Note: Descriptions are shown in the official language in which they were submitted.
~144~19
WO95/01994 PCT~S94tO7685
RECOMBINANT CTLA4 POLYPEPTIDES AND METHODS FOR MAKING THE SAME
The present invention relates to soluble proteins useful for
controlling T cell activation, and more particularly to soluble
CTLA4 proteins produced by recombinant DNA methods.
Background of the Invention
Inappropriate T cell activation has been implicated in a
number of deleterious conditions, including autoimmune diseases
and transplant rejection. Optimal activation of T cells for
clonal expansion is believed to require two signals. One is an
antigen-specific signal delivered through T cell receptors (TCR),
while the second is an antigen-non-specific or co-stimulatory
signal. Chen et al., Cell 71:1093-1102 (1992); Liu et al., Eur.
J. Immunol. 22:2855-2859 (1992).
The second non-specific signal is determined by a class of
T cell regulatory molecules known as co-stimulators that
determine whether T cells are activated to proliferate or enter
into a state of unresponsiveness known as clonal anergy. B7, a
T cell regulatory molecule, is a co-stimulatory protein expressed
on the cell surface of antigen presenting cells such as activated
macrophages, activated B lymphocytes and dendritic cells as
reported in Razi-Wolf et al., Proc. Natl Acad. Sci. U.S.A.
89:4210-4214 (1992) and Freeman et al., J. Immunol. 139:326-3267
(1992).
B7 is a natural ligand for T cell surface proteins known as
CD28 and CTLA4 (cytolytic T-lymphocyte-associated antigen number
4). CD28 and CTLA4 share substantial homology in their amino
acid sequences, particularly in the transmembrane and cytoplasmic
do~inc~ and are therefore believed to share similar functions~in
the T-cell co-stimulation pathway. B7 is known to have a greater
affinity for CTLA4 compared with CD28.
CD28 is constitutively expressed on most T lymphocytes.
CTLA4, however, was determined to be preferentially expressed by
activated versus unactivated cytolytic T cells in DNA
hybridization experiments described in Brunet et al., Nature
328:267-270 (1987). It is now known that CTLA4 is expressed by
W095/01994 ~ 319 PCT~S94/07685
activated cytotoxic T lymphocytes and activated helper T
lymphocytes.
The interactions of B7 with CD28 and CTLA4 play an important
role in the full activation of T cells in the co-stimulation
pathway during an immune response. Neutralization of B7 or CD28
activity, for example with monoclonal antibodies, prevents T cell
proliferation in response to foreign antigens and polyclonal
activators such as lectins. Neutralization of B7 activity also
prevents T cells from acting as helper cells for the induction of
antibody synthesis by B cells.
In addition to playing an important role in T cell
proliferation and antibody induction, the interaction of B7 with
CD28 regulates cytokine synthesis in T lymphocytes. Cytokines
that are known to be regulated by the interaction of B7 with CD28
include interleukin-2, tumor necrosis factors alpha and beta,
gamma interferon and granulocyte-macrophage colony stimulating
factor (Gimmi et al., Proc. Nat'l Acad. Sci. U.S.A. 88:6575-6579
(l991); Linsley et al., J. Exp. Med. 173:721-730 (1991); and
Thompson et al., Proc. Nat'l Acad. Sci. U.S.A. 86:1333-1337
(1989)).
Synthesis of these cytokines is not completely inhibited by
commonly used immunosuppressive agents such as cyclosporine,
which is a fungal metabolite used to suppress the immune system
in patients undergoing organ transplants or suffering from
autoimmune diseases. Consequently, it is believed agents that
effectively inhibit B7 activity could be used as an alternative
to cyclosporine therapy or in combination with cyclosporine to
provide an additive or synergistic effect in inhibiting T cell
proliferation. Because of the similarity between CD28 and CTLA4,
it is believed that the interaction of B7 with CTLA4 should also
regulate cytokine synthesis in T lymphocytes.
However, previous attempts to express the extracellular
domain of CTLA4 as a soluble, unfused protein have been
unsuccessful. According to PCT Publication No. W0 93/00431,
successful expression of active CTLA4 proteins is believed to
require an expression system that permits the proteins to form as
dimers because the proteins are believed to occur in nature as
WO95101994 21 ~ ~ ~ I 9 PCT~S94/07685
dimers. ThuS, researchers have focussed on fusion proteins in an
effort to find an appropriate expression system.
A fusion protein cont~;n;~g the extracellular domain of
CTLA4 joined to the F~ heavy chain region of an immunoglobulin
molecule has been developed as a possible agent having B7
inhibitory activity. This fusion protein, referred to as "CTLA4-
Ig fusion protein," is described in Linsley et al., J. Exp. Med.
174:561-569 (1991) and in PCT Patent Publication No. WO 93/00431.
According to these publications, the CTLA4-Ig fusion protein is
secreted from mammalian cells as a disulfide-linked dimeric
protein that aggregates in solution. However, attempts to
express the extracellular domain of CTLA4 as an unfused protein
in mammalian cells were unsuccessful. The Ig portion of the
fusion protein facilitates the formation of a dimeric fusion
protein, which is capable of being processed and expressed by the
mammalian cells. The Ig portion additionally allows the active
fusion protein to be purified from conditioned media using a
protein A affinity column. Protein A has a high affinity for the
Fc region of Ig molecules.
The molecular weight of the major CTLA4-Ig species in
solution is approximately 200 kDa based on size exclusion
chromatography also described in Linsley et al., su~ra. Because
the molecular weight of the monomeric form of the CTLA4-Ig fusion
protein expressed in mammalian cells is about 50 kDa, the major
species in solution is believed to be an aggregated complex of at
least four CTLA4-Ig molecules.
The B7 inhibitory activity of the CTLA4-Ig fusion protein
has been tested in both in vitro and in vivo experiments. In the
in vitro experiments, the CTLA4-Ig fusion protein bound to B7 and
neutralized its activity. In fact, the CTLA4-Ig fusion protein
was a better inhibitor of B7 activity than a comparable CD28-Ig
fusion protein. The results of these assays are consistent with
the previous experiments showing that B7 binds to CTLA4 with
greater affinity than CD28. The CTLA4-Ig fusion protein was
found to inhibit T cell proliferation, with a half maximal
inhibitory dose of 30 ng/ml, in a mixed lymphocyte reaction as
reported in Linsley et al., supra. The fusion protein also
WO95/01994 ~ ~ PCT~S94/07685
inhibited the ability of helper T cells to stimulate antibody
production by B lymphocytes in an in vitro study described in
Linsley et al., J. Exp. Med. 174:561-569 (1991).
In experiments conducted in vivo, the CTLA4-Ig fusion
protein was determined to be immunosuppressive and capable of
prolonging survival of pancreatic and heart allografts in mice
and rats (Lenschow et al., Science 257:789-792 (1992) and Turka
et al., Proc. Nat'l Acad. Sci. U.S.A. 89:11102-11105 (1992)). In
the mouse study, the administration of CTLA4-Ig resulted in the
long term acceptance of pancreatic allografts. These results
suggest that the fusion protein had tolerized the recipient mice
to the foreign tissue. Other animal studies described in Linsley
et al., Science 257:792-795 (1992) also demonstrate that CTLA4-Ig
was capable of inhibiting primary antibody responses to foreign
antigens such as sheep red blood cells.
The CTLA4-Ig fusion protein has several disadvantages as a
therapeutic agent for human disease. Because the fusion protein
is a non-naturally occurring molecule, a patient receiving the
protein may develop an immune response to the protein.
Antigenicity may be more of a problem when patients are taken off
the therapeutic agent so they are no longer immunosuppressed and
are ca~able of mounting an immune response against the fusion
protein. Therefore, antigenicity may prevent the CTLA-Ig fusion
protein from being administered intermittently to patients
suffering from chronic diseases. In addition, the half-life of
the CTLA4-Ig fusion protein in mice is about 4 days, with
significant levels of the fusion protein still detectable in the
animals 5 weeks after the cessation of treatment with CTLA4-Ig.
Linsley et al., Science 257:792-795 (1992). Furthermore, when
bound to B7 on the surface of antigen-presenting cells, the Ig
portion of the fusion protein may activate the complement cascade
that results in cell death and hematological problems. Finally,
CTLA4-Ig fusion protein is expressed in mammalian cells, which is
a costly method of producing recombinant proteins.
Thus, a need exists for additional therapeutic agents
capable of inhibiting the co-stimulatory pathway in T cell
WO95/01994 ~14 ~ 319 PCT~S94/07685
activation. The present invention satisfies this need and
provides related advantages as well.
summarY of the Invention
The present invention relates to recombinantly-produced
CTLA4 polypeptides that are not fusion proteins containing human
Ig molecules. The soluble, recombinant polypeptides contain, as
a basic unit, a monomer consisting essentially of the
extracellular domain of the CTLA4 receptor protein. Preferably,
the recombinant polypeptides are the product of joining two or
more monomers through intermolecular disulfide bonds or through
a cross-linking agent, such as polyethylene glycol (PEG), to form
biologically active dimers and other multimers.
The polypeptides can also be functional derivatives of the
monomers and multimers, such as cysteine muteins in which a
cysteine is substituted for one or more amino acids or is added
to the wild-type CTLA4 amino acid sequence. The substitution is
preferably made at residue numbers 79, 80, 81, 109, 110 or 111 of
the extracellular domain of the CTLA4 receptor protein as shown
in SEQ ID NO.2, while the addition of an extra cysteine is
preferably made after residue number 125 from the N-terminal end
of the naturally-occurring CTLA4 receptor protein. Other
functional derivatives include, for example, pegylated dumbbell
molecules in which two cysteine muteins are attached through
activated groups on each end of a PEG molecule.
The present invention also provides methods of making the
recombinant polypeptides. The methods include the steps of:
(a) obtaining a DNA sequence capable of directing a host
cell to express a polypeptide corresponding to the extracellular
domain of a CTLA4 receptor protein, the polypeptide having B7
binding activity;
(b) inserting the DNA sequence into a vector having
operational elements for expression of the DNA sequence;
(c) transferring the vector into a host cell capable of
expressing the polypeptide;
(d) culturing the host cell under conditions for expression
of the polypeptide;
WO95/01994 2 ~ ~ 4 319 PCT~S94/07685
(e) harvesting the polypeptide; and
(f) permitting the polypeptide to assume an active tertiary
structure. Optionally, the polypeptide can also be permitted to
assume an active quaternary structure.
Vectors and host cells useful for the expression of the
recombinant CTLA4 polypeptides are also provided. In addition,
the invention further provides pharmaceutical compositions
cont~; n; ng the CTLA4 polypeptides as the active ingredient.
The invention also relates to methods for separating the
various forms of the recombinantly-produced polypeptides,
particularly the separation of monomers and dimers. The
invention also relates to methods for separating various dimer
species and purifying active dimers from less active dimers.
After obtaining active, recombinant polypeptides according to the
above methods, the resulting mixture is passed over an ion
exchange column, particularly an anion exchange column, followed
by passage over a sizing column. The separation methods produce
one pool mixture of at least about 90% dimers and a second pool
of at least about 85% monomers. These methods also separate
active dimers from less active dimers.
Detailed DescriPtion of the Invention
The present invention provides soluble, recombinantly-
produced CTLA4 polypeptides that are not fused to human Ig
molecules. The novel recombinant polypeptides of the present
invention are useful for inhibiting inappropriate T cell
proliferation that can lead to various disorders.
The naturally-occurring or wild-type CTLA4 protein is a
ligand of B7, which is a cell surface protein involved in the co-
stimulatory pathway leading to T cell activation. The nucleotide
and amino acid sequences of murine and human CTLA4 are reported
in Brunet et al., Nature 328:267-270 (1987) and Dariavach et al.,
Eur. J. Immunol. 18:1901-1905 (1988), respectively. The overall
amino acid homology between human and murine CTLA4 proteins is
76%. The correct amino acid sequence of the full length human
CTLA4 protein is provided in PCT Publication No. WO 93/00431,
published on January 7, 1993.
WO95/01994 ~ 3 ~ 9 PCT~S94/07685
As noted previously, earlier attempts to produce an unfused
or truncated CTLA4 protein have been unsuccessful. Therefore,
prior to the present invention, methods for obtaining a
biologically active, recombinant CTLA4 protein involved 5 expressing CTLA4 as a fusion protein. More particularly, the
fusion protein is described in PCT Publication No. W0 93/00431 as
cont~;ning the extracellular domain of CTLA4 fused to the heavy
chain region of a human immunoglobulin molecule (referred to as
"CTLA4-Ig" protein). According to this publication, successful
expression of the extracellular domain of the CTLA4 receptor
protein requires an expression system that permits the protein to
form dimers. In contrast, the unfused or truncated versions of
the CTLA4 protein appear not to be expressed in an active form.
The publication further indicates that the Ig portion of the
CTLA4-Ig fusion protein is believed to facilitate dimer formation
and to aid in the purification of the fusion protein by
conventional protein A affinity chromatography.
The present invention is based on the discovery of methods
for producing a biologically active, soluble recombinant CTLA4
polypeptides (sCTLA4) that are not Ig fusion proteins. As used
herein, the term "biologically active" refers to polypeptides
that exhibit B7 binding activity.
The recombinantly-produced CTLA4 polypeptides of the
invention have, as a basic unit, a monomer that consists
essentially of the extracellular domain of the wild-type CTLA4
receptor protein. The monomers consist essentially of the amino
acid sequence of SEQ ID N0:2. Monomers expressed in prokaryotic
hosts cells, such as E. Coli, are encoded by an amino acid
sequence similar to SEQ ID N0:2, but with a methionine at the N-
terminal end. In reference to monomers, the term "consistsessentially of" as used herein is intended to encompass a monomer
encoded by an amino acid sequence corresponding to the
extracellular domain of the wild-type CTLA4 protein or
corresponding to the extracellular domain joined to additional
r 35 amino acids other than an amino acid sequence encoding for a
human Ig molecule. The calculated molecular weight of the CTLA4
monomeric form is about 12.5-13.5 kDa. The recombinantly
W095/01994 ~ 3 ~ PCT~S94/07685
produced sCTLA4 monomer appears as two major bands in the range
of about 14-16 kDa on SDS PAGE under non-reducing conditions.
The recombinant CTLA4 polypeptides of the present invention
can also be in the form of dimers or other multimers, which
contain more than one basic monomeric unit. Such multimers,
particularly dimers, can be formed by joining two or more
monomers through intermolec~ r disulfide bonds or by cross-
linking agents such as, for example, polyethylene glycol
(hereinafter referred to as "PEG"), other polyethers, EDTA and
other linkers known to those skilled in the art. The dimeric
form produced by two monomers joined by intermolecular disulfide
bonds has a calculated molecular weight of about 25 kDa and
appears as at least three major bands in the range of about 24-27
kDa on SDS PAGE under non-reducing conditions. The invention
provides methods for separating the various dimer forms and
purifying the most active dimer form.
The monomeric and dimeric forms are biologically active
according to the assays described in the examples below. The
active dimeric form, however, was found to be about 10- to 100-
fold more active than the monomeric form of CTLA4 in these in
vitro biological assays.
The present invention further provides methods of producing
the recombinant sCTLA4 polypeptides. Such methods include the
steps of:
(a) obt~; n; ng a DNA sequence capable of directing a host
cell to express a polypeptide corresponding to the extracellular
domain of a CTLA4 receptor protein, the polypeptide having B7
binding activity;
(b) inserting the DNA sequence into a vector having
operational elements for expression of the DNA sequence;
(c) transferring the vector into a host cell capable of
expressing the polypeptide;
(d) culturin5 the host cell under conditions for expression
of the polypeptide;
(e) harvesting the polypeptide; and
(f) permitting the polypeptide to assume an active tertiary
structure.
W095/01994 21~ ~ 31~ PCT~S94/07685
Optionally, the peptide can thereafter be permitted to
assume a quaternary structure in which two or more monomers join
to form a unit, such as a dimer or other multimeric forms. In
addition, the present invention further optionally includes
separating the dimeric forms to obtain the form with the most
inhibitory activity, referred to herein as the active dimeric
form.
The nucleic acid sequences useful in the present methods
include SEQ ID NO:l and its functional equivalents. As used
herein, the term "functional equivalent(s)" means modified
sequences having one or more additions, deletions, or
substitutions to the above sequence that do not substantially
affect the ability of the sequence to encode a polypeptide having
B7 binding activity. Such modified sequences can be produced by
means known in the art, including, for example, site directed
mutagenesis. The sequences can be obtained from natural sources,
such as the natural DNA sequence encoding the extracellular
domain of a CTLA4 receptor protein. Alternatively, the sequence
can be produced synthetically according to methods known in the
art. Additionally, such DNA sequences can be derived from a
combination of synthetic and natural sources. The natural
sequences further include cDNA and genomic DNA segments. Methods
of obtaining the synthetic and natural DNA sequences are
described in PCT Publication No. WO 93/00431, published on
January 7, 1993, which is incorporated herein by reference.
Vectors that can be used in these methods include those
vectors into which a CTLA4 DNA sequence, as described above. As
used herein, the term "consisting essentially of" in reference to
vectors means that such vectors contain nucleotide sequences that
encode for the extracellular domain of CTLA4 receptor protein,
including any desired operational elements, but not nucleotide
sequences encoding a human Ig molecule. A CTLA4 DNA sequence can
be inserted and linked with any desired operational elements to
effect its expression. The vectors can contain one or more of
the following operational elements: (l) a promoter; (2) a Shine-
Dalgarno sequence and initiator codon; (3) a terminator codon;
(4) an operator; (5) a leader sequence to facilitate
WO95/01994 ~1~ 4 3 ~ ~ PCT~S94/07685
transportation out of the host cell; (6) a gene for a regulator
protein; and (7) any other DNA sequences necessary or preferred
for appropriate transcription and subsequent translation of the
vectors. EP Application No. 90 113 673.9, which is incorporated
herein by reference, discloses several useful vectors and
desirable operational elements.
The vectors can be transferred into suitable host cells by
various methods known in the art, including transfection and
transformation procedures. Various transfer methods are
described in Sambrook et al., Molecular Cloninq: A Laboratory
Manual, Cold Spring Harbor, N.Y. (1989), which is incorporated
herein by reference. Such host cells can be either eucaryotic or
procaryotic cells. Examples of such host cells include chinese
hamster ovary (CHO) cells, yeast, E. Coli and baculovirus
infected insect cells. The host cells described in EP
Application No. 90 113 673.9, which is incorporated herein by
reference, are also useful in the present methods.
The host cells of the present invention can be cultured
under conditions appropriate for the expression of the
recombinant CTLA4 polypeptide. These conditions are generally
specific for the host cell and are readily determined by one of
ordinary skill in the art in light of the published literature
regarding the growth conditions for such cells. For example,
BerqeY~s Manual of Determinative Bacteriolo~y, 8th ed., Williams
& Wilkins Co., Baltimore, Maryland, which is incorporated herein
by reference, contains information relating to appropriate
conditions for culturing bacteria. Similar information relating
to culturing yeast and mammalian cells are described in R.
Pollack, Mammalian Cell Culture, Cold Spring Harbor Laboratories
(1975), incorporated herein by reference.
In one embodiment, cells can be grown to a high density in
the presence of appropriate regulatory conditions that inhibit
expression of the desired CTLA4 polypeptide. When optimal cell
density is reached, the environmental conditions can be altered
to those appropriate for expression of the polypeptide according
to procedures known in the art or as described in the examples
below. Therefore, prior to harvesting the expressed CTLA4
~ 3 1 9
W095/Olgg4 PCT~S94/07685
polypeptides, it is particularly useful to allow the host cells
to grow near optimal density before inducing expression.
Expression of the recombinant CTLA4 polypeptides can be
confirmed by using anti-CTLA4 antibodies according to assay
procedures known in the art, such as Western blotting or ELISA
for example. Once expression of the recombinant polypeptides has
been confirmed, the polypeptides can then be harvested according
to methods known to those skilled in the art.
The recombinant polypeptides can be purified after
harvesting, and, if necessary, before or after allowing the
recombinant polypeptide to assume an active structure.
Preferably, the polypeptides are purified before assuming their
active tertiary or quaternary structure. Methods for purifying
the recombinant proteins are known in the art and include, for
example, the methods described in EP Application No. 90 113
673.9, which is incorporated herein by reference.
For polypeptides that are expressed in a biologically
inactive form or to increase their biological activity, the
following general refolding procedures can be used. These
procedures are particularly useful to produce biologically active
polypeptides expressed by procaryotic host cells, such as E.
Coli .
First, intramolecular or intermolecular disulfide bonds or
other non-covalent interactions that have occurred during the
expression of the CTLA4 polypeptides are disrupted by exposing
the polypeptides to denaturing and reducing agents. Suitable
denaturing agents are those compounds or chemicals that cause a
change in the conformation of a protein by disrupting the
intermolecular or intramolecular bonds that results in a loss of
biological activity without substantially affecting its primary
structure. Examples of such denaturing agents include guanidine
hydrochloride and urea.
Preferably, guanidine hydrochloride is used as the
denaturant. The concentration of guanidine is in the range of
about 0.5M to about 6.OM, preferably at least about 6.OM.
If urea is used as the denaturing agent, any interfering
cyanate that may form can be removed by passing the urea solution
WO95/01994 2~ ~ ~ 31~ PCT~S94/07685
over an anion exchange column, such as DOWEX 1-X8 (BioRad,
Richmond, California). Cyanate can modify amino groups in the
protein and, therefore, should be removed. (Stark, Methods in
Enzymoloqy 11:125 (1967))
Next, the disulfide bonds are then reduced with a reducing
agent. Suitable reducing agents include, for example, beta-
mercaptoethanol, dithiothreitol (DTT) and cysteine. Preferably,
DTT is used as the reducing agent. The preferred DTT
concentration is 6mM. In one embodiment as described in Examples
5 and 8A, the free thiols present in the reduced protein are
oxidized by the addition of a large excess of an oxidizing agent,
preferably a disulfide-contA;n;ng oxidizing agent such as, for
example, oxidized glutathione or cystine. Finally, the resulting
solution is diluted prior to adding a second reducing agent to
catalyze disulfide interchanges. Preferably, the second reducing
agent contains a sulfhydryl (thiol) group such as, for example,
DTT, 2-mercaptoethanol, dithioerythritol, cysteine, cystamine.
The second reducing agent can a~so be a disulfide containing
compound such as sodium borohydride or any of the Group VIA
hydrides having added cystine, oxidized glutathione or any
cysteine-contA; n ing peptides. The purpose of adding the second
reducing agent is to produce an environment in which the CTLA4
recombinant polypeptides assume a variety of 3-dimensional
configurations by the formation and breaking of various disulfide
or other non-covalent bonds. Although not wishing to be bound by
any particular theory, it is believed the proper 3-dimensional
structure and disulfide bonding pattern of the wild-type CTLA4
receptor protein is energetically more stable than other possible
conformations. Therefore, under conditions in which the
recombinant polypeptides are allowed to assume a variety of 3-
dimensional conformations, a significant proportion of the
polypeptides will form biologically active conformations. In
addition, this environment also facilitates the formation of
dimers through intermolecular disulfide bonds.
In a second preferred method, the denatured and reduced
protein is diluted and allowed to refold into monomers and dimers
WO95/01994 21~ ~ 319 PCT~S94/07685
without the addition of additional oxidizing or reducing agents
as described in Example 8B.
The monomeric and dimeric forms can then be separated
following the procedures described in Examples 5 and 8 below.
Briefly, the mixture is first dialyzed and centrifuged. The
resulting supernatant is thereafter passed over an ion,
preferably an anion, exchange column, followed by passage over a
sizing column, such as Superdex 75 column for example. Passage
over the ion exchange column results in a dimer pool mixture of
about 70% dimers, while the further passage over the sizin~
column results in a dimer pool mixture of at least 90% dimers,
and preferably about 95% dimers. The same procedure yields a
monomer pool mixture of at least about 85% monomers. Thereafter,
the mixture can be passed over a phenyl sepharose column or,
alternatively, over a reverse phase column for further separating
the monomers from the dimers. Useful ion exchange columns
include, without limitation, Mono Q, Q-Sepharose, Resource Q and
Source 15Q columns. Other equivalent separation procedures known
to those skilled in the art can also be used to separate the
various recombinant CTLA4 forms.
The present invention also provides functional derivatives
of the recombinant CTLA4 polypeptides. As used herein, the term
"functional derivative" means any biologically active modified
form of the recombinant CTLA4 polypeptides. Such modifications
can be (1) substitutions or additions in the amino acid sequence,
and/or (2) the addition of another functional group to be used as
a cross-linking agent or to improve certain pharmacokinetic or
immunologic properties. Such modifications, however, should not
substantially decrease the biological activity of the parent
recombinant polypeptide by no more than a 10-fold decrease,
preferably less than a 5-fold decrease in activity. Therefore,
as used herein, the term "functional derivative" can mean an
active fragment, an analog or a derivative of a recombinant CTLA4
polypeptide described above that substantially retains the
biological activity of the unmodified recombinant CTLA4
polypeptide. In the case of analogs, such modified polypeptides
preferable have an amino acid homology of greater than about 40~
319
W095/01994 PCT~S94/07685
compared to SEQ. ID. N0. 2, more preferably in excess of 50%, and
most preferably in excess of 90%. An amino acid homology of
about 99~ is particularly useful.
For example, one modification can be the substitution or
addition of a cysteine to provide a "free cysteine" within the
amino acid sequence to produce a "cysteine mutein." The terms
"cysteine mutein" or "CTLA4 mutein," as used herein, refers to
muteins having at least one cysteine that is not involved in an
intramolecular or intermolecular disulfide bond. The free
cysteine can appear at any amino acid residue that does not
substantially interfere with its ability to bind B7.
Preferably, a cysteine is substituted for at least one amino acid
appearing at residue number 79, 80, 81, 109, 110, 111, or added
after residue number 125 of SEQ.ID.NO. 2 from the N-terminal end.
The muteins and other derivatives can be prepared by methods
well known to those skilled in the art. Such methods include,
for example, mutagenic tec-hn;ques in which nucleotides are
substituted or added that encode for a cysteine. A general
method is described, for example, in U.S. Patent No. 4,518,584,
incorporated herein by reference. Alternatively, the muteins can
be synthesized by methods also known to those skilled in the art.
In one embodiment, the cysteine mutein can be attached to
polyethylene glycol (PEG) at a free cysteine to increase its
molecular weight and improve its pharmacokinetic properties such
as an increased serum half-life. Long chain polymer units of PEG
can be bonded to the mutein via covalent attachment to the
sulfhydryl group of a free cysteine residue on the mutein.
Various PEG polymers with different molecular weights can be
used, for example, 5.0 kDa (PEG5~), 8.5 kDa (PEG8s~), 10 kDa
(PEGlo~), and 20 kDa tPEG20~). To obtain selectivity of reaction
and homogenous reaction mixture, it is useful to use
functionalized polymer units that will react specifically with
the sulfhydryl groups. The functional or reactive group attached
to the long chain PEG polymer is the activating group to which
the mutein attaches at the free cysteine site. Suitable
activating groups include, for example, maleimide, sulfhydryl,
thiol, triflate, tresylate, aziridine, exirane or 5-pyridyl. PEG
14
WO95/01994 21~ ~ 3 ~ 9 PCT~S94/07685
molecules can also be attached to CTLA4 at free amines using NHS
(N-hydroxysuccinimide)-derivatized PEG molecules.
Other CTLA4 conjugates are also contemplated, for example,
(1) by attaching a single PEG molecule to a CTLA4 monomer (mono-
pegylated) or dimer, for example, at free amines as described inthe examples below; (2) by attaching two PEG molecules to a CTLA4
dimer, or (3) by attaching two or more CTLA4 monomers or dimers
through a cross-linking moiety, such as PEG, to produce a
compound that can be depicted schematically as a "dumbbell."
Alternatively, two or more CTLA4 dimers can be attached through
a cross-linking moiety such as PEG to produce a "dimer dumbbell."
To create the dumbbell compounds, a PEG molecule cont~in;ng
two activating groups can be used such as, for example, PEG bis-
maleimide (a PEG molecule containing a maleimide activating group
on each end of the molecule) or bis-NHS-PEG (a PEG molecule
cont~;n;ng an NHS group at each end of the molecule). Those
skilled in the art can readily determine the appropriate pH,
concentration of polypeptide, and ratio of polypeptide to PEG
necessary to produce a useful yield of the mono-pegylated or
dumbbell polypeptide.
The present invention further provides pharmaceutical
compositions containing the recombinant CTLA4 polypeptides or its
functional derivatives in a pharmaceutically acceptable carrier.
The term "pharmaceutically acceptable carrier" as used herein
means a non-toxic, generally inert vehicle for the active
ingredient, which does not adversely affect the ingredient or the
patient to whom the composition is administered. Suitable
vehicles or carriers can be found in standard pharmaceutical
texts, for example, in Reminqton's Pharmaceutical Sciences, 16th
ed., Mack Publishing Co., Easton, PA (1980), incorporated herein
by reference. Such carriers include, for example, aqueous
solutions such as bicarbonate buffers, phosphate buffers,
Ringer's solution and physiological saline. In addition, the
carrier can contain other pharmaceutically-acceptable excipients
for modifying or maint~;n;ng the pH, osmolarity, viscosity,
clarity, color, sterility, stability, rate of dissolution, or
odor of the formulation.
~l4~3~
WO9S/01994 PCT~S94/07685
The pharmaceutical compositions can be prepared by methods
known in the art, including, by way of an example, the simple
mixing of reagents. Those skilled in the art will know that the
choice of the pharmaceutical carrier and the appropriate
preparation of the composition depend on the intended use and
mode of administration.
Once the pharmaceutical composition has been formulated, it
can be stored in sterile vials as a solution, suspension, ~el,
emulsion, solid, or as a dehydrated or lyophilized powder. Such
formulations can be stored either in a ready-to-use form or in a
form that requires reconstitution prior to a~m; n; ~tration.
Generally, storage of the formulations is at temperatures
conventional for such pharmaceuticals, including room temperature
or preferably 4C or lower, such as -70C. The formulations can
be stored and administered between a pH range of about 5 to 8,
preferably at about physiological pH.
The recombinant CTLA4 polypeptides and their functional
derivatives can be used for a variety of purposes. In one
embodiment, the recombinant polypeptides can be used as
immunogens to produce polyclonal or monoclonal antibodies
according to methods known in the art such as described, for
example, in Harlow & Lane, Antibodies: A LaboratorY Manual
(1988), incorporated herein by reference. Because CTLA4 is
immunosuppressive, preferably the recombinant CTLA4 polypeptides
are first denatured and, if desired, reduced prior to their use
as an immunogen to produce anti-CTLA4 antibodies. Such
antibodies can, in turn, be used to detect CTLA4 receptor
proteins on the cell surface of T cells or for in vivo uses such
as imaging or to inhibit the binding of B7 to such receptor
proteins according to procedures well known in the art.
The recombinant polypeptides of the present invention can
also be used as research reagents to detect the presence of B7 or
to purify B7 according to procedures known in the art. For
diagnostic purposes, the recombinant polypeptides can be labelled
with a marker prior to being exposed to a sample suspected of
containing the ligand to be detected. The polypeptides can also
be attached to a solid support for the purification of B7.
WO95/01994 ~ I 4 4 ~19 PCT~S94/07685
Additionally, the recombinant polypeptides and functional
derivatives thereof can be used to prevent, suppress or treat
disorders associated with inappropriate T cell activation and
proliferation. Accordingly, the present invention provides 5 methods for the therapy of disorders associated with such
deleterious T cell activation and proliferation. Such disorders
include, for example, transplantation rejection, various
autoimmune diseases and other T-cell mediated disorders. PCT
Publication No. WO 93/0043l, incorporated herein by reference,
describes various T-cell mediated disorders. The autoimmune
diseases for which the administration of CTLA4 polypeptides and
functional derivatives may be useful include rheumatoid
arthritis, asthma, Lupus, multiple sclerosis, psoriasis, graft
versus host disease, Type I diabetes and other autoimmune
diseases described in E. Rubenstein & D. Federman, Scientific
American Medicine, vol. 2, chapter IV (1993), incorporated herein
by reference.
The therapeutic methods of the present invention are
accomplished by administering to a patient an effective amount of
a recombinant CTLA4 polypeptide of the present invention or a
functional derivative thereof to inhibit deleterious T cell
activation. The active ingredient is preferably formulated into
a pharmaceutical composition as previously described.
As used herein, the term "patient" refers to any animal
having T cells that are capable of being co-stimulated by B7,
including humans. In addition, the recombinant CTLA4
polypeptides and their functional derivative are also referred to
as the "active ingredient(s)."
An effective dosage depends on a variety of factors known to
those skilled in the art, including the species, age, weight, and
medical condition of the patient, as well as the type of disorder
to be prevented, suppressed or treated, the severity of the
condition, the route of administration and the active ingredient
used. A skilled physician or veterinarian can readily determine
and prescribe an effective amount of the active ingredient.
Generally, treatment is initiated with small dosages
substantially less than the optimum dose of the active
319
WO95/01994 PCT~S94/07685
ingredient. Thereafter, the dosage is increased by small
increments until the optimum or desired effect is attained
without causing significant harm or deleterious side effects.
Preferably, the daily dosage is in the range of about 10-2000 mg
per human patient.
The compounds and pharmaceutical compositions of the present
invention can be administered orally or parenterally by any means
known in the art, including, for example, by intravenous,
subcutaneous, intraarticular or intramuscular injection or
infusion. To achieve and maintain the desired effective dose,
repeated administration may be desirable. The frequency of
dosing ~ill depend on several factors such as, for example, the
formulation used, the type of disorder, the individual
characteristics of the patient, and the like. Those skilled in
the art can readily determine the appropriate frequency based on
such factors.
The following examples are intended to illustrate but not
limit the present invention.
EXAMPL~ 1
Cloninq of CTLA4
DNA sequences encoding the extracellular domain of the CTLA-
4 protein were cloned from a human T cell leukemia cell line; Hut
78, using the Polymerase Chain Reaction (PCR) tPchn;que. The
HuT 78 cell line (catalogue # TIB 161) was obtained from the
American Type Culture Collection in Rockville, MD. The Hut 78
cells were grown in RPMI 1640 medium containing 10~ fetal bovine
serum, 2 mM glutamine, S x 10-5 M 2-mercaptoethanol, 100 U/ml
penicillin, and 100 ug/ml streptomycin at 4x105 cells/ml. The
cells were activated by the addition of 5ng/ml phorbol 12-
myristate 13-acetate (catalogue #P-8139, Sigma Chemical Company,
St. Louis, M0), 1 ~g/ml PHA-L (catalogue # L-4144, Sigma Chemical
Company, St. Louis, M0), 5 ng/ml IL-2 (R&D Systems, Minneapolis,
MN) and grown for an additional 49 hours. At harvest, 9x106 cells
were washed in phosphate buffered saline (PBS), pelleted, frozen
wo 95,0lgg4 ~ 3 ~ 9 PCT~S94/07685
immediately in liquid nitrogen and stored at -70C overnight. The
next day the frozen cells were resuspended in 3ml of PBS and 1 ml
(3x106 cells) was pelleted briefly in a microfuge. Messenger RNA
was prepared from the cells using a "Micro FastTrack mRNA
Isolation Kit" purchased from Invitrogen Corporation (San
Diego,CA) according to the instructions provided by the
manufacturer. The resulting mRNA pellet was resuspended in 10~1
of water and lul was used to prepare first strand cDNA using a
"cDNA Cycle Kit" (Invitrogen Corporation) and random primers
supplied in the kit. The first strand cDNA synthesis procedure
was performed according to the manufacturer's instructions.
The mature, extracellular portion (from alanine 1 to
aspartate 125) of the cDNA for CTLA-4 (Dariavach et al., Eur. J.
Immunol., vol. 18, pp. 1901-1905 (1988)) was amplified by PCR
using one-fifth of the total cDNA volume (4 ~1 of 20 ~1) of the
first strand cDNA in a mixture containing lOmM Tris pH 8.3, 50mM
KCl, 1.5mM MgCl2, 0.001% (w/v) gelatin, 200uM each of dATP, dCTP,
dGTP, & TTP, and 20 pmoles of each oligonucleotide primer
[5'CCCCATATGGCAATGCACGTGGCCCAGCCTGCT3' (SEQ ID N0:3) and
5'CCCAAGCTTGGTACCTTATCAGTCAGAATCTGGGCACGGTTCTGG3' (SEQ ID NO:4)
(regions that overlap CTLA-4 DNA sequences are underlined) in a
volume of 100~1. After denaturing the RNA/cDNA hybrids at 95C
for 1 minute the temperature was lowered to 60C and 0.5~1 (2.5
units) of "AmpliTaq DNA Polymerase" (Perkin-Elmer Corporation,
Norwalk, CT) was added and the temperature raised to 72C for 1
minute. The PCR was performed in an Ericomp "Twinblock" thermal
cycler (San Diego, CA) with 29 additional cycles comprising 1
minute at 95C, 1 minute at 60C, and 1 minute at 72C. The PCR
amplification was completed with a 10 minute incubation at 72C.
After verifying that a 0.4kb PCR fragment was produced (by
running a small aliguot of the reaction mixture on a 1.5~ agarose
gel) the reaction mixture was extracted with phenol once,
followed by precipitation with ethanol and subsequently digested
with NdeI and HindIII restriction endonucleases. The digested
DNA was put through a spin column to remove small DNA fragments
and a small portion (equivalent to about one twentieth of the
original PCR reaction) was ligated to NdeI-HindIII cut pT88IQ, a
19
WO95/01994 2 ~ 19 PCT~S94/07685
Tac promoter expression plasmid, and inserted into E. coli host
strain DH5-alpha (available from GIBCO BRL, Gaithersberg, MD).
The expression vector pT88IQ is a derivative of the
expression vector pT3XI-2. The vector pT3XI-2 was constructed in
the following manner. The starting plasmid for this construction
was plasmid pKK223-3 purchased from Pharmacia. Plasmid pKK223-3
carries a partial gene for tetracycline resistance. This
nonfunctional gene was replaced by a complete tetracycline
resistance gene carried on plasmid pBR322. Plasmid pKK223-3 was
digested completely with SphI and partially with BamH1. A 4.4
kilobase pair fragment was gel purified and combined with a
synthetic adapter (SEQ ID N0:5):
5' GATCTA~.A~TTGTCATGTTTGACAGCTTATCAT 3'
3' ATCTTAACAGTACAAACTGTCGAATAGTAGC 5
BglII ClaI
and a 539 basepair fragment of DNA from a ClaI, SphI digest of
the tetracycline resistance gene of pBR322 (PL Biochemicals, 27-
4891-01). The resulting plasmid was designated pCJl.
Next, a XhoI linker purchased from New England Biolabs
(Beverly, Massachusetts) was inserted into plasmid pCJl's PvuII
site to form plasmid pCJX-l. This insertion disrupts the rop
gene which controls plasmid copy number. Next, an EcoRI fragment
cont~i~;ng the lacI gene was purified from plasmid pMCg (Calos
et al., 1983), then inserted into the XhoI site with Xho~ to
EcoRI adapters. The polylinker region in plasmid pKK223-3 was
next replaced with a polylinker cont~;ning additional sites by
cutting with EcoRI and PstI (SEQ ID N0:6):
5' AATTCCCGGG TACCAGATCT GAGCTCACTA GTCTGCA 3'
3' GGGCCC ATGGTCTAG~ CTCGAGTGAT CAG 5'
The plasmid vector so obtained is designated pCJXI-l.
Finally, the tetracycline resistance gene was replaced with
a similar gene which had the recognition sites for restriction
enzymes HindIII, BamHl, and SalI destroyed by bisulfite
mutagenesis. The following procedure was used to mutate the
tetracycline resistance gene of pBR322. Plasmid pBR322 was cut
with HindIII, then mutagenized with sodium bisulfite (Shortle and
Botstein, 1983). The mutagenized DNA was ligated to form
2l~l3l~
WO95/01994 PCT~S94/07685
circular DNA, then cut with HindIII to linearize any plasmid that
escaped mutagenesis. This digestion mixture was used to
transform E. coli JM109 (Yanisch-Perron et al., 1985).
Tetracycline-resistant colonies were isolated and checked for
loss of the HindIII site in the tetracycline resistance gene of
the plasmid. A successfully mutated plasmid was designated pTl.
A similar procedure was followed to mutagenize the BamH1 site in
pT1, yielding plasmid pT2. Plasmid pT2 in turn was mutagenized
to remove the SalI site, forming plasmid pT3. A ClaI-StyI
fragment of pT3 carrying the mutated tetracycline resistance gene
was isolated and used to replace the homologous fragment of
pCJXI-1 to form pT3XI-2. The mutated tetracycline resistance
gene still encodes for a functional protein. Downstream of the
tac promoter region, a polylinker was introduced which contains,
among other sites, BamH1 and KpnI restriction sites useful for
cloning genes for expression in E. coli as described below.
As in pT3XI-2, the expression of the cloned gene containing
the pT88IQ vector is driven by the tac promoter. Translation
starts at the ATG of the unique NdeI recognition sequence CATATG
(a downstream NdeI site was eliminated so that this start site
NdeI sequence would be unique). There is a polylinker downstream
of the NdeI site to facilitate insertion of the desired gene. In
addition, the XhoI fragment cont~;n;ng the lacI region is
replaced by a truncated fragment which eliminates the lacZ
promoter and the operator region which is a binding site for the
lac repressor. The lacI region in the replacement also carries
the lacIq mutation -- a single base substitution which results in
an increase in lac repressor production (Muller-Hill et al.,
Proc. Nat'l Acad. Sci. (U.S.A.) 59:1259-1264 (1968)).
The specific differences between pT3XI-2 and pT88IQ are as
follows:
1. The cloning site region.
Between the EcoRI site upstream of the polylinker
and the HindIII site at the downstream end of the polylinker, the
following 135-mer sequence was substituted (SEQ ID NO:7):
5' >CACAACGGTTTCCCTCTAGAAA~ATTTTGTTTAACTT~AA~-~AGGA~A~AT~
W095/01994 ~ 319 PCT~S94/07685
CATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCCCGGGTACCGTCGA
CGAGCTCTTCGAACTAGTCCGCGGT > 3'
This sequence contains an NdeI site (underlined) at the
start codon for expression and a polylinker containing
S recognition sites for BamHI, XmaI, KpnI, SalI, SacI, BstBI, SpeI
and SacII.
2. The downstream NdeI site.
There is an NdeI site in pT3XI-2 about 2.4 Kb
downstream of the cloning region. This site was eliminated so
that the NdeI site at the start codon as described above was
unique in pT88IQ. The site was changed from 5' > CATATG > 3' to
S' > CA~ATATG > 3', eliminating the NdeI recognition sequence.
3. The lacIq region.
The region in pT3XI-2 between the two XhoI sites
cont~;n;ng the lacI region was replaced by the 1230 base sequence
shown below:
lacIq sequence of pT88IQ (1230 BP) (SEQ ID NO:8)
CCATGGCTGG TGCCTAATGA GTGAGCTAAC TCACATTAAT TGCGTTGCGC
TCACTGCCCG CTTTCCAGTC GGGAAACCTG TCGTGCCAGC TGCATTAATG
AATCGGCCAA CGCGCGGGGA GAGGCGGTTT GCGTATTGGG CGCCAGGGTG
~lllllCTTT TCACCAGTGA GACGGGCAAC AGCTGATTGC CCTTCACCGC
CTGGCCCTGA GAGAGTTGCA GCAAGCGGTC CACGCTGGTT TGCCCCAGCA
GGC~.AAAATC CTGTTTGATG GTGGTTGACG GCGGGATATA ACATGAGCTG
TCTTCGGTAT CGTCGTATCC CACTACCGAG ATATCCGCAC CAACGCGCAG
CCCGGACTCG GTAATGGCGC GCATTGCGCC CAGCGCCATC TGATCGTTGG
CAACCAGCAT CGCAGTGGGA ACGATGCCCT CATTCAGCAT TTGCATGGTT
TGTTGAAAAC CGGACATGGC ACTCCAGTCG CCTTCCCGTT CCGCTATCGG
CTGAATTTGA TTGCGAGTGA GATATTTATG CCAGCCAGCC AGACGCAGAC
GCGCCGAGAC AGAACTTAAT GGGCCCGCTA ACAGCGCGAT TTGCTGGTGA
CCCAATGCGA CCAGATGCTC CACGCCCAGT CGCGTACCGT CTTCATGGGA
~AAAATA~TA CTGTTGATGG GTGTCTGGTC AGAGACATCA AGAAAT~ACG
CCGGAACATT AGTGCAGGCA GCTTCCACAG CAATGGCATC CTGGTCATCC
AGCGGATAGT TAATGATCAG CCCACTGACG CGTTGCGCGA ~AA~A~TGTG
CACCGCCGCT TTACAGGCTT CGACGCCGCT TCGTTCTACC ATCGACACCA
CCACGCTGGC ACCCAGTTGA TCGGCGCGAG ATTTAATCGC CGCGACAATT
TGCGACGGCG CGTGCAGGGC CAGACTGGAG GTGGCAACGC CAATCAGCAA
CGACTGTTTG CCCGCCAGTT GTTGTGCCAC GCGGTTGGGA ATGTAATTCA
WO95/01994 ~ 4 319 PCT~S94/07685
GCTCCGCCAT CGCCGCTTCC A~lllllCCC GCGTTTTCGC AC.~ACGTGG
CTGGCCTGGT TCACCACGCG GGAAACGGTC TGATAAGAGA CACCGGCATA
CTCTGCGACA TCGTATAACG TTACTGGTTT CACATTCACC ACCCTGAATT
GACTCTCTTC CGGGCGCTAT CATGCCATAC CGCr-~AAGGT TTTGCACCAT
TCGATGGTGT CGGAATTAAT TCAGCCATGG
This substituted region eliminates the lacZ promoter and the
~ operator region which is a binding site for the lac repressor.
It also contains the lacIq mutation which causes an increase in
lac repressor synthesis (Muller-Hill et al., supra.).
Plasmid DNA was prepared from several of the resulting
colonies and the inserted DNA was sequenced. Several clones of
the expected sequence were found and expression studies showed
that they produced a recombinant protein of the expected size
(about 14 kDa) of sCTLA-4.
To increase the expression level, the sCTLA-4 region of
clone 59-8-7 was cut out with NdeI and K~nI, eluted from an
agarose gel to purify it away from the pT88IQ plasmid, and
ligated to similarly cut T7 promoter expression vector pT5T as
described in PCT Patent Publication No. WO 91/08285, incorporated
herein by reference. The pT5T::sCTLA4 construct was inserted
into E. coli host strain HMS174/DE3 (obtained from Dr. F. William
Studier, Brookhaven National Laboratory, Upton, NY), and plasmid
DNA prepared from 3 colonies. The plasmid DNAs were sequenced to
verify that the sCTLA4 DNA sequences were correct and had been
inserted correctly. One clone, 59-8-14, was selected for
expression and refolding studies and is referred to henceforth as
pT5T::sCTLA-4. All of the CTLA4 cDNAs obtained in the present
study contained a threonine residue, and not an alanine residue,
at amino acid position 111 of the protein sequence (SEQ ID NO:2).
This result confirms the corrected nucleotide sequence of human
CTLA4 reported by Linsley et al., J. Exp. Med. 174:561-569
( 1991) -
Preliminary expression of the sCTLA4 protein was performed
by growing pT5T::sCTLA-4 in HMS174/DE3 in Luria Broth containing
12ug/ml tetracycline to an OD~ of 1.0 and inducing expression of
sCTLA-4 by adding isopropyl beta-D thiogalactopyranoside (IPTG,
catalogue #I-5502, Sigma Chemical Company, St. Louis, MO) to a
WO95/01994 21~ 4 319 PCT~S94/07685
concentration of lmM. Cells were harvested at two hours post-
induction. Small aliquots of whole cells were boiled in SDS
sample buffer containing 5% 2-mercaptoethanol for 2 minutes and
run on a 14% polyacrylamide SDS gel. The most prominent band
visible upon staining the gel with coomassie blue was
approximately the 14 kDa sCTLA-4. This band was absent in a
control culture lysate prepared from HMS174/DE3 that contained
pT5T with a different gene (interleukin-6) in it.
EXAMP~E 2
Large Scale Production of sCTLA4
A 10 liter fermentation was done to provide sufficient
quantities of recombinant sCTLA4 for biochemical analyses.
E.coli strain HMS174/DE3 containing plasmid pT5T::sCTLA4 was
grown at 3~C in 10 L of complex medium ( 40 g/L NZ-amine HD, 4
g/L KH2PO4, 1 g/L MgSO4-7H20, 1 g/L Na2SO4, 0.3 g/L Na3citrate-2H20,
50 g/L glycerol, 10 mg/L thiamine HCl, 2 ml/L trace minerals,
0.05 ml/L Mazu DF-204 and 15 mg/L tetracycline) until the optical
density at A660 was 10. At this time the cells were induced by
adding 0.24 grams of IPTG ( a final concentration of 0.1 mM) to
the culture. The cells were grown for an additional 6.5 hours
and then harvested by centrifugation. The cell pellet was stored
frozen at -20C until use.
EXAMPLB 3
Preparation of Washed Inclusion Bodies (WIBS)
403 grams wet weight of the E. coli cell pellet prepared
according to Example 2 were diluted with 2 liters of breaking
buffer (25mM NaCl, 50mM Tris-HCl pH 7.5, lmM dithiothreitol).
The resulting slurry was passed through a Rannie mini-mill (APV
Gaulin, Inc., Everett, MA) three times at a pressure of 10,000
PSI to break the cells. The broken cells were spun at 5,000 rpm
in a Beckman J2-20 centrifuge using a JA-10 rotor for 15 minutes.
The supernatant was decanted and discarded. The loose pellets
were resuspended in breaking buffer and spun again for 60 minutes
at 10,000 rpm and the supernatant decanted. A two-phase pellet
WO95/01994 ~19 PCT~S94/0768~
was observed: the lower pellet was white and the loose upper
pellet was beige. The pellets were frozen at -20C. Sodium
dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
analysis of samples from the two pellets showed that the majority
of the sCTLA-4 was present in the lower white pellet and that the
upper beige pellet was composed primarily of E. coli membrane
proteins.
To remove the E. coli membrane proteins, the frozen pellets
of Example 2 were thawed and resuspended in 1.5 liters of
breaking buffer by homogenization with a Polytron PT 3000 mixer
(Kinematica AG, Littau, Switzerland) at 8000 rpm. The mixture was
then spun at 8000 rpm (11,000 x g) in a JA-10 rotor for 30
minutes. The pellets were frozen at -20C. The next day the
pellets were thawed and resuspended (by homogenization with the
Polytron mixer at 5000 rpm) in 2.1 liters of breaking buffer and
centrifuged at 8000 rpm as before. The bottles were decanted to
remove most of the remaining beige membrane layer, which was
discarded. The pellet that rPr~;n~ is referred to as washed
inclusion bodies (WIBS). The wet weight of the washed inclusion
bodies was 92.5 grams, which is about 23~ of the weight of the
original E. coli cell pellet. The WIBs were frozen at -20~C until
used.
EXAMPLE 4
Refoldinq and in vitro activitY of sCTLA4 from WIBS.
One gram of WIBs was denatured in 60 ml of freshly made 6M
guanidine HCl, O.lM Tris pH 8.0, 6mM dithiothreitol by
homogenizing briefly using a Polytron mixer at 2000-3000 rpm and
leaving at room temperature for 15 minutes. The insoluble debris
was pelleted by spinning at 18,000 rpm in a JA-20 rotor for 15
minutes. 3.3 ml of 0.5M glutathione was added to the supernatant
and left for 15 minutes at room temperature. The following
solutions were added sequentially with stirring at room
temperature:
1) 40 ml 6M guanidine in 5OmM Tris-HCl, pH 9.7
2) 500 ml 50mM Tris-HCl, pH 9.7
2~41~
WO95/01994 PCT~S94/07685
3) 6 ml 0.5M cysteine
4) 6 ml lOOmM phenylmethanesulfonyl fluoride (in 100%
ethanol)
The preferred concentration of guanidine-HCl in the re~old
mixture was determined to be between 0.6M and 4M.
The bottle cont~;n;ng the sCTLA4 refold mixture was left at
4C for 2 days to allow the sCTLA4 to refold into its proper
conformation. At this time, 50 ml of the refold mixture was
removed and tested for biological activity. Before testing, the
refold mixture was centrifuged for 15 minutes in a JA-20 rotor at
8,000 rpm in a J2-21 centrifuge (Beckman Instruments, Palo Alto,
CA) to remove any precipitate that had formed during the
refolding procedure. Twenty-five ml of the supernatant was then
dialyzed against 4 liters of 50 mM NaCl, 20 mM Tris-HCl, pH 8.
Ten ml of human serum albumin (HSA) at a concentration of 300
ug/ml in 50 mM NaCl, 20 mM Tris-HCl pH 8 was dialyzed in the same
flask. The HSA was obtained from ICN Pharmaceuticals, Inc.
(Costa Mesa, CA, catalogue number 823011). After dialysis the
refold mixture and HSA solutions were centrifuged at 8,000 rpm
for 15 minutes in a JA-20 rotor to remove precipitated material.
The protein concentrations of the dialyzed sCTLA4 refold mixture
and HSA were determined to be 750 ug/ml and 220 ug/ml,
respectively.
The dialyzed, sCTLA4 refold mixture was tested for
biological activity in an in vitro mixed lymphocyte reaction (see
Methods in Immunology, pg.487-497, eds: J. S. Garvey, N. E.
Cremer and D. H. Sussdorf, The Benjamin/Cummings Publishing
Company, Re~;ng, MA, 1977). In this assay lymphocytes from two
different individuals are mixed together. Because of differences
in their antigenicity, the cells recognize each other as foreign.
This initiates an immune response that results in lymphocyte
proliferation. The proliferative response of the cells is
measured by pulsing the cells with 3H-thymidine according to the
stAn~Ard mixed lymphocyte reaction procedure described herein.
Lymphocytes were isolated from anticoagulated blood
treated with one-tenth volume of 3.8% sodium citrate made up in
26
~14~19
W095/01994 PCT~S94/07685
an endotoxin-free 0.9% saline solution ) obtained from human
subjects A and B using Accuspin-System Histopaque 1077 media
purchased from Sigma Diagnostics, St. Louis, M0. The cell
isolation procedure followed was that described in the
manufacturer's directions that accompany the kit. Lymphocytes
from individual B were treated with mitomycin C (obtained from
Sigma Chemical Company, St. Louis, M0) at a concentration of 25
ug/ml for 30 minutes at 37C. The cells were washed four times
with 10 ml of media to remove the mitomycin C. Lymphocytes from
each individual were resuspended at 1 x 106/ml in Complete medium
tRPMI 1640 medium cont~;n;ng 25 mM HEPES buffer, 10~ human AB
serum, 2 mM glutamine, 100 U/ml penicillin and 100 ug/ml
streptomycin). In cases where the two lymphocyte populations
were mixed, 100 ~l of each cell suspension were added per well of
a 96 well tissue culture plate (Corning Glass Works, Corning,
NY). Control wells, which were used to measure proliferation of
unstimulated lymphocytes, contained 200 ~1 of cells from a single
individual. Aliquots of the dialyzed, unfractionated sCTLA4
refold mixture or HSA were suspended in complete medium at
concentrations of 0.05-50 ~g/ml. 50 ~l aliquots of the
suspensions were added to appropriate wells of the mixed cell
populations. Samples were tested in triplicate. After
incubation for 5 days at 37C, each well received 2 ~Ci of 3H-
thymidine (Dupont, catalogue # NET-027Z) in 50 ~l of complete
medium. Approximately 18-20 hours later, the cells were
harvested onto glass fiber filter strips using a PHD Cell
Harvestor (both purchased from Cambridge Technology, Inc.,
Watertown, MA). The cells were washed 3 times with PBS and DNA
precipitated using 7% trichloroacetic acid. Filters were washed
with absolute methanol and air dried. 3H-thymidine incorporated
into DNA was measured by scintillation counting. Means of
triplicate wells were calculated for each test sample.
The results of this experiment are shown in Table 1. The
data show that the sCTLA4 refold mixture caused a dose-dependent
inhibition of lymphocyte proliferation, as measured by a decrease
in 3H-Thymidine incorporation into DNA. The maximum inhibition
observed was 85% at a protein concentration of 10 ug/ml. The
3 ~ ~ --
WO95/01994 PCT~S94/07685
protein concentration of the refold mixture that gave 50%
inhibition was about 100 ng/ml. HSA did not cause a similar
inhibition of lymphocyte proliferation, indicating that the
inhibition observed with the sCTLA4 refold mixture was specific.
TABLE 1
INXIBITION OF LYMPHOCYTE PROLIFERATION IN THE
MI~ED ~YNP~OCYTE REACTION (~UMAN 8~BJECTS A AND B)
BY AN UNFRaCTIONATED sCTLA-4 REFOLD MIX
REFO~D NIX ~3A
DOSE ~ %
10~ng/ml) cpm* INHIBI~ION** cpm*IN~IBITION**
o 3535 0% 3036 o
2746 29% 3382 -17
100 2153 51% 3694 -33
1,000 1703 67% 3400 -18%
1510,000 1237 85% 2953 4%
* Counts per minute. Means of triplicate wells
** Percent inhibition was determined after first subtracting
the cpms for an equivalent number of unmixed cells of subjects A
and B from the cpm totals. These "unstimulated cell" cpms
totaled 816 and 1021 for the sCTLA-4 refold mix and HSA,
respectively. A negative percent inhibition indicates
stimulation.
EXAMPLE 5
Purification and bioloqical activities of
sCTLA4 monomers and dimers
A. Purification
300 ml of a refold mixture prepared as described in Example
4 was dialyzed in SPECTRO/POR 3 tubing (Spectrum Medical
Industries, Los Angeles, CA) against 5700 ml of 20mM Tris-HCl pH
8.0 at 4overnight. After dialysis, an extensive precipitate was
observed. SDS-PAGE analyses showed that the precipitate is
composed largely of E. coli membrane proteins and improperly
refolded sCTLA-4. The dialyzed refold mixture was centrifuged at
8000 rpm in a JA-10 rotor for 15 minutes. The supernatant was
28
WO95/01994 ~ i 4~ 9 PCT~S94/07685
passed through a 0.45 micron filter (Nalge Company, Rochester,
NY) to remove residual precipitate and loaded onto a 20 ml Q-
sepharose column (Pharmacia LKB, Picataway, NJ) and washed with
50mM guanidine, 20mM Tris-HCl pH 8Ø The bound protein was
eluted with a 600 ml linear salt gradient from 0 to 60% lM NaCl,
20mM Tris pH 8.0 at a flow rate of 5 ml/minute. Monomer forms of
sCTLA-4 eluted at about 250mM NaCl (peak A) whereas dimer forms
of sCTLA4 eluted at about 350mM NaCl (peak B). A broad protein
peak eluting at about 450-600mM NaCl (peak C) also contained
sCTLA4. This peak was composed primarily of sCTLA4 monomers and
a few higher molecular weight forms of sCTLA4 which probably are
disulfide crosslinked. This material may represent sCTLA4 forms
that are aggregated. The monomeric and dimeric forms of sCTLA4
were confirmed by electrophoresing samples of the column
fractions on 14% polyacrylamide SDS gels under non-reducing
conditions. The dimeric form of sCTLA4 migrated as 2-3 bands in
the 24-27 kDa molecular weight range. The monomeric form of
sCTLA4 migrated as 2-3 bands in the 14-16 kDa molecular weight
range. In the presence of a disulfide reducing agent (2-
mercaptoethanol) both dimeric and monomeric sCTLA4 migrated as
single bands with a relative molecular weight of about 15 kDa.
These gel analyses indicated that the sCTLA4 dimers comprised two
sCTLA4 proteins covalently attached to one another by a disulfide
bond.
The column fractions containing sCTLA-4 peaks A,B and C were
pooled separately and concentrated using a stirred cell
concentrator and YM3 membranes (both obtained from Amicon, Inc.,
Beverly, MA). Pools A and B were concentrated to about 1.9 ml
and pool C was concentrated to about 2.3 ml. The protein
concentrations in the concentrated pools were about 900 ug/ml for
pools A and B, and 1820 ug/ml for pool C. 1.5 ml of each
concentrated pool was dialyzed in a multiwell dialysis manifold
(BRL, Gaithersburg,MD) against 2 liters of lOOmM NaCl, 20mM Tris-
HCl pH 7.4 at 2.2 ml per minute at 4C. Aliquots of the
concentrated, dialyzed pools were P~Ar;ned on a non-reducing SDS
gel. It was observed that pool A contained mostly sCTLA4 monomers
and a small amount of sCTLA4 dimers; pool B contained mostly
29
W095/01994 ~14 ~ ~19 PCT~S94/07685
sCTLA4 dimers and a small amount of sCTLA4 monomers; and pool C
contained mostly sCTLA4 monomers but also contained some
(approximately 10%) sCTLA4 dimers as well as smaller amounts of
higher molecular weight forms of sCTLA-4, which probably are
trimers, tetramers, etc. Five 200 ~l aliquots of each pool were
frozen and stored at -70C until use in assays.
Aliquots (50 ~l) of the monomer and dimer pools from the Q-
Sepharose column (pools A and B, respectively) were loaded
separately onto a Superdex-75 sizing column (3.2 x 300 mm;
commercially available from Pharmacia LKB, Picataway,NJ) that had
been equilibrated with 250 mM NaCl, 20 mM sodium acetate pH 5.5.
The column was eluted with a flow rate of 50 ~l/min. The monomer
pool eluted as a major peak (70% of total protein) with a
molecular weight of 15-17 kDa and as a minor peak (30% of total
protein) with a molecular weight of 30-35 kDa. The dimer pool
eluted as a major pool (70% of total protein) with a molecular
weight of 30-35 kDa and a minor peak (30% of total protein) with
a molecular weight of 15-17 kDa.
B. Hydrophobic Interaction Chromatography of CTLA4 Dimer
60 ~l of the CTLA4 dimer pool (approx. 1.2 mg/ml) obtained
from the Q-sepharose column was diluted up to 500 ~l with 20 mM
Tris-HCl, 2M NaCl, pH 7.4 and loaded to a 1 ml column packed with
Phenyl Sepharose (Hi Sub)(Pharmacia/LKB, Pictaway NJ) previously
equilibrated with 20 mM Tris-HCl, 2M NaCl, pH 7.4. Proteins were
eluted with a linear gradient from 0-50% CH3CN (and 2M-OM NaCl)
in 30 min at a flow rate of 1.0 ml/min. sCTLA4 dimers eluted as
a symmetrical peak at approximately 27% CH3CN, O.9M ~aCl. sCTLA4
monomers eluted slightly later at about 30-35% CH3CN, 0.8M NaCl.
C. Reverse Phase Purification of CTLA4
20 ~l aliquots of the Q-sepharose monomer (Pool A) and dimer
(Pool B) pools were diluted up to 200 ~l (with 0.05% TFA in H20)
and loaded separately to an RP-1 reverse phase column (SynChrom
Inc.) previously equilibrated with 0.05% TFA in H20. Protein was
eluted with a linear gradient from 0-100% CH3CN (0.05% TFA) in 30
minutes at 100 ~l/minute. The monomeric form of sCTLA4 eluted as
WO95/0199~ 31 ~ PCT~S94/07685
a single peak (approx. 95% pure) at approximately 85% CH3CN. The
dimeric form of sCTLA4 eluted as 5-6 heterogenous peaks at about
85-90% CH3CN.
CTLA4 monomers and dimers obtained from the HPLC column were
sequenced by the Edman degradation method known to those skilled
in the art. The amino-terminal sequences obtained for monomers
and dimers were identical: AlaMetHisValAla (SEQ ID N0:9). This
sequence matches the amino-terminal sequence expected for sCTLA4,
except that the N-terminal methionine residue is absent. The
absence of the N-terminal methionine residue indicates that this
residue is efficiently cleaved from the sCTLA4 protein by E. coli
processing enzymes.
EXAMPLE 6
In vitro activitY of recombinant sCTLA4 monomers and dimers
Aliquots of pools A,B and C from the Q-sepharose column
described in Example 5 were tested for biological activity in a
mixed lymphocyte reaction (procedure described in Example 4).
The lymphocytes used for this experiment were isolated from human
subjects C and D. Lymphocytes from subject D were treated with
mitomycin C and washed as described in Example 4. The mixed
lymphocyte cultures were set up as described in Example 4. Human
serum albumin (HSA) was used as a control protein. The HSA for
this experiment was prepared by r;X;ng 4 mg of HSA in 60 ml of 20
mM Tris-HCl pH 8, 250 mM NaCl, 37.5 mM guanidine hydrochloride
and concentrating the sample to 1.97 ml using a stirred cell
concentrator and YM3 membranes (both obtained from Amicon,Inc.,
Beverly, MA). 1.2 ml of this mixture was dialyzed against 2
liters of 100 mM NaCl, 20 mM Tris-HCl, pH 7.4 using a multiwell
dialysis manifold (BRL, Gaithersburg, MD). The final protein
concentration of the HSA pool was lloO ug/ml. Recombinant sCTLA4
(aliquots of pools A (monomer), B (dimer) and C (late monomer) or
HSA were suspended in complete medium at concentrations of 0.05-
50 ug/ml. 50 ~l aliquots added to appropriate wells of the mixed
cell populations. Samples were tested in triplicate. After
incubation for 5 days at 37C, each well received 2 uCi of 3H-
31
WO95/01994 ~14 1313 PCT~S94/07685
thymidine in 50 ~l of complete medium. Approximately 20 hours
later the cells were harvested as described in Example 4 and
radioactivity incorporated into DNA determined by scintillation
counting. The results of this experiment are given in Table 2.
TABLE 2
INHIBITION OF LYMPHOCYTE PROLIFERATION IN THE
MIXED L~rnO~YTE REACTION ~HUNAN S~BJECT8 C AND D)
BY sCTLA-4 POOLS A, B AND C OB~TN~n B~
Q-SEPHAROSE COL~MN r~R~M~OGRAPHY
0 DOSE cpm~ % INHIBITION~
~ng/ml) POOL A POOL B POOL C HSA POOL A POOL B~ POOL C HSA
0 12,958 16,b78 9,940 10,703 0 0 0 O
16,127 9,727 12,767 10,687 -35%61% (48%) 40% 2%
100 14,684 6,359 9,100 10,870 -18%96% (76%) 12% -2%
1,000 7,096 6,163 7,372 10,297 66%109% (86%) 36% 6%
10,000 3,983 3,029 ~,000 9,084 99%131% (102%) 70% 22%
* Counts per minute. Means of triplicate wells. Pools A and
B were tested on one 96 well plate and Pool C and HSA were tested
on another plate.
** Percent inhibition was determined after first subtracting
the cpms for an equivalent number of unmixed cells of subjects C
and D from the cpm totals. These "unstimulated cell" cpms
totaled 3907, 6002, 2847 and 3204 for sCTLA-4 pools A, B, C and
HSA, respectively. A negative percent inhibition indicates
stimulation.
*** Since the "unstimulated cell" cpm total for Pool B was
greater than that for the other pools, percent inhibition for
Pool B also was calculated using the mean (3319 cpm) of the
"unstimulated cell" cpms for the other three test samples. The
modified percent inhibition is shown in parenthesis in the Pool
B column.
The data show that each of the Q-sepharose pools containing
recombinant CTLA4 (pools A,B and C) caused a dose-dependent
inhibition of lymphocyte proliferation in the mixed lymphocyte
3 5 reaction, as evidenced by a decrease in radioactivity
incorporated into DNA. No significant inhibition was seen with
HSA, indicating that the inhibition was specific for sCTLA4.
Pool B, which contained predominantly CTLA4 dimers, was a more
WO95/01994 ~1~ 4 319 PCT~S94/07685
potent inhibitor of the proliferative response than was pool A
(mostly CTLA4 monomers) or pool C (mostly aggregated CTLA4
monomers, dimers and higher molecular weight forms). The dose of
pool B that inhibited lymphocyte proliferation by 50~ was
determined to be slightly less than 10 ng/ml. This number may be
an overestimate of the potency of pool B because the counts per
minute (cpms) of the unmixed lymphocyte cell populations used to
calculate percent inhibition were higher in the pool B samples
than in the other pools (see footnote to Table 2). To account
for this, data for pool B also were calculated using the mean
cpms of the unmixed cell populations of the other protein pools.
These modified percent inhibitions are given in parentheses in
Table 2. Using the modified figures, the dose of pool B that
inhibited lymphocyte proliferation by 50% was determined to be
about 10 ng/ml. Essentially complete inhibition of lymphocyte
proliferation occurred at pool B protein concentrations of 1-lo
ug/ml. The doses of pools A and C that inhibited lymphocyte
proliferation by 50% were between 100 and 1,000 ng/ml for pool A
and between 1000 and 10,000 ng/ml for pool C. Thus, the pool
contA;ning mostly CTLA4 dimers (pool B) had 10- to 100-fold
greater specific inhibitory activity than did the pools
containing mostly CTLA4 monomers or monomer aggregates (pools A
and C).
Pools A, B and C were tested in a second mixed lymphocyte
reaction experiment using lymphocytes obtained from human
subjects E and F. Lymphocytes from individual F were treated
with mitomycin C as described in Example 4. Other procedures of
this experiment were as described in Example 4 and in the
previous experiment. The results of this experiment are given in
Table 3.
WO95/01994 21~ ~ 31~ PCT~S94/07685
TABLE 3
INHIBITION OF ~YMr~u~Y.~ PROLIFERATION IN THE
MIXED LYMPHOCYTE REACTION (HUNAN SUBJECTS E AND F)
BY s~TLA-4 POOLS A, B AND C OBT~TN~ BY
5Q-SEPHAROSE CO~MN ~U~QM~TOGRAP~Y
DOSE cpm~ % INh~ IG~
In~/ml) POOLA POOL B POOL CHSA POOLAPOOL B POOL C HSA
0 28,920 32,24331,031 29,675 0 0 0 o
26,478 27,89830,301 25,214 9% 15% 3% 16%
10 10 28,344 24,47629,927 26,601 2% 26% 4% 12%
100 27,541 20,26821,320 28,255 5% 40% 34% 5%
1,000 24,687 17,64518,051 26,891 16% 4996 45% 10%
10,000 13,222 10,40216,050 25,405 59% 73% 52% 16%
* Counts per minute. Means of triplicate wells. Pools A and
B were tested on one 96 well plate and Pool C and HSA were tested
on another plate.
** Percent inhibition was determined after first subtracting
the cpms for an equivalent number of unmixed cells of subjects E
and F from the cpm totals. These "unstimulated cell" cpms
totaled 2372, 2280, 2400 and 2590 for sCTLA-4 Pools A, B, C and
HSA, respectively.
As was seen in the previous experiment, pool B was more
potent than pools A and C in inhibiting lymphocyte proliferation.
The maximal inhibition seen with pool B in this experiment was
73%. The dose of pool B that inhibited lymphocyte proliferation
by 50% was about 1 ug/ml. In contrast, the doses of pools A and
C that inhibited lymphocyte proliferation by 50% were about 10
ug/ml. No significant inhibition of lymphocyte proliferation was
seen with HSA.
None of the recombinant sCTLA4 pools completely inhibited
lymphocyte proliferation in this experiment. There are several
possible explanations for this. One explanation may be that the
sCTLA4 proteins in pools A, B and C were inactivated during
mixing of the samples . Another explanation may be that co-
stimulatory molecules other than CTLA4's ligand, B7, were
expressed on the surfaces of one subject's antigen-presenting
cells. Other co-stimulatory molecules that are distinct from B7
are known to exist (Razi-Wolf et al., Proc. Nat'l Acad. Sci.
34
~ 1 4 ~
WO95/01994 PCT~S94/07685
(U.S.A.) 89:4210-4214 (1992); Liu et al., Eur. ~. Immunol., 22:
28S5-2859 (1992). One subject had a white cell count that was
about four times normal, suggesting that he had experienced an
infection recently. Some of his white cells may have been
activated as a consequence. That this may have been the case is
suggested by the greater stimulation of lymphocyte proliferation
- seen in this experiment (11-14 times over the levels seen with
unmixed cells) compared to the previous two experiments (3-4
times over the levels seen with unmixed cells). If one assumes
that the 73% inhibition observed with pool B is the maximum
inhibition that could have been achieved with sCTLA4 in this
experiment, then the dose of pool B that gave 50~ of this maximum
inhibition was between 10 and 100 ng/ml, which is similar to 50%
inhibitory doses determined in the previous two experiments.
15EXAMPLE 7
Develo~ment of a Stable B7 Expressinq Cell Line
As an alternative to the mixed lymphocyte reaction a new
bioassay was developed that measures IL-2 production by a human
T cell line in the presence of PHA lectin and a chinese hamster
ovary (CHO) cell line that has been stably transformed to express
the human B7 receptor protein. The IL-2 bioassay has several
advantages over the mixed lymphocyte reaction. These advantages
include the fact that the IL-2 bioassay takes only one and a half
days to perform versus 6-7 days for the mixed lymphocyte
reaction, the IL-2 bioassay is insensitive to bacterial endotoxin
(which can contaminate sCTLA4 preparations prepared from
bacteria), whereas the mixed lymphocyte reaction yields spurious
data if endotoxin is present and the IL-2 assay uses cells lines
rather than primary cells, which reduces the risk of infection
and makes it easier to obtain large numbers of cells for assays.
Development of the bioassay required cloning a human B7 cDNA,
cloning it into a suitable vector for expression in eukaryotic
cells and transforming and selecting CHO cells that express the
B7 receptor protein.
WO95/01994 PCT~S94/07685
A. Cloning of a human B7 cDNA
The B7 gene was cloned from the human Raji B cell line (ATCC
No. CCL 86). mRNA was isolated from 3 x 106 Raji cells using a
Micro-FastTrack mRNA Isolation Kit (Invitrogen, San Diego, CA)
according to the manufacturer's instructions. cDNA copies of one
tenth of the mRNA were made using a cDNA Cycle Kit (Invitrogen,
San Diego). The B7 genes in one fifth of the Raji cDNA were
amplified by PCR using oligonucleotide primers complementary to
the B7 eequence 5' and 3' ends, Pfu Polymerase (Stratagene, San
Diego), and a Gene Amp System 9600 Thermal Cycler (Perkin Elmer
Cetus, CA).
The following oligonuclèotide primers were used:
B7~5'p)32: 5' CCC AAG CTT TCA CTT TTG ACC CTA AGC ATC TG 3'
(SEQ.ID.NO:10)
B7~3'p)36: 5' CCC TCT AGA TTA TAC AGG GCG TAC ACT TTC CCT TCT-3'
(SEQ.ID.NO:11)
(overlaps with B7 sequence are underlined)
The PCR reaction mixture contained 20 mM Tris-HCl pH 8.2, 10
mM KCl, 6 mM (NH4)2SO4, 1.5 mM MgCl2, 0.1% Triton X-100, 200 ~M
each of dATP, dCTP, dGTP, and TTP, 20 pmoles of each primer
oligo, 4 ~1 of Raji cDNA, and 0.5 ~1 (1.25u) of Pfu polymerase
(total volume = 50 ~1). PCR conditions were 30 cycles of ( 1
minute at 95C, 1 minute at 60C, and 1 minute at 72C), followed
by a 10 minute incubation at 72C. After the PCR was
completed, 45 ~1 of the reaction mixture was passed over a spin
column (ChromaSpin-100, ClonTech, Palo Alto, CA), then 20 ~1 was
digested with ~I and HindIII and electrophoresed on a 0.8%
agarose gel. The band of about 0.9kb was eluted and ligated to
plasmid pRc/CMV (Invitrogen, San Diego, CA) that had been cut
with the same restriction enzymes and gel purified in the same
way. The ligation mixture was used to transform E coli strain
TOPlOF'(Invitrogen, San Diego, CA). Colonies selected on Luria
Broth agar plates containing 50 ~g/ml of ampicillin were screened
for plasmids cont~;n;ng inserts of the correct size and the
inserted gene from one such construct was sequenced thoroughly on
2 1 ~ 9
WO95/01994 PCT~S94/07685
both strands to verify that it had the expected sequence. This
plasmid clone was named B7-5.
B. Creation of a Stable B7 Expressing Cell Line
Chinese Hamster Ovary cells (CHO-K1, ATCC No: CCL 61) were
grown in DMEM and penicillin, streptomycin, glutamine, proline
(20 ~g/ml), and 10~ fetal bovine serum. A titration experiment
determined that 400 ~g/ml of the antibiotic G418 (Genticin
sulfate, GIBCO BRL, Gaithersburg, MD) was sufficient to kill the
CHO cells. The pRc/CMV vector used to express the B7 gene
contains an aminoglycoside phosphotransferase gene that confers
resistance to G418. The B7-5 plasmid used to transfect the CHO
cells was prepared using the Qiagen mini-prep procedure
(Qiagen,Chatsworth,CA) in which 19.2 ml of overnight culture
grown in Luria Broth with 50 ~g/ml of ampicillin yielded 120 ~l
of plasmid DNA at about 1256 ~g/ml. CHO cells were transfected
by the calcium phosphate precipitate method using a kit from
Invitrogen (San Diego, CA) according to the manufacturer's
instructions. On day 4 after transfection, media was replaced
with new media cont~;n;ng G418 at 400 ~g/ml. On day 19 after
transfection, G418-resistant cells were subjected to limiting
dilution to select for individual resistant cells. Six
individual colonies were isolated and subjected to a second round
of limiting dilution. A single well of each was chosen for
propagation. The cell lines were named F9, C11, G10, E12, C12 and
H9.
C. FACS screening of transformed B7-CHO cell lines
The six G418-resistant cell lines were screened with an
anti-human B7 monoclonal antibody to determine if they express B7
on their cell surfaces. Confluent T-75 flasks of each cell line
were washed twice with 10 ml of calcium- and magnesium-free PBS
and exposed to 10 ml of calcium- and magnesium-free PBS
containing 10 mM EDTA for 10 minutes at room temperature. After
pipeting up and down several times to loosen the cells, non-
adherent cells were transferred to a 15 ml conical centrifuge
tube and centrifuged at 1000 rpm in a GS-6R tabletop centrifuge
2.~ 1 9
WO9S/01994 PCT~S94/07685
(Beckman instruments, Houston, TX). The cells were resuspended
in 120 microliters ice cold FACS Media (RPMI 1640 media
(Biowhittaker, Walkersville, MD, cat# 12-115B) containing 2%
(v/v) fetal bovine serum and 0.1% sodium azide). The cell
concentration was about 2X 107 per ml. Fifty microliters of each
cell line were mixed on ice in a 1.5 ml microfuge tube witll 50
microliters of FACS media cont~;n;ng a 1:1000 dilution of an
anti-human B7 monoclonal antibody (Becton Dickinson, San Jose,CA,
catalogue # 550024) or a control mouse IgG1 monoclonal anti~ody
(Becton Dickinson, San Jose,CA, catalogue #550029). The cells
were incubated with the antibody on ice for 55 minutes, the
microfuge tubes filled with FACS media and then centrifuged 5
minutes at 300 x g in a microfuge. Supernatants were removed by
aspiration and the cells resuspended in 100 micro]iters of ice
cold FACS media containing a 1:25 dilution of FITC-labeled
polyclonal goat anti-mouse antisera (Becton Dickinson, San Jose,
CA, catalogue number 349031). The mixtures were incubated for
55 minutes on ice, the tubes filled with ice cold FACS media and
centrifuged ~or 5 minutes at 300 x g in a microfuge. The
supernatants were aspirated and the cells resuspended in 500
microliters of ice cold FACS media. Labeled cells were analyzed
for positive fluorescence using a flow cytometer. Cell lines F9,
C12 and H9 were positive for B7 expression using this assay.
D. IL-2 Production Bioassay
The F9, C12 and H9 cell lines were mixed with the CD28-
positive human Jurkat T cell line (ATCC No. CRL 1863) in the
presence of PHA-L lectin (Sigma Chemical Company, St. Louis, MO,
Cat.# L-4144) to determine if they induced IL-2 production by the
Jurkat cells. To each well of a 96 well tissue culture plate was
added lxlO5 Jurkat cells and 5x104 F9, C12, H9 or parent CHO
cells. Control wells contained Jurkat cells only. PHA was added
to each well to a final concentration of lO~g/ml. The final
volume per well was 250 ~l. Cells and chemicals were resuspended
in IL-2 assay media (RPMI 1640 media (Biowhittaker, Walkersville,
MD, cat# 12-115B) containing 25 mM HEPES buffer, penicillin,
streptomycin, glutamine and 10% fetal bovine serum). The F9,
38
WO 95/01994 PCT/US94/07685
C12, H9 and parent CHO cells had been detached from their culture
dishes by incubation in Dulbeccos calcium- and magnesium-free PBS
con~;ning 10 mM EDTA. The detached cells were washed several
times in IL-2 assay media before counting and plating. Assays
were performed in triplicate. After thorough mixing, the plates
were incubated for approximately 20-24 hours at 37C in a standard
tissue culture incubator. The liquid in each well was then mixed
by pipetting and 100 ~l transferred to a new well of an IL-2
ELISA assay plate (R~D Systems Inc., Minneapolis, MN). The
procedure used for the ELISA assay was that provided by the
manufacturer except that IL-2 assay media was used as the blank.
Optical density of the wells was read at 450nm - 570nm in a
microplate plate reader (Molecular Devices, Menlo Park, CA).
Optical density reflects the amount of IL-2 in the sample.
optical density means for the triplicate wells were calculated
and converted to pg/ml IL-2 using an IL-2 standard curve. The
results showed that the B7-CHO cell lines, F9, C12 and H9 cells
induced production of 360 pg/ml, 300 pg/ml and 150 pg/ml IL-2,
respectively. The parent, non-transfected CHO cells induced 20
pg/ml IL-2. Jurkat cells alone produced 20 pg/ml IL-2. These
results indicated that the F9, C12 and H9 cell lines were capable
of inducing IL-2 production by Jurkat T cells. The Cl2 cell line
was chosen for further assay development. Control experiments
showed that PHA was required to induce IL-2 production above
background levels. Titration experiments showed that IL-2
production increased in a dose-dependent way with increasing
numbers of C12 cells per well in the bioassay. The response was
more logarithmic than linear. The st~n~rd IL-2 production assay
used to measure bioactivities of sCTLA4 preparations uses 2.5x104
C12 cells, 1 x 105 Jurkat cells and 10 ~ll/ml PHA per well in the
above bioassay. Since CTLA4 binds to and neutralizes B7 on the
C12 cells, addition of CTLA4 to the test wells results in a
decrease in IL-2 production, which is measured by a decrease in
the optical densities of the test wells.
21~4~
WO95/01994 PCT~S94/07685
EXAMP~E 8
Identification and purification of
proPerly refolded sCTLA4 dimers
As described in Example 5, most refolds of sCTLA4 contains
multiple (typically at least three) dimer forms in the 24-27 kDa
molecular weight range. The dimer species can be resolved by
SDS-PAGE (14% non-reducing SDS gel) and by reverse-phase
chromatography using a RP-4 column as described in Example 8B.
The different dimer forms differ in their bioactivities in the
IL-2 production assay. Only one of the dimer forms is capable of
significantly inhibiting IL-2 production in this assay. The
dimer form with the greatest specific activity probably is
properly folded, whereas the less active dimer forms probably are
misfolded. The different dimer forms could be separated from one
another using a sizing column. The most active dimer species
elutes latest from the column (smaller apparent molecular weight)
As described in Example 8D and Table 6 below. "Active" and "less
active" dimer species were separated from one another as
described in the examples below. The active and less active
dimer forms obtained using refold procedure 2 (described below)
could be separated from one another using a Mono Q, Source 15Q
ion-exchange columns or by using a phenyl-sepharose hydrophobic
interaction column.
A. Refold Procedure 1
Thirty grams of WIBs was dissolved in 2000 ml of freshly
made 6M guanidine HCl, 0.1M Tris pH 8.0, 6mM DTT using a polytron
PT 3000 (Brinkman Instruments, Lucerne, Switzerland) and left for
15 minutes at room temperature. The solution was then
centrifuged for 30 minutes at 10,000 rpm in a JA-10 rotor and the
pellet discarded. To the supernatant was added 110ml of 0.5M
glutathione (oxidized form). The solution was left for 15 to 30
minutes at room temperature and then slowly added to 18 liters of
O.44M guanidine HCl in 50mM Tris pH 9.7 with gentle stirring.
200 ml of 0.5M cysteine and 200 ml of 100mM phenylmethylsulfonyl
fluoride (in ethanol) was then added. The refold mixture was left
WO95/01994 ~ 3 ~ 9 PCT~S94/07685
at 4C for 6 days without stirring. At that time the mixture was
concentrated to about 1 liter using an SlOY3 spiral
ultrafiltration cartridge (Amicon, Beverly, MA) and dialyzed in
Spectra/Por 3 tubing (Spectrum Medical Industries, Houston, TX)
- 5 against 19 volumes of 20mM Tris pH 8.0 for two to three days. The
extensive precipitate was removed by spinning for 15 minutes at
10,000 rpm in a JA-10 rotor. Residual precipitate was removed by
passing the supernatant through 0.45~m filters. The supernatant
was loaded onto a 300ml Q-sepharose (Fast Flow; Pharmacia,
Piscataway, N.J.) column at 10 ml per minute. Proteins were
eluted from the column at 10ml/minute using a 0 to 60% gradient
of lM NaCl in 20mM Tris pH 8Ø Aliquots (25~1) of each fraction
from the 30% to 40% region (approximately 300mM to 400mM NaCl)
were electrophoresed on a non-reducing 14% SDS gel. When stained
with coomassie blue R250 the active dimer species can be
discerned as a tightly focused band whereas the inactive or less
active dimer species ("less active dimers") are more diffuse.
This distinction is readily apparent. The less active dimer
species typically have slightly higher apparent molecular weights
than the active dimer on a 14% non-reducing SDS gel. One less
active dimer species often co-migrates with the active dimer
species on SDS gels. This less active dimer species can be
distinguished from the active dimer species using the sizing
column described below. Q-sepharose column fractions cont~i~;ng
the active dimer species were pooled and concentrated to about 40
ml using a YM-10 membrane in an Amicon stirred cell
(Amicon,Beverly, MA). The concentrated active dimer pool was
passed through a 7 liter, 85cm Sephacryl S-100 (Pharmacia) column
in a buffer of 250mM NaCl, 20mM Tris pH 7.5 at 26 ml per minute.
Aliquots (25~1) of each fraction across the main protein peaks
(protein was detected by measuring absorbance at A~o nm of the
fractions) were electrophoresed on a 14% non-reducing SDS gel as
described above. The active dimer species elutes later than the
inactive dimer species. This sizing column step removes most
other contaminating proteins as well as most less active dimer
species. Fractions that contain reasonably pure active dimer
were pooled and concentrated to about 10ml using a YM-10 membrane
WO95/01994 ~ 3 ~ ~ PCT~S94/07685
in a stirred cell (Amicon, Inc., Beverly MA). Protein
concentrations were measured using a Lowry protein assay kit
t"DC Protein Assay", Bio-Rad Laboratories, Richmond, CA) using
IgG as the protein st~n~rd (Bio-Rad Laboratories, Richmond, CA).
B. Refold procedure 2
It was discovered that substantially more active CTLA4 dimer
could be recovered from a refold mixture by modifying the refold
procedure. Refold procedure 2 is an improved refold procedure
that yields substantially more active CTLA4 dimer per gram of
starting WIBS. Oxidized glutathione and cysteine, which are
typically included in mixtures used to refold recombinant
proteins from bacteria, are eliminated from the refold mixture,
resulting in considerable cost savings. Oxidized glutathione and
cysteine appear to interfere with the correct refolding of active
CTLA4 dimers. It is believed that the oxidized glutathione
and/or cysteine bind to cysteine residues in CTLA4 and interfere
with protein refolding and/or correct disulfide bond formation.
In refold procedure 2, no additional oxidizing or reducing agents
are added to the refold mixture besides the DTT that was used
originally to reduce the WIBS. The following is a typical refold
starting with 30 g of WIBS.
Thirty grams of WIBs was dissolved in 600ml of freshly made
6M guanidine HCl, 50mM Tris pH 8.5 using a polytron PT 3000
(Brinkman Instruments) and then stirred slowly for 30 minutes at
room temperature. 7.2ml of 0.SM DTT (final DTT concentration=
6mM) was added and the solution stirred slowly at room
temperature for 1 hour. The solution was then centrifuged at
10,000 rpm for 30 minutes in a JA-10 rotor and the pellet
discarded. The supernatant was slowly added to 11.4 liters of a
guanidine/Tris solution, which contains 343.9 g of guanidine ~Cl,
10.9 g Tris-HCl, and 60.6 g of Tris base dissolved in 11.4 liters
of water. The refold mixture was left at 4C for 3 days. The
solution was then passed through an SA-1 continuous flow
centrifuge (Westfalia, Oelde, Germany) at 200 ml/min at 14 psi,
followed by a chase with 2 liters of 0.6M guanidine HCl, 50mM
Tris pH 9.5 at 4C. The supernatant was concentrated to about 1
42
WO 95/01994 ~ 31~ PCT~S94/07685
to 2 liters using a spiral ultrafiltration cartridge (SlOY3,
Amicon Inc., Beverly, MA) and dialyzed in Spectra/Por 3 tubing
(Spectrum Medical Industries, Houston, TX) against 19 liters of
20mM Tris pH 7.5 at 4C for a day. The dialysis buffer was
- 5 changed (same solution and volume) and dialysis continued for
another day at 4C. The extensive precipitate that formed was
removed by centrifugation for 15 minutes at 10,000 rpm in a JA-lO
rotor. Residual precipitate was removed by passing the
supernatant through 0.45~m filters. The solution was loaded onto
a 50ml Source 15Q (Pharmacia) column at lO ml per minute.
Proteins were eluted from the column at lOml/minute with a O to
60% gradient of lM NaCl in 20mM Tris pH 8Ø Aliquots (lO~l) of
each fraction from the major protein peak eluting at about 300mM
NaCl were electrophoresed on a non-reducing 14% SDS gel. When
lS stained with coomassie blue R250 the "active" dimer can be
discerned as a tightly focused band, whereas the "less active"
dimer bands are more diffuse. This distinction is readily
apparent. In contrast to refold procedure 1, the less active
dimers that form using refold procedure 2 typically have lower
apparent molecular weights than the active dimer species on 14%
non-reducing SDS gels. Fractions contA;n;ng the active dimer were
pooled and concentrated using a YM-10 membrane in a stirred cell
(Amicon) to a volume of about 40 ml. The concentrated active
dimer pool was passed through a 7 liter, 85cm Sephacryl S-100
(Pharmacia) column in 250mM NaCl, 20mM sodium acetate pH 5.5, at
26 ml per minute. Aliquots (10~1) of each fraction across the
main protein peak (detected by absorbance at A280 nm) on a 14% non-
reducing SDS gel, as described above. The active dimer elutes
later than the less active dimers. This sizing column step
removes most other contaminating proteins as well as most active
dimers. Fractions containing predor;n~ntly active dimer were
pooled and concentrated to about lOml using a YM-10 membrane in
a stirred cell (Amicon Inc., Beverly, MA). Protein concentration
was determined using a Lowry protein assay kit ("DC Protein
Assay", Bio-Rad Laboratories, Richmond, CA) using IgG (Bio-Rad
Laboratories) as the protein s~n~rd.
43
WO95/01994 2 ~ ~ ~ 3 1 9 PCT~S94/07685
The active dimer species obtained by the above procedure was
further characterized by reverse phase HPLC. Aliquots (50~1-
100~1) of the purified active CTLA4 dimer were diluted to 500~1
with Buffer A (0.05% trifluoroacetic acid "TFA"), and injected onto a reverse phase
column (RP-4, 1 x 250mm, Synchrom, Lafayette, IN), and eluted with 100%
acetonitrile, 0.042% TFA (Buffer B) using a linear gradient (increase of 2.6% Buffer
B/min) at a flow rate of 0.25 ml/min. The correctly refolded, active CTLA4 dimereluted as a symmetrical peak at 27.8 min.
Table 4 compares yields of good dimer obtained from several refold
o experiments using procedure 1 and procedure 2. It is clear from the table that 4-5X
as much active dimer was obtained from procedure 2 as was obtained using
procedure 1.
TABLE 4
~ S~ing VVIBS sCllLA4 l~co~,Gd
R~ 16 30g 23mg
lUF 17 30g 14mg
RUF 19 30g 25mg
EUF KC 36g 16mg
RUF 22 30g 76mg
RF 23 30g 143mg
RUF 24 30g llOmg
RUF 2~ 30g 83mg
Experiments RFl6, RFl7, RFl9 and RF-KC used refold procedure l.
Experiments RF22, RF23, RF24 and RF25 used refold procedure 2.
C. Refold Procedure 3
In refold procedure 3, 0.4g WIBS was dissolved in 8 ml of 6M
guanidine, 50 mM Tris-HCl, pH 8.5. Four ml of this solution was
reduced by adding DTT to a final concentration of 6 mM. Two ml
44
W095/01994 ~1 4 ~ 3 ~ 9 PCT~S94/07685
of this solution was diluted lO-fold to 20 ml with 50 mM Tris-
HCl, pH 9.5. The guanidine concentration was maintained at l M.
The final DTT concentration was 0.6 mM. Protein was refolded for
3 days at 4C. After dialysis against 20 mM Tris-HCl, pH 8, the
protein was applied to a Mono-Q column (Pharmacia HR5/5 column)
in a buffer of 20 mM Tris-HCl, pH 8. Protein was eluted with a
linear gradient of 0-600 mM NaCl in 20 mM Tris-HCl pH 8 at a flow
rate was l ml per min (an increase of lO mM NaCl per min). The
column profile showed a major protein peak eluting in fractions
32 and 33, followed by a smaller, broad protein peak eluting in
fractions 34 to 37. SDS-PAGE analysis showed that the major
protein species in fractions 32 and 33 co-migrated with the
active dimer species obtained using refold procedure l.
Fractions 34 to 37 contained at least three dimer species, one of
which (a minor component) co-migrated on the SDS gel with the
active dimer species. The other two dimer species run slightly
faster, i.e., lower apparent molecular weights, than the active
dimer species. Fractions 35 and 36 were enriched for these
faster migrating dimer species. To determine which dimer species
had the greatest activity, fractions 32 and 33 were combined and
fractions 35 and 36 were combined. The two pools were tested in
the IL-2 production bioassay. Protein concentrations were
determined by a Bradford assay using bovine serum albumin as the
standard. Use of bovine serum albumin as the stAn~Ard yields
protein concentrations that are about half those obtained if IgG
is used as the s~An~rd. The results (Table 5) show that the
pool of fractions 32 and 33 had the greatest inhibitory activity,
with an ICSo of about lO0 ng/ml. This is comparable to the ICso
for the active CTLA4 dimer species purified using refold
procedure l. The pool of fractions 35 and 36 showed little
titratable inhibitory activity and had an ICso greater than 3
ug/ml.
WO 95/01994 ~ 3 ~ 9 PCTrUS94/07685
T~B~E 5
Pro~ Optical Density (450 - 570 mn)~
~g ) Pool 32/33 Pool 35/36
0 .319 i .011 .276 i .036
0.0015 .312 i .013 .247 ~ .020
0.0045 .307 i .060 .242 ~ .010
0.014 .222 ~ .023 .257 ~ .044
0.04 .208 i .008 .241 i .014
0.12 .173 i .024 .232 i .011
0.37 .118 i .009 .210 ~ .017
1.1 .117 ~ .014 .193 i .010
3.3 .056 i .006 .177 ~ .035
.053 ~ .006 .114 i .008
* Values are means + one standard deviation for triplicate
wells. Protein concentrations were determined using bovine serum
albumin as the stAn~rd.
The major protein in fractions 32 and 33 is similar in
molecular weight (by SDS-PAGE) and physical characteristics
(elution time on ion-exchange columns) to the major protein in
the main protein peak obtained using refold procedure 2. The
less active dimer species in fractions 35 and 36 are similar if
not identical to the improperly folded dimer species obtained
using refold procedure 2.
D. Separation of active and less active dimer species on a
sizing column.
In Experiment RF-KC, CTLA4 was refolded and dimers purified
from the Q-Sepharose column essentially as outlined in refold
procedure 1. At least three dimer species could be discerned by
non-reducing SDS-PAGE. The correct or most active dimer species
46
~144319
W095/01994 PCT~S94/07685
constituted a minor amount of the total dimer species in this
experiment. Fractions containing predominantly dimer species
(Fractions 89-109) were pooled, concentrated to 222 ml, and
applied to an S-100 sizing column as described in refold
procedure 1. CTLA4 dimers eluted as a major protein peak,
comprising fractions 33-41, followed by a smaller shoulder peak,
comprising fractions 42-54. Non-reducing SDS-PAGE analysis
showed that the shoulder peak was enriched for the active dimer
species, although it did contain considerable amounts of the less
active dimer species (at least 50% of the total protein in the
shoulder peak). The major protein peak contained multiple dimer
species that are predominantly the less active dimer species. The
major protein peak contained lit~le of the active dimer species.
The main protein peak, fractions 33-41, were pooled (called Pool
A) and tested for activity in the IL-2 production bioassay.
Similarly, the shoulder peak, fractions 42-54, were pooled
(called Pool B) and tested for activity in the bioassay. The
results (Table 6) showed that only Pool B had significant
inhibitory activity. The ICSo for Pool B was 120-370 ng/ml
whereas the ICso for Pool A was greater than 10 ug/ml. To further
purify the active dimer species, Pool B, fractions 42-54, were
pooled, concentrated to 40 ml, and reapplied to the S-100 column.
Fractions were not collected until 1750 ml of buffer had flowed
through the column. Collection of 25 ml fractions was then
begun. The CTLA4 dimers eluted as two overlapping protein peaks:
an early eluting peak, fractions 28 to 35, that contained
multiple dimer species and a later eluting peak, fractions 36 to
44, that were enriched for a single dimer species. Pools from
the two protein peaks were prepared, fractions 28-35 (Pool B-1)
and fractions 36-41 (Pool B-2), and tested in the IL-2 production
bioassay. The results (Table 6) showed that the late eluting peak
(Pool B-2) was the most active, with an ICso of between 120 and
370 ng/ml; the early eluting peak (Pool B-1) was much less
active, with an IC50 of about 10 ~g/ml.
A
47
WO95/0199421 ~ ~ 31 9 PCT~S94/07685
TABLE 6
Proteu~ Optical Density (450 - S70 nm)~
(~g/ml) Pool A Pool B Pool ~2 pool ~1
(Fr~ctior~s 33-41) (FrDctions 42-54) (Fractions 3~41) (Fr~ctions 28-35)
O .SS6 i .124 .SS6 ~ .124 .298 i .019 .341 t .011
O.OOlS .S81 i .021 .590 i .039 .293 ~ .011 .362 i .065
0.004S .S28 ~ .016 .SIS i .OIS .272 i: .020 .383 i .027
0.014.463 i .035 .S79 :i: .007 .243 i .023 .305 i .023
0.04.S73 i .025 .472 i .032 .196 i .006 .379 i 037
0.12.S20 i .OIS .424 i .004 .134 i .007 .348 i .02()
0.37.S6~ i .049 .298 i .0~3 .154 i .021 .271 i 050
1.1.S14 i .034 .247 i .021) .088 i 019 .256 i .029
3.3.421 i .038 .201 i .019.039 i .078 .177 + .021
10.37S i .010 .099 i .002 .067 i .027 .169 i .072
* Values are means I one standard deviation for triplicate
wells. The values for Jurkat cells alone were 0.089 + .039, 0 +
. 005 and 0 + .006 for Pools A and B, Pool B-2 and Pool B-1
experiments, respectively.
E. Additional Purification of Refolded CTLA4
The CTLA4 dimer pool prepared substantially according to
Refold Procedure 8B column, except purification was accomplished
by using only an ion exchange column, was loaded directly onto a
hyd~ophobic interaction column (HIC) (phenyl-sepharose, 5mm X
5cm, Pharmacia, Piscataway, NJ) previously equilibrated with 20
mM TRIS, pH 7.4, 250 mM NaCl. The bound protein was eluted with
30 column volumes using a linear gradient to 20mM TRIS, pH 7.4,
50% acetonitrile (CH3CN), at a flow rate of 1 ml/min. CTLA4
eluted as two peaks: a major peak eluting at 15% CH3CN, and a
minor peak eluting at 25% CH3CN. SDS-PAGE analysis demonstrated
that the major peak corresponded to the correctly refolded,
active CTLA4 dimer, while the minor peak corresponded to the mis-
48
WO95/01994 - 9 pcT~s94lo768s
folded, less active CTLA4 dimer species migrating with lower
relative molecular weights.
EXAMPLE 9
~ioassay of different purified CTLA4 preParations
CTLA4 active dimers, purified using refold procedure 1, were
assayed for activity using the IL-2 production assay described
above. CTLA4 protein was diluted using IL-2 assay media to
desired concentrations, mixed with 2.5x104 B7+-CH0 cells (C12
cells) and lxlOs Jurkat cells in the presence of 10 ~g/ml PHA and
incubated for approximately 24 hours at 37C in a tissue culture
incubator. Each protein dilution was assayed in triplicate using
96-well tissue culture plates (Corning, Corning, NY). Jurkat
cells plus PHA were used as the control. The IL-2 concentrations
of the wells was determined using an IL-2 ELISA kit as described
above. The optical densities of the wells is proportional to the
amount of IL02 in the wells, i.e., a higher optical density
indicates higher IL-2 levels. The IC50s (concentration to observe
half-maximal inhibition of IL-2 production) of different CTLA4
dimer preparations ranged from about 100-300 ng/ml using this
assay (Table 7).
49
2~4319
WO 95/01994 PCTrUS94/07685
T~iBLE 7
Plo~in Optical D~nsity (450 - 570 nrn)~
~ug ) RUF16 FUP17 EUF19 RUF-KC
0 .324 i .020 .407 ~ .034 .292 ~ .014 .298 i .019
0.0015 .331 ~ .005 .359 ~ .058 .278 ~ .022 .293 i .011
0.0045 .278 ~ .027 .226 i .017 .274 ~ .021 .272 ~ .020
0.014 .290 i .018 .220 ~ .011 .243 i .013 .243 ~ .023
0.04 .207 ~ .009 .231 ~ .078 .250 i .047 .196 ~ .006
0.12 .151 i .014 .128 i .006 .160 ~ .004 .134 ~ .007
0.37 .129 i .008 .088 i .005 .143 i .020 .154 ~ .021
1.1 .075 i .006 .064 i .027 .095 i .008 .088 i .019
3.3 .070 i .011 .023 i .006 .081 i .010 .039 i .078
.059 i .015 .033 i .016 .059 i .003 .067 i .027
* Values are means + one stAn~rd deviation for triplicate wells.
The values for Jurkat cells alone were 0.035 + .003, 0.206 +
.059, 0.027 + .002 and 0 i .005 for RF16, RF17, RF19 and RF-KC
experiments, respectively. The Jurkat cell alone value was
unusually high in the RF19 experiment for unknown reasons.
Active CTLA4 dimer prepared using refold procedure 2 had
similar IC50s in the IL-2 production bioassay.
Ea~iMPLE 10
Recombinant sCTLA4 Inhibits Cellular Damage In Animals
Tiegs et al. (Journal of Clinical Investigation vol. ~0,
196, 1992) describe a T cell-dependent liver injury model in mice
that is inducible by Concanavalin A (Con A). Con-A-induced liver
damage is detectible within 8 hours and results from polyclonal
activation of T cells by macrophages in the presence of Con A.
Liver damage is measured by release of specific liver enzymes,
including serum glutamate pyruvic transaminase (SGPT), into the
WO95/01994 ~ 14 ~ 31 g PCT~S94/07685
blood stream. The in vivo activity of sCTLA4 was assessed using
this model. The CTLA4 protein was contained in a pool of refolds
RF-16, RF-17, RF-19 and RF-KC prepared using refold procedure 1
(Table 7). Female Balb/C mice, 18-20g, were purchased from
Charles River. The mice received an intravenous injection (15
mg/kg) of Con-A (Type V, catalogue # C-7275; Sigma Chemical
Company, St. Louis, Missouri) at 0 hour and subcutaneous
injections of saline or 0.3, 3 or 30 mg/kg CTLA4 at -2, 0, 2, 4,
and 6 hours. At 8 hours, the mice were sacrificed and the serum
levels of SGPT were measured using an Ektachem 700 analyzer
(Kodak, Rochester, N.Y.). SGPT serum levels of individual mice
are shown in Table 8.
WO 95/01994 21 4 4 3 1 9 PCTrUS94/07685
T~iB~E 8
*Nonn~ sCl~A4 ~se (mg/kg/~jec~on)t
(no Con A) 0 0.3 3
118 932 3046 468 316
47 943 108 1981 1386
124 1673 783 525 286
295 420 972 211 260
2512 613 519 563
133 1917 1465 466 468
118 1163 4845 969 165
74 4914 1642 382
M 2502
N = 10 N = 9 N = 8 N = 8 N = 7
* Normal control mice did not receive Con A
~ Experimental mice received Con A plus the indicated doses of
sCTLA4 numbers given are SGPT levels (mU/ml) for individual mice.
Mice receiving 3 or 30 mg/kg CTLA4 per injection showed a
statistically significant decrease in SGPT levels, indicating
less liver damage, compared to Con-A-only treated controls
(p<0.05). An analysis of variance with Dunnett's multiple
comparisons was performed to test for differences between the
groups receiving saline and different doses of CTL~4.
.~ 3 1 9
W095/01994 PCT~S94/07685
EXAMPLE 11
PEGylation of Wild-tyPe CTLA4
A. PEGylation with NHS-PEG Reagents
CTLA4 contains two lysine residues per monomer. Soluble
CTLA4 can be efficiently PEGylated using an NHS-5K-PEG reagent,
which preferentially reacts with free amines such as those
present on lysine residues. The active CTLA4 dimer prepared
according to Example 8E was concentrated to 1.5-4.0 mg/ml using
a stirred pressure cell (Amicon, 50ml) containing a 3000 Da
molecular weight cut-off (MWC0) membrane (YM3, Amicon). Refolded
soluble CTLA4 was reacted with a 5,000 kDa NHS-ester polyethylene
glycol (5K-NHS-PEG). The final reaction mixture contained 675
mg/ml, (28 mM) CTLA4, 9mM TRIS, 55mM sodium phosphate, pH 7.0,
396 mg/ml, (84 mM) 5K-NHS-PEG, 112mM NaCl. The molar ratio of
PEG:CTLA4 was 3:1. The reaction was carried out at room
temperature for 5-6 hours. The reaction mixture was stored at
4C. SDS-PAGE analysis (non-reduced conditions) demonstrated that
the PEGylated products consisted of a major and a minor product
migrating with relative moleuclar weights of 46,000 Da, and
65,000 Da, respectively. The percent overall conversion of the
CTLA4 starting material was approximately 50-60%.
B. Isolation of Lysine-PEGylated Products
The reaction mixture cont~in;ng the PEGylated products was
diluted with an equal volue of 20 mM TRIS, pH 8.0 (Buffer C), and
loaded onto an anion exchange column (Resource Q, 5mm X 50mm,
volume = 1.0 ml, Pharmacia, Piscataway, NJ) previously
equilibrated with Buffer C. The bound protein (and unreacted
PEG) were eluted with a linear gradient (20 column volumes) to
0.5 M NaCl at a flow rate of 1.0 ml/min. 0.5ml fractions were
collected. The minor PEGylated product (migrating at 65000 Da on
SDS-PAGE) eluted in fractions 9 and 10 at about 0.3M NaCl; the
major PEGylated product (migrating at 46000 Da on SDS-PAGE)
eluted in fractions 11 and 12 at about 0.35 M NaCl. Unreacted
PEG and unreacted CTLA4 dimer eluted in fractions 14 and 15 at
about 0.4M NaCl.
1 9
WO95/01994 PCT~S94/07685
C. Analysis of PEGylated Products
Aliquots of both the major and minor PEGylated products, and
unreacted CTLA4 dimer were analyzed by SDS-PAGE under both
non-reducing and reducing conditions. Reduction of the
unreacted CTLA4 dimers yielded monomers migrating with a relative
molecular weight of 12000 Da. Reduction of the major PEGylated
product (migrating with a relative molecular weight of about
46,000 Da by non-reducing SDS-PAGE) yielded both unPEGylated
monomer and PEGylated product migrating at molecular weights of
12000 Da and 18000 Da, respectively, in a molar ratio of 1:1.
This demonstrates that the major PEGylated product (46,000 Da) is
a mono-PEGylated dimer, i.e. only one of the monomer subunits is
PEGylated and it contains a single PEG molecule. The species
migrating at 18000 Da after reduction is a mono-PEGylated
monomer. Reduction of the minor PEGylated product (migrating
with a relative molecular weight of 65,000 Da by non-reducing
SDS-PAGE) yielded 1 major product: a PEGylated product migrating
at 18000 Da. This 18,000 Da PEGylated product is mono-PEGylated
monomer indicating that the 65000 Da PEGylated product is doubly
PEGylated CTLA4 dimer. Since reduction of this doubly PEGylated
species does not yield significant amounts of unPEGylated
monomer, each CTLA4 monomer contains a single PEGylated lysine
residue. Small amounts of both a PEGylated product migratiny at
46000 Da and unPEGylated monomer were also detected after
reduction of the 65,000 Da minor PEGylated product. It is likely
that these are the products from small amounts of high MW (>
67000 Da) PEGylated species contaminating the 65,000 Da product.
D. Bioactivities of PEGylated Products
Fractions 9 and 10 (doubly PEGylated dimers), fractions 11
and 12 (mono-pegylated dimers) and fractions 14 and 15 (unreacted
dimers) fro Example llB were pooled separately, concentrated and
assayed for activity in the IL-2 production bioassay described in
Example 7. Results, shown in Table 9, indicate that mono-
pegylated CTLA4 had an ICso approximately 3-4X greater than that
of unpegylated CTLA4 (400 ng/ml versus 100 ng/ml). The IC50 for
21~4319
WO95/01994 PCT~S94/07685
di-pegylated CTLA4 was about 6X greater than that of unpegylated
CTLA4.
TABLE 9
~0~Opti~1Dk~ity(450-570nm)*
(~g ) F~ olls 9/10 Fractions 11/12 ~a~;Lons 14/15
0 .522 ~ .026 .575 i.024 .597 +.oæ
0.0015 .502 ~.004 .553 i.032 .556 ~.025
0.0045 .486 i.010 .531 i.034 .582 i.047
0.014 .443 ~.028 .552 i.029 .499 i.016
0.04 .423 i.012 .452 i.030 .391 ~.013
0.12 .415 ~.045 .383 ~.017 .307 i.005
0.37 .395 ~.035 .325 i.024 .225 ~.022
1.1 .292 i.018 .æ8 ~.017 .114 i.008
3.3 .219 i.009 .140 i.006 .075 ~.010
lS 10 .152 ~.019 .094 i.009 .057 ~.003
* Values are means + one standard deviation for triplicate
wells. The values for Jurkat cells alone were 0.026 + .003,
0.049 + .004 and 0.040 + .017 for Fractions 9/lO, Fractions ll/12
and Fractions 14/15 experiments, respectively. Protein
concentrations were determined using bovine serum albumin as the
St~nA~rd .
The foregoing description of the invention is exemplary for
purposes of illustration and explanation. It should be
understood that various modifications can be made without
departing from the spirit and scope of the invention.
Accordingly, the following claims are intended to be interpreted
to embrace all such modifications.
