Note: Descriptions are shown in the official language in which they were submitted.
wo 94/10317 2 1 ~ 6 ~ 2 6 PCI/US93/10506
- Conjugate Vaccine Against Group B Streptococcus
Background of the Invention
.St~tement as to Rights to Inventions Made Under
Federally-Sponsored Research and Development
Part of the work performed during development of this invention
utilized U.S. Government funds. The U.S. Government has certain rights in
this invention.
Cross Reference to Related Applications
This application is a continuation-in-part of U.S. Application No.
07/408,036, filed September 15, 1989.
Field of the Invention
The invention relates to the fields of microbiology and vaccine
technology, and concerns the development of a vaccine capable of conferring
immunity to infection by group B Streptococcus.
Related Art
Bacteria of the Streptococcus genus have been implicated as causal
agents of disease in humans and animals. The Streptococci have been divided
into immunological groups based upon the presence of specific carbohydrate
antigens on their cell surfaces. At present, groups A through O are
recognized (Davis, B.D. et al., In: Microl~iology, 3rd. Edition, page 609,
(Harper & Row, 1980). Streptococci are among the most common and impor-
tant bacteria causing human disease. Although Streptococci of the B
group are associated with animal disease (such as mastitis in cattle),
WO 94/1031~L 46~3~6 -2- PCI/US93/10506
Streptococcus aga/acti(.~ (a group B Streptococci) has emerged as the most
common cause of human neonatal sepsis in the United States and is thought
to be responsible for over 6000 dèaths annually (Hill, H.R. et al., Sexually
Transmitted Diseases, McGraw Hill, pp. 397-407). Group B Streptococcus
is also an important pathogen in late-onset meningitis in infants, in postpartumendometritis, and in infections in immunocompromised adults (Patterson, M.J.
et al., Bact. Rev. 40:774-792 (1976)). Although the organism is sensitive to
antibiotics, the high attack rate and rapid onset of sepsis in neonates and
meningitis in infants results in both high morbidity (50%) and mortality (20%)
(Baker, C.J. et al., New Eng. J. Med. (Editorial) 314(26): 1702-1704 (1986);
Baker, C.J. et al'., J. Infect. Dis. 136: 137-152 (1977)).
Group B Streptococcus is a common component of normal human
vaginal and colonic flora. While the most common route of neonatal infection
is intrapartum from vaginal colonization, nosocomial spread in newborn
nurseries has also been described (Patterson, M.J. et al., Baa. Rev. 40:774-
792 (1976)). However, only a small percentage of infants colonized with
group B Streptococcus develop serious infections. The role of both host
factors and bacterial virulence determin~ntc in the transition from colonizationto infection is not well understood.
Several proteins from group B Streptococcus are throught to have a
role in virulence and immunity (Ferrieri, P, Rev. Infect. Dis. I O:S363 ( 1988)).
In 1975, Lancefield defined the C proteins of group B Streptococcus by their
ability to elicit protective immunity (Lancefield, R.C, et al., J. Exp. Med.
142:165-179 (1975)). This group of proteins is thought to contain several
different polypeptides and antigenic determinants. In view of these fin(ling~,
efforts to prevent infections with group B Streptococcus have been directed
towards the use of prophylactic antibiotics and the development of a vaccine
against group B Streptococcus (Baker, C.J, et al., Rev. of Infec. Dis. 7:458-
467 (1985), Baker, C.J. et al., New Eng. J. Med. (Editorial) 314(26): 1702-
1704 (1986)). Polysaccharide vaccines against group B Streptococcus are
described by Kasper, D.L. (U.S. Patent 4,207,414 and U.S. Reissue Patent
2146926
WO 94/10317 PCr/US93tlO506
_ --3--
RE31672, and U.S. Patent Nos. 4,324,887, 4,356,263, 4,367,221, 4,367.222,
and 4,367,223), by Carlo, D.J. (U.S. Patent 4,413,057, European Patent
Publication 38,265), and by Yavordios, D. et al. (European Patent Publication
711515), all of which references are incorporated herein by reference.
Except for the small sub-population of infants in whom both maternal
colonization with group B Streptococcus and other perinatal risk factors can
be identified, the use of prophylactic antibiotics has not been practical or
efficacious in preventing the majority of cases (Boyer, K.M, et al., New Eng.
J. Med. 314(26):1665-1669 (1986)). Intrapartum chemoprophylaxis has not
gained wide acceptance for the following reasons: (1) It has not been possible
to identify maternal colonization by group B Streptococcus in a fast, reliable
and cost-effective manner; (2) About 40% of neonatal cases occur in low-risk
settings; (3) It has not been considered practical to screen and/or treat all
mothers or infants who are potentially at risk; and (4) antibiotic prophylaxis
has not appeared to be feasible in preventing late-onset meningitis (7200 cases
per year in the United States) or postpartum endometritis (45,000 cases
annually) (Baker, C.J. et al., New Eng. J. Med. (Editorial) 314:1702-1704
(1986)).
Deposit of Microorganisms
Plasmids pJMS1 and pJMS23 are derivatives of plasmid pUX12 which
contain DNA capable of encoding antigenic Streptococci proteins that may be
used in accordance with the present invention. Plasmid pUX12 is a derivative
of plasmid pUC12. Plasmids pJMS1 and pJMS23 were deposited on
September 15, 1989, at the American Type Culture Collection, Rockville,
MD. and given the designations ATCC 40659 and ATCC 40660, respectively.
WO 94/10317 PCr/US93/10506
46326' 4
Summary of the Invent~on
Streptococcus agal(7c~1ae is the most common cause of neonatal sepsis
in the United States and is responsible for between 6,000 and 10,000 deaths
per year. While the type-specific polysaccharide capsule of group B
Streptococcus is immunogenic and carries important protective antigens,
clinical trials of a polysaccharide vaccine have shown a poor response rate
(Baker, C.J. etal., NewEngl. J. Med. 319:1180 (1980); Insel, R.A, etal.,
NewEng. J. Med. (Editorial) 319(18):1219-1220 (1988)).
The present invention concel --s the development of a conjugate vaccine
to group B Streptococcus, (i.e. Streptococcus agalactiae) that utilizes to a
protective protein antigen expressed from a gene cloned from group B
Streptococcus. This novel conjugate vaccine has the advantages both of
eliciting T-cell dependent protection via the adjuvant action of the carrier
protein and also providing additional ~r~Lecli~e epitopes that are present on the
cloned group B Streptococcus protein (Insel, R.A, et al., New Eng. J. Med.
(Editorial) 319(18): 1219-1220 (1988); Baker, C.J, et al., Rev. of Infec. Dis.
7:458~67 (1985)).
In detail, the invention provides a conjugate vaccine capable of
conferring host immunity to an infection by group B Streptococcus which
comprises (a) a polysaccharide conjugated to (b) a protein; wherein both the
polysaccharide and the protein are characteristic molecules of the group B
Streptococcus, and wherein the protein is a derivative of the C protein alpha
antigen that retains the ability to elicit protective antibodies against the group
B Streptococcus.
The invention also concerns a method for preventing or attenuating an
infection caused by a group B Streptococcus which comprises administering
to an individual, suspected of being at risk for such an infection, an effectiveamount of the conjugate vaccine of the invention, such that it provides host
immunity against the infection.
WO 94/10317 21 4 6 9 2 6 PCI/US93/10506
The invention further concerns a method for preventing or attenuating
infection caused by a group B Streptococcus which comprises administering
to a pregnant female an effective amount of a conjugate vaccine of the
invention, such that it provides immunity to the infection to an unborn
offspring of the female.
The invention also provides a method for preventing or attenuating an
infection caused by a group B Streptococcus which comprises administering
to an individual suspected of being at risk for such an infection an effective
amount of an antisera elicited from the exposure of a second individual to a
conjugate vaccine of the invention, such that is provides host immunity to the
infection.
Brief Description of the Figures
Figure 1 shows the modifications of pUC12 to create the plasmid
pUX12.
Figure 2 shows the restriction and transcriptional map of the plasmid
pUX12.
Figure 3 shows the modifications which were made to pUX12 in order
to produce the + 1 reading frame plasmid pUX12+ 1 (A), and which produce
the -1 reading frame plasmid pUX12-1 (C). (B) shows a construction which
is additionally capable of resulting in a -1 reading frame plasmid.
Figure 4 shows the result of mouse protection studies employing rabbit
antisera against S1 and S23. Protection was observed in mice inoculated with
anti-S1 antisera (p<0.002) or with anti-S23 antisera (p<0.022). Due to the
sample size used, this difference in the observed statistical significicance
between the Sl and S23 experiments is not signihcant. In the Figure, the
mice surviving per total tested is reported as a fraction above each bar.
Figure 5 shows the sequencing strategy and restriction endonuclease
map of bca. The partial restriction endonuclease map encompasses the region
of pJMS23 from an Nde I site to a Sn l site located at nucleotide 3594 for
~ 4~g PCI'/US93/10506
which the nucleotide sequence of bca and flanking region was determined.
The open reading frame is illustrated by an open box. Transposon Tn5seql
mutations (triangles) serve to prime nucleotide sequencing in both directions
from each of the insertions. The regions`of sequence obtained from
oligonucleotide primers (open arrows) and the nested deletions (closed arrows)
are also shown. Restriction endonuclease cleavage sites are abbreviated as
follows: A, Alu I; B, Bsm l; F, Fok I; H, Hincll; N, Nde I; S, Sty I. -bp,
base pairs.
Figure 6 shows the nucleotide [SEQ ID NO: 14] and deduced amino
acid sequences [SEQ ID NO: 151 of bca and the fl~nking regions. The DNA
strand is shown 5' to 3', and nucleotides are listed on the upper line beginning78 base pairs upstream from the open reading frame. The deduced amino acid
sequence for the open reading frame is below the nucleic acid sequence. The
G+C content of 40% and the codon usage are similar to other streptococcal
genes (Holling.ch~-l, S.K. et al., J. Biol. Chem. 261:1677-1686 (1986)).
Highlighted realulcs include the -10 (TATAAT) promoter consensus site,
ribosomal binding site (RBS), signal sequence, repeat region 1, the C
terminus, with the termination codon (TAA) at position 3161, and two regions
of dyad symmetry that are potential transcriptional terminators.
Figure 7 is represented by two panels (A and B) that show homologies
to the putative signal sequences and C-terminal membrane anchor of the C
protein alpha antigen, rewspectively. Panel 7A: the N terminus of the C
protein alpha antigen on the top line (sequence 1) tSEQ ID NO: 16] and is
compared with the following Gram-positive signal sequences (accession codes
are listed for each of the sequence numbers): sequence 2 [SEQ ID NO: 17],
the C protein beta antigen (S15330; STRBAGBA) and four M proteins of
group A Streptococcus; sequence 3 [SEQ ID NO: 18], ennX (STRENNX);
sequence 4 [SEQ ID NO: l9l, emm24 (STREMM24); sequence 5 [SEQ ID
NO: 20], M1 (S00767); sequence 6 [SEQ ID NO: 21], S01260. Lysine (K)
and arginine (R) residues preceding the underlined hydrophobic stretch are in
boldface type, as are serine (S) and threonine (T) residues preceding the
WO 94/10317 2 1 ~ 6 ~ 2 S PCl/US93/10506
--7--
probable signal cleavage sites. The probable cleavage site for the alpha signal
is following the valine at position 41; however, alternative cleavage sites exist
at positions 53-56. Panel B: The C terminus of the C protein alpha antigen
is shown on the top line (sequence 1) [SEQ ID NO: 22] and compared with
S the following Gram-positive membrane anchor peptides: sequence 2 [SEQ ID
NO: 23], M5 (A28616, M6 (A26297), and M24 (A28549); sequence 3 [SEQ
ID NO: 24], ennX (STREENX); sequence 4 [SEQ ID NO: 25], S00128,
STRPROTG, and A26314; sequence 5 [SEQ ID NO: 26], spg (A24496);
sequence 6 [SEQ ID NO: 27], arp4 (S05568) and emm49 (STRM49NX,
STRMM24); and sequence 7 rSEQ ID NO: 28], emml2 (STR12M), M5, M6,
M24, emml2, emm49, and ennX are all M proteins; arp4 is a binding protein
of group A Streptococcus. S00128, STRPROTG, spg, and A26314 are IgG
binding proteins of group G Streptococcus. Sequence 8 [SEQ ID NO: 29]
illustrates the membrane anchor for the beta antigen, which lacks the
PPFFXXAA [SEQ ID NO: 1] motif. Highlighed areas include Iysine residues
(K) preceding the LPXTGE [SEQ ID NO: 2] motif (boxed), the hydrophobic
region (underlined) with the PPFFXXAA [SEQ ID NO: 1] consensus (boxed
and underlined), and the terminal amino acid aspartic acid (D) or asparagine
(N)-
Figure 8 shows a comparison of the cloned and native gene products
of bca. Surface proteins of the A909 strain of group B Streptococclls (type
la/C) and C protein alpha antigen clone pJMS23-1 were analyzed by
SDS/PAGE and Western blotting and were probed with the alpha antigen-
specific monoclonal antibody 4G8. Arrowheads illustrate an example of the
difference between proteins. Molecular mass markers (in kDa) are shown on
the right.
Figure 9 shows a schematic of the open reading frame of bca.
Summary of the structural features of the open reading frame of the C protein
alpha antigen based on analysis of the amino acid sequence deduced from the
nucleotide sequence of bca. The numbers above the boxes indicate the
WO 94/10317 PCI/US93/10506
2~j926 -8- _
nucleotide position, and the numbers below are the amino acid residues of the
mature protein within the open reading frame.
Detailed Description of the Preferred Embodiments
Significance and Clinical P~ ,e.~ e
Maternal immunoprophylaxis with a vaccine to group B Streptococcus
has been proposed as a potential route for protecting against infection both in
the mother and in the young infant through the peripartum transfer of
antibodies (Baker, C.J. et al., New Eng. J. Med. (Editorial) 314(26): 1702-
1704 (1986); Baker, C.J. etal., NewEng. J. Med. 319:1180 (1988); Baker,
C.J. et al., J. lnfect. Dis. 7:458 (1985)). As is the case with other
encapsulated bacle,ia, susceptibility to infection correlates with the absence of
type-specific antibody (Kasper, D.L., et al., J. Clin. Invest. 72:260-269
(1983), Kasper, D.L., et al., Antibiot. Chemother. 35:90-100 (1985)). The
lack of opsonically active type-specific anti-capsular antibodies to group B
Streptococcus is a risk factor for the development of disease following
colonization with group B Strep~ococcus (Kasper, D.L. et al., J. Infec. Dis.
153:407-415 (1986)).
One approach has been to vaccinate with purified type-specific capsular
polysaccharides. Methods of producing such vaccines, and the use of such
vaccines to immunize against group B Streptococcus are disclosed by Kasper,
D.L. (U.S. Patent 4,207,414 and U.S. Reissue Patent RE31672, and U.S.
Patent Nos. 4,324,887, 4,356,263, 4,367,221, 4,367,222, and 4,367,223), by
Carlo, D.J. (U.S. Patent 4,413,057, European Patent Publication 38,265), and
by Yavordios, D. et al. (European Patent Publication 71,515), all of which
references are incorporated herein by reference.
Although the polysaccharide capsule of group B Streptococcus is well
characterized and has been shown to play a role in both virulence and
immunit~ (Kasper, D.L. J. Infect. Dis. 153:407 (1986)), these capsular com-
WO 94/10317 PCr/US93/10506
21~69~6
ponents have been found to vary in their immunogenicity depending both on
the specific capsular type and on factors in the host's immune system (Baker,
C.J, et al., Rev. of Infec. Dis. 7:458-467 (1985)). A recently completed
clinical trial evaluating a capsular polysaccharide vaccine of group B
Streptococcus showed an overall response rate of 63 % and indicated that such
a vaccine was not optimally immunogenic (Baker C.J, et al., New Eng. J.
Med. 319(18): 1180-1185 (1988)).
Differences in immunogenicity have also been observed with the
capsular polysaccharides of other bacteria. For examplet the vaccine against
the type C meningococcal capsule is highly active while the group B
meningococcal polysaccharide vaccine is not immunogenic (Kasper, D.L. et
al., J. Infec. Dis. 153:407-415 (1986)). T-cell independent functions of the
host's immune system are often required for mounting an antibody response
to polysaccharide antigens. The lack of a T-cell independent response to
polysaccharide antigens may be responsible for the low levels of antibody
against group B Streptococcus present in mothers whose children subsequently
develop an infection with group B Streptococcus. In addition, children prior
to 18 or 24 months of age have a poorly developed immune response to T-cell
independent antigens.
Determinants of Virulence and lmmllnity in group B Streptococcus
There are five serotypes of group B Streptococcus that share a common
group specific polysaccharide antigen. However, antibody of the group
antigen is not protective in animal models. Lancefield originally classified
group B Streptococcus into four serotypes (la, Ib, II and III) using precipitin
techniques. The composition and structure of the unique type-specific capsular
polysaccharides for each of the serotypes was subsequently determined
(Jennings, H.J, etal., Biochem. 22:1258-1264 (1983), Kasper, D.L. etal., J.
Infec. Dis. 153:407-415 (1986), Wessels, M.R, et al., Trans. Assoc. Amer.
Pl~vs. 98:384-391 (1985)). Wilkinson defined a fiftll serotype. Ic, by the
WO 94/10317 PCr/US93/10506
2~,~6926 -10- ~
identification of a protein antigen (originally called the Ibc protein) present on
all strains of serotype Ib and some strains with the type Ia capsule (Wilkinson,H.W, et al., J. Bacteriol. 97:629-634 (1969)? -~Wilkinson, H.W, et al., Infec.
and Immun. 4:596-604 (1971)). Thls protein was later found to vary in
prevalence between the di~re-~nl serotypes of group B Streptococcus but was
absent in serotype la (Johnson, D.R, et al., J. Clin. Microbiol. 19:506-510
(1984)).
The nomenclature has recently been changed to classify the serotypes
of group B Streptococcus solely by the capsular type-specific polysaccharides,
and a fifth capsular type has also been described (type IV) (Pritchard, D.G,
et al., Rev. Infec. Dis. 10(8):5367-5371 (1988)). Therefore, the typing of
group B Streptococcus strains is no longer based on the antigenic Ibc protein,
which is now called the C protein. The type Ic strain is reclassified as
serotype la on the basis of its capsular polysaccharide composition, with the
additional information that it also carries the C protein.
~mmnnQlogical, epidemiological and genetic data suggest that the type-
specific capsule plays an important role in illln~ullily to group B Streptococcus
infections. The composition and structure of the type-specific capsular
polysaccharides and their role in virulence and illlnlu,li~y have been the
subjects of intensive investigation (Ferrieri, P. et al., Infec. Immun. 27: 1023-
1032 (1980), Krause, R.M, etal., J. Exp. Med. 142:165-179 (1975), Levy,
N.J, et al., J. Infec. Dis. 149:851-860 (1984), Wagner, B, et al., J. Gen.
Microbiol. 118:95-105 (1980), Wessels, M.R, et al., Trans. Assoc. Amer.
Phys. 98:384-391 (1985)).
Controversy has existed regarding the structural arrangement of the
type-specific and group B streptococcal polysaccharides on the cell surface, on
the immunologically important determinants with in the type-specific
polysaccharide, and on the mechanisms of capsule determined virulence of
group B Streptococcus (Kasper, D.L. et al., J. Infec. Dis. 153:407-415
(1986)). To study the role of the capsule in virulence, Rubens et al. used
transposon mutagenesis to create an isogeneic strain of type III group B
WO 94/10317 PCl/US93/lOS06
ll 214692G
.~
Streptococcus that is unencapsulated (Rubens, C.E, et al., Proc. Natl. Acad.
Sci. USA 84:7208-7212 (1987)). They demonstrated that the loss of capsule
expression results in significant loss of virulence in a neonatal rat model.
However, the virulence of clinical isolates with similar capsular composition
varies widely. This suggests that other bacterial virulence factors, in additionto capsule, play a role in the pathogenesis of group B Streptococcus.
A number of proteins and other bacterial products have been described
in group B Streptococcus whose roles in virulence and immunity have not been
established, CAMP (Christine Atkins-Much Peterson) factor, pigment
(probably carotenoid), R antigen, X antigen, anti-phagocytic factors and poorly
defined "pulmonary toxins" (Ferrieri, P, et al., J. Exp. Med. 151:56-68
(1980); Ferrieri, P. etal., Rev. Inf. Dis. 10(2):1004-1071 (1988); Hill, H.R.
et al., Sexually Transmitted Diseases, McGraw-Hill, pp. 397-407). The C
proteins are discussed below.
Isogeneic strains of group B Streptococcus lacking hemolysin show no
decrease in virulence in the neonatal rat model (Weiser, J. N, et al., Infec. and
Immun. ~:2314-2316 (1987)). Both hemolysin and neuraminidase are not
always present in clinical isolates associated with infection. The CAMP factor
is an extracellular protein of group B Streptococcus with a molecule weight of
23,500 daltons that in the presence of staphylococcal beta-toxin (a
sphingomyelinase) leads to the Iysis of erythrocyte membranes. The gene for
the CAMP factor in group B Streptococcus was recently cloned and expressed
in E. coli (Schneewind, O, et al., Infec. and Immun. 56:2174-2179 (1988)).
The rs)le, if any, of the CAMP factor, X and R antigens, and other factors
listed above in the pathogenesis of group B Streptococcus is not disclosed in
the prior art (Fehrenbach, F.J, et al., In: Bacterial Protein Toxins, Gustav
Fischer Verlag, Stuttgart (1988); Hill, H.R. et al., Sexually Transmitted
Diseases, McGraw-Hill, NY, pp. 397-407 (1984)).
The C protein(s) are a group of a cell surface associated protein
antigens of group B Streptococcus that were originally extracted from group
B Streptococcus by Wilkinson et al. (Wilkinson, H.W. et al., J. Bacteriol
WO 94/10317 PCI/US93/10506
6g~6 -12-
97:629-634 (1969), Wilkinson, H.W, et al., Infec. ana' Imrnun. 4:596-604
(1971)). They used hot hydrochloric acid (HCI) to extract the cell wall and
trichloroacetic acid (TCA) to precipitate protein antigens. Two antigenically
distinct populations of C proteins have beèn described: (1) A group of
proteins that are sensitive to degradati`Qn by pepsin but not by t;ypsin, and
called either TR (tr~psin resistant) or alpha (c~). (2) Another group of group
B Streptococcus proteins that are sensitive to deg adation by both pepsin and
trypsin, and called TS (t~ypsin sensitive) or beta (O (Bevanger, L, et al., ActaPath. Microbiol. Scana' Sect. B. 87:51-54 (1979), Bevanger, L, et al., Acta
Path. Microbiol. Scana'. Sect. B. 89:205-209 (1981), Bevanger, L. etal., Acta
Path. Microbiol. Scana'. Sect. B. 91:231-234 (1983), Bevanger, L. etal., Acta
Path. Microbiol. Scana'. Sect. B. 93: 113-119 (1985), Bevanger, L, et al., Acta
Path. Microbiol. Immunol. Scana'. Sect. B. 93: 121-124 (1985), Johnson, D.R,
et al., J. Clin. Microbiol. 19:506-510 (1984), Russell-Jones, G.J, et al., J.
E~tp. Med. 160:1476-1484 (1984)).
In 1975, Lancefield et al. used mouse protection studies with antisera
raised in abbits to define the C proteins functionally for their ability to confer
protective immunity against group B Streptococcl~s strains carrying similar
protein antigens (Lancefield, R.C, etal., J. Exp. Med. 142:165-179 (1975)).
Numerous investigators have obtained crude preparations of antigenic proteins
from group B Streptococcus, that have been called C proteins, by chemical
extraction from the cell wall using either HCI or de~erge-lL~. (Bevanger, L, et
al., Acta Path. Microbiol. Scana'. Sect. B. 89:205-209 (1981), Bevanger, L.
et al., Acta Path. Microbiol. Scand. Sect. B. 93:113-119 (1985), Russell-
Jones, G.J, etal., J. Exp. Med. 160:1476-1484 (1984), Valtonen, M.V, etal.,
Microb. Path. 1: 191-204 (1986), Wilkinson, H.W, et al., Infec. ana' Immun.
4:596-604 (1971)). The reported sizes for these antigens have varied between
10 and 190 kilodaltons, and a single protein species has not been isolated or
characterized (Ferrieri, P. et al., Rev. Inf. Dis. 10(2): 1004-1071 (1988)).
By screening with prolective antisera, C proteins can be detected in
about 60% of clinical isolates of group B Streptococcus, and are found in all
WO 94/10317 PCI/US93/10506
214692~
-13-
serotypes but with differing frequencies (Johnson, D.R, et al., J. Clin.
Microbiol. 19:506-510 (1984)). Individual group B Streptococcus isolates may
have both the TR and TS antigens, or only one, or neither of these antigens.
Except for the ability of the partially purified antigens to elicit protective
immunity, the role of these antigens in pathogenesis has not been studied in
vitro. In vivo studies with group B Streptococcus strains that carry C proteins
provides some evidence that the C proteins may be responsible for resistance
to opsonization (Payne, N.R, et al., J. Infec. Dis. 151:672-681 (1985)), and
the C proteins may inhibit the intracellular killing of group B Streptococcus
following phagocytosis (Payne, N.R, et al., Infea. and Immun. 55: 1243-1251
(1987)). It has been shown that type Il strains of group B Streptococcus
carrying the C proteins are more virulent in the neonatal rat sepsis model
(Ferrieri, P, et al., Infect. Immun. 27: 1023-1032 (1980), Ferrieri, P. et al.,
Rev. Inf. Dis. 10(2): 1004-1071 (1988)). Since there is no genetic data on the
C proteins, isogeneic strains lacking the C proteins have not previously been
studied. There is evidence that one of the TS, or ,B, C proteins binds to IgA
(Russell-Jones, G.J, et al., J. Erp. Med. 160: 1476-1484 (1984)). The role,
if any, that the binding of IgA by the C proteins has on virulence is, however,
not disclosed.
In 1986, Valtonen et al. isolated group B Streptococcus proteins from
culture supernatants that elicit protection in the mouse model (Valtonen, M.V,
et al., Microb. Path. 1:191-204 (1986)). They identified, and partially
purified, a trypsin resistant group B Streptococcus protein with a molecular
weight of 14,000 daltons. Antisera raised to this protein in rabbits protected
mice against subsequent challenge with type Ib group B Streptococcus (89%
protection). This protein is, by Lancefield's definition, a C protein.
However, when antisera raised against this protein were used to
immunoprecipitate extracts of group B Streptococcus antigens, a number of
higher molecular weight proteins were found to be reactive. This suggested
that the 14,000 m.w. protein may represent a common epitope of several
group B Streptococcus proteins. or that it is a degradation product found in the
WO 94/10317 PCl'/US93/10506
2~ 9~6 -14- _
supernatants of group B Streptococcus cultures. The diversity in the sizes in
C proteins isolated from both the bacterial cells and supel"a~nts suggests that
the C proteins may represent a gene family, and maintain antigenic diversity
as a m~h~ni~m for protection against the immune system.
The range of reported molecular~eights and difficulties encountered
in purifying individual C proteins are similar to the problems that many
investigators have faced in isolating the M protein of group A Streptococcus
(Dale, J.B, et al., Infec. and Immun. 46(1):267-269 (1984), Fischetti, V.A,
et al., J. Exp. Med. 144:32-53 (1976), Fischetti, V.A, et al., J. Exp. Med
146: 1108- 1123 (1977)). The gene for the M protein has now been cloned and
sequenced, and found to contain a number of repeated DNA sequences
(Hollingsh~-l, S.K, et al., J. Biol. Chem. 261: 1677-1686 (1986), Scott, J.R,
et al., Proc. Natl. Acad. Sci USA 82:1822-1826 (1986), Scott, J.R, et al.,
Infec. ana' Immun. 52:609-612 (1986)). These repeated sequences may be
responsible for post-transcriptional processing that results in a diversity in the
siæ of M proteins that are produced. The mech~nicm by which this occurs
is not understood. The range of molecular weights described for the C
proteins of group B Streptococcus might result from a similar process.
Cleat et al. attempted to clone the C proteins by using two ~-t;pal~lions
of antisera to group B Streptococcus obtained from Bevanger (~ and ,l~) to
screen a library of group B Streptococcus DNA in E. coli (Bevanger, L. et
al., Acta Path. Microbiol. Immunol. Scana'. Sect. B. 93: 113-119 (1985), Cleat,
P.H, etal., Infec. and Immun. 55(5):1151-1155 (1987), which rer~.~nces are
incorporated herein by l~fel~nce). These investigators described two clones
that produce proteins that bind to antistreptococcal antibodies. However, they
failed to determine whether either of the cloned proteins had the ability to
elicit protective antibody, or whether the prevalence of these genes correlated
the with group B Streptococcus strains known to carry the C proteins. The
role of the cloned gene sequences in the virulence of group B Streptococcus
was not investigated. Since the C proteins are defined by their ability to elicit
WO 94/10317 PCr/US93/10506
-lS- 2146926
protective antibodies, this work failed to provide evidence that either of the
clones encodes a C protein.
The Conjugated Vaccine of the ~1ll Invention
The present invention surmounts the above-discussed deficiencies of
prior vaccines to group B Streptococcus through the development of a
conjugate vaccine in which the capsular polysaccharides are covalently linked
to a protein backbone. This approach supports the development of a T-cell
dependent antibody response to the capsular polysaccharide antigens and
circumvents the T-cell independent requirements for antibody production
(Baker, C.J, et al., Rev. of Infec. Dis. 7:458-467 (1985), Kasper, D.L. et al.,
J. Infec. Dis. 153:407-415 (1986), which references are incorporated herein
by reference).
In a conjugate vaccine, an antigenic molecule, such as the capsular
polysaccharides of group B Streptococcus (discussed above), is covalently
linked to a "carrier" protein or polypeptide. The linkage serves to increase
the antigenicity of the conjugated molecule. Methods for forming conjugate
vaccines from an antigenic molecule and a "carrier" protein or polypeptide are
known in the art (lacob, C.O, et al., Eur. J. Immunol. 16: 1057-1062 (1986);
Parker, J.M.R. et al., In: Modern Approaches to Vaccines, Chanock, R.M.
etal., eds, pp. 133-138, Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY (1983); Zurawski, V.R, et al., J. Immunol. 121: 122-129 (1978);
Klipstein, F.A, et al., Infect. Immun. 37:550-557 (1982); Bessler, W.G,
Immunobiol. 170:239-244 (1985); Posnett, D.N, et al., J. Biol. Chem.
263:1719-1725 (1988); Ghose, A.C, et al., Molec. Immunol. 25:223-230
(1988); all of which references are incorporated herein by reference).
A prototype model for conjugate vaccines was developed against
Hemophilus influenzae (Anderson, P, Infec. and Immun. 39:223-238 (1983);
Chu, C, et al., Infect. Immun. 40:245-256 (1983); Lepow, M, Pediat. Infect.
Dis. J. 6:804-807 (1987), whicll references are incorporated herein by
WO 94/10317 PCr/US93/10506
2~,~69~G -16- `~
reference), and this model may be employed in constructing the novel vaccines
of the present invention. Additional methods for producing such a conjugate
vaccine are disclosed by Anderson, P.W, et al., European Patent Publication
245,045; Anderson, P.W, et al., U.S. Pa ent Nos. 4,673,574 and 4,761,283;
S Frank, R. et al., U.S. Patent No. 4,789,735; European Patent Publication No.
206,852; Gordon, L.K, U.S. Patent No. 4,619,828; and Beachey, E.H, U.S.
Patent No. 4,284,537, all of which references are incorporated herein by
reference.
The protein backbones for conjugate vaccines such as the Hemophilus
influenzae vaccine have utilized proteins that do not share antigenic propertieswith the target organism from which the bacterial capsular polysaccharides
were obtained (Ward, J. et al., In: Vaccines, Plotkin, S.A, et al., eds,
Saunders, Philadelphia, page 300 (1988).
In contrast, the conjugate vaccine of the present invention employs im-
munogenic proteins of group B Streptococcus as the backbone for a conjugate
vaccine. Such an approach is believed to lead to more effective vaccines
(Insel, R.A, etal., NewEng. J. Med. (Editorial) 319(18):1219-1220 (1988)).
The conjugate, protein-polysaccharide vaccine of the present invention is the
first to specifically characterize group B Streptococcus proteins that may be
used in a conjugate vaccine. Any protein which is characteristic of group B
Streptococcus may be employed as the protein in the conjugate vaccines of the
present invention. It is, however, prefered to employ a C protein of a group
B Streptococcus for this purpose. As discussed more fully below, plasmids
pJMS1 and pJMS23 contain DNA which encode Streptococcus C protein. The
most plcr~ d C proteins are those obtained upon the expression of such
DNA in bacteria.
As indicated above, the present invention concerns the cloning and
expression of genes which encode the protective group B Streptococcus protein
antigens. Such proteins are preferdbly used as the protein backbone to which
the one or more of the polysaccharides of the group B Streptococcus can be
conjuoated in order to form a conjugate vaccine against these bacteria.
WO 94/10317 PCI/US93/10506
-17- 214~2~
. .
Alternatively, one or more proteins as described herein may be conjugated to
the structure of a polysaccharide of the group B Streptococcus.
The role of these proteins in the virulence and immunity of group B
Streptococcus may be exploited to develop an additional therapy against group
B Streptococcus infection. The isolation and characterization of these genes
of a bacterial origin allows the manipulation of the gene products to optimize
both the adjuvant and antigenic properties of the polypeptide backbone/carrier
of the conjugate vaccine.
Genetic Studies of the C Proteins
The present invention thus concerns the cloning of the C proteins of
group B Streptococcus, their role in virulence and immunity, and their ability
to serve as an immunogen for a conjugate vaccine against group B
Streptococcus.
Despite the extensive literature available on cloning in many groups of
Streptococci, only limited genetic manipulations have been accomplished in
group B Streptococcus (Macrina, F.L, Ann. Rev. Microbiol. 38:193-219
(1984), Wanger, A.R, etal., Infec. andlmmun. 55:1170-1175 (1987)). The
most widely used technique in group B Streptococcus has been the
development of Tn916 and its use in transposon mutagenesis (Rubens, C.E,
etal., Proc. Natl. Aca~l. Sci. USA 84:7208-7212 (1987), Wanger, A.R, etal.,
Res. Vet. Sci. 38:202-208 (1985)). However, since it would appear that there
is more than one gene for the C proteins and the protective antisera bind to
several proteins, screening for the C protein genes by transposon mutagenesis
is impractical.
2~ The present invention acomplishes the cloning of the C proteins (and
of any other proteins which are involved in the virulence of the group B
Streptococcus, or which affect host immunity to the group B Streptococcus)
through the use of a novel plasmid vector. For this purpose, it is desirable to
employ a cloning vector that could be rapidly screened for expression of
WO 94/10317 PCr/US93/10506
69?~6 -18-
proteins which bind to naturally elicited antibodies to group B Streplococcus.
Since such antibodies are heterologous polyclonal antibodies and not
monoclonal antibodies, it was necess~ry that a vector be employed which
could be easily screened through many positive clones to identify genes of
interest. ;
A number of techniques were available for screening clones for the
expression of antigens that bind to a specific antisera (Aruffo, A, et al., Proc.
Natl. Acad. Sci. USA 84:8573-8577 (1987)). The most widely used system,
Agtll, was developed by Young and Davis (Huynh, T.V. et al., In: DNA
Cloning, A Practical Approach, Vol. 1 (Glover, D.M, Ed.) IRL Press,
Washington pp. 49-78 (1985); Wong, W.W, et al., J. Immunol. Methods.
82:303-313 (1985), which e~ ces are incorporated herein by eferc,lce).
This technique allows for the rapid s~;lcenillg of clones expressed in the
Iysogenic phage whose products are released by phage Iysis. Commonly faced
problems with this system include the requirement for subcloning DNA
fragments into plasmid vectors for detailed endonncle~ce restriction mapping,
plc;~Jaling probes and DNA se4uenci"g. In addition, the preparation of DNA
from phage stocks is cumbersome and limits the number of potentially positive
clones that can be studied efficiently. Finally, the prepa,a~ion of crude protein
extracts from cloned genes is problematic in phage vector hosts.
To circumvent these problems, the present invention provides a plasmid
vector which was developed for screening cloned bacterial chromosomal DNA
for the expression of proteins involved in virulénce and/or immunity. The
present invention thus further concerns the development and use of an efficient
cloning vector that can be rapidly screened for expression of proteins which
bind to naturally elicited antibodies to group B Streptococcus. The vector was
prepared by modifying the commonly used plasmid cloning vector, pUC12
(Messing, J, et al., Gene 19:269-276 (1982); Norrander, J, et al., Gene
26: 101-106 (1983); Vieira, J, et al., Gene 19:259-268 (1982); which
references are incorporated herein by reference). The invention concerns the
veclor described below, and itS functional equivalents.
WO 94/10317 PCI'/US93/10506
21~69XB
_ -19-
Using this system, plasmid clones can be easily manipulated, mapped
with restriction endonucleases and their DNA inserts sequences, probes
prepared and gene products studied without the necessity for subcloning.
pUC12 is a 2.73 kilobase (kb) high copy number plasmid that carries a ColE1
origin of replication, ampicillin resistance and a polylinker in the lacZ gene
(Ausubel, F.M, et al.J Current Topics in Molecular Biology; Greene Publ.
Assn./ Wiley Interscience, NY (1987) which reference is incorporated herein
by reference).
Several modifications were made in the polylinker of pUC12 (Aruffo,
A, et al., Proc. Na~l. Acad. Sci. USA 84:8573-8577 (1987) which reference
is incorporated herein by reference). The overall plan in altering pUC12 was
to modify the polylinker to present identical but non-cohesive BstXI sites for
cloning, to add a "stuffer" fragment to allow for easy separation of the linear
host plasmid, and to provide for expression from the lac promoter in all three
translational reading frames.
In order to provide a site for the insertion of foreign DNA with a high
efficiency and to minimi7e the possibility for self-ligation of the plasmid,
inverted, non-cohesive BstXI ends were added to the polylinker. As shown in
Figure 1, pUC12 was first cut with BamHI (Step 1) and the plasmid was
mixed with two synthetic oligonucleotide adaptors that are partially
complementary: a 15-mer (GATCCATTGTGCTGG) [SEQ ID NO: 3] and an
11-mer (GTAACACGACC) [SEQ ID NO: 4] (Step 2). When the adaptors are
ligated into pUC12, two new Bstl sites are created but the original BamHI
sites are also restored (Step 3). The plasmid was then treated with
polynucleotide kinase and ligated to form a closed circular plasmid (Step 4).
When this plasmid is treated with BstXI, the resulting ends are identical and
not cohesive (both have GTGT overhangs) (Step 5).
A second modification in the polylinker was done to allow for the
purification of the linear plasmid for cloning without contamination from
partially cut plasmid that can self-ligate. A blunt end, 365 base pair (bp),
FnuD2 fragment was obtained from the plasmid pCDM. This cassette or
WO 94/10317 PCr/US93/10506
~ ~f69?~6 -20-
"stuffer" fragment, which does not contain a Bst~ site, was blunt end ligated
to two synthetic oligonucleotides that are partially complementary: a 12-mer
(ACACGAGATTTC) [SEQ ID NO: 5] and an 8-mer (CTCTAAAG) (Step 6).
The resulting fragment with adaptors has 4 bp overhangs (ACAC) that are
complementary to the ends of the modified pUCI2 plasmid shown in Step 5.
The modified pUC12 plasmid was ligated to the pCDM insert with adaptors;
the resulting construct, named pUX12, is shown in Figure 2. The pUXI2
plasmid can be recreated from plasmids pJMSI or pJMS23 by excision of the
introduced Streptococcus DNA sequences. Alternatively, it may be formed by
I0 recombinant methods (or by homologous recombination), using plasmid
pUCI2.
Since pUXI2 is to be used as an expression vector, it is preferable to
further modified the polylinker such that it will contain all three potential
reading frames for the lac promoter. These changes allow for the correct
translational reading frame for cloned gene fragments with a frequency of one
in six. For example, a cloned fragment can insert in the vector in one of two
orientations and one of three reading frames. To construct a +1 reading
frame, the pUXI2 plasmid was cut with the restriction enzyme EcoRI which
cleaves at a unique site in the polylinker. The single stranded 5' sticky ends
were filled in using the 5'-3' polymerase activity of T4 DNA polymerase, and
the two blunt ends ligated. This resulted in the loss of the EcoRI site, and thecreation of a new XrnnI site (Figure 3A). This construction was confirmed by
demonstrating the loss of the EcoRI site and confirming the presence of a new
~nnl site in the polylinker. In addition, double stranded DNA sequencing on
the +1 modified pUX12 plasmid was performed using standard sequencing
primers (Ausubel, F.M, et al., Current Topics in Molecular Biology; Greene
Publ. Assn./ Wiley Interscience, NY (1987)). The DNA sequence showed the
WO 94/10317 PCI`/US93/10506
-21- 2145926
addition of 4 base pairs to the polylinker and confirmed the modification of
pUX12 to a + 1 reading frame. This plasmid is called pUX12+ 1.
In order to construct a -1 reading frame, the pUX12 vector was cut
with the restriction enzyme SacI which cuts at a unique site in the polylinker
of pUX12. The single stranded 3' sticky ends were cut back to blunt ends
using the 3'-5' exonuclease activity of T4 polymerase, and the resulting blunt
ends ligated. The resulting sequence should eliminate the SacI site while
resulting in a new FnuD2 site (Figure 3B). However, restriction mapping of
the pUX12-1 plasmids showed that while the SacI site was absent, there was
no FnuD2 site present. In addition, the Smal/XmaI sites on the polylinker
were no longer present. Several potential pUX12-1 constructs were sequenced
from mini-prep, double-stranded DNA. Of the six modified plasmids se-
quenced, one was found with ten nucleotides absent, thereby creating a -1
reading frame (Figure 3C). This suggests that the T4 DNA polymerase has
additional exonuclease activity and cuts back additional double stranded
portions of the polylinker. Nevertheless, the resulting plasmid had a -1
reading frame. The plasmid was named pUX12-1.
The use of the pUX12 vectors in the cloning of antigenic proteins of
group B Streptococcus are discussed in detail in the Examples below. In brief,
DNA derived from group B Streptococcus, or complementary to such DNA
is introduced into the pUX12, pUX12+ 1 or pUX12-1 vectors and transformed
into Escherichia coli. The cloned DNA is expressed in ~. coli and the cellular
Iysate is tested to determine whether it contains any protein capable of bindingto antisera to group B Streptococcus.
There are a number of potentially interesting modifications of pUX12
that could increase its utility. For example, the lac promoter could be
replaced by another promoter, the origin of replication could be modified to
produce a lower copy number vector and the drug resistance marker could be
changed.
Any vector capable of providing the desired genetic information to the
desired host cell may be used tO provide genetic sequences encoding the alpha
WO 94/10317 PCI/US93/10506
~69?.6 -22- -~
antigen derivatives of the invention to a host cell. For example, in addition
to plasmids, such vectors include linear DNA, cosmids, transposons, and
phage.
The host cell is not limited to E. coli.- Any bacl~lial or yeast (such as
S. cerevisiae) host that is capable of expressi~ig the derivatives of the invention
may be used as an appropriate host. For example, B. subnlis and the group B
Streptococcus may be used as hosts. Methods for cloning and into such hosts
are known. For example, for Gram-positive hosts, see Harwood, C.R., et al.,
eds., "Molecular Biological Methods for R(7cilll/~, " Wiley-Interscience, New
York, 199I) for a description of culture methods, genetic analysis plasmids,
gene cloning techniques, the use of transposons, phage, and integrational
vectors for mutagenesis and the construction of gene fusions, and methods of
measuring gene exl~lession. Appropriate hosts are available from stock centers
such as the American Type Culture Collection (Rockville, Maryland, USA)
and the R(7Cjl//~c Genetic Stock Center (Ohio State Univ., Columbus, OH,
USA).
The present invention concell.s a vaccine comprising a polysaccharide
(such as the capsular polysaccharide) which is cl1a,a;l~lis~ic of the group B
Streptococcus conjugated to a protein which is also characteristic of the group
B Streptococcus. The "polysaccharide" and "protein" of such a conjugated
vaccine may be identical to a molecule which is characteristic of the group B
Streptococcus, or they may be functional derivatives of such molecules.
For the purposes of the present invention, a group B Streptococcus
polysaccharide is any group B-specific or type-specific polysaccharide.
Preferably, such polysaccharide is one which, when introduced into a m~mm~l
(either animal or human) elicits antibodies which are capable of reacting with
group B Streptococcus may be employed. Examples of the preferred
polysaccharides of the present invention include the capsular polysaccharide
of the group B Streptococcus, or their equivalents. For the purposes of the
present invention, any protein which when introduced into a mammal (either
animal or human) either elicits antibodies which are capable of reacting a
WO 94/10317 PCr/US93/10506
-23- 21g6~2S
protein expressed by group B Strep~ococcus, or which increases the
immunogenicity of a polysaccharide to elicit antibodies to a polysaccharide of
the group B Streptococcus may be employed. Examples of the preferred
proteins of the present invention include the C proteins of the group B
Streptococcus, or their equivalents.
Examples of functional derivatives of the peptide antigens include
fragments of a natural protein, such as N-terminal fragment, C-terminal
fragment or internal sequence fragments of the group B Streptococcus C
protein alpha antigen that retain their ability to elicit protective antibodies
against the group B Streptococcus. The term functional derivatives is also
intended to include variants of a natural protein (such as proteins having
changes in amino acid sequence but which retain the ability to elicit an
immunogenic, virulence or antigenic property as exhibited by the natural mo!e-
cule), for example, the variants of the alpha antigen recited below that possessfewer of the internal repeats than does the native alpha antigen, and/or an
altered flanking sequence.
The peptide antigen that is conjugated to the polysaccharide in the
vaccine of the invention may be a peptide encoding the native amino acid
sequence of the alpha antigen, as encoded on plasmid pJMS23 (with or without
the signal peptide sequence) or it may be a functional derivative of the native
sequence. The native group B Streptococcus C protein alpha antigen as
encoded on pJMS23 contains an open reading frame of 3060 nucleotides and
encodes a precursor protein of 108,705 daltons. Cleavage of the putative
signal sequence of 41 amino aicds yields a mature protein of 104,106 daltons.
The 20,417 dalton N-terminal region of the alpha antigen shows no homology
to previously described protein sequences and is followed by a series of nine
tandem repeating units that make up 74% of the mature protein. Each
repeating unit (denoted herein as "R") is identical and consists of 82 amino
acids with a molecular mass of 8665 daltons, which is encoded by 246
nucleotides. The size of the repeating units corresponds to the observed size
differences in the heterogeneous ladder of alpha C proteins natural]y expressed
WO 94/103~7 PCI`/US93/10506
~69~,6 -24-
by the group B Streptococcus. The C-terminal region of the alpha antigen
contains a membrane anchor deomain motif that is hared by a number of
Gram-positive surface proteins. The large region of identical repeating units
in this gene, (termed the bca gene, for group B Streptococcus, C protein,
_Ipha antigen) defines protective eoptopes and may be used to generate
diversity of alpha antigen functional deriuatives that are useful in the vaccines
of the invention.
Preferably, the sequence of such a functional alpha antigen derivative
contains 1-9 copies of the 82 amino acid repeat (246 nucleotides) that begin
at amino acid 679 of the DNA sequence of Figure 6, (as used herein, the
partial repeat designed as repeat 9' therein is also useful in this regard). Thefunctional derivative may lack the 185 amino acid 5' fl~n'-ing sequence (555
nucleotides) that is found in the native protein prior to the repeating sequenceor it may retain this sequence and/or the derivative may lack the 48 amino
acid (246 nucleotides) C-terminal anchor sequenre or it may retain this
sequence. The functional derivative may be the N-terminal fragment that
precedes the start of the alpha antigen r~ g unit(s) or the functional
derivative may be only the C-terminal fragment that follows the end of the
alph antigen repP-~ting unit(s) or the function derivative may be a hybrid of the
N-terminal fragment and C-terminal fragment with no copies of the "R" units
as defined below. The amino terminal sequenr,e of the native alpha antigen
may or may not contain the signal sequence. Either of the alpha antigen's
amino terminal sequence or carboxy terminal sequence may be used in the
conjugate vaccines of the invention, with or without one or more copies of the
sequence that is repeated in the core of the native alpha antigen protein.
As used herein, "R" represents one copy of the 82 amino acid repeat
that beings at amino acid 679 of the alpha antigen DNA sequence of Figure
6, "R,~" represents "X" number of tandem copies of this repeat, tandemly
joined at the carboxyl end of one R unit to the amino terminal end of the
adjoining R unit, "N" represents the 5' amino acid flanking sequence that is
found in the sequence shown on figure 6, with or without the signal sequence;
WO 94/10317 PCI`/US93/10506
_ -25- 2I4692~
when the signal sequence is lacking, "N" is a 185 amino acid 5' flanking
sequence that is found in the native protein as shown on Figure 6; when the
signal sequence is present, "N" is a 226 amino acid 5' flanking sequence as
shown in Figure 6. "C" represents the 48 amino acid C-terminal anchor
sequence as shown on Figure 6. Using this notation, the following species are
examples of derivatives of the native protein that may be constructed according
to the invention:
1. R
2. N
3. C
4. N-C
5. N-R
6. R-C
7. N-RI-C
8. R2
9. N-R2
10. R2-C
11. N-R2-C
12. R3
13. N-R3
14. R3-C
15. N-R3-C
16. R4
17. N-R4
18. R4-C
19. N-R4-C
20. R5
21. N-R5
22. R5-C
23. N-R5-C
24. R6
25. N-R6
26. R6-C
27. N-R6-C
WO 94/10317 PCT/US93/10506
~6 9~6 -26-
28. R,
29. N-R7
30. R7-C
31. N-R,-C
32. R8
33. N-R8
34. R8-C ~ `
35. N-R8-C
36. Rg
37. N-R9
38. Rg-C
39. N-R9-C
40. Rlo
41. N-R~o
42. Rlo-C
43. N-RIo~C.
Greater than 10 repeating R units, including, for example, 11, 12,13,14,15,
16, 17, 18, 19 or 20 R units, may be constructed in a similar manner. In
addition, fragments of R, N, or C may be used if such fragments enhance the
functional ability of the derivative to elicit pr~;live antibodies against the
group B Streptococcl~s, or if such fragment provides another desired property
to the construct, such as a secretion signal or membrane localization signal.
Alpha antigens from other strains of the group B Streptococcus may be
prepared and used in a similar manner as a slight variability in the sequence
of the protein, such as in the N terminus or C terminus or R repeat would not
alter the biological properties and their functional ability to elicit protective
antibodies. For example, a group B Streptococcus alpha antigen isolated from
a different strain of the group B Streotococcus and having the same repeat unit
but a different N-terminal amino acid sequence is intended to be within the
scope of the invention.
The peptides of the invention, whether encoding a native protein or a
functional derivative thereof, are conjugated to a group B Streptococcus
carbohydrate moiety by any means that retains the ability of these proteins to
induce protective antibodies against the group B Streptococcus.
WO 94/10317 PCr/US93/10506
_ -27- 21~6928
Heterogeneity in the vaccine may be provided by mixing specific
conjugated species. For example, the vaccine preparation may contain one or
more copies of one of the peptide forms conjugated to the carbohydrate, or the
vaccine preparation may be prepared to contain more than one form of the
above functional derivatives and/or the native sequence, each conjugated to a
polysaccharide used therein. Conjugates providing a peptide (such as one of
the peptides exemplified in group numbers 1-43) can be mixed with conjugates
providing any other peptide (such as a second example from group numbers
1-43) to arrive at a "compound" conjugate vaccine. A multivalent vaccine may
also be prepared by mixing the group B-specific conjugates as prepared above
with other proteins, such as diphtheria toxin or tetanus toxin, and/or other
polysaccharides, using techniques known in the art.
Heterogeneity in the vaccine may also be provided by utilizing group
B Streptococcal preparations from group B Streptococcal hosts (especially into
Streptococcus agalactine), that have been transformed with the recombinant
constructs of the invention such that the streptoccal host expresses the alph
antigen protein or functional derivative thereof. In such cases, homologous
recombination between the genetic sequences encoding the repeating R units
will result in spontaneous mutation of the host, such that a population of hostsis easily generated and such hosts express a wide range of antigenic alpha
antigen functional derivatives useful in the vaccines of the invention. Such
spontaneous mutation usually results in the deletion of R units, or portions
thereof, although mutation of other regions of the alpha antigen may also
occur.
As used herein, a polysaccharide or protein is "characteristic" of a
bacteria if it is substantially similar in structure or sequence to a molecule
naturally asociated with the bacteria. The term is intended to include both
molecules which are specific to the organism, as well as molecules which,
though present on other organisms, are involved in the virulence or
antigenicity of the bacteria in a human or animal host.
6 -28- PCI/US93/10566
The vaccine of the present invention may confer resistance to group B
Streptococcus by either passive immunization or active immunization. In one
embodiment of passive immunization, the vaccine is provided to a host (i.e.
a human or m~mm~l) volunteer, and the elicited antisera is recovered and
directly provided to a recipient ~,u~L,ecled of having an infection caused by a
group B Streptococcus.
The ability to label antibodies, or fragments of antibodies, with toxin
labels provides an additional method for treating group B Streptococcus
infections when this type of passive immuni7~tion is conducted. In this
embodiment, antibodies, or fragments of antibodies which are capable of
recognizing the group B Streptococcus antigens are labeled with toxin
molecules prior to their ~lminictration to the patient. When such a toxin
derivatized molecule binds to a group B Streptococcus cell, the toxin moiety
will cause the death of the cell.
lS In a second embodiment, the vaccine is provided to a female (at or
prior to pregnancy or pa.lu~ilion), under conditions of time and amount
sufficient to cause the production of antisera which serve to protect both the
female and the fetus or newborn (via passive inco-~o-~lion of the antibodies
across the placenta).
The present invention thus concerns and provides a means for
preventing or attenuating infection by group B Streptococcus, or by org~nicmc
which have antigens that can be recognized and bound by antisera to the
polysaccharide and/or protein of the conjugated vaccine. As used herein, a
vaccine is said to prevent or attenuate a disease if its administration to an
individual results either in the total or partial attenuation (i.e. suppression) of
a symptom or condition of the disease, or in the total or partial immunity of
the individual to the disease.
The administration of the vaccine (or the antisera which it elicits) may
be for either a "prophylactic" or "therapeutic" purpose. When provided
prophylactically, the compound(s) are provided in advance of any symptom of
group B Streptococcus infection. The prophylactic administration of the
WO 94/10317 PCr/US93/10506
21~6926
~_ -29-
compound(s) serves to prevent or attenuate any subsequent infection. When
provided therapeutically, the compound(s) is provided upon the detection of
a symptom of actual infection. The therapeutic administration of the
compound(s) serves to attenuate any actual infection.
S The anti-infl~mm~tory agents of the present invention may, thus, be
provided either prior to the onset of infection (so as to prevent or attenuate an
anticipated infection) or after the initiation of an actual infection.
A composition is said to be "pharmacologically acceptable" if its
a-lmini~tration can be tolerated by a recipient patient. Such an agent is said
to be a(lmini~tered in a "therapeutically effective amount" if the amount
administered is physiologically significant. An agent is physiologically
significant if its presence results in a detectable change in the physiology of
a recipient patient.
As would be understood by one of ordinary skill in the art, when the
vaccine of the present invention is provided to an individual, it may be in a
composition which may contain salts, buffers, adjuvants, or other substances
which are desirable for improving the efficacy of the composition. Adjuvants
are substances that can be used to specifically augment a specific immune
response. Normally, the adjuvant and the composition are mixed prior to
presentation to the immune system, or presented separately, but into the same
site of the animal being immunized. Adjuvants can be loosely divided into
several groups based upon their composition. These groups include oil
adjuvants (for example, Freund's complete and incomplete), mineral salts (for
example, AIK(SO4)2, AlNa(SO4)2, AINH4(SO4), silica, kaolin, and carbon),
polynucleotides (for example, poly IC and poly AU acids), and certain natural
substances (for example, wax D from Mycobacterium tuberculosis, as well as
substances found in Corynebacterium parvum, or Bordetella pertussis, and
members of the genus Brucella. Among those substances particularly useful
as adjuvants are the saponins such as, for example, Quil A. (Superfos A/S,
Denmark). Examples of materials suitable for use in vaccine compositions are
provided in . Remington's Pl~arnlaceutical Sciences (Osol, A, Ed, Mack
WO 94/10317 PCI/US93/10506
69~,6 -30-
Publishing Co, Easton, PA, pp. 1324-1341 (1980), which reference is
incorporated herein by reference).
The therapeutic compositions of the present invention can be
~imini~tered parenterally by injection~ rapid infusion, nasopharyngeal
absorption (intranasopharangeally), dermoabsorption, or orally. The
compositions may alternatively be ~-~ministered intramuscularly, or
intravenously. Compositions for parenteral ~.lmini~tration include sterile
aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of
non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils
I0 such as olive oil, and injectable organic esters such as ethyl oleate. Carriers
or occlusive dressings can be used to increase skin permeability and enhance
antigen absorption. Liquid dosage forms for oral ~.1mini~tration may generally
comprise a liposome solution containing the liquid dosage form. Suitable
forms for suspending liposomes include emulsions, suspensions, solutions,
syrups, and elixirs con~ining inert diluents commonly used in the art, such as
purifled water. Besides the inert diluents, such compositions can also include
adjuvants, wetting agents, emulsifying and suspending agents, or sweetening,
flavoring, or perfuming agents.
Many different techniques exist for the timing of the immunizations
when a multiple administration regimen is utilized. It is possible to use the
compositions of the invention more than once to increase the levels and
diversities of expression of the immunoglobulin repertoire expressed by the
immunized animal. Typically, if multiple immunizations are given, they will
be given one to two months apart.
According to the present invention, an "effective amount" of a
therapeutic composition is one which is sufficient to achieve a desired
biological effect. Generally, the dosage needed to provide an effective amount
of the composition will vary depending upon such factors as the animal's or
human's age, condition, sex, and extent of disease, if any, and other variables
which can be adjusted by one of ordinary skill in the art.
WO 94/10317 PCI/US93/10506
2l~69~
-31-
The antigenic preparations of the invention can be administered by
either single or multiple dosages of an effective amount. Effective amounts
of the compositions of the invention can vary from 0.01-1,000 ~g/ml per dose,
more preferably 0.1-500 ~g/ml per dose, and most preferably 10-300 ~g/ml
per dose.
Having now generally described the invention, the same will be more
readily understood through reference to the- following examples which are
provided by way of illustration, and are not intended to be limiting of the
present invention, unless specified.
Example I
Cloning Efflciency of the pUX12 Vectors
Several experiments were designed to test the cloning efficiency of the
pUX12 vectors and to determine whether the modified reading frames
transcribed correctly. The results of these experiments will be briefly
summarized below:
1. To clone a DNA fragment into pUX12, the three constructs,
pUX12 (the original "æro" reading frame construction), pUX12+1 and
pUX12-1, were mixed in equimolar concentrations. The plasmids were then
cut with BstXI to cleave the stuffer fragment within the polylinker. The
stuffer fragment was separated from the plasmid using either low melting point
agarose or a potassium acetate gradient (Aruffo, A, et al., Proc. Natl. Acad.
Sci. USA 84:8573-8577 (1987), Ausubel, F.M, et al., Current Topics in
MolecularBiology; Greene Publ. Assn./ Wiley Interscience, NY (1987)). The
DNA to be cloned was cut with a restriction enzyme that gives blunt ends (any
such restriction enzyme may be employed). If necessary, double stranded
DNA with signal stranded ends can be modified to create blunt ends. The
blunt ends of the DNA fragments were mixed with the two synthetic
oligonucleotide adaptors. These are the same 12-mer and 8-mer used in
preparing the stuffer fragment. The modified DNA fragments were separated
WO 94/10317 PCr/US93/10506
~,~469?'6 -32-
from the unincorporated synthetic oligonucleotides on a potassium acetate
gradient. These fragments were then ligated into the linear pUX12 family of
plasmids and used to transform E. coli.
To verify that the pUX12 vectors self-ligate at a low frequency under
conditions optimize for the cloning of inserts with adaptors, a second drug
resi~t~n~e marker was cloned into pUX12. -As shown in Figure 1, pUX12 has
a ,B-I~rt~m~ce gene and carriers resi~t~n-,e to ampicillin (ampR). The rationalefor cloning a second marker was to compare the ratio of clones that contained
both drug resi.ct~n~.e markers to those pUX12 plasmids that self-ligated under
typical cloning conditions and therefore only expressed rçsi~t~nce to ampicil-
lin. The tetracycline resi.st~nre gene (tetR) from the plasmid pBR322 was
cloned into the polylinker of pUX12 with the adaptors described above. A
group of test ligations were run to establish the optimal concentration of
oligonucleotide adaptor to fragment ends, and the ratio of modified insert to
linear pUX12 plasmid for ligation and transformation. By using the tetR gene
as a marker, we were able to determine cloning parameters so that greater
than 99% of the transrol,llants selected on ampicillin conl~inin~ plates also
carried the tetR marker. Thust the frequency of self-ligation is very low in this
system and it is not necec~ry to screen for the presence of an insert in the
polylinker prior to scree~ g a library in pUX12.
2. To confirm the position of the translational reading frame in the
polylinker of pUX12, a structural gene whose sequence and product are
known, and that lacks its own promoter, was cloned.
For this purpose, a mutant of the tox structural gene carried on the
plasmid (Costa, J.J, etal., J. Bacteriol. 148(1):124-130 (1981), Michel, J.L,
et al., J. Virol. 42:510-518 (1982) which references are incorporated herein
by reference) was chosen. The plasmid, pABC402, was treated
simultaneously with the restriction endonucleases Apal and Hindlll (Bishai,
W.R, et al., J. Bacteriol. 169:1554-1563 (1987), Bishai, W.R., et al., J.
Bacteriol. 169:5140-5151 (1987) which references are incorporated herein by
reference). The Apal site is withill the structural gene near the N-terminal and
WO 94/10317 PCI/US93/10506
`~ 33 21~6g2~
the Hind~ll site lies just outside of the C-terminal of the tox gene. This 1.2
kb restriction fragment was separated from the remaining 4.1 kb of the
pABC402 vector using low melting point agarose.
To create blunt ends for cloning, the tox fragment was treated with T4
DNA polymerase. The exonuclease activity of the polymerase cut back the
Apal 3' ends and the polymerase activity filled in the 5' overhand at the
Hindlll site (Maniatis, T. et al., Molecular Cloning, A ~aboratory Manual,
Cold Spring Harbor Press, Cold Spring Harbor, NY (1982)). This purified
fragment with blunt ends was ligated into the mixture of pUX12 that contains
all three reading frames. Individual transformants were randomly picked and
screened by restriction mapping to determine the orientation and reading frame
of the inserts. In addition, the nucleotide sequences of the
polylinker/adaptor/insert regions were determined. All six potential
orientation and reading frame combinations were identified. Finally, extracts
from these clones were screened using Western blots probed with antisera to
diphtheria toxin (Blake, M.S., et al., Anal. Biochem. 136:175-179 (1984),
Murphy, J.R., et al., Curr. Topics Microbiol. and Immun. 118:235-251
(1985)).
Reactive toxin related proteins were only detected from clones that
contained the structural gene in the correct orientation and reading frame.
This plasmid is called pUDTAH-1; the DNA sequence of the polylinker and
beginning of the tox structural gene is shown in Table 1. The depisted
sequence is the DNA sequence of the beginning of the tox' structural gene in
pUDTAH-1. ATG is the start signal for the transcript (lacZ'), GAT begins
the modified polylinker of pUX12 and GCC starts the correct translational
reading frame for the tox' gene.
WO 94/10317 PCI/US93/10506
.469~6 34
Table 1
Seql-~n-~.os of Plasmid pUDTAH
ATGACCATGATTACGAATTCGAGCTCGCCCGGG GATCCA--~-~-.~AAAG CCACC
[SEQ ID NO 6]
Polylinker ~ligonucleotide Diphtheria
(A~G=LacZ Translation Adaptors Tox' Gene
Initiation Codon)
Example 2
Puri~lcation of Chromosomal DNA from Group B Streptococcus
To accomplish the purification of chromosomal DNA from group B
Streplococcus chromosomal DNA was isolated from the A909 strain of group
B Streptococcus (Lancefield, R.C., et al., J. Exp. Med. 142: 165-179 (1975))
by the method of Hull et al. (Hull, R.A., et al., Infect. and Immun. 33:933-
938 (1981)) as modified by Rubens et al. (Rubens, C.E., et al., Proc. Natl.
Acad. Sci USA 84:7208-7212 (1987) both of which rererel-ces are incorporated
herein by reference). In brief, mutanolysin was used to convert the group B
Streptococcus strain A909 (Ia/c) strain into protoplasts. The resulting surface
extract was found to contain numerous proteins that immunoreact with
protective antisera raised to the intact bacteria. An insoluble protein fractionwas partially purified using conventional column chromatography. Two
fractions, including one which was highly concentrated for a single 14
kilodalton (kd) species, were used to immunize rabbits. Antisera raised
against these partially purified group B Streptococcus proteins were found to
be able to confer passive protection in a mouse virulence assay against a
heterologous capsule type of group B Streptococcus which carries the C
proteins.
Group B Streptococcus DNA was purified by centrifugation in a
buoyant-density cesium chloride (CsCI) gradient, and the chromosomal DNA
was dialyzed exhaustively against TAE buffer, pH 8.0 (Maniatis, T. et al
WO 94/10317 PCl`/US93/10506
21~9~
-35 -
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold
Spring Harbor, NY (1982). The A909 strain of group B Streptococcus has a
- type 1 capsule, expresses the C proteins and has been used previously in
studies of the C proteins (Valtonen, M.V., et al., Microb. Path. 1:191-204
(1986)). It is also the strain of group B Streptococcus that was used in
preparing the protective antisera for screening.
The yield of Group B Streptococcus chromosomal DNA averages 3 to
S mg for each 500 ml of an overnight culture of group B Streptococcus. The
purified DNA was digested separately with 24 commonly used restriction
endonucleases and the resulting fragments were run on a 1.0% agarose gel.
A wide range of enzymes were chosen, including those that have unique sites
on the polylinkers commonly used in cloning vectors. Ethidium bromide
(EtBr) staining of the gel showed that all of the restriction enzymes yielded a
distribution of discrete fragment sizes of group B Streptococcus DNA. This
suggests that group B Streptococcus DNAis not modified for any of the
restriction enzymes tested.
In order to determine whether there were any inhibitors present to
block ligation of the DNA, the restriction endonuclease digestions described
above were ethanol precipitated, placed in a ligation buffer and incubated
overnight at 14C with DNA ligase. These samples were again run on a
1.0% agarose gel and stained with EtBr. The resulting restriction patterns
showed a higher molecular weight distribution. Therefore, there was no
inhibition of the ligation of group B Streptococcus DNA.
WO 94/10317 PCr/US93/10506
69~6 -36- _
Example 3
Preparation of a Library of Group B
Streptococcus Chro" ~s- m~l DNA
The preparation of a library of group B Streptococcus chromosomal
DNA in pUX12 and its transformation into E. coli was performed as follows.
To cleave the group B Streptococcus chromosomal DNA for cloning, four
restriction enzymes were chosen that give a broad distribution of restriction
fragment sizes The pUX12 vector and adaptors are most efficient when blunt
ended fragments are cloned. The enzymes chosen recognize four base pair
sites and leave blunt ends. Group B Streptococcus DNA was partially digested
individually with AluI, FunD2, Haelll and Rsal.
The resulting fragments were mixed, purified with phenol/chloroform,
ethanol precipitated and resuspended in a ligation buffer (M~ni~ti~, T. et al.,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold
Spring Harbor, NY (1982)). One ~4g of the group B Streptococcus DNA frag-
ments was mixed with 3 ~ug of the 12-mer and 2 ,ug of the 8-mer oligo-
nucleotide adaptors. Three microliters of T4 DNA ligase (600 units, New
England Biolabs), were added and the reaction was maintained overnight at
14C. The free linkers were separated from the group B Streptococcus DNA
fragments on a potassium acetate velocity gradient (Aruffo, A., et al., Proc.
Natl. Acad. Sci. USA 84:8573-8577 (1987)).
The pUX12 plasmid containing all three translational reading frames
was digested with BstX~ and the stuffer fragment was removed using a low
melting point agarose gel. The group B Streptococcus library was prepared
by mixing 10 ng of the adapted group B Streptococcus fragments with 100 ng
of the linear pUX12 vector in 100 ~1 of ligation buffer to which 0.1æ T4
DNA ligase was added. The ligation reaction was maintained overnight at
14C and then used to transform the MC1061 strain of E. coli on plates
containing ampicillin (Ausubel5 F.M., et al., Current Topics in Molecular
Biology (1987)) .
WO 94/10317 PCI`/US93/10~06
_ 37 21~692B
Sixteen of the resulting transformants were isolated, grown overnight
in LB and plasmid DNA isolated by mini-preps. The plasmid DNA was
digested with BamHI, and run on a 1.0% agarose gel. All of the plasmids
screened contained inserts in the pUX12 vector, and the average insert size
was 1.4 kb. To date, the plasmid DNA obtained from over 200 clones have
been screened and only one clone was found that appeared to lack an insert in
the polylinker.
Example 4
Characterization of Protective Antisera
to be Used in Screening the Library
As discussed earlier, the C proteins have been partially purified by a
variety of techniques and protective antisera have been prepared by a number
of investigators (Bevanger, L., et al., Acta Path. Microbiol. Scand. Sect. B.
93: 113-119 (1985), Russell-Jones, G.J., et al., J. Exp. Med. 160: 1476-1484
(1984), Wilkinson, H.W., et al., Infec. and Immun. 4:596-604 (1971)).
A set of experiments was performed to duplicate the work of Valtonen,
Kasper and Levy who isolated a 14,000 mw protein from supernatants of
group B Streptococcus that elicits protective antibody (Valtonen, M.V., et al.,
Microb. Path. 1:191-204 (1982) which reference is incorporated herein by
reference). This experiment revealed that when proteolytic inhibitors to the
supernatants of group B Streptococcus cultures are added prior to the
concentration and purification of the C proteins (Wong, W.W., et al., J.
Immunol. Methods. 82:303-313 (1985)), the 14,000 mw protein was no longer
a prominent protein in the supernatant. This indicated that this protein resultsfrom the proteolysis of larger molecular weight C proteins in the supernatants
of group B Streptococcus cultures.
WO 94/10317 PCr/US93/10506
69~6 -38-
Example S
Optimizing Conditions for Screening for Expression
in a Plasmid-Based Vector
As discussed above, the most commonly used vectors for the detection
of expression are based on ~gtl 1 (Young, R.A., et al., Proc. Natl. Acad. Sci.
USA 80:1194-1198 (1983)). We were able to increase the sensitivity of
detection of expression from the pUX12 plasmid vector by combining two
previously described procedures for antibody screening of bacterial colonies.
The tran~rollllants from the library were plated overnight and the resulting
colonies transferred to nitrocellulose filters (Bio-Rad). The colonies were
Iysed by placing the filters in an atmosphere saturated with chloroform
(CHCI3) in a closed container for 30 minutes The filters were then placed in
a Iysis buffer and inr,llh~ted overnight as described by Helfman et al.
(Helfman, D.M., et al., Proc. Natl. Acad. USA 80:31-35 (1983)). The
antibody scree~ g was done utilizing commercially prepared E. coli Iysate
(ratio 1:200) and Horseradish Peroxidase Conjugated, Affinity Purified Goat
Anti-Rabbit IgG (ratio 1 :3000) in the Express-Blot Assay Kit prepared by Bio-
Rad Laboratories. By pretreating the colonies with chlolufor.l, and the
overnight inrub~tion with DNase and Iysozyme described above, it was
possible to reduce the ratio of primary antibody required from 1:500 to
1 :5000.
Example 6
Initial Analysis of Po~,ili~e Clones and
Their Protein Products
The library of group B Streptococcus chromosomal DNA in the pUX 12
vector was screened with the above-discussed protective anti-C proteins
antisera. The group B Streptococcus library had an average fragment size of
1.4 kb. Transformants were screened as described above, and then subcloned
WO 94/10317 PCr/US93/10506
39 21 ~69~6
and rescreened with the antisera three times. Of 20,000 clones screened, there
were 35 independently isolated clones that reacted with the protective antisera.The clones were denominated S 1-S35, and the plasmids containing the clones
were denominated pJMS1-plMS35. The clones ranged in size from 0.9 to
13.7 kb and have an average size of 4.5 kb.
Plasmid DNA was isolated from the clones by minipreps and the inserts
surveyed with four restriction endonucleases. Fourteen of the clones can be
divided into three groups based on sharing identical insert sizes and common
restriction endonuclease mapping patterns within each group. Clones S1 and
S23, discussed below, were found to be members of different groups.
By further comparing the restriction patterns of the individual clones
it was possible to identify 24 clones that shared common restriction fragments.
Clones S l and S23 were not found to share any common restriction fragments.
Extracts of the clones were prepared, run on Western blots and probed
with the antisera used in screening the library. Six size classes of protein
antigens were identified (A-F). By combining data from the restriction
endonuclease mapping and the Western blots it was possible to classify 24 of
the 35 clones into 6 different protein antigen patterns (Table 2). This initial
classification was done only to get a rough survey of the potential number of
genes involved. Sl was found to be 3.5 kd in size, and to belong to antigen
protein pattern A. S23 was found to be 13.7 kd in size, and to belong to
antigen protein pattern D.
WO 94/10317 PCT/US93/10506
69~6
Table 2
Pr~ =r~ C~ fi~tiQn of the Group B
Streptococcus C Protein Clones
Protein NumberMolecular WeightCoding Capacity Size of Antigen
5 Profile of clonesof insert (kb)of DNA insert(in daltons)
A 6 3.5 136,000 115,000
B 3 1.9 76,000 50,000
C 7 4.4 174,000 130,000
D 6 13.7 ~500,000 110,000
E 1 1.7 67,000 50,000
F I 0.9 36,000 15,000
When Western blots of extracts of the clones were probed with antisera
to a group B Streptococcus strain that does not express the C proteins, only
one group of clones was positive (Protein Profile B). This indicates that the
majority of positive clones express proteins that are unique to strains that carry
the C proteins; these proteins are not common to all strains of group B
Streptococcus.
Example 7
Characterization of the Cloned Gene Sequences
The actual number of C proteins that are expressed by group B
Strep~ococcus has not been determined. Recent immunological studies by
Brady et al. characterizing C protein typing antisera from the C.D.C. iden-
tified four se~,alat~ antigens (Brady, L.J., etal., J. Infect. Dis. 158(5):965-972
(1988)). Preliminary genetic and immunological characterization of the
putative C protein clones of group B Streptococcus suggests that four or five
genes encode proteins that are present on strains of group B Streptococcus that
are known to carry the C proteins. Two groups of experiments were
conducted to determine whether the cloned gene products represent C proteins.
WO 94/10317 PCI/US93/10506
_ -41- 21~69~:6
As discussed above, studies of the C proteins had defined two
phenotypes: one group of proteins that was sensitive to degradation by pepsin
but not trypsin (called TR or ~x) and another group of proteins that was
sensitive to degradation by both pepsin and trypsin (called TS or ,B) (Johnson,
D.R., et al., J. Clin. Microbiol. 19:506-510 (1984), Russell-Jones, G.J., et
al., J. Exp. Med. 160: 1476-1484 (1984)).
The typing antisera, cY and ,B, were used to screen the cloned gene
products on Western blots (Bevanger, L., et al., Acta Path. Microbiol. Scand.
Sea. B. 87:51-54 (1979); Bevanger, L., etal., Acta. Path. Microbiol. Scand.
Sect. B. 89:205-209 (1981); Bevanger, L., et al., Acta. Path. Microbiol.
Scand. Sec. B. 91:231-234 (1983); Bevanger, L., et al., Acta. Path. Microb-
iol. Scand. Sect. B. 93:113-119 (1985); Bevanger, L., et al., Acta. Path.
Microbiol. Immuol. Scand. Sec. B. 93:121-124 (1985) which references are
incorporated herein by reference).
The c~ typing sera identified Protein Profile D, and the ~ typing
antisera identified Protein Profile A. These proteins were subjected to
digestion with pepsin and trypsin. Protein Profile D is sensitive to pepsin but
not trypsin, and Protein Profile A is sensitive to both pepsin and trypsin.
These results are consistent with previous studies and confirm that at least twoof the C protein genes have been cloned.
The most important and characteristic property of the C proteins is
their ability to elicit protective antibodies against group B Streptococcus strains
that express C proteins. Several approaches could be used to prepare antisera
against the cloned gene products. For example, Iysates of the E. coli clones
could be directly injected into rabbits in order to determine if the Iysates
contain proteins capable of eliciting antibodies to any of the E. coli or group
B Streptococcus proteins introduced. The resulting antisera can be preab-
sorbed with a Iysate of E. coli prior to testing the antisera to reduce the
number of cross-reacting antibodies. Such a Iysate can be used to reduce the
number of cross-reacting antibodies in both colony blots used for screening the
clones for expression and in Weslem blots used to study both cellular extracls
WO 94/10317 PCr/US93/10506
2~J~6926 -42- _
of group B Streptococcus and partially purified group B Streptococcus
proteins.
ReplcsenLalive clones from Protein Profiles A, B and D are sonicated
and injected into rabbits to raise antisera against the cloned group B
Streptococcus protein antigens (Lancefield, R.C., et al., J. Exp. M ed.
142:165-179 (1975), Valtonen, M .V., et:al., Microb. Path. 1:191-204
(1986)). The control rabbits are injected with E. coli that carries pUX12
without an insert in the polylinker. The antisera is preadsorbed with an E.
coli Iysate and screened first on Western blots against extracts of the clones
in the library. The.erore, it is possible to determine if there are cross-reacting
epitopes between the clones and to confirrn that these antisera are directed
against the cloned proteins identified during the preliminary round of
screening.
Alternatively, the preadsorbed antisera may be tested in the mouse
protection model. In this classic model, the mice are injected intraperitoneallywith rabbit antisera (Lancefield, R.C., et al., J. Eicp. M ed. 142:165-179
(1975)). The following day they are again injected inlla~elilol1eally with an
LDgo of viable group B Streptococcus that are known to carry C proteins. The
endpoint is the death of the mice over a 48 hour period.
In order to test the immunogenicity of the proteins expressed by the
cloned gene sequences, Escherichia coli cells cont~ining pJMSl and pJMS23
were grown, and used to prepare cellular extracts. These extracts were then
used to immunize rabbits. Antisera raised in response to immunization with
the S1 and the S23 extracts were tested using the mouse protection model.
When the mouse protection model experiment was performed, the
antisera raised from the clones representing Protein Profiles A and D (S 1 and
S23, respectively), were each found to be proleclive. Antisera from a clone
representing Protein Profile C was not protective and the control antisera also
did not show protection. The antisera raised against the clones expressing
Protein Profile C also binds to proteins extracted from strains of group B
Streptococcus that do not carry the C protein. Therefore, this group of clones
WO 94/10317 PCI/US93/10506
_ 43 2I~B92B
do not encode C proteins. In summary, five of the six groups of clones do not
encode proteins that are unique to strains of group B Streptococcus that
express C proteins.
The initial biochemical, immunological and functional analysis of two
of the groups of clones demonstrates that at least two C proteins genes (S I andS23) have been successfully cloned. This is the first demonstration that single
polypeptide gene products cloned from group B Streptococcus can elicit
protective immunity. Antibodies to Sl were found to be able to bind two
bands of the A909 extract at 50 and 60 kd. Antibodies to S23 were found to
I0 be able to bind to a regularly repeating pattern of bands in the group B
Streptococcus surface extract which ranged in MW from > 180 kd to 40 kd.
A monoclonal antibody derived from the A909 extract showed this same
repeating pattern of immunoreactivity. This indicates that a single epitope was
recognized in different molecular weight proteins and suggests a regularly
repeating structure. The proteins recognized by the SI antiserum were
susceptible to pepsin and trypsin degradation whereas those recognized by the
S23 antiserum were susceptible to pepsin but not to trypsin. This experiment
shows that these proteins partially purified from group B Streptococcus and
expressed from the group B Streptococcus cloned genes represent the alpha
and beta antigens of the C protein of group B Streptococcus.
The 35 potential C protein clones described above may be evaluated
both genetically and immunologically to determine the number of genes that
are present. In addition, the isolation of these clones permits the genes which
confer protective immunity to group B Streptococcus infection may be
identified. It is likely that the protective antisera used to obtain the initialclones also detected proteins other than the C proteins. The use of such other
proteins in a therapy against Streptococcus B infection is also contemplated by
- the present invention. Since a major goal of the present invention is the
.
Isolatlon and Identlficatlon of the protelns mvolved In Immumty, antlsera
prepared against the proteins expressed by these clones may be studied in the
Wo 94/10317 PCI/US93/10506
~69?~6J ~ -44-
mouse protection model. Those genes thal express proteins that are protective
are preferred proteins for a conjugate vaccine.
As ~iiccnssed above, the initial screening of group B Streptococcus
chromosomal DNA in an E. coli/pUX12 vector library with protective antisera
resulted in 35 independently isolated clones. By combining data from
restriction endonncle~ce mapping of the cloned fragments and Western blots
of protein extracts from the clones, it was possible to tentatively classify 24
of the 35 clones into 6 different protein antigen patterns (Table 2). This
survey permitted a determination of the potential number of genes isolated.
To further characterize such clones, colony blots are preferably used
to determine which clones share common DNA sequences. For such blots, a
single colony of each of the clones is placed in a well of microtiter dish
cont~ining LB broth and grown at 37C overnight. Control colonies include
the host E. coli strain and the E. coli strain cont~ining pUX12. The overnight
cultures are transferred onto a nitrocellulose filter on an agar plate cont~ining
the same culture medium. These plates are grown up over 8 hours at 37C
and the nitrocellulose filter cont~ining the freshly grown colonies is prepared
to be screened for DNA-DNA hybridization. The probes are prepared from
the group B Streptococcus DNA inserts in the pUX12 library. Mini-preps are
used to obtain plasmid DNA from the clones. The polylinker in pUX12 has
both a BamH~ and BstXl site on either side of the insert; therefore, the group
B Streptococcus insert is excised from the plasmid using either BamHI or
BstX~. Fortunately, the chromosomal DNA of group B Streptococcus contains
few BamH~ sites and many of the inserts are removed from the vector in one
fragment as the result of digestion with BamHI. Low melting point agarose
is used to separate the plasmid vector from the inserts. The inserts will be cutfrom the agarose gel and directly labelled by random prime labelling. The
labelled inserts are then used to probe the colony blots. This results in the
identification of clones that share DNA sequences.
WO 94/10317 PCI/US93/10506
_ 45 21~692{~
Thus, on the basis of the information obtained from the colony blots
described above, the 35 clones are placed into groups that share DNA
sequences. These groups are mapped with multiple restriction endonucleases
to determine the relationship of each clone to the others within that region of
the DNA. Since the host plasmid, pUX12, contains many unique restriction
endonucleases sites that are present only in the polylinker, much of the
restriction mapping can be done utilizing the plasmid mini-prep DNA without
needing to purify the inserts separately. By combining the colony blot data
with detailed restriction mapping it is possible to get a reasonable assessment
of the number of genetic loci involved. If some of the groups of clones do not
represent the genes of interest in their entirety, it may be necessary to use
these clones to isolate other more complete copies of the genes from the
chromosomal library. However, given the large average size distribution of
the initial 35 clones isolated, it is likely that some may represent a complete
open reading frame.
Before proceeding with a genetic analysis, antisera is preferably
prepared against the cloned gene products, and utilized in the mouse protection
model to determine the ability of these antisera to protect against infection with
group B Streptococcus ~Lancefield, R.C., et al., J. Exp. Med. 142:165-179
(1975), Valtonen, M.V., et al., Microb. Path. 1: 191-204 (1986)).
A clone whose expressed protein is able to elicit protective antibodies
is a preferred candidate for use in a conjugate vaccine. Clones whose
expressed protein fails to elicit protective antibodies may be further analyzed
to determine whether they are also candidates for a vaccine. Since the C
proteins are membrane associated, a failure of protein expressed by a clone to
elicit protective antibodies may reflect the fact that the protein may not be
stable in E. coli, and in a high copy number vector. This problem has
occurred in cloning other membrane proteins from both group A and group
B Streptococcus (Kehoe, M. et al., Kehoe, M., et al., Infect. and Immun.
43:8Q4-810 (1984), Schneewind, O., et al., Infect. and lmmun. 56:2174-2179
(1988)). Several of the 35 clones isola~ed in the preliminary studies sllow a
WO 94/10317 PCr/US93/10506
~.469~6 ~6- _
small colony morphology. In addition, some of these clones are unstable and
have been found to delete part of the group B Streptococcus DNA insert from
the pUXI2 polylinker. There are several techniques that can be used to
stabilize these clones including: cloning into a low copy number vector or
behind a promoter that can be down-regulatea, growing the clones at 30C
instead of 37C, cloning into a vector-t~at has been adapted to accumulate
membrane proteins. In addition, it is possible to transform the plasmids into
an E. coli host, pcnB, that restricts the copy number of pBR322 derived
plasmids like pUXI2 (Lopilato J., et al., Mol. Gen. Genet. 205:285-290
(1986) which reference is incorporated herein by reference).
A failure of a clone to express protein which elicits protective antibod-
ies may also indicate that the expressed protein lacks an epitope which is
important for protection. This could be the case if the entire gene was not
cloned or could not be expressed in E. coli. It might also be problem if there
I5 is post-transcriptional processing of the C proteins in group B Streptococcus
but not for the cloned C protein genes in E. coli. It might be nlocesc~ry eitherto subclone out the complete gene and/or transfer it into an alternate host
background where it can be expressed.
A failure of a clone to express protein which elicits protective antibod-
ies may also indicate that antibodies elicited from antigens produced in
Escherichia coli may differ from those elicited from an animal by the native
C proteins on group B Streptococcus. In addition, the Iysed bacterial extracts
used to immunize the rabbits contain a number of E. coli protein antigens.
Therefore, it may be necessary to obtain antisera for testing in the animal
model from partially purified gene products instead of from the entire
orgamsm.
Any cloned group B Streptococcus proteins that are able to elicit
protective antibodies can be called C proteins. The antisera prepared for this
group of experiments will also be used for localizing these protein.
WO 94/10317 PCI'/US93/10506
214692~
-- -47-
Example 8
Mapping, Characterization and Sequencing
of the C Protein Gene~
In order to further characterize the C protein genes, a fine structure
genetic map of C protein gene clones described above may be prepared and
their DNA sequence(s) determined. Such mapping is preferably accomplished
utilizing genomic Southern blots. By determining the DNA sequences of the
C protein genes, one can determine the structure of the genes including their
ribosomal binding sites, potential promoters, signal sequences, and any
unusual repetitive sequences. The DNA sequences are preferably compared
to a library of known DNA sequences to see if there is homology with other
genes that have been characterized. In addition, the protein sequences of the
C proteins can be determined from DNA sequences of their genes. It is often
possible to make predictions about the structure, function and cellular locationof a protein from the analysis of its protein sequence.
Genomic Southern blots are, thus, preferably used to determine if any
of the genes are linked. For this technique, group B Streptococcus chromoso-
mal DNA is digested individually with several different restriction
endonucleases that identify sequences containing six or more base pairs. The
purpose is to obtain larger segments of chromosomal DNA that may carry
more than one gene. The individual endonuclease digestions are then run out
on an agarose gel and transferred onto nitrocellulose. The Southern blots-are
then probed with the labelled inserts derived from the above-described library.
If two clones that did not appear !elated by the colony blots or endonuclease
mapping bind to similar chromosomal bands, this would indicate that either
they are part of the same gene, or that they are two genes that are closely
linked on the chromosome. In either case, there are several ways to clone out
these larger gene segments for further study. One technique is to prepare a
cosmid library of group B Streptococcus and screen for hybridization with one
of the probes of interest. When a clone is obtained that contains tWO or more
WO 94/10317 PCr/US93/10506
?~,.469~6 -48- _
genes of interest it could be endonuclease mapped and studied for the expres-
sion of protective antigens as described for the previously described clones.
The identification of the above-described clones permits their DNA
sequences to be determined. If the clones are on the pUX12 plasmid, it is
possible to use double stranded DNA sequencing with reverse transcriptase to
sequence from oligonucleotide primers prepared to the polylinker. This
technique was used earlier in characterizing the pUX12 pla~smid and is a rapid
way to sequence multiple additional oligonucleotide primers to sequence a
gene that is larger than 600 base pairs. Therefore, the DNA sequencing for
the C protein genes is preferably performed by subcloning into an M13, single
stranded DNA sequencing system (Ausubel, F.M., et al., Current Topics in
Molecular Biology (1987)).
The elucidation of the DNA sequences of the C proteins provides
substantial information regarding the structure, function and regulation of the
genes and their protein products. As discussed earlier, the heterogeneity in
the sizes of C proteins isolated by many investigators and their apparent
antigenic diversity suggests the possibility of either a gene family, or a post-transcriptional mech~ni~m for modifying the protein products of the C protein
genes (Ferrieri, P., et al., Infect. Imrnun. 27:1023-1032 (1980)). The M
protein of group A Streptococcus was ~ cl~sed earlier as an example of this
phenomenon (Scott, J.R., et al., Proc. Natl. Acad. Sci. USA 82:1822-1826
(1985)). Although the DNA sequence of M protein shows no homology with
group B Streptococcus chromosomal DNA by hybridization, there may be
structural homologies between their DNA sequences (Hollingshead, S.K., et
al., J. Biol. Chem. 261: 1677-1686 (1986), Scott, J.R., et al., Proc. Natl.
Acad. Sci. USA 82: 1822-1826 (1985), Scott, J.R., et al., Infea. and Immun.
52:609-612 (1986)). The DNA sequences of the C proteins are preferably
compared with a library of known DNA sequences. In addition, the amino
acid sequences derived from the DNA sequences are compared with a library
of known amino acid sequences.
WO 94/10317 PCI/US93/10506
~ 49 2146g26
Example g
Prevale~lce of the C Protein Genes
To determine the prevalence of the C protein genes, chromosomal
DNA from clinical and laboratory isolates of the various serotypes of group
B Streptococcus are probed on genomic Southern blots with the C protein
genes. In addition, comparison of the phenotypic expression as determined by
precipitin techniques with genetic composition as shown by DNA-DNA
hybridization is preformed in order to provide information regarding the
regulation of expression of the C protein genes. The probes of the C protein
genes are used to screen chromosomal DNA from other types of
Streptococcus, and other bacterial pathogens.
Probes are prepared and labelled from the C protein genes of isolates
of group B Streptococcus which includes most of the original typing strains
used by Lancefield (Lancefield, R.C., et al., J. l~xp. M ed. 142:165-179
(1975)). Colony blots of the 24 clinical and laboratory isolates of group B
Streptococcus are screened using the microtiter technique described above.
The ability of the various strains to hybridize to the C protein genes is then
compared with the phenotypic characteristics of these organisms in binding to
typing antisera directed against the C proteins. In this manner, it is possible
to determine what strains carry any or all of the C protein genes, and whether
some strains carry silent or cryptic copies of these genes.
Those strains that hybridize to the C protein gene probes on colony
blots are then screened using genomic Southern blots to determine the size,
structure and location of their C protein genes. Chromosomal DNA isolated
from the strains of group B Streptococcus that show binding on the colony
blots is digested with restriction endonucleases, run on an agarose gel and
blotted onto nitrocellulose. These Southern blots are probed with probes of
the C protein genes. In this manner, it is possible to determine if there are
differences in the location and size of these genes in the different serotypes of
group B Strep~ococcus and to compare ciinical (i.e. potentially viruient)
WO 94/10317 PCr/US93/10506
69?'6 50
isolates with laboratory strains (and with those which colonize clinically but
are not associated with infection).
The C protein gene probes are also preferably used to screen other
streptococcal strains and a variety of pathogenic bacteria. Streptococcal strains
are known to share other proteins ~sociated with virulence including the M
and G proteins (Fahnestock, S.R., et al., J. Bact. 167(3):870-880 (1986),
Heath, D.G., et al., Infec. and lmmun. 55: 1233-1238 (1987), Scott, J.R., e~
al., Infec. and Immun. 52:609-612 (1986), Walker, J.A., et al., Infec. and
Immun. 55:1184-1189 (1987) which references are incorporated herein by
reference). The strains to be tested are first screened using colony blots to
determine whether they have any homologous sequences with the C protein
genes probes. Genomic Southern blots are then prepared with the
chromosomal DNA of the bacterial strains that test positive on the colony
blots. These blots are then probed with the C protein genes to localize and
define the areas of homology, such as a region of a C protein which serves as
a membrane anchor, binds to the Fc region of immunoglobulins, or shares
regions of homology with other genes with similar functions in other bacteria.
Example 10
Modiflcation of the C Protein Genes
in Group B Streptococcus
A number of potential virulence associated properties have been
ascribed to the C proteins including resistance opsonization and inhibition of
intracellular killing following phagocytosis (Payne, N.R, et al., J. Infec. Dis.151:672-681 (1985), Payne, N.R., et al., Infect. and lmmlm. 55:1243-1251
(1987)). To better understand the roles of the C proteins in virulence, isogen-
eic strains are constructed in which the C protein genes are individually
mutated. These strains will be tested for virulence in the neonatal rat model
(Zeligs, B.J., et a~.> Infec. and Immun. 37:255-263 (1982). Two methods
may be utilized to creale isogeneic stralns to evaluate the role of the C
WO 94/10317 PCI/US93/10506
2I~692~
_ --51--
proteins in the virulence of group B Streptococcus. Preferably, tranposon
mutagenesis with the self-conjugative transposon tn916 may be employed.
- Alternatively, site-directed mutagenesis may be used. The lack of efficient
methods for genetic manipulation in group B Streptococcus necessitates the
development of new genetic techniques to modify genes in group B
Streptococcus and create isogeneic strains for studying virulence (Lopilato, J.,et al., Mol. Gen. Genet. 205:285-290 (1986) which reference is incorporated
herein by reference).
Transposon insertional mutagenesis is a commonly used technique for
constructing isogeneic strains that differ in the expression of antigens
associated with virulence, and its use in group B Streptococcus is well
described (Caparon, M.G., et al., Proc. Natl. Acad. Sci. USA 84:8677-8681
(1987), Rubens, C.E., et al., Proc. Natl. Acaa'. Sci USA 84:7208-7212
(1987), Wanger, A.R, Res. Vet. Sci. 38:202-208 (1985), Weiser, J.N., Trans
Assoc. Amer. Phys. 98:384-391 (1985) which references are incorporated
herein by reference). Rubens, et al. have demonstrated the utility of Tn916
in studies of the group B Streptococcus capsule (Rubens, C.E., Proc. Natl.
Acad. Sci. USA 84:7208-7212 (1987). The self-conjugating transposon TN916
may be made from Streptococcus faecalis into group B Streptococcus as
previously described (Wanger, A.R., Res. Vet. Sci. 38:202-208 (1985) which
reference is incorporated herein by reference). Strains are selected for the
acquisition of an antibiotic resistance marker, and screened on colony blots forthe absence of expression of the C proteins as detected by the specific antiseraprepared as described above. Isolates that do not appear to express the C
proteins can be further mapped using genomic Southern blots to localize the
insertion within the C protein genes. The original Tn916 strain carried tetR;
however, an erythromycin resistance marker has recently been cloned into
Tn916 (Rubens, C.E., et al., Plasmid 20: 137-142 (1988)). It is necessary to
show that. following mutagenesis with Tn916, only one copy of the transposon
is carried by the mutant strain and that the transposon is localized within the
C protein gene.
WO 94/10317 PCI`/US93/10506
?,~ 469?'6 -52-
The application of these techniques to deleting the C protein genes in
group B Strep~ococcus is straightforward, unless a C protein genes is essential
to the survival of group B Streptococcus. However, strains of group B
Streptococcus have been described that lack any detect~ble C protein and it is
unusual for a bacterial virulence determinant to be an essential gene for
survival in vitro. An additional use of Tn916 that will be explored is the
identification of potential regulatory elements of the C protein genes.
In the event that specific defined mutations are desired or if the C
protein gene is essential for the viability of group B Streptococcus, techniquesof site-directed mutagenesis may be employed (for example to produce
conditional mutants). Site-directed mutagenesis may thus be used for the
genetic analysis of group B Streptococcus proteins. One problem that has
delayed the development of these techniques in group B Streptococcus is the
difficulty encountered in transforming group B Streptococcus. Electroporation
has proven valuable in introducing DNA into bacteria that are otherwise
difficult to transform (Shigekawa, K., et al., BioTech. 6:742-751 (1988) which
reference is incorporated herein by reference). Conditions for transforrning
group B Streptococcus utilizing electroporation may be utilized to surmount
this obstacle. It is thus possible to do site directed mutagenesis, to evaluate
complementation, and to introduce C protein genes into group B Streptococcus
strains that do not express the C proteins. Any of several approaches may be
utilized to insert native or mutated C protein genes into strains of group B
Streptococcus. For example, a drug resistance marker may be inserted within
the C protein gene clones in pUX12. A drug resist~nce marker that can be
expressed in group B Streptococcus, but that is not normally present, is
preferred. This modified pUX12 protein clone is transformed into group B
Streptococcus using electroporation (Shigekawa, K., et al., BioTech 6:742-751
(1988) which reference is incorporated herein by reference). Since the pUX12
plasmid cannot replicate in group B Streptococcus, those strains that acquire
the drug resistance phenotype would likely do so by homologous
recombina[ion between the C protein gene on the host GB chromosome and
WO 94/10317 PCI`/US93/10506
21~926
-53-
the mutated C protein carried on the pUX12 plasmid. The mutants are
screened as described above. If there are no homologous sequences in the
recipient strain, it is possible to construct a vector with the C protein gene
inserted within a known streptococcal gene, i.e., a native drug resistance
marker gene from group B Streptococcus. Following electroporation, such a
plasmid construct would integrate into the chromosome via homologous
recombination.
Alternatively, modifled C protein genes could be introduced into the
group B Streptococcus chromosome by inserting the genes into the self-
conjugating transposon Tn916 and introducing the modified transposons via
mating from Streptococcus faecalis. This technique was used to successfully
modify Tn916 with an erythromycin gene and insert this gene into the
chromosome of group B Streptococcus (Rubens, C. E., et al., Plasmid 20:137-
142 (1988)). It is necessary to show that, following mutagenesis with Tn916,
only one copy of the transposon is carried by the mutant strain and that the
transposon is localized within the C protein gene.
Example 11
Evaluation of the Role of the C Proteins in Virulance
of Group B Streptococcus
Previous studies that compared strains of group B Streptococcus that
do and do not carry C proteins involved isolates that were not known to be
isogeneic (Ferrieri, P., et al., Rev. Inf. Dis. 10(2):1004-1071 (1988)).
Therefore, it was not possible to determine whether the differences in
virulence observed are related to the C proteins or to some other virulence
determinant. The construction of isogeneic strains having either intact C
protein genes or C protein gene deletions permit a characterization of the role
of the C protein in vurulence. The strains are preferably tested in the neonatalrat model for virulence and in the mouse protection model for their
immunological properties. A second important test of virulence is the abiiity
WO 94/10317 PCI`/US93/10506
~,465? 6 54
of a gene to restore virulence through reversion of allelic replacement in a
mutant strain. By inserting the C protein genes into group B Streptococcus
strains that either do not carry the gene or which carry inactivated C protein
genes, it is possible to determine the effect of the C protein by examining the
virulence of the resulting construct in the above animal models.
Isogeneic strains of group B Streptococcus in which the C protein genes
are individually mutated may be created using either transposon mutagenesis
or site-directed mutagenesis. Such strains are preferably characterized on
genomic Southern blots to determine that only a single insertion is present on
the chromosome. The location of these insertions may be ascertained using
the fine structure genetic mapping techniques (liscllcsed above. The isogeneic
strains are then tested for virulence in the neonatal rat model (Zeligs, B.J., et
al., Infec. and Immun. 37:255-263 (1982)).
Transposon mutagenesis permits the identification of genes involved in
regulating the expression of the C proteins. For example, strains carrying the
wild type C protein genes which are found to no longer express C proteins
following transposon mutagenesis and in which transposon is not located
within the C protein structural gene, carry mutations in sequences involved in
the regulation of expression of the C protein genes. This approach was used
successfully in characterizing the mry locus in group A Streptococcus that is
involved in regulation of the M protein (Caparon, M.G., et al., Proc. Natl.
Acad. Sci. USA 84:8677-8681 (1987), Robbins, J.C., et al., J. Bacteriol.
169:5633-5640 (1987) which references are incorporated herein by reference).
Such methods may also be used to produce strains which overexpresses the C
proteins, or which produce C proteins of altered virulence or immunity.
WO 94/10317 PCl/US93/10506
55 ~1~6g2B
Example 12
Lor~1i7~1ion of the C Proteins on Group B Streptococcus
and Evaluation of Their Ability to Bind to Tmmllnoglobulins
Lancefield and others have shown that antibody to the C proteins binds
to the outer membrane of group B Streptococcus (Lancefield, R.C., et al., J.
~cp. Med. 142:165-179 (1975), Wagner, B., et al., J. Gen. Microbiol.
118:95-105 (1980)). This suggests that the C protein is an outer membrane
protein. C proteins can also be isolated from the supernatants of cultures of
group B Streptococcus, indicating that these proteins may be either secreted
by group B Streptococcus or lost at a high rate from the cell surface. The
DNA-and protein sequences derived from the C protein genes are valuable in
determining the structure and function of the C proteins. One potential
virulence determinant commonly described for the C proteins is the ability to
bind to the immunoglobulin, IgA (Ferrieri, P., et al., ~ev. Inf. Dis.
10(2):1004-1071 (1988), Russell-Jones, G.J., etal., J. Exp. Med. 160:1467-
1475 (1984)).
Immuno-electron microscopy has been utilized to localize cell surface
determinants that are detected by specific antibody. Antisera raised against theC protein clones of group B Streptococcus is incubated with group B
Streptococcus strains that carry the C proteins. Ferritin-conjugated goat anti-
rabbit IgG is used to detect the antigen on the cell surface as previously
described (Rubens, C.E., et al., Proc. Natl. Acad. Sci. USA 84:7208-7212
(1987), Wagner B., et al., J. Gen. Microbiol. 118:95-105 (1980)).
A simple determination of the ability of C proteins to bind to
immunoglobulins can be assessed using Western blots. Cellular extracts of
both the E. coli clones containing the C protein genes and of group B
Streptococcus strains that carry the C proteins can be run on SDS-PAGE and
blotted onto nitrocellulose. Controls include extracts of ~ coli carrying the
wild type pUX12 plasmid, strains of group B Streptococcus that do not carry
the C protein genes. and isogeneic group B Streptococcus strains in which the
WO 94/10317 - PCI/US93/10506
-56-
~46~6
C protein genes have been inactivated. The Western blots can be probed
individually with labelled immunoglobulins, e.g., IgG, IgM, IgA, and their
components, e.g., the Fc or F(ab)2 fragments (Heath, D.G., et al., Infect. and
Immun. 55:1233-1238 (1987), Russell-Jones~, G.J., et al., J. Exp. Med.
160: 1467-1475 (1984)). The immunoglobulins are preferably iodinated using
either iodogen or chloramine T.
A more specific way to measure the ability of the C proteins to bind
to immunoglobulins and their components involves purifying the C proteins
and using them directly in a binding assay (F~hn~stoc~, S.R., et al., J. Bact.
167(3):870-880 (1986), Heath, D.G., et al., Infect. and lmmun. 55: 1233-1238
(1987)). Using the protein sequence, one can purify the C protein. In
addition, since it is possible to express the C protein genes in E coli, one mayconstruct E. coli strains that overproduce the C proteins and thereby obtain
larger amounts of C proteins for purification.
Example 13
Use of the Cloned C Protein ~ntjg~n~ of
Group B Slr~t~cocc~s in a Conjugate Vaccine
The above-described protective C protein antigens of group B
Streptococcus were tested for their potential in a conjugate vaccine. To assess
this potential, cellular extracts of E. coli containing pJMS1 or pJMS23 were
prepared as decribed above, and used to immunize rabbits. The resulting
antisera was tested in the mouse lethality model for its ability to protect micefrom infection by the group B Streptococcus strain H36B. Strain H36B carries
the C protein of group B Streptococcus. As a control, the ability of the
antisera to protect the mice against infection by Streptococcus strain 515
(which does not carry the C protein) was determined. The results of this
experiment are shown in Figure 4.
WO 94/10317 PCr/US93/10506
21~692~
-s7-
Example 14
The Sequence of the C Protein Alpha Antigen
and Its R~pe~ting Units
As stated above, Streptococcus agalactine [group B Streptococcus
(GBS)] is an important pathogen in neonatal sepsis and meningitis, postpartum
endometritis, and infections in adults, in particular in diabetics and
immunocompromised hosts (Baker, C.J., et al., in Infectious Diseases of the
Fetus and Newborn Infant, Remington, J.S. et al. Saunders, Philadelphia,
(1990) pp. 742-811)). The best-studied GBS virulence determinants are the
type-specific capsular polysaccharides that are essential for pathogenesis
(Rubens, C.E., et al., Proc. Natl. Acad. Sci. USA 84:7208-7212 (1987);
Wessels, M.R., et al., Proc. Natl. Acad. Sci. USA 86:8983-8987 (1989)).
The roles of GBS surface proteins in infection are less well understood
(Ferrieri, P. Kev. Infect. Dis. S363-S366 (1988); Michel, J.L., et al. in
Genetics and MolecularBiology of Streptococci, Lactococci, and Enterococci,
Dunny, G.M. et al. eds., Am. Soc. Microbiol., Washington (1991), pp. 214-
218). The C proteins are surface-associated antigens expressed by most
clinical isolates of capsular types. Ia, Ib, and II and are thought to play a role
in both virulence and immunity (Johnson, D.R., et al., J. Clin. Microbiol.
19:506-510 (1984); Madoff, L.C., et al., Infect. Immun. 59:2638-2644
(1991)). Two C protein antigens, alpha and beta, have been described
biochemically and immunologically (Michel, J.L., et al. in Genetics and
MolecularBiologyofStreptococci, Lactococci, andEnterococci, Dunny, G.M.
et al. eds., Am. Soc. Microbiol., Washington (1991), pp. 214-218).
In 1975, Lancefield et al. (Lancefield, R.C., et al., J. E~cp Med
142: 165-179 (1975)) showed that antibodies raised to the C proteins in rabbits
protected mice challenged with GBS bearing the C proteins. A monoclonal
antibody to the alpha antigen (4G8) that induces opsonic killing of GBS and
protects mice from lethal challenge with GBS has been described (Madoff.
L.C, et al., Infect. Imnlun. 59:204-2l0 (1991). incorporated hereill b~
PCr/US93/ 10506
-58-
reference). As shown above, the gene encoding the encoding alpha and beta
antigens were cloned and expressed in Escherichia coli. It was shown that
antibodies raised to the clones of both alpha and beta encode different C
proteins that define unique protective epitopes (Michel, J.L., et al., Infect.
S Imrnun. 59:2023-2028 (1991)). The alpha and beta antigens are independently
expressed and antigenically distinct proteins.
The C protein beta antigen that specifically binds to human serum IgA
has been cloned (Michel, J.L., et al., Infect. Immun. 59:2023-2028 (1991);
Cleat, P.H., et al., Infect. Imrnun. 55:1151-1155 (1987)) and sequenced
(Heden, L.-O., etal., Eur. J. Immunol. 21:1481-1490 (1991); Jerlstrom,
P.G., et al., Mol. Microbiol. 5:843-849 (1991)). However, the role of the
beta antigen and IgA binding in virulence is not known. Studies by Ferrieri
et al. (Payne, N.R., et al., J. Infect. Dis. 151:672-681 (1985); Payne, N.R.,
et al., Infect. Imrnun. 55:1243-1251 (1987)) showed that C protein-bearing
strains of GBS resist phagocytosis and inhibit intracellular killing.
Opsonophagocytic killing in the ~ sence of alpha antigen-specific monoclonal
antibody (4G8) correlated directly with increasing molecular mass of the alpha
antigen and with the quantity of alpha antigen e,~essed on the bacterial cell
surface (Madoff, L.C., et al., Infect. Imrnun. 59:2638-2644 (1991)). GBS
strains e~ ,aing the alpha antigen were resistant to killing by
polymorphonuclear leukocytes in the absence of specific antibody; however,
this resi~t~nre was not dependent on the size of the alpha antigen.
The completed nucleotide sequence of bca and flanking regions
reported here provides information regarding the size, structure, and
composition of the alpha antigen gene. An interesting feature of both the
native and cloned gene products of the alpha antigen is that they exhibit
protein heterogeneity by expressing a regularly repeating ladder of proteins
differing by approximately 8000 Da (Madoff, L.C., et al., Infect. Immun.
59:2638-2644 (1991); Michel, J.L., et al., Infect. Immun. 59:2023-2028
(1991)). Since the protective monoclonal antibody 4G8 binds to the repeat
region, this region defines a protective epitope (Madoff, L.C., Infect. Immun.
WO 94/10317 PCI/US93/10506
21~92~
,_ 59
59:2023-2028 (1991)). Smaller tandemly repeated sequences encoding
immunodominant epitopes have been reported in a number of pathogens but
have not been associated with the protein heterogeneity seen in the alpha
antigen (Enes, V., et al., Science 225:628-630 (1984); Fischetti, V.A., et al.,
Rev. Infect. Dis. lO(Supp. 2):S356-S359 (1988); Pereira, M.E., et al., J. Exp.
Med. 174:179-191 (1991); Fischetti, V.A., et al., in Genehcs and Molecular
Biology of Streptococci, Lactococci, and Enterococci, Dunny et al. eds. Am.
Soc. Microbiol., Washington (1991), pp. 290-294; Dailey, D.C., et al., Infect.
Immun. 59:2083-2088 (1991); vonEichel-Streiber, C., et al., Gene 96: 107-113
(1990)). Though the maximum molecular size of the alpha antigen differs
among strains of GBS, this protein heterogeneity is a constant feature (Madoff,
L.C., et al., Infect. Immun. 59:2638-2644 (1991)).
The nucleotide sequence of bca contains nine identical 246-nucleotide
tandem repeating units. The estimated size of the peptide encoded by each of
these repeats is 8665 Da and correlates with the intervals found in the
heterogeneous laddering of the alpha antigen. The amino acid sequence
derived from the DNA sequence revealed both significant homologies and
important differences between the alpha antigen and other streptococcal
proteins (Heden, L.-O., et al., Eur. J. Immunol. 21:1481-1490 (1991);
Jerlstrom, P.G., et al., Mol. Microbiol. 5:843-849 (1991); Fischetti, V.A.,
et al., in Genetics and Molecular Biology of Streptococci, Lactococci, and
Enterococci, Dunny et al. eds. Am. Soc. Microbiol., Washington (1991), pp.
290-294). The repeating units of the alpha antigen suggest possible
mech~nicmc for phenotypic and genotypic variability and provide natural sites
for gene rearrangements that could generate antigen diversity.
WO 94/10317 PCI'/US93/10506
69?"6 -60- -
Materials and Methods
Bacterial Strains, PIA~m;(~SJ Transposons, and Media. GBS strain
A909 (type la/C,~) (Lancefield, R.C., etal., J. Exp. Med. 142:165-179
(1975)), E. coli strains MC1061 and DK1 (Ausubel, F.M., et al., Current
S Protocols in Molecular Biology, Wiley, New York (1990)), pCNB (Lopilato,J. et al., Mol. Gen. Genet. 205:285-290 (1986)), DH5~ (aderivative of DH1;
GIBCO/BRL), and NK-8032; E. coli plasmids and clones pUC12, pUX12, and
pJMS23; and the transposon Tn5seql have been described (Michel, J.L.,
et al., Infect. Immun. 59:2023-2028 (1991)). The plasmid pGEM-7Zf(-) was
purchased from Promega, Madison, WI, USA. Additional subclones of
pJMS23 (pJMS23-1, -7, -9, and -10) are described below. Growth media for
GBS and E. coli and antibiotics for selection have been described (Michel,
J.L., et al., Infect. Imrnun. 59:2023-2028 (1991)).
DNA Procedures and Nr~cleoh(le Sequencing Strategy. Standard
procedures for the preparation of plasmid DNA, synthesis and purification of
oligonucleotides, restriction endonucle~ce mapping, agarose gel
electrophoresis, and Southern blot hybridization are from Ausubel etal.
(Ausubel, F.M., et al., Current Protocols in Molecular Biology, Wiley, New
York (1990)). Restriction endonucleases and other enzymes for manipulation
of DNA (e.g., DNase, RNase, and ligase) were obtained from New Fn~ nA
Biolabs and Boehringer Manneheim. Transposon mutagenesis utilized lambda-
Tn5seql (Nag, D.K., et al., Gene 64: 135-145 (1988)).
Nucleotide sequencing of double-stranded DNA used plasmids
containing transposon Tn5seq l insertions using primers of Sp6 or T7
promolers for bidirectional sequencing, synthetic oligonucleotide primers, and
nested deletions using Erase-a-Base (Promega, Madison WI, USA; Henikoff,
S., Gene 28:351 (1984)). A total of 12 primers were prepared to obtain the
sequence in both directions for the areas of the gene flanking the repeat
region. Sequencing of the region of repetitive DNA was completed with
WO 94/10317 PCr/US93/10506
21~6~6
--61--
exonuclease III-generated nested deletions. All sequencing employed
Sequenase kit, version 2, used according to manufacturer's specifications for
double-stranded sequencing (United States Biochemical). Adenosine 5'~
[35S]thio]triphosphate was obtained from Amersham. GenAmp PCR kit with
AmpliTaq polymerase was used according to manufacturer's instructions
(Perkin-Elmer/Cetus) .
Subclones pJMS23-1, pJMS23-7, and pJMS23-10 were prepared for
transposon mutagenesis to target smaller regions within bca (Michel, J.L.
et al., Infect. Immun. 59:2023-2028 (1991)). Subclone pJMS23-1 contains a
5.9-kilobase Hind~ll fragment in pUX12; pJMS23-7 contains 2.8-kilobase Alu
I fragment from pJMS23-1 ligated into the HincII site in the polylinker of
pUC12; and pJMS23-10 is a BsaB1/Sma I double restriction endonuclease
digestion of pJMS23-7 that yielded a 2.3 kilobase insert containing the repeat
region. For nested deletions the Alu I fragment from pJMS23-1 was ligated
into the Sma I site on pGEM-7Zf(-) to create pJMS23-9. Nested deletions
were constructed in the forward direction from the Hind~ll and Nsi I sites and
in the reverse direction from EcoRI and Sph I sites. The sizes of-the
subclones, mutants, and deletions used for sequencing were confirmed by
restriction endonuclease mapping and/or PCR with primers to the pUC12
polylinker and to Tn5seql (Sp6 and T7).
Data analysis used the Department of Molecular Biology computer at
Massachusetts General Hospital (Boston) with Genetics Computer Group
(Madison, WI) version 7 software and the BLAST network of the National
Center for Biotechnology Information of the National Institutes of Health
(Bethesda, MD).
Monoclonal Antibodies, SDS/PAGE, and Western Im nl-noblots.
Extracts of GBS and E. coli proteins, SDS/PAGE, immunoblotting, and
probing with the alpha antigen monoclonal antibody 4G8 were performed as
described in Madoff, L.C., et al., Infect. Immun. 59:2638-2644 (1991), in
Madoff, L.C.~ et al., Infect. Immun. 59:204-210 (1991), and in Michel, J.L.,
et al., Infect. Immun. 59:2023-2028 (1991)
WO 94/10317 PCr/US93/10506
2~S69?~6 -62-
Results
Nu-~leoti~ Sequence of bca. Subclones of pJMS23, which encodes
the bca locus from GBS strain A909 (type Ia/C) and expresses the alpha
antigen in E. coli, were used for determining the sequence of bca (Michel,
J.L., et al., Infec~. Immun. 59:2023-2028 (1991)). As is often the case with
Gram-positive genes cloned into E. coli, many of the subclones were unstable
(Schneewind, O., et al., Inect. Immun. 56:2174-2179 (1988)). This problem
is compounded in bca by a large region of repetitive DNA that provides
multiple, fixed sites for homologous recombination.
Homologous recombination such as this may be purposely taKen
advantage of to generate a population of recombinant hosts that express a
variety of alpha antigen functional derivatives. Such a population would be a
mixtures of the alpha antigens and their functional derivatives and may be
utilized in the vaccines of the invention to provide a wide range of alpha
antigen sequences against which the host may direct the immune response.
To verify that pJMS23 encodes the complete native gene without
deletions, Southern blots of genomic DNA from A909 were probed with gene
fragments from the clone. There were no dirreleilces found in the restriction
maps of bca between A909 and pJMS23. The complete nucleotide sequence
of bca was obtained independently on both stands using three strategies:
transposon mutagenesis with Tn5seql, synthetic oligonucleotide primers, and
exonuclease III nested deletions (Figure 5).
The complete nucleotide sequence of the bca locus and derived amino
acid sequence for a single, large open reading frame are shown in Figure 6.
The structural gene consists of 3063 nucleotides, encodes 1020 amino acids,
and has a calculated molecular mass of 108,705 Da. There is a prokaryotic
promoter consensus sequence (TATAAT) upstream (at-10) from the initiating
codon (Doi, R.H., et al., Microbiol. Rev. 50:227-243 (1986)). There are no
clear homologies in the -35 region assuming a spacing of 5-19 bases upstream
from the -lO region (Hawley, D.K., et al., Nucleic Acids Res. 11:2237-2255
WO 94/10317 PCr/US93/10506
-63- 2146926
._
(1983)). The probable ribosomal binding site flanking the 5' end of bca is
AGGAGA (Shine, J., et al., Proc. Natl. Acad. Sci. USA 71: 1342-1346
(1974); Gold, L., et al., Annu. Rev. Microbiol. 38:365-403 (1981)).
Downstream of the TAA termination codon are two regions with dyad
symmetry that could function as transcription terminators (Brendel, V., et al.,
Nucleic Acids Res. 12:4411-4127 (1984)).
The derived amino acid sequence of the mature peptide of bca predicts
a pKa of 4.49, which is close to the experimentally measured values for both
the native and the cloned C protein alpha antigen. The alpha antigen contains
no cysteine and only a single methionine at the initiation codon. The alpha
antigen is rich in proline (11 % in the mature protein) but does not show the
XPZ motif identified in the C protein beta antigen of GBS (Heden, L.-O.,
et al., Eur. J. Immunol. 21:1481-1490 (1991); Jerlstrom, P.G. et al., Mol.
Microbiol. 5:843-849 (1991)) or the proline repeat motifs described in M
protein of group A streptococci (Fischetti, V.A., et al., Mol. Microbiol.
4: 1603-1605 (1990)).
Deduced Signal Sequence of bca and Homologies. As a cell surface-
associated protein, alpha antigen may use a signal sequence to be exported
from the cytoplasm. A BLAST search identified five Gram-positive surface
proteins with homology to the first 41 amino acids of the alpha antigen (Figure
7A). Based on the pattern described for other Gram-positive signal sequences,
it is likely that the first 41 amino acids of alpha antigen comprise a signal
sequence (vonHeijne, G., Eur. J. Biochem. 133:17-21 (1983); vonHeijne, G.
et al., FEBS Lett. 244:439446 (1989)). There is a high proportion of
arginine and Iysine residues near the N terminal, followed by a hydrophobic
region, a serine at position 36, and a valine at position 41. Other possibilities
are cleavages after valine at position 54 or either of the alanine residues at
positions 55 and 56 that follow a serine at position 52. Assuming that the
signal sequence is cleaved following amino acid 41, the mature protein would
contain 979 amino acids with a molecular mass of 104,106 Da. This suggests
that the signal sequence is encoded by 123 nucleotides, making up 4% of the
WO 94/10317 PCI/US93/10506
2~469~ -64- _
gene, and has a molecular mass of 4616 Da. Further support for a signal
sequence of this size comes from Western blots comparing the sizes of the
native and cloned alpha antigens probed with the monoclonal antibody 4G8.
As shown in Figure 8, each of the steps of the alpha antigen protein ladder
from clone pJMS23 is slightly larger than that of the native protein from GBS
A909, which suggests that the signal sequence may not be processed in E. coli
as it would be in the GBS. The size .lirrereilce is about 4 kDa, which would
correspond to a shorter (41 amino acids) rather than a larger (53-55 amino
acids) signal sequence in bca.
Analysis of the N Tenninus of bca. Following the putative signal
sequence, there is a region of 185 amino acids before the repeated sequences.
The N-terminal region contains 555 nucleotides, accounts for 18 % of the gene,
and encodes a polypeptide with a predicted molecular mass of 20,417 Da. A
computer search comparing the primary nucleotide sequence and the derived
amino acid sequence in all six reading frames of the N terminus of bca with
sequences in GenBank and Swiss-Prot using the BLAST network of programs
found no homologies, thus suggesting that this region of the gene is unlike any
previously sequenced or described nucleic acid or amino acid sequence.
Repeating Unit Region of bca. Beginning at amino acid 679 of the
DNA sequence, there are nine large tandem repeating units with identical
nucleic acid and amino acid structures that encolllpass 74 ~ of the gene. The
size and repetitive nature of this region of bca are illustrated in Figure 9.
Each repeating unit consists of 246 nucleotides encoding 82 amino acids with
a calculated molecular mass of 8665 Da. The entire repeat region contains
749 amino acids and consists of the nine identical repeating units and a partialrepeating unit design~ted 9'. The calculated molecular mass of this region is
79,053 Da.
The determination of the beginning and end of the repeat is somewhat
arbitrary. Here, the determination starts from the N terminus, beginning with
the first codon that was in the open reading frame. If desired, the repeating
units could also be defined as beginning OUI of frame or starting at the C-
WO 94/10317 PCr/US93/10506
214692~
-65 -
terminal side. BLAST computer searehes for nucleic acid and derived amino
acid homologies showed to significant matches for the repeat units. Therefore,
these repeating units appear to be unique to the alpha antigen and are differentin size and structure from those deseribed for other streptoeoecal proteins
(Heden, L.-O., et al.Eur. J. Immunol. 21: 1481-1490 (1991); Jerlstrom, P.G.,
et al., Mol. Microbiol. 5:843-849 (1991); Fischetti, V.A., et al., in Gene~ics
and Molecular Diology of Streptococci, Lactococci, arul Enterococci, Dunny
et al. eds. Am. Soc. Microbiol., Washington (l991), pp. 290-294; Yother, J.,
et al., J. Bacteriol. 1 74:601-609 (1992)).
C-Terminal Anchor of bca and Homologies. Following the repeating
units is a small C-terminal region containing 148 nucleotides and making up
4.4% of the gene. This region encodes 45 amino acids with a calculated
molecular mass of 4672 Da. A BLAST search for amino acid homologies
identified a class of Gram-positive surface proteins with a common membrane
anchor motif (Figure 7B), including the M proteins of group A Streptococcus
and IgG binding proteins from both group A and group G Streptococcus
(Wren, B.W., Mol. Microbiol. 5:797-803 (1991)). The amino aeid
composition at the C terminus is characteristic of the peptide membrane
anchor, including a hydrophilic stretch with Iysine before the LPXTGE [SEQ
ID NO: 2] motif (Figure 7B) (Fischetti, V.A. et al., Mol. Microbiol. 4: 1603-
1605 (1990)). This is followed by a hydrophobic region with the consensus
PPFFXXAA [SEQ ID NO: 1], where X designates a hydrophobic amino acid.
Finally, there is a hydrophilic tail ending in aspartic acid that presumably
extends into the cytoplasm of the cell.
Analysis of the Nucleotide Sequence and the Deduced Alpha Antigen
Protein.
Figure 9 illustrates four distinct regions within the open reading frame
of bca as determined from the nucleotide and derived amino acid sequences.
A hydrophobicity plot of the amino acid sequence shows that the putative
signal sequence has a short, hydrophilic N terminus, followed by a
hydrophobic stretch, and ending in a hydropllilic region, wllereas the C-
WO 94/10317 PCI`/US93/10506
2~69?'6 -66- --
peptide membrane anchor has a hydrophobic wall-spanning domain and a
small hydrophilic tail (Engelman, D.M., et al., Annu. Rev. Biophys. Biophys.
Chem. 15:321-353 (1986); Kyte, J., et al., J. Mol. Biol. 157: 105-132 (1982)).
The native alpha antigen demonstrates a ladder of polypeptides at
regularly repeating intervals that is also seen with the cloned gene product
(Figure 8). The siæ of the individual repeats in bca could code for a
polypeptide of 8665 Da, which corresponds to the size differences in the
protein ladder. To look at possible mech~ni~ms gener~Ling protein
heterogeneity, bca nucleotide and derived RNA and protein sequences were
surveyed. Analysis of the nucleotide sequence of bca failed to show codons
within the repeat regions that could cause early termination of translation. In
addition, the amino acid sequence of the repeat region was screened with-the
Genetics Computer Group program for potential sites for proteolytic cleavage.
A unique site within each repeat was sensitive to pH 2.5, represented by
aspartic acid followed by proline. However, these sites were also found in the
N terminus. Although the alpha antigen is relatively resistant to trypsin, therewere numerous potential trypsin cleavage sites found in the sequence. Finally,
modeling of RNA sequence and tertiary structure failed to identify regions
within the repeats that might be involved with RNA-me~i~ted self-cleavage.
Discussion
Two biological properties identified for the alpha antigen of GBS are
the ability to resist opsomophagocytosis in the absence of specific antibody andthe expression of epitopes that elicit protective antibodies (Madoff, L.C.,
et al., Infect. Immun. 59:2638-2644 (1991); Lancefield, R.C., et al., J. Exp.
Med. 142:165-179 (1975); Payne, N.R., etal., J. Infect. Dis. 151:672-681
(1985); Payne, N.R., et al., Infect. Immun. 55:1243-1251 (1987)). Analysis
of the sequence of the alpha antigen shows four distinct structural domains.
The pulative N-lerminal signal sequence and the C-terminal membrane anchor
support the hypotllesis that the alpha anli~en is a surface-associated membrane
WO 94/10317 PCl'/US93/10506
_ -67- 21~6926
protein. These properties, along with the repeating unit motif, are shared by
a number of Gram-positive proteins that are thought to be involved in the
pathogenesis of bacterial infections (Fischetti, V.A., et al., in Genetics and
MolecularDiology of Streptococci, Lactococci, and Enterococci, Dunny et al.
eds. Am. Soc. Microbiol., Washington (1991), pp. 290-294).
The alpha antigen sequence identified a region of large, identical,
tandem repeats composing 74% of the gene and demonstrating no homology
to previously described protein or nucleic acids sequences. However, a
number of virulence-associated proteins contain multiple repetitive elements.
The M protein of group A Streptococcus, which is antiphagocytic, carries
protective epitopes and displays variability in antigen size and presentation,
contains two extended tandem repeat regions and one nontandem repeat region
occupying nearly two-thirds of the gene (Fischetti, V.A., et al., Rev. Infect.
Dis. S356-S359 (1988); Hollingshead, S.K., et al., J. Biol. Chem. 261:1677-
1686 (1986); Haanes, E.J., et al., J. Bacteriol. 171:6397-6408 (1989)). The
individual repeats are smaller in M protein than in the alpha antigen and range
from 21 to 81 base pairs. In addition, there is divergence between the
repeating units at the ends of the repeat region, while those in the middle are
nearly identical. Pneumococcal surface protein A contains a region containing
up to 10 repetitive segments of 20 amino acids each (Yother, J. et al., J.
Bacteriol. 174:601-609 (1992)). Both M protein and pneumococcal surface
protein A demonstrate antigenic variability and changes in protein/gene size
thought to be mediated by repetitive DNA sequences in their structural genes
(Fischetti, V.A., et al., in Genetics and Molecular Diology of Streptococci,
Lactococci, and Enterococci, Dunny et al. eds. Am. Soc. Microbiol.,
Washington (1991), pp. 290-294; Yother, J., et al., J. Bacteriol. 174:601-609
(1992); Haanes, E.J., et al., J. Bacteriol. 171:6397-6408 (1989)). Other
Gram-positive genes with repetitive motifs include the glycotransferase genes
from Slreptococcus sobrinus and Streptococcus mutans (Ferretti, J.J., et al.,
J. Bacteriol. 169:4271-4278 (1987); Shiroza, T., et al., J. Bacteriol. 170:810-
816 (1988,~). Immunodomillall~ epitopes associated with repetitive sequences
WO 94/10317 PCr/US93/10506
?~.469?~6 -68- _
have been identified in a number of other pathogens including Rickettsia
rickettsii, Trichomonas vaginalis, and Clostridium difficile (Dailey, D.C.,
et al., Infect. Immun. 59:2083-2088 (1991); Anderson, B.E., et al., Infect.
Immun. 58:2760-2769 (1990); vonEichel-Streiber, C., et al., Gene 96: 107-113
(1990)). The repeats found in alpha antigens are unique for three reasons:
(i) They are larger than those found for other Gram-positive surface proteins.
(ii) They are identical at the nucleic acid level and do not diverge. (iii) The
size of protein encoded by the repeating units corresponds to the laddering
seen in the native and cloned alpha antigens.
The findings of large tandem repeating units raises many questions
about the genotypic and phenotypic variability of the alpha antigen. When
probed on Western immunoblots with the 4G8 monoclonal antibody, both the
native and the cloned alpha antigen display a regular ladder of proteins varyingby about 8 kDa, and the size of the alpha antigen varies between strains
(Madoff, L.C., et al.lnfect. Immun. 59:2638-2644 (1991)). Restriction
endomlcle~ce mapping of the original alpha antigen clone pJMS23 showed
multiple S~ I fragments of about 270 base pairs (Michel, J.L., et al., Infect.
Immun. 59:2023-2028 (1991)). Since strain A909 contains only one copy of
bca it was proposed that these fragments may be responsible for the protein
heterogeneity. The nucleotide sequence confirms the repetitive nature of the
gene but does not identify the mechanism of protein laddering.
Since multiple protein sizes are seen in both native and cloned
backgrounds and since there is no evidence for a gene family, we postulate
that laddering results from a mechanism common to both E. coli and GBS
and/or is mediated by a property specific to the alpha antigen. Western blots
on Tn5 transposon insertion mutations within the repeat region still show
laddering, which demonstrates that the C terminus is not required for
heterogeneity, suggesting that either the N-terminal or repeat region
determines laddering.
Studies of the alpha antigen among GBS isolates using a monoclonal
antibody showed that the maximum molecular size of the alpha anti~gen is
WO 94/10317 PCr/US93/10506
21~692~
-69-
constant for a given isolate but varies widely among different isolates (Madoff,L.C., et al., Infect. lmmun. 59:2638-2644 (1991)). The tandem repeating
units could provide convenient fixed recombination sites for deletion or
duplication of the repeat region. Deletion would reduce the size of the gene
and might occur during DNA replication by unequal crossover or mispaired
template slippage, which would occur in frame (Harayama, S., etal., J.
Bacteriol 173:7540-7548 (1991)). Duplication of DNA could be a mechanism
to amplify mutations within a repeat and create antigenic diversity. However,
we have no evidence that the variation in the protein size of the alpha antigen
is accompanied by antigenic diversity and the expression of different protectiveor opsonic epitopes.
The nine complete tandem repeats in the alpha antigen from A909 are
identical at the nucleic acid level, which demonstrates a highly conserved
structure. This suggests that the duplication causing the repeats is a recent
event, that there are properties internal to the repeats that maintain their
integrity, or that their structure is essential for the gene. Southern blots of
genomic DNA from alpha antigen-bearing strains of GBS probed with alpha
antigen-specific DNA show variability in gene size among strains. To look
at the mechanism of genotypic diversity among strains, it will be necessary to
clone and sequence bca from other phenotypic variants and to determine the
phylogenetic relationships among C protein-bearing strains of GBS (Michel,
J.L., et al. in Genetics and Molecular Biology of Streptococci, Lactococci,
andEnterococci, Dunny, G.M., et al. eds., Am. Soc. Microbiol., Washington
(1991), pp. 214-218; Michel, J.L., et al., Infect. Immun. 59:2023-2028
(1991); Cleat, P.H., et al., Infect. Immun. 55:1151-1155 (1987); Heden, L.-
O., et al.Eur. J. Immunol. 21:1481-1490 (1991); Lindahl, G., et al., Eur. J.
Immunol. 20:2241-2247 (1990)).
Therefore, in summary, Western blots of both the native alpha antigen
and the cloned gene product demonstrate a regularly laddered pattern of
heterogeneous polypeptides. The nucleotide sequence of the bca locus reveals
an open reading frame of 3060 nucleotides encoding a precursor protein of
WO 94/10317 PCI/US93/10506
?,.!,469?,6 70 _
108,705 Da. Cleavage of a putative signal sequence of 41 amino acids yields
a mature protein of 104,106 Da. The 20,417-Da N-terminal region of the
alpha antigen shows no homology to pre~iously described protein sequences
and is followed by a series of nine tanden~ repeating units that maKe up 74%
of the mature protein. Each repeating unit is identical and consists of 82
amino acids with a molecular mass of 8665 Da, which is encoded by 246
nucleotides. The size of the repeating units corresponds to the observed size
dirrerences in the heterogeneous ladder of alpha C proteins expressed by GBS.
The C-terminal region of the alpha antigen contains a membrane anchor
domain motif that is shared by a number of Gram-positive surface proteins.
The large region of identical repeating units in bca defines protective epitopesand its structure may be manipulated for the construction of protective
vaccines that are directed to the phenotypic and genotypic diversity of the
alpha antigen.
Example 15
A Vaccine Containing C Protein Alpha Antigen
Fr~ tiQn~ e~ liv~ Having at Lea~.t
One of the Native Repeating Units.
The above-described protective C protein alpha antigen functional
derivatives (such as a protein moiety of N, C, N-C, R" R2, R3, R4, Rs~ R6,
R" R8, R9, N-RI, N-R2, N-R3, N-R4, N-Rs, N-R6, N-R7, N-R8, N-R9, R1-C,
R2-C, R3-C, R4-C, Rs-C, R6-C, R,-C, R8-C, Rg-C, N-RI-C, N-R2-C, N-R3-C,
N-R4-C, N-Rs-C, N-R6-C, N-R,-C, N-R8-C, or N-R9-C) may be prepared by
recombinant means using recombinant methods similar to those described
above for cloning and expressing the native group B Streptococcus alpha
antigen and beta antigen in hosts such as E. coli. Any technique may be
utilized to synthesize the desired alpha antigen functional derivative sequence,including those described above for the recombinant production of these
proteins, and those described by Williams, J.l., et al., Us 5.089,406
WO 94/10317 2 1 4 6 9 2 6 PCI/US93/10506
7 1
("Method of Producing a Gene Cassette Coding for Polypeptides with
Repeating Amino Acid Sequences~" incorporated herein by reference) and by
McPherson, M.l., ed., Directed Mutagenesis, A Practical Approach," IRL
Press, New York, 1991.
The recombinantly expressed, above-described protective C protein
alpha antigen functional derivatives (such as a protein moiety of N, C, N-C,
Rl~ R2, R3? R4, Rs~ R6, R7, R8, Rg, N-R" N-R2, N-R3, N-R4, N-R5, N-R6, N-
R7, N-R8, N-Rg, Rl-C, R2-C, R3-C, R4-C, Rs-C, R6-C, R7-C, R8-C, R9-C, N-
Rl-C, N-R2-C, N-R3-C, N-R4-C, N-Rs-C, N-R6-C, N-R7-C, N-R8-C, or N-R9-
C) may be purified, if necessary, from the recombinant host or medium using
techniques known in the art and then tested for their potential in a conjugate
vaccine. Each peptide species may be tested alone, or in combination with
other peptides. To assess this potential, cellular extracts of E. coli containing
recombinant plasmids are prepared as described above, and used to immunize
rabbits. The resulting antisera are tested in the mouse lethality model for their
ability to protect mice from infection by the group B Streptococcus strain
H36B. Strain H36B carries the C protein of group B Streptococcus. As a
control, the ability of the antisera to protect the mice against infection by
Streptococcus strain 515 (which does not carry the C protein) is determined.
A similar assay may be used to assess the conjugated form wherein the
peptide is conjugated tO a group B Streptococcus polysaccharide using the
above described techniques known in the art. Preferrably, this is a group B
Streptococcus capsid polysaccharide. The conjugates are used to immunize
rabbits. The resulting antisera are tested in the mouse lethality model for their
ability to protect mice from infection by the group B Streptococcus strain
H36B. Strain H36B carries the C protein of group B Streptococcus. As a
control, the ability of the antisera to protect the mice against infection by
Streptococcus strain 515 (which does not carry the C protein) is determined.
- Althougll the foregoing refers to particular prefen-ed embodiments, it
will be understood that the present invention is not so limited. It will occur
tO those ordinarily skilled in tlle art that various modifications may be made
WO 94/1031,~1 ~692~ PCI/US93/10506
-72-
to the disclosed embodiments and that such modifications are intended to be
within the scope of the present invention.
WO 94/10317 7 3 21 4 6 9 2 B PCr/US93tlO506
~ SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Michel, James L.
Kasper, Dennis
Ausubel, Frederick M.
Madoff, Lawrence C.
(ii) TITLE OF INVENTION: Conjugate Vaccine Against Group B
Streptococcus
(iii) NUMBER OF SEQUENCES: 29
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Sterne, Kessler, Goldstein h Fox
(B) STREET: 1100 New York Avenue, N.W.; Suite 600
(C) CITY: Washington
(D) STATE: D.C.
(E) COUNTRY: USA
(F) ZIP: 20005-3934
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi~ CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT (TO BE ASSIGNED)
(B) FILING DATE: 02-NOV-1993
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/968,866
(B) FILING DATE: 02-NOV-1992
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION-
(A) NAME: Cimbala, Michele A.
(B) REGISTRATION NUMBER: 33,851
(C) REFERENCE/DOCKET NUMBER. 0609.237PC01
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 371-2600
(B) TELEFAX: (202) 371-2540
(C) TELEX: 248636 SSK
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Pro Pro Phe Phe Xaa Xaa Ala Ala
1 5
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPC: peptide
WO94/10317 7 4 PCI`/US93/10506
2~46926
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Leu Pro Xaa Thr Gly Glu
l 5
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SE~ ID NO:3:
GATCCATTGT GCTGG 15
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ll base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GTAACACGAC C 11
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
ACACGAGATT TC 12
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
ATGACCATGA TTACGAATTC GAGCTCGCCC GGGGATCCAT TGTGCTGGAA AGCCACC 57
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
WO 94/10317 7 5 2 1 ~ 6 9 2 6 PCI/US93/10506
~~ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GGATCCATTG TGCTGG 16
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
GGATCCATTG TGCTGGCCAG CACAATGGAT CC 32
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 base pairs
(B) TYPE: nucleic.acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GGATCCATTG TG 12
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GGATCCATTG TGCTCTAAAG 20
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
CGAATTAATT CG 12
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(xi) SEQUENCE DESCP.IPTION: SEQ ID NO:12:
TCGA
GCGGGC CC 1
p~ ~69~ 7 6 PCI/US93/10506
(2~ INFORMATION FOR SEQ ID NO:13: -
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pair~
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13`:
AATTCGCGCC CGGGG 15
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1380 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 79..1173
(ix) FEATURE:
(A) NAME/KEY: misc feature
(B) LOCATION: 1004
(D) OTHER INFORMATION: /note= "This feature is to signify
that the nucleotide sequence from position 757
through 1003 is inserted at position 1004 and can be
repeated up to eight times (for a total of nine
repeating copies of these sequences within the polynucleotide)."
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
AGCATAGATA TTCTAATATT 'l~l'l-~lll'AA GCCTATAATT TACTCTGTAT AGAGTTATAC 60
AGAGTAAAGG AGAATATT ATG TTT AGA AGG TCT AAA AAT AAC AGT TAT GAT 111
Met Phe Arg Arg Ser Lys Asn Asn Ser Tyr Asp
1 5 10
ACT TCA CAG ACG AAA CAA CGG TTT TCA ATT AAG AAG TTC AAG TTT GGT 159
Thr Ser Gln Thr Lys Gln Arg Phe Ser Ile Lys Lys Phe Lys Phe Gly
15 20 25
GCA GCT TCT GTA CTA ATT GGT CTT AGT TTT TTG GGT GGG GTT ACA CAA 207
Ala Ala Ser Val Leu Ile Gly Leu Ser Phe Leu Gly Gly Val Thr Gln
30 35 40
GGT AAT CTT AAT ATT TTT GAA GAG TCA ATA GTT GCT GCA TCT ACA ATT 255
Gly Asn Leu Asn Ile Phe Glu Glu Ser Ile Val Ala Ala Ser Thr Ile
45 50 55
CCA GGG AGT GCA GCG ACC TTA AAT ACA AGC ATC ACT AAA AAT ATA CAA 303
Pro Gly Ser Ala Ala Thr Leu Asn Thr Ser Ile Thr Lys Asn Ile Gln
60 65 70 75
AAC GGA AAT GCT TAC ATA GAT TTA TAT GAT GTA AAA TTA GGT AAA ATA 351
Asn Gly Asn Ala Tyr Ile Asp Leu Tyr Asp Val Lys Leu Gly Lys Ile
80 85 90
GAT CCA TTA CAA TTA ATT GTT TTA GAA CAA GGT TTT ACA GCA AAG TAT 399
Asp Pro Leu Gln Leu Ile Val Leu Glu Gln Gly Phe Thr Ala Lys Tyr
95 100 105
GTT TTT AGA CAA GGT ACT AAA TAC TAT GGG GAT GTT TCT CAG TTG CAG 447
Val Phe Arg Gln Gly Thr Lys Tyr Tyr Gly Asp Val Ser Gln Leu Gln
110 115 120
WO 94/10317 77 ~ 1 4 6 9 2 ~ PCr/US93/10506
A~T ACA GGA AGG GCT AGT CTT ACC TAT AAT ATA TTT GGT GAA GAT GGA 495
Ser Thr Gly Arg Ala Ser Leu Thr Tyr Asn Ile Phe Gly Glu Asp Gly
125 130 135
CTA CCA CAT GTA AAG ACT GAT GGA CAA ATT GAT ATA GTT AGT GTT GCT 543
Leu Pro His Val Lys Thr Asp Gly Gln Ile Asp Ile Val Ser Val Ala
140 145 150 155
TTA ACT ATT TAT GAT TCA ACA ACC TTG AGG GAT AAG ATT GAA GAA GTT 591
Leu Thr Ile Tyr Asp Ser Thr Thr Leu Arg Asp Lys Ile Glu Glu Val
160 165 170
AGA ACG AAT GCA AAC GAT CCT AAG TGG ACG GAA GAA AGT CGT ACT GAG 639
Arg Thr Asn Ala Asn Asp Pro Lys Trp Thr Glu Glu Ser Arg Thr Glu
175 180 185
GTT TTA ACA GGA TTA GAT ACA ATT AAG ACA GAT ATT GAT AAT AAT CCT 687
Val Leu Thr Gly Leu Asp Thr Ile Lys Thr Asp Ile Asp Asn Asn Pro
190 195 200
AAG ACG CAA ACA GAT ATT GAT AGT AAA ATT GTT GAG GTT AAT GAA TTA 735
Lys Thr Gln Thr Asp Ile Asp Ser Lys Ile Val Glu Val Asn Glu Leu
205 210 215
GAG AAA TTG TTA GTA TTG TCA GTA CCG GAT AAA GAT AAA TAT GAT CCA 783
Glu Lys Leu Leu Val Leu Ser Val Pro Asp Lys Asp Lys Tyr Asp Pro
220 225 230 235
ACA GGA GGG GAA ACA ACA GTA CCC CAA GGG ACA CCA GTT TCA GAT AAA 831
Thr Gly Gly Glu Thr Thr Val Pro Gln Gly Thr Pro Val Ser Asp Lys
240 245 250
GAA ATC ACA GAC TTA GTT AAG ATT CCA GAT GGC TCA AAA GGG GTT CCG 879
Glu Ile Thr Asp Leu Val Lys Ile Pro Asp Gly Ser Lys Gly Val Pro
255 260 265
ACA GTT GTT GGT GAT CGT CCA GAT ACT AAC GTT CCT GGA GAT CAT AAA 927
Thr Val Val Gly Asp Arg Pro Asp Thr Asn Val Pro Gly Asp His Lys
270 275 280
GTA ACG GTA GAA GTA ACG TAT CCA GAT GGA ACA AAG GAT ACA GTA GAA 975
Val Thr Val Glu Val Thr Tyr Pro Asp Gly Thr Lys Asp Thr Val Glu
285 290 295
GTA ACG GTT CAT GTG ACA CCA AAA CCA GTA CCG GAT AAA GAT AAA TAT 1023
Val Thr Val His Val Thr Pro Lys Pro Val Pro Asp Lys Asp Lys Tyr
300 305 310 315
GAT CCA ACA GGT AAA GCT CAG CAA GTC AAC GGT AAA GGA AAT AAA CTA 1071
Asp Pro Thr Gly Lys Ala Gln Gln Val Asn Gly Lys Gly Asn Lys Leu
320 325 330
CCA GCA ACA GGT GAG AAT GCA ACT CCA TTC TTT AAT GTT GCA GCT TTG 1119
Pro Ala Thr Gly Glu Asn Ala Thr Pro Phe Phe Asn Val Ala Ala Leu
335 340 345
ACA ATT ATA TCA TCA GTT GGT TTA TTA TCT GTT TCT AAG AAA AAA GAG 1167
Thr Ile Ile Ser Ser Val Gly Leu Leu Ser Val Ser Lys Lys Lys Glu
350 355 360
GAT TAATCTTTTG ACCTAAAATG TCACTAAATT TTTCACCATT TATTGGTGTG1220
Asp
365
AACACATTAA TAAAGTTATG CATCTCTCTC CAACAAAATT AATTAAAGTG TTTCAATTTT 1280
TCGAGATTAA TTCTTGAAAA AAGCCTATCG AGATTATTAA TTTCGATAGG CTTTTGATTT 1340
TGTGTAAGCG TCCAATATAC CTTGTTATTG GACGCTTACT 1380
W094/10317 g~2,6 7 8 PCI`/US93/10506
~2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 364 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(B) LOCATION: 310
(D) OTHER INFORMATION: /note= "This feature indicates that
the amino acid sequence from position 227 through
309 is inserted at position 310 and may repeat up to
eight times (for a total of nine repeating copies of
these sequences within the polypeptide)."
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Met Phe Arg Arg Ser Lys Asn Asn Ser Tyr Asp Thr Ser Gln Thr Lys
1 5 10 15
ln Arg Phe Ser Ile Lys Lys Phe Lys Phe Gly Ala Ala Ser Val Leu
Ile Gly Leu Ser Phe Leu Gly Gly Val Thr Gln Gly Asn Leu Asn Ile
Phe Glu Glu Ser Ile Val Ala Ala Ser Thr Ile Pro Gly Ser Ala Ala
Thr Leu Asn Thr Ser Ile Thr Lys Asn Ile Gln Asn Gly Asn Ala Tyr
le Asp Leu Tyr Asp Val Lys Leu Gly Lys Ile Asp Pro Leu Gln Leu
le Val Leu Glu Gln Gly Phe Thr Ala Lys Tyr Val Phe Arg Gln Gly
100 105 110
Thr Lys Tyr Tyr Gly Asp Val Ser Gln Leu Gln Ser Thr Gly Arg Ala
115 120 125
Ser Leu Thr Tyr Asn Ile Phe Gly Glu Asp Gly Leu Pro His Val Lys
130 135 140
Thr Asp Gly Gln Ile Asp Ile Val Ser Val Ala Leu Thr Ile Tyr Asp
145 150 155 160
er Thr Thr Leu Arg Asp Lys Ile Glu Glu Val Arg Thr Asn Ala Asn
165 170 175
sp Pro Lys Trp Thr Glu Glu Ser Arg Thr Glu Val Leu Thr Gly Leu
180 185 190
Asp Thr Ile Lys Thr Asp Ile Asp Asn Asn Pro Lys Thr Gln Thr Asp
195 200 205
Ile Asp Ser Lys Ile Val Glu Val Asn Glu Leu Glu Lys Leu Leu Val
210 215 220
Leu Ser Val Pro Asp Lys Asp Lys Tyr Asp Pro Thr Gly Gly Glu Thr
225 230 235 240
hr Val Pro Gln Gly Thr Pro Val Ser Asp Lys Glu Ile Thr Asp Leu
245 250 255
al Lys Ile Pro Asp Gly Ser Lys Gly Val Pro Thr Val Val Gly Asp
260 265 270
WO 94/10317 _ ~79 _ 2 t 4 6 9 2 6 PCI/US93/lOS06
Arg Pro Asp Thr Asn Val Pro Gly Asp His Lys Val Thr Val Glu Val
275 280 285
Thr Tyr Pro Asp Gly Thr Lys Asp Thr Val Glu Val Thr Val His Val
290 295 300
Thr Pro Lys Pro Val Pro Asp Lys Asp Lys Tyr Asp Pro Thr Gly Lys
305 310 315 320
la Gln Gln Val Asn Gly Lys Gly Asn Lys Leu Pro Ala Thr Gly Glu
325 330 335
sn Ala Thr Pro Phe Phe Asn Val Ala Ala Leu Thr Ile Ile Ser Ser
340 345 350
Val Gly Leu Leu Ser Val Ser Lys Lys Lys Glu Asp
355 360
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Met Phe Arg Arg Ser Lys Asn Asn Ser Tyr Asp Thr Ser Gln Thr Lys
1 5 10 15
Gln Arg Phe Ser Ile Lys Lys Phe Lys Phe Gly Ala Ala Ser Val Leu
Ile Gly Leu Ser Phe Leu Gly Gly Val Thr Gln Gly Asn Leu Asn Ile
35 40 45
Phe Glu Glu Ser Ile Val Ala Ala
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Met Phe Lys Ser Asn Tyr Glu Arg Lys Met Arg Tyr Ser Ile Arg Lys
1 5 10 15
Phe Ser Val Gly Val Ala Ser Val Ala Val Arg Ser Leu Phe Met Gly
Ser Val Ala His Ala
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 amino acids
(B) TYPE: amino acid
(D) TOPOLO5Y: both
WO94/1~6926 ' `~ O PCI`/US93/10506
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Met Ala Arg Gln Gln Thr Lys Lys Asn Tyr Ser Leu Arg Lys Leu Lys
1 5 10 15
Thr Gly Thr Ala Ser Val Ala Val Ala Leu Thr Val Leu Gly Ala Gly
20 25 30
Phe Ala Asn Gln Thr Glu Val Arg Ala
(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
Met Thr Lys Asn Asn Thr Asn Arg His Tyr Ser Leu Arg Lys Leu Lys
1 5 10 15
Thr Gly Thr Ala Ser Val Ala Val Ala Leu Thr Val Leu Gly Ala Gly
20 25 30
Leu Val Val Asn Thr Asn Glu Val Ser Ala
(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Met Ala Lys Asn Asn Thr Asn Arg His Tyr Ser Leu Arg Lys Leu Lys
1 5 10 15
Thr Gly Thr Ala Ser Val Ala Val Ala Leu Thr Val Leu Gly Ala Gly
20 25 30
Phe Ala Asn Gln Thr Glu Val Lys Ala
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 50 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: ~oth
(ii) MOLECULE TYPE: peptide
WO 94/10317 2 I 4 6 9 2 6 pcr/us93/1o5o6
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
Met Ala Lys Asn Asn Thr Asn Arg His Tyr Ser Leu Arg Lys Leu Lys
i 5 10 15
Thr Gly Thr Ala Ser Val Ala Val Ala Leu Thr Val Leu Gly Ala Gly
Phe Ala Asn Gln Thr Glu Val Lys Ala Asn Gly Asp Gly Asn Pro Arg
35 40 45
Glu Val
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Lys Ala Gln Gln Val Asn Gly Lys Gly Asn Lys Leu Pro Ala Thr Gly
1 5 10 15
Glu Asn Ala Thr Pro Phe Phe Asn Val Ala Ala Leu Thr Ile Ile Ser
20 25 30
Ser Val Gly Leu Leu Ser Val Ser Lys Lys Lys Glu Asp
35 40 45
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
Asn Lys Ala Pro Met Lys Glu Thr Lys Arg Gln Leu Pro Tyr Thr Gly
1 5 10 15
Val Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Leu Thr Val Met Ala
Thr Ala Gly Val Ala Ala Val Val Lys Arg Lys Glu Glu Asn
35 40 45
(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
W094/10317 2~69~6 8 2 PCI`/US93/10506
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Arg Pro Ser Gln Asn Lys Gly Met Arg Ser Gln Leu Pro Ser Thr Gly
1 5 10 15
Glu Ala Ala Asn Pro Phe Phe Thr Ala Ala Ala Ala Thr Val Met Val
20 25 30
Ser Ala Gly Met Leu Ala Leu Lys Arg Lys Glu Glu Asn
35 40 45
(2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
Ala Lys Lys Glu Asp Ala Lys Lys Ala Glu Thr Leu Pro Thr Thr Gly
1 5 10 15
Glu Gly Ser Asn Pro Phe Phe Thr Ala Ala Ala Leu Ala Val Met Ala
Gly Ala Gly Ala Leu Ala Val Ala Ser Lys Arg Lys Glu Asp
(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Ala Lys Lys Asp Asp Ala Lys Lys Ala Glu Thr Leu Pro Thr Thr Gly
1 5 10 15
Glu Gly Ser Asn Pro Phe Phe Thr Ala Ala Ala Leu Ala Val Met Ala
Gly Ala Gly Ala Leu Ala Val Ala Ser Lys Arg Lys Glu Asp
(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
WO 94/10317 2 I ~ 6 ~ 2 ~ PClJUS93/10506
8 3
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
Ser Arg Ser Ala Met Thr Gln Gln Lys Arg Thr Leu Pro Ser Thr Gly
1 5 10 15
Glu Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Ala Thr Val Met Val
20 25 30
Ser Ala Gly Met Leu Ala Leu Lys Arg Lys Glu Glu Asn
35 40 45
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
Asn Lys Ala Pro Met Lys Glu Thr Lys Arg Gln Leu Pro Ser Thr Gly
1 5 10 15
Glu Thr Ala Asn Pro Phe Phe Thr Ala Ala Ala Leu Thr Val Met Ala
Ala Ala
(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
Lys Gly Asn Pro Thr Ser Thr Thr Glu Lys Lys Leu Pro Tyr Thr Gly
1 5 10 15
Val Ala Ser Asn Leu Val Leu Glu Ile Met Gly Leu Leu Gly Leu Ile
Gly Thr Ser Phe Ile Ala Met Lys Arg Arg Lys Ser
WO 94/10317 8 4 PCr/USg3/ioso6
INDICATIONS RELA'I'INC, 'I'<) A Dl,l'C~SlT~D MICROORGANISM
(PCT Rule 13l~is)
A. The jnrli~ ~jcmC made below relate lo the microorganism referred lo in lhe description
on page 3 , line ~ n
1~. IDENTIFICATION OF DEPOSIT Furlher deposits are idenlified on an ad~liti- -I sheet
Name of dc~siLd.y inctit~lion
AMERICAN TYPE CULTURE COLLECTION
Address of d~,osit... ~ li (including pos~al code and counfry)
12301 Parklawn Drive
Rockville, Maryland 20852
United States of America
Dale of deposil Accession Number
1~; S~DtPmbPr 1 9f~9 40659
C. ADDITIONAL INDICATIONS (leave blank if no~ applicablc) This inforrnation is oon'~ on an additional sbeet O
Plasmid DNA, pJMS 1
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if ~he imlica~ions arenotfor all dcsigna~l S~a~)
E. SEPARATE FURNISHING OF INDICATIONS (I ave blank if no~ applicable)
Theinr~ir~-ionclistedbelowwillbesubmitledlolhelnternationalBureaulater(specify~hegeneralna~ureof~ eg, ~Accession
Numb~r of Deposi~")
For receivin~ Ofrlce use only For International Bureau use only
~This sheel was received with Ihe internalional applicalion [~ l-his sheel was received by Ihe Inlernalional Bureau on:
Aulhoria,cd ofrlccr /1 Aulln)riaed ol1'icer
l-orm l'C~I`/hO/134 (July I~J2)
WO94/10317 8 5 ~'~G Q~ PCr/US93/10506
INl)lCA'rlONS RELATING TO ~ DE:I'OSITED MICI~OORGANISM
(PCr Rule 131~is)
- A. Ibe indications made below relale lo the microorganism referred to in tbe description
on pa~e 3 , line 20
1~. IDENTIFICATION OF DEPOSIT Further deposits are identified on an adrfitirn~l sheet il~'
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal codc and coun~ry)
12301 Parklawn Drive
Rockville, Maryland 20852
United States of America
Date of deposil Accession Number
15 September 1989 40660
C. ADDITIONAL INDICATIONS (leaveblankif nol applicable) This information is ol~n~inued on an additional sbeet
Plasmid DNA, pJMS23
D. DES IGNATED STATES FOR WHICH INDICATIONS ARE MADE (if ~he indica~ions arc not Jor all llcsignaled S~ates)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if nol applicablc)
TbeindicationslistedbelowwillbesubmittedtothelnternalionalBureaulater(specifylllegeneralnalureoftheindicalionse.g., ~Accession
Number of Deposil ~)
For reccivin~ Of`f`ice use only For lnternational Bureau use only
~This shee~ was received with the international application Cf This sheet was received by the International Bureau on:
~uihori~e~f of jl`leyr Af'~ A~nh~)r~ `)c~r
~G~
I:om~ I'CI/1~()/134 (Jui~ 1992)
