Note: Descriptions are shown in the official language in which they were submitted.
WO94/10325 21~ ~ & 2 2 PCS~Fl93/00450
.
., ` 1
l~ecombinant m~thod and host for manufacture of xylitol.
Cross Reference tQ Related A~plicatlon
This application is a ~ontinuation-in-part
appllcation of U.S. Appl. No. C7/973,325, filed November 5,
1992. ~ ~
. - :
Backgrou~d of the In~e~tion;
1 0
I. Field of the Invention
The presen$ invention relates generally to methods
of using geneti~cally modified microorganisms for the manu-
facture of useful chèmical compounds ~metabolic enginee-
ring) and more specifical~ly to constructiny microbial
strains~by yenetic manipulation that ar;e capable of conver-
ing readily~available carbon sources, such~as D glucose,
into~ a more valua~ble~product, for example~, xylitol.
2. Related Art~
, ~ ~
Xylitol~ls a chemical ~compound of a ~onsiderable
value as a spe¢ial sweetener~ It is approximately as sweet
2~ as sucrose,;non-toxic, and non-cariogenic~
Currently~, ~xyl~itol ;is~produced by~chemical h~dro-~ ;
genation of D-~ylose.~D-xylose~ is obkained~ from hydro
lysates of various plant materials where it is always pre-
sent~ in~i a~mixture ~with other pentoses an!d h~xoses.
~ Purifi~cation of xylose and;also xylitol presents therefore
a~signl~ficant problem. A~numbe~r~af processes~ of this~type;
are known.~ U.~S~ patents;3~784,408,~4,066,711, 4,075,406,
and~4,0a8-,~85;~;;;can~be~mentioned as examples.
The re~uc~ion~of D-xylose into xyli~ol can also be
3~5;~ ach~iéved~in a~microblological process using elther~strains
WO94/1032~ PCT/FIg3/004~0
2~862~
isolated from na~ure (Barbosa, M.F.S. et al., J. Industrial
Microbiol . 3:241-251 (1988)) or genetically engineered
strains (Hallborn, J. et al~, Biotechnology 9:1090-1095
(1991)). Howe.ver, obtaining the substrate, D-xylose;, in a
form suitable for yeast fermentation is also a considerable
problem because inexpensive xylose sources such as sulphite
liquor from pulp and paper processes contain impurities
which inhibit yeast growth.
An attractive alternative method for the manufacture
of xylitol would be obtaining it by fermentation of a cheap
and readily available substrate, such as ~-glucose.
However, no microorganisms are known that produce xylitol
in significant amounts during one-step fermentation of any
common carbon sources o~her than D-xylose and D-xylulose,
both of which are structurally very closely related to ~
xyli~ol~ :
On the o~her hand, many microorganisms, especially
osmophilic yeasts, for example Zygosaccharomyces rouxii,
Candida polymorph~, an~ Torulopsis candida, produce
significant amounts of a closely related pentitol, D- ~:
arabitol, from D-glucose (Lewis D.H. & Smith D.C., New
Phytol . 66:143-184 (1967)). Using this property of
osmophilic yeasts, H. Onishi and T. Suzuki developed a -:
method for converting D-glucose into xylitol by three
consecutive ~ermentations (Appl. Microbiol. 18:1031-1035
: (1969~). In::this process, D-glucose was first converted
into D-arabitol by fermentation with an osmophilic yeast
strain. Second, the ~-arabitol was oxidized into D-
xylulose in a fermentation with ~cetobacter suboxydanis .
Finally, the D-xylulose was reduced to xyli~ol in the third
fermentation uising on o~ many yeast strains capable of
reducing D-xylulose into xylitol. ~:
An obvious disadvantage of this method is that it
involves three different fermentation steps~ each taking
35 . from 2 to 5 days; further additional steps like ~
:.
WO94~1032~ PCT/FI93/00450
2148622
fi~ -
sterilization and cell removal are also needed, thus
increasing processing costs. The yield of the step
I ~ermentatiQn process is low and the amount of by-products
is high. Thus, a need still exists for methods for the
economical production of xylitol in microbial systems from
readily available substrates.
;
s~mmary of tbe InYention
lO ~ The pres~ent invention pravides methods for
constructing~r~ecombinant ~osts, and thè recombinant hosts
constructed therebyl such hosts beLng capable of producing
xylitol when grown on carbon sources other than D xylulose '
or D-xylose, and~ other than~ polymers or oligomers or
~ mixtures thereof. The~carbon sources used by the hosts of
the invention are inexpensive~and~readily available. The t
microorganisms` of the invention are also capable of
secreting~the synthesized xylitol into the~culture medium.
This ~go~l ~is~achieved through modification of the
2~0 ~ metabolism~ of a desired microorganism, preferably a
naturally occurring~yeast microorganism, by introducing and
expressing desired~heterologous genes. This goal is also
"~ achieved by~urthqr modification of the me~abolism of such
de~sired~ microorgàni~m, ~so; as to ~overexpress and/or ~ ~
25 ~ ~inactivate~ths~ activit~or expression of certain gen s '~A
homologous~to-such~microorganlsm~in~its~native state.
There~fore, ~it~ is~an~ object of th~e~invention to
provide a method ror the production of xylitol, such method
ùtilizin`g ~new and novel~microbe strain,~a ~recombinant
30 ~ host,~ also~ herein~ termed~a genetically ~engineered~
micro~rganism,~ as~the ~produc;er~ of~ such~;xy~ltol, ~such
genetically enginee~ed microorganism~producing such~xylitol
either~ de~;~ovo~ ~r ~in ~enhanced~amounts whe~n compared the
native~unenginee~ed~mlcroorganism.
~, WO94/l032~ PCT/Fl93/00450
2148622
It is a further object of the invention to provide
a method for the production of xylitol, such method
utilizing a novel metabolic pathway that has been
engineered into a microorganism and which r~sults in the de
nov~ or enhanced production of xylitol by such
microorganism. ~ -
It is a further object of the invention to provide
a method for the production of xylitol, such method
utilizi~g a novel metabolic pathway as above, and such
pathway modifying the ~pathway of D-arabitol biosynthesis
and/or metabolism, such pathway being modified so ~hat the
I ` :
microorganism now produces xylitol from fermentation of
carbon sources that the unmodified host utilizes for D-
ar~bitol biosynthesis. ~-
It is~a further object of the invention to provide
a method for the production of xylitol, such ~ethod
utilizing the altered D-arabitol pathway above, and such
pathway being alt~red either by the extension of the
preexisting pathway~ for D-arabitol biosyn~hesis (with
additional steps for D-arabitol utilizationj or by the
substitution of one or more steps of the D-arabitol pathway
with similar steps leading to~the formation of xylitol.
It is a further object of the invention to provide
a me~hod for ~the production of xylitol, such method
~5 utili3ing the altered ~ arabitol biosynthesis~ pathway
above, and such pathway being altered~by extending~the pre-
existiny D-arabitol pathway by the~ introduction and
overexpression of the genes coding for D-xylulose-forming
i b-arabitol; !dehydrogenase ~(EC l.l~l.llj and 'xyli~ol
dehy~rogenase~(EC 1.1~.1.9) ;into an D-arabitol-producing
microorganism. ;~
It is a further object of the invention to provide
a method for the ;production of xylitol using a novel
microorganism as~above,~ such m~thod~utilizing the altered
35~ ~D-arabitol~biosynthesis pathway above, and such pathway
:
~:: : ::: : : ~
WO94/1032~ PCT/Flg3/00450
2~ 6,
! ~ .
.. . ..
being altered further, by inactivating, using chemically -:
indu~ed mutagenesis or gene disruption, the gene coding for
transketolase (EC 2.2.1.1) or the gene coding for D-
xylulokinase~(EC 2.7.1.}73 in such microorganism.
5It is a further obj~ct of the invention to provide
a method for the production of xylitol using a novel ;-
microorganism as above, such method utilizing a
genetically-engineered altered overexpresslon of the genes
: coding for the enzymes of the oxidative branch of the
10pentose-phosphate pathway, and;~specifically D-glucose-6-
phosphate dehydrogenase (E~C 1.1~1.49) and/or 6-phospho-D- .
gluconate dehydrogenase (EC 1,1~1.44) in such -.
microorganism.
It is a~further:object of ~ the invention to pro~ide `
a method for the p~oduction of :xylitol:using a novel
microrganism as;above~, such method;utilizing a genetically-
ngineered altered overexpression of the genes coding for r~
the ~enzymes:of::the:~oxidative: branch of the pentose-
phosphate pathway,~as well:a~s the~D-ribu1Ose-S-phosphate .
20~ epimerase gene (EC 5.1.3.1). ~
Brie~ Descripti:o~:of~the Drawing~ ~ .
Figure 1 ~:is a ~restriction;map of the:~insert ~in:: ..
25~ ~plasmid ~p~L2. This~ insert ~is~ that of ~the ~:Xlebsiella :~
t errigena Phpl~ chromosomal ~ locus:~and contains~the :K. ~ -~
terrlgena :~D-arabit~ ehydrogenase gene.~ Tha open box ;.
represents ~. terrigena chromosomal DNA. The arrow shows
the locatioh'and direction of the D-arabi~ol déhydrogenase
30 ~ (EC 1.~ ) gene in this~DNA.
Figure 2 shows the construction o~pYARD from pADH
and~pAAHS. On~ the plasmid~ diag~ams,~the single line (-) `
indicates bacterial~sequences;~the wavy line indicates S. .-
: ; cerevisiae~2,LIm~DNA;: the ~open arrow:t=) indicates the ADCI
35: promoter ~the~ ADCI gene c~odes for S. cerevisiae alcohol
:
WO94~103~ PCT/Fl93/00450
2148622
dehydrogenase or ADCI, formerly called AD~I); the open
diamond (O3 indicates the ADCI transcriptional terminator;
the rectangular block indicates the LEU2 gene; and the
hatched arrow indicates the D-arabitol dehydrogenase gene.
- Figure 3 ~hows the construction of plasmid pJDB(AX)-
16. X~L2 is the xylitol dehydrogenase gene from Pichia
stipitis. dalD is the D-arabitol dehydrogenase gene. ADCI
is the transcriptional regulation area (promoter) of the
ADCI gene ~hat precedes ànd is operably linked to the dalD
coding sequence. The symbols are not the same as in Figure
4. On the plasmid diagrams, the~single line (-) indicates
bacterial se~uences and 2~m DNA where noted; t~e closed
arrow indicates the ADC1 promoter; the shaded diamond ~)
indicates the ADCI transcriptional terminator; the
rectangular block indicates the ~EU2 marker gene; the
hatched arrow indl~cates the XYL2 gene; and the blocked
rectangle indicates~the dalD gene.
Figure 4 shows~ the construction of the E. coli-Z.
rouxii shuttle vector pSRT(AX~ 9. The symbols are as in
Figure 3.
Figure 5 shows th- restricti~n map of the cloned
T~ candida rDNA fragment.
Figure ~6 shows the construction of the plasmid
pTC(AX).
Figure 7 shows the restriction map of the cloned
. candida rDNA fragment.
; Figure 7a shows the construction of the plasmid
.
pCPU(AX).
l s Figu~ 8ishows the clonin~ of the ZWFl and gnd gene.
Figure 8a shows the construction of ~he PAAH(gnd)
; plasmid.
Figure 9 shows the construction of plasmid pSRT(ZG).
Fi~ure lO shows the cultivation of the strain
; Z, rouxii ATCC 133~6 [pSRT(AX~-09] in a fermentor.
w~94~1n3~5 PCT/Fl93/00450
7 ~ ~ ~
,.
Figure 11 shows the cultivation of the mutant
derived from strain Z. rouxii ATCC 13356 [pSRT(AX)-9] in a
fermentor. ~;
~etailed Description of the Preferred Embodiments
.
I. D~i~ition~ .
-.
~n the description that follows, a number of terms
used in recombinant DNA technology are extensively -~
utilized. In order to~ provide a ~clear and consistent .
understanding of the specification and claims, including
the scope to be given such terms, the following d,efinitions
I are provided.
¦ 15 CarbQn source other than_~ylose or xYlulose. As used -.
I herein, by a "carbon source other than D-xylose and D-
j xylulose" is meant a carbon substrate for xylitol
production other tha~ D-xylose and D-xylulose or polymers `~
or oligomers or mixtures thereof (such as xylan and
hemicellulose). The carbon source preferably suppor~s
growth of the generically engineered microbial hosts of the
invention, and fermentation in yeast hosts~ Many~cheap and
readily available compounds can be used as carbon ssurces
for the production of xylitol in the~microbial hosts of the
present invention, including D-glucose, and various D-
glucose-containing syrups and mixtures of D-glucose with
other sugars. Other sugars assimilable by the hosts of the
invention, including yeast and fungi, such as various aldo-
' and ketohexoses (~or example, D-fructose, D-galactose, and
D-mannose), and oligomers and polymers thereof ~for ~-
example, sucrose,~lactose, starch,:inulin and maItose) are
intended to be included in this term~ Pentoses other tha,n ~:
. ~
xylose and xylulose and non-carbohydrate carbon sQurces
: such as glycerol, ethanol, various plant oils or
hydroca,rbons~preferably n-alkanes containing 14-16 carbon -~
: `,
WV94~10323 PCT/F193/00450
214S622 8
atoms) are also intend~d to be included in this term. The
spectrum of carbon sources useful as substrates for the
productio~ of xylitol by the hosts of the present invention
will vary depending on the microbial host. For example,
5 glucose and glucose-containing syrups are the prefer~ed
carbon source for xylitol production with the genetically
manipulated Zygosaccharomyces rouxii of the invention,
while n-alkanes, preferably having 14-16 carbon atoms, are
the preferred carbon source for modified Candida tropicalis .
strains.
Gene. A DNA seguence containing a template for a ~A
polymerase. The RNA ~ranscribed from a gene may or may not
cod~ for a protein. RNA that codes for a protein is termed
messenger RNA (mRNA) and, in eukaryotes, is transcribed by
RNA polymerase II. ~ gene containing a RNA polymerase II
template (as a result of a RNA polymerase II promoter)
wherein a RNA sequence is transcribed which has a sequence
complementary to that of a specific mRNA, but is not
normally translated can also be canstructed. Such a gene
cons~ruct i5 herein termed an l'antisense RNA gene" and such
a ~NA:transcript:is termed an "antisense RNA." Antisense
RNAs are not normally translatable due tv thP presence of
txanslational stop codons;in the antisense RNA sequence.
A "complementary DNAI' or~"cDNA" gene includes
xecombinant genes synthesiæed by, for example, reverse
; ;transcription of mRNA, thus lacking intervening sequen~es
:: ~introns). Genes:clones~ from genomic DNA will generally
contain introns.
!' ! ` I i ~Cloni~gLyehicle. A plasmid or phage DNA or other DNA
se~uence which is~ able t~ carry genetic information, ~`~
speci~ically DNA, into a host cell. A cloning vehicle is
often characterized by one or a small number of
endonu~lease recognition sites a~ which such DNA sequences
can~be cut in a determinable fashion without loss of an
essential biologlcal function of the vehicle, and into
W094/10325 2 PCT/F193/U0450
which a desired DNA can be spliced in order to bring about
its cloning into the host cell. The cloning vehicle can
further contain a marker suitable for use in the
identification of cells transformed with the cloning
s vehicle, and origins of replication that allow for the
maintenance and replication cff the vehicle in one or more
prokaryo~ic or eu~aryotic hosts~ Markers, for example, are
tetracycline resistance or ampicillin resistance. The word
"vector" is sometimes used for "cloning vehicle."
'iplasmid" is a cloning vehicle~ generally circular DNA,
that is maintained and replicates autonomously in at least
one host cell.
ExPression vehicle. A vehicle or vector similar to
a cloning vehlcle but which supports expression of a gene
that has been cloned into it, aftfer transformation into a
host. The cloned gene is usually placed under the control
of (i.e., operably linked to) certain control sequences
such as promoter sequences, tha$ can be provided by the
vehicle or by thf~ recombinant construction of the cloned
: 20 ~ geneO Expression control sequences will ~ary depending on
whether the vector is designed to express the opera~ffly
linked gene in a prokaryotic or eukaryotic hf~st and can
additionally contain transcriptio~al elements such as
enhancer elements (upstream activation sequences) and
te~mination sequences, and/or translational initiation and
termination sites.
Host. A host is a cell, prokaryotic or eukaryotic,
th~t is utilized as the recipient and carrier of
f; i Irecombinant material.
Host of the Invention. The "host of the ir.ffvention"
is a microbial host that does not naturally produce xylitol
in sifgnificant amounts during fermentation from common
c~rbon sources other than D-xylose or D-xylulosfe, or
polymers or oligomers or mixtures thereof, but has been
engineering to do so a~cording to the methods of the
,.
..
,
:~ ;'
W0~4/~03~ PCT/Fl93/0045Q
. _
-~ 10
2 ~ 6 2 2
invention. By a "significant amount" is meant an amount
which is suitable for isolation of xylitoI in pure form or
an amount that can be reliably measured by the analytical
methods normally used for the analysis of carbohydrates in
the microbial fermentation broth.
Arabitol ~ehydroqenase. There are two types of D-
ara~itol dehydrogenases. D-xylulose-forming (EC 1.1~11) and
D-ribulose-forming. D-ribulose-for~ing dehydrogenases are
found in wild type yeasts and fungi.~D-xylulose-forming
ara~itol dehydrogenases axe known only in bacteria. Unless
otherwise stated, it is the ~-xyluIose-Xorming arabitol
dehydrogenase that is intended herein and referred to
herein as arabitol dehydrogenase. I
Oxida~ive Branch of the Pentose-Phosphate Pathway.
By the "oxidati~e branch of ~he pentose-phosphate pathway"
is meant to include that part of the pentose~phosphate
shun~ that catalyzes oxidative reactions, such as those
reactions catalyzed by D-giucose-6~phospha~e dehydrogenase
(EC 1.1.1.49) and 6-phospho-D-gluconate dehydrogenase (EC
1.1.1.44~, and that utilizes hexose~ substrates~to form
pentose phosphates. The "non-oxida~ive" part of th
pentose-phosphate pa~hway: (which~ also catalyzes the net
formation of ribose from D-glucose) is chara~terized by
non-oxidative isomerizations ~such ~ as the reactions
~ c2talyzed by ribose-S-phosphate isomerase, D-ribulose-5-
phosphate-3-epimerase and transa1dolase. See Biol ogical
Chemistry, H.~. Mahler & E.H~.Cordes, Harper ~ Row,
publishers, New~York, 1966, pp. 448-454.
Functilonal Derlvative. A "functional derivatlve" of
a protein or nucleic acid, is a molecule ~that has been
; chemically or biochemically derived from (obtain~ed :from)
such protein or nucleic acid and which~retains a biologica~
activity~(either functional or structural) ~hat is a
characte~istic of the native protein or nùcleic~acid. The
te~m "~f~nctional derivative" is intended to include "frag-
:. : :
W094/~0325 P~T/~193/0~450 ~
,
11 2.1~6~2 ,'
ments," "variants," "analoguesr" or "chemica~ derivatives"
of a molecule that retain a desired activity of the nati~e
m~lecule.
As used herein, a molecule is said to be a "chemical
derivative" of another molecule when it contains additional
chemical moieties not normally a part of the molecule. Such
moieties can improve the molecule's solubility, absorption,
biological half life, etc. The moieties can decrease the
toxicity-of the molecule, or eliminate or attenuate any
un~esirable side effect of the molecule, etc. M~ieties
capable of mediating such effects are disclosed in Reming-
ton's Pharmaceutical Sciences (1980~. Procedures for
coupling such moieties to a molecule are well known in the
art.
15Fraqment. A "fragment" of a molecule such as a
protein or nucleic acid is meant to refer to a portion of
the native amino aoid or nucleotide genetic sequence, and
in particular the functional derivatives of the invention~
Variant or naloq. A "variant'~ or "analog" of a
20protein or nucleic acid is meant to refer ko a molecule
substantially similar in structure and biological acti~ity
to either the native molecule t such as that encoded by a
functional allele.
25II. Co~stxuction of Metabolic Pathways for Xylitol
Bio~y~thesis
According to the invention, the native metabolic
pathway~ of~ a microbial host are manipulated sol as to
30decrease or eliminate the utilization of carbon into
purposes o~her than xylitol production. All of the hosts of
the in~ention produce xylltol in one fermentation step. In
one embodiment, a hosts of the invention can possess
~ xylitol dehydrogenase (EC 1.1.1.3) acti~ity sufficient for
35xylitol production. However, as described below, in those ~-
~ ~ '.
.
.~
`~' wc~ g4/,0325
p~/~193/004~;0
;` ~118622 12 J
hosts wherein it is desired to overproduce xylitol
dehydrogenase activity, recombinant genes encoding xylitol
dehydrogenase can be transformed into the host cell.
In the practical realization of the invention, all
of the hosts of the: inve~tion are charac~erized by the
ability to synthesize xylitol from structurally unrelated
carbon sources such as D-glucose and not just from D-xylose
and/or D-xylulose. The hosts of the invention are also
capable of secreting the synthesized xylitol into the
medium.
: Specifically,- in the exemplified and preferred
embodiments, the hosts of the invention are characterized
by one of two pathways. First~, a pathway in which arabitol
is an intermediate in xylitol formation and second, a
pathway in which xylulose-5-phosphate is directed into
xylitol formation through dephosphorylation and reduction
reactions. Accordingly, the hosts of the invention are
characteri2ed by at least one:of the following genetic
alterations~
ZO (1) a gene encoding a protein possessing D-xylulose-
forming D-arabitol dehydrogenase activity ~EC 1.1.1.11) has
been cloned into the host~hus providing for the conversion
of D-arabitol to D-xylulose (characteristic of pathway
and/or
t2) the native host gene encoding transketolase
activity has been inactivated~(characteristic of pathway
In addition a variety~ of further modifications to
the hostsican be performed, so as to enhance the xylitol
producing capabilities~ of :such hosts. For example~ the
~: hosts as described in :(l) and (2) can:be further modified
such that~
(3) a gene encodin~g a protein possessing xylitol
dehydrogenase (EC 1.~1.9) activity has been cloned into
35: : the:host;
:
,
PCT1~193/~450
WO~4/10325
13 . 21 ~ 8 622
(3) the native host gene encoding D-xylulokinase (EC
2~7.l.17) has been inactivated;
~ 4) a gene encoding a protein possessing D-glucose-
6 phosphate dehydrogenase (EC l.l.1.49) activity has been
cloned into the host;
(4) a gene encoding a protein possessing 6-phospho-
D~gluconate dehydrogenase (~C l.1~l.44) activity has been
~loned into the host;
(5) a gene encoding a protein possessing D-ribulose-
5-phosphate 3-epimerase (EC 5.l.3.l) activity has been
cloned into the host;
In a preferred embodiment, the hosts of the
invention possess more than one of the above-described
genetic alterations. For example, in a preferred
embodiment, carbon flows from D-arabitol "directly to~
(that is, in one step~ D-xylulose, and from D-xylulose
"dlrectly to" xylitol. Accordingly, in such embodiment, the
host of the invention has been altered such that a gene
encoding a protein possessing D-xylulo~e-forming D-arabitol
dehydrogenase acti~ity and a~gene encoding a xylîtol
dehydrog~nasè (EC l.l.l,9) have been cloned into the hvst.
It should be noted that while, in many embodiments1 D-
arabitol is internally synthesiæed from other carbon
sources by the hosts of the invention, D-arabitol could
also be externally added directly to the medium.
In another preferred embodiment, th. xylitol
; biosynthesis pathway does not incorporate arabi~ol as an
intermediate. Ra~her, the carbon flow is from D-xylulose-5-
phosphate to D-xylulose further to xylitol. When D-glu~ose
is used as~the Garbon source, the flow of carbon would be
: through the oxidati~e portion of the pentose phosphate
pathway, from ~D-glucose to D-glucose-6-phosphate to 6-
phospho-D-gluconate to D-ribuIose-5-phosphate. The D-
ribulose-5-phosphate would further epimerized to
xylulose-5-phosphate, depho~phorylated to D-xylulose and
~ ;
.
,
W094~1~32~ PCT~F193/00450
. I -.
` 2148622 14
reduced to xylitol. Accordingly, a h~st of the invention
for utilization of this embodiment would include a host in
which:
(alj a gene encoding a protein possessing D-glucose-6-
! 5 phosphate~dehydrogenase (EC 1.1.1.49) activity has
been cloned into the host or the native gene of the
: : host is overPxpressed;:and/or
(a2) a gene encoding a protein possessing 6-phospho-D-
: gluconate dehydrogenase (EC~ .1.44) activity has
: 10 :: been cloned into~the host or the native gene o~ the
: host`is overexpressed; and/or
~(a3) a gene encoding:a protein possessing D-ribulose-S-
. . phosphate-3-epimerase~activity has been cloned into
: ~ the host or ~the native gene of the host is
` 15 overexpre~ssed; and/or~
(a43 :a gene: encoding a :~protein possessing xylitol
~: . : ~dehydrogenase (EC 1.1.1.9) activity has been cloned
; i~ into the host or the native gene of~the host is~: :~ :` ovsrexpres~ed;~
~ ~ zo (b) the native transketolase gene has~been~inactiY~ated;
;; ~` ~ ; and/or ~
.~ : ~c) the native~host :gene:; encoding xylulokinase ~EC
~: ~ 2.7.1.17) a~ctivity has~be~en:inactivated~
;~ The dephosphorylation~step (~D-xylulose-phospha~e to ~D-:
; ~ 25; :~ x~.lùlos:e: conversion)~is~the~only ~step catalyzed by an ::::enzyme::~hat :has not~ been c~aracterized in~pure~ form.:
;~ Howev~r,::thè~ enzyme activity responslble:~:for~the similar~:
:~ . step (D-ribulose-5-phosphate:to D-ribulose) in ~he native ~:~
1~ ~ D-arabltol-forming path~ay~ o~ osmophillc yeast was
:;~ : 30 ~ pre~ious:ly~shown to:be::non-specifi~ and c~apab3.~ also ~of
~ ~ catalyzing~the:dephasphorylat~i~on~ of xylulose:-5-phosphate ~: ;
`~ ~ (Ingram,:~J~.~M.~ and: W.A.~ Wood, ~J. ~acteriol~. 89:ll86~ 41965)~ The:mutatlon o~transketo:lase and overexpression
o:f~::the~two ~dehydrogenases ~o~: the ~oxida~i~e pentose
:35~ phosphate pathway~serveia dual purpose. ~:irst, they~ can
WO94/l0325 PCT/Fl93/00450
. ~ !
`15 ~ 2t~8622
increase the efficiency of pathway I by increasing the
amount of ribulose-5-phosphate in the cell and conse~uently
the production of arabitol and xylitol. Seco~dly, the over-
accumulation of xylulose 5-phosphate which is necessary for
the operation of pathway II should also result from the
same combination of modifications.
Therefore, methods:utilizing the naturally occurring
pathway leading to the formation of D-arabitol from various
carbon sources and extending this pathway by two more
reacti~ns to convert D-arabitol into xylitol are not the
only possible pathway within the invention. Other pathways
leading to xylitol as a final metabolic product and not
involvlng D-arabitol as an intermediate can be constructed.
Thus, a pathway to xylitol from Doribulose-5-phosphate, can
be realized through:more than:one chain o~ reactions. D-
ribulose-5-phosphate:~can ef~iciently be converted to D-
xylulose-5-phosphateby D ribulose-5-phosphate-3-epimerase
j and if further conversion of D-xylulose-5-phosphate is
prevented by a mutati~n in the transketolase gen~, the
accu~ulated D-xylulose-5-phosphate can be dephosphorylated
by the same non-specific phosphatase as D~ribulose-5-
phosphate (Ingram, J.M. et al ., J. Bacteriol . 89:1186-1194
(1965)~ and reduced into xylitol by xylitol dehydroge~ase.
Realization of this~ pathway ~can further require the
inactivation~of D-xyluloXinase gene in orde~ to minimize
~` the energy loss due to :the futile loop: D-xylulose-5-
phosphate ~ D-xylulose ~ D-xylulose 5~phosphate. An
additional genetic change - introduction and (over)-
I !e`xpression of` the D-ribulok~inase gene (EC 2.7.1.47) could
minimize simultaneous D-arabitol production by such strains
by :trapping the D-ribulose~ produced by the unspecific
phosphatase. The D:-ribulose:~will be converted back into the
D-ribulose-5~-phosphate and further into D-xylulose 5-
: phosphate. :: ~
'
: ... .... :
WO94/1032S PCT/F193/00450
~ ` `` 2~622 16
III. ConstruGtion of the Hosts of the In~ention
The process for genetically engineering the hosts ofthe invention, according to the invention, is facilitated
through the isolation and partial sequencing of pure
protei~ encoding an enzyme o~ interest or by the cloning of
genetic sequences which~are capable of encoding such
protein with polymerase chain reaction technologies; and
through the expression of such genetic sequences. As used
herein, the term "genetLc~sequences" is intended to refer
to a nucleic acid molecule~ (preferably~DNA). Genetic
sequences which are ca~pable of encoding~ a protein are
derived from a variety of sources. These sourres include
genomic DNA, cDNA, synthetic DNA, and combinations thereof.
The preferred source of ~genomic DNA is a~yeast genomic
library. The preferred source of the cDNA is a cDNA library
prepared from yeast mRNA grown~ in~ conditions ~nown to
induce expression of the desired mRNA or protein.
The cDNA o`the invention~will not include naturally
occurring introns if the cDNA was made using~mature~m~NA~as
a templ;ate. The genomic DNA of~the~invention may or~may~not
include naturally~occurring introns.~More~ver, such genomic
DNA can` be obtained in association with the~ 5~' promoter
region of the gene sequènces and/or~ with~the 3' ~tran-
scriptional termination region. Further,~ such genomic DNAcan be obtained in associa~ion with the genetic se~uences
which encode~the ~5' ;non-translatèd~;reqion~;of ~the r~NA~
and/or with the gene~ic sequences which encode the 3' non-
translate~d~egion;.~ To the ~extent that a hos~ cel~ an
30; recognize~the transcriptl~onal ~ and/or ~translati~nal
; regul~atory~ignals associated~wi~th the;express~lon of~the~
mRNA~and~p~r~otein~ then~the~5'~ and/or~3' non-~ranscribed
règions~`of~the~native gene,;~and/or, the~5' and/or~3' non-
; translat~d~ regions of~ the~mRNA, can be retainèd ~and
~ em~l~yed Eor -r n~c~ p-lO al ard tra~slational regulation,
WO94/10325 PCTlFI93/00450
17 .. - :
æl~s6~2
I ~enomic DNA can be extracted and purified from any host
cell, especially a fungal host, which naturally expresses
the desired protein by means well known in the art (for
example, see Guide to Moleculax Cloning Techniques, S.L.
Berger et al., eds., Academic Press (1987)). Preferably,
the mRNA preparation used will be enriched in m~NA coding
for t~e desired protein, either naturally, by isolati~n
from cells which are producing large amounts of the
protein, or in vitro, by tech~iques commonly used to enrich
mRNA preparations for specific sequences, such as sucrose
gradient centrifugation, or both.
For cloning into a vector, such suitable DNA
preparations (either genomi~c DNA or cDNA) are randomly
I sheared or enæyma~ically cleaved, respecti~ely, and ligated
into appropr-late:vectors to form a recombinant gene (either
genomic or cDNA) library.
: A DNA sequence encoding a;desired protein or its
functional derivatives can be insert~d into a ~NA vector in
accordance with conventional techniques, includiny blunt-
ending or s~aggered-ending termini for ligation,
restriction enzyme diges~ion to provide appropriate
terminl, filling in of cohesive ends as appropriate,
alkaline phosphatase treatment to avoid undesirable `~
joining, and ligation with appropriate ligases. Techniques
for such manipulations are~disclosed by ~aniat~s, T~, :
(Ma.niatis, T. et al., Molecular Cloning fA ~aboxatory
! Manual ), Cold Spring Harbor Labor~tory, second edition,
.1988~ and are well~known in the art.
Libraries containing sequences coding for the
desired gene~:c:an be screened and the desired gene seque~ce .:
. ldentified by any means which specifically selects for a
: sequence coding for~ such gene or protein such as, for
example, a) by hybridization with an appropriate nucleic
~; : acid probe~s) containing a sequence specific for the DNA of
~35 :~this protein, or b) by hybridization-selected translational
,
.
WO 94/10325 PCI/F193/U0450
: ~
` 2148622 18
analysis in which native mRNA which hybridizes to the clone
in guestion is translated in vitro and the translation
¦ products are further characterized, or, c) if th~ cloned
genetic sequences are themselves capable of expressing
mRNA, by lmmunoprecipitation of a translated protein
product produced by the host containing the clone.
Oligonucleotide probes specific for a certain
protein which can be used to identify clones to this
¦ protein can be designed from the knowledge of the amino
acid sequence of the protein or from the knowledge o~ the
nucleic acid sequence of the DNA~encoding such protein or
a related protein. Alternatively, antibodies can be raised
;~ against purified forms of the~protein and used to identi~y
~,
the presence of unique protein determinants in
transformants that express the desired cloned protein. The
se~uence o~ amino acid residues ln~a-peptide i5 designated
; herein either khrou~h the use of their commonly employed
three-letter designations or~ ~by their single-letter -`
designations. A listing of ~these~three-letter and one-
letter designations~can be found in textbooks ~su~h as ~:
Biochemistry, Lehningér, A., Worth Publishers, New York, NY
(1`970~). When ~ the~ amino acid sequence ~ is~ listed
horizontally~,~ unl~ess otherwise~statedj the amino terminus i
is intended to be on~the~left~end nd the carboxy terminus
~is~ intended to ~be at the right~ end. Si~ilarly, unless
otherwise stated~ or`~apparent~;from the context, a nucleic
aci~ s~quence~is presented with the 5' end~on the left. ~ ~
Becausé the genetic code is degenerate, more than -:
; one codon can be used to encode a particular amino acid
30;~ t~Watson,~J.D.~,~In: Molecular~iology of the~ Gene,~3rd Ed.,
W.A. Ben~amin,~Inc.~,~Men~l~o~Park, CA~(1977~ pp. 356-357).
The peptide fragments are analyzed~to idéntify sequences of
amino a~cids which càn be~encoded by oligonucleotides having
the~ lowest ~degree o~f~ degeneracy. Th}s is preferably
WO94/10325 PCT/Fl93/00450
.
19 1 `; Zl~862
acco~plished by identifying sequences that contain amino
acids which are encoded by only a single codon.
Although occasionally an amino acid sequence oan be
encoded by only a sin~le oligonucleotide sequence,
~re~uently the amino acid sequence can be encoded by any of
a set of ~imilar oligonucleotides. Impor~antly, whereas all
of the members of this set contain oligonucleotide
se~uences which are capable o~ encoding the same peptide
fragment and, thus, potentially contain the same
oligonucleotide sequence as the gene which encodes the
peptide fragment, only one member~of the set contains the
nucleotide sequence that is identical~to the exon coding
sequence of the~gene. Because this member is present~within
the set, and is capable of hybri~izing to DNA even in the
presence of the other members of the set, it is possible to
employ the unfractionated set of oligonucleotides in the
same manner in which one would employ a single oligo-
nucleotide to clone the gene that encodes the peptide.
Using the genetic code, one or more different
2Q oligonucleotides can be identified from the amino acid
sequence, each of which would be capable of encoding the
desired protein. ~ The probability~that a particul~r oligo~
nucleotide will, in ;fact, constitute the actual protein
encoding sequence can be estimated;by considering ~bnor~al
`25 base~pairing relationships and the ~requency with which a
particular codon is actually used (to encode a particular
: .
~mino acid) in~eukary~tic cells. Using "codon usage rules,"
a single oligonucleotlde sequence, or a set of oligonucleo
! , tide se~uences, that contain a theoretical "most probable"
nucleotide sequence capable of encoding the protein
sequences is identified.~
The ~ suitable oligonucleotide, or set of
olig~nucleotides, which;is capable of encoding a fragment
~ ~ of a cer~ain~gene (or which is complementary to such an
;~ ; 35 oligonucleotide, or set of oligonucleotides) can be syn-
WO94~10325 PCT/FI93/004
(
~i 48 622 20
~ .
thesized by means well known in the art ~see, for example,
Synthesis and Application of D~A and R~A, S.A. Narang, ed.,
1987, Academic Press, San Diego, CA) and employ~d as a
probe to identify and isolate a clone to such gene by
techniques known in the art. Techniques of nucleic acid
hybridization and clone identification are disclosed by
Maniatis, T., et al., in: Molecular Cl:oning, A Lab~ratory
Manual, Cold Spring ~arbor Laboratories, Cold Spring
Harbor, NY (1982)), and by Hames, B.D., et al ., in:
Nucleic Acid ~y~ridization, ~ A Practical Approach, IRL
Press, Washington, DC (1985))~ Those members of the above-
described gene library which are found to be-capable of
such hybridization are then analyzed to determine the
extent and nature of coding sequences which they contain.
15To ~acilitate ~he detection of a desired DNA coding
s~quence, the above-described DNA probe~is labeled with a
;; detectable group. Such dete~table group can be any material
ha~ing a detectable physical or chemical property. Such
materials have been well-developed in the field of nucIeic
20 ~ acid hybridization~and in gene~al~most any label useful in
such~ methods can be~applied ;to the present invention.
Particularly useful are radioactive labels,~such as 32p, 3H,
14Cl 3S5,~ i2sI, or the~like. Any radioactivè label ~an be
employed which provides for an adequate signal and has a;~ 25 ~ sufficient hal~-life~ :T~ sing~e stranded, the oligonuc-
leotide~`can be;ra~dioactiveIy label~led using~kinase ~
reac~ions Alternativ21y,~pDlynucleotides are also useful
as nucleic acld~hybridization pr~obes~when labeled withla
non-radioactive markér such as biotin, an enzyme or a fluo-
30~ rescent group.~
Th~s,~in summary, ~the elucidation ~o~ a partial~
protein sequence, permlts~the identificatlon of a theo~
retical~nmost proba~le~" DNA ~equence, or a set of such
sequences, capabl~e o~encodin~ such a~peptide. By construc-
35~ tlng~ a~ ~Oli~gOTlUCLeOtlde comFl-mentary~to this =heoretical
~ . . . : :
PCT/Fl93/00450
WO~J~03~5
21 .
sequence (or by constructing a set of oligonucleotides com-
plementary to the set of "most probable" oligonucleotides)~
one obtains a DNA molecule ~or set of DNA molecules)/
capable of functioning as a probe~s) for the i~entification
and isolation of clones containing a gene.
In an alternative way of cloning a gene, a library
is prepareid using an expression vector, by clonin~ DNA or,
more preferably cDNA prepared from a cell capable of
expressing the protein into an expression vector. The
li~rary is then screened for members which express the
desired protein, for example, by screening the library with
antibodies to the protein.
The above discussed methods are, therefore, capable
o~ identifying genetic sequences which are capable of
encoding a protein or biologically active or antigenic
fragments of this protein. In order to further characterize
su~h genetic sequences, and, in order to produce the ~:
recombinan~ protein, it is desirable to express the
proteins which these sequences encode. Such expresslon
~0 identifies those clones which express proteins possessing
characteristics of the desired protein. Such characteris-
tics can include the ab~lity:to specifically bind~antibody,
the ability to elicit the production of antibody which are
: capable of binding to the na~ive, non~recombinant protein,
the ability to provide a enzymatic activity to a cell ~hat
is a property of thP proteinl and th ability to pro~ide a :-:
non-enzymatic (but spe~ific) function to a:recipient cell,
among others.
` i A DNA sequence can be shortened by means khown;in
the ar~ ~o isolate a desired gene frcm a chromosomal regisn
-that contains~ more informa~ion than necessary for the
utilization:of this gene in the hosts of the inveintion. For
example, restriction digestlon can be uti1iæed to cleave
the full-length sequence at a desired location.
:
.
'
WOg4/1032~ PCT/Fl93/004~0
22
21486~2 ' ~:
Alternatively, or in addition, nucleases that cleave from
the 3 -end of a DN~ molecule can be used to digest a
certain sequence to a shortened form, the desired length
then being identified and purified by gel electrophoresis
and DNA sequencing. Such nucleases include, for example,
Exonuclease III and Bal 31. Other nucleases are well known
in the art.
;;
In the practical realization of the invention the
osmophilic yeast Z. rouxii has ~been mployed as a model.
Z. rouxii is compatible with food~production since it is
traditionally used in~ Japan for~ the manufacture of soy
sauce. The yeast has been described for instance in: T~e
Yeasts, A Taxonomic Study, Kreger-van Rij ~ed.), Elsevier
Science pubIishers B.V., Amsterdam 3984, wherein this yeast
15 is described on pages 462-465~. Other ~-arabitol-producing
yeasts like Candida polymorpha,~ T rulopsis candida,.~Candida
~tropicalis, Pichia farinosa, Torulaspora hansenii, etr., as
well as D-arabitol producing fungi like Dendryphiella
salina or Schizophyllum~ ~commune can also be used as host
organisms for the purposes of the present invention.
;The enzymes oxidi~ing D-arabitol~into~D-xylulose (EC
~; }.1.1.11) are known tQ occur in~bacteria but not in yeast
or fungi. For~ the~ purposes~ of the present invention
: Klebsiella~ terrigena is the preferred source of thè D-
arabitol dehydrogenase tD-xylulose forming) gene since it
s~ a~ ~nonpathogenic ~soll bacterium~ and it; has a high~
inducible D-arabitol dehydrogenase activity. The Klebsiella
`: ~ terrigena strain Phpl used in the examp~es~ was obtained~
f~om K. Haahtela, Helsinki University. Thè isolation o~ the
30~;~strain is described in ;Haahtela et al .,~ Appl .: ~nv.
Microbiol .~ ~ 45:~563-57~0 (lg83)). The~cloning of ~the D-
~arabitol~dehydrogenase gene~can~be conveniently achieved by
const~uc~ing a genetic` library of the K~ terrigena
chromosomal~DNA in;~ suitable veotor, for instance well
~ known, and commercially a~ailable, plasmid pUCl9. This
::~:: . :
W094tl032~ PCT/FI93/004
23
library is transformed into one of many E. coli strains
which are able to utilize D-xylulose but not D-arabitol as
a sole carbon source. E. coll strain SCS1 available from
Stratagene is an example of a suitable strain. The
transformants are then plated on a medium containing D-
arabitol as a sole carbon source and the clones able to
grow on this medium are isolated. The coding region of the
K. terriyena D-arabitol dehydrogenase can be conveniently
isolated in a form of 1.38 ~b BclI-ClaI fragment and fused
with appropriate promoter :and ~transcription terminator
sequences. The Saccharomyces cerevisiae ADCI promoter and
transcription terminator are examples of transcriptional
regulatory elements suitable for the purposes of the
present invention when the yeast Z. rouxii is used as a
hos~ organism. The sequence of ADCI is available from
: GenBank. - ~
: . Although the majority of~ yeasts and fungi possess
the xylitol dehydrogenase (EC 1.1.1.9) gene, overexpression
of the said gene will typically be necessary for the
:20 implementation of the present invention. The cloning of the
Pichia stipitis XYL2 gene encoding xylitol dehydrogenase
(EC 1.1.1.9) can conveniently be~achie~ed by polymerase
: chain reaction technology using the published information
on the nucleoti~e sequence of the XYL2 gene (Kotter et al.~
: 25 Curr. Genet. 18:493-~500 (1990)~. The gene can be introduced
into~other yea t; spe~ies without any modifications and
~ ~xpressed under control of~its own promoter or the promoter
: can be exchanged for another strong yeast promoter.
Genetically stable transfo~mants can be cons~ructed
with vector ystems:, or transformation syste~s, wher~by a
desired DMA is integrated~into the:host chr~mos~me. Such
intégration can: occur: de ~n~v o within the cell or be
: assisted by transformation with~a vector which functionally
inserts itself ln~o the host chromosome, for example, with
~:~ 35 ~ phage, :retroviral vectors, transposons or other DNA
:
WO94~10325 PCT~F193/004~0
~4~6~`~ 24
elements which promote integration of DNA sequences in
chromosomes.
The genes coding for ~-arabitol dehydrogenase and
xylitol dehydrogenase tEC l.l.l.9) under control of
suitable promoters can be combined in one plasmid constr~c-
tion and introduced into the host cells of an D-arabitol
producing organism by transformation. The nature of the
plasmid vector will depend on the host organism. Thus, for
Z. rouxii vectors incorporating the DNA of the pSRl cryptic
- lO plasmi~ (Ushio, K. et al., J. Ferment. Technol. 66:48l-488
~1988)~ are used in the preferred embodiment of the present
invention. For othier yeast or fungal species for which
autonomously replicating plasmids are unknown, integration
of *he xylitol dehydrogenase (EC l.l~l.g3~and D-arabitol
lS dehydrogenase gene~s into the host's chromosome can be em-
plo~ed. Targeting the inte~ration to the ribosomal ~NA ~DNA
encoding ribosomal RNA) locus of the host is the preferred
method of obtaining the high copy-number integration and
high;level expression of the two dehydrogenase genes such
; 20 targeting can be achieved by providing recombinant DNA
sequences on the recombinant construct sufficient to direct
integration to this locus. The genetic markers used for the
transformation of the D-arabitol-producing microorganisms
are pre~ferably dominant markers conferrîng resistance to
variQus antibiotics such as gentamicin or~phleomycin or
:
heavy metals~ such as copper, or the like. The seIectable
marker gene can either be directly linked to the DNA gene
sequences to be expressed, or introduced into the same cell
by co~transformation.
Besides introducti~on of D-arabitol deh~drogenase and
xylitol dehydrogenase (EC l.l.l.9) genes. other genetic
modifications can be used ~or constructing novel xylitol-
producing strains. Thus, the genes coding for the enzymes
of the oxidative pentose~ phosphate pathw y can be
,
~ 35 overexpressed in order to increasc the rate ofisynthesis of
- :
:: '`
`:
:
W0~4/10325 PCT/FIg3/00450
~` 25 ~ ~86'~
D-arabitol precursor D-ribulose-5-phosphate. Also, the gene
coding for transketolase-the enzyme catalyzing the
catabolism of pentulose-5-phosphates or pentose-5-
phospha~es may be inactivated by conventional mutagenesis
or gene disruption techniques leading to increased
accumulation of five-carbon sugar phosphates. Inactivation
of the D-xylulokinase gene can increase xylitol yield by
eliminating the loss of D-xylulose due to phosphorylation.
A combination of an inactivating transketolase mutation
with the overexpression of D-ribulose-5-epimerase can be
used for creating a different type of xylitol production
pathway in which D-arabitol is not used as an intermediate.
To express a desired protein and/or its active
derivatives, transcriptional and translational signals
recognizable by an appropriate host are necessary. The
cloned coding se~uences, obtained through the methods
described above, and preferably ln a double-stranded form,
can be operably linked to sequences controlling
transcriptional expression in an expression vector, and
; 20 introduced into a host cell, either prokaryote or
eukaryote, to produce recombinant protein or a functional
derivative thereof. Depending upon which strand of the
coding sequence is operably linked to the sequences
controlling tran criptional expression, it is also possible
25~ to express an~isense RN~ or a functlonal deriva~ive
thereof. ~
Expression of the protein in different hosts can
result in different post-translational modifications which
cain alter th~properties of the protein. Preferably, ~hè
present invention enrompasses the expression of the protein
o~ a functional derivative thereo~, in eukaryotic cells,
and especially in yeast.
nucleic acid molecule, such as DNA~ is said to be
"capable of expressing" a ~polypeptide if it contains
expression control sequences which contain transcriptional
WOg4/1032~ PCT/FIg3~00450
~ 6 26
``'; ';" '
`'~
regulatory information and such sequences are "operably
linked" to the nucleotide sequence which encodes the
polypeptide.
An operable linkage is a linkage in which a sequence
is connec~ed to a regulatory sequence (or sequences) in
such a way as to place expression of the sequence under the
influence or control of the regulatory sequence. Two DNA
sequences tsuch as a coding sequence and a promoter region
se~uence linked to the 5i end of~the coding sequence) are
said to be operably linked if induction of promoter
fun~tion results in the transcription of mRNA encoding the
desired protein and if the nature of the linkage between
the two DNA sequences does not (l) alter the reading ~rame
of a coding sequence, (2j interfe~e with the ability of
the expression regulatory sequences to direct the
axpression of the proteinl antisense RNA, or ~3) interfere
with the ability of the DNA template to be transcribed.
Thus, a promoter re~ion would be operably linked to a DNA
sequence if the promoter was capable of effecting
transcription of that DNA sequence. ~
The precise nature of the~regulatory regions needed
for gene expression can vary betwe n species or ce-l types,
but shall in general include, as necessary, 5~ non-
.
transcribing and 5' non-translating (non-coding) sequences -:
, . .
involved with initiation of transcription and translation
respectively, such~as the TATA box,~capping sequence, CAAT
sequence, and the like. ~Especially, such 5~ non~
transcribing control sequences will include a region which
contains a `promoter for transcriptional control of the
~operably linked ~gene. ~Such transcripti~nal co~trol
sequences can al50 include enhancer sequences or upstream
activator sequences, as desired.
Expression of~a protein in eukaryotic hosts such as
yeast re~uires;~he use of regulatory regions functional in
35 ~ such hosts, and preferably yeast regulatory systems. A
: ~ ..
,
'
PCT/F193/00450
WO~4/1032~
-~ 27 ~8~
wide variety of transcriptional and translational regu-
latory sequences can be employed, depending upon the nature
of the host~ Preferably, these regulatory signals are
associated in their native state with a particular gene
which is capable of a high level of expression in the host
cell.
In eukaryotes, where transcription lS not linked to
translation, such control regions may or may not provide an
initiator methionine (AUG) codon, dependi~ng on whether the
cloned sequence contains such a methionine. Such regions
will, in general, include a:promoter:~region sufficient to
direct the initiation of RNA synthesis in the host cell.
Promoters from yeast genes ~hich encode a mRNA product
capable of translation are:~preferred, and especially~
strong promoters~:can ~be employed~ provided they also
function as promote~s in the host cell. Preferred strong
yaast promoters~include the GALl gene promoter, glycolytic
~ene promoters such as that for phosphoglycerolkinase
(PGK), or the constitutive alcohol dehydrogenase (ADCl)
20 ; promoter (Ammerer, G. Meth. Enzymol . l~lc:l92-2nl (1983);
~ho, FE~S Lett. 291:45 49 tl991)).
As is widely known, translation of eukaryotic mRNA
is initiated at the codon: which encodes the first
methionine. Fo~ th~is reason,~:it is pref rabl to ensure
:that the linkage~between~a eukaryotic promoter and a DNA
se~uence~which encodes the desired protein, or a functional
~: derivative thereof, does not contain any intervening codons
which are capable o~ encoding a methionine.jThç presence o~
such codons.results either in a formation of a fusion
protein (if~he~AUG codon is in the same reading ~rame as
the~protein-coding:DNA sequence) or a frame-shif~ mutation
(if the:AUG~codon~is not in the same reading frame as ~he
protein-coding sequence3.
Transcrip~ional initi~tion regulatory signals can be
selected which~allow for repression or activation, so that
,
:: :
~:
1 W094/1032~ PCT/Fl93/OOqSO ~
.
21~3622 28
expression of the operably linked genes ran be modulated.
Of interest are regulatory si~nals which are temperature-
sensitive so that by varying the temperature, expression
can be repressed or initiated, or are subject to chemical
regulation, e.g., metabolite. Translational signals are not
necessary when it is desired to express antisense RNA
seguences. `
If desired, the non-transcribed and/or non-
translated regions 3' to the sequence coding for a desired
protein can be obtained by the above-described cloning
methods. The 3'-non-transc~ibed region can be retained for
its transcriptional termination regulatory sequence
elements; the 3-non-translated region can be retained for
its translational termination regulatory sequence elements,
or for those elements which direct polyadenylation in
eukaryotic cells. Where the native expression control
se~uences signals do not function satisfactorily in a host
cell, then sequences functional in the host cell can be
substituted.
The vectors of the invention can further comprise
other operably linked regulatory elements such as DNA
elements which confer antibiotic resistance, or origins of
replication for maintenance of the vector in one or more
host cells.
In anothe~ preferred embodiment, especially for Z.
rouxii, the introduced sequence is incorporated into a
plasmid vector capable of autonomous rPiplication in the
recipient host. Any of a wide ~ariety of veictqrs can ~e
employed~for this purpose.
Factors of importance in selecting a particular
plasmid or viral vector include: the ease with which
recipient cells that contain the vector can be recognized
and selected from those recipient cPlls which do not
contain the vector; the number of copies of the vector
which are desired in a particular host; and whether it is
WO94/1032~ PCT/Fl93/004~0
~? ~
desirable to be able to "shuttle" the vector between host
cells of different species.
Preferred yeast plasmids will depend on the host.
For Z. rouxii vectors ba~ed on the native cryptic plasmids
pSRl (Toh, E~ et al ., J. Bacteriol . 151:1380--1390 (1982)),
pSB1, pSB2, pSB3 or pSB4 (Toh, E. et al., J. Gen.
Microbiol . 130:2527-2534 (1984) ) are preferred~ Plasmid
pSRT303D (Jearnpipatkul, A., et~ al ., Mol . Gen. G~net.
206:88-84 (1987)); is ~an example~of useful plasmid vector
for Zygosaccharomyces yeast~
Once the vector or DNA sequence containing the con-
struct(s) is prepared for expression, the DNA construct(s)
is introduced into ~an appro~riate host ceil by any of a
variety of suitable means`, including tr~ansformation. After
~ ~he introduction of the vector, recipient cells are grown
in a selective medium, which selects for the growth o~
vector-containing~ cel~ls. Expression of ~he cloned gene
sequence(s) re~ults in the ~production of ~the desired
protein, or~ in the production of~a fragment of this
protein.;This ~expression can take place in a continuous
manner in the transformed cells, or in;a controlled manner,
~ fo~ example, by induction o~expression.
¦~ ~ To construct the hosts of~the invention that have
been altered such that they can no longer express a certain
gene product,~site-directed mutagenesis can be~performed
using techniques~known in the~art, such as gene disruption
(Rothstein,;R.S., ~eth. Bnzymol . lOlC:202-211 (1983~ ) .
IY. Productio~ of Xylitol
When ;recombinant~larabitol producing yeast,
preferably osmophilic, are~used as~hosts of the invention,
theyl~can~be grown in~high~osmoti~ pressure med~um, for
example medium conta~ining 10-60% D-g~lucose, and preferably
35 ~ ~ 25~ D-glucos~e~("Normal'~' medium usually contains only 2-3~
: , ,
WOg4/10325 PCT/Fl93/004~0
2 1 4~ 62 2 30
glucose.) High osmotic pressure medium induces D-arabitol
formation in wild type strains of osmophilic yeasts such as
. Z. rouxii. The culture medium of the recombinant and
control (wild type) strains is analyzed according to
methods known in the art, at different culti~ation times,
for the presence of xylitol. In cultivation conditions not
optimized for maximum D-arabitol yield, the experimental
strain Z. rouxii A~CCl3356LpSRT(AX)-9] produced and
secreted into the culture media both xylitol and D-
arabitol. Only D-arabitol was detected in the culture
medium of the control strain. The yield of xylitol in the
first trials ~see Table 4 in example 4] was approximately
7.7 g/l after 48 hours of cultivation.
Xylitol can be purified from the medium of the hosts
of the invention according to any technique known in the
art. For example, US 5,081,026, incorporated herein by
reference, described the chromatographic separation of
xylitol from yeast cultures. Thus, from the ~ermentation
istep, xylitol can be purified from the culture medium using
chromatographic ~steps as described in US 5,081,02
~ollowed by crystallization.
Having now generally described the invention, the
same will become better understood by reference to certain
..
specific examples that are included herein for purposes of
~5 illustration only and are not intended to be limiting
` ~unless otherwise specified.
j~ xampleis j j
I Example 1
1 30 Cloning o~ the bacterial D-arabitol dehydrogenase
`~, gene
; Rlebsiella terrigena Phpl (obtained from X.
Haahtela, Helsinki University, see Haahtela et al., Appl.
EnvO Microbio1. 45:563-57Q ~1983)) was grown in 1 liter of
lS ~B medium ~l% tryptone, Q.5% yeast extract, 1% NaCl)
-
:
W094~1032~ ~ PCT/Fl93/00450
` 31
overnight at 30 C. Bacterial cells (approximately 5 g)
were collected by centrifugation, washed once in TE (10 mM
tris-HCl, 1 mM E~TA, pH 7.5) and resuspended in TE
containin~ 1% sodium dodecyl sulfate and 200 ~g/ml
proteinase K. The sus~ension was incubated at 37C for 30
min and then exkracted once with an equal volume of phenol
and two times with chloro~orm. 3 M sodium acetate (1/10 of
volume) and ethanol (3 volumes)~ were added and the
precipltated nucleic acids~collected by centrifugation and
redissolved in 5 ml of TE~ The RNA was removed by
centrifugation of the solution through 25~ ml of 1 M NaCl
overnight at 30,000 rpm in a Beckmann Ti50.2 rotor. The
K. terrigena chromosomal DNA obtained by the above method
had an average fragment size of~more then 50,000 base pairs
~ (bp). The DN~ was~ then digested~ by ~the restriction
endonuclease~Sau3A in the~supplier's (Boehringer's) buffer
at an enzyme:DNA ~ratio of 5U/mg untiI the average DNA
fragment size was reduced to approximately 5-10 kb
~assessed~by agar~ose gel electrophoresis). The~digest was
~ 20 fractionated by electrophoresis through a 20 x 10 x 0.6 cm
; i~ 0.6% agarose gel in TBE buffer (O~G9M tris-boric acid, 1 mM
EDTAj pH~8.3j at 5;V/cm overnight,~a weIl was cut in the
agarose slab at a position corresponding to a fragment si~e
of approximate;ly 5 kb, a piece of~dialysis membrane ;was
~ ~ 25 ~fixed along the~well and~ electrophoresis was~continued~
;~ ~ until essentiall~ all the DNA~fragments~larger then 5 kb~
were adsorbed on the ~membrane. The plasmid ~DNA of pUCl9
purchased;~ from Pharmacia3~ ~was ! ~digested wi~h ~the
restriction endonuclease~ BamHI and ~acterial alkaline
; 30 ~ phosphatasè~ using~the supplier's ~buffer and~reaction
conditions.~The`~ near ~form of ~pUCl9~was puri~ied by~
preparative gel~ electrophoresi~s ~uslng ;the~ membrane
; e~lectroelution method described above and ligated with~the
5-15 k~fraction~o~ the Xle~siella terrigena chromosomal
~ DNA. The ligation~mixture was used to transform compe~ent
~ W094/l032S PCT/Fl93/00450
`2~8622 32
cells of E. coli SCSl (purchased from Stratagene) to `~
ampicillin resistance. In this experiment, approximately
10,000 re~ombinant clones were obtained. The pooled cells
~rom the transformation plates were spread onto minimal
medium plates containiny ~-arabitol (1%) as the sole carbon
source. After two days of incubation at 37~C several
colonies were obtained. Plasmid DNA was isolated from two
(fastest growing) of these clones and used ts retransform
E. co7i strain HB101, whi~h is unable to catabolize D-
arabitol but able to use D-xylulose. All the transformants
proved to be D-arabitol-utilizakion positive on McConkey
~obtained from Difco) agar-D-arabitol plates while all
control cl~nes ~the same strain transformed with pUC19)
were negative. Restriction analysis has shown that the two
~5 isolated clones contained identical plasmids. One of the
two isolated plasmids (named pARL2) was used for further
characterization. A restriction map of the cloned 9.5 kb
` (approximately) fragment of X. :terrigena DNA in pARL2
bearing khe D-arabitol dehydro~enase~gene is repr~sented in
Figure 1.
: ~ '
.
. ~ Example 2
Expression o~ the bacterial D-arabitol dehydrogenase
gene in yeast ;
25Fxom the original K~ terrigena 9.~ kb~DNA clone
containing the ~D-arabitol dehydrogenase gene an
approximately~l~8 kb SacI-HindIII fragment was subcloned
i using conve~tional recombinant DNA techniques and found t~o
contain the D-ara~itol dehydrogenase gene. The plasmid
30containing this DNA~fragment in the pUC19 vector (pADH,
where ADH mean D-arabitol dehydrogenase~ was isolated from
. coli st~ain JM110,~ digèsted with BclI and ClaI
restriction endonucleases and a 1.38 kb DNA ~ragment was
isolated by~preparative agarose gel;electrophoresis. This ~;
~; 35DNA fra~ment was ~reated with the Klenow ~ragment of DNA-
, : - .
¦ WO94/lD325 2~ PCT/Fl93/00450
. ~ 62,~? !
33
. '~
polymerase I in the prese~ce of all four deoxynuc~eotide
triphosphates and ligated with a yeast expression vector
pAAH5 (Ammerer, Meth. Enzymol. 101:192-203 (1983)) that had
been cut with ~indIII and treated with Klenow fragment
(Figure 2). The resulting expression plasmid, pYARD, is a
shuttle E~ coli-Saccharomyce~ cerevisiae vector containing
a bacterial (E. c~li) origin of replica~ion and ampisillin
resistance gene, a yeast (S. cerevisiae~ origin of
replication ~rom 2 ~m DNA, and the yeast (S. cerevisiae)
LEU2 gene for selection in yeast. The expression cassette
in~ludes a yeast alcohol dehydrogenase I (ADCI) promoter
and (ADCI) transcription terminator f~lanking and operably
linked to the K. terrigena D-arabitol dehydrogenase gene.
Saccharomyces cerevisiae strain GRF18 (MAT~, leu2-3,
112, his3-11,15) and S. cerevisiae: strain DBY746 (ATCC
:~: ~ 44773; MATaj leu2-3,11Z~his3-A1 ura3-52 t~p~-289) were ~oth
used as the h~sts for trans~ormation; with D~arabi~ol
dehydrogenas~e expression vector~pYARD described above, with
; the same results. The transformation was performed by the~
~20 standard lithium chloride~proced~ure ~Ito et~al., Bacteriol.
;~ 153:163-160~(19~83))~ using the~ LEU2 marker of pYARD for
transformant~selection. The~transformants were ~grown i~n
; liquid~culture in~minimal medium: 0.67% yeast nit~ogen base~
Difco"), 2% ~D-glucose, 100 mg/l of histidine~ and
~1 ~ 25 ~ t~yptophane~at 30~C overnight; with~ shaking.~ Cells ;were
collected~by~centrifugation, suspended in~a~mlnlmal volume~
of O.I M potassium phosphate buffer p~ 6.8, containing lmM
N~D+ and,d~1srupted wlth 0.5~mm glass~beads in~a Bead baater
apparatus ~"Biospec~products"3 for 6~ minutes with ice
~ cooling.~D-àrabitol~dehydrogenase~activlty;was measured as
describéd above.~ n ~D-arabitol-grown K. terrigena cell
extract was~used~as~a positive control ln these experiments~
and DBY746 transformed~with~pAAH5 as ne~ative control. The
results presented ~ in~ Table 2 show that D-arabitol
W094/103~5 PCT/Fl93/00450
` 1~ ~ 622 34 `.
dehydrogenase gene isolated from K. terrigena is expressed
e~ficiently in yeast.
Table2
~= _ . . ~ . _ _ . .:
¦ ~-arabitoldehydr~genaseactiYity
Microbialstrain (arbitraryunits) .
___.= ~
.~. terriBenQ Phpl :3 .~ .
DBY746lpYARDl }.0 .
DBY746lpAAH~] : `0.00
~ _ _ __ ~ ~'
Example 3
Construction of yeast'vectors for overexpression
of xylitol dehydro:genase and ~-arabitol dehydrogenasegenes
The known nucleotide sequence of a yeast (Pichi~
s~ipitis) gene, X~L2, encoding~ xylitol d hydrogenase
(Kotter et al., Curr.~ Genet. 18:493-500 (1990)) was used to
synthesize oli~onucleo~ides fQr the cloning of this gene by
the polymerase chain reaction. The t~o oligonucleotides:
CGAATTCTAGACCACCCTAAGTCGTCCC:(5~-oIigonucleotide) CSEQ ID
No.:1:] and TTCAAGAATTCAAGAAACTCA~GTGATGC ~3'-oligo-
nucleotide) [SEQ XD No. :2:~ were designed to incorporate
: convenient restr~iction sites~X~aI and EcoRI at the 5'- and
25 ~ termini of the PCR produc~. The ~5'-oligonucleotide -~
: anneals at position 1-24 of~ XYL2 and the 3'-nucleo~ide
anneals at position 1531-15~0, according to the numbering
used in Kotter et al., Curr. Genet . 18 : ~93-500 (19~0).
: 1. ~ P,ichia stipitis CBS6054i (C~ntraalbureau ~oor
Schimme1cultures, Oosterstraat 1, PO Box 273,~ 3740 AG ::
Baarn,:The Netherlands) was ~rown overnight in YEPD medium
: (1% yeast extract, 2%: peptone, 2% D-glucose), the cells .-
:~ . were collectèd by centrifu~ation, washPd once with 1 M ~.
sorbitol olution con~aining 1 mM EDT~, pH 7~5, resuspended
in the same solution and digested with Lyticase (Sigma). ;:
.
.
:~:
WO94/10325 PCT/Fl93/00450
~ 8~
The digestion was controlled by monitoring the optical
; density at 600 nm of a 1:100 dilution of the cell
suspension in 1% SDS. The digestion was terminated when
this value dropped to approximately one seventh of the
s original. The spheropIast suspension was then washed four
times with lM sorbitol solution. The spheroplasts were
lysed in 1% SDS and krea~ed with 200 ~g/ml proteinase K at
37C for 30 min. After one phenol and two chloroform
extractions, the nucleic acids were ethanol precipitated
and redissolved in a small volume of TE buffer. The
integrity of the chromosomal DNA was checked by agar~se gel
electrophoresis. The average DNA fragment size was higher
then 50 kb. PCR was p~rformed using Tag DNA polymerase
(Boehringer) in the supplier's buffer. The thermal cycle
was 93C - 30 sec, 55OC - 30 sec, 72~C - 60 sec. The PCR
product was chloroform extracted, ethanol precipitated and
' digested with EcoRI and XbaI under standard conditions.
¦ After agarose gel purifica~ion, the DNA fragment was cloned
` into XbaI and EcoXI cut pUC18 (plasmid pUC~XYL2)).
¦ ~ 20 Subsequent ~restriction analysis confirmed that the
restriction map of the:cloned fragment corresponds to the
l nucleotide sequçnce o~ P. stipitis XYL2 gene.
I Yeast plasmids for overex~ressing D~arabitol
; dehydrogenase and~xylltol dehydrogenase were cDnstructed as
illustrated ~y Figure 3 and Figure 4. To change the
flanking rest~iction sikss o~ the D-ara~itol dehydrogenase
.
~ expression cassette of plasmid pYARD/ the whole cassette
: was excised by~BamHI di~estion and cloned in~o the BamHI
cleaved pUC18. The resulting plasmid pUC(YARD) was digested
wlth SalI and EcoRI and:the sole~2.0 kb DNA frag~ent was
; lsolated by preparatlve gel eIectrophoresis. This fragmPnt
was~ ligated with a 1.6 kb Hi~dIII-EcoRI DNA fragment
~:: isolated from the pl smid pUC(XYL2) and the 6.6 kb fragment
; ~ ~f E. co1i yeast s~uttle vec~or pJDB207 tBeggs, J.D. Nature
~ 35 275:104:-109 ~1978)~ d:igested with HindIII and SalI. Plasmid
;:
:, .
: '
WO94/103~ PCT/~193~04~0
21~862~ 36
pJDB(AX)-16 was isolated after transformation of ~. coli
- with the above ligation mixture. This plasmid is capable of
- replicating in both E. coli and Saccharomyces cere~isiae.
In S. cerevisiae it directs the high level synthesis of
both D arabitol dehydrogenase and xylitol dehydrogenase.
Plasmid pSRTtAX)-9 was synthesized by ligation of the 4.7
kb SalI fragment from the plasmid pJDB(AX)-9 and the linear
form of the plasmid~pSRT303D (J~arnpipatkul et al., Mol.
~e~ Genet. 206:88-94 (1987)) obtained by partial
hydrolysis with SalI.
Example 4
Construction of yeast ~trains secreting xylitol
Zygosacc~aromyces rouxii ATCC 13356 was transformed
with the plasmid pSRT(AX)-9: by a slight variation of a
previously described method (Ushio, ~. et al., J. Ferment.
Technol. 66:481~488 (1988)). Briefly, Z. rouxii cells were
grown overnight in YEPD medium (giving a ~ulture with
: optical density at:600 nm of 3-5), collected by low-speed
centrifu~ation, washed twice in l M sorbitol~ 1 mM EDTA
solution pH 7.5, resuspended in l/5 of the original culture
volume o~ the same solution containing 1% 2-mercaptoethanol
and digested at room temperature with lyticase tSigma). The
digestion was followed by diluting a suitable aliquot of
the cell suspension:into 1% SDS solution and measuring the
optical density of~the diluted sample~at 600 nm~ When this
value dropped to 1/7 of the original, the digestion was
terminated by coollng the suspension on ice and washing (by
a lQ min, 1000 rpm centrifugation at 0C) with the sorbitol
solution unkil the mercaptoethanol smell could no longer be
detected. The spheroplasts wexe washed once with cold 0.3
:~: M calclum chl~oride solution in l M sorbitol and resuspended
~:` in the same solution in about 1/4 of original cult~re
volume. 200 ~1~ali~uots o this suspension and 10-20 ~g of
: :35 ~ plasmid DNA were mixed and incubated at 0C for 40 min. 0.8
:
PCl`/F193/Oû450
WO~4/1032~
i ` ~ 21~86' 1 :-
37 22
..
ml of ice-cold 50 % PEG-6000 solution containing 0.3 M
calclum chloride was added ~o the spheroplast suspension
and incubation in the cold was continued for 1 h. The
spheroplasts were concentra~ed by cen~rifuga~tion at 4000
S rpm for 10 ~in in a~table-top centrifuge, resuspended ln 2
ml~ of ~YEPD~ containing ~l M ~sorbitol and left for ;
re~eneration~overnight at room temperature. The regenerated
~cells~were pl~ated~onto~YEPD p~lates~containing 50-lOO ~g/ml
of~gentamicin~and incubated~a~t~3~0~C~or~4-6 days.
~ The trans~ormants;~;were grown~in liquid~YEPD medium,
cell extracts~prepàred~ as ~described~ for S. cerevisiae .,
(Example 2), and the activities o~ D-arabltol dehydrogenase
~and xylitol dehydrogenase measured. The results of these
measurements~are~compared~with~similar measurements made~in
~o~her organisms~in~Tabl;e 3~They~show~that~both~ g~enes are~
expressed ef~ficiently~in~ rouXii~
The~cell~s~ of Z~.~rouxii~ATCC~;13356 *ransformed th~
pSRT(A~ 9 were~ grown for W b~ 5 in 50 ~ml of D ~:
cont-inl~ ~5~wt~ D g lo~o~`~m`l flas~ on a rotary~
sha~er~ c ~O~C ~n e~
anal~ d~bo~, tah~ rd~HP~C and gas chromatogr~phy. The~
'~s~ in~the~culture~-~medium~of un~ransformed~lZI~lro~xii~ ;~rownlin
~ the~same~media~ without~gsntamicln . ~
WO 94/10325 PCrlF193/00450
. .
38
21~6~2
.
.
Tuble 3
.
Activities of D-arabitol dehydrogenase and
xylitol dehydrogenase in different :
organisms and strains
~ .
Organism ~D-arabitol xylitc)l
and strain ~ ~ Plasmid (~) dehydrogenase -dehydrogenase
I (lU/mg protein) (lU ml~ p~ef~)
l~lebsiella temge~la: None ; ~ 0.48 ND- (**3
: S. cerevlsiae~ : None 0 00 ~ 0 01
S. cerevisiae pJDB(YARD) . 3.0 < 0.01
DBY746 ~
5. cerev~siae pJDB(AX)-16 ~ 1.9 1.2
~ ~ < 0.02
ATCC 13356 pSRT(AX)-9 ~ ~ ~ 1.3 0.7
- :
(*) The plasrmids are desiDned to express the foilowing enæymes:
pJDB(YARD) - D-arabitol dehydrogenase
pJDB(AX)-16 - D-arabitol dehydrogenæe and xy}itol dehydrogeinase
pSRT(AX)-9 - D-arabitol d~hydrogenase~and xylitoi dehydro~enase
: : (**): ND - Not determined
~: ~ . .
~: ,
,
:,
: ,
: . ~
- :
:::~: : :
~:
'
PCI'/F193/00450
WO94/10325
.:
_ ~ ._
Table4
Productionofxylitolby~eZ. ro~ii AT~C13356
carrying~epl~midpSRT(AX,i-9
. ~,.
~ Experiment1 Expérimen~2
Cultivation~ime O Medium with M~ium wi~out
Ye~t~Extract ~ Yeast-Extract -
, ._~5 ~ - ~
: __O_ 0.0 ~0.0_
l44 ~ ~ ~ ~ 7.S ~ 6~
Using a similar appro~ch, strains producing xylit~l
from other carbon sources can be constructed. For example,
:Candlda: tropicalis~ is: capable of converting n-alkanes inko
D-a~abitol (Hattori, K.~;and Suzuki T., Agric. Biol . Ch~em.
5~ 38:1875-1881 (1974)~) in good ~yield. The 4.7 kb SalI
; fragment from the~plasmid pJDB~AX~-9 can be inserted into
the plasmid~pCUl (Haas~,~ L.~et~al~ J.~Bacteriol. 172~:4571-
4977~(19903)~and~used to trans~form~C~;tropicalis straln~SU~
~; ~ 2 (ura3j. Alter~atively,~the same~expression casset~e can
~tO ~ be transf~ormed into a~prototr~ophlc C:.~ tropicalis ~ strain on
a plasmid vec~or bearing a dominant~select}ve marker.
xa~p~le 5 ;~
Construction~of an~integrative~ dominant selection
vector;for~the ~expression~of arabitol dehydrogenase~and
xylito~ dehydrogenase and transformation ~of Toru70psls
cand id a
Chromosomal~DNA~was~isolated~from T.~ ~andida (ATCC
Z0214)~ by~a~ procedure~similar t~ the standard pFocedure
used~for~S. ;-cerevisiae~ However,~preparation~ of T.~ candida
20 ;~spheroplasts~ r quired ~;a ~high~ concentration of ~Lyticase
(Sigma)~ approx.~50~j~00~0 U~per ~lO g of cells and l~ong~
incubation~;-time~ from~ several hours to oYernlght
WQ94/18325 PCT/FI93/004~0
214~622 40
incubation at room temperature to achieve efficient cell
wall lysis. The buffer for spheroplast preparartion was lmM
EDTA, pH 8, containing 1 M sorbitol and 1~ mercaptoethanol.
The spheroplasts were washed three times with the same
buffer (without mercaptoethanol) and lysed in 15 ml of 1~
SDS. Two phenol extractions were performed immediately .-
after cel~ lysis and the DNA was precipitated by addition
of 2 volumes of ethanol and centrifugation (5 min at lO,ooo
rpm). The DNA was washed twice with 70% ethanol and dried
under ~acuum. The DNA was dissolved in 5 ml of 10 mM tris-
HCl buffer containiny 1 mM EDTA, RNAse A was added to 10 :-
~g/ml concentration and the solution was incubated for 1 h .-~
at 37C. The integrity of the'DNA was confirmed by agarose :
gel electrophoresis using uncut lambda DNA as a molecular
weight reference. -
: 200 ~g of the chromosomal DNA of T. candida was cut
with HindIII and Eco~I, the :digest was applied into a 6 cm
wide well on an 0.7% (8x15x0.8 cm) preparative agarose gel
and separated by~electrophoresis. A l~cm wid2 strip of the .-~
gel was cut out of the ~el and blotted onto a positively
charged nylon membrane (8Oehringer 1209 299). The blot was
probed with a lOkb DNA fragment of Zygosaccharomyces bailii
r~NA excised with SalI from the plasmid pAT68 (K. sugihara
et ~1., Agric. Biol. Chem. 50(6) :1503-151 (1986)). The
2S probe was labeled and the blots were:developed:~sing DIG
DNA Labeling and Detection Kit (~oehringer 1093 657)
according to the manufacturer's instructions. Three
hybridization~ bands were observed corrèsponding to DNA
fragments of approximtely 4.5, 2.7 and l.1 kb. Using the
: 30 blot~ as a reference, a band corresponding to thé largest
: ~4.5 kb) hybridizing DNA fragment was cut out of the :~
remaining portion of the preparative gel, the DNA was
electroeluted and ligated~:with pUCl9 cut by EcoRI and
HindIII. ~ ~ ;
:
,:
PCT/FI93~00450
WO~4/10325
21~8622
41
The ligation mlxture ~as used to transform E. coli.
The transformed bacteria were plated onto a charged nylon
membrane (Bio-Rad 162-0164) laying on the agar surface of
a plate containing LB medium with ampicillin. After 24 h
incubation at 37~C, the membrane was lifted and in situ
lysis of bacterial colonies was performed according to the
manufacturer's instructions. No replica plates were needed
since E. coli Ipenetrates this type of membrane and after
the filter is lifted there is~a ~isible~trace of every
bacter.ial colony on the agar surface. The ~membrane~was
probed with the same Z. bailii rDNA:fragment using the same
: ~IG detection kit as aboYe. A:~number ~f positive clones
were identified (approximately 2-5% of all clones). A
restriction ànalysis o;f the plasmid mini~preparations~from
~ 8i;~ hybrldization-posltive ~lones~ and 4~:hybridization-
negative clones~was performed usin~ a mixture of EcoRI,
klndIII and EcoRV. All hybridi:zation-positive clones
~ produced identica;l re5triGt~ion~ fragment patterns (with
;characteristic fragments of~O.S5 and 1.5~kb) wh.ile:the~same
20~ patterns~of the~ hybridi2at~ion-ne~gatIve ~clones were all
different. The~;plasmid: DN~;from~ one of~ hybridization-
~positlve clones;was iso`lat~ed~:on preparatlve scal~ and name
~: ~ pT~rDNA. It~wals ~concluded~ that~ the cloned piece: was ~a
~ ~ fragment~of~ candlda~ rDNA::because~ it hybridized~
:~ ~ 25 ~strong~y with~rDNA of~Z. bailii and 2) it~was~clonèd~from
the~ partially enr~iched~T~ candida ~ Ghromosomal DNA digest~
: ~ith high:frequency (rDNA is known to be represented by
:aboutli~lOO~ciopi~es in~yeast~). k partial r~striction map~of
: the~cloned DNA:fragment is~shown:in Figure 5.
30 ~ A~p;lasmid~:combining the~rDNA fragment~of ~ candlda~
with~ a~domlnant :selection~;marker~ wasl:~oonstructed; as
fol~lows~:~Plasmid~pUT3~3~2 ~6atignol,:A., et~:al.,~ene 91:35-~
41~(19~90)~ was cut:~wi~h~HindIII and XpnI,~the 1.3 kb DNA
frag~en~was:: isolated:~by~agarose~ electropho~resis, and
35~ gated:wi~h~the 4:.5 kb:~HlndIII-EcoRI fragment from pTCrDNA
: ~ ~
~;` W~4/1032~ PCT/~193/00450
` : ~ !
, ' i
6 2 2 42
,:
and pUC19 digested with EcoRI and KpnI (Figure 63. The
ligation mixture was transformed into E. coli and a clone
bearing the plasmid pTC(PHLE) was identified by restriction
analysis.
PTC(PHLE) was partially digested with SalI and the
linear form of the plasmid was purified by agarose gel
electrophoresis. It~was ligated with a 5 kb SalI fragment
isolated from pJDB(AX)-16 tExamp~le 2). Plasmid pTC(AX~ was
identified ~mong the clones obta~ined after transformation
of this ligation mixtur~ into E. coli (Figure Ç). This
plasmid contains the following functional èlements:
a) bacterial phleomycin-resistance gene under con-
trol of a yeast promoter and`transcription terminator en-
: abling the dire~t selection o~ ~:the yèast cells transformed
~ 15 ~by this plasmid;
: . ~ b) a piece of T. candida rDNA providing a target for
: :homologous recombination wikh T.~ ca~dida chromosome and
: improving:the efficiency of transformation;
~: :c) the~ expression~casse~te~for arabitol-dehydroge-
- 20 ~ nase and xylitol ~dehydrogenase:genes pro~iding for the ~
syntheseis of the two enzyme~s ~of arabitoi--xylitol ;
conversion pathway.
. ~ : Example 6
Transformation of T. candida:and analysis o~ xylltol
~ 25: :prcduction
;: ` The plasmid pTC ~AX) was used to transform the
Torulopsi~s candida s~rain ATCC 20214. T. candlda was grown ..
for 36 h in ~EPD medium:containing lQ% glucose. The cells
were:collected~by centrifugation (2000 rpm for 10 min at
:;: 30~ 4C) and washed~three~times with:~sterile 1 M sorbikol. The
cell pellet~was suspended~in~an equal~volume of cold 1 M
sorbitol, 200 ~1~ali~uotes~were mixed with pUT~AX) DNA (~o~
100 ug)~and then transferred~in~o ice-co~d 2 mm electrode
gap electroporation cuvettes and electroporated using
-
,
: :
:
WO94/10325 PCT/Fl93/00450
43 ~ 2~ ~
;..
. .
Invitrogen ElectroPorator apparatus with the following
settings: voltage 1300 V, capacitance 50~F, parallel
resistance 150 n. The cells were transferred into 2 ml of
YEPD containing 1 M sorbitol and incubated ovenight at 30C
on a shaker. The transformed cells were collected by low
speed centrifugation, and pIated onto plates containing
YEPD medium titrated to pH 7.5 and containlng 30 ~g/ml of
phleomycin. The plates~were in~ubated at 30CC for 7-10
days. Most of the yeast colonies that developed during this
time were background mutants since similar number .of
:co~onies appeared also on the control plates (which contain
cells trea~ed similarly:but without addition of DNA). To
distinguish true transformants from spontaneous mutants,
the chromosomal ~NA was isolated from 72 individual yeast
`15 c.olonies by a scaled down :procedure for :isolating
. candida chromosomal DNA described~above. 10 ~g of each
: of these DNA preparations was cut with a mixture of EcoRI
and BamHI. The digests were sep:arated on a 1% agarose gels
and then blotted onto a positively charged ny~on membrane
:as described in~Example 5. The blots were probed with DNA
from the plasmid pA~H (Example 2~ which contains arabitol-
: ~ : dehydrogenase sequences ~and :pUC sequences but no DNA
f~ragments of yeast origin (to avoid hybridization between
~ ~ possible homologous yeast sequences).;The~probe was labeled
:: 25 and the blots were~developed using DIG DNA~Labeling and; ~ Detection Kit ~(Boehringer 1093 657). Only one clone
(T. candida::pTC(AX)) with a hybridization signal
compatible~with the structure of;the transforming pla~smid
(three bands `in the 2-3: kb. region) was discovered
: ~30 :~indicating~a very:low transformation e~ficiency. A positive
: hybr~idization: signal ~was detected fvr one more clone,
~:~howe~er, the:position~of the only hybridizing band (about
~7 kb) indicated that either Qnly a fragment of'the
: : pT~ X) has integrated into yeast chromosome or some
~35 :rearrangement occurred at the integration site. We assumed
::; ;::`~ ~ : :
W094/1032~ PCT/FI93J004~0
I
214~622 44
that the plasmid had integrated into the T. candida
chromosome. This assumption is compatible with the
observation that after growth in non selective medium and
cloning, all clones of T. c~ndida: :pTC(AX) retain the
phleomycin resistant phenotype.
The T. candida: :pTC(AX) transformant was grown in
YEPD medium containing 10~ glucose for 36 h, and the
arbitol dehydrogenase and xylitol dehydrogenase activities
were measured as described in Example 4. The results are
presented in Table 5. : -
. . . _
Table S
Arabitol dehydro~enase and~xylitol dehydrogenase activities in w;ld type ~:
T. candida and the strain trans~ormed with pl`C(AX~.
(~U/m~ protein)
_ . _ _ ~ . , _~
~ ~ 15T. candida : Arabitol dehydrogenase Xylitol dehydrogenase
: . _ _ . . .
Wildt~e 0.02 0.03 .
~ , _ . _ .
Transformant 00~ 0.05
The ackivity of xylitol-dehydr:ogenase was not~significantly
~:~ increased over the activity level of endo~enous T. candida
xylltol dehydrogenase. The ~activity: of plasmid-encoded
arabitol-dehydrogenase (EC 1.1.1.11) ~was di~ficult to
separate from the actiYity of endogeneous~synonymous but
~: different (ribulose-forming, EC 1.1.1.) arabitol dehydro~
: genase~ The only definitive conclusion from this experiment
was that the expression level of both enzymes was much
wer than in Z. rouxii. At~empts to increase the piasmid
copy number ~and the expression level of the two
. dehydrogenases of the integr~ted plasmid by cultivating
: T. candida: :pTC(AXj~on media with ihcreasing concentrations
; 30 o~phleomycin were not success~ul.~
The xylitol pxoduction by ~he ~. candida::pTC(AX)
~: was tested after growing it on YEP~ containing 10% glucose
:`
:
':
WO94/10325 ~ PCr/F193/OMS0
-
for 5-7 days. In three separate experiments, the
transformant produced l.l; 1.6; and 0.9 g/l xylitol, while
no xylitol was detected in the culture medium of the wild
type T. candida by HPLC. The detection limit of the
analytical method we employed is low~r then O.l g/l
Therefore, it is possible to conclude that xylitol
production by T. candlda: :pTC(AX) is in fac~ determined by --
the plasmid.
Example 7 `.
Transformatlon of Candida p~lymorpha with
arabitol-dehydrogenase and xylitol-dehydrogenase genes. -'
In srder to introduce arabitol dehydrogenase and
xylitol-dehydrogenase genes into Candida polymorpha, a
mutant in the orokidine phosphate decarboxylase gene
lS ~hereinafter called also URA3) was isolated using a
modification of the method of Boeke et al. (Boeke, J~D., -~
et al., Mol. Gen. Genet. 197:345 346 ~1984) ), C. pol~morpha
strain ~TCC 20213 was yrown for 24 h in YEPD, the cells
were collected by centrifugation (2000 rpm, lO min;, washed
with water two times and suspended in three volumes of
sterile O.l M sodium phosphate buffer pH 7Ø Ethyl
methanesulfonate was added to l~ concentration and the
cells were incubated for 2h at room temperture~ The
reaction was stopped by transferring the cells into O.lM
: sodium thiosulfate solution and washing them three times
with sterile water. Mutagenized cells were transferred into ~;;
; 0.5 liters of YEP~ and grown at 30C with shaking ~or two
days. The yeast was collected by centrifugation, washed two
times with water a~d transferred into l liter of medium
containing 0.7~ Yeas~ Nitrogen Base (Difco), 2% glucose ~SC ..
: medium? and incubated on a rotary shaker for 24 h at 30C.
l mg o~ nystatin was a~ded to th~ culture and the .'
incubation continued for 4 hours. Nystatin-treated cells
"
were separated from the medium by centrifugation, washed
,~
:'
WO94~1Q325 PCTtFl93/00450
!
2i~8~22 46
two times with water, and transferred into 1 liter of SC
medium containing 50 mg/liter of uracil. The cells were
incubated ~n a rotary shaker for 5 days and then plated on
SC medium plates containing 50 mg/liter uracil and 1
g/liter of fluoroorotic acid. After incubating the plates
for two weeks at 30~C, approximately 400 fluoroorotic acid
reistant colonies were obtained and all of them were tested
for uracil auxotrophy. Five uracil-dependent clones were
isola~ed. However, three clones did grow on uracil-free
. .
medium, although at a reduced rate. Two clones (named
C. polymorpha U-2~and C~ ~polym~rph~ U-S) which had a clear
uracil-dependent phenotype were used for transformation
experiments.
Cloning of the C. polymorpha URA3 gene was achieved
by a conventional strategy~ The~chromosomal DNA was
isolated by the;method described in Example 5. The DNA was
~`~ partially cut with Sau3A and~fractionated on agarose gels.Several fractions were collected and their molecular size
distribution was checked by analyti~al gel elec~rophoresis.
The fractions in the range~of 5 to 10 kb were used for
cloning experiments~. The vector used for construction of
the library, pYEpl3 (Broach et al., Gene 8:121-133 (1979)),
contains the S. cerevisiae LEU2 gene, 2~ origin of
replication and a unique restrlction site for Bam~I. The
:~ 25 Yector~ was: cut with BamHI, purified by agarose gel
~; ~ electrophoresis ~and~ dephosphorylated wlth~ bacterial~
alkaline phosphatase. 5e~eraI independent vector
preparatlons and ligation conditions varyin~ the vector to
insert r!atio and reaction volume) were tested in small
scale experiments to optimize for~ the lar~est number of
transformants and highest~percentage~of recombinant clones
; (analysed by restr~iction analysi5 of plasmid minipreps from
r~ndom clones).~ The~large scale ligations were performed
using the optimized c~nditions and transformed into ~. coli
strain X~1-BLUE. The constructed library included about
; ~ :
- . .
W094/10325 PCT/Fl93/004~0
47 ~2 ~
lS,000 primary transformants approximately 90~ of which
were insert-containing.
Yeast strain DBY746 (MATalpha, leu2-3,112, his3-A1,
trpl-289, ura3-52) was transformed with a C. polymorpha
s gene library. Each library pool was transformed into
S. cerevlsiae separatel~ using about 20 ~g of plasmid DNA
and plating the:transformation on one plate supplPmented
with uracil, tryptophan and histidine (i.e. using only
leucine selection~. 3,000-10,000 yeast transformants per
plate were obtained. The yeast transfor~ants wPre then
replica plated on plates with mininal medium supplemented
with tryptophan and histidine (uracil minus plates).
Control replicas on histidine-histidine (uracil minus
plates~. Control replicas on histidine-minus and
tryptophan-minus plates were also made. One to four uracil-
independent clone~ appeared on almost ever~ plate. The
histidine independent and tryptophan-independent isolates
were also obtained, however the:number of isolates was 2-3
times lower then for UR~3 isolates.
20Plasmids from six of the uracil~independent clones
were rescued into E. coli, isolated on a preparative scale
and used ~o re-transform DBY746 to leucine prototrophy. lO-
: 20 random colonies from each transformation were then
checked for uracil dependence. Five out of six rescued
25plasmids ~ransformed DBY746 to the Leu~ Ura~ pheno~ype.
~estriction analysis of the five plasmids named xevealed
very similar restriction patterns. Those patterns were too
1 complex to produce~an unambiguous restric~i~n mapjof khe
cloned fragment. However, it was found that HlndIII
30digestion ~enerates in all clones a fragment covering most
o* the ~NA~ insert (approximately 4.5 kb). This fragment
from one of the C.: polymorpha URA3 isolates pCP291 was
puri~i2d ~y agarose gel electrophoresis and subr.loned into
pJDB(AX) partially digested with HindIII. The structure of
'
W094/10325 PCT/FI93/00450
. : 48
6~2
the plasmid pCPUtAX) isolated as a result of this cloning
experiment is shown in Figure 7A~Z
Transformation of both C. polymorpha U-2 and C.
polymorp~a U~5 was attempted using the same electroporation
conditions as described in Example 6. The electroporated
cells, after overnight shaking in YEPD containing lM
sorbitol, Zwere plated on SC medium plates. After 10 days
of incubation at 30C,~approximately lOO colonies were
bbserved on the plate~ containing C. polymorpha U-2
transformed with pCPU(AX), while the number of colonies on
the control plate (containing similarly treated cells of
this strain without added DNA) was only 14. C. polymorpha
U-5 failed to demonstrate ,a signficant effect! in a
transformation experiment over the no-DNA control. Three
` 15 ra~ndom clones from the C. polymorpha U-2 transformation
: plate were first streaked on a fresh SC medium plate and
these.streaks used ~o inoculate 100 ml cultures of YEPD
containing 15% glucose. The control culturP was inoculated
with C. polymorpha U-2. After incubation on a rotary shaker
: 20 (200 rpm): at 30C for 10 days, the xylitol content in the
culture medium was:analysed by~HP~C. The results of this
experiment arè pres~nted in Table 6.
,
Table 6 ~
:: : ~ ~
: Xylitol:;productionbyC. polymo~ha U-2
~ ~ ~nm~ wi~pC~U~AX) .
~ Strain ¦Xylitol(m~/ml) :~
1 `1 ' ` i ~ ':: ~---- O O 1:
C. polymorpha U-2
, _ _ . . ~
C.~polymorp~a U-2::pCPU(AX)-I ~ O.S :
"
C. polymorpha U-2::pCPU(AX)-2 00 ..
30; ~ C polymorpha U-2-:pCPU(AX)-3~ 2.1
. _ ~ _
: : :
,
-
WO94/1032~ PCT/Fl93/00450
. ,~ ' !
49 ~ ~ :
Considerable variation in the level of xylitol production
betw~en different clones was observed. It ~ay be a :~
consequence of integr~tion of the pasmid pCPU(AX3 at
different loci of the C. p~lymorpha chramosome. Strain
C. polymorph~ U-2::pCPU(AX)-2 is probably a reuertant and
not a true transformant. However, these experiments clearly
demonstrated that th~ arabitol-xylitol pa~hway may also be
introduced into C. polymorpha.
Example 8
Cloning of the enzymes of oxidative pentose
phosphate pathway and their overexpression in osmophilic
yeast
The first enæyme of the oxidative pentose phosphate
pathway - D glucose~6-phosphate dehydrogenase is coded in
S. cerevisiae by the ZWFl gene. The sequence of this gene
is known (Nogae T., and Johnston, Mo Gene 96:161-19 ~1990);
i . Thomas D. et al !, The EMBO J~ 10:547-553 (1991)). The gene
including the complete coding~region, 600 bp of the 5'-
noncoding re~ion and 450 bp of the 3'-noncoding region has
20 been cloned by PCR using the two oligonucleotides~
CAGGCCGTCGACAAGG~TCTCGTCTC (5'-oligonucleotide) [SEQ ID
No.:3:] and ~ATTAGTCGACCGTT~ATTGGGGCCACTGAGGC (3'-olig~-
nucleotide) [SEQ ID No.:4:]. The 5~-oligonucleotide anneals
at positions 982-1007 and the 3'-oligonucleotide anneals at
25 position 3523-3555 in the numbering of D-gluccse-6-
phosphate dehydrogenase as described in Nogae T., and
Johnston, M. Ge~ 96:161-19 (1990). The chromosomal 4NA was
isolated from S. cereYisiae strain GRF18 by the method
described in Example 3. The PCR parameters were the sam as
- 30 in Example 3~ The amplified DNA fragment containing the
ZWF1 gene was digested with Sal I and cloned into pUC19
di~ested with the same xestrictase resulting in plasmid
pUC(ZWF). The identity o the cloned gene was checked by
restriction analysis.
.
W094/1~325 PCT/~1~3/00450
2 ~ 4~ 6~ 50 ~-
The second enzyme of the pentose phosphate pathway,
6-phosphogluconic acid dehydrogenase is coded in E. coli by
the gnd gene. The nucleotide sequence of this gene is known
(Nasoff, M.S. et al.~ Gene 270253-264 (1984)). In order to
clone the gnd gene from E. coli, the chromosomal DNA was
isolated from the E. coli strain HB101 by a method
identical to the method used for isolation of the
Klebsi~lla terrlgena ;DNA (Example 1). The oligonucleotides
(GCGA~GCTTAAAAATGTCCAAGCAACAGATCGGCG [SEQ ID No.:5:j and
GCGA~GCTTAGATTAATCCAGCCATTCGGTATGG~[SEQ ID No.:6:~) for the
PCR amplification of the gnd gene were designed to amplify
only the coding region and to intrcduce HindIII sites
immediately upstream of ,the initiation codon and
immediately downstream of the stop codon. The 5'-
oligonucleotide anneals at positions 56-78 and the 3'-
oligonucleotide anneals at position 1442-1468 in the
. numbering of 6-phosphogluconic acid dehydrogenase as
¦ described in Nasoff, M.S. et al., Gene 27:253-264 (1984).
l The amplified DNA fragment was digested with HindIII and
! 20 ligated with the HindIII digested vector pU~l9. Ten
.: independent apparently identical clones of the resulting
plasmid pUC~gnd) were pooled~ This was done in order to
avoid possLble problems assoaiated with the sequence errors
which might be introduced durlng~PCR amplification. The
coding region of the gnd ~gene was fused with the S.
,
cerevisiae ~DCI promoter a:nd transcription terminat~r by
transferring the 1.4 kb HindIII fragment from the pU~g~d~
pool into the expression vector pAAH5 ~Ammerer~ Meth .
t; ! I ' Enzym~ dl:l92-203 (1983~. Several independent clones of
the resulting plasmid pAAH(gnd) were transformed into S.
cerevisiae strain ~GRF18..by the lithium chloride procedure
Ito et al.,: J. Bacteriol. 153:163-168 (1983)3 and the
activity o~ 6-phospho-D-gluconate dehydrogenase was
~: ~ measured in the tran formants. In:all the tran~formants,
the activity of the 6-phospho-D-gluconate dehydrogenase was
~;
W094~10325 PCT/F193JOOq50
51 ~6~
elevated several times relative to the untransformed hos~
indicating that the bacterial 6-phospho-D-glu onate
dehydrogenase can be efficiently expressed in yeast. The
clone of pAAH(gnd~ which produced the hig~est activity in -~
yeast was chosen for further constructi3ns~ The cloning of
the ZWFl and gnd genes as well as the construction of the
pAAH(gnd) plasmid are illustrated by Figure 8 and 8a.
In order to overexpress si~ultaneously both D- ~:
glucose-6~phosphatedehydrogenaseand5-phospho-D-gluconate ~:
~0 dehydrogenase genes in an osm~philic yeast hos~, the ~:
plasmid pSRT(ZG) was constructed. The m~.thod for
constructing this plasmid is illustrated by Figure 9.
Briefly, the 6-phospho-D-gluconatedehydrogenase expression
casse~te ~rom th~ plasmid pAAH~gnd) was transferred as a
3.1 kb Bam~I DNA fragment into BamHI cut pUC19. The
resulting plasmid pUC(ADHgnd~ was cleaved with SacI and
XbaI and a 3.1 kb DNA fragment was purified by ~garose gel
electrophoresis~ This fragment was simultaneously ligated
with two other DNA fragments: 2.5 kb fragment of the
pUC(ZWF) obtained by digestion with SacI a~d partial
digestion with Pst~ and a vector frayment of the plasmid
pSRT(AX)-~ ~Example 3) diges~ed with PstI and X~aI. The
structure of the resulting plasmid~pSRT(ZG~ was confirmed
by restriction analysis. After transforming Z. rouxii ATCC
13356 with pSRT(ZG) (by the method described in Example 4)
the activi~y of D-glucose-6~phosphate dehydrogenase and 6
phosphQ D-qluconate dehydrogenase was measured in the
~transformed strain. Both enzymes had approximately twe~ty
times higher acti~ities in the transformed strain than in
t~e untransforme~ control ~Table 7). Similar methods can be
used to achieve overexpression of thD. two genes coding for
enzymes of the oxidative part of the pentose phosphate
pathway in other yeast species. H~wever, since there are no
vectors capa~le of being maintained as extrachromosQmal
plasmids in most yeast species other than Saccharomyces or
:~ .
W094/10325 PCT/FI93/00450
.
~ 52
'''' 214~62~
Zygosaccharomyces - integrative transformation is the only
useful method for such hosts. The pre~erred type of
integrative vectors are the vectors targeted for
integration at the ribosomal D~A locus sinc ~ectors of
this type provide ~or high copy number integration and
consequently for higher exp~ession level ~Lopes, T.S.
et al., Gene 79:199-206 1989)).
Table 7
Activlty of the D-glucose-6-phosphate dehydrogenase and
6-phospho-D-gluconate dehydrogenase in ~ rou~ii ATCC 13356
transformed with pSRT(~G) and untransformed control
. , G~ nole/min~mg of prot~ 'in) _
'Y:east strairi~ ',' . ' .',D,-gluc06~-P., :.. ~ 6-P-Giuconate -'
. :..: . , ....::..:,..~ ., .,': ~:'. `dehydrogënasè..,~ ' ;: dehy~ogenase .,,'
_ ~ ,.
Z rouxii 0.33 0.45 ~ ,~
(untransformed)
__ _ _ _ . .. .___
æ rou~ii 7.3 7.7
lpSRT(ZG)] : J:
' ~ , . _ _ __._ '''
,'
. ~ Example-9
: : Construction o~ the:transketolase mutants in yeast
~The transketolase mutants in yeast can be Qbtained
most conveniently~by a site directed gene disruption method
although conventional methods of chemical mutagenesis are
also applicable. A homologous transketolase gene cloned
from the yeast species in which the:mutation is desired
will generally~be necessary to apply~the gene disruption
technology although sometimes a heterologous clone from a
very clo~ely related species~can also be used. The sequence
of the transketolase gene from S. erevisiae is known
;(Fletcher,~T.~S., and~Kwee, I.L., EMBL DNA sequence library,
ID::SCTRANSK, accession number M63~023~ Using this se~uence,
: : . the s. cerev;siae tr~ansketolase gene was cloned by PCR.
Oligonucleotides
~ . : , ;
~:
~,
:
~: .
WO94~1D325 PCT/F193/00450
~ 53 ~8~
AGCTCTAGAAATGACTCAATTCACTGACATTGATAAGCTAGCCG tSEQ. ID
No.:7:] and GGAGAATTCAGCTTGTCACCCTTATAGAATGCAATGGTCTTTTG
[SEQ ID No.:8:~ and the chromosomal DNA from S. ~erevisiae
(isolated as described above) were used for the
ampli~ication of the DNA ~ragment containing the
transketolase gene. The 5'-oligonucleotide anneals at
positions 269-304 an~ the 3'-oligonuc~eotide anneals at
position 2271~2305 in the numbering of tran~ketolase as
descxibed in (Fletcher, T.S., and Kwee, I~L., EMBL ~NA se-
10quence library, ID:SCTRANSK, accession number M63302). The
fragment was digested with XbaI and EcoRI and cloned into
the pUClg cleaved with the same enzyme~. The restriction
analysis o~ the resulting plasmid pUC(TKT) confirmed the
identity of the cloned DNA fragment. This plasmid was cut
15 with BglII and ClaI and the large DNA fragment was purified
by agarose electrophoresis. This fragment was ligated with
two DNA fragments isolated from the plasmid pUT332
(Gatignol, A. ~t al., Gene 91:35-41 (l990)): a ClaI~PstI
fragment bearing the UR~3 gene and the 3'-part of the
bleomycin resistance gene and a BamHX-PstI DNA fragment
bearing the yeast TEFl (transcription eIongation factor l)
promoter and the 5'-part of the bleomycin resistance gene
coding sequence. Af~er transformation of E. coli with the
above ligation mixture and restriction analysis of the
plasmid clones, the plasmid pTKT(B WRA) was isolated. This
plasmid con~ains the coding sequence of S. cerevisiae
transketolase gene in which the 90 bp fragment of between
~he ClaI and BglII~sites is sub.~tituted~wikh a fragment~sf
pUT332 containing tw~ markers selectable in S. cerevisiae -
the UR~3 gene and the bleomycin resistance gene under
: control of the~ TEFl promoter and CYCl transcription
terminator. The plasmid was used to transform S. ce~evisia~
::strain D~Y746 (ATCC 44773; MAT~ his3A1 1PU2-3,112 `ura3-~2
trpl-289) to phleomycin resistance ~lO ~g/ml phleomycin in
35 YEPD medium) by the lithium chloride method (Ito et a7., J.
;:
., .. .. ..... . .. ,, --
W094/1032~ PCr/FI93/00450
~ 4~62~ 54
Bacteriol . 153 :163-168 (1983)). The transformants were
tested for uracil prototrophy and for the ability to grow
on D-xylulose. Five URA3 clones, three of which displayed
reduced growth on D-xylulose, were grown in 100 ml
cultures, cell extracts were prepared by shaking with glass
beads and the transketolase activity was measured in the
crude extracts. T~e assay was performed in O~1 M glycyl-
glycine buffer pH 7.6 containing 3 mM magnesium chloride,
O.1 mM thiamine pyrophosphate, 0.25 mM NADH, and 0.2 mg/ml .-
bovine serum albumin. ~mmedia~ely ~efore measureme~t 3 ~l ~
o~ a solution cont:ainlng 0.5 ~ D-xy~lulose-S-phosphate and .-
0.5 M ribose-5-phosphate were added to l ml of th~e above
buffer followed by 7.5 U of ~riose phosphate isomerase and
; 1.5 U of ~glycerophosphate dehydrogenase :(both from
Sigma). The reaction was initiated by adding a suitable :`:
. .
: aliquot:of the crude extrac~ and followed by recording the
decrease of optical density at 3~40 nm.~The cellular extract
`~: of the strain: DBY746 was~used as ~a control. The
: transketolase activity in the crude extract~of DBY746 and
the two transformants with unretarded growth on D-xylulose
was readily measurable at approxima~ely 0:.25 U/mg protein.
The~three transformants~with~reduced growth ~n D-xylulose
had transketo;lase~:~a~ct~ivity below the detect;ion~limit of~our
method ~:(at ~l~east:~20 times;1ower than wild type).: The~
ZS~: activities~ o~ D-glucose-6-phosphate~ dehydrogenase and 6-
:phospho-D-gluconate~dehydrogenase~were al~o measured:as a
control ~for possible ~enzyme inactiva:tion ~during t~e
~;preparation of:the.cell extracts.~The~ac~i~it;ies of these
:~: two enzymæs were~ very~slmilar in ~all six~strainsO
30: ~There~fo~e, ~it~wa~s~ conGluded that the three clones~;which
grew~poorly~on~D-xylulQse ~ontained the~mutation in t~e
transketolase gene. The ~growth~of ~the~ strains:with ~the~
disrupted:transket~lase gene~was a;lso somewhat retarded~n
a ~synthet~ic~ ~medium lackin~:~ aromatic :amino acids
, ~
: . .............. ............
W0 94/1032; PCI/F193/00450
`'21~6,~
phenylalanine and tyrosine although thP effect was smaller
than the effect of this mutation on D-xylulose utilizatio~.
Transketolase genes from other yeast species can
conveniently be cloned by complementation of the
transketolase~ mutation in the S. cerevisiae strains
described above. Preferably, the cloning can be performed
by constructing a gene library of the non-Saccharomyces
yeast strain in an appropriate vector (for example, the
well known plasmi~YEpl3), transforming this library into
a S. cerevisiae strain bearing transke~olase mutation (for
example, the mutants obtained by gene disruption described
above) and selecting for transformants with restor~d growth
on D-xylulose. The plasmid DN~ can be rescued from such D-
xylulose-positive:transformants and used to transform the
: 15 same recipient strain. ~All ~the clones from this
: transformation should be able to grow well on D-xylulose.
.:
: Transketolase activity can be measured in the transformants
and its reappearance at a significant le~el can serve as
proof of the identity~of the cloned gene. Additional ~nd
final proof can be obtained by:~sequencing short stretches
of cloned PNA a~nd finding pi:eces of sequence homologous to
he 5. cerevisiae transketolase ;gene sequence or by
demonstrating hybridizatlon of the cloned DNA fragment with
: the authentic transketolase clone~ from S. cerevisiae.
~lternatively,~ the cloning procedure can be ~ased on the
DNA: hybridization as primary m~thod for selecting the
:
clones containing the tra~sketolase gene from the gene
librar:y o~,a; non-sa~charomyces yeast. A:fragmçnt of the ! S .
: cerevisiae transketolase gene can be used as the probe for
a ~olony or~plaque hybridization:experiment and the clones
which~give~ the~: strongest ~hybridization signal can be
further~analyzed by partial seguencing.
Whatever method ~ is used for the cloning of
transketoIase~: gene from:~a chosen yeast species the
35~: su~s~e~uent steps: for obtaining a mutation in the
WO94/1032~ PCT/Fl93/00450
6l2
`?,~ 4~6 56
transketolase gene in this yeast are the same. The cloned
DNA fragment should be characterized by constructing a '~'
partial restriction map ~nd preferably localizing the ~"
coding region of the transketolase gene. Then a piece of
DNA which can function as a selectable marker in the chosen
yeast is i~nserted into the DNA fragment containing thP ~,
transketolase,gene not closer than several hundred bp from -~
,
either ~of the termini of th~is fragment. The cassette ,~
conta~ining the~bacterial~phleomycin gene under control of ~'
a strong yeact promoter, such as the above-descri~ed
cassette fr~m~the plasmid pUT332, could for example, be
used for many yeast species as a dom~inant selective marker. ,
It is essential that the insertion of the DNA fragment ~'
bearing~ the selec~able marker is done in such a fashion
15' 'that the codlng region~of the;transketolase gene~is either ~ '
disrupted by~the inserted DNA or,; preferably~, th2 inserted ,'
DNA frag~ent~substi~utes~(part of);the coding region. Such
a DNA con~truct can~then be used;to~disrupt the chromosomal '`,~
copy of the~ transketolase gene~in~the~selected yeast by a ,":
20 '~method~similar to~the method described abo~for~obtaining~ ~ '
~, . i - , . ~ . .
the transketolase~mutation ln~S~ cerevlsia~. Any~suitable i ~ "
;transformation;~ m~ethod ~can~ be~employed, the~ preferred~
methods~are~protop,last~`~ransformation and electrop~oration.;~
The~; s~lection ~of~ the ~clones~ bearlng, the disrupted~
25~ transketolase gene~ can~be~done~similarly~to ~he method~
described~above~f~or~;S~ cerevisiae. Also, the analysis~ of
the~ructure of~the transketol;ase~chromosomal region~by~
Souther,n hybr,ld;ization can be~used as an~alternative!meth~d ,'
or in addition to~other methods.
30~ xa~ple la~
Cloning~of~th'e D-ribulokinase gene;
,Thè~preferred;~way~to~cl~one the~D-ribulokinase gene ~ ~
isi~similar~ to~the~method~described in Example~l~ for the ~-,,~.
cloning of~the~-D-arabitol~dehydrogena e. It is known thak ,-,`
W094~10325 PCT/F193/00450
57 ~ ~6~ ~
D-ribulokinase gene in se~eral bacteria such as E. coli or
Kl e~siel l a aerogenes is a part of the ribitol utilization
operon (Loviny, T. et al., Biochem. J. 230:579-585 (1985)).
It is also known that E. coli B strains do not contain th-s
operon and are therefore incapable of utilizing ribitol as
a carbon source. Thus,~an E.~ coli B strain (suoh as common
laboratory strains HB1Ol and JM103 or strains which can be
transformed with h:igh efficiency such as SCSl or XLl-Blue
from Stratagene) can:be transf~rmed with a gene library of
a ribitol-utilizing bacteria constructed in any suitable
vector, preferably pUCl9. Non-pathogenic bacterial species
such as Kl e~siel l a terrl gena are the preferred source
organisms for isolation of the D-ribulokinase gene. The
E . col i transformants which are capa~le of growth on
15~ minimal medium containing ribi~ol as the sole carbon source
~ can then be selected. Th:e~plasmid DNA from such ribitol-
; positive clones can~be isolated and used to retransform an
:~ E~. coli B strain. ~All transformants from such
retrans~ormation:should be able to grow on ri~itol as the
sole carbon source. A restriction map of the cloned insert
: can then be constructed. Using this~map various deletion
: :derivatives of the original: clone can be prepared and
analyzed for the retention of ribitol operon by above-
: mentioned functionàl test. Several successive deletions can
: : ~ 25 ~ be~performed in order to minimize the size of the DNA
~ fra~ment bea~ing the ribitol~operon~to 3.5 - 4 kb ~the size
of this operon in K. aerogenes). Finally, (partial)
:jnucleotide~;sequence of the :D-ribulokinase~ g.ene can ~be
determined and used to~ exsise the coding region of this
gene either using suitable naturally occurring restriction
sites: or using known ~CR techniques ~for introduction o~
such sites. :The D-ribulQkinase gene ~an be expressed in
other hosts, preferably~yeasts, by a method that includes
standard steps such~as fuslng the coding region of the D-
~ ~ 35 ~ ~ribulokinase gene~to a~suitable promoter and transcription
: :: : ;~ :
.. . ... ,.. , . .. ... ..... . , .... ~ . .
WO94/I03~ PCT/FI93/OV450
8 6 ~2 58
terminator, transferring the expression cassette to a
vector suitable for the transformation of the chosen host,
obtaining the tr,ansformants, and, finally verifying the
:e~ficiency of D-rlbulokinase expression.
Example 11
Cloning and overexpression of the D-ribulose-5-
phosphate-3-epimerase ~ene
The method for isolating~homogeneous D-ribulose-5-
, : phosphate-3-epimerase ~from: baker's ~east (indus~rial
Saccharomyces cere~isiae yeast)~ is known (Williamson, W.T.
et al., Me~h. Enzymol. 9:605-608 (1966)). The enzyme can be
isolated and the N-terminal as well as partial internal
a~ino :acid se~uences determined by the generally known
~ methods. Thus~obtained partial amino acid sequences can
li ~ 15 then be used to generate, by a procedure known~as reverse
: ~ translation, the sequences o~ oligonucleotides which then
: ;~ ; can be:used to prime the polymerase:chain reaction. The DNa
fragments ~generated~by ~PCR can be used as hybridization
~: ; ~ probes to screen~a:yeast gene library f~r a full length
20; copy of the D-rlbulose~5-phosphate-3-epimerase gene. The:
~ preferred wày to overexpress the D-ribulose-S~phosphate-3-
: :: :~epimerase gene in o~her:yeast hosts is to clone it~into a
. ~ vector whiah:ha~s~ a~high copy number in the desired host
: ~ (for example~ ;,:pSRT30:3D ve¢tor for: Z. rouxii).~ An~
2;5~ :alternat;ive and more:~efficient:way:of overexpressing the
~;` ' :gene is~to determin~e at least a partial nucleotide sequ2nce
of~the~D~-ri~ulose-5-phosphate-3-epimerase`~gene around the
trànslation start codon and use this information for
:, isolating :the~ coding:~ sequenoe :of ~he ~D-ribulose-5 ~
30~ phosphate-~3-epimerase gene~ and~ fusing it to a~promoter;
known to:function efficiently~in the~chosen host.
~ ~ . : , - .. .
W0~4/1~325 PCT/~193~0045~
~ 8~
Exampl~ 12
Cloning of the D-xylulokinase gene and construction
of D-xylulokinase mutants
Methods for cloning of the D-xylulokinase ~EC
2~7.1.17) gene from different yeast species have been
described (Ho, N.W.Y. et al., Enzyme Microbiol. Technol.
11:417-421 (1989); Stevis, P.E. et al., Applied and
E~vironmental ~i~robiol. ~3:2975-2977 (1987)). Also, a
method for constructing the D-xylulokinase mutation in S.
cerevisiae by gene disruption has been described (Stevis,
P.E. et al., Appl. Bioc~:em. Biotechnol. 20:327-334 (1989)~o
Similar methods can be used for constructing D-xylulokinase
mutants in other yeasts. Fo~ the yeast species other than
5. cerevisiae, the:genetic markers used for the disruption
lS ~ of D-xylulokinase gene are:preferably dominant antibiotic
resistance markers (see Example 9). Alternatively,
: clnssical mutant constructinn methods based on chemical
! (for example, treatment with~ethyl methane sulfonate or
¦ acriflavine) ~or physical ~ultraviolet light, X-rays)
. 20 mutagenesis can be employed. The mutant enrichment can be
performed by growing the mu~agenized cells on D-xylulose as
¦ the sole carbon source in the presence of anti~iotic (su~has nystatin) which kills only growing cells. The inability
of D-xylulokinase mutants to utilize ~-xylulose as the sole
' ~25 carbon source for~:growth can be used for the selection of
¦ mutants. ~ ~ :
Example 13
Strains producing xylitol via D-arabitol with improved `~
: : - yield ~ ~ ~
Example 4 describes t~e method for the construction
: of a yeast strain capable of producing xylitol from
structurally unrelated carbon sour es such as D-glucose by
: a: pathway : which u~ili:zes D-arabitol as the key
: intermediate. To impro~e xylitol yield in fermentations
~: ~ ~ : ,
: ~ :
: ~ :
::
` WO~4ll~325 PCT~l93/~04~0 ~
I :
~0
~4~6~ :
with the strains utilizing this "D-arabitol pathway" - the
D-arabitol yield must be improved. The pathway leading from
D-glucose to D-arabitol in D arabitol-producing yeasts has
been described (Ingram, J.M. et al., J. Bacteriol. 89:1186-
1194 (1965)). D-arabitol is produced from D-ribulose-5-
phosphate via dephosphorylation and reduction with a NADPH-
linked D-ribulose reductase. Formation of D-ribulose-5-
ph~osphate from D-glucose 6-phosphate by two successive
irreversible dehydrogenation steps with D-glucose-6-
phosphate ~dehydrogenase ~ and ~ 6-phospho-D-gluconate
dehydrogenase is a universally occurring pathway known as
the oxidative branch of the pentose phosphate pathway (or
hexose monophosphate shunt).,In the non-oxidative branch of
the pentose phosphate pathway, D-ribulose-5-phosphate is
reversibly isomerized into ribose-S-phosphate and D-
xylulose-5-phosphate.~Ribose-5-phosphate and D-xylulose-5-
phosphate arè further metabollzed by ~ransketolase.
Therefore, ~transketolase can~b mutated in an D-arabitol-
producing~microbial strain~and the fraction~of D-ribulose-
5-phosphate converted into~D-arabitol will be increased.
Exa~ple 9 describes~the method for obtaining the
transketolase mutants. Further increase of the D-arabitol
yield can be achieved i~ the rate of~D-ribulose-5-phosphate~
`; ~ ; biosynthesis is maximlzed~through~overexpression of the two
genes codi~g for the enzymes o~the oxidative~branch of the~
pentose phosphate pathway as described~above (Example 8).
` `` The s~rains optimized by this method wlth~respect~to the D-
arabitol y;ield can ~then be further~ transformed with
recombinant DNA constructions ~bearing the xylîtol
30~ dehydrogenase an~ D-arab;itol dehydrogenase genes~(Examples
3~and~4~) resultlng in strains~with~improved efficiency of
xylitol production. ~ ~ ~
.~ ~ :: : : '
WO94/1032S PCT/F193/00450
`` 61
Example 14
Strains producing xylitol by alternative pathways
The method according to Examples 4 and 13 are ~he
most straightforward methods for the cons~ruction of
microbial strains capable of converting D-glucose and other
carbon sources into xylitol. These methods utilize the
naturally occurring pathway leading to the formation of ~-
arabitol from various carbon sources and extend this
pathway by two more reactions to convert D-arabitol into
xylitol. However, this pathway is not the only possible
pathway. Other pathways leading to xylitol as a final
metabolic product and not involving D-arabitol as an
intermediate can be constructed. Thus, a pathway to xylitol
from the same precursor - ~-ribulose-5-phosphate can be
realiæed through a different chain of reactions. D-
ribulose-5-phosphate can ef~iciently be converted to D-
xylulose-5-phosphate by D-ribulose 5~phosphate-3-epimerase
(Example 11) and if further conversion of D-xylulose-5-
phosphate is prevented by a mutation in the transketolase
gene, the accumulated D-xylulose-5-phosphate can be
dephosphorylated by the same n~n-specific phosphatase as D- ;
ribul~se-5-phosphate (Ingram, J.M. et al., ~. Bacteriol .
89:1186-1194 (1965)) and reduced into xylitol by xylitol
dehydrogenase (Example:3). Realization of this pathway can
further re~uire the inacti~ation of D-xylulokinase genP.
(Example 12~ in order to minimize the energy loss due to
the futil~ loop: D-xylulose-5-phosphate ~ ~-xylulosP t D-
xylulose-5-phosphate. An additlonal geneti~ chan~e j-
introduction and (over)-expression of the D-ribulokinase -~
gene (~.C. 2.7.1.~7j could minimize simultaneous D-arabitol
production by such strains by trapping the D-ribulose
produced by the unspecific phosphatase. The D~ribulose will
be converted back into the D-ribulose 5-phosphate and
: ~ ~urther into D-xylulose-5=-phosphate.
'.
- ~.
-
:
W094~103~5 PCf/FI93/004;0
2 1 ~ 62
Example 1S
Stability of the recombinant Z. rouxii strain andproduction of xylitol under conditions of fermentor
cultivation
The stability of xylitol production during extended
cultivation was checked in both selecti~e conditions (using
the selective medium~ YEPD containing 50 mg/liters G418
and 30~ glucose) and non-selective~conditi~ns (using the
same medium without G418). A single freshly obtained
transformant~ of Z. rouxii ATCC 13356 ~pSRT(AX)-9)] was
grown in a 200 ml:volume of G418~contalning YEPD. The cells
were transferred into 50~ glycerol solution and frozen at -
70C in 1 ml aliquotes. Four frozen aliquotes of Z. rouxii
I ~pSRT(AX)-9)~ were used to inocula~e two 50-ml cultures in
¦ 15 selective medium and:two in non-selective medium. After the
cultures reache~the~sta~ionary phase of growth (50-60 h at
3:0C and ~00 rpm) a sample was taken for the HPLC analysis
: o~ pentitol content and 1 ml of: the:culture was used to
inoculate another 50 ml of the:same::~(either selective or
non-selecti~e)~ medium. The: ~growth-dilution ~cycle was
repeated four more times. The conditions of this experiment
approximate the propagation of the~recombinant strain from
: ~a standard ~rozen inoculum in a large scale~fermentation.
The results o~ this experiment are presented ln Table~8.
Predictably~, th~e stability o~ the recombinant strain is
higher on the~selective med~ium`. However, even~under non-
selective medium: the: decline in xylitol yield was only
detected afterjapproximtely 20 generations. Under selectlye
conditions, the xylitol production was stable for
approximately:~3~0 generat:Lon~s.
: An aliqùote~of the .frozen stock of the transformed
Z. rouxii strain was used:to inoculate a 2 liter fermentor
:: containing 1 liter of ~medium having the following
composition (pi~r ;liter): 0.:1 g NaCl , 6.8 ~ potassium
35~ ~ phosphate, 0.5 g ammonium sulphat~, 20 g of yeast extract
; ; ~ ~ .
::
WO94~l0325 PCT/FI93/00450
~: 63 ~S~
and ~O0 g of glucose, 50 mg of G481, pH 6Ø The
cultivation conditions were: aeration rate, 0.5 v/min;
agitation, 400 rpm; temperature, 30C.
Figure 10 shows the time course of the glucose
consumption and xylitol accumulation in this fermentation.
The concentration of dissolved oxygen which reflects the
respiritory activity of the yeast culture is alco shwon. An
apparent biphasic growth was observed: in the first phase,
a plateau in glucose and xylitol concentrativn was rPached
in about forty hours (less than half of the available
glucose was consumed at that p~int), the second phase was
observed after approximately 200 hours of cultivation when
the glucose consumption and xylitol production reswned. The
final xylitol ~oncentration was 15 g/liter, almost two
times higher than the concentration obtained in the flask
fermentations. The biphasic growth with a long lag period
indicated that a spon~aneous mutant was selected
(presumably having a higher alcohol tolerance than the
parent strain). To check this hypothesis, a single clone
was isolated from the culture at the endpoint of the
fermentor run. This isolate was grown in a f~rmentor under
the con~itions identical to those described above. The
re~ults of this experimPnt ~(Figure 11) confirmed that a
mutant capable of~ complete assimilation of 400 g/liter
glucose in about 60 hours ~was indeed isolated. This
experiment also shows that the xylitol-producing Z. rouxii
strain can also assimilate xylitol when all the glucose in
the cultur~m2dium is consumed. ~ I ~
:.
WO 94~1~325 PCr/~193/û0~50
!
6~ 64 ~ .
-,:
_ _ _ _ : -
Table 8
Stability of xylitol i~roduction by the strain
7. rouxii ATCC 13356 lpSRT(AX)-9~ under conditions of serial
cultivation ~g/liter, normalized by total pentitol yield). :.
l . __ _ . ,,,
5Cultivation conditions ~
__ _ ~ _ _ . . _ ~
Seriai Dilution No I Culture No. Selective Nlon-Selective -~:
___= ~ 6
_ _ ~y ~ . __ _ _ . ,~
2 1 8.9 8.9 .
_ 2 8.5 8.4_ `.
1 2_ ' 8.5 83 ` `
I 0 d, 1 8.7 8.0 : ~ .
2 8.6 6.9 . -.
_ _~ _ _ _ ~ .''~.
_ _ 2 __ _ _g8~6 _ ~.6
_ _ 2 _79_ _ 2 -
All references are incorporated herein by reference. ~.
:~ Havin~ now fully described the invention, it will be
understood by those with skill in the art that the scope
can be performed with a wide and:equivalent range of
concentra~ions, parameters, and the like~ without affecting
: :the spirit~ or ~scope:of the invention or any embodiment .. `.
:~ thereof. :: .`
:
'
` ' ' ,.'
~.
.
: , , ':'
,'.
WO94/1032~ PCT/Fl93/00450
65 ~8~
SEQUENCE LISTING
(1) GENERAL INFORMATION: :
(i) APPLICANT: Harkki, Anu M.
Myasnikov, Andrey N.
Apajalahti, Juha H.A.
Pastinen, Ossi A.
~ii) TITLE OF INVENTION: Manufacture of Xylitol ;~
~iii) NUMBER OF SEQUENCES:~8
(iv3 CORRESPONDENCE ADDRESS:
: (A) ADDRESSEE: :
(B) STREET:
(C) CITY:
~D) STATE: ,
~E) COUNTRY: .
~ (F) ZIP~
(v) COMP~T~R ~EADABLE FORM: :
(A) MEDIUM TYPE: Floppy disk ~:
tB~ COMPUTER: IBM PC compatible
~C) OPERATING SYSTEM:: PC-~OS/MS-DOS
(D? SOFTWARE: PatentIn Release #1.0, Version
: ~1.25
: (vi) CURRENT APPLICATION DATA:: -
(A) APPLICATION NUMBER::PCT (to be assigned)
(B) FILING DATE: herewith
(C) CL~SSIFICATION: ~ :
: (vi) PRIOR APPLICATION DATA~
: ` (A) APPLICATION NUMB~R: US 08/110,6~72
: (B) ~ILING DATE: 24-AUG-1993
::
(Yi) PRIOR:APPLICATION DATA:
: (A) APPLICATION NUMBER: US 07/973,325
(B) FILING DATE: 05~NO~-1992
(viii) ATTORNEY/AGENT INFORMATION:
tA~ NAME:
(B) REGISTRAT~ON:NUMBER:
C) REFERENCE/DOCKET NUMBER:
(ix) TELECOMMUNIC~TTON INFORMATX~N:
A)~TELEPHON~
(B) TELEFAX~
:
.
: :
:: :
W094/1n325 PCT/~193/00450
~4~6~ 66
(2~ INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LEN~TH: 28 base pairs .
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both ~
,~-
, ;
(xi) SEQUENCE DESCRIPTION: SEQ ID NO~
CGAATTCTAG ACCACCCTAA GTCGTCCC
~8
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS: :~
(A) LENGT~: 29 basç pairs
(B) TYP~: nucleic acid
(C) STRANDEDNESS: bo~h
(D) TOPOLOGY: both
,.
~:
(xi) SEQUENCE DESCRXPTION: SEQ ID NO:2:
TTCAAGAATT CAAGAAA~TC ACGTGATGC
29
(2) INFORMATIQN FOR SEQ ID NO:3: ,~
"-
(i) SEQUEN OE CHARACTE~ISTICS:
tA) LEN~TH: 26 base pairs
(B) TYPE: nucleic acid ,~;
` .(C) STRANDEDNESS: both :.
(D) TOPOLOGY: both
"-
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CAGG~CGTCG A~AGGATCT CGTCTC
Z6
:~ (2) IN~ORMATION FOR SEQ ID NO:4:
(i) SEQUENCE:CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nu~lei:c acid
tc) STRANDEDNESS~ both
(D) TOPOLOGY: both
: .
: ~ '
; ' ;
WO94/1032~ PC~/F193/00450
txi~ SEQUENCE DESCRIPTION: SEQ ID NO:4:
AATTAGTCGA CCGTTA~TTG GGGCCACTGA GGC
33
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS: :
(A) LENGTH: 35 base pairs .
(B) TYPE: nucleic acid
~C) STRANDEDNESS: both
~D) TOPOLOGY: both .
'~
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GCGAAGCTTA AAAATGTCC~ AGCAACAGAT CGGCG
35 . ~:
(2) INFORMATION FOR SEQ ID NO:6:
(ij SEQUENCE CHARACTERISTICS:
(A) LEN&TH: 34 base pa}rs
(B~ TYPE: nucleic acid
(C) STRANDEDNESS: both ~.
(D) TOPOLOGY: both
: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CCGAAGCTTA GATTAATCCA GCCATTCGGT ATGG
34
~(2~ INFO~MATION FOR SEQ ID NO:7:
(i) SE~UENCE CHARACTERXSTICS:
A)~LENGTH: 44:base pa`irs
(B) TYPE: nucleic acid
~C) STRANDEDNESS: both
D) TOPOLOGY: both
Xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
AGCTCTAGAA ATGACTCAAT TCACTGACAT TGATAAGCTA &CCG
`:
,
~:
:
WO 94~1032~ PC~F193/00450
S~ 68
( 2 ) INFORMP.TION FOR SEQ ID NO ~
i ) SEQUENCE: CHARACTERISTICS:
(A) LENGTlI: 44 base pairs
(B) TYPE: nucleic acid
( C ) STRANDEDNESS: both
(D) TOPOLOGY: both
( xi ) SEQUENCE DESCRIPTION: SER ID NO: 8:
GGAGAATTCA GCTTGTCACC CTTATAGAAT GCAATt;GTCT TTTG
44
" .
~ .
~.
:`
1 ~ ' ' `' I ' i' ' : '
~:
~ ~ `
