se~uence present in
the target DNA (i.e., crossover target seguence). In ~eneral~
targeting efficiency is optimized with the use of isogenic DNA
homology regions, although it is recognized that the presence
of recombinases in cer~ain ~S cell clones may reduce the
.degree of sequence identity required for effici~lt
recombination.
The invention also provides transgenes which encode
a gene product that is xenogenic (e.g., heterol~gous) to a
nonhuman host species. SuGh transgenes typically comprise a
structural gene sequencP expression cassette, wherein a linked
:promoter and, preferablyr an enhanc~r drive expression of
structural sequences encoding a xeno~enic (e.g., heterologous
protein). For example, the invention provides transgenes
: which comprise a mammalian enhancer and at least one human APP
promoter linked to structural sequences that encode a human -~
: APP:protein. Transgenic mice harboring such transgenes
express human APP mRNA(s). Preferably, the polynucleotide
sequen~e encoding the xenogenic (e.g., hetPrologous) protein
is operably linked to cis-acting transcriptional regulatory
regions ie.g., promoter, enhancer) so that a heterologous
protein is expressed in a manner similar to the expression of : :
the cognate endogenous gene in the naturally-occurring
nonhuman animal 7 Thus, it is generally preferab~e to operably
link a ~ransgene structural encoding sequence to
transcriptional regulatory elements which naturally occur in ~ .
-- or near the cognate endogenous gene. However, transgenes
encoding h~terologous proteins may be targeted by employing a
homologous gene targeting construct tar~eted adjacent to the
endogenous transcriptional regulatory sequences, so that the
operable linkage of a regulatory seq~ence occurs upon
W~94/00569 2 1 3 5 8 ~ ~ ~ PCT/US93/05~
integration of the transgene into a targ~ted endogenous
chromosomal location of th~ ES cell.
Selectable Marker Genes
A selectable marker gene expression cassette
typically comprises a promoter which is operational in the
targeted host cell ~e.g., ES cell) linked to a structural
sequence that encodes a protein or polypeptide that confers a
selectable ph~notype on the targeted host cell, and a
polyadenylation signal. A promoter included in an Pxpression
cassette may be constitutive, cell type-specific, stage-
specific, and/or modulatable (e.g., by hormones such as
glucocorticoids, MMTV promoter), but is expressed prior to
and/or during selection. An expression cassette can
optionally include one or more enhancers, typically linked
upstream of the promoter and within about 3-10 kilobases.
However, when the selectable marker is contained in a
homologou targe~ing ccnstruct, homologous rec~mbination at
the targeted endogenous site(s) can be chosan to place the
selectable marker structural se~uence downstream of a
functional endogenous promoter, and it may be pcs~ible for the
targeting construct replacement region to comprise only a ;:;
structural sequence encoding the sele~table marker, and rely ::
upon an endogenous promoter to drive transcriptio~ (Doetschman
et al. (1988) Proc. Natl Acad. Sci. (U.S.A.l 85: 8583,~:
incorporated hsrein by referencP). Similarly, an endogenous
enhancer located near a targeted endogenous site may be relied
on to enhance transcription of selecta~le marker gene
sequences in enhancerless constructs. Preferred expre5sion
cassektes of the invention encode and Pxpress a selectable
drug resistance marker andJor a HSV thymidine kinase enzyme.
Suitable dru~ resistance genes include, for example: gpt
~xanthine-guanine phosphoribosyltransferar-e), which can be
selected for with mycophenolic acid; neo (neomycin
phosphotransferase), which can be selected for with G418,
hygromycin, or puromycin; and DFHR (dihydrofolate reducta~e) t
which can be selected for with methotrexate (~ulligan and Berg
(1981) Pro~. Na~l. Acad. Sci. (U.S.A.~ 78: 2072; Southern and
Berg (1982) J. Mol. Ap~l. Genet. 1: 327; which are
213~3~ 3 ` ~:
W094/0056~ PCT/US93/05~73
incorporated herein by ref~rence). Other suitable selectable
markers will be apparent to those in the art.
Selection for correctly co-lipofected recombinants
will generally employ at least positive selection, wherein a
selectable marker gene expression cassette encodes and
expresses a functional protein (e.g., neo or gpt) that confers
a selectable phenotype to targeted cells harboring the
endo~enously integrated expression ca~sette, so that, by
addition of a selection agent (e.~ 418, puromycin, or
mycophenolic acid~ such targeted cells have a growth or
~ survival advantage over cells which do not have an integrated
expression cassette. Further guidance regarding selectable
.marker genes is available in several publications, including
Smith and Berg ~1984) Cold Sprinq Harbor Sym~. Ouant. Biol.
49: 171; Sedivy and Sharp (19~9) Proc. Natl. Acad. Sci.
(U.S.A.3 86: 227; Thomas and Capecchi (1987) op.cit., which
are incorporated herein by reference.
Larqe Xeno~enic Polynucleotides
Large polynucleotides are usually cloned in YAC
vectors. For example, human genomic DNA libraries in YAC
cloning vectors can be screened (e.g., by PCR or labeled
polynucleotide prob~ hybridization) to isolate YAC clones
spanning complete genes of interest ~e.g., a human APP gene, a
human immunoglobulin heavy cha~n locus or light chain locus)~
25 ~ or ~ignificant portion~ of such genes which comprise a
complete transcriptional unit. Methods f~r making YAC
libraries, isolating desired YAC clones, and purifying YAC DNA
are described in the art (U.S. Pa~ent 4~889,806; Burke et al.
(1987) Science 236- 806; Murry et al. (1986) Cell 45: 529,
incorporated herein by reference~
Once a desired YAC clone is isolated, and preferably
deproteinized, yeast-derived YAC sequences may optionally be
completely or partially removed by digestion with one or more
restriction enzymes which cut outside the desired cloned large
trans~ene sequence; yeast-derived sequences are separated from
thP clo~ed insert se~uences by, for example, pulsed gel
electrophoresis. Preferably, a complete unrearranged YAC
W094/005~9 2 1 3 ~ 3 1 ~ PCT/US93/05
24
clone is used as a large transgene or large homologous
targeting construct in the methods of the invention.
In one aspect, preferred YAC clones are those which
completely or partially span structural gene sequences
selected from the group consisting of: human APP gene, human
immunoglobulin heavy chain locus, human immunoglobulin light
chain locus, human al-antitrypsin gene, human Duchenne
muscular dystrophy gene, human Huntington's chorea-associ2ted
loci, and other large structural genes, preferably human
g~nes.
Preferred YAC cloning vectors are: a modified pYAC3
vector ~Burke et al. (19~7) o~.cit., incorpora~ed herein by
. . .
.referen~e), pYACneo (Traver et al. (1989) Proc. Natl. Acad.
ci. (U.S.A.) 86 5898, incorporated herein by reference), and
pCGS966 (Smith et al. (1990) Proc. Natl. Acad._Sci. (U.S.A.
87: 8242, incorporated herein by reference).
Cationic Li~ids
Lipofection, and various variations of its basic
methodology, have been described previously in th~ art ~U.S.
Patents 5,049,386; 4,946,787; and 4,897,355) and lipofection
reagents are now sold comme~cially (e.g., "Trans~ectam9' and ~:~
; "Lipofectin"). ~`~
Cationic and neutral lipids that are suitable for ::
; efficient lipofection of DNA have been described in the art.
~ipofection may be accomplished by forming lipid complexes
with DNA made according to Felgner (W091/17424, incorporated
: herein by reference~ and~or cationic lipidization ~W091/16024; ~.
incorporated herein by reference). Various lipofection
protocols described in the art may be adapted for co- ~-
lipofection according.to the invention; for example but not ~;
limitation, general lipofectlon protocols ar~ described in ~he
fo~lowing references which are incorporated herein: Behr et
al. (1989) Proc. Natl. Acad. Sci. Lu.s.A~! 86: 6982; Demeneix
et 1. (1991) nt. J. Dev. Biol. 35: 481; Loe~fler et al,
. ~1990~ J. Neurvchem. 54; 1~12; Bennett et alO (1992) Mol.
~21~ 41: 1023; Bertling et al. (1991) ~otechnol. Appl.
Biochem. 13: 390; Felgner et al. (1987) Proe. Natl. Acad. Sei.
(U.S.A.) 84: 7413; Felgner and Ringold (1989) Nature 337: 387;
W094/00~69 2 i 3 5 3 1 3 PCT/US93/05873
Gareis et al. (1991) Cell. Mol. Biol. 37: 191; Jarnagin et al.
(1992) Nucleic Acids Res. 20: 4205; Jiao et al. (1992) Exp.
Neurol. 115: 400; Lim et al. (1991) Circulation 83: 2007;
Malone et al. (1989) Proc. Natl. Acad. Sci. ~U.S.A.~ 86: 6077;
Powell et al. (1992) Eur. J. Vasc. Sura. 6: 130; Strauss and
Jaenisch (19~2) EMBO J. 11: 417; and Leventis and Silvius
(1990) Biochim. Biophvs. Acta 1023: 124.
Newer polycationic lipospermines compounds exhibit
broa~d c:ell ranges ~Behr et al., (1989) o~.cit. ) and DNA is
coated by these compounds. In addition, a combination o~
neutral and cationic lipid has been shown to be highly
efficient at transfection of animal cells and showed a broad
.spectrum of effectiveness in a variety of cell lines (Rose et
al., (1991) BioTechni~ues 10:520)
15- A lipofection complex (or a cationic lipidized DNA
complex) i5 defined as the product made by mixing a suitable
cationic lipid composition with one or more polynucleotide
peci~s, such as a large transgene and a selectable marker
gene expression cassette. Such a co-lipofection complex is
characterized by an înteraction between the polynucleotides
and lipid components that results in the formation of a co-
lipofection complex that, when contaoted with mammalian cells
under suitable conditions (e.g., buffered saline or ES cell
medium with or without serum, 20-45C), results in
incorporation of the polynucleotides into the ma~malian cells;
preferably thP mam~alian cells are ES cells, such as murine ES
cells.
Various suitable cationic lipids may be used, either
a}one or in combination with one or more other cationic lipid
species or neutral lipid species. Generally, sl~itabl~
cationic lipids comprise a positively charged head group (one
or more charges) and a covalently linked fatty acid tail. A
suitab}e cationic lipid composition is "Trans~ectam" ~ProMega,
~adison, WI) compri5ing the cationic lipid-polyamine
dioctad~cylamidoglycyl spermidine (DOGS). DOTMA is a
preferred lipid known as N-(2,3-di(9-~3~-octadecenyloxy))-
prop-1-N,N,N trimethylammonium chloride. DNA--DOTMA complexes
made essentially from DOTMA and DNA. Other axamples of
wo g4/00569 2 1 3 5 3 i 3 PCT/US93/0587~
suitable cationic lipids are: dioleoylphosphatidylethanolamine
(PtdEtn, DOPE), dioctadecylamidoglycyl, N-trimethylammonium
chloride, N-trimethylammonium methylsulfate, DORI and DORI-
ether (DORIE). DORI is N-[1-(2,3-dioleoyl)propyl]-N,N-
dimethyl-N-hydroxyethylammonium acetate and DORIE is N-[l-
(2,3~dioleyloxy~propyl]-N,N-dimethyl-N-hydroxyethylammonium
acetate. DOTAP is N- r 1- ( 2,3-dioleoyloxy)propyl]-N,N,N-
trimethylammonium methyl sulfate; this lipid has ester rather
than ether linkages and can be metabolized by cells.
lQ Optionally, one or more co-lipids may be combined
~ with a suitable cationic lipid. An optional co-lipid is to be
understood as a structure capable of producing a stable D~A-
lipid complex, alone with DNA, or in combination with other
lipid components and DNA, and is preferably neutral, although :
it can alternatively be positively or negatively charged.
Examples of optional co-lipids are phospholipid-related
materials~ such as lecithin, phosphatidylethanolamine,
lysolecithin, lysophosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, sphingomyelin,
cephalin, cardiolipin, phosphatidic acid, cerebrosides,
dicetylphosphate, dioleoylphosphatidylcholine ~DOPC),
dipalmitoyl-pho~phatidylcholine (~PPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG), diolsoyl- :
phosphatidylethanolamine (DOPE), palmitoyloleoy- ~ :
lphosphatidylcholine (POPC),palmitoyloleoyl~
phosphatidylethanolamine (POPE) and dioleoyl-
phosphatidylethanolamine 4-(N-maleimidomethyl) ~ :~
cyclohexane-~-carboxylate ~DOPE-mal). ~dditional
non-phosphorous containing lipids are, e.g.,stearylamine,
dodecylamine, hexadecylamine, acetyl palmitate,
glycerolricinoleate, hexadecyl stereate, isopropyl myristate,
amphoteric acrylic polymers, triethanolamine-lauryl sulfate,
alkyl-aryl sulfate polyethyloxylated fatty acid amides,
dioctadecyldimethyl ammonium bromide and the like.
G~nerally, to form a lipofection complex, the
polynucleo ide(s) i5/are comblned according to the teaching~
in the art and herein with a suitable cationic lipid, in the
2i35~13
W094/00569 PCT/US93/~Sg73
presence or absence of one or more co-lipids, at about pH 7.4-
7.8 and 20-30C. When more than one species of polynucleotid
are combined in a lipofection complex it may be referred to
herein as a co-lipofection complex. A co-lipofection complex
yenerally compri es a large polynucleotide ta transgene or
homologously targeting construct) and a selectable marker gene
expression cassette. The co-lipofection complex is
administered t~ a cell culture, preferably murine ES cells,
under lipofection conditions as described in the art ~nd
herein.
General Methods
A preferred method of the invention is to transfer a
.sub~tantially intact YAC clone comprising a large heterologous
transgene into a pluripotent stem cell line which can be used
to generate transgenic nonhuman animals following injection
~ into a host blastocyst. A particularly preferred embodiment ~-
o~ the inventi~n is a human APP gene targeting constrUct co-
lipofected with an unlinked positive (e.g., neo~ selection
expression cassette. The human APP transgene is transferred
into mouse ES cells (e.g., by co-lipQfection with nQo) under
~onditions suitable for the continued viability of the co-
: lipofected ES cells. The lipofected ES cells are culturedunder selective conditions for positive selection (e.g., a
selective concentration of G418). Selected cells are then ::~
verified as having the correctly targeted transgene
recombination by PCR analysis according to standard PCR or . :
Sou hern blotting methods known in the art (U.S. Patent
4,683,202; Erlich et al., (1991) Science 252: 1643, which are ~:
incorporated herein by referenre~.
Correctly targeted ES cells are then transferred
into suitable blastocyst hosts for generation of chimeric
transgenic animals according to methods known in the art
(Capecchi, M. (1989) TIG 5:70; Capecchi, M. (19B9) Sc~ienc~e
244:1288, incorporated herein by reference). Several studies
have already us d ~CR to successfully identify the desired
transfected cell lines ~Zimmer and Gruss (1989) Nature 33~:
150; Mouellic et a~. (1990) Proc. Natl. Acad. Sci. (U.S.A~l
87: 4712; Shesely et al. (1991~ Proc. Natl. Acad. Sci. US~ ~8:
W~94~00569 2 1 3 5 3 1 3 PC~/USg3/05~--
28
429~, which are incorporated herein by reference). This
approach is very effective when the number of cells receiving
exogenous ~argeting transgene(s) is high (i.e., with
electroporation or lipofection) and the treated cell
populations are allowed to expand (Capecchi, M. (1989) -
op.cit., incorporated herein by referencP).
For making transgenic non-human animals (which
includ~ homologously targeted non-human animals), embryonal
stem cells (ES cells) are preferred. Murine ES cells, such
lQ as AB-l line grown on mitotically inactivP SNL76/7 cell feeder .
layers (Mc~ahon and Bradley, Cell 62:1073-1085 (1990))
essentially as desrribed (Robertson, E.J. (1987) in
Teratocarcinomas and Embryonic ~tem Cells: A Practical ~ :
Approach. E.J. Robertson, ed. (Oxford: IRL Press), p. 71-112)
may be used for homologous gene targeting. Other suitable ES
lines in~lude, but are not limited to, the E14 line (Hooper et
alO ~19~7) Nature 325: 292-295), the D3 line (Doetschman et
al. (1985) J. ~mbryol. Exp. Mor~h. 87: 27-453, and the CCE
line ~Roberts~n et al. (1986) Nature 323: 445-4481. Rat,
hamster, bo~ine, and porcine ES cell lines are al~o a~ailable
in the art for producing non-murine transgenic non-human
animals bearing a human APP gene sequence. The success of
generating a mouse line from E5 cells bearing a large
transgene or specifically targeted genetic alteration depends
on the pluripotence of the ES cells (i.e., their ability, once
injected into a host blastocyst, to participate in
embryogenesis and contribute to the germ cells of the
resulting animal). The blastocysts containing the in~ected ES
cells are allowed to develop in the uteri of pseudopregnant
nonhuman females ~nd are ~orn as chimeric mice. The resultant
transgenic mice are chimeric for cells having the large
transgene(s~/homologous targeting constructs and are
backcrossed and screened for the pr~senc. of the transgene~s)
andlor YAC sequences by PCR or Southern blot analysis on tail
biopsy DNR of offspring ~o as to identify transgenic mice
heterozygous for the transgene(s)/homo~ogous targeting
constructs. By performing th~ appropriate cros~es, it i5
possible to pro~uce a transgenic nonh~man animal homozygous
213531~
~W094/00~69 . - PCT/US93/0~873
29
for multiple large transgenes/homolo~ous recombination
constructs, and optionally also for a transgene encoding a
different he~erologous protein. Such transgenic animals are
satisfactory experimental models for various diseases linked
to the transferred transgene~s).
- For performing certain types of studies, trans~enic
rats harboring and expressing a human APP sequence may be
preferred. :
EXPERIMENTAL_EXAMP~ES .-~
EXAMPLE 1
Materials and Transfection Calibration :
Pilot experiments to determine toxicity levels,
optimum DNA:lipid ratios, etc. were performed with ] (2kb
PGKneo cassette in pUC) and with pYPNN (a modified pYACneo
vector containing a PGKneo cassette in place of the SV40-neo ~
cassette in the acentric arm. ~.
: The YAC used in these calibration experiments was an
85kb human IgH gene fragment cloned into a modified pYACneo
vector (EcoRI >NotI loning site alteration). The YAC was
thus lOOkb in length including the vector arms.
: DOTMA (Lipofectin, BRL, Bethesda, MD) and DO~S
(Transfectam, ProMega, Madison, WI) were tested as cationic
ipids. Fig. 1 shows chemical structures of representative
cationic lipids which can be used to form co-lipofection
~co~ lexes. ES cell toxicity curves were performed for each.
: : Toxic effects could be seen with DOTM~ at the 30~g/ml level~
DOGS sho~ed no toxic effect-~ at the 60~g/ml level.
: Optimal DNA:lipid ratios were determined for both
lipids, using pGKneo as reporter. Optima for DOTM~ and DOGS
were at 1:10 and 1:50 (DNA:lipid, wt:wt~, respectively. :
Optimal ES cell number for ~ach lipid was
determined. Optimal incubation times and conditions were .
determined (how long and in what buffer gave maximal
trans~ection with ~oth DNA:lipid complexes). Pilot studies
indi~ated that 3-5 x 106 ES cells incuba~ed with ~ 1:50
mix~ure o~ DNA:DOGS in serum free DMEM for 3-4 ~ours at 37C
yielded the maximal number of transfectants. T~ese conditions
were routinely used for the YAC lipofertion experiments.
W~94/00569 2 1 3 ~ ~ 1 3 PCT/US93~0~
Neor was pro~ided by an unlinked plasmid carrying a
PGXneo cassette, either eem or pYPNN, in a co-lipofection
procedure. DNA:plasmid molar ratios varied from 1:4 to 1:20.
An equal wPight of carrier DNA (sheared herring sperm) was
also added.
Yeast blocks were prepared at 3.5 x 109 cellstml in
0.67% low gel temp agarose. The YAC was isolated by PFGE.
Outer lan2s were stained with EtBr and aligned with the
unstained portion. A thin slice containing the YAC was :
isolated using a brain knife. Approximately l~g of YAC was
recovered in ~pproximately 10mls of gel. The gel was washed
extensively in g~lase buffer (40mM bis-Tris pH 6.0, lmM EDTA,
.40mM NaCl), melted at 70C, cooled tG 40~C, and incubated with
10U g~lase (Epicentre Technologies, Madison, WI) overnight.
After digestion, pYPNN or picenter were added at a
typical molar ratio of 1:4 (YAC:plasmid)~ An equal weight of
sheared herring sperm DNA was added as carrier. TAe agarase
dig~stion mix ~ontaining approximately 100 mg of the YAC wa~
directly incubated with Transfectam at optimal DNA:lipid
ratios for 30 minutes at room temperatures. No polyamines
were added.
ES cells were washed, trypsinized, and resuspended
in serum free DMEM. Nine mls of cell suspension containing 3
x 106 ES cells (and about 105 feeder cells) were plated onto a
60mm petri plate tnot tissue culture plastic~. About 1 ml of
the DNA-lipid mix was added to the cells in DMEM and incubated
at 37C for 3-4 hours. The cells were then collected in DMEM
FBS, and plated at 106 per 100mm tissue culture dish. G418
selection was applied 24 hours later, and colonies picked
after about 10 days.
Typically, 1-2~g of YAC was used per experiment.
Thus, about 10-20 separate lipofections were performed on a
given day. Generally, several hundred G418 resistant clones
- were picked~ of which at lPast 1-2% contained speci~ic YAC
derived sequence. Of these, approximately 10% carry the
intact YAC, as determined by fine structure south~rn blotting
using probes covering the entir~ YAC ins~rt, PF~E southern
analysis, and PCR analysis.
W094/0~569 2 1 ~ 5 3;1 3; P~T/US93/05873
31
EXAMPLE 2
Production of mice carryin~_a YAC encodinq human AmYloid
Precursor Protein
Preparation of the APP YAC DNA: A 650kb human
genomic fragment containing the full length APP gene was
isolated as a yeast artificial chromosome (YAC) in a yeast
host strain (clone #B142F9) from the Washington University YAC
library (available from Center for Genetics in Medicine
Librarian, Washington University School of Medicine, St.
Louis, Missouri). The yeast strain was grown to late log
phase in AHC medium, resuspended in 0.67% low gelling
e~perature agarose (SeaPlaque, FMC Corp.) at 3.5 x 109
.cells/ml, and cooled in block formers (Bio~Rad). Intact yeast
chromosomal DNA was prepared as follows. Thirty 250~1 blocks
of B142F9 ~ells were swirled in a 150 mm petri dish containing
50ml~ of YSS ~YSS: 4mg/ml NoYozyme 234 (Novo Nordisk), lM
sorbitol, lOOm~ EDTA, 50mM Potassium Phosphate, pH 5.5) at
:37C for 30 minutes. The blocks were wa~hed once in TE (10 mM
Tris pH 7.5, lmM EDTA) and swirled in 50 mls o~ LDS ~LDS: 1%
lithium dodecyl sulfate, 1~ sarcosyl, 100 mM E~TA~ for 30 to
60 minutes at 37C. The LDS was removed with a sterile 50ml
pipette, and the blocks swirled in 50mls of fresh LDS
overnight. The blocks were rin ed several times in 50mM EDTA,
and stored at 4~C in 50mM EDTA. 100~1 segments of the
prepared blocks were loaded into each well of a 1~ low gelling
temp agarose gel in 0.25X TBE 114 x 25cm CHEF gel, 10 well gel
comb, Bio-Rad). The yeast chromosomes were separated by
pulsed ~ield gel electrophoresis (CHEF-DRIL, Bio-Rad) using a
60 second switch time at 200V and 14C for 4~ hours~ The end
lanes of the gel were removed, stained for 2 hours in 0.5~g~ml
ethidium bromide, and the separated chromosomes visualized on
a W transluminator. Under these condition-~, the 650kb YAC
was separated from the nearest endogenous yeast chromosome ~y
- 3-5mm. The gel segments were notched to indicate the location
of 650kb YAC, and the segments realigned with the remainder of
the gel. A 2 mm wide slice of the gel containing the 650kb
YAC was isol~ted using a brain knife ~Roboz Surgical
Instrument Co) and stored in 50mM EDTA at 4 C. Approximately
W094/~0~69 2 1 3 5 3 1 ~ PCT/US93/05~ ~
5 ~g of YAC DNA was isolated in approximately 10 mls of gel.
The agarose slice containing the YAC DNA was equilibrated in
gelase buffer (40mM bis-Tris pH 6.0, lmM EDTA, 40mM NaCl),
melted at 70C for 20 minutes until completely liquid, and
cooled to 45C. Gelase (25 U, Epicentre Technologies,
Madison, WI) was added and the molten agarose mixture was
incubated at 45~C for 90 minutes to liquify the D~A-agarose
mixture.
Introduction of the APP YAC into ES cells
Embryonic stem cells ~AB-l) were washed in PBS,
trypsinized, and resuspended in serum free ES medium (DMEM, lX
glutamine, pen/strep, 1 mM 2-mercaptoethanol, lX NEAA).
.Approximately 5 x ~o6 cells in 9 ml of serum-free ES cell
suspension were placed into each of ten 60mm petri (non-tissue
culture treated) dishes. A linearized plasmid containing a
selectable marker (PGKneoA+R, containing the PGK promoter
fused to the neomycin resistance gene; R~dnicki et al. (1988)
Mol. Cell. Biol. 8: 406; Rudnicki et al. (1989) Biochem~ Cell.
Biol. 67: 593, incorporated herein by reference) was added to
~0 1 ml of gelase treated YAC DNA at a 2:1 (plasmid:YAC~ molar
ratio. A cationic lipid (Transfectam, ProMega, Madison, WI)
was added a~ a 50:1 (Transfectam:DNA) weight:weight ratio, the
mixture was gently inverted once to mix and incubated ~t room
temperature for approximately 30 minutes. One ml of the
D~A:lipid mixture was then added to each 60mm dish of ES cells
and incubated for 4 hours in a 37C CO2 incu~ator. The cells
were then transferred to a sterile 250ml bo~le, an equal
volume of ES medium ~as above, but including 15% fPtal calf
serum3 was added. Cells were removed from the dishes with
gentle pipetting and combined with an e~ual volume of ES
medium containing 15 percent fetal calf serum~ This cell
suspension was transferred in 15 ml aliquots to 100mm tissue
culture plates containing mitotically inactivated SNL75/7
fibroblast feeder cells (McMahon and Bradley (1990~ Cell ~:
1073, incorporated h~rein by re~erence~ and returned to the
ki~sue culture incubator for 24 hours~ After 24 hours, the
medi~m was changed to ES medium con aining 10 percent fetal
calf serum and 400~y/ml G418, and refed every 48 hours. After
~1~53~
.WO9~/0~569 - PCT/US93/0~873
7 days, a t~tal of 366 G418 resistant colonies were counted.
Each of 240 colonies were individually transferred to a well
of a 96-well microtitre dish containing 50 ~1 of 0.25 percent :
trypsin in calcium-free magnesium-free PBS. After 15 minutes,
50 ~1 ~f serum-containing medium was added, the colony
dissociated by trituration, and the cell suspension was
transferred to duplirate 96-well plates containing culture
medium and feeder layers (as supra) . A~ter 4~ 5 days, one set
of dishes was frozen according to conventional methods
~Ramixez-Solis et al. Guide to Techniques in Mouse DevPlop~ent
(199~) Methods in EnzYmsloav, incorporated herein by
reference). Cells were dissocia~ed in 50 ~1 trypsin and mixed
. with 50 ~1 of Freezing Medium (20% DMSO, 20% fetal calf serum
in DMEM3; 100. ~1 of sterile silicon oil was layered on top of
the cell suspension in each well, and the plates were placed
in Styrofoam containers and frozen at -~0C.
Identification of ES clones containina APP sequences
The other set of microtitre dishes containing
lipofectant ES clones was used to prepare DNA for PCR
analysis. ~0~1 of lysis buffer (50mM Tris pH ~.0, 200mM ~aCl,
25mM EDTA, 0.2% SDS, lmg/ml Prot~inase K) was added to each
well rRamire2-Solis et al. (1992~ Anal. Biochem. 201: 331,
i~corporated herein by reference). After an overnight
incubation at 55~C, S~l of 2.5M NaCl and 95 ~1 of 100% ~tOH
were added to each well. The dishes were gently swirled at
room temperature for 60 minutes to precipitate the D~A. The
wells were then rinsed 5 times with 70~ EtOH, and dried at
37C. The DNAs were resuspended overnight in 100~1 of H2O at
37C in a humidified incubator.
The individual DNA samples were pooled in rows and
colu~ns for PCR (Fig. 2), and the pools analyzed for APP
sequences by PCR, using the following primers ~adapted from
Fidani et al., Human Molecular Genetics 1, 165-16~, 1992):
APP-PA: 5'-GCT TTT GAC GTT GGG GGT TA-3^
. APP-PB2: 5'-TTC GTG AAC AGT GGG AGG GA-3'
APP-17A: 5l-ATA ACC TCA TCC AAA TGT CCC C-3
~PP-17B: 5-GTA ACC CAA GCA TCA T&G AAG C-3
wo g4/00569 2-1 3 5,~ 1 3 P~T/US93/OSY-
~4
APP-PA/PB2 denote primers specific for the promoter
region of the human APP gene, APP7A/7B are specific for exon
7, and APP17A/17B are specific for exon 17.
PCR analysis of the pools indicated 42 clones which :
potentially carried both promoter and exon 17 sequences
(Fig. 3). PCR analysis of the 42 clones individually
indica~ed 6 clones (#s 23, 24, 176, 213, 219, 230) containing
both promoter and exon 17 sequences (Fig. 4). These clones
were expanded in culture, and frozen in vials in liquid
nitrogen. The~e cells were mounted in agarose blocks for PFGE
analysis, ~nd harvested for RNA isolation.
Structural~Analysis of E5 clones containinq APP sequences
The integrity of th~ APP YAC carried by ES clones
was first estimated using a rare cutter fingerprint technique
as follows. Restriction enzymes which infrequently cut human
DNA were used to define patterns of fragments which hybridized
to a human alu fragment probe. Rare cutters often contain the
dinucleotide Cp~, and mammalian cells often methylate Cp&
- dinucleotides rendering most restriction sites containing them
refractory to digestion. However, yeast cells do not
methylate CpÇs, and thus the pattern of CpG containing
restriction sites in a given fragment will depend on whet~er
the fragment is propagated as a YAC in yeast or within a
mammalian cell line. Thus, only rare cutter enzymes without
CpG in ~heir recognition sequence were used to generate a
diagnostic pattern of alu-containing fragments from the YAC.
Bl42F9 agarose blocks were digested completely with
the res~riction enzymes Sfi I, Pac I, Swa I, Pme I, and ~pa I,
and analyzed by PFGE Southern blotting using total human DNA
as a probe for Alu fragments (Fig~ 5~. The pattern of bands
generatefi by Sfi I digestion was used as a reference pattern,
since there was an even distribution of bands from 30 kb to
220 kb. If a YAC were to integrate intact into ES cells, Sfi
I digestion would be expected to generate a similar pattern of
bands~ with the exception of the terminal fragm~nt~. The
terminal fragm~nts could be easily identified ~y reprobing the
Sfi I digest with pBR322 sequences. In this case, the entire
set of fragments were ordered by par~ial digest mapping.
W094/0~569 2 1 3 5 3 1 ~ PCT/US93~05873
Briefly, B142F9 blocks were digested with a range of Sfi I
concentrations, separated by PFGE, and probed with either the
2.5 kb (trp ~rm specific) or the 1.6 kb (ura arm specific) Bam
HI-Pvu II fragment of pBR322, such that at a particular level
of partial digestion, a ladder of bands were generated. Each
band differed from its nearest neighbor by the distance to the
neighboring Sfi I sites (Fig. 6).
The six ES lines were digested to completion with
Sfi I and probed under high stringen~y conditions with total
human ~NA. Of the six lines, only thre~ (24, 176, 230) showed
a pattern of bands consistent with the reference pattern from
the APP Y~C. The rare cutter fingerprinting approach does not
. require any knowledge of the se~uence of the fragment cloned
in the YAC, and is thus applicable to the analysis of any YAC
containing human DNA. Further, if probes for repetitive
elements from other species which were not found in the target
mammalian cell line were available, this approach could be
used to analyze the structure of YACs containing other foreign
DNAs into other mammalian cell lines.
Transcriptional analysis of APP YAC containinq ES clones
The six ES lines were analyzed for transcription by
PCR. Total RNA was prepared from Pach cell line by standard
guanidium isothiocyanate/lithium chloride procedures (Sambrook
et al., Molecular Cloning). Complementary DNA was prepared
using an oligo-dT primer, and the cDNAs were analyzed by PCR
for splice products of the human APP gene using the PCR
primers deri~ed from exons 6 and 9 as depicted below (adapted
from Golde et al., Neuron 4 253-267, 1990). To exclude
inappropriate amplification of mouse APP cDNAs, the 3' ~nd
nucle~tide of each oligo was choseFI such that it was specific
for the human cDNA se~uence and not the corresponding mouse
cDNA sequence. PCR oligos specific for mouse APP cDNA were
also prepared.
human APP sp~cific oligos:
APP-HASl: 5'-CAG GAA TTC CAC CAC AGA GTC TGT GGA A-3'
~PP-HAS2: 5' CAG GAT CCG TGT CTC GAG ATA CTT GTC A~3'
,
2~35313
W094~00569 - PCT/US93/05P-'
36
mouse APP specific oligos:
APP-MASl: 5'~CAG GAA TTC CAC CAC TGA GTC CGT GGA G-3'
APP-MAS2: 5'-CAG GAT CCG TGT CTC CAG GTA CTT GTC G-3'
Clones 24, 176, and 230 showed the expected PCR
bands indicative of alternatively spliced human APP
transcripts encoding the 770, 751, and 695 amino acid forms of
the protein (Fig. 7). Clones 23, 213, and 219 did not contain
PCR detectable txanscript, and also serve~ as a negative
control, indicating that the human APP specific oligos did not
amplify bands from mouse APP transcripts endogenous to the ES
cell lines. Further, the RT-PCR analysis confirmed and
validated the resulks of the rare cutter fingerprint analysis
.which predicted that clones 24, 176, and 230 contained the
intact YAC whereas clones 23, 213, and 219 did not.
~uantitative anal~sis of APP transcript in ES cells
Since RT-PCR analysis is qualitative, RNase
protection assays are used to quantitate the alternatively
spliced human APP transcripts in the ES lines. The RNase
probe was generated by cloning the 310 bp RT-PCR product as an
E~o RI-Bam HI fragment into the vector pSP72 (Fig. 8). The
resultant plasmid~ pHAPP, is linearized at the Hpa I site, and ~-:
: :antisense transcript is generated from the SP6 promo er.
RNase protection assays are performed according to standard
protocols (Sambrook et al., Molecular Cl~ning~.
~lterna~ively, Sl nuclease protection analysis is
: used to quantitate the transcripts. pHAPP is digested with
Xho I and Hpa I to release a 446 bp fragment. The double
stranded fragme~t is end-labelled with Klenow, denatured,
hybridized to ~NA samples from the ES lines carrying human APP
sequences, and Sl analysis performed according to standard
m~tho~s (Sambrook, et al., Molecular Cloning~.
In addition, expression of human APP protein can be
determined by immunoprecipitation of human APP using
antibodies specific for human APP protein from ES cell lin~s
and tis~ue of tran5qenic animals. Such ~ntibodies may also
permit direct detection o~ human APP by standard
immunohistochemical analysis of tissue sections
Anal~sis of human APP ex~ression in transqenic mice
2135~
- W094/00569 PCT/US93/05873
The qualitative and quantitative assays described
above are also applicable to the analysis of the human APP
gene in tissues of the transgenic mice derived from these ES
lines.
Production of chimeric founders and qermline transmission of
he_APP YAC
Clones 23, ~13 and 219 were injected into
blastocysts to generate chimeric founder animals as described
(~obertson, ed. Teratocarcinomas and Embryonic Stem Cells).
1~ Founders ara bred to wild type mice to generate F1 animals
carrying the ~PP YAC.
Mou e models of Alzheimer's Disease
~verexpression of the wild type human (or mouse) APP
protein may result in phenotypes characteristic of Alzheimer's
Dlsease, including neurofibrillary tangle formativn, plaque
formation, and neurological dysfunction. Toward that end,
di~ferent mouse lines expressing the~APP YAC can be interbred
to increase the number, and hence expression, of human APP
g nes.
Alternatively, mutations identified as associated
with Familial Alæheimer's Disease (codon 717:V->I, F, or G)
and/or Hereditary Cerebral Hemorrhage with Amyloidosis, Dutch
type ~HCHWA-D, codon 693:glu->gln) may be introduced into the
human APP gene contained on the YAC using standard yeast
molecular genetic techniques such as in~ertion/eviction of a
plasmid carrying a subcloned fragment of the APP gene
containin~ the mutation, or by oligonucleotide directed
transformation of yeast (Guthrie and Fink~ Guide to Yeast
Molecular Genetics and Molecular Biology). YACs ~.arrying : .
these mutated APP genes can be introduced into transgenic mice
using procedures described a~ove. O~her naturally-occurring
human APP disease allele sequences also may be used, including
but not limited to those described at codon 692 (Ala -> Gly) t
- codon 692 ~Glu -> Gln or Gly), and codon 713 (Ala ~> Val) and `~
others that are described (Hendricks et al. (1992) Nature
Genet. 1: 218; Jones ~t al. (1992) ature Genet. 1: 306; Hardy
et alO ~1992) ~ature Genet. 1: 233, Mullan et a}. (1992)
W~94/00569 2 1 3 5 3 1 ~ PCT/~Sg3/05~ -
38
Nature Genet. 1: 505; Levy et al. (1990) Science 248 1124,
incorporated herein by reference).
EXAMPLE 3
Transqenic Mice ExPressinq a Human Immunoqlobulin Gene Cloned
in a Yeast Artificial Chromosome
An 85 kb fra~ment of the human heavy chain
immunoglobulin ge~e was cloned as a YAC, and embryonic stem
cell lines carrying substantially intact, integrated YACs were
derived by colipofection of the YAC and an unlinked
selectable marker. Chimeric founder animals were produced by
blastocyst injection and offspring transgenic for the YAC
~lone were obtained. Analysis of serum from these offspring
for the presence of human heavy chain demonstrated expression
of the YAC borne i~munoglobulin gene fragment. Unlike fusion
of yeast spheroplasts with mammalian cells, no yeast
chromosomal DN~ need be introduced by the co-lipofection
method a6 the YAC(s) are typically first isolated ~rom yeast
chromosomes by a separation method, such as pulsed field gel
electrophoresis (PFGE). The YAC was introdu~ed into ES cells
by co-lipofection with an unlinked selectable marker plasmid.
The co-lipofection strategy differs from lipofection of
modified YACs in that retrofitting vectors do not need to be
constructed or recombined into the YAC, and YACs carried in
recombination deficient hosts can be used. In contrast to
microinjection approaches, it is likely that larger YACs can
be introduced by co-lipofection than microinjection due to the
technical hurdles in purification o~ intact YAC DNA and
because of the high shear forces imparted on the DNA during
microinjection. Furthermore, unlîke fusion of yeast
: 30 spheroplasts with mammalian cells where some of the yeast ;
chromosomes integrate with the YAC5~ 6, no yeast chromosomal
DNA is introduced in c~-lipofection since the YAC is first
isolated by pulsed field gel electrophoresis.
Transgenic mice were produced by blastocyst
injection of ~S cells carrying an intact YAC. The YAC was
maintained intact through the germline, and human heavy chain
antibody subunits were detected in the serum of transgenic
offspring.
W094/0~s69 ~l.J J ~, ~ PCT/USg3/05~73
39
Human Heavy Chain Gene Fragment
The 85 kb Spe I fragment of the unrearranged human
immunoglobulin heavy chain locus was isolated. The 85kb Spe
I fragm~nt of the human heavy chain immunoglobulin (H) chain
gene contains at least one of each element required for
correct rearrangement and expression of a human IgM heavy
chain molecule.
An 85kb Spe I restriction fragment of the human
hea~y chain immunoglobulin gene contains VH6, the functional
diversity tD) segments, all six joining (J) segments, and the
C~ constant region segment ~Hofker et al. (1989) Proc natl.
. Acad. ~Sci. uy~S.A.) 86: 5587; ~erman et al. ~1988) EMBO J~ 7:
727; Shin et al. ~1991) EMBO J. 10: 3641). Fresh human sperm
was harvested and genomic DNA prepared in agarose blocks as
described in Strauss et al. (1992) Mamm. Ge.nome 2: lSO). A
size selec~ed (50-lOOkb) Spe I complete dig~st YAC library was ~ :
prepared in the yeast host strain AB1380 in pYACneol5, u~ing
the Spe I site near the entromerP as the cloning siteO A
: 20: ~ize selected (50-lOOkb) Spe I complete digest YAC library was
produced in the YAC Yector pYACneo15 and screened by colony
hybridization with a probe specific for human C~ ~Traver et
al. ~1989) Proc. Natl. Acad. Sci. ~U.S.A.~ 86: 589B). one
positive cl~ne (Jl~ was identified among approximately 18,000
pri~ary transformants. Because yeast mitochondrial DNA often
obscured the YAC on pulsed field gel electrophoresis, a r-
petite variant làcking mitochondrial DNA was selected by EtBr `
: treatment, and denoted Jl.3P. One subclone, Jl.3P, was
mounted in agarose~blocks at 3.5 x 109 cells/ml and intact
yeast chromosomal DNA was prepared (5mith et alO (1990) Proc.
Natl. Acad. Sci._ ru.s~A~ 8242). The YAC DNA was isolated
in a 3-4mm wide gel slice from a low melting point preparative
C~EF gel (Biorad). The gel slice was equilibrated in b-
agarase buffer (Gelase, Epicentr~ Technologies), melted at
70-C for 20 minutes, cooled to 45-C, and digested with lO
units o f agarase overnight at 45 C.
Characterization _ ~ YAC Jl.3P
WO9~/00569 2 1 ~ 5 3 ~ ~ PCT/USg3/0~ -
The authenticity of the J1.3P insert was determined
by restriction mapping and Southern analysis. The ends of the
insert were subcloned, using the bacterial selectable markers
in the centromeric and acentromeric arms of pYACneo. Fine
structure restriction analyses of the terminal fragments were
entirely consistent with published maps and sequences of the
region (Fox et al. nalysis and maniPulation of yeast
mitochondr-al qenes, In Guide to Yeast Genetlcs and Molecular
Biology (1991) eds. Guthrie C and Fink G, Academic Press, San
Diego~ California; Word et al. (1989) In~._Immunol. 1: 296)
and defined the orientation of the insert with respect to the
vector arms. The orientation was further verified by PCR
: analysis of the acentromeric insert for VH6 sequences, and
hybridization of the centromeric insert with the C~ probe.
Southern analysis of the C~ region was consistent with
published maps and restriction analyses ~Hofker et al. (1989)
Proc._Natl. Acad. Sci._(U.S.A.L 86: 5587). The functional
diversity segments of the human heavy chain are contained in
a 35 kb ~pan containing a four-fold polymorphic repeat of D
segments. Southern analysis of the J1.3P YAC produced a
"restriction fraqment fingerprintl' of the D region in which
al~ of the D specific bands in the YAC were present in human
genomic DNA.
~: Co-lipofection of Jl.3P YAC into ES cells -
: 25 The J1.3P YAC was co-lipofected with an unlinked
linearized plasmid carrying the neor gene driven by the mouse
PGK promoter (Soriano et al. (l991~ Cell 64: 893)o
Selectable marker lasmids
Plasmid is a 5 kb plasmid containing an expression
casse~te consisting o~ the neo gene under the transcriptional
control of the mouse phosphoglycerate kinase-l promoter and
the PGK-l poly ~A) site ~Tybulewicz et al. (1991) Cell 40~
271). The plasmid pYPNN is a variant of pYACneo containing
- the PGKneo cassette in place of the SV40 promoter-neor
cassett~, conætrurted by exchange of a 4.5kb Sal I-Apa I
fra~ment of pYACneo for a 1.5kb Sal I-Apa I fragment of a
containing the PGK promotor, neor coding region, and the
W094~00569 2 1 3 5 ~ 1 ~ PCT/US93~05873
41
PGXp(A) signal. The plasmids were linearized with Sal I ~a~
or Not I (pYPNN).
Lipofection of YAC DNA into ES cells.
The digested agarose/DNA mixture was divided into 1
ml (approximately 100 ng) portions in polystyrene tubes
(Falcon) and 100 ng pYPNN or 20 ng , and 1 ~g sheared
herring sperm DNA (Sigma) was mixed in each tube, and cationic
lipid tTransfectam~ ProMega) was then added at a 10:1 ratio
(wt:wt~ and gently mixed into the DNA solution. The mixture
10 wa~ incubated for 30 min at room temperature to allow
formation of DNA-lipid complexes. Rapidly growing conf luent
cultures of AB-1 embryonic stem (ES) cells on mitotically ~;
. inacti~ated SNL 76/7 fibroblast feeder layers were trypsinized ~;
to yield a single cell suspension, washed with serum~
containing medium, and resuspended in serum-fr2e DMEM (Gibco).
For each lipofection~ 9 ml of cell suspension containiny 3 x
1O6 ES cells and about 1 x 105 feeder cells w~re mixed with 1
ml of the DNA-lipid m~xture in a 60 mm petri dish (Falcon
1007; Becton Dickinson) and incubated for 4 hours at 37 C in
20 ~ ~a humidified 5% CO2 atmosph~re. Dishes were swirled gently .
during the incubation to minimize cell attachment. After
incubation, cells were diluted with serum-containing ES cell
medium, dispersed gently, and plated at 1 x 106 on 100 mm
culture dishes containing feeder layers. Cells were selected ~: :
~5 in G418 (400 ~g/ml powd2r, Gibc~) for 9-lZ days, beginning 24 ~ ~ :
: hours after plating. Two different plasmids were tested: pYPNN
(a 12 kb derivative of pYACneo carrying the PGKneo cassette in
place of the SV40-neo cassette) and ickensian (a 5 kb plasmid
carrying the same PGKneo cassette). The YAC:plasmid molar
3~ ratio was 1:8 for pYPNN and 1:4 for ickensian. Two cationic
lipid formulations were tested, DOGS (Transfe::tam; ProMega~
and DOT~ (Lipo~ectin; BRL). Similar trans~ection
efficiencies were obtained for DOGS and DOTMA wit~ linearized
plasmids, but DOGS was ultimately chosen for the YAC
experiment5 because its cationic mQiety is spermine, obvi~king
the need for exogenously added spermine as a DNA protectant,
~nd because DQGS waS not toxic to E5 cells at the
concentrations used. Because the DNA:lipid ratio was found to
W0~4/00569 ~ 1 35~1~ PCT/US93/05~--
42
be important to the transfection efficiency, and precise
measurement of the YAC DNA concentration was difficult, each
lipof~ction contained an estimated 10-fold excess ~1 ~g) of
sheared herring sperm carrier DNA to provide a baseline level
of DNA.
Analysis of ES clones
G41~-resistant clones were dispersed with trypsin
an~ the cells from each clone were dividPd into one well of a
96-well plate that was frozen and a second 96-well or 24-well
plate used for preparation of DNA for screening by Southern
analysis. Positi~e clones were thawed and expanded for
further analy~is.
Southern blot hybridization and PCR
Genomic DNA was prepared from ES cells and tail
biopsies by ra~id preparation methods ~Laird et al. (1991)
Nucleic Acids Res. 19: 4293) and subjected to South~rn
analysis by standard methods. For pulsed field gel
electrophoresis, ES cells were embedded in agarose blocks at
1O7 cells/ml, prepared for restriction digPstion, and dige~ted
overnight with Spe I. For Southern analysis of pulsed field
gels, the DNA was acid-nicked, then transferred to GeneScreen
Plus ~DuPont) in denaturing solution ~0.4N NaOH, 1.5 M NaCl).
51igonucleotides suitable for PCR amp.ification of the VH6
region were prepared from published sequences. Primers used
were 5'CAGGTACAGCTGCAGCAGTCA3' and 5'~CCGGAGTCACAGAGTTCAGC3',
which amplified a diagnostic 275 bp product.
Production and analysis of trans~enic mice
Clones containing intact YAC sequences were injected
into blastocysts to produce chimeric founder animals, which
were bred with C57BL/6 wild ~ype mice and JH- mice, which
carry targeted inactivations of ~oth ropies of the mouse heavy
chain gene. Thymic cells from transgenic offspring were
mounted in agarose blocks for pulsed field gel eleGtrophoresis
and Southern analysis to confirm transmission of the intact
YAC.
ELISA assays
Human mu chain was detected using a 2-site ELISA
assay. Polyvinyl chloride microtiter plates were coated with
2135313
W094/00569 PCT/US93/~5~73
43
mouse monoclonal anti-human IgM clone CH6 (The Binding Site,
San Diego, CA) at 1.25 ~g/ml in 100 ~l PBS by overnight
incubation at 4 C. Plates were blocked by l hr incubation
with 5% chicken serum (JRH, Lexana, XS) in PBS. Following 6
washes with PBS, 0.5% tween-20, serum samples and standards
were di.luted in 100 ~l PBS, 0.5% Tween-20, 5% chicken serum
(PTCS) and incubated in the wells for 1 hr at room temp.
Purified human myeloma-derived IgM, kappa (Calbiochem, La
Jolla, CA) was used as a stand rd. Plates were then washed 6
times with PBS, 0.5% tween-20 before addition of peroxidase ~`
~ conjugated rabbit anti-human IgM, Fc5u fragment specific
antibody diluted 1/lO00 in lO0 ~l PTCS. After another 1 hr
. incubation at room temperature, the wells were washed 6 times
and developed for 112 hr with 100 ~l ABTS substrate (Sigma) .
Assay plates were read at 415-490 nm on a Vmax microplate
- reader (~olecular Device~, Menlo Park, CA), and IgM
cQncentration determined from a 4-parameter logistic curve fit
of the standard values. A level of 4.89 ng/ml in serum
samples i5 routinely detected by this assay and differentiated
from bac~ground by at least 3 standard deviations.
Results
Approximately eight ~g of Jl.3PYAC DNA were
lipofected in eight separate experiments (Table 1). Of the
1221 G418 resistant clones screened, 15 contained the two
diagnostic Eco RI C~ fra~ments (Table 2). Two of the clones
~#s 195 and 553) contained only one of the two C~ bands,
which may have arisen from fragmentation of the YAC within the
missing Eco RI fragment (Table 2~. The two selectable marker
plasmid~, pYPNN and ace, produced, respectively, frequencies
of 0.5 and 13.5 G418 resistant clones per 106 transfected
cells; the efficiency of pYPNN selection was much lower eYen
though it was used at twice the molarity of ace. It is
unclear why the plasmids differed, since they both contained
the same neor cassette, but it may be a con~equence of the
35 . extent of se~uence homology ~etween the plasmid and the vector
armst or different efficiencies of neor expression from the
two plasmids.
WO 94/00569 2 1 3 5 3 1 3 ~ `/US93/05~ `
~ t)
o
o a)- u~
~z ~n o
,t
`~ h.C
~ .,1 0
:3~ ~D ~'X ~ S
0 ~ Inh O
Q)
O :
C~ ~ U
I V ~ ~ ~1 0 0 0 0 r~ ~ ~ a'V
~ ~ ~'~
a
c ~ C~ o o ~ 0 e~
o ~,1 ,,, o ~
~: 3
. U C:: O
_I a~
t~ ILO
c: aJ~r~ O o
O ~n ns O h
I ~ ,
:~ o t) 00 o~
I a~
f~5 ~ ~ 3 1 -~
O O ~::
1 ~ .~
I " ~ ~
Cl: ~ Cl ~ f~
~ ~,C
C~
I
.-~ o
O' I ~S U~
a .~ co oo co
O ~
I¢ q-l 3
._.~ O
f. I
I s: Q) O
O ~
O
~) ,4 ~a
~: O O O
~1 ~ ~Z; Z Z; Z o u7
z; æ ~ æ ~ Q, u~ ~4
Q~ ~n ~ ~ ~ ~ ~ ~ ~ ~ ,~ 3 ~: Z
I o a
a) ~ o r~ U
c~ ~ ~
,~ ~ o
~1 ~ O
Q; q:
0
~C .~ o
E~ O Q3 ~n
:
s
213531:~
WO ~4~00569 PCI`/USg3/05873
~ ~X
Q, U~ 0~ ~ H
,~ O X ~
'CS O
3~Q ~ U~
C ,C S ~
~a 0 ~ u~ o ~ Q) Q.~ ~ ~n
.~ ~ o ~ ~ GS ~ u o-~ ~ H O
~ Ull ~ + + + I ,~ ~ C~: S O ~ ~ 3 ~,~
_~ Q~v ~ ~ ~
Ir)¦ 'C5N C~ N IU O ~U h ,~ ~S
I I I I C ~ Q) C)~ ~I R O 3 `~
~ ~~ Q) O ~O
a 0 Q) ~ ~ C ~l ri .C ~ ,~
O a) ~ ~ ~ ~ ~ o a
I + ~ + a~ i r C a~
r~ , C ~ o ~o ~ s ~ o
o ~ o-~
:~ ~ 3 ~ ~,~q ~J ~,G~ '8 V Q
~1 1 1 + ~ s o
1: ~al ~
O ~1 ~ ~ +
--~ ~ a ~ s ~ ~ Q
u~ ~ I ~ a) h ~ 0 ~
~C Q) U) ~ Q) ` ~? ~ ~: X h ~ S.J
tn~ ) 01) N
~1 ~11 ~ ~ + + I ~ ~ ~ Q 0~
O ~ ~ 0 10 C ~5 C CQ ~ ~q
~Dl ~ O O
S~4 ~I C 11~ ~
~ ~ + .c a~ ~ + Cl' o Z
::1 ~ ~ U~ ~ 3 ~
U: ~i ~ rl ~ ~ ~ V
tl ~ I + + C U~ A ~ U3 S~ J H U~
o ~
. u~ ~ O
~ ~1 ~ ~ + + ~ o ~: ~
-~ ~1 ~ ~ + ~ o ~ u ~ ~o Pt;
Q 3 :> ~.ÇI .C ~: O U
C ~- X ~ Q) ~ ~- ~
~I t` + ~ ~ t ~.)~rl ,IC: q.l 'O t~S O ~U ~ -I Pb
.~ Q ~C
+ ~ ~ a) - (5 ~ ~1 ~ ~ ~ ..
` + U~ ~ N ~
O ~ R
U U~ + ~4 G) ~
~ ~ Q, ~ O O
,~ 5 0 ~ ~q U
Q) ~ Q) ~ J h al ~ h C) ~ rl
G ~ * ~
C .~ i ~ ~ 3 a) ~ t '~ O
I E~ ~ /11 0.c ~ o
o ~ e ~ o J~
o ~ o ~ o ,l ~ ~
W094/00569 ~ ~ 3~3 1 3 PCT/US93/05~-
46
Analysis of YAC structure in ES cells.
The four C~+ clones from the pYPNN co-lipofections
(#s 12,14,18,21) were analyzed for D region structure by the
restriction fragment fingerprint assay de~cribed above. Of
the four clones, only clone 18 retained the fingerprint of the
parent YAC. Clones 14 and 21 contained fewer bands than the
parent, suggestiny that YAC sequences may have been lost, ~-
while clone 12 contained several additional bands, consistent ~;
with integration of more than one copy of the YAC in this ES
line.
The integrity of the 3 ' end of the insert region in
the four ES ~ines wa~ assessed by Southern analysis using the
10.5kb Nde I-Spe I terminal fragment isolated by vector
recircularization as probe. Three bands are expected from a
Xho I digest of the parent YAC: a verv large D-J-C~ band (>30
kb), a i.5 kb C~-C~ band, and an 8.9 kb C~-vector band. A
double digest with Xho I and Spe I is-expected to reduce the
size of the 8.9 kb ~and to 4.1 kb. The 4.5 kb and ~.9 bands
are pres~nt in the Xho I digests, while the 4.5 kb and 4.1 kb
bands are present in the Xho I-Spe I digests of the parent
; ~Y~C. Among the four ES lines, only line 18 contained the
parental YAC banding pattern indicati~e of an intact 3'-end.
The presence of an 8~9 ~b band is consis~ent with the
~retention of the vector arm Xho I site in the ES line,
sugges~ing that very little of the telomeric region had been
lost in this clone. Loss of YAC terminal sequences would ~e
~: expected to result in aberrant Xho I bands. Among the other
three ES lines, clone 14 lacked the 4~5 kb Xho I band, while
clones ~2 and 21 contained aberrantly short Xho I bands,
indicating rearranged or deleted 3l end regions in these ES
clones. A similar analysis of 5' end integrity was not
possible due to repetitive elements in the region. However,
PCR and Southern analysis using the Y~6 PCR product a~ probe
indicated that clone 18 contained VH~ sequences, while clones
14, 12, and 21 did not (Table 2). ::
O~ the 13 C~+ ES cell lines from the d co- :
lipofectiorls, one was lost during clonal expansion, and one ~ :
266) was eliminated because it lacked VH6 sequence. The -
W094/00569 2 1 3 5 3 1 3 PCT/VS93/~873
47
remainder were analyzed for D region structure, 3'-end
integrity and/or VH~ sequence (Table 2). Of the 11 lines
analyzed for D region fingerprint, six (#s 86, 191, 220, 371,
463, 567) showed an intact D region while five had aberrant
patterns. 3' end analysis of five of the six lines with
intact D regions revealed that all but one (~220) contained an
intact 3' end. PCR analysis revealed that f iYe of the six
line with intact D regions (#86, 220, 371, 463, 567)
contained V~6 sequences, while only one of five lines without
intact D regions (#35) contained VH6 sequences.
Ten of the ES cell lines were examined for full
length insert by pulsed field Southern analysis using tha ~
, r~gion or C~ probe (Table 2). Only clones 18, 371, and 463
contained an 85 kb Spe I fragment indicative of a full length
insert; all of the other clones had a smaller Spe I fragment.
The Spe I digest of clone 18 was screened with both D and C~
probes and a probe for VH6; all three probes hybridlzed to a
single band of 8S kb.
The pulsed field Southern analysis, taken together
2Q with the D region, 3' end and VH6 fine s~ructure analy~es,
indicate that the YAC insert was transferred intact in three
ES lines: #18, #371, and #463. A high degree of internal
rearrangement, deletion or fragmentation was generally seen in
the ES lines carrying disrupted YAC se~uences, ~lthough subtle
alterations of structure were also detected (e.g., #567~.
Overall, the fre~uency of intact YAC transfer was low, 1 în
400 G41~ clones (3/1221). However, the isolation of the
: clone DNAs and the primary screen for C~ sequences (which
eliminated 1206 of the 1221 clones from further analysis) were
rapidly performed using the microtitre plate protocols
desrribed in Methodology. Thus, only 15 clones required
extensive analysis (Table 2).
Molecular analysis of YAC stxucture in ES cells is
grea ly ~acilitated by a low, preferably single, copy of ~he ..
YAC. The D region, pulsed field gel analysis, and 3' end
ànalyses of the ES ~ines are consistent with a low or single
copy integration of the YAC. Analysis of clones 18, 371, and
463 for a diagnostic 3' end flanking band showed that clones
.-
W094~0569 ~ 1 3 5 3 ~ 3 PCT/US93/OS~-'
48
18 and 371 carriPd a single copy of the YAC insert, while 463
may have an ~dditional intact or partially intact copy.
Production of chimeras and germline transmission of the YAC
Blastocysts were injected with ES lines 18, 371, and
S 463. Chimeric founder animals ranging from 10% to 95% ES cell
contribution to coat color were derived from all three lines.
The oldest animal, a 40% chimeric male derived from ES line
18, ~ransmitted the ES cell genotype to 20 of 73 offspring.
Eleven of the 20 agouti of~spring were positive for an intact
D region fingerprint, consistent with Mendelian segregation of
a hemizygous YAC transgene allele. In addition, pulsed field
Southern analysis using the D region probe demonstrated a
. single 85 kb Spe I band in transgenic offspring, indicating
that the YAC was stably maintained through the germline.
Thus, co-lipofection of YACs into ES cells does not abrogate
ES cell totipotency.
Southern analysis of integr~tion sites for the co-
lipofected selectable marker indicated integration of 2 to lO
plasmid copies. Because it is possible that the marker
plasmids could be a source of mutations if they were to insert
at multiple loci, the integration sites of the plasmid were
tracked by Southern analysis for plasmid sequences. Sin~e
pYPNN and the YAC vector arms lack Eco RI sites and contain
pBR322 sequences, each Eco RI band which hybridized to a
pBR322 probe represent~ the integration of a separate intact : .
or fra~mented copy of pYPNN or the YAC vector arms. Analysis
of ES cell clone 18 DNA revealed eight Eco RI bands ranging in
: gize from 5.5 kb to 20 kb, and the offspring of a hemizygous
transgenic animal bred with non-transgenic mates were analyzed
for se~regation o~ the Eco RI bands. Among 14 offspring, all
eight Eco RI bands were detected in tail DNAs of the 9
transgenic pups, and none were de~ected in tail DNAs of the
non-transgenic pups~ Thus, all detectable marker plasmids
segregated with the YAC, indicating that they had inserted at
or near the YAC integration site. Co-integration o~ different :~
DNAs have bee~ observed in transgenic mice produced by
microinjectîon of zygo~es, and it is expected that co~
integration of plasmid DNAs would be no more mutagenic for co-
wo g4~00s6~ 2 1 3 5 ~ 1 3 PCT~US93/Q5873
49
lipofection than for zygote microinjection. Presumably, the
herring sperm carrier DNA had also co-integrated with the YAC,
and may be a source of Eco RI sites in the Southern analysis.
Since co-integrated carrier DNA may potentially adversely
affect YAC transgene function, it is frequently preferable to
omit carrier DNA. Preliminary experiment~ with a 650 kb YAC
indicate that carrier DNA is not required for efficient
lipofection of intact YACs into ES ~ells. This preliminary
work also suggests that the size limit of YACs which can be
successfully co-lipofected into ES cells is at least 650 kb.
5erum expression_of_human immunoglobulins in trans~enic mice
Line 18 transgenic mice were assayed for human mu
.chain in the serum by ELISA. Human mu heavy chain was
detected in the serum of transgenic offspring (Table 3).
Although the human mu serum levels in the transgenics were
clearly within the detectable range, they were very low
compared to serum levels of endogenous mouse IgM. The low
level of transgene expression is due in part to competition
from the endogenous heavy chain gene. The transgene was
introduced into a background in which the endogenous heavy
chain alleles are inactivated, and in this mouse, the human mu
serum levels were ele~ated approximately 10 fold (Table 3).
., :
.
WO 94/00569 2 13 5 3 1 3 PCI/US93/05~--
Table 3~ Detection of serum human IqM b~ ELISA
Genotype SexAqe at assav Human IqM
(wk~
YAC 18+ F 3, 9, 20 < 5 ng/ml
YAC lB~ M 17 12 . 2 ng/ml
YAC 18+ F 10 27 . 0 ng/ml
YP~C 18+ F 6, 17 < 5 ng/ml
YAC 18~ F 4 5 . 8 ng/ml
YAC 18+ F 6 lOo 5 ng/ml
YAC 18+ M 6 10. 4 ng/ml
YAC l~+lJH M 5, 8 165 ng/ml
Wild type F ~ < 5 ng/ml
Wild type F 6 < 5 ng/ml
Wild type F 6 < 5 ng/ml
Wild type M 6 < 5 ng/ml
Wild type F 34 < 5 nglml
Wild type F 34 < 5 ng/ml
Wild type M 3 4 < 5 ny/ml
Wild type M 34 ~ 5 ng/ml .
2 5
Table 3. Blood samples from transgenic animals and controls
were analy~ed by ELISA for human IgM at the ages indicated.
All of the transgenic animals are derived from ~ ~ingle clone
1~ ~ounder chimera, and are hemizygous for the YAC (YAC 18+).
3 0 Five c3f the seYen animals in wild type back~round had
cletectable human IgM in their serum. The level of detection
of the ELISA was 5 ng human IgM~ml serum. The serum human IgM ~ ~:
level was elevated approximately 10-fold when the YAS~
transgene was bred into a background lacking functional
35 endogenous mouse he~vy chain genes (YAC18+/JH~
. ..
W094/00569 2 1 3 ~ 3 1 3 PCT/US93fO5873
. . ~ , .
51
FACS Analysis of YA5+lJH- Mice
Fluorescence-activated cell-sorting (FACS) analysis
was performed on mice positive for the YAC containing the 85kb
heavy chain gene fragment and homozygous for a functionally
disrupted t"knocked-ou~"~ endogenous murine immunoglobulin
heavy chain gene by disruption of the JH region by homologous
gene targeting. The mice had a single copy of the YAC
transgene and lacked functional murine heavy chain alleles.
The FACS analysis used antibodies to detect human mu chains,
among others, and showed that about 60 cells per 10,000 total
peripheral lymphocytes from the mice expressed a human mu
chain immunoglobulin, This level is approximately 1-2 percent
, of the number of cells that express murine mu chains in a
wild type (non-transgenic/non-knockout) mouse spleenO
~ACS detected human mu chain expression in cells
obt~ined from the spleen and peritoneal cavity of the YAC~/JH-
mice.
Although the foregoing invention has been described
in some detail by way of illustration and example, for
purposes of clarity of understanding, it will be obvious that
: certain changes and modifications may be practiced within the
,
scope o~ the appended claims.
,:
2~5
: :
.:
