Note: Descriptions are shown in the official language in which they were submitted.
~ WO 94/09815 ~ 2146973 PCT/US93/10455
-1-
~
USES OF TGF-3 RECEPTOR FRAGMENT
AS A THERAPEUTIC AGENT
DESCRIPTION
Technical Field
This invention relates to the fields of drug
therapy and protein synthesis. A soluble TGF-0 binding
protein fragment is used to treat conditions
characterized by an excess of TGF-Q, including
fibroproliferation and immunosuppression. The present
invention also relates to recombinant expression of the
binding protein fragment in prokaryotic and eukaryotic
cells.
Technical Background
Transforming growth factor-(3 (TGF-0) represents
a family of polypeptides, of which three are present in
mammals, TGF-01, TGF-02 and TGF-03. These factors have
global effects on cell growth and differentiation
(Roberts and Sporn (1990) Handbk. Exn. Pharm. 95:419-58).
There is a growing body of evidence that TGF-/3 also
modulates the immune process (Wahl et al. (1989) Immunol.
Today 10:258-61). In addition to stimulating the
congregation of immune cells at the site of injury, TGF-/3
also provides strong positive feedback for its own
continued synthesis (Kim et al. (1990) Mol. Cell. Biol.
10:1492-1497). These factors have led to the
investigation of the role of TGF-/3 in immune and
fibroproliferative disorders.
CA 02146973 2004-03-25
-2-
In fibroproliferative diseases, TGF-0 is
becoming considered as a prominent factor. TGF-0 is
known 1) to stimulate cells to produce more proteins,
including collagen, biglycan, decorin and fibronectin;
and 2) to inhibit enzymes which degrade these proteins.
Thus, TGF-ft can cause fibrous tissue to accumulate. For
example, in diabetic nephropathy and human mesangial
proliferative glomerulonephritis, both fibroproliferative
diseases, a prominent and important pathological feature
is the accumulation of mesangial matrix (Mauer et al.
(1984) J. Clin. Invest. 74: 1143-55). Likewise,
postradiation fibrosis is characterized by excessive TGF-
0, proliferation of fibroblasts and overproduction of .
connective tissue (Canney and Dean (199) Brit. J. Radiol.
L3:620-23).
There have been several attempts to suppress
the effects of TGF-0 excess by administering antibody
which is specific for TGF-B. In the application which
resulted in U.S. Patent 5571714 also assigned to Celtrix
Pharmaceuticals, Inc.,
monoclonal antibodies to TGF-0 were shown to have
affinity constants ranging from 1.6 X 107 L/mol to 3.4 X
108 L/mol in a competitive radioimmunoassay test. These
monoclonal antibodies were suggested for use in treating
tumor cells that produce TGF-ft to counteract the
immunosuppressive effects of TGF-0. Another proposed use
was treating metastatic cancers.
Border et al. (1990) Nature 9~:371-74, found
that antiserum against TGF-0 suppressed experimentally
induced glomerulonephritis, which was characterized by
mesangial proliferation. Border et al. reported that the
antibodies to TGF-0 which were raised in rabbits had 50%
binding to TGF-0 at a ratio of 1:6000 in a
radioimmunoassay. Antibodies typically have a molecular
weight of at least 150 kilodaltons (kd).
CA 02146973 2004-03-25
-3-
More recently, Border et al. (t1992) Kidnev
Int. 41:566-570) mentioned that "[o]ther investigators
have used our strategy of antagonizing TGF-0 by
administering anti-TGF-(3 in vivo. This approach has
confirmed a causal role for TGF-0 in pathological matrix
accumulation by reducing scar formation in fetal skin, in
the central nervous system following wounding and
reduction of interstitial fibrosis in a model of acute
lung injury." (p. 567). In J. Exp. Med. (1993) 177:225,
Wahl also cites TFG-B excess
in "a spectrum of connective tissue disorders including
rheumatoid arthritis, scleroderma, myelofibrosis, and
hepatic, intraocular, and pulmonary fibrosis."
Anti-TGF-0 antibodies have been administered to
animals given an intraarticular injection of bacterial
cell walls in an amount sufficient to cause the
development of arthritis. One intraarticular injection
of anti-TGF-0 was sufficient to prevent arthritis. (Wahl
(1992) J. Clin. Immunol. 12:1-14). In J. Exp. Med. (1993)
[supra], Wahl et al. reported that antibody injected into a
joint before systemic administration of streptococcal
cell wall (SCW) resulted in a 75% decrease in joint
inflammation. Even if the antibody were injected about
two weeks after the SCW injection, at which time the
inflammation had become'chronic, there was still a
significant benefit. Likewise, Goddard et al. ((1990)
Cytokine _Z: 149-55) found that TGF-0 inhibited the growth
of cultured synovial cells, which was reversed by
administration of neutralizing antibodies.
TGF-0-specific antibodies also were injected
into the margins of healing dermal wounds in adult rats.
Control wounds (those with irrelevant antibody or TGF-0)
all had scarring, but the antibody-treated wounds healed
completely with normal strength but no scar formation.
Shah et al., (1992) The Lancet 339: 213-14.
WO 94/09815 PCT/US93/10JO
-4-
TGF-(3-specific antibody has also been found to
partially restore, at least in laboratory tests, the
defective T-cell responses due to excess TGF-0 production
such as in patients with acquired immune deficiency
syndrome (AIDS). (Kekow et al. (1990) Proc. Natl, Acad.
Sci. 87:8321).
In rat prostate cancer, TGF-01 is
overexpressed, compared to normal prostate tissue. it
appears that TGF-(31 enhances tumor growth by stimulating
tumor cells (Steiner and Barrack (1992) Mol. Endocrinol.
6:15-25). Steiner and Barrack tested the effect of anti-
TGF-/3 antibody on over-producing prostate cancer cells
which had stopped growing. The antibody caused the
prostate cancer cells to begin proliferating again. In
mouse prostate cancer, both TGF-01 and 3 were elevated
and were correlated with progression to malignancy and
may even promote carcinoma (Merz et al. (1991) Mol.
Endocrinol. 5:503-13).
Another way of suppressing TGF-a in
experimental glomerulonephritis in rats, which is
associated with TGF-01 excess, was a low-protein diet.
Both the excreted nitrogen and the expressed TGF-01
decreased. (Okuda et al. (1991) Proc. Natl. Acad. Sci.
U.S.A., 88:9765-69.)
In addition, TGF-0 has natural inhibitors,
including decorin and endoglin. Yamaguchi et al. ((1990)
Diature 34.6,:281-84) have proposed that decorin binds TGF-0
and provides negative regulation of the TGF-0 by
interfering with TGF-0 binding to a receptor. Decorin is
highly glycosylated and has a molecular weight of about
46 kd and an affinity for TGF-0 of about 10-8 to 10-9 M.
Endoglin also appears to bind TGF-0 with an
affinity constant of about 5 X 10-11 M. Endoglin also is
highly glycosylated and has a molecular weight of about
90 kd.
WO 94/09815 214 6 973 PCF/US93/10455
-5-
a
Previously, anti-TGF-0, decorin and endoglin
have been suggested as inhibitors of TGF-(3. However,
these three proteins share the undesirable feature of
high molecular weight (20-180 kd). Affinity constants
for the antibody and decorin are relatively low, ranging
from about 10-8 to 10-9 M. Moreover, administering
antibodies from other.species can cause cross-species
reactions.
An improved inhibitor would have a much lower
molecular weight and higher affinity. This combination
of features would permit much lower doses and increase
ease of administration. Moreover, a native protein
would not cause cross-species reactions.
Nine classes of TGF-/3 receptors have been
found. The main receptors on cells are Type I, Type II
and Type III. A soluble form of the Type III receptor
has been detected, and it binds TGF-0 similarly to the
membrane-bound Type III receptor (Andres et al. (1989) J.
Cell. Biol. 109:3137-45).
The human Type II receptor has been cloned and
codes for a protein of 563 amino acids (Lin et al. (1992)
Cell, 68: 775-85). This protein contains three discreet
domains: a 136-amino acid extracellular domain, a 30-
amino acid hydrophobic transmembrane domain, and a 376-
amino acid intracellular domain. The extracellular
region binds TGF-0. The Type II receptor has a very high
affinity for TGF-/3, on the order of about 10-11 to
10-12 M. Furthermore, the Type II receptor is a native
human protein, which should help avoid cross-species
reactions. And finally, the region which binds TGF-0 is
only about l00 amino acids long. Therefore, its
molecular weight is only a fraction of previously
suggested inhibitors.
Production of recombinant heterologous proteins
in prokaryotic host cells is essential to produce
CA 02146973 2004-03-25
-6-
commerciall.y feasible amounts of protein. Unfortunately,
bacterial host cells such as E. coli often are not ideal
or simply cannot be used to produce such proteins. This
is because the proteins, when over-expressed, form
refractile, insoluble "inclusion bodies and/or prove
lethal to the cells. Inclusion bodies are found in the
cytoplasm of the cell. Although.inclusion bodies can be
isolated from the cell by cell lysis and centrifugation,
subsequent purification of the proteins involves
dissolving the inclusion bodies and renaturing the
proteins. Renaturation is not always effective or
efficient. A variety of mechanisms have been sought to
overcome these problems. However, none of the methods
are ideal.
Purification of proteins produced in bacterial
host cells has also proven to be problematic. In many
cases, the proteins of interest, particularly when
incorporated into inclusion bodies, co-purify with
bacterial cell wall components which can be toxic.
Mamcnalian cells are sometimes preferred for
recombinant production because they can appropriately
glycosylate and properly fold proteins.
CA 02146973 2005-12-13
-6a-
Disclosure of the Invention
Various embodiments of this invention provide the
use of a high affinity type II TGF-0-binding receptor
fragment, wherein the fragment is amino acids 1-105 from the
extracellular portion of the binding receptor and is capable
of reducing excess TGF-0 activity in an individual, in the
manufacture of a medicament for treating an individual for a
medical condition associated with TGF-(3 excess.
Various embodiments of this invention provide the
use of a high affinity type II TGF-0-binding receptor
fragment that is amino acids 1-105 from the extracellular
portion of the binding receptor and is capable of reducing
an excess of TGF-0 in an individual, in the manufacture of a
medicament for treating a wound to avoid excessive
connective tissue formation associated with TGF-0 excess.
Various embodiments of this invention provide the
use of a high affinity type II TGF-(3-binding receptor
fragment that is amino acids 1-105 from the extracellular
portion of the binding receptor and and is capable of
preventing excessive fibrous tissue formation, in the
manufacture of a medicament for preventing postradiation
fibrosis in an individual undergoing or about to undergo
radiation therapy.
various embodiments of this invention provide the
use of a high affinity type II TGF-0-binding receptor
fragment that is amino acids 1-105 from the extracellular
portion of the binding receptor and is capable of increasing
the immune response to a vaccine in an individual, in the
manufacture of a medicament for increasing the effectiveness
of a vaccine in an individual about to receive or receiving
a vaccine.
CA 02146973 2005-12-13
-6b-
Various embodiments of this invention provide a
composition for treating an individual for a medical
condition associated with TGF-0 excess comprising a
physiologically compatible carrier and a high affinity type
II TGF-(3-binding receptor fragment, wherein the fragment is
amino acids 1-105 from the extracellular portion of the
binding receptor and is capable of reducing excess TGF-(3
activity in an individual.
Various embodiments of this invention provide a
composition for treating a wound to avoid excessive
connective tissue formation associated with TGF-i3 excess
comprising a physiologically compatible carrier and a high
affinity type II TGF-(3-binding receptor fragment, wherein
the fragment is amino acids 1-105 from the extracellular
portion of the binding receptor and is capable of reducing
excess TGF-(3 activity in an individual.
Various embodiments of this invention provide a
composition for preventing postradiation fibrosis in an
individual undergoing or about to undergo radiation therapy
comprising a physiologically compatible carrier and a high
affinity type II TGF-(3-binding receptor fragment, wherein
the fragment is amino acids 1-105 from the extracellular
portion of the binding receptor and is capable of reducing
excess TGF-(3 activity in an individual.
Various embodiments of this invention provide a
vaccine which contains a high affinity type II TGF-$
receptor fragment that is amino acids 1-105 from the
extracellular portion of the binding receptor.
in one embodiment, the invention provides a method
for treating an individual for a medical condition
associated with TGF-(3 excess. The method provides for the
parenteral, oral or local administration of a sufficient
CA 02146973 2005-12-13
-6c-
amount of TGF-0 binding receptor fragment to the individual
to reduce excess TGF-0 activity in the individual.
In another embodiment, the method of the present
invention provides for the administration of a fragment of
human recombinant TGF-0 receptor.
~'1 3 PCT/US93/10455
WO 94/09815 21i~696
-7'.~-
~ =
In yet another embodiment, the method of the
present invention provides for TGF-3 receptor fragment
administration by intravenous, intraocular,
intraarticular, transdermal and enteral methods.
In another embodiment, the method of the
present invention provides for the administration of the
Type II TGF-0 receptor. In another embodiment, the
administered protein is a fragment of Type II TGF-/3
receptor. In a further embodiment, the administered
protein is Type I TGF-0 receptor; in another embodiment,
the protein is a Type I TGF-J3 receptor fragment. In yet
another embodiment, Type III TGF-0 receptor fragment is
administered.
In another embodiment, the TGF-/3 receptor
fragment is administered to patients with cancer. In
further embodiments, the type of cancer is plasmacytoma,
glioblastoma, or prostatic or ovarian carcinoma.
In another embodiment of the present invention,
the TGF-0 receptor fragment is administered to patients
with collagen vascular diseases, such as systemic
sclerosis, polymyositis, scleroderma, dermatomyositis, or
systemic lupus erythematosus.
In another embodiment of the present invention,
the TGF-j3 receptor fragment is administered to patients
with fibroproliferative=disorders. In a further
embodiment, the TGF-0 receptor fragment is administered
to patients with hepatic, intraocular and pulmonary
fibrosis. In a further embodiment, the TGF-0 receptor
fragment is administered to patients with diabetic
nephropathy, glomerulonephritis, proliferative
vitreoretinopathy, rheumatoid arthritis, liver cirrhosis,
and biliary fibrosis.
In still another embodiment, the method of the
present invention provides for treating a wound in an
individual to avoid excessive connective tissue formation
WO 94/09815 PCT/US93/ 1041*
-S-
which is associated with TGF-/3 excess. The method
provides for administration of a sufficient amount of
TGF-0-binding receptor fragment to the individual to
reduce the excess of TGF-0 in the individual. In further
embodiments, the types of wounds include surgical
incisions, trauma-induced lacerations and wounds involving the peritoneum for
which the excessive
connective tissue formation is abdominal adhesions. In a
further embodiment, the excessive connective tissue
formations which are avoided include scars, including
those where the scar involves restenosis of blood
vessels, and hypertrophic scars, and keloids.
In another embodiment of the present invention,
the method provides for administration of TGF-0 receptor
fragment in the condition of TGF-fl excess characterized
by immunosuppression associated with an infectious
disease. In a further embodiment, the immunosuppression
may be associated with trypanosomal infection or viral
infections such as human immunosuppression virus, human
T cell lymphotropic virus (HTLV-1), lymphocytic
choriomeningitis virus and hepatitis.
In another embodiment, the invention provides a
method of increasing the effectiveness of a vaccine. In
this aspect, TGF-/3-binding receptor fragment is
administered to an individual about to receive a vaccine
or receiving a vaccine. The amount of TGF-0-binding
receptor fragment is sufficient to increase the
individual's immune response to the vaccine. In a
preferred embodiment, the vaccinated individual is
immunocompromised.
In another embodiment, the invention provides a
method of preventing postradiation fibrosis in an
individual undergoing or about to undergo radiation
therapy. TGF-0-binding receptor fragment is administered
WO 94/09815 - 214 697 3 P('I'/US93/10455
-9-
in =
an amount sufficient to prevent excessive fibrous
tissue formation.
Brief Description of the Drawings
Figure 1 is a photograph which illustrates
binding of biotinylated TGF-/32 to filter paper embedded
with Type II soluble TGF-0 receptor fragment (sfl-RII).
Figures 2A and 2B are photographs of
electrophoresis results showing that s/3-RII from E. coli
and COS cells, respectively, binds with specificity to
TGF-0 in solution.
Figures 3A and 3B show the reaction of antibody
specific for a fragment of the sfl-RII with E. coli
soluble and inclusion body fractions (Figure 3a) and with
COS supernatants (Figure 3b) transfected with control
vector (right lane) or sQ-RII vector (left lane).
Modes For Carrying Out the Invention
The following terms are used herein:
"Individual" means a living organism, including
humans, other mammals and any other animals which produce
TGF-0.
"TGF-fl" is a family of peptide growth factors,
including five members, numbered 1 through 5.
"TGF-fl excess" as used herein is an amount of
TGF-# present in serum or tissue which is significantly
above the normal level. More preferably, TGF-0 excess is
a level between about 2 and about 20 times normal. Even
more preferably, TGF-J3 excess is a level between about 2
and about 15 times normal. For example, Deguchi measured
24-hour TGF-fl production of bronchoalveolar cells and
reported normal levels of 410 225 pg/107 cells against
excess TGF-fl production of 1288 453 pg/107 cells in
CA 02146973 2004-03-25
-10-
systemic lupus.erythematosus and 1417 471 pg/107 cells
in scleroderma ((1992) Ann. Rheum. Dis. 5_1:362-65).
TGF-fl excess can be determined, in combination with
normal levels, by measurement of the TGF-0 protein, of
TGF-0 MRNA, or of products whose synthesis is stimulated
by TGF-0, such as collagen.
TGF-0 receptors are cell surface proteins, of
which three.(Type I, Type II and Type III) are known in
mammals.
TGF-# receptor Type II is a membrane-bound
protein with an intracellular domain, transmembrane
domain and extracellular portion which binds to TGF-0.
Human TGF-0 receptor Type II has been determined to have
the amino acid sequence shown in Lin et al., (1992) Cell
68:775, and corrected by personal communication as shown in
SEQ ID NO:1.
A TGF-0 receptor fragment is a portion or all
of a TGF-0 receptor molecule which is capable of binding
TGF-0. Preferably, this fragment has a high affinity for
TGF-0. Even more preferably, the TGF-0 receptor fragment
has a greater affinity for TGF-0 than does anti-TGF-/i
antibody or decorin.
s#-RII" refers to protein fragments of the
extracellular portion of the TGF-fl receptor Type II which
are soluble and bind with high affinity to TGF-ft.
Preferably, the affinity is in the range of about 10-11
to 10-12 M, although'the affinity may vary considerably
with fragments of different sizes, ranging from 10-7 to
10-13 M. These fragments are proteins consisting of
about 136 amino acids or less. Most preferably, ss-RII
is about 136 amino acids.
In another embodiment, sp-RII is about 10-110
amino acids in length and comprises the TGF-P binding
site. Preferably, the so-RII of this embodiment is a
protein of about 50-80 amino acids.
WO 94/09815 _ 2146973 PCT/US93/10455
-11-
If the entire native amino acid sequence of 136
amino acids is used, the amino acid sequence resembles
that of the entire extracellular portion of the Type II
receptor. When smaller so-RII fragments are employed,
they resemble various portions of the extracellular
portions of the Type II TGF-# receptor, so long as they
bind TGF-,6 with high affinity.
Although the sequence of s,6-RII is based on the
native TGF-0 receptor II extracellular fragment, the
definition of s/3-RII also comprises analogs of s/3-RII
which have high affinity for TGF-(3. Such analogs include
those made by conservative substitutions of amino acids,
as well as those made by mutated cells synthesizing s(3-
RII. Only analogs with high affinity for TGF-/3 are
included in this definition.
"Connective tissue" is fibrous tissue
characterized by the presence of fibroblasts and fibrous
proteins such as collagen and elastin.
A "therapeutic composition" as used herein is
defined as comprising sfl-RII and other physiologically
compatible ingredients. The therapeutic composition may
contain excipients such as water, minerals and carriers
such as protein.
"A sufficient amount of TGF-(3-binding receptor
fragment" as used herein refers to the amount of TGF-(3
receptor fragment that neutralizes the biologic activity
of excess TGF-Q. It may be determined by (1) suitable
clinical variables of improvement, (2) pathologic
evaluation of the effects on fibrosis and/or
immunosuppression or prevention of fibrosis, or (3) a
direct inhibition of TGF-0.
This invention provides for administering to an
individual with a medical condition associated with TGF-0
excess a sufficient amount of TGF-0-binding receptor
fragment, such as s(3-RII, to reduce excess TGF-0 activity
WO 94/09815 PCT/US93/1040
-12-
o
in the individual. The TGF-0-binding receptor fragment
is all or only a portion of a receptor which is capable
of binding TGF-0. sJ3-RII is made by synthesizing the
extracellular domain of the TGF-::/3 Type II receptor
(/3-RII) and developing a fragment of this (3-RII domain as
a high affinity, soluble binding protein (s(3-RII) for
TGF-0. This invention further provides for delivering
s/3-RII to a site where TGF-0 is in excess, such as in
disease states characterized by fibroproliferation and
immunosuppression such as is associated with infectious
disease.
The so-RII of the present invention may be
synthesized by means known in the art. The longer, 136-
amino acid version is preferably synthesized by
recombinant techniques which are known to those in the
art. Alternately, and preferably for shorter versions of
s/3-RII, so-RII also can be synthesized by solid-phase
synthetic methods known to those in the art.
While not wishing to be bound by any particular
theory, it appears that the so-RII regulates TGF-0
activity by competing for TGF-/3 with cell-surface
receptors. It is further believed that so-RII
inactivates TGF-0 by removing it from the free pool of
TGF-0 available to interact with cell surface receptors.
Depending on the pharmacologic properties of clearance,
the s(3-RII/TGF-0 complex is removed from the site of TGF-
0 excess. This complexing with excess TGF-0 reduces the
amount of free TGF-0. With less TGF-0 available to
complex with cell receptors, TGF-0 induced
fibroproliferation slows down, resulting in stasis of the
disease state.
The so-RII fragments of the present invention
may be used to treat viral infections in which there is
an overproduction of TGF-0 and immunosuppression.
Examples of viruses with which TGF-0 excess is associated
WO 94/09815 2146973 PCI'/US93/ 10455
-13-
include, but are not limited to, hepatitis C, lymphocytic
choriomeningitis, human immunodeficiency virus (HIV), and
human T cell lymphotropic virus (HTLV-1), the latter
being discussed in Kim et al. ((1991) Mol. Cell. Biol.
11-5222-28).
The so-RII fragment of the present invention
may be used to treat the trypanosome-mediated
immunosuppression. This may be caused by Trypanosoma
cruzi or Leishmania cruzi, among others.
Immunosuppression in Leishmania cruzi has been studied by
Barral-Netto et al., (1992) Science 257:545-48.
The so-RII of the present invention also may be
used to increase the efficacy of vaccines. Because TGF-0
may cause immunosuppression, the administration of s(3-RII
can counteract immunosuppression caused by TGF-0 and
increase the vaccine recipient's immune response to the
vaccine. s(3-RII should be particularly effective in
immunosuppressed patients. s/3-RII may be administered
before or concomitantly with the vaccine.
The so-RII fragments of the present invention
also may be used to treat forms of cancer which are
associated with excess TGF-0. It is also generally known
that TGF-fl is produced by different tumor cells (sarcomas
and carcinomas). Specific examples of tumors in which
TGF-0 production is excessive include glioblastoma (Wrann
et al. (1987) EMBO. J. 6: 1633-36; and Bodner et al.
(1989) J. Immunol. 143: 3222-29) and plasmacytoma (Berg
and Lynch, (1991) J. Immunol. 146: 2865-72). This TGF-0
production may protect the tumor cells from recognition
by the host's immune system, Wrann et al. (1987) EMBO. J.
6:1633. In these situations, TGF-/3 suppresses the
proliferation of T and B cells, NK cells, LAK cells, and
macrophages that are normally involved in tumor
destruction. The so-RII fragments of the present
invention also may be used to treat prostatic cancer.
WO 94/09815 PCT/US93/10J*
-14-
Merz et al.- ((1991) Mol. Endocrin. 5:503-13) reported
that elevated TGF-0 is correlated with progression of
prostatic hypertrophy to malignancy and to metastasis.
Steiner and Barrack have also reported that
overproduction of TGF-01 pro.static tumors produced more
extensive metastatic disease ((1992) Mol. Endocrin. 6:15-
25)). Therefore, early treatment with so-RII may help
abort progression to malignancy; and later treatment may
prevent metastasis.
The administration of s/3-RII fragments of the
present invention may be used in fibroproliferative
disorders. As mentioned above, animal models of
glomerulonephritis have shown good results with
anti-TGF-0 antibodies blocking excess TGF-8. These
antibodies will be difficult to deliver because they have
a high molecular weight and they may result in severe
allergic reactions when they are derived from other
species. Thus, it would be preferable to administer a
lower molecular weight, native protein or close analog,
such as s/3-RII, in glomerulonephritis. Kidney diseases
associated with TGF-0 excess include, but are not limited
to, mesangial proliferative glomerulonephritis,
crescentic glomerulonephritis, diabetic nephropathy,
renal interstitial fibrosis, renal fibrosis in transplant
patients receiving cyclosporin, and HIV-associated
nephropathy. These conditions are associated with
excessive fibrous tissue formation which administration
of sft-RII should suppress.
As sQ-RII by itself is not known to have an
effect aside from capturing TGF-/3, s(3-RII may safely be
administered during or at the end of retinal reattachment
surgery, which is the most common cause of proliferative
vitreoretinopathy (PVR) (Connor et al. (1989) J. Clin.
Invest. 83:1661-1666).
WO 94/09815 - 2146973 PCT/US93/10455
-15-
o
Another important fibroproliferative condition
is rheumatoid arthritis (RA), which is also associated
with excess TGF-0 production. Data indicate that
blocking TGF-0 at any time in the development or chronic
stages of RA may help stop the progressive deterioration
of the joint and bone. Hence, sQ-RII fragments of the
present invention may be administered to patients with
early joint pain and to patients with prolonged joint
pain and deteriorated joints. The current theory is that
joint deterioration in RA is due to an overproduction of
TGF-/3. Excess TGF-f3 has been measured in joints after
test animals are injected with streptococcal cell walls,
whose presence is believed to cause R.A. Because anti-
TGF-a antibody blocks arthritic changes in this model, it
is believed that so-RII may also have a positive effect.
Work in an animal model suggests that chronic
liver cirrhosis which is characterized by excess collagen
deposition, could be mediated by TGF-0. (Czaja et al.
(1989) J. Cell. Biol., 108: 2477-82; and Hoyt et al.
(1988) J. Pharm. Exp. Ther. 246: 765). In patients with
chronic hepatitis and cirrhosis, the levels of TGF-01
MRNA were 2-14 times higher and correlated with higher
measurements of serum procollagen than were observed in
patients with normal or fatty livers. Six of eight
patients with hepatitis-C were treated with alpha-
interferon for one year and had sustained clinical
improvement and normalization of serum procollagen
activity. These treated patients also had normal levels
of TGF-01 mRNA in liver biopsy specimens taken at the end
of one year, further supporting the role of TGF-/3 in
liver fibrosis (Castilla et al. (1991) N. Engl. J. Med.
= 324:933-40).
Cirrhosis of the liver is a widespread
condition which is associated with an abnormally high
degree of fibrous tissue in the liver and frequently with
WO94/09815 2146973 PCT/US93/10
-16-
6
high levels.of TGF-3. Cirrhosis is the end product of
the liver's reaction to many types of injury, including
alcohol abuse, exposure to other chemicals, infections
(such as hepatitis), intestinal bypass operations and
5 others. In cirrhosis, normal hepatocytes, which produce
fibrous blood proteins and clear toxins from the blood,
have been replaced by fibrous tissue. In many instances,
TGF-0 is in excess. In such instances, the so-RII
fragment of the present invention may be used to treat
10 cirrhosis.
so-RII fragments also may be used to treat
biliary cirrhosis, a condition in which the bile ducts
become scarred and interfere with the gall bladder
emptying its enzymes and digestive juices into the small
15 intestine and hence with the digestion of fats. so-RII
fragments also may be of assistance in treating this
condition when it is associated with excess TGF-(3.
Other conditions associated with excess TGF-0
levels include idiopathic pulmonary fibrosis and
20 myelofibrosis. To complex with excess TGF-0 and to slow
the development of excess fibrous tissue, so-RII is
intended for administration in these conditions.
The so-RII fragments of the present invention
may be used to treat collagen vascular diseases that are
25 associated with overproduction of TGF-0. It is currently
believed that there is an overproduction of TGF-# in
collagen vascular diseases, such as progressive systemic
sclerosis (PSS), polymyositis, scieroderma,
dermatomyositis, eosinophilic fascitis, and morphea.
30 Collagen vascular diseases may also be associated with
the occurrence of Raynaud's syndrome. Among other
effects, excess TGF-0 production may also be involved in
interstitial pulmonary fibrosis, an end-stage lung
disease which is associated with autoimmune diseases such
35 as systemic lupus erythematosus (SLE) and scleroderma
WO 94/09815 214 6973 PCT/US93/10455
-17-
0
(Deguchi, (1992) Ann. Rheum. Dis. 51:362-65); or it may
be caused by chemical contact, allergies to dust and hay
fever. A therapeutically effective amount of the s~-RII
of this invention may be administered to neutralize the
biologic activity of excess TGF-0, which in turn would
prevent unwanted fibrosis.
so-RII fragments of the present invention also
may be used in preventing excessive scarring in patients
who are known to form keloids or hypertrophic scars. s(3-
RII may be administered to prevent scarring or excessive
scarring during healing of various types of wounds
including surgical incisions and traumatic lacerations.
s,6-RII may be applied to skin wounds before they are
closed to help in healing without scar formation. s/3-RII
also may be placed in surgical abdominal wounds to help
prevent adhesion formation which occurs all too commonly
after that type of surgery. Williams et al. ((1992) J.
Surg. Res. 52:65-70) recently reported that TGF-S was
more effective in promoting postoperative peritoneal
adhesions than a control of diluent. Intraperitoneal
injections of TGF-0 for five days did not induce
adhesions in unoperated rats. Williams et al. proposed
that preventing TGF-0 production postoperatively might
help prevent adhesion formation. Rather than preventing
TGF-(3 production, which could have systemic side effects,
the present invention provides for the local
administration of sufficient SO-RII to complex with local
TGF-(3 overproduction and prevent excessive healing
processes.
According to Lindholm et al., ((1992) J. Cell.
Biol. 117:395-400), TGF-01 is a strong inhibitor of
astrocyte proliferation and may thus interfere with nerve
regeneration. Because so-RII complexes with TGF-0, sQ-
RII may encourage nerve regeneration. In deeper wounds
WO 94/09815 PCT/US93/10*
-18-
~+~~ ~~~ where nerves are cut, the application of s/3-RII also can
help nerve regeneration.
TGF-0 excess also has been reported in nasal
polyposis, a condition characterized by multiple polyps
(Ohno et al. (1992) J. Clin. Invest. $9: 1662-68). s(3-
RII can help lower the TGF-0 excess and slow the
hyperproliferation that results in polyps. s(3-RII can be
administered after polyp surgery to prevent excessive
scarring and recurrence of polyps. so-RII can also be
administered to inhibit polyp formation in the intestine.
s(3-RII may also be administered following
coronary angioplasty, preferably placed along the inside
of the affected arteries. According to Karas et al.,
((1991) Clin. Cardiol. 14:791-801) restenosis or scarring
and reclosing of arteries following coronary angioplasty
is seen in approximately one-third of patients operated
on. Because the fibrous network which ultimately
develops into a scar normally accumulates rapidly, early
administration of s(.i-RII would reduce excess TGF-0 in
this area and slow excessive proliferation of connective
tissue and restenosis.
TGF-0 excess has also been observed in cardiac
fibrosis after infarction and in hypertensive
vasculopathy. To aid in proper healing without excess
scar or fibrous tissue formation, so-RII can be
administered in these conditions.
TGF-0 excess also has been observed in the
tissues of patients receiving radiation therapy. Such
tissue is characterized by excess connective tissue
development, epithelial thinning and blood vessel
occlusion associated with overgrowth of endothelial
cells. Administration of so-RII will complex with the
excess TGF-/3 and will contribute to healing without
excessive fibrosis.
WO 94/09815 2146973 PCT/US93/10455
-19-
~
Formulation= Administration and Dosaae
The formulation, method of administration and
dosage s/3-RII will depend upon the disorder to be
treated, and the medical history of the patient. These
factors are readily determinable in the course of
therapy. Suitable patients with conditions caused by an
excess of TGF-0 can be identified by laboratory tests,
medical history and physical findings. TGF-Q excess can
be determined directly by immunoassay (Example 6 below)
of the patient's serum or of the affected tissue. Excess
TGF-fl can also be determined by bioassays such as the
cell proliferation assay described in Kekow et al.,
(1990) Proc. Natl. Acad. Sci. U.S.A. 87: 8321-25. Excess
TGF-fl also can be determined indirectly by measuring the
level of TGF-fl mRNA (for example, in the polymerase chain
reaction of Kekow et al.).
The medical history may reveal facts which
support a diagnosis of fibroproliferative disorder,
collagen vascular disease, immunosuppression, or of
potential for problematic wound healing, as in peritoneal
adhesions following surgery, or restenosis of blood
vessels after coronary angioplasty. Conditions which are
identified as being associated with high levels of TGF-0
and/or proliferation of fibrous tissue are considered to
cause TGF-Q excess. =
Patients may have a wide spectrum of physical
findings which are indicative of such disorders. Skin
biopsies have been used to test TGF-3 in patients with
systemic sclerosis. Swollen, hot joints are seen in
arthritis.
In accordance with the method of the present
invention, the formulation comprises s/3-RII in an
administrable form. The method of the present invention
provides for formulating so-RII in modes which are
readily apparent to those skilled in the art.
WO 94/09815 PCT/US93/1040
-20-
~
Preferably,-the so-RII is dissolved in physiologically
compatible carriers.
Physiologically compatible carriers for so-RII
include intravenous solutions, such as normal saline,
serum albumin, 501 dextrose, plasma preparations, other
protein-containing solutions and TPN solutions. The
preferred carrier for parenteral administration of so-RII
is a sterile, isotonic aqueous solution, such as saline
or 5s dextrose. Even more preferred is normal saline
with human serum albumin. For use in enhancing the
immune response to vaccines, so-RII may be mixed with the
vaccine formulation.
Depending on the mode of administration, the
so-RII composition may be in the form of liquid or semi-
solid dosage preparations, such as for example, liquids,
suspensions or the like. Alternatively, a solution of
so-RII may be placed into an implant, such as an osmotic
pump, for the slow release of so-RII over an extended
period of time. Alternatively, so-RII may be provided in
sustained release carrier formulations such as semi-
permeable polymer carriers in the form of suppositories
or microcapsules. See, for instance, U.S. Patent No.
3,773,919 for Microcapsular Sustained Release Matrices
Including Polylactides; Sidmon et al., Biopolymers 22
(1), 547-556 (1983) for copolymers of L-glutamic acid and
ry-ethyl-L-glutamate; Langer et al., J. Biomed. Res. 2a,
167-277 (1981) for poly(2-hydroxyethylmethacrylate) or
the like. Finally, receptor fragmentation and
modifications, such as fusion of the so-RII fragment with
human immunoglobulin (IgG) or with polyethylene glycol
(PEG) so as to extend the half life of the so-RII
fragment, are other alternative forms of administration.
The mode of administration delivers so-RII to
the individual in a safe, physiologically effective
manner. sa-RII may be given by intraocular, intranasal,
WO 94/09815 - 2146973 PCT/US93/10455
-21-
subcutaneous, =
intravenous, intramuscular, intradermal,
intraperitoneal, intraarticular, enteral or other
conventional routes of administration.
In a preferred embodiment, the so-RII of the
invention is administered locally to the affected tissue
sites by bolus injection or perfusion. For example, for
PVR, the preferred mode of administration is a single
intraocular injection. Local administration is also
preferred in peritoneal wounds to avoid adhesion
formation and in other wounds to encourage healing with
no keloids or visible scars. For nasal polyposis, nasal
drops are preferred.
Local and systemic administration are equally
preferred in lung fibrosis (parenteral injection or nasal
spray or drops) and cancer. In early, localized tumors,
localized administration may be preferred. In later
tumor stages, where cancer cells may have metastasized,
parenteral administration may be preferred, alone or in
combination with local injection. RA can be treated by
intraarticular or systemic administration.
Systemic administration is the preferred mode
of administration in glomerulonephritis, liver cirrhosis,
immunosuppressive conditions (such as viral infections,
AIDS and trypanosomal infections), and in widespread skin
diseases (such as progressive systemic sclerosis, diffuse
fascitis, and generalized morphea). Systemic
administration also is preferred when s/3-RII is used to
enhance vaccine response. so-RII can be administered
with the vaccine by subcutaneous, intramuscular or
intradermal injection.
The dose of sj3-RII to be administered can be
readily determined by those skilled in the art, based on
the usual patient symptoms discussed above. The dosage
of s(3-RII to be given in a bolus injection is preferred
to be between 20 ng and 300 mg. The bolus injection may
WO 94/09815 PCT/US93/10440
-22-
be repeated over several days, or the so-RII can be
continuously infused. If given as an intravenous
infusion, the amount of so-RII to be infused over a 24-
hour period is about 1 mg -to about 100 mg.
The amount of so-RII to administer may also be
determined by maintaining the local tissue concentration
of TGF-0 at a subnormal level, or about 1-1,000 Ecg/ml.
For tumors, the amount administered is preferably about
20 ng to 300 mg so-RII per gram tumor tissue.
Preferably, so-RII is applied topically,
injected at the site of the problem or injected
intravenously. Most preferably, s(3-RII is administered
by bolus injection at the site where TGF-j3 is to be
controlled. By intravenous injection, so-RII should be
administered at a rate to maintain a circulating serum
concentration sufficient to reduce the TGF-0 excess.
Preferably, the patient is started with a
relatively low dose of s(3-RII. The low dose preferably
should be continued until the patient's acute phase is
ameliorated or adequately improved, as indicated
appropriate physical findings and laboratory results.
Such improvement may be evident in two to three weeks.
In the absence of significant improvement, the dose of
so-RII should be increased.
For patients to be vaccinated, the dose of sfl-
RII is preferably between 20 ng and 300 mg. Preferably,
more sJ3-RII is given to immunocompromised vaccinated
patients. sQ-RII can be administered a short time before
the vaccine, to permit so-RII to complex with TGF-0 prior
to vaccination. Or so-RII can be administered
simultaneously with the vaccine.
The invention has been disclosed by direct
description. The following examples show that the so-RII
binding protein fragment can treat conditions
WO 94/09815 - 2146,973 PCT/US93/10455
-23-
characterized by an excess of TGF-0; however, these
examples should not be taken in any way as limiting the
scope of the method.
10
20
30
~
WO 94/09815 c~116173 PCI'/US93/104,#
~+ -24-
0
- EXAMPLES
Example 1
s(.3-RII was expressed in E. coli as a 15 kd
protein of 136 amino,acids with no carbohydrate. Those
skilled in the art are familiar with cloning genes in the
fashion detailed in Lin et al. ((1992) Ce l68_: 775-785)
Lin et al. also disclose the complete amino acid and
nucleotide sequences.
The expression vectors used in this work were
prepared from pET3b supplied by W. Studier. A new
vector, pETX, was prepared and differs from pET3b in that
it contains a modified oligonucleotide linker downstream
of the unique BamHI site in the vector, having the
sequence 5'...GGATCCCGTGGAGGATTAAACCATGGATGGATGCATAAGCTT
CGAATTC...3' (SEQ ID NO:2).
In addition, the restriction fragment between
the unique EcoRI site and the EcoRV site downstream of
the terminator was deleted so that both restriction sites
were destroyed.
The pDJ12833 vector backbone was derived from
pETX by reconstituting the tetracycline resistance gene
and inserting a 385 bp fragment carrying the par locus of
pSC101 (according to the method of Meacock and Cohen,
(1980), Cell 20: 529-42) into the unique PvuII site of
pBR322 backbone present in pET3b, the parent vector.
pER10088 is similar to pDJ12833 but does not carry the
par locus. Both vectors contain, in addition, the
translational coupler described in Squires, et al. (1988)
J. Biol. Chem. 263:16297-302.
The DNA encoding the extracellular domain of
the type II receptor was subcloned after PCR
amplification of the 136 codons of that domain from a
pre-existing cDNA clone, pH2-3FF (obtained from MIT).
The oligonucleotides used in the amplification were
CA 02146973 2004-03-25
-25-
5'...GGGGATCCGATAGTGGAGGATGATTAAATGATCCCACCGCACGTTCAGAAGT
...3' (5' oligo) (SEQ ID NO:3); and
5'GGGGAATTCAAGCTTAGTCAGGATTGCTGGTGT TATATTCTTCTGA...3'
(3' oligo) (SEQ ID NO:4). Amplification was for 40
cycles with annealing at 55 C. The single major product
of this amplification was purified using the Mermaic#m Kit
from Bio 101 (La Jolla, CA) and digested with BamHI and
EcoRI, gel purified and ligated to pETX vector digested
with the same enzymes + calf alkaline phosphatase. After
transformation of JM109, the structure of a single
recombinant plasmid (pDJ16902) was confirmed by DNA
sequencing.
pDJ16919 was constructed by transferring the
expression cassette from pDJ16902 into the backbone of
expression plasmid pDJ12833.
The so-RII protein was obtained by growing
E. coli strain W3110 DE3 containing pDJ16919 at 37 C in a
Biostat~m E fermentor' (manufactured by Braun) and inducing
s/3-RII synthesis. The cell paste was collected and
stored at -80 C until ready for use.
An aliquot of paste was suspended in 0.1 M Tris
pH 8.0, 5 mM EDTA, 1 mM PMSF. Lysozyme was added to a
final concentration of 0.2 mg/ml and the sample incubated
at 4 C for approximately 30 min. The sample was
sonicated with 3-60 sec pulses on ice on a Branson 250
Sonifier and centrifuged at 10,000 rpm on a Sorvall
(Wilmington, DE) centrifuge. The pellet was collected,
and this fraction is known as the "inclusion body
fraction".
The inclusion body fraction was solubilized in
6 M guanidine HC1 and dialyzed against 10 mM HC1. The
dialyzate was neutralized with 1M NaOH and
chromatographed on a Q-SepharoseFK column (Pharmacia,
Piscataway, NJ). The bound material was eluted with a
salt gradient (0-0.5 M sodium chloride) in 0.1 M Tris pH
CA 02146973 2004-03-25
-26-
.7.5 and the fractions were.analyzed on 18% SDS-PAGE with
Coomassie blue stain. The bulk of the ss-RII appeared in
fractions 5-15 and was pooled for analysis or further
purification.
The s/3-RII protein prepared in this example was
found to bind TGF-# when sp-RII was bound to a
hydrophobic support, as discussed in Example 2, and in
solution as discussed in Example 3.
Example 2
s/3-RII had been previously solubilized.from
inclusion bodies in 6M guanidium hydrochloride with 25mM
dithiothreitol. The sample was diluted five fold and
split into two fractions. The "control" sample was left
untreated. The "S#-RII" sample was brought.to a final
concentration of 5mM cystamine and incubated overnight at
4 C. Both samples were dialyzed against O.1M Tris,
concentrated, and applied to a membrane for a ligand
blotting assay as follows. First, ImmobilonPl P membrane
(Millipore Corp., Bedford MA) was soaked in methanol for
five seconds and then in tris-buffered saline (50 mM
Tris, pH 7.5, 0.2 NaCI)(TBS) for one to ten minutes.
Meanwhile, the dot-blot apparatus (Gibco-BRL,
Gaithersburg, MD) was set up and the membrane inserted on
top of a sheet of 3NIlP paper (Whatman International, Ltd.,
Maidstone, UK) wetted with TBS. This assembly was
tightened.
Fifty l TBS was placed in each well. Next,
samples of SPRII and control were added in any volume up
to 200 l and vacuum filtered very slowlv for about 5-15
minutes.
The assembly was disassembled, the filter was
marked and blocked in TBS with 5t dried milk overnight at
4 C. It is important to start with a fresh TBS-milk
CA 02146973 2004-03-25
-27-
suspension. Alternately, the filter could also be
blocked for one hour at room temperature.
One blot was incubated with 50 pM biotinylated
TGF-02 (1.25 ng/ml) alone while the other blot was
incubated with 50 pM biotinylated TGF-02 and 50 nM TGF-
02(+) as a competing ligand for 1.5 hours at 37 C. Next
the filter was washed three times, 10 minutes each with
TBS/0.05% Tween 2021. Next streptavidin-HRP (Zymed
Laboratories, Inc., South San Francisco CA) was added at
a dilution of 1:1000 in TBS/5t milk/0.05% Tween 20. This
was incubated at room temperature for 30 minutes. The
filter was washed three times, 10 minutes each with
TBS/0.05o Tween 20.
The filter was moved to a new dish. It was
overlaid with about 6 ml of a 1:1 mixture of ECL reagents
(Amersham Corp., Arlington Heights, IL) and incubated for
one minute.
The filter paper was blotted on a paper towel
and was placed in a plastic bag and sealed. The filter
was exposed to film (XAR-55m, Eastman Kodak, Rochester, NY)
for one to 45 minutes.
The results of the so-RII fragment binding to
biotinylated TGF-02 bound to filter paper are shown in
Figure 1.
Example 3
This example demonstrates that sfl-RII binds
with TGF-0 in solution. Q-Sepharose bound material (804
ug/ml) was incubated overnight at 4 C with 50 pM 125I-
TGF-01 without (-) or with (+) 40 nM unlabeled TGF-ft1.
The complexes were cross-linked at 4 C for 15 min with
0.3 mM disuccinimidyl suberate and electrophoresed under
reduced conditions on 18t SDS-PAGE. The gel was dried
and complexes were visualized by autoradiography. Figure
2A is a photograph of these results. Molecular size
CA 02146973 2004-03-25
-28-
standards are indicated at the left in kilodaltons. The
indicates monomeric TGF-01; the "**" indicates
dimeric TGF-01; the indicates the appropriate size
complex at approximately 31 kD (monomer of TGF-fl cross-
linked to sfl-RII).
Example 4
Plasmid H2-3FF containing a 4.5 kb cDNA
fragment of the human TGF-Q type II receptor (Lin et al.,
(1992) Cell, 68:775-85) was cloned into the EcoRI site of
TGF-0 plasmid pcDNAI was digested with EcoRI. The 4.5 kb
cDNA fragment was isolated and subcloned into the EcoRI
site of plasmid BlueScriptFK SKII+. The plasmid obtained.
from this subcloning experiment was named BS/ORII RI.
This plasmid was used to transform E. coli.strain CJ236
to obtain single-stranded DNA containing uracil residues
(UssDNA). Single-stranded uracil-containing DNA was
isolated by infecting CJ236 cells containing plasmid
BS/ORII RI with helper phage VCS-M13 and subsequent
kanamycin selection. The UssDNA obtained from these
cultures was to be used as a template for site-directed
mutagenesis experiments.
An oligonucleotide was synthesized with the
antisense sequence of the TGF-ft type II receptor from
nucleotides 553-583 (nucleotides are numbered according
to Lin et al., 1992) with the exception of the codon for
Asnlo6 which was changed such that a stop codon would be
inserted. The sequence of the oligonucleotide used to
create this mutation is
5'-TAGCAACAAGTCAGGTTAGCTGGTGTTATAZTC-3' (SEQ ID NO:5).
This primer in combination with the UssDNA described
above was used to carry out an in vitro mutagenesis
experiment (Kunkel et al., (1985) Proc. Natl. Acad. Sci.
USA _U:488-492). Clones containing the desired mutation
were identified by nucleotide sequencing. A clone
CA 02146973 2004-03-25
-29-
containing a stop codon in place of Asn106 was named
BS /,BRI Is .
BS/ORIIs plasmid DNA was purified and digested
with EcoRI and BgIII to isolate a 1177 base pair fragment
comprising the 5' untranslated sequence and sequences for
the extracellular domain (ECD) of the receptor and a
portion of the transmembrane domain containing the stop
codon created by site-directed mutagenesis. This 1177
base pair EcoRI-BgIII fragment was subcloned into the
EcoRI-BgIII site of plasmid pSGS'm (Stratagene). This
plasmid allows expression of heterologous genes in
mammalian cells utilizing a SV40 early promoter and SV40
splice and polyadenylation signals. The plasmid created
by this subcloning experiment was called pSG/QRIIs.
Example 5
COS-M6 cells were maintained in DMEM high
glucose media supplemented with 10% fetal bovine serum
and antibiotics. COS-M6 cells were transiently
transfected using the DEAE-dextran method as described by
Seed et al. (1987) Proc. NatZ. Acad. Sci. USA QA:3365-
3369. Briefly, plasmids pSG/ftRIIs or pSGS (negative
control) were complexed with DEAE-dextran and added to
the cultures for 2 hours. Following this incubation, the
cells were glycerol shocked, washed and then allowed to
recover for 32 hours. The cultures were then washed
three times with serum-free media and allowed to grow for
an additional 72 hours in serum-free media. The media
were collected, the cell debris was removed by
centrifugation and then analyzed for the presence of
soluble TGF-Q type II receptor expression.
Example'6
Initially the soluble type II receptor protein
(s#-RII) was detected by visualization on a Western blot.
WO 94/09815 PCT/IJS93/1046
-30-
Supernatants were electrophoresed under reducing
conditions on SDS-PAGE and blotted (Towbin et al., (1979)
Proc. Natl. Acad. Sci. USA 76:43~5_0-4354). Polyclonal
rabbit antisera prepared against a peptide (residues 68-
89) were incubated with the blot and the immunoreactive
proteins were visualized after developing with an
alkaline phosphatase conjugated anti-rabbit IgG and Nitro
blue tetrazolium (Figures 3A and 3B). See Example 10 for
more detail on the antisera preparation. The peptide
antisera detect a single protein from E. coli (Fig. 3A)
and a heterogeneous set of proteins ranging in size from
24-32 kDa from COS cells (Fig. 3B). Binding of
radiolabeled TGF-a to proteins expressed by transfected
COS-M6 cells was performed essentially as described
previously (Segarini et al. (1989) Mol. Endocrinol.
3:261-272).
Briefly, purified TGF-0 was radiolabeled with
Na125I and incubated with aliquots of the conditioned
media from cells transfected with either plasmid
pSG/(3RIIs or pSG5 as a negative control. Following
affinity labeling, TGF-0/soluble receptor complexes were
covalently crosslinked with disuccinimidyl suberate,
separated by reducing SDS-PAGE and visualized by
autoradiography. Included in some of the binding
reactions was a 1000-fold molar excess of unlabeled TGF-0
to compete.for binding with radiolabeled material.
Fig. 2B is the result of such a binding experiment
demonstrating the presence of an affinity labeled protein
of approximately 40 kda that was not present in vector-
only transfected cells. Binding of radiolabeled TGF-01
could be effectively blocked by including a 1000-fold
molar excess of unlabeled TGF-/31 (Fig. 2B), lane labeled
pSG/(3RIIs+) but not TGF-02 (data not shown) in the
binding reaction mixture.
WO 94/09815 PCT/US93/10455
_ 214 6,973
31-
o =
Example 7
The effect of s/3-RII is compared with that of
anti-TGF antibody in a glomerulonephritis model.
Experimental glomerulonephritis can be induced in rats
with a single injection of antithymocyte serum because
the glomerular mesangial cells express a thy-1.1 epitope
on their surfaces. The experimental lesion is acute
mesangial proliferative glomerulonephritis and is
characterized by expansion of the mesangial matrix and
hypercellularity. The injured cells also express more
TGF-01 mRNA and TGF-01, which in turn stimulates the
synthesis of two proteoglycans, biglycan and decorin.
The antiserum is prepared by immunizing a
rabbit with a cyclized, synthetic peptide containing
residues 78-109 of human TGF-01. The anti-TGF-01
antiserum is capable of inhibiting binding of TGF-0 to
cells. (Flanders et al. (1988) Biochemistry 27:739-46)
First, glomerulonephritis is induced in rats by
an intravenous injection of antithymocyte serum. Next,
for six days, three groups of rats are treated with daily
intravenous injections of saline (the negative control
group), anti-TGF-/31 antiserum (the positive control
group) or sQ-RII.
On the seventh day, the animals are sacrificed
and slides are made of the kidneys, which are stained
with periodic acid-Schiff solution to emphasize the
pathological changes. The negative control kidneys have
full-blown glomerulonephritis with reddish-pink amorphous
fibrous material filling most of the glomerulus. The
positive control kidneys have a staining pattern which is
similar to a normal glomerulus. The kidney which is
treated with so-RII also has a normal appearance,
indicating that the so-RII blocks the response due to the
secretion of excessive TGF-0.
CA 02146973 2004-03-25
-32-
The extent of glomerular injury can be
quantitated by performing glomerular cell counts from 30
randomly selected glomeruli from normal animals and
nephritic animals in each group. On day 4, there are
fewer cells in glomeruli from antithymocyte-treated rats,
presumably because the treatment causes cell lysis. By
day 7, there are more cells than normal. The changes in
cell counts in the anti-TGF-01 and so-RII group are
expected to be the same.
Another measure of the effect of anti-TGF-01
and sfl-RII on the disease process is to quantitate the
amount of extracellular matrix accumulation in the
glomeruli. The degree of glomerular matrix expansion is
determined as the percentage of each glomerulus occupied
by the mesangial matrix according to the method of Raij
et al. (1984) Kidney Int..a: 137-43. The anti-TGF-01
and sfl-RII kidneys are expected to have similar'
percentages of mesangial matrix to that in normal kidney,
and significantly less mesangial matrix than in the
negative control kidneys.
After glomerular injury and simultaneous
treatment with anti-TGF-ft, the mesangial cells expressed
more TGF-fl1 mRNA; however, proteoglycan synthesis is
nearly normal with anti-TGF-01 and sft-RII.
Example 8
The following compares the action of TGF-0
antibody with s$-RII in an arthritis model. TGF-#
antibody is prepared as disclosed in U.S. Patent 5571714,
which discloses the formation of monoclonal antibodies
3C7.14 specific for TGF-1i2 and TGF-B3 and 1D11.16 specific
for TGF-Lil, -B2 and -B3.
First, arthritis is induced in pathogen-free
female LEW rats (Harlan Sprague Dawley, Indianapolis, IN)
~ WO 94/09815 2146973 PCT/ US93/ 10455
-33-
9
weighing about 100 grams. Each receives a dose of cell
wall fragments from Group A streptococci (SCW) (30 g
rhamnose/gm body weight), injected intraperitoneally (ip)
according to the technique described in Brandes et al.
(1991) J. Clin. Invest. 87:1108.
SCW-injected and control LEW rats are given an
intraarticular (IA) injection in one of the hind ankles
of one of the following:
1. anti-TGF-# (1D11.16) which is specific for
TGF-al and TGF-01 in 25 l PBS,
2. sQ-RII in 25 l PBS,
3. PBS only, or
4. an irrelevant isotype control mouse
myeloma immunoglobulin (MOPC21, IgGl)
Joints are clinically monitored by determining
the amount of joint erythema, swelling and distortion on
a scale of 0 (normal) to 4 (severe inflammation).
Radiographs are taken and are evaluated for soft tissue
swelling, joint space narrowing, bone erosions and
deformity. Tissue specimens are obtained and prepared
for histopathologic analysis as described in Brandes et
al., ibid. Total RNA is isolated from excised synovial
tissues according to the method of Allen et al. (1990) J.
Exp. Med. 171=231.
Injection of SCW produces an acute inflammatory
response which is clinically detectable within hours and
maximal in 3-5 days. When anti-TGF-Q is injected
directly into a joint before ip administration of the
SCW, inflammation at 24 hours is significantly below that
observed in joints with the irrelevant antibody. At the
peak of the acute response, inflammation of anti-TGF-0
joints remains far below that of joints with the
irrelevant antibody. Even if joints are injected with
anti-TGF-fl when inflammation is well developed (day 13),
anti-TGF-0 still has a significant anti-inflammatory
WO 94/09815 PCT/US93/104(o
-34-
a
effect,,when compared to irrelevant antibody. Because
so-RII also binds TGF-0, so-RII has a similarly
beneficial effect when given early or late in the
inflammatory process.
Examp 1 e 9
To simulate acute liver injury, the
hepatotoxin, D-galactosamine, is administered to cause
liver fibrosis, mortality, and maximal TGF-0 gene
expression approximately 48 hours after administration.
A rat model utilizing this hepatotoxin is used to
evaluate the therapeutic effect of so-RII on acute liver
fibrosis and serves as a model for liver cirrhosis.
Sprague-Dawley rats are administered 1.6 g/kg
D-galactosamine intraperitoneally. Half of the rats are
also to be given so-RII two hours prior to
D-galactosamine administration, and at 24, 48, and 72
hours after D-galactosamine administration. Two rats
from each test group are sacrificed at 48 hours to
evaluate the efficacy of s/3-RII at peak TGF-0 gene
expression.
Histological examination reveals that so-RII-
treated animals exhibit reduced liver pathology.
Northern blot evaluation of tissues from specimens
treated with so-RII show significantly decreased levels
of collagen mRNA and almost normal levels of serum
albumin, in contrast to non-treated controls.
Example 10
Polyclonal antibodies to the carboxy-terminal
region of so-RII have been prepared and tested. Linear
or cyclic peptides of amino acids 68-89 were injected
once per month (in one case a month was skipped) at a
concentration of 4 mg/ml in phosphate buffered saline
with 200 l per injection in complete Freund's adjuvant
_ 214fi973
WO 94/09815 PCT/US93/10455
-35-
(first injection) or incomplete Freund's adjuvant
(succeeding boosts). Bleeds were collected during the
second, fourth, fifth, sixth, and seventh months after
the initial boost.
Soluble and inclusion body fractions from
E. coli, and supernatant fractions from sJ3-RII and
vector-transfected COS cells were electrophoresed under
reducing conditions on SDS-PAGE. The E. coli fractions
were prepared in duplicate. The proteins were
electrotransferred to Immobilon P filters (Millipore,
Bedford MA). Next, the E. coli filters were blocked with
super-Blotto (2.5~k nonfat dry milk in Tris buffered
saline (TBS), 10g (v,v) glycerol, 1M glucose, 0.5t Tween
20). The COS filters were blocked with standard Blotto
(5%- nonfat dry milk in Tris buffered saline). Then all
filters were reacted with 10 g/ml of rabbit antiserum.
One half of the duplicate E. coli filters was incubated
with nonimmune rabbit antiserum as a control. The blots
were washed with TBS, containing 0.05%- Tween 20 (T-TBS),
and reacted with a secondary antibody, goat anti-rabbit
IgG horseradish peroxidase (HRP) diluted 1:50,000, and
incubated for one hour. The blot was washed with T-TBS
and reacted with a membrane TMB kit for Kirkegaard and
Perry according to package directions.
Figure 3A shows E. coli soluble and inclusion
body fractions reacted with peptide antiserum (left lane)
or with control rabbit antisera (right lane). Figure 3B
shows COS supernatants from cells transfected with
control vector (right lane) or s(3-RII vector (left lane).
sj3-RII produced in COS cells is glycosylated and appears
as heterogeneous bands.
In both E. coli and COS systems, a soluble
receptor was produced and included an amino acid sequence
that is recognized by antisera induced by linear and/or
cyclic peptides of amino acids 68-89 of the extracellular
WO 94/09815 -36- PCT/US93/100
domain of .the type II TGF-3 receptor. Control nonimmune
rabbit antiserum did not reCognize the type II receptor.
Vector-transfected COS csils did not produce a protein
that is reactive with the antisera.
COS cells were transfected with the pSG/ORII
vector or with a control vector (pSG5). After 72 hours,
the two supernatants were collected, incubated with 50 pM
125I-TGF-01 without (-) or with (+) 40 nM unlabeled TGF-
01. The samples were crosslinked with 0.3mM
disuccinimidyl suberate (DSS) (Pierce Chemical Co.,
Rockford IL) and electrophoresed on SDS-PAGE under
reducing conditions. The gels were dried and exposed for
autoradiography, with the result shown in Figure 2B.
A single asterisk (*) indicates monomeric TGF-01, a
double asterisk indicates dimeric TGF-01 and a single
arrowhead indicates the TGF-01/sfl-RII complex. The size
and heterogeneous appearance of the complex suggests that
the s/j-RII from COS cells is glycosylated with 7-10 kD of
carbohydrate.
Example 11
The efficacy of TGF-9 in preventing post-
radiation fibrosis can be assessed in patients who
require radiation therapy for a tumor, such as
adenocarcinoma, prior to bowel resection. At surgery,
biopsies of various tissues can be obtained. There are
two negative control groups: patients who do not receive
radiotherapy prior to surgery and patients who receive
radiotherapy but no TGF-S. The study group is
administered sg-RII concomitantly with the radiotherapy.
Each day, when the patient reports for
radiotherapy, the patient receives an intravenous
injection of sg-RII. After radiation therapy is stopped,
the patient receives weekly intravenous doses of sZ-RII
until surgery.
WO 94/09815 - 21469j 3 PCT/US93/10455
-37-
At surgery, the tumor and associated tissues
are removed. Slides are made from the tumor and tissue
samples. Under microscopic examination, the tissue
samples show signs of healing without excessive fibrosis.
This invention has been detailed both by
example and by direct description. It should be apparent
that one having ordinary skill in this art would be able
to surmise equivalents to the invention as described in
the claims which follow but which would be within the
spirit of the.description above. Those equivalents are
to be included within the scope of this invention.
20
30
WO 94/09815 PCT/ US93/ 104(b
-38-
o =
- SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: SEGARINI, PATRICIA R.
DASCH, JAMES R.
OLSEN, DAVID R.
CARRILLO, PEDRO A.
(ii) TITLE OF INVENTION: USES OF TGF-BETA RECEPTOR FRAGMENT AS A
THERAPEUTIC AGENT
(iii) NUMBER OF SEQUENCES: 5
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Morrison & Foerster
(B) STREET: 755 Page Mill Road
(C) CITY: Palo Alto
(D) STATE: California
(E) COUNTRY: USA
(F) ZIP: 94304-1018
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US UNASSIGNED
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: LUTHER, BAR.BARA J.
(B) REGISTRATION NUMBER: 33,954
(C) REFERENCE/DOCKET NUMBER: 22095-20261.20
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (415) 813-5600
(B) TELEFAX: (415) 494-0792
~ WO 94/09815 _ 2146973 PCT/US93/10455
-39-
(C)- TELEX: 706141
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:-.
(A) LENGTH: 2095 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CGCTCGTTGG CGAGGAGT'Pr CCTGTTTCCC CCGCAGCGCT GAGTTGAAGT TGAGTGAGTC
15
ACTCGCGCGC ACGGAGCGAC GACACCCCCG CGCGTGCACC CGCTCGGGAC AGGAGCCGGA
120
CTCCTGTGCA GCTTCCCTCG GCCGCCGGGG GCCTCCCCGC GCCTCGCCGG CCTCCAGGCC
180
CCTCCTGGCT GGCGAGCGGG CGCCACATCT GGCCCGCACA TCTGCGCTGC CGGCCCGGCG
240
CGGGGTCCGG AGAGGGCGCG GCGCGGAGCG CAGCCAGGGG TCCGGGAAGG CGCCGTCCGT
300
GCGCTGGGGG CTCGGTCTAT GACGAGCAGC GGGGTCTGCC ATGGGTCGGG GGCTGCTCAG
360
GGGCCTGTGG CCGCTGCACA TCGTCCTGTG GACGCGTATC GCCAGCACGA TCCCACCGCA
420
CGTTCAGAAG TCGGTTAATA ACGACATGAT AGTCACTGAC AACAACGGTG CAGTCAAGTT
480
TCCACAACTG TGTAAATT'TT GTGATGTGAG ATTTTCCACC TGTGACAACC AGAAATCCTG
540
WO 94/09815 PCT/ US93/ 10*
-40-
CATGAGCAAC TGCAGCATCA CCTCCATCTG TGAGAAGCCA CAGGAAGTCT GTGTGGCTGT
600
ATGGAGAAAG AATGACGAGA ACATAACACT AGAGACAGTT TGCCATGACC CCAAGCTCCC
660
CTACCATGAC TTTATTCTGG AAGATGCTGC TTCTCCAAAG TGCATTATGA AGGAAAAAF1A
720
AAAGCCTGGT GAGACTTTCT TCATGTGTTC CTGTAGCTCT GATGAGTGCA ATGACAACAT
780
CATCTTCTCA GAAGAATATA ACACCAGCAA TCCTGACTTG TTGCTAGTCA TATTTCAAGT
840
GACAGGCATC AGCCTCCTGC CACCACTGGG AGTTGCCATA TCTGTCATCA TCATCTTCTA
900
CTGCTACCGC GTTAACCGGC AGCAGAAGCT GAGTTCAACC TGGGAAACCG GCAAGACGCG
960
GAAGCTCATG GAGTTCAGCG AGCACTGTGC CATCATCCTG GAAGATGACC GCTCTGACAT
1020
CAGCTCCACG TGTGCCAACA ACATCAACCA CAACACAGAG CTGCTGCCCA TTGAGCTGGA
1080
CACCCTGGTG GGGAAAGGTC GC2TTGCTGA GGTCTATAAG GCCAAGCTGA AGCAGAACAC
1140
TTCAGAGCAG TZTGAGACAG TGGCAGTCAA GATCTTTCCC TATGAGGAGT ATGCCTC'ITG
1200
GAAGAC.AGAG AAGGACATCT TCTCAGACAT CAATCTGAAG CATGAGAACA TACTCCAGTT
1260
CCTGACGGCT GAGGAGCGGA AGACGGAGZT GGGGAAACAA TACTGGCTGA TCACCGCCTT
1320
CCACGCCAAG GGCAACCTAC AGGAGTACCT GACGCGGCAT GTCATCAGCT GGGAGGACCT
1380
WO 94/09815 _ 214U 973 PCT/US93/10455
-41-
GCGCAAGCTG =
GGCAGCTCCC TCGCCCGGGG GATTGCTCAC CTCCACAGTG ATCACACTCC
1440
ATGTGGGAGG CCCAAGATGC CCATCGTGCA CAGGGACCTC AAGAGCTCCA ATATCCTCGT
1500
GAAGAACGAC CTAACCTGCT GCCTGTGTGA CTTTGGGCTT TCCCTGCGTC TGGACCCTAC
1560
TCTGTCTGTG GATGACCTGG CTAACAGTGG GCAGGTGGGA ACTGCAAGAT ACATGGCTCC
1620
AGAAGTCCTA GAATCCAGGA TGAATTTGGA GAATGCTGAG TCCTTCAAGC AGACCGATGT
1680
CTACTCCATG GCTCTGGTGC TCTGGGAAAT GACATCTCGC TGTAATGCAG TGGGAGAAGT
1740
AAAAGATTAT GAGCCTCCAT ZTGGTTCCAA GGTGCGGGAG CACCCCTGTG TCGAAAGCAT
1800
GAAGGACAAC GTGTTGAGAG ATCGAGGGCG ACCAGAAATT CCCAGCZTCT GGCTCAACCA
1860
CCAGGGCATC CAGATGGTGT GTGAGACGTT GACTGAGTGC TGGGACCACG ACCCAGAGGC
1920
CCGTCTCACA GCCCAGTGTG TGGCAGAACG CTTCAGTGAG CTGGAGCATC TGGACAGGCT
1980
CTCGGGGAGG AGCTGCTCGG AGGAGAAGAT TCCTGAAGAC GGCTCCCTAA ACACTACCAA
2040
ATAGCTCTTA TGGGGCAGGC TGGGCATGTC CAAAGAGGCT GCCCCTCTCA CCAAA
2095
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
WO 94/09815 -42- PCT/US93/104f&
0
(D). TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GGATCCCGTG GAGGATTAAA CCATGGATGG ATGCATAAGC TTCGAATTC
49
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 52 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GGGGATCCGA TAGTGGAGGA TGAZTAAATG ATCCCACCGC ACGTTCAGAA GT
52
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GGGGAAZTCA AGCTTAGTCA GGATTGCTGG TGTTATATTC TTCTGA
46
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
WO 94/09815 2~ ~ 6973 PCT/US93/10455
-43-
o =
(Ai LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
TAGCAACAAG TCAGGTTAGC TGGTGTTATA TTC
33
20
30
