Note: Descriptions are shown in the official language in which they were submitted.
WO94/167~ 2ls ~n7 ~ PCT~S94/00799
WO~ND ~TNG C0MP08ITION
Field of the Invention
This invention relates to pharmaceutical compositions for
wound healing comprising the combination of insulin-like growth
factor and insulin-like growth factor binding protein and to
methods of using the compositions.
Background of the Invention
Insulin-like growth factors 1 and 2 (IGF-1 and IGF-2,
respectively) are seven kDa proteins that are related in
structure to each other and to insulin. IGF-1 and IGF-2 are
growth and differentiation factors for most cells in the body and
are present at high concentrations in serum (about 300 ng/ml for
IGF-1 and 1000 ng/ml for IGF-2). Circulating levels of IGF-1 are
determined primarily by growth hormone, which stimulates the
1' liver to make IGF-1. Most of the growth-promoting effects of
growth hormone are believed to be mediated by IGF-1. The
combination of growth hormone and IGF-1 is shown to stimulate
linear growth and weight gain as described in PCT Patent
Application No. US91/03841.
The use of various growth factors to enhance wound healing
is suggested in J. Van Brunt and A. Klausner, BioTechnology,
6:25-30, 1988. IGF-2 was shown to be an effective treatment for
wounds, as reported in U.S. Patent 4,885,163 to Sharr and Smith.
IGF-l alone, however, was not effective in partial thickness
wounds, but acted synergistically in combination with PDGF
(platelet derived growth factor) to promote connective tissue and
epithelial growth, as described in Lynch, et al., J. Clin.
Invest. 84:640-646, 1989 and Van Brunt and Klausner,
Bio/Technology 6:25-30, 1988. U.S. Patent 4,983,581 reports the
use of IGF-1 and TGF-~ in a wound healing composition. PCT Patent
Application Publication No. WO91/18621 describes the use of IGF-1
in combination with growth hormone to enhance growth and weight
gain, but not for wound healing.
IGF-1 and IGF-2 circulate in blood bound to specific binding
proteins of which six are now known (IGFBP-1 to IGFBP-6). The
binding proteins bind 95~ or more of the IGFs in blood. When
bound by binding proteins, IGF-1 and IGF-2 are prevented from
.
~il '! f
4/~6X3 PCT~S94/00799
interacting with cell~surface receptors which mediate their
biological functions. Insulin like growth factor binding protein-
1 (IGFBP-l, or BP-l) is a 23 kDa IGF binding protein. A
published in vivo experiment that has been performed with IGFBP-l
indicates that IGFBP-l acts as an IGF-l inhibitor in vivo.
Lewitty et al., Endocrinology, 129:2254-2256, (1991) found that
IGFBP-l inhibited the hypoglycemic response of rats given
intravenous infusions of IGF-l, which promotes glucose uptake by
cells. This property can lead to hypoglycemia when IGF-l is
present in sufficient amounts. Publications by other groups
indicate that IGFBP-l is expressed in vivo during periods of
growth arrest (e.g., starvation and diabetes), also suggesting
that IGFBP-l might act as an IGF-l inhibitor.
In vitro experiments have yielded contradictory conclusions
as to whether IGFBP-l potentiates or inhibits the effects of IGF-
1 on cells and tissues. IGFBP-l was reported to inhibit the
effects of IGF-l on cultured endometrial cells (Rutanen et al.,
J. Clin. Endocrinol. Metab. 60:173-180, 1988), choriocarcinoma
cells (Ritvos et al., Endocrinology, 122:2150-2157, 1988),
thyroid follicular cells (Frauman et al., Endocrinology,
124:2289-2296, 1989), fibroblasts (Liu et al., Biochem. Biophys.
Res. Comm., 174:673-679, 1991) and chicken cartilage cells (Burch
et al., J. Clin. Endocrinol. Metab., 70:173-180, 1990). In
contrast, Elgin et al., Proc. Natl. Acad. Sci. USA, 84:3254-3258,
(1987) reported that IGFBP-l potentiated the mitogenic effects
of IGF-l on fibroblasts and smooth muscle cells in the presence
of platelet poor plasma. Subsequent studies (Clemmons and
Gardner, Journal of Cellular Physiology, 145:129-135, 1990)
showed that an additional factor in platelet poor plasma was
required for IGFBP-l to potentiate the effects of IGF-l on these
cells. The identity of this factor is not known. Koistinen et
al., Biochem. Biophys. Res. Comm., 173:408-415, (1990) reported
that IGFBP-l inhibited the binding of IGF-l to human fibroblasts
but paradoxically stimulated their DNA synthesis.
The use of the combination of IGF-l and IGFBP-3 for
anabolism is described in PCT patent application publication
number W092/13556. Systemic administration of IGFBP-3 was found
to potentiate the anabolic effects of IGF-l, whereas another
WO g4/167~ 2 1 ~ ~ 0 7 8 PCT~S9it00799
study found systemic administration of IGFBP-l inhibited the
anabolic effects of IGF-1.
Since wound healing is mediated by a myriad of components,
another wound healing composition which contains natural human
proteins and which is easy to administer and manufacture would
be a beneficial contribution to the existing pharmacopeia
available for wound healing. The present invention provides a
novel composition for wound healing.
Summary of the Invention
The present invention describes the use of a combination of
IGF-l and IGFBP, particularly IGFBP-1, in a composition for non-
systemic administration for wound healing. Since it has been
known that IGFBP-l inhibits the activity of IGF-1 systemically,
it is indeed surprising to discover that IGFBP-1 potentiates IGF-
1 when used in non-systemic administration for wound healing.
The present inventors have determined that IGFBP-1 acts as
an IGF-l inhibitor in vitro and when given systemically in vivo.
In contrast, they have found that IGFBP-1 potentiates the growth-
promoting effects of IGF-1 when applied non-systemically for
wound healing. The potentiating effect of IGFBP-l in non-
systemic healing may be due to the ability of IGFBP-l to prolong
the half-life of IGF-l at a wound site, the ability of IGFBP-1
to protect IGF-l from extracellular proteases in the wound, or
a true synergistic interaction of the two factors.
This invention is directed to a composition comprising IGF-1
and IGFBP and a pharmaceutically acceptable carrier suitable for
non-systemic administration for use in wound healing.
In addition, this invention is directed to a method for
promoting the rate or improving the quality of wound healing,
which comprises non-systemically administering to such wound IGF-
1 and IGFBP in a therapeutically effective amount to promote
wound healing.
Detailed Description of the Invention
The present invention relates to pharmaceutical compositions
comprising IGF-1, IGFBP and a pharmaceutically acceptable carrier
suitable for non-systemic administration for use in wound
healing. Although the invention is described with respect to IGF
WO94/167~ ~ PCT~S94/00799
2ls4n7s
binding protein 1 (IGFBP-l or BP-1), the present inventors
contemplate the use of any of the six known IGF binding proteins.
Terms used throughout this specification are defined as
follows:
The term "IGF" refers to any polypeptide that binds to the
IGF type I Receptor, including, for example, IGF-1, IGF-2, (desl-
3)IGF-1, met-IGF-1, insulin, and any active fragments which bind
to the type I Receptor. This hormone family is described in
Blundell and Humbel, Nature, 287:781-787 (1980). Due to this
lo common receptor binding, the teachings of the present invention
which are described with respect to IGF-1 are intended to
encompass IGF-2, (desl-3)IGF-1, met-IGF-1, insulin, and any
active fragments which bind to the type I Receptor.
The term "IGF-1" refers to natural human IGF-1,
recombinantly produced human IGF-1, met-IGF-1, and any active
fragments of IGF-1.
The term "IGFBP" refers to any of the six known IGF binding
proteins or to active fragments of these binding proteins which
bind to IGF.
The term "pharmaceutically acceptable carrier" refers to a
physiologically-compatible, aqueous or non-aqueous solvent.
The term "patient" refers to any human or animal in need of
treatment for wound healing.
The term "non-systemic" refers to any route of
administration which does not directly involve the use of blood
or blood vessels. Examples of formulations useful for non-
systemic administration include salves, ointments, creams, gels,
lotions, aerosols, powders, liquids or solids. Non-systemic
administration includes topical routes, intradermal injections,
suppositories, enema, inhaled aerosol, oral routes, and any non-
circulatory route of administration.
The compositions of the present invention comprise IGF-1 and
IGFBP, particularly IGFBP-l, in a pharmaceutically acceptable
carrier. IGF-l can be obtained commercially from Bachem in
Torrance, California. IGF-1 can also be purified from natural
sources, for example from serum. IGF-l can also be prepared by
methods well known to those skilled in the art including, for
example, recombinant techniques such as those set forth in the
WO94/167~ 2 1 S ~ 0 7 8 PCT~S94100799
examples below. Although the expression system of the
recombinant methods described in the examples employs a
particular bacterium, it is contemplated that yeast, bacterial,
mammalian, insect or other expression systems can also be used.
IGF-l can also be synthesized using conventional methods known
in the art
IGFBP-l can be purified from natural sources such as
amniotic fluid, or can be produced in accordance with procedures
described in PCT Application publication WO 89/09792, published
on October l9, 1989, incorporated herein by reference. IGFBP-l
can also be produced by employing the procedures used by the
inventors of the present application, as set forth in the
examples below. The present inventors have performed in vitro
and in vivo experiments to determine the interaction of
recombinant IGFBP-l with IGF-l.
Compositions containing a molar ratio of IGF-l to IGFBP-l
between l:l00 and l00:l are contemplated. It is believed
compositions containing concentrations of IGF-l of less than 0.0l
~g/25 mm2 of surface area of wound may not be effective while
compositions containing concentrations of IGF-l of more than 500
~g/25 mm2 of surface area of wound may have undesirable side
effects, such as elevated levels of circulating IGF-l. The
frequency of dosing will depend on pharmacokinetic parameters of
the IGF-l and IGFBP-l in the formulation used and can be readily
determined by those skilled in the art.
The formulations of this invention are designed for non-
systemic administration. One formulation incorporates IGF-l and
IGFBP-l into liquid form in which physiological saline solution
may be used as a carrier. It is contemplated that other
pharmaceutically acceptable carriers may also be used. The
liquid formulations comprise protein and a carrier, such as
phosphate buffered saline (PBS). The liquid form may be applied
directly to the wound, injected intradermally, or used to
saturate an occlusive dressing.
In addition to liquid form, it is also contemplated that a
formulation may incorporate IGF-l and IGFBP-l into a salve,
ointment, cream, gel, lotion, topical aerosol, or powder.
WOg4tl67~ PCT~S94/00799
21540~8
Ointments generally are prepared using either (1) an
oleaginous base, i.e., one consisting of fixed oils or
hydrocarbons, such as white petrolatum or mineral oil, or (2) an
absorbent base, i.e., one consisting of an anhydrous substance
or substances which can absorb water, for example, anhydrous
lanolin. Customarily, following formation of the base, whether
oleaginous or absorbent, the active ingredients (IGF-1 and IGFBP-
1) are added in an amount affording the desired concentration.
Creams and lotions are oil/water emulsions. They consist
of an oil phase (internal phase), comprising typically fixed
oils, hydrocarbons, and the like, such as water-soluble
substances, including, for example, added salts. The two phases
are stabilized by use of an emulsifying agent, for example, a
surface active agent, such as sodium lauryl sulfate, hydrophilic
colloids, such as acacia colloidal clays, veegum, and the like.
Upon formation of the emulsion, the active ingredients (e.g.,
IGF-1 and IGFBP-1) customarily are added in amounts to achieve
the desired concentration.
Gels comprise a base selected from an oleaginous base,
water, or an emulsion-suspension base, as previously described.
To the base is added a gelling agent which forms a matrix in the
base, increasing its viscosity. Examples of gelling agents are
hydroxypropyl cellulose, acrylic acid polymers, and the like.
Customarily, the active ingredients (e.g., IGF-1 and IGFBP-1) are
added to the formulation at the desired concentrations prior to
the addition of the gelling agent.
In one embodiment, it is envisioned that the carrier and the
active ingredients are formulated in a physiologically-
compatible, slow-release formulation. The primary solvent in
such a formulation may be either aqueous or non-aqueous in
nature. In addition, the formulation may contain other
pharmacologically-acceptable excipients for modifying or
maintaining the pH, osmolarity, viscosity, clarity, color,
sterility, stability, odor, rate of dissolution, absorption, or
release of the active ingredients. Such excipients are those
substances usually and customarily employed to formulate dosages
for administration in either unit dose or multi-dose form.
WO g4/167~ 2 1 ~ ~ 0 7 8 PCT~S94/00799
Once the therapeutic composition has been formulated, it may
be stored in sterile vials or containers as a solution,
suspension, gel, emulsion, solid, or dehydrated or lyophilized
powder. Such formulations may be stored either in a ready to use
form or requiring reconstitution immediately prior to
administration. Formulations containing IGF-1 and IGFBP-l are
stored and administered at or near physiological pH. It is
presently believed that storage and administration in a
formulation at a high pH (i.e. greater than 8) or at a low pH
(i.e. less than 5) is undesirable.
The present invention also relates to methods for treating
wounds by administering the above described pharmaceutical
compositions to a patient in need thereof.
The manner of administering the therapeutic compositions of
the present invention containing for example, IGF-1 and IGFBP-1,
can be via non-systemic methods, including topical applications,
intradermal injection, suppositories, enema, inhaled aerosol, or
oral routes. To achieve and maintain the desired dose of IGF-1
and IGFBP-1, repeated doses may be administered. Any of these
methods are intended to create a preselected concentration range
of IGF-1 and IGFBP-1. Those skilled in the art can readily
determine the appropriate mode of administration and dosage
depending on various factors including, for example, the type and
location of the wound, the age and condition of the patient, and
the formulation used. Examples of the types of wounds
treatable using the compositions of the present invention are
chemical or thermal burns; skin graft donor and transplant sites;
cutaneous ulcers, including but not limited to decubitus ulcers,
diabetic ulcers, venous stasis ulcers, and necrobiosis lipoidicum
ulcers; surgical wounds, wound dehiscence, including but not
limited to the abdominal, thigh, and chest areas; corneal trauma
and transplants; tooth extractions and oral surgery; disruption
of a mucous membrane, including but not limited to the
gastrointestinal tract (ulcerative colitis) and bladder; and any
of a wide range of other traumatic interruptions of connective
tissue, e.g., abrasions. The pharmaceutical compositions of the
present invention are particularly useful for dermal wounds.
WO94/167~ ` PCT~S94/00799
21~ 4 078 i
The effects of IGF-1 and IGFBP-1 alone and in combination
on wound healing were tested using the rabbit ear dermal ulcer
model, as described more fully in the examples below. Briefly,
IGF-l and IGFBP-1 in varying ratios or control buffer were
applied to an induced wound in the models. Tissues from the
wound site were subjected to histologic analysis. IGF-1 or
IGFBP-1 alone did not have a significant effect on healing
compared with controls. The combination of IGF-l with IGFBP-l
showed significantly increased wound healing compared with
controls. The enhancement was greatest when IGF-1 was in molar
excess.
Experiments were also conducted using homozygous db/db mice,
which are diabetic and exhibit delayed wound-healing compared to
normal mice or heterozygous db/+ mice. Experiments were designed
to compare the effects of IGF-l and IGFBP-1 alone and in
combination on wound-healing in this model. Parameters measured
were: (1) percent re-epithelialization; (2) new granulation
tissue; and (3) capillary number. The combination of IGF-1 +
IGFBP-1 caused a dose-dependent increase in each of these wound
healing parameters. The responses to the combination of IGF-l
and IGFBP-l were better than the responses to either protein
alone.
The following examples are illustrative only and are not
intended to limit the invention.
EXAMPLE 1
Construction of the IGF-1 qene
The IGF-1 gene was assembled in two stages. Initially, the
DNA sequence encoding IGF-1 was joined to DNA sequences encoding
the secretory leader sequence of the E. coli OMP A protein
(ompAL). This gene fusion was constructed in order to determine
whether IGF-1 could be efficiently secreted from E. coli. A
second construct, in which IGF-1 is expressed as an intracellular
protein in E. coli, was created by deleting DNA sequences
encoding the OmpA leader sequence and replacing them with DNA
sequences that allow intracellular expression of IGF-1.
Construction of the OmpA~-IGF-1 gene fusion
The four synthetic oligonucleotides labeled OmpAlU (SEQ ID
NO:1), OmpA2U (SEQ ID NO:2), OmpAlL (SEQ ID NO:3) and OmpA2L (SEQ
WO94/167~ 215 4 n 7 8 PCTNS94/00799
ID NO:4), were annealed pairwise (lU + lL and 2U + 2L) and the
pairs ligated together. All four of these oligonucleotides were
synthesized using DNA synthesizers purchased from Applied
Biosystems (Models 391 and 380A). The ligation mixture was then
digested with the restriction enzyme HaeIII. The resulting
BamHI/HaeIII restriction fragment coding for a translational
start signal and the first 21 amino acids of the ompA signal
sequence was purified. This DNA fragment was mixed with BamHI
+ PstI-digested PUC18 DNA (Boehringer Mannhein Biochemicals,
Indianapolis, IN) and the two synthetic oligonucleotides [IGF-1
(1-14) U + L] (SEQ ID NO:5 and SEQ ID NO:6) were ligated
together. The ligation mixture was used to transform E. coli
strain JM109 (New England Biolabs, Beverly, MA) and individual
colonies isolated. These plasmids (OmpALIGF-lpUC18) have a
translational start signal followed by DNA sequences encoding the
OmpA signal sequence and the first 14 amino acids of IGF-l.
An M13 phage containing DNA sequences encoding amino acids
15 through 70 of IGF-1 was created by ligating together the two
complementary pairs of oligonucleotides (IGFlU + lL and IGF2U +
2L) (SEQ ID NO:7 and SEQ ID NO:8) and cloning the DNA fragment
into PstI + HindIII-digested M13 mpl9 DNA (New England Biolabs,
Beverly, MA). Double-stranded DNA was purified from a phage
clone and the PstI/HindIII fragment encoding amino acids 15-70
of the IGF-l protein were isolated. This DNA fragment was
ligated together with PstI + HindIII-digested plasmid OmpALIGF-
lpUC18 DNA and used to transform E. coli strain JM107 (GIBCO BRL,
Gaithersburg, MD). The BamHI/HindIII fragment containing the
IGF-l gene fused to the OmpAL sequence was isolated and cloned
into the BamHI + HindIII generated site of plasmid pT3XI-2
(described in PCT Application publication WO 91/08285 published
on June 13, 1991). The completed plasmid containing the ompAL-
IGF-1 gene fusion is called pT3XI-2 ~10c(TC3)ompALIGF-l.
Construction of the MethionYl-IGF-1 qene
The BamHI/HindIII fragment containing the OmpAL-IGF-l gene
fusion described above was purified from plasmid pT3XI-
2~10c(TC3)ompALIGF-l and digested with HinfI. The approximate 200
bp HinfI/HindIII DNA fragment was mixed with the annealed,
complementary synthetic oligonucleotides (MetIGFlU + lL) (SEQ ID
2 1 S ~ PCT~S94/00799
NO:9 and SEQ ID NO:10) and ligated with BamHI + HindIII-digested
plasmid pT3XI2 DNA, and used to transform E. coli JM107. The
completed plasmid construct is called ~10C(TC3)IGF-lpT3XI-2 and
contains an extra alanine residue in between the initiator
methionine and the beginning of the IGF-1 sequence. The
BamHI/HindIII fragment cont~;~ing the mutant IGF-1 gene was
isolated and ligated into the BamHI + HindIII generated site of
plasmid pTST (described in Nature, Vol. 343, No. 6256, pp. 341-
346, 1990). The ligation mixture was used to transform E. coli
BL21/DE3 described in US Patent 4,952,496 and the resul.ing
individual colonies were isolated. This construct was named
~10C(TC3)IGF-lpT5T.
The extra alanine codon was removed by in vitro mutagenesis.
In vitro mutagenesis was performed using a Muta-Gene kit (Bio-Rad
Laboratories (Richmond, CA). The mutagenesis procedure followed
was essentially that described in the instructions that accompany
the kit. Plasmid ~10c(TC3)IGF-lpT3XI-2 was digested with BamHI
+ HindIII and the -200 bp DNA fragment containing the mutant IGF-
1 gene was purified and cloned into the BamHI and HindIII sites
of plasmid M13 mpl9.
Uracil-containing single-stranded template DNA was prepared
following propagation of the phage in E. coli strain CJ236
(supplied with Muta-Gene Kit, Bio-Rad Laboratories, Richmond,
CA). The oligonucleotide used for mutagenesis had the sequence:
5' - GATGATTAAATGGGTCCGGAGACT - 3' (SEQ ID NO 11). The
mutagenesis reaction product was used to transform E. coli strain
JM109 and individual plaques picked.
Double-stranded replicative form DNA from individual phages
was isolated, digested with BamHI + HindIII and the ~200 bp
fragment containing the IGF-1 gene purified. The purified DNA
was cloned into the BamHI + HindIII generated site of plasmid
pT5T and used to transform E. coli strain BL21/DE3. Several
isolates were sequenced, and all were correct. One bacterial
colony with the correct plasmid was named ~10(TC3)mutIGF-lpT5T.
Expression of Met-IGF-1 in bacteria
For small-scale experiments, an overnight culture of E. coli
strain ~10(TC3)mutIGF-lpT5T was diluted 1:100 into 800 ml of
WO94/167~ 215 4 0 7 8 PCT~S94/00799
Luria Broth (10 g/liter tryptone, 5 g/liter yeast extract and 10
g/liter NaCl, pH 7.5) medium cont~ining 15 ~g/ml tetracycline and
grown at 37 until the optical density at 600 nm was 0.7-0.9.
IPTG (isopropyl-~-D-thiogalactopyranoside (Sigma Chemical
Company, St. Louis, MO) was added to a final concentration of 1
mM and the culture grown for an additional 2.5-3.0 hours at 37C.
At the end of the induction period, the cells were harvested by
centrifugation. The cell pellet was washed once with ice-cold
buffer A (50 mM Tris-HCl pH 7.5/ 25 mM NaCl/1 mM DTT) and stored
frozen at -70C or resuspended in buffer A and used immediately.
For large-scale experiments, E. coli strain ~lO(TC3)mutIGF-
lpT5T was grown in a 10 liter fermenter at 37C in complex media
(40 g/l NZ amine HD, 2 g/l KH2P04, 1 g/l MgSO4 . 7H20, 1 g/l Na2SO4,
1 g/l Na3 citrate . 2H20, 50 g/l glycerol, 0.1 ml/l Macol
l9::GE60, 2 ml/l trace minerals, 20 mg/l thiamine HCl, and 15
mg/l tetracycline HCl, pH 7). When the optical density of the
culture reached approximately 10, IPTG was added to a final
concentration of 0.1 mM. Bacteria were grown for an additional
2-8 hours, harvested by centrifugation and the cell pellet stored
at -70C until use.
EXANPLE 2
Purification of Met-IGF-1
E. coli cells were suspended in Buffer A (50 mM Tris, pH
7.5, 20 mM NaCl and 1 mM DTT), and were disrupted at 1800 psi
using a French pressure cell. The suspension was centrifuged at
20,000 x g for 30 minutes, and aliquots of the pellet and the
supernatant were analyzed by SDS-PAGE. A major band
corresponding to Met-IGF-I was present in the pellet, but not the
supernatant. The pellet was resuspended in Buffer A (40 ml/10
g cell paste), and re-centrifuged at 20,000 x g for 30 minutes.
This wash procedure was repeated 2 times. The final pellet
containing Met-IGF-I was resuspended in 6 M guanidine, 50 mM
Tris, pH 7.5, 6 mM DTT (25 ml/10 g cell paste) using a ground
glass homogenizer, and the suspension was incubated at room
temperature for 15 minutes. The undissolved protein was removed
by centrifugation at 20,000 x g for 30 minutes. SDS-PAGE
analysis of the pellet and supernatant showed that Met-IGF-I was
present in the supernatant only.
WO94/lC7~ PCT~S94/00799
2ls4n7s
Refoldin~ of Met-IGF-1
The denatured and reduced Met-IGF-1 was subjected to a
three-step refolding protocol.
1) The oxidizing agent, oxidized glutathione (GSSG) was
added to the supernatant from Example 2 to a final concentration
of 25 mM, and incubated at room temperature for 15 minutes.
2) The solution was then diluted 10 fold gradually with
50 mM Tris, pH 9.7 to a final concentration of 150 - 300 ~g/ml.
Cysteine was added to a final concentration of 5 mM to aid in
disulfide exchange.
3) The solution from step (2) was incubated overnight at
4C to allow completion of disulfide exchange, and then
centrifuged at 20,000 x g for 15 minutes. SDS-PAGE analysis of
the pellet and the supernatant showed that the supernatant was
composed of relatively homogeneous Met-IGF-I.
Aliquots (50 ~1) of the supernatant were diluted to 1 ml
with Buffer C (0.05~ trifluoroacetic acid)(TFA, Pierce, Rockford,
IL), injected onto a reverse phase column (RP-4, 1 x 250 mm,
SynChrom, Lafayette, IN), and eluted with Buffer D (80%
acetonitrile in water, 0.042% TFA) using a linear gradient
(increase of 1% Buffer D/minute) at a flow rate of 0.1 ml/minute.
Two major peaks were resolved: Peak I at 56.5 minutes, and
Peak II at 58.2 minutes. In addition, a minor peak was present
at 60 minutes, and a broad peak at 75-79 minutes containing
improperly refolded Met-IGF-I species. Based on the integration
of the HPLC chromatogram, Peak I and Peak II represented
approximately 25% and 30% of the crude Met-IGF-I protein loaded
onto the reverse phase column, respectively. N-terminal sequence
analysis of Peak I and Peak II gave the sequence
MetGlyProGluThrLeu... (SEQ ID NO:12), which matches the
N-terminal amino acid sequence of human IGF-I except for the
extra methionine residue at the N-terminus. Recombinant human
Met-IGF-I (Bachem, Torrance, CA) eluted at a retention time
identical to Peak II. Therefore, Peak II represents correctly
refolded Met-IGF-I, as evidenced by retention time identical to
the purchased standard as well as biological activity identical
to the purchased standard. IGF-1 which has not been correctly
refolded exhibits reduced or no biological activity.
WO g4/167~ 2 1 S 4 0 7 8 PCT~S94/00799
E~AMP~E 3
Isolation of Correctly Refolded Met-IGF-l
The following is a description of the preparation of met-
IGF-1 from 305 g of cell paste. The supernatant from the
refolding procedure of Example 2 (6700 ml) was concentrated 10-
fold and exhaustively dialyzed against 20 mM HEPES, pH 7.5. The
dialyzed sample was centrifuged 20,000 x g for 15 minutes to
remove precipitated proteins, passed through a 0.2 ~m filter
(Corning, Corning, NY) and loaded onto an S-Sepharose column (5.0
x 40 cm, Pharmacia LKB, Piscataway, NJ) previously equilibrated
with the same buffer, at a flow rate of 40 ml/minute. The bound
met-IGF-l was eluted with a 5000 ml linear gradient to 0.5 M NaCl
at a flow rate of 40 ml/minute. 25 ml fractions were collected.
Two symmetrical peaks were resolved: Peak A eluting at 0.12 M
NaCl, and Peak B eluting at 0.15 M NaCl. SDS-PAGE analysis of
aliquots of Peaks A and B showed that they contained relatively
homogeneous IGF-l (> 90% homogeneous); however, several high
molecular weight E. coli proteins were still present. The S-
Sepharose fractions corresponding to Peaks A and B were pooled
separately. HPLC analysis (RP-4, 1 x 250 mm) of the S-Sepharose
pools showed that Pool A and B were composed of major peaks
eluting at 56.5 minutes and 58.2 minutes, respectively, as well
as several minor peaks. The major RP-4 peak of the S-Sepharose
pool B eluted with the same retention time as commercially
purchased recombinant human met-IGF-l (Bachem, Torrance CA).
The S-Sepharose pool B was made to 2 M NaCl, 20 mM HEPES,
pH 7.5, and loaded at a flow rate of 30 ml/minute onto a
Toyopearl Butyl-650S 5.0 x 25 cm( Supelco, Bellefonte, PA)
hydrophobic interaction column previously equilibrated with 20
mM HEPES, pH 7.5, 2M NaCl. The bound protein was eluted with a
1250 ml linear gradient to 20 mM HEPES, pH 7.5, 20% ethanol at
a flow rate of 40 ml/minute. 25 ml fractions were collected.
A major peak eluted at approximately 17.5% ethanol, as well as
a minor peak at 13-15% ethanol. Aliquots (50~1) of the fractions
were diluted to 200~1 with Buffer C (0.05% TFA), injected onto
a reverse phase column (RP-4, 1 x 250mm, Synchrom), and eluted
with 80% acetonitrile, 0.042% TFA (Buffer D) using a linear
gradient (increase of 1% Buffer D/minute) at a flow rate of 0.1
WO94/1C7~ 2 1 ~ 4 ~ 7 8 PCT~S94/00799
ml/minute. The major peak eluting at 17.5% ethanol contained
homogeneous, correctly refolded met-IGF-1. Fractions containing
this peak were pooled, concentrated to 2 mg/ml, dialyzed against
100 mM HEPES, 44 mM sodium phosphate, pH 6.0, and stored at -
70C.
Relatively small quantities (50-100 ~g) of pure, correctly
folded recombinant met-IGF-1 could be obtained by injecting
75-150 mg of S-Sepharose pool B (in 1 ml of 0.05% TFA, Buffer C)
onto a reverse phase column (RP-4, 4.6 x 250 mm) and eluting with
80% acetonitrile in water, 0.042% TFA (Buffer D) using a linear
gradient (an increase of 1% Buffer D/min) at a flow rate of 0.5
ml/min. Correctly refolded met-IGF-1 eluted with a retention
time of 58.2 min, was neutralized with 1 M Tris, pH 7 (0.15
ml/min), dialyzed against either 100 mM HEPES, 44 mM sodium
phosphate, pH 6 (IGF binding buffer), or phosphate buffered
saline (PBS) and stored at -70C.
EXAMPLB 4
Conversion of Met-IGF-1 to IGF-1
In order to convert recombinant met-IGF-1 to native human
IGF-1, an aminopeptidase, isolated from Aeromonas proteolYtica
using a modification of a previously described method (Lorand,
L., 1976, Meth. Enzymol. 15: 53-543, incorporated herein by
reference) was used to remove the N-terminal methionine.
Recombinant met-IGF-1 was incubated in the presence or absence
of the purified aminopeptidase in a 100 ~l reaction mixture
containing 120 ~g met-IGF-1, 20 mM Tricine, pH 8.0, 1 ~g
aminopeptidase for 30 minutes at 25 C. The reaction was stopped
by the addition of 1 ml 0.05% TFA in water. Aliquots of the
samples were analyzed on a reverse phase column, and the protein
peaks collected and subjected to sequence analysis. Met-IGF-1
eluted at 58.2 minutes; whereas, the material reacted with the
aminopeptidase comigrated with natural human IGF-1 (Bachem,
Torrence, CA) at 56 minutes. The following is a summary of the
pmoles of each residue recovered at each sequence cycle,
normalized for 100 pmoles of starting material:
14
2ls4n7s
WO94/167~ PCT~S94l00799
-
TABLE 1
met-IGF-1 + 1 uq Aminopeptidase
Pmoles Recovered
Cycle Met Gly Pro Glu Thr
1 2.32 86.8 2.4 1.78 1.45
2 0.00 23.3 105.6 3.1 0.8
3 0.18 13.8 23.4 128.6 1.4
4 0.00 9.3 4.6 24.1 51.5
Sequence obtained: Gly, Pro, Glu, Thr; approximately 2% of the
molecules did not have N-terminal Met cleaved by aminopeptidase.
TABLE 2
met-IGF-1 No Aminopeptidase
Pmoles Recovered
Cycle Met Gly Pro Glu Thr
1 88.16 11.6 2.15 1.62 0.0
2 4.8 108.4 2.31 4.1 2.0
3 0.5 25.8 80.72 7.6 1.3
4 0.0 15.9 25.2 71.6 0.9
Sequence obtained: Met, Gly, Pro, Glu
These results show that approximately 98~ of met-IGF-1 was
converted to native IGF-1 by the aminopeptidase.
EXANPLE 5
Purification & Refolding of IGFBP-1
E. coli cells expressing the IGFBP-1 were suspended in
Buffer A (50 mM Tris, pH 7.5, 20 mM NaCl and 1 mM DTT) at a
concentration of 40 ml/10 g cell paste, and were disrupted at
1800 psi using a French pressure cell. The suspension was
centrifuged 20,000 x g for 30 minutes, and aliquots of the pellet
& supernatant were analyzed by SDS-PAGE. A major band
corresponding to the IGFBP-1 was present in the pellet, but not
the supernatant. The pellet was suspended in Buffer A (40 ml/10
g cell paste), and re-centrifuged at 20,000 x g for 30 minutes.
This wash procedure was repeated 2 times. The final pellet
containing the IGFBP-1 was suspended in 6M guanidine, 50 mM Tris,
pH 7.5, 6 mM DTT (25 ml/10 g cells) using a ground glass
homogenizer. The suspension was incubated at room temperature
for 15 minutes. The undissolved protein was removed by
2ls~n7s
WO94/167~ PCT~S94/00799
centrifugation at 20,000 x g for 30 minutes. Final concentration
of the IGFBP-l was 1.0 mg/ml. "SDS-PAGE analysis of the pellet
and supernatant show~,d~that IGFBP-l was present in the
supernatant only.
The denatured and reduced IGFBP-1 was subjected to a three-
step refolding procedure.
a) Oxidized glutathione, the mixed-disulfide producing
reagent (GSSG), was added to the supernatant to a final
concentration of 25 mM, and incubated at room temperature for 15
minutes.
b) The solution was then diluted 10 fold gradually with
50 mM tris. pH 9.7 and phenylmethylsulfonylfluoride was added to
final concentration of lmM. Final concentration of protein was
100~g/ml.
c) The refolding mixture was incubated overnight at 4C,
and then centrifuged at 20,000 x g for 15 minutes. SDS-PAGE
analysis of the pellet and supernatant showed that the
supernatant was composed of relatively homogeneous IGFBP-l.
Aliquots (50~1) of the supernatant were diluted to 200~1
with Buffer C (0.05% TFA), injected onto a reverse phase column
(RP-4, 1 x 250mm, Synchrom), and eluted with 80% acetonitrile,
0.042% TFA (Buffer D) using a linear gradient (increase of 1%
Bufer D/minute) at a flow rate of 0.1 ml/minute.
A single major peak representing refolded IGFBP-l eluted at
68 minutes. The retention time of the refolded IGFBP-l shifted
to 71.0 minutes after being completely reduced and denatured in
5 M guanidine, 50 mM Tris pH 7.5, 100 mM DTT. These results
indicate that IGFBP-l refolds to a single predominant species
under the conditions described. N-terminal sequence analysis of
IGFBP-l eluting at 68.0 minutes gave the sequence
MetAlaProTrpAsnCysAlaPro... (three letter amino acid code)(SEQ
ID NO:13), which matches the N-terminal amino acid sequence of
human IGFBP-1 except for an extra methionine residue at the N-
terminus of the recombinant protein.
Isolation of Refolded IGFBP-l
The refold mixture (15000 ml) prepared from 590g of E. coli
paste containing the correctly refolded IGFBP-l was concentrated
to 1800 ml, dialyzed against 20 mM sodium phosphate, pH 6.0,
16
WO 94/16723 2 1 5 4 0 7 8 PCr/US94100799
centrifuged at l0,000 x g for 30 minutes to remove precipitated
E. coli proteins and loaded onto an Q-Sepharose (Pharmacia/LKB,
Piscataway, NJ) column (5.0 x 60 cm) previously equilibrated with
the same buffer. The bound protein was eluted with a 5000 ml
linear gradient to 0.5M NaCl at a flow rate of 20 ml/minute. 25
ml fractions were collected. A single major peak eluted at 0.3-
O.4 M NaCl; l00 ,ul aliquots of each fraction were analyzed
separately by a reverse phase chromatography column (RP-4 l x 250
mm Synchrom). Fractions containing predominantly correctly
refolded IGFBP-l (determined from RP-4 analysis), were pooled
(900 ml), the pH was adjusted to 7.5, the conductivity was
adjusted to l mM NaCl (95 mOhm), and loaded onto a Toyopearl
butyl-650 S hydrophobic interaction column (5 x 5 cm) (Supelco,
Bellefonte, PA), previously equilibrated with 20 mm HEPES, pH
7.5, l.0 M NaCl at a flow rate of 30 ml/minute.
The protein was eluted with a 1500 ml linear gradient to 20
mM HEPES, pH 7.5 at a flow rate of 40 ml/minute. A single broad
peak eluted at 5 - 15% ethanol. Aliquots (l0~l) of each peak
fraction were analyzed by RP-4 reverse phase chromatography and
SDS-PAGE. Fractions containing pure (95%) correctly refolded
IGFBP-l were pooled, concentrated to 6-8 mg/ml and assayed for
bioactivity.
EXANPLE 6
Activity of IGF-l and IGFBP-l on Mouse 3T3 Fibroblasts
A crystal violet dye assay was used to measure cell
proliferation. Assays were performed in 96 well gelatin-coated
plates. Balb/c 3T3 fibroblasts were plated at 25,000 cells/well
in 200 ~Ll of serum-free DMEM (Dulbecco's modification of Eagle's
media, Mediatech, Herndon, VA) containing 0.03 M Glycerol and 0-
l000 ng/ml IGF-l. Cells were incubated for 72 hours at 37C .
At this time, the media was replaced with 150 ,ul of 0.2% crystal
violet, 10% formaldehyde, l0 mM potassium phosphate pH 7Ø
After a 20 minute incubation at room temperature, the wells were
- washed 3 times with PBS, and the cell-bound dye released by
incubation with 200 ,ul/well of 50% ethanol/0.lM sodium citrate,
- pH 4.2. Absorbance at 570 nm was read the next day. Results
showed that recombinant IGF-l stimulates proliferation of 3T3
fibroblast cells in a dose dependent manner. Maximal
WO94/167~ 2 15 ~ O ~ 8 PCT~S94/00799
proliferation occurred at a IGF-1 concentration of about 200
ng/ml. The ED50 was approximately 20-30 ng/ml.
The effect of IGFBP-1 on IGF-l-stimulated proliferation of
3T3 fibroblasts was determined~by co-incubating the cells with
a set amount of IGF-1 and increasing amounts of IGFBP-1. Balb/c
3T3 fibroblasts were plated at 25,000 cells/well in 200 ~l of
serum-free DMEM containing 0.03 M glycerol and either 20ng or
50ng/ml IGF-l, and varying amounts of IGFBP-1 (100 ng/ml - 1 x
104 ng/ml). The cells were incubated for an additional 72 hours
and processed as described above. At both concentrations of IGF-
1, co-incubation with a 5-fold molar excess of IGFBP-1 inhibited
the proliferation of the fibroblasts by about 50%; a 10-15 fold
molar excess of IGFBP-1 was sufficient to completely inhibit the
IGF-1 dependent proliferation.
ActivitY of IGF-1 on Rat Osteosarcoma Cells
The mitogenic activity of IGF-1 was determined by measuring
the relative amount of 3H-thymidine incorporated into DNA of rat
osteosarcoma cells when varying amounts of IGF-1 were incubated
with these cells under serum free conditions. Rat osteosarcoma
cells (UMR106 cell line, American Type Culture Collection,
Accession No CRL-1661, Rockville, Maryland) were plated at 5-6
X 104 cells in 0.5 ml of Ham's F12 (Mediatech, Herndon, VA)
containing 7% fetal bovine serum, 100 U/ml penicillin and 100
~g/ml streptomycin and 2 mM L-glutamine per well in 48-well
tissue culture plates (Costar, Cambridge, MA). After incubating
the plates for 72 hours at 37C (at which time the cells were
confluent, i.e., touching each other), the cells were washed
twice with phosphate buffered saline (PBS) and pre-incubated an
additional 24 hours in serum-free Ham's F12 medium containing 100
U/ml penicillin and 100 ~g/ml streptomycin and 2 mM L-glutamine.
After this pre-incubation in serum-free media, 0.5 ml of F12
serum-free media containing serial dilutions (1.0 - 1,000 ng/ml)
of IGF-l were incubated with the cells for an additional 20-24
hours. Each well was pulse-labeled with 0.5 ~Ci of 3H-thymidine
(Cat. #NET-027Z, NEN Research Products, Du Pont Co., Boston, MA)
for 4 hours, then washed with cold PBS three times. Incorporated
3H-thymidine was precipitated with cold 7% trichloroacetic acid
(Cat. #0414-01, J.T. Baker Inc., Phillipsburg, NJ) and
WO94tl67~ 2 1 ~ ~ 0 7 8 PCT~S94/00799
quantitated by liquid scintillation counting. Assays were
performed in triplicate.
These results showed that recombinant IGF-1 stimulates the
proliferation of UMR106 rat osteosarcoma cells in a dose
dependent manner. Maximal proliferation occurred at 100 - 200
~g/ml. The ED50 was approximately 20 - 30 ng/ml.
The effect of recombinant IGFBP-1 on the IGF-1-stimulated
mitogenesis of rat UMR106 osteosarcoma cells was determined using
the assay described above. After the 24 hour pre-incubation with
serum-free media, the cells were incubated for an additional 20-
24 hours with 50 ng/ml IGF-1 plus different amounts of
recombinant IGFBP-1, ranging from 100 ng/ml to 10,000 ng/ml. We
found that at a molar ratio of 20:1 (IGFBP-l:IGF-1), IGFBP-1
reduced the mitogenic activity of IGF-1 by 80%.
These results also showed that IGF-1 is biologically active
when tested in vitro using two different types of cells, murine
Balb-C 3T3 fibroblasts and UMR106 rat osteosarcoma cells.
Furthermore, IGFBP-1 inhibited IGF-1 dependent proliferation of
these cells demonstrating its ability to bind IGF-1 and prevent
the binding of IGF-1 to cell surface IGF receptors. In both of
these assays a molar ratio of 10-20:1 (IGFBP-l:IGF-1) inhibited
the biological activity of IGF-1 by 80-100%.
EXANPLE 7
DIABETIC (db/db) MOUSE MODEL
Homozygous db/db mice are diabetic and exhibit delayed
wound-healing compared to normal mice or heterozygous db/+ mice
(Tsuboi and Rifkin, Journal of Experimental Medicine, 172:245-
251, 1990). The following experiments were designed to compare
the effects of IGF-1 and IGFBP-1 on wound-healing in this model.
The IGF-1 used in these experiments is met-IGF-1.
Female db/db mice (approximately 8 weeks of age) were
randomly assigned to treatment groups. Each mouse received two
6 mm full-thickness circular wounds on the center of the back
using a 6 mm punch biopsy instrument. Growth factors or control
solution, phosphate buffered saline (PBS) containing 1 mg/ml
bovine serum albumin (BSA (Sigma Chemical Company, Chicago, IL)
were applied to the wounds in 20 ~l. Solutions were applied
daily for 5 days. Wounds were left open during this time.
19
wO94/l67232lS~n78 - PCT/US94/00799
Animals were sacrificed on day 8 and histological sections of the
wounds prepared at their widest margin. Parameters measured
were: (1) percent re-epithelialization; (2) new granulation
tissue; and (3) capillary number.
Re-epithelialization was d~etermined by calculating the ratio
of the length of re-epithelialized epidermis versus the original
wound width using tracings of the histological sections on a TV
monitor at 40 X magnification. Data are expressed as
percentages.
New granulation tissue was determined from tracing the
margins of the granulation tissue in each wound on a TV monitor.
Data are expressed as an area (mm2).
Capillary number was determined by counting the number of
capillary lumens in whole wound cross sections of the granulation
tissue at 100 x magnification.
Ex~eriment 1
The first experiment was designed to compare increasing
amounts of an approximate 1:1 molar ratio of IGF-l:IGFBP-l to
saline controls. The highest dose tested a 1:0.5 molar ratio of
the two proteins. The four treatment groups were as follows:
1. control 5 mice
2. 1 ~g IGF-l + 4 ~g IGFBP-l 4 mice
3. 10 ~g IGF-l + 40 ~g IGFBP-l 4 mice
4. 50 ~g IGF-l + 100 ~g IGFBP-l 4 mice
The results of this experiment are shown in Table 3.
WO 94/16723 2 1 S 4 0 7 8 PCI/US94/00799
.
_I
S ~ ~ o\ d~ d~ o~
0 a) i o 0 ~ o
0 ~ U --I er
~ m o
C.) Q
~ ~ 0 ~D
+l +l +l +l
Z O O O _I
_I
h c
O 'I ~ o dP ~,o 0\0 0\0
;,!~ V.
E- H _ a
Z ~ a Q 3 ~ +~ + O O
~7z ~ Q 0 t`
O H ~
~ O ~ O -J
Z ,¢ 3 _ ~ U o ,~
Z H
-- Z~_
o - O 0
rn,
'1 .,~ D 0 0 1` a~
~) ~, ;,) +l +l +l +l
0 -~ o a~ ~1 0
T ~ 0
a' r4 -I 0 ~ ~
0Q~ ~ O
_ O _ O
_ d' t~ d' ~ _I
tD ~ ~ -- ~ -- -1 --
_~ o _~ O
~1 -- ~4 -- P~ --
o m m m
I ~ I r~ I ~
.: 14 H h H ~ H
U H + H + H +
21
wo g4/l67~ 2 1 5 ~ ~ 7 ~ PCT~S94/00799
The combination of IGF-1 + IGFBP-l caused a dose-dependent
increase in the rate of re-epithelialization and in capillary
number (+ 156% and + 140%, respectively, compared to controls, at
the highest dose). There was a less significant increase in
granulation tissue (+112%).
ExPeriment 2
This experiment was designed to determine whether the
positive effects seen in experiment 1 were due to IGF-1, IGFBP-1,
or the combination of IGF-1 + IGFBP-1.
10 Treatment groups were:
1. control 9 mice
2. 50 ~g IGF-1 8 mice
3. 165 ~g IGFBP-1 8 mice
4. 50 ~g IGF-1 + 165 ~g IGFBP-1 8 mice
The results of this experiment are shown in Table 4. The
positive effects of the combination of IGF-1 + IGFBP-1 on re-
epithelialization and capillary number were repeated (+133% and
+143%, respectively, compared to controls). A better response of
the two factors in stimulating granulation tissue was seen in
this experiment (+161%, compared to controls). The combination
of IGF-1 + IGFBP-1 was better than either protein alone.
WO 94/16723 2 1 5 4 0 7 8 PCT/US94100799
O
rn ~ o~ ~ o~o o\o
L U ,~
N ~r ~ d'
4 ~S +l +l +l +l
.~ Z N Cl~
3 ~ N t~ _I
H ~r 11 In ~
+
_1 ~
o L ,~0 ~ Oo\o
~4 ~ r4 ~ o N ~D
rn
O
Z ,~C ^ ~no ~ ~r
~ Z ~ o o o O
~r - Q +l +l +l +
~ ,1 ~o a~
H ~ r~o
a ~ N N~ ~1
s ~ a
~4 o a .,~ ~ O
o ,1o r~
z; H t~ --I O --I ~I t~
H O
I~
ILI C'
C~
H I U
~1 o
.
O
J +l +l +l +l
r~ 4 ~ O
~, . .. .
~) CO ~N ~r
tr~
`1 ~ ~
O O _I
~U --U~ ~ --
O
Ll ~ I p4
m
~1 ~ 4
O ~~ r~ r~
C~ HH H H
WO94/167~ 2 1 5 ~ 0 7 8 PCT~Sg4/00799
EXAMY~E 8
RABBIT EAR DERMAL ULCER MODEL
This experiment was designed to test the effects of IGF-l
and IGFBP-l in the rabbit ear full thickness dermal ulcer model
(Mustoe et al., Journal of Clinical Investigation, 87:694-703,
l99l). This wound healing m~odel precludes significant wound
contraction and requires new granulation tissue and epithelial
cells for healing to originate centripically. The effects of
IGF-l alone, IGFBP-l alone and combinations of the two factors in
three different molar ratios were compared.
Twenty four young adult New Zealand white rabbits (3.0-3.5
kg) were divided into six comparison groups. Surgical procedures
were performed under an operating microscope and under sterile
conditions. Rabbits were anesthetized by an intramuscular
injection of a mixture of ketamine (60 mg/kg) and zylazine (5
mg/kg). The hair was clipped from the inside and along the
margins of both ears. Each ear was immobilized and four 6 mm
ulcers were made to the depth of bare cartilage using a 6 mm
trephine. This wounding procedure leaves bare cartilage with the
perichondrium removed. Growth factors or vehicle solution were
applied once only to the wounds at the time of wounding in a
volume of 5 ~l. The wounds were then covered with an occlusive
dressing (Tegaderm, 3M Corporation, Minneapolis, MN). The left
and right ears of the rabbits in the different comparison groups
received the growth factor or control solutions indicated in
Table 5.
WO g4/167~ 2 1 ~ ~ 0 7 8 PCT~S94/00799
TABLE 5
~h~lN~ PR~-O~OL FOR IGFBP-1 AND IGF-1
IN THE RABBIT DERNAL ~LCER MODEL
TREATMENT IGF1:IGFBP-1
GROUP LEFT EAR RIGHT EAR MOLAR RATIO
Group 1 Buffer IGF-1 1 yg/IGFBP-1 11:1
0.3 ~g
Group 2 IGF-1 5 ~g IGF-1 5 ~g/IGFBP-1 11:1
1.5 ~g
Group 3 IGFBP-1 13.2 ~g IGF-1 4 ~g/IGFBP-1 1:1
13.2 ~g
Group 4 Buffer IGF-1 1 ~g/IGFBP-1 1:1
3.3 ~g
Group 5 IGF-1 5 ~g IGF-1 5 ~g/IGFBP-1 5:1
3 ~g
Group 6 IGFBP-1 9 ~g IGF-1 15 ~g/IGFBP-1 5:1
9 ~g
Rabbits were sacrificed 7 days post-wounding. Each wound was
bisected, fixed in formalin and 5 ~m cross sections taken for
histological analysis. Measurements were made under a light
microscope using a lens micrometer. Parameters measured were:
new granulation tissue (horizontal migration of new granulation
tissue measured from the original wound edge); granulation tissue
gap (distance between the advancing edges of the new granulation
tissue), epithelial gap (distance between the advancing edges of
the new epithelium) and superficial peak height (vertical
distance between the cartilage and the maximum height of the new
granulation tissue).
The results of this experiment are presented in Tables 6 and
7. The combination of IGF-1 + IGFBP-l significantly stimulated
new granulation tissue formation when IGF-l was applied in molar
excess (the 5:1 and 11:1 IGF-l:IGFBP-l groups). The effects seen
were dose-dependent. The equimolar combinations of IGF-1 +
IGFBP-l gave variable responses, with the low dose group showing
wo g4,l67~ 2 1 ~ ~ 0 7 8 PCT~S94/00799
. ~, ,, .~
stimulation and the high dose group showing no stimulation above
control values. The effects of the combination of IGF-1 + IGFBP-
1 on re-epithelialization and height of new granulation tissue
were less striking. The latter two parameters are less reliable
indicators in this model.
26
WO 94/16723 2 1 S 4 0 7 8 PCT/US94/00799
~ oo~ o ~ o~r ,1
, ~ â N N 1~ . ~ .1 ~
~ ~ +i+i +i +i +i +i +i
E~ ~ ~ ,~ ~ ~ ,1 0
H N~D C~ C~D 0 0
W U) U U~ O 7 d' 0
N N N N N _i
0 ~ ~
-- O O O O O O O
1~ ~C +l+l +l +l +l +l +l
P W o o oo o N
o W
H E~
~ ~ o u~ ~ ~`t~ N
C) ~ W ~ CO ~ O O O O O O
H C~ P H Cl _ --l +l +l +l +l +l +l
W ~ ,Z" E~ o ~r ~D 0 0
0 ~
W .,. ~ O ~D O1`
,,~ Z Z
m .1 OP ~
¢ I
u~ In o
m Z H H Ij3 N 0 ~r~I H N ~D
~ o m ~ 6 P
'I ,~ ~ ~ _ oq o o o o o o o
Z ~ -- H -- +l +l _l+l +l +l +l
~ p, 3 E~ D o ~ ~r H N
~ 10 o _1 0 a~ t~
H ~ ~ ~ 0 N C" ~ I`I` O~
~ Z
4 H z ~ t
O
t
I m ~ I m q~
:~r3 r3 r3 r3 '3;~ r3 r3
m H H H H H H H H m
w Pl
~ P ~ m ~ m ~: m
~I N N t`~
O ~ O
'~ ~ h ~ h ~ ~
WO 94/167232 1 ~ 4 ~ 7 8 PCTIUS94100799
r~ o co
~ ~ N ~
H r~ ~r
" ~ q O O O O O
J ~
~ ~ _ O O O O O
P ~ o 1~ ~ ~D O
z
O
~ D ~ OO
.,~ p ~ +0~ +0~+0~ 0
o0
~ DO
w o ~ ~u~ ~
~ ~ w ~ l oo
~ o o o oo
Z P H -- +l +l+l +l +l
Z E~
. . . ..
~1 0~1 0~1
E~ ~
H H H H I--IH H --~
z
L 3 ~ m
C~ , 3
O O O
WOg4/16723 2l~;4n78 PCr/US94100799
~o o\P o~O ~
oo ~ ~`
~ ~ + + + +
4 ~
~ o~P o~ o~O ~
~ ~ + + + +
~ ~1 ~ o ~,~0 o\ ,~0
C ,~ ,~ O ~ P~
H o~ + + I +
~ m ~ ~
~_~ H o o
E~ a o ~6
W ~ Z ~ I ~ o~ o~o o~o
, ~ H ~ ~ Z ~_~ p +
m ~, o:
Z ~o ~ ~
O 14 ~ ~o~o o~
Z ~ ~ c + + ' +
O ~
Z C~ ~
~ ~ o~ ~ o~O ~
m m ~ + + I +
o o
p, . - o o
r~ I O O I ~ O I _1 _1 1 ~ ~
a ~ o ~ O
~ H I _ H I _ H I H
m - m - m ,
m ~ ,~ m ~ ~ m ~ ~ m ~ ,
~I H -- ~ H -- ~ H -- d' H
29
wo g4,l6723 2 1 5 4 0 7 8 ~IUS94/00799
o
m 3
~ OC + +
H Cl
~1
m 3 r
C!~ + +
~ ,
Z I p,,1
30 m ~D
H H p + +
P~
O
O I ~
E~~ 3 u~ ~D
O W~ POC + +
C.) c,~ t~
PC
1~ ~
O C ~ ~ d~
E ~ 3
3m 0C + +
CC '~
~ 3 ~ ~`
m3 C + +
p, O O
O ~
Z
W I ~ ~ I a~ _~
:~ O
~, H I H
t ~" -I m _,
m ~ ~ m ~ u~
11~ H -- ~C) H
WO94/167~ 2 1 5 4 0 7 8 PCT~S94/00799
Numbers shown are the percent increase or decrease in new
granulation tissue in treatment groups lB-6B relative to
comparison groups lA-6A. Data from Table 6 were used for these
calculations.
IGF-1 alone or IGFBP-l alone were not effective in
stimulating new granulation tissue formation above the levels
seen with buffer solution.
EXAMPLE 9
RABBIT EAR DERMAL ULCER MODEL (ISCHEMIC)
Young adult female New Zealand white rabbits (3.0-4.0 kg)
were divided into 2 groups. In one group, four 6mm dermal ulcers
were made in normal ears as described in Mustoe et al., J.
Clinical Invest., 87:694-703 (1987) and above in Example 8.
In the second group, three 6mm ulcers were made in ischemic
ears as described in Ahn and Mustoe, Ann. Plastic Surgery, 24:17-
23 (1990). Ischemic ears were rendered in 28 (56 ears) rabbits.
The ears were reproducibly ischemic with a tissue PO2 measured
with a tissue optode of 20-28. A full thickness circumferential
incision was made around the base of the rabbit ears, sparing the
cartilage, the three major veins and the caudal artery. All of
the minor veins, the arterioles, the ventral artery and the
central artery were divided and the tissues cut. The skin was
sutured by continuous method. The wounds were made in an
inverted L-pattern, with the long arm over the ventral artery and
the base over the central artery, avoiding the area near the
caudal artery. The wounds extended to bare cartilage and the
central tissue was removed. Each animal was examined daily for
infection, disruption of the wound, or loss or displacement of
the wound covering. In the ischemic model, the wounds were made
immediately following the creation of the ischemia. Wound
healing was profoundly impaired. This model is a major
improvement over previously known wound healing models in
reproducing the hypoxic (ischemic) environment that exists in
many human chronic wounds.
W094/167~ 2 1 S ~ 0 7 8 PCT~S94/00799
IGF-1 and/or IGF-BPl in varying ratios and varying
concentration or control buffer were applied at the time of
wounding, and occlusive dressings were applied. Wounds were
harvested at day 7 for histologic analysis.
Test substances were applrièd to the wounds once at the time
of wounding as described in Example 8. Following administration
of the test growth factors, the wounds were covered with an
occlusive polyurethane film (TEGADERMr, 3M Company, Minneapolis,
MN). At day 7, the rabbits were anesthetized. The entire ear
was then removed and fixed in 10% buffered neutral formaldehyde
overnight or in omnifix for 2.5 hours. The wound was partially
excised by taking a through and through rectangular block,
including both skin surfaces and the cartilage. The animals were
then sacrificed.
In the histological analysis, the tissues were dehydrated in
graded alcohol and xylene and then embedded in paraffin according
to standard procedures. The wounds were bisected and sectioned
at 6 ~m to obtain a cross-section near the center of the wound.
The section was mounted on poly-L-lysine coated slides and
stained with hematoxylin and eosin. The slides were observed
under an ordinary light microscope.
Measurements of various parameters indicative of the rate of
healing were then taken. The parameters measured included: new
epithelial growth ("N-EG"); the distance between advancing edges
of granulation tissue ("P-P" also referred to as granulation
tissue gap in Example 8); the height of new granulation tissue
("SP" also referred to as the superficial peak height in Example
8), new granulation tissue ("TNG"); and volume of new wound
healing tissue ("N-volume"). N-volume was calculated using the
assumption wounds heal concentrically according to the standard
volume formula measured from the difference between the volume of
wound at day o and the volume at day 7, the time of sacrifice.
P-P is a direct measurement of the horizontal distance between
migrating granulation tissue edges from histologic cuttings. For
P-P measurements, a smaller number indicates more effective
healing. TNG is a measurement of new granulation tissue growth
based on differences in staining in new collagen versus the
mature collaqen of intact dermis. N-EG is a measurement of the
WO g4tl6723 2 1 ~ 4 0 7 8
horizontal migration of new epithelial tissue measured from the
original wound edge.
Tables 8 and 9 provide a summary of the results obtained in
the non-ischemic model of Example 8 and the ischemic model
described above, respectively. All amounts of proteins indicated
in Tables 8 and 9 are in ~g doses.
The results shown in Table 8 are consistent with those
obtained in the non-ischemic studies described in Example 8. The
results indicate that a molar excess of IGF-1 over IGF-BP1 is
preferred, while neither alone are as effective. In addition,
there appears to be a dose dependent effect. When used in molar
ratios of 5:1 to 11:1, an increase in new granulation tissue
formation and epithelialization was observed, with the ratio of
10:1 (43.2 ~g IGF-1 to 12.9 ~g IGF-BP1) providing the maximal
effect, within the dose range tested. In the ischemia model, the
43.2 ~g/12.9 ~g (10:1) ratio proved to be highly effective.
W0941167~ 2 1 5 ~ 0 7 8 PCT~S94/~799
TABLE 8
NON-ISCHEMIC MODEL
NUMBER
CONDITION N-EGI P-P' SP~ TNG' N-VOLUNE OF WOUNDS
BUFFER 367 470` 50.5100 4.2 E+06 65
IGF (5 ~g) 413 455 48 91 3.5 E+06 32
IGF (43.2) 355 440 49 93 4.0 E+06 12
BPl (9) 364 452 46100 3.7 E+06 28
BPl (13.2) 353 476 50.378 3.4 E+06 16
IGFl/BPl(l~
1/3.3 440 472 50114 4.6 E+06 27
4/13.2 342 468 51 79 3.4 E+06 16
IGFl/BPl(5:1):
3/5 463 398 53.4138 5.8 E+06 16
15/9 505 409 50.6149 5.9 E+06 16
IGF/BPl(ll:l):
1/0.3 334 409 50.3126 5.1 E+06 16
5/1.5 381 413 60141 6.9 E+06 16
IGFl/BPl(10:1)
43.2/12.9 497 345 52219 8.1 E+06 12
measured in mm x 102
34
WO94/167~ 215 4 0 7 8 PCT~S94/00799
TABLE 9
ISCHEMIC MODEL
NlNBER
CONDITION N-EG P-P 8P TNG N-VOLUME OF WOUNDS
IGF/BP1 (5~
15/9 133 546 40.3 32 1.15 E+06 11
BUFFER 121 S39 40.5 28 1.05 E+06 12
P-VALUE *NS *NS *NS *NS *NS
IGFl/BPA(10:1):
43.2/12.9 278 519 42.764.7 2.26 E+06 6
BUFFER
(2 RABBITS) 102 557 40.722 8.00 E+05 6
P-VALUE 0.055 *NS *NS <0.05 <0.03
IGF/BP1(10:1):
43.2/12.9 468 460 42.8 101.7 3.60 E+0612
BUFFER
(4 RABBITS) 259.5 543 42.5 36 1/23 E+06 8
P-VALUE <0.01 <0.05 *NS <0.01 <0.0001
*NS=not significant, p>0.05
The statistical analysis was carried out using Student's
paired t-test for each group studied. All values are expressed
as mean +/- SEM. A p- value of 0.05 or less was considered
significant.
Although this invention has been described with respect to
specific embodiments, it is not intended to be limited thereto
and modifications made by those skilled in the art are considered
to fall within the spirit and scope of the instant invention.
