Note: Descriptions are shown in the official language in which they were submitted.
WO 95/06717 PCT/US94/09957
21S89~3
Desc,;~lion
METHODS OF SUPPRESSING GRAFT REJECTION
Technical Field
The present invention relates generally to the field of tissue
transplantation, and more specifically, to methods for preventing graft rejection
mediated by T-cell recognition and activation.
Back~round of the Invention
Effective and safe methods of ~u~l les~ g the immlme response have
been a critical issue for clinical transplants from the beginning of the 1950's. Upon
introduction of allograft tissue into an animal, an attack by the immlln~ system is
15 initiated consisting of both humoral and cell merli~te~l responses. In these responses,
tissue cells are targeted for clearance by antibodies directed against the transplanted
tissues or destroyed by killer cells. Allograft rejection consists of a series of complex
T-cell dependent events triggered by donor histocompatibility molecules. One major
event in T-cell activation is associated with the de novo ~ es~ion of the cell surface
20 protein, interleukin-2 receptor (IL-2R) which is essential for proliferation and continued
viability of alloactivated T-cells upon binding to IL-2. (Cantrell et al., Science
~:1312, 1984). When IL-2R is not present, the immune response is ~u~pl~ssed.
One early attempt to suppress the rejection response utilized whole-body
irradiation. However, such attempts were lln~uccec~ful due to a lack of specificity and
25 increased tumor production. This led to the utilization of either specific drugs or
antibodies for the prevention and treatment of graft rejection. In this regard, a number
of drugs (Carpenter et al., New Fn~l. J. Med. ~:1224, 1991) have been shown to be
successfully imrnunosuppressive, but not without various side effects. These toxic
effects generally include neurologic, dermal, gastrointestinal, endocrine, vascular, and
30 hematologic complications. One such established drug that induces specific tolerance
to organ transplants is cyclosporine. This drug exerts its therapeutic affect by inhibiting
T-cell-mediated alloimmune and autoimmune responses specifically by suppression of
IL-2 production at the mRNA transcriptional level (Kronke et al., PNAS 81:5214,
1984). Although the exact mech~ni.~m is not yet known, reduction of IL-2 synthesis has
35 been demonstrated in vivo in bone marrow transplants (Hess et al., J. Immunol.
1~:355, 1983) and renal-transplant recipients (Azogui et al., J. Immunol. 131:12Q5,
WO 95/06717 PCT/US94/09957
?,~S~9~3~ 2
1983) by repetitive drug ~(1mini~tration. However, since cyclosporine is non-
specifically a~mini~tered throughout the systemic circulation, the drug is known to have
many toxic side-effects, for example hepatotoxicity and nephrotoxicity (Kahan et al.,
New F~l J. Med. ~1:1725, 1985 In addition, ~lmini~tration of cyclosporine
5 renders the patient more ~-lsceylible to general infection.
Antibodies directed to the lymphoid cells of the immune system have
also been used in anti-rejection therapy, starting in the 1960's (Filo et al.,
Transpl~ntation ~Q:445, 1980). However, such anti-lymphocyte globulins, althoughgenerally useful, were of variable potency and had the potential disadvantage of10 collt~ g antibodies directed against a wide variety of nonlymphoid tissues, such as
platelets and macrophages. The first clinical antibody to be used was anti-CD3~ also
known as OKT3. OKT3 is directed only against mature T-lymphocytes, its precise
target being the CD3 cluster that composes the antigen-receptor complex of T-cells.
The F(ab)2 fragment of the OKT3 monoclonal antibody retains the immunosuppressive
15 prope~ies of the whole antibody but is less active in eliciting T-cell activation and
lymphokine release (Woodle et al., Transplantation 52:354, 1991). Bioengineered
variants of the OKT3 molecule with high epitope specificity and high immune
suppression potency have been produced. However, the antibody has the disadvantage
of activating all accessible T-cells, sometimes resulting in severe febrile and circulatory
20 problems for the first day or two after ~tlmini~tration (Carpenter, ~m. J. Kidney Dis.
14:suppl 2:1, 1989). Monoclonal antibodies directed at surface receptors other than
CD3 have yielded mixed results (Heffron et al., Transplant Sci. 1:64, 1991). Although
anti-CD4 monoclonal antibodies have appeared more attractive in view of their low
toxicity and propensity to induce longer-lasting immunologic non-responsiveness in
25 certain animal models, the depletion of CD4+ T-cells may lead to a possible AIDS
syndrome (Sablinski et al., Transplantation 52:579, 1991). Therefore, these systems do
not provide suitable long-term effects and must be ~cycli~i~rely ~imini~tered.
Consequently, there is a need in the art for improved methods of
~uyylcssh1g the immune response, without the side effects or disadvantages of
30 previously described methods. The present invention fulfills these needs and further
provides other related advantages.
Summarv of the Invention
Briefly stated, the present invention provides methods for suyylcssillg
35 MHC antigen presentation in order to suppress the immune response of T-cells,including cytotoxic T-lymphocytes (CTL), thereby preventing graft rejection. Within
WO 95/06717 ~ ~ ~ ,$~ ~ 3 PCTIIJS94/099S7
one aspect, a method is provided for suppressing graft rejection, compricing
transforming tissue cells isolated from a donor animal with a recombinant vectorconstruct which directs the expression of a protein or active portion of a protein capable
of inhibiting MHC antigen presentation, and transplanting the l~ srolllled tissue cells
into a recipient animal such that an immune response against the tissue cells is~uypl~ssed. Within one embodiment of the invention, the recombinant vector construct
directs the expression of a protein capable of binding ~2-microglobulin, such as H301.
With another embodiment, the recombinant vector construct directs the t;Aylession of a
protein capable of binding the MHC class I heavy chain molecule intracellularly, such
as E3/19K.
Within another aspect of the invention, a method is provided for
suyyles~ g graft rejection, comprising transforming tissue cells isolated from a donor
animal with a recombinant vector construct which transcribes an antisense message, the
~nti~en.~e message being capable of inhibiting MHC antigen presentation, and
transplanting the transformed tissue cells into a recipient animal such that an immllne
response against the tissue cells is ~uy~lessed. Within certain embodiments of the
present invention, the recombinant vector construct transcribes an antisense message
which binds to a conserved region of the MHC class I heavy chain transcripts, ~2-
microglobulin transcript, or the PSFl transporter protein transcript.
Within still another aspect of the invention, a method is provided for
suppressing graft rejection, comprising transforming tissue cells isolated from a donor
animal with a recombinant vector construct which transcribes a ribozyme capable of
inhibiting MHC antigen presentation, and transplanting the transformed tissue cells into
a recipient animal such that an immune response against the tissue cells is suppressed.
Within certain embodiments of the invention, the recombinant vector construct
transcribes a ribozyme that cleaves a conserved region of MHC class I heav,v chain
transcripts, ~2-microglobulin transcript or the PSFl transporter protein transcript.
Within another aspect of the invention, a method is provided for
suppressing graft rejection comprising transforming tissue cells isolated from a donor
animal with a multivalent recombinant vector construct which directs the expression of
a protein or active portion of a protein capable of inhibiting MHC antigen presentation,
and an antisense or ribozyme capable of inhibiting MHC antigen presentation, andtransplanting the transformed tissue cells into a recipient animal such that an immune
response against the tissue cells is suppressed. Within a related aspect, tissue cells
3~ isolated from a donor animal are transformed with a multivalent recombinant vector
construct which directs the expression of an ~nti~en~e message and a ribozyme capable
WO 95/06717 PCT/US94/09957
sl ~S933 4
of inhibiting MHC antigen presentation. Subsequently, the transformed tissue cells are
transplanted into a recipient animal such that an immune response against the tissue
cells is suppressed. Within another related aspect of the invention, tissue cells isolated
from a donor animal are transformed with a multivalent recombinant vector construct
which directs the ~ ,~s~ion of two or more proteins or active portions of proteins
capable of inhibiting MHC antigen presentation, two or more ~ntisçn~e messages
capable of inhibiting MHC antigen presentation, or two or more ribozymes capable o~
inhibiting MHC antigen presentation. Subsequently, the transformed tissue cells are
transplanted into a recipient animal such that an immune response against the tissue
cells is suppressed.
Within various embodiments of the invention, the multivalent
recombinant vector construct expresses or transcribes at least two of the following in
any combination: a protein or active portion of a protein selected from the group
consisting of E3/19K and H301, an antisense message that binds to the transcript of a
conserved region of MHC class I heavy chains, ~2-microglobulin or PSFl transporter
protein, or a ribozyme that cleaves the transcript of a conserved region of MHC class I
heavy chains, ~2-microglobulin or PSF 1 l~alls~ol ler protein. Within another
embodiment, the multivalent recombinant viral vector constructs express or transcribe
two such proteins or active portions of the proteins, two antisense messages or two
ribozymes.
Within preferred embodiments, the recombinant vector construct is a
recombinant viral vector construct. Within a particularly preferred embodiment, the
recombinant vector construct is a recombinant retroviral vector construct. Within other
embodiments, the recombinant viral vector construct is carried by a recombinant virus
selected from the group con.~i~ting of togaviridae, picornaviridae, poxviridae,
adenoviridae, parvoviridae, herpesviridae, paramyxoviridae and coronaviridae viruses.
In the context of the present invention, suitable donor tissue cells include
bone marrow cells, pancreatic islet cells, fibroblast cells, corneal cells and skin cells.
Such tissue cells may be transplanted into a recipient animal using a number of
methods, including direct injection or catheter infusion.
Within still another related aspect of the present invention,
ph~rrn~eutical compositions are is provided comprising tissue cells transformed with a
recombinant vector construct or a multivalent recombinant vector construct as described
herem.
Within various embodiments of the present invention methods are
provided wherein the transformed tissue cells are implanted into an animal having the
WO 95/06717 PCT/US94/09957
`8~3
same type MHC, into a different animal species from which the tissue cells were
removed.
These and other aspects of the present invention will become evident
upon reference to the following detailed description.
s
Detailed Description of the Invention
Prior to setting forth the invention, it may be helpful to an underst~n-ling
thereof to set forth definitions of certain terms that will be used hereinafter."Tr~n~lant" refers to the insertion or grafting of tissue cells into a
recipient animal such that at least a portion of the tissue cells are viable subsequent to
implantation. The implanted tissue can be placed within tissue of similar function or of
different function. For example, tissue cells from one animal may be removed andtransformed with recombinant vector constructs before being "implanted" into another
animal. Transplantation of tissue between genetically (li~simil~r ~nim~l~ of the same
species is termed allogeneic transplantation.
"Tramfonnin~" tissue cells refers to the transduction or transfection of
tissue cells by any of a variety of means recognized by those skilled in the art, such that
the transformed tissue cell e~lesses additional polynucleotides as compared to a tissue
cell prior to the transforming event.
"Recombinant vector construct" or "vector construct" refers to an
assembly which is capable of expressing sequences or genes of interest. In the context
of protein expression, the vector construct must include promoter elements and may
include a signal that directs polyadenylation. In addition, the vector constructpreferably includes a sequence which, when transcribed, is operably linked to the
sequences or genes of interest and acts as a translation initiation sequence. Preferably,
the vector construct includes a selectable marker such as neomycin, thymidine kinase,
hygromycin, phleomycin, histidinol, or dihydrofolate reductase (DHFR), as well as one
or more restriction sites and a translation tennin:~tion sequence. In addition, if the
vector construct is used to make a retroviral particle, the vector construct must include a
retroviral parl~ging signal and LTRs appropl;ate to the retrovirus used, provided these
are not used already present. The vector construct can also be used in combination with
other viral vectors or inserted physically into cells or tissues as described below. As
noted above, the vector construct includes a sequence that encodes a protein or active
portion of the protein, antisense or ribozyme. Such sequences are designed to inhibit
35 MHC antigen presentation in order to suppress the irn~nune response of cytotoxic T-
lymphocytes against the transplanted tissue.
WO 95/06717 PCT/US94/09957
~5~933
In general, the recombinant vector constructs described herein are
prepared by selecting a plasmid with a strong promoter, and a~lopliate restriction sites
for insertion of DNA sequences of interest downstream from the promoter. As noted
above, the vector construct may have a gene encoding antibiotic resi~t~nçe for selection
S as well as termin~tion and polyadenylation signals. Additional elements may include
enhancers and introns with functional spli~: donor and acceptor sites.
The construction of multivalent recombinant vector constructs may
require h-;o promoters when two proteins are being expressed, because one promoter
may not ensure adequate levels of gene ~l res~ion of the second gene. In particular,
where the vector construct expresses an ~nti.~en~e message or ribozyme, a secondpromoter may not be necessary. Within certain embotliment~, an intçrn~l ribosomebinding site (IRBS) or herpes simplex virus thymidine kinase (HSVTK) promoter isplaced in conjunction with the second gene of interest in order to boost the levels of
gene expression of the second gene. Briefly, with respect to IRBS, the u~ leallluntr~n~l~ted region of the immunoglobulin heavy chain binding protein has been shown
t~ support the internal engagement of a bicistronic message (Jacejak et al., Nature
3 3:90, 1991). This sequence is small, approximately 300 base pairs, and may readily
be incorporated into a vector in order to express multiple genes from a multi-cistronic
message whose cistrons begin with this sequence.
Where the recombinant vector construct is carried by a virus, such
constructs are prepared by inserting sequences of a virus cont~ining the promoter,
splicing, and polyadenylation signals into plasmids cont~ining the desired gene of
interest using methods well known in the art. The recombinant viral vector cont~ining
the gene of interest can replicate to high copy number after transduction into the target
tissue cells.
Subsequent to plepd~dLion of the recombinant vector construct, it may be
preferable to assess the ability of vector transformed cells to down regulate MHC
antigen p. esentation. In general, such ~cses~ments may be performed by Western blot,
FACS ana,ysis, or b other methods recognized by those skilled in the art.
Wit.~n preferred embodiments. the recombinant vector construct is
carried by a retrovirus. Retroviruses are R~- viruses with a single positive strand
genome which in general, are nonlytic. ~ pon infection, the retrovir~s reverse
transcribes its RNA into DNA, forming a provirus which is inserted into the host cell
genome. Preparation of retroviral constructs for use in the present invention isdescribed in greater detail in an application entitled "Recombinant Retroviruses"
(U.S.S.N. 07/586,603, filed September 21, 1990) herein incorporated by reference. The
PCI`/US94/09957
WO 95/06717 ~ ;~L 5:89 33
retroviral genome can be divided conceptually into two parts. The "trans-acting"portion consists of the region coding for viral structural proteins, including the group
specific antigen (gag) gene for synthesis of the core coat proteins; the pol gene for the
synthesis of the reverse transcriptase and integrase enzymes; and the envelope (env)
5 gene for the synthesis of envelope glycoproteins. The "cis-acting" portion consists of
regions of the genome that is finally packaged into the viral particle. These regions
include the p~c~ing signal, long terrnin~l repeats (LTR) with promoters and
polyadenylation sites, and two start sites for DNA replication. The internal or "trans-
acting" part of the cloned provirus is replaced by the gene of interest to create a "vector
10 construct". When the vector construct is placed into a cell where viral packaging
proteins are present (see U.S.S.N. 07/800,921), the transcribed RNA will be packaged
as a viral particle which, in turn, will bud off from the cell. These particles are used to
transduce tissue cells, allowing the vector construct to integrate into the cell genome.
Although the vector construct express its gene product, the virus carrying it is15 replication defective because the trans-acting portion of the viral genome is absent.
Various assays may be utilized in order to detect the presence of any replication
competent infectious retrovirus. One preferred assay is the extended S+L- assay
described in Example 9. Preferred retoviral vectors include murine leukemia
amphotropic or xenotropic, or VsVg pseudotype vectors (see WO 92/14829; and
20 U.S.S.N. 08/ to be assi~ned bv PTO incorporated herein bv reference).
Recombinant vector constructs may also be developed and utilized with
a variety of viral carriers including, for example, poliovirus (Evans et al., Nature
339:385, 1989, and Sabin et al., J. of Riol. Standardization 1:115, 1973) (ATCC VR-
58); rhinovirus (Arnold et al., J. Cell. Biochem. L401, 1990) (ATCC VR-1110); pox
25 viruses, such as canary pox virus or vaccinia virus (Fisher-Hoch et al., PNAS 86:317,
1989; Flexner et al., Ann. N.Y. Acad. Sci. 569:86, 1989; Flexner et al., Vaccine 8:17,
1990; U.S. 4,603,112 and U.S. 4,769,330; WO 89101973) (ATCC VR-l l l; ATCC VR-
2010); SV40 (Mulligan et al., ~ature ~:108, 1979) (ATCC VR-305), (Madzak et al.,J.Gen. Vir. 73:1533, 1992); influen~ virus (Luytjes et al., Cell 59:1107, 1989;
30 McMicheal et al., The New Fr~l~nd Journal of Medicine ~Q:13, 1983; and Yap et al.,
~ature ~1~:238, 1978) (ATCC VR-797); adenovirus (Berkner et al., Biotechniques
6:616, 1988, and Rosenfeld et al., Science ~:431, 1991) (ATCC VR-l); parvovirus
such as adeno-associated virus (Samulski et al., J. Vir. 63:3822, 1989, and Mendelson
et al., V;rolo~,v 166:154, 1988) (ATCC VR-645); herpes simplex virus (Kit et al.,
35 Exp. Med. Biol. ~1~:219, 1989) (ATCC VR-977; ATCC VR-260?; ~ature 277: 108,
1979); HIV (EPO 386,882, Buchschacher et al., L Vir. 66:2731, 1992); measles virus
WO 95/06717 PCT/US94/09957
~5a933 8
(EPO 440,219) (ATCC VR-24); Sindbis virus (Xiong etal., Science ~:1188, 1989)
(ATCC VR-68); and coronavirus (Hamre et al., Proc. Soc. Fxp. Riol. Med. 121:190,1966) (ATCC VR-740). It will be evident to those in the art that the viral carriers noted
above may need to be modified to express proteins, ~nti~n~e messages or ribozymes
5 capable of inhibiting MHC antigen presentation.
Once a vector construct has been prepared, it may be used to transform
isolated tissue cells through a variety of routes. More specifically, naked DNA or a
recombinant viral vector construct co~ -g a gene that codes for a protein or active
portion of a protein, an ~nti~çn~e message or ribozyme capable of inhibiting MHC10 antigen pres~nt~tion, may be introduced into tissue cells removed from a donor using
physical methods or through the use of viral or retroviral vectors as discussed herein.
Ex vivo procedures for physical and chemical methods of uptake include
calcium phosphate plecil,italion, direct microinj~çtion of DNA into intact target cells,
and electroporation wherebv ~ells suspended in a conducting solution are subjected to
15 an intense electric field in c r to transiently polarize the membrane, allowing entry of
macromolecules. Other pro. dures include the use of DNA bound to ligand, DNA
linked to an inactive adenovirus (Cotton et al., PNAS 89: 6094, 1990), bombardment
with DNA bound to particles, liposomes entrapping recombinant vector construct.
spheroplast fusion whereby E. coli COll~ g recombinant viral vector constructs are
20 stripped of their outer cell walls and fused to animal cells using polyethylene glycol and
viral transduction, (Cline et al., Pharmac. Ther. ~:69, 1985; and Frie~im~nn et al.,
Science ~:1275, 1989). Alternatively, as noted above, the vector construct may be
carried by a virus such as vaccinia, Sindbis or corona virus. Further, methods for
~tlmini~tering a vector construct via a retroviral vector are described in more detail in an
25 application entitled "Recombina... Retroviruses" (U.S.S.N. 07/586,603) herein incorporated by reference.
In an e.~- vivo context, the transformed cells are transplanted into the
animal, and monitored for gene expression as described in Examples 15. Protocols vary
depending on the tissue cells chosen. Briefly, a recombinant vector construct carrying a
30 sequence, the expression of which inhibits MHC class I presentation, is transformed
into tissue cells. Preferable 105 to 109 tissue cells are transformed. The cells are
cultured, and transformed cells may be selected by antibiotic resistance. Cells are
assayed for gene expression by Western blot and FACS analysis, or other means. For
example, as described in more detail below, bone marrow cells that have been
35 transformed are tr~splanted in an animal by intravenous ~-imin-~tration of 2 to 3 x 107
cells (see WO 93/00051).
WO 95/06717 2 1 ~ ~ 9 ~ 3 PCT/US94/09957
Cells that can be transformed include, but are not limited to, fibroblast
cells, bone marrow cells, endothelial cells, keratinocytes, hepatocytes, and thyroid
follicular cells. Tla~ led cells may be ~(lmini~tered to patients directly by
intramuscular, intra~lçrm~l, subdermal, intravenous, or direct catheter infusion into
5 cavities of the body. In vivo gene ex~lession of tr~n~ ced bone marrow cells is
detected by monitoring hematopoesis as a function of hematocrit and Iymphocyte
production.
It will be evident to those skilled in the art that isolated pancreatic islet
cells can also be transformed as described above. Such transformed cells may then be
10 transplanted into recipients by injection through the gastro-epiploic artery. In vivo gene
expression of insulin is observed by monitoring blood glucose levels.
As discussed above, the present invention provides methods and
compositions suitable for inhibiting MHC antigen presentation in order to suppress the
immune response of the host. Briefly, CTL are specifically activated by the display of
15 processed peptides in the context of self MHC molecules along with accessory
molecules such as CD8, intercellular adhesion molecule -1 (ICAM-1), ICAM-2, ICAM-
3, leukocyte functional antigen-1 (LFA-1) (Altmann et al., Nature 338:521, 1989), the
B7/BB1 molecule (Freeman et al., J. Tmmunol 143:2714, 1989), LFA-3 (Singer,
Science ~:1671, 1992; Rao, Crit. Rev. Tmmunol. 10:495, 1991), or other cell
20 adhesion molecules. Antigenic peptide presentation in association with MHC class I
molecules leads to CTL activation. Transfer and stable integration of specific
sequences capable of ~x~le;,~ g products expected to inhibit MHC antigen presentation
block activation of T-cells, such as CD8 CTL, and therefore suppress graft rejection.
A standard CTL assay is used to detect this response as described in more detail in
25 Example 13. Components of the antigen presentation pathway include the 45Kd MHC
class I heavy chain"B2-microglobulin, proces~ing enzymes such as proteases, accessory
molecules, chaperones, and transporter proteins such as PSF 1.
Within one aspect of the present invention, vector constructs are
provided which direct the expression of a protein or active portion of a protein capable
30 of inhibiting MHC class I antigen presentation. Within the present invention, an "active
portion" of a protein is that fragment of the protein which must be retained for
biological activitv. Such fragments or active domains can be readily identified by
systematically removing nucleotide sequences from the protein sequence, transforming
target cells with the resulting recombinant vector construct, and determining MHC class
35 I presentation on the surface of cells using FACS analysis or other immunological
assays, such as a CTL assay. These fragments are particularly useful when the size of
WO 95/06717 PCT/US94/09957
9~3
the sequence encoding the entire protein exceeds the capacity of the viral carrier.
Alternatively, the active domain of the MHC antigen l"ese~ tion inhibitor protein can
be enzymatically digested and the active portion purified by biochemical methods. For
example, a monoclonal antibody that blocks the active portion of the protein can be
used to isolate and purify the active portion of the cleaved protein (Harlow et al.,
.~ntibodies: A T.~horatory Manual, Cold Springs Harbor, 1988).
Within one embodiment, the recombinant vector construct directs the
expression of a protein or active portion of a protein that binds to newly synthesized
MHC class I molecules intracellularly. This binding prevents migration of the MHC
class I molecule from the endoplasmic reticulum, resulting in the inhibition of t~rmin~l
glycosylation. This blocks transport of these molecules to the cell surface and prevents
cell recognition and lysis by CTL. For instance, one of the products of the E3 gene may
be used to inhibit transport of MHC class I molecules to the surface of the transformed
cell. More specifically, E3 encodes a l9kD tr~ncmemhrane glycol~oteill, E3/19K,
transcribed from the E3 region of the adenovirus 2 genome. Within the context of the
present invention, tissue cells are transformed with a recombinant vector construct
co.-t~inil-g the E3/19K sequence, which upon ~l"es~ion produces the E3/19K protein.
The E3/19K protein inhibits the surface exl"cssion of MHC class I surface molecules,
and cells transformed by the vector construct evade an immune response. The
construction of a representative recombinant vector construct in this regard is presented
in Example 2. Consequently, donor cells can be transplanted with reduced risk of graft
rejection and may require only a minim~l immlm~ul"es~ e regimen for the transplant
patient. This allows an acceptable donor-recipient chimeric state to exist with fewer
complications.
Within another embodiment of the present invention, the recombinant
vector construct directs the expression of a protein or an active portion of a protein
capable of binding ~-microglobulin. Transport of MHC class I molecules to the cell
surface for antigen presentation requires associat:-~n with ~2-microglobulin. Thus,
proteins that bind ~2-microglobulin and inhibit its association with MHC class Iindirectly inhibit MHC class I antigen presentation. Suitable proteins include the H301
gene product. Briefly, the H301 gene, obtained from the human cytomegalovirus
(CMV) encodes a glycoprotein with sequence homology to the ,B2-microglobulin
binding site on the heavy chain of the MHC class I molecule (Browne et al., Nature
347:770, 1990). H301 binds ~2-microglobulin, thereby preventing the maturation of
MHC class I molecules, and renders transformed cells unrecognizable by cytotoxicT-cells, thus evading MHC class I restricted immune surveillance.
PCT/US94/09957
WO 95/06717
213~933
Other proteins, not discussed above, that function to inhibit or down-
regulate MHC class I antigen plcsell~ation may also be identified and utilized ~vithin the
context of the present invention. In order to identify such proteins, in particular those
derived from m~mm~ n pathogens (and, in turn, active portions thereof), a
5 recombinant vector construct that eA~,esses a protein or an active portion thereof
suspected of being capable of inhibiting MHC class I antigen presentation is
transformed into a tester cell line, such as BC. The tester cell lines with and without the
sequence encoding the candidate protein are comya~ed to stimulators and/or targets in
the CTL assay. A decrease in cell Iysis corresponding to the transformed tester cell
10 indicates that the candidate protein is capable of inhibiting MHC presentation.
An alternative method to determine down-regulation of MHC class I
surface expression is by FACS analysis. More specifically, cell lines are transformed
with a recombinant vector construct encoding the candidate protein. After drug
selection and expansion, the cells are analyzed by FACS for MHC class I expression
15 and compared to that of non-transformed cells. A decrease in cell surface ~Al,r~ssion of
MHC class I indicates that the c~n.lid~te protein is capable of inhibiting MHC
pres~ont~tion (see, for instance, Example 12).
Within another aspect of the present invention, methods are provided for
suppressing graft rejection by transforming tissue cells with a recombinant vector
20 construct which transcribes an ~nticPnce message capable of inhibiting MHC class I
antigen presentation. Briefly, oligonucleotides with nucleotide sequences
complement~ry to the protein coding or "sense" sequence are termed "antisense".
Antisense RNA sequences function as regulators of gene expression by hybridizing to
complementary mRNA sequences and arresting translation (Mizuno et al., PNAS
25 81:1966, 1984; Heywood et al., Nucleic Acids Res. 14:6771, 1986). ~nticen~e
molecules comprising the entire sequence of the target transcript or any part thereof can
be syntht ci7ed (Ferretti et al., PNAS 83:599, 1986), placed into vector constructs, and
effectively introduced into cells to inhibit gene ~ sion (Izant et al., Cell 36:1007,
1984). In addition, the synthesis of ~nticence RNA (asRNA) from DNA cloned in
30 inverted orientation offers stability over time while constitutive asRNA ~ies~ion does
- not interfere with normal cell function.
Within one embodiment of the present invention, the recombinant viral
vector construct transcribes an ~nticence message capable of binding to a conserved
region of the MHC class I transcripts, thereby inhibiting cell surface expression and
35 MHC class I antigen presentation. One may identify such conserved regions through
computer-assisted comparison of sequences representing different classes of MHC
PCT/US94/09957
WO 95/06717
?~, ~5~3 12
genes (for exarnple, HLA A, B and C), available within ~ sequence ~l~t~b~nk~ (e.g.,
Genbank). Conserved sequences are then identifi~ Irough computer-assisted
~lignment for homology of the nucleotide sequences. he conserved region is a
sequence having less than 50% mi~m~tch, preferably less than 20% micm~tch, per 100
base pairs bet~veen MHC class I genotypes.
Within another embodiment of the present invention, the recombinant
vector construct transcribes an antisense message ~ onsible for binding to ~2-
microglobulin transcript. This binding prevents translation of the ~2-microglobulin
protein and thereby inhibits proper assembly of the MHC class I molecule complexnecessary for cell surface expression. Within a preferred embodiment, the nucleotide
sequence for ~2-microglobulin is cloned into a vector construct in the reverse
orientation. The proper ~nti~n~e orientation may be determined by restriction enzvme
analysis.
Within still another embodiment of the present invention, the
recombinant vector construct transcribes an ~nti~n.ce message responsible for binding
PSF1 transcript, a peptide tran~?orter protein. Since this protein is necessary for the
efficient assembly of MHC clas; 3 ;nolecules, such an antisense blocks the transport of
processed antigenic peptide fra~ments to the endoplasmic reticulum (ER) prior toassociation with the MHC class I molecular complex. Within a preferred embodiment,
the nucleotide sequence for the ~nti~en~e PSF1 is prepared and inserted in reverse
orientation into the vector construct and detPrrnin~-l by restriction enzyme analysis.
Ai discussed above, the sequences of other proteins involved in antigen
presentation may also be identified, and used to design a recombinant vector construct
capable of transcribing an antisense RNA message that inhibits MHC antigen
presentation. More specifically, the nucleotide sequence of the gene encoding the
protein is examined, and the identified sequence is used to synth~si7P an a~plop,iate
~nti.~ence message. It is preferable to use a sequence complimentary to a portion
u~ e~ll or close to the start sequence of the target message. This allows the antisense
sequence to bind to the mRNA preventing translation of a significant portion of the
protein. Examples of such molecules are ICAM-1, ICAM-2, ICAM-3, LFA-1, LFA-3,
and B7/BB1. Down-regulation of MHC class I e~l,lession or antigen presentation may
be assayed by FACS analysis or CTL assay, respectively, as described in Exarnples 14
and 15 or by other means as described above for proteins capable of inhibiting MHC
class I presentation.
Within another aspect of the present invention, a method is provided for
suppressing an imrnune response within an animal by transforrning selected cells of the
PCT/US94/09957
WO 95/06717
~13~9~
13
animal with a recombinant vector construct which transcribes a ribozyme responsible
for the enzymatic cleavage of a component involved in the MHC antigen pl~,se~ Lion.
Briefly, ribozymes are RNA molecules with enzymatic cleaving activity which are used
to digest other RNA molecules. They consist of short RNA molecules posses~ing
5 highly conserved sequence-specific cleavage domains flanked by regions which allow
accurate positioning of the enzyme relative to the potential cleavage site in the desired
target molecule. They provide highly flexible tools in inhibiting the expression and
activation of specific genes (Haseloff et al., ~ature ~g:585, 1988). Custom ribozymes
can easily be designed, provided that the transcribed sequences of the gene are known.
10 Specifically, a ribozyme may be designed by first choosing the particular target RNA
sequence and ~tt~r.hing complimentary sequences to the beginning and end of the
ribozyme coding sequence. This ribozyme producing gene unit can then be insertedinto a recombinant vector construct and used to transform tissue cells. Upon
expression, the target gene is neutralized by complimentary binding and cleavage,
15 guar~nteeing permanent inactivation. In addition, because of their enzymatic activity,
ribozymes are capable of destroying more than one target.
Within one embodiment of the present invention, recombinant vector
construct cont~ining specific ribozymes are used to cleave the transcript of a conserved
region of the MHC class I molecule in order to inhibit antigen presentation. Within
20 another embodiment of the present invention, the recombinant vector constructtranscribes a ribozyme responsible for the enzymatic cleavage of the ~2-microglobulin
transcript. Specifically. a ribozyme with fl~nking regions complimentary to a sequence
of the ~2-microglobulin message cleaves the transcript, thereby preventing protein
translation and proper assembly of the MHC class 1 molecule complex. This inhibits
25 transport of the MHC class I complex to the cell surface, thereby suppressing antigen
pres~nt~tion.
Within still another embodiment of the present invention, the
recombinant vector construct transcribes a ribozyme responsible for the enzymatic
cleavage of the PSF1 transcript, thereby suppressing cell surface ~fession of MHC
30 class I molecules and preventing antigen presentation. Specifically, a ribozyme
designed with fl~nking regions complimentary to a sequence of the PSF1 message
cleaves the transcripts and inhibits transport of peptides to the ER, thereby preventing
assembly of the MHC class I complex and antigen presentation.
It will be evident to those skilled in the art that the sequences of other
35 proteins involved in MHC antigen presentation (see above) can be identified and used
to design a recombinant vector construct capable of transcribing a ribozyme that
WO 9S/06717 PCTIUS94/09957
933
inhibits MHC antigen presentation. Down regulation of MHC class I ~lcssion or
antigen prese~t~tion may be assayed by CTL analysis, respectively, or other means as
described above for proteins capable of inhibiting MHC class I presentation.
Within another aspect of the invention, multivalent recombinant vector
S constructs are provided. Briefly, the efficienc~ of ~u~ ssing an autoimmune response
can be enhanced by tran~ro-l~ g cells with a multivalent recombinant vector construct.
Upon c;~lession~ the gene products increase the degree of interference with MHC
antigen presentation by ~tt~king a single component via two different routes or two
different components via the same or different routes. The construction of multivalent
10 recombinant vector constructs may require two promoters because one promoter may
not ensure adequate levels of gene ~lcssion of the second gene. A second promoter,
such as an int~rn~l ribzome binding site (IRBS) promoter, or herpes simplex virus
thymidine kinase (HSVTK) promoter placed in conjunction with the second gene of
interest boosts the levels of gene expression of the second gene.
Within pl~r~ d embo~limentc, the vector construct expresses or
transcribes at least two of the fc .~wing components in any combination: (a) a protein
or ^ ve portion of the proteins E3/19K or H301; (b) an antisense message that binds
th~ nscript of a conserved region of the MHC class I heavy chain, ~2-microglobulin
or PSFl transporter protein; and (c) a ribozyme that cleaves the transcript of the
20 proteins listed in (b) above. In addition, multivalent recombinant vector constructs are
provided which e~press two proteins or active portions of proteins as described herein,
two antisense messages, or two ribozymes.
Within related embodirnents, a number of specific combinations may be
utilized to form a multivalent recombinant vector construct. For example, a multivalent
25 recombinant vector construct may consist of a gene expressing E3/19K or H301 in
combination with the antisense or ribozyme message for a conserved region of theMHC class I heavy chain, ~2-microglobulin, or PSF1 transporter protein.
Within another aspect of the present invention, pharmaceutical
compositions are provided comprising one of the above described recombinant vector
30 constructs or a recombinant virus carrying the vector construct, such as a retrovirus,
poliovirus, rhinovirus, vaccinia virus,- influenza virus, adenovirus, adeno-associated
virus, herpes simplex virus, SV40, HIV, measles virus, coronavirus or Sindbis virus, in
combination with a carrier or diluent. The composition may be prepared either as a
liquid solution, or as a solid form (e.g., Iyophilized) which is suspended in a solution
35 prior to transforming tissue cells ex vivo.
W O 95/06717 21~ PCTrUS94/09957
In addition, the approach described herein may be used in vivo to arrest
or ameliorate rejection of previously engrafted tissue. In this regard, the composition
may be ~e~ ed with phztrm~ceutically acceptable suitable carriers or diluents for
injection or other means al~pro~liate to the carrier. Generally, the recombinant virus
5 carrying the vector construct is purified to a concentration ranging from 0.25% to 25%,
and preferably about 5% to 20%, before formulation. Subsequently, after ple~dlion of
the composition, the recombinant vector will constitute about 10 ng to 1 ~g of material
per dose, with about 10 times this amount of m~ten~l present as copurified
co~ nt~ Preferably, the composition is prepared in 0.1-1.0 ml of aqueous
10 solution formulated as described below.
Ph~rm~ceutically acceptable carriers or diluents are those which are
nontoxic to recipients at the dosages and concentrations employed. Representative
examples of carriers or diluents for injectable solutions include water, isotonic solutions
which are preferably buffered at a physiological pH (such as phosphate-buffered saline
15 or Tris-buffered saline) and co~ti.it~ing one or more of mannitol, lactose, trehalose,
dextrose, glycerol and ethanol, as well as polypeptides or proteins such as human serum
albumin (HSA). One suitable composition comprises a recombinant virus carrying avector construct in 10 mg/ml mannitol, 1 mg/ml HSA, 20mM Tris pH=7.2 and 150mM
NaCl. In this case, since the recombinant virus carrying the vector construct rel)lesel,L~
20 approximately 10 ng to 1 ~lg of material, it may be less than 1% of the total high
molecular weight material, and less than 1/100,000 of the total material (including
water). This composition is generally stable at -70C for at least six months. It will be
evident that substantially equivalent dosages of the multivalent recombinant vector
construct may be l~rc~d. In this regard, the vector construct will constitute 100 ng to
25 100 ug of material per dose, with about 10 times this amount of m~teri~l present as
copurified collL;...~ nt~. For recombinant viruses carrying the vector construct, the
individual doses normally used are 106 to 1010 c.u. (e.g., colony forming units of
neomycin resistance titered on HT1080 cells). These compositions are ~rlmini~tered at
one- to four-week intervals for three or four doses (at least initially). Subsequent
30 booster shots may be given as one or two doses after 6-12 months, and thereafter
annually.
The following examples are offered by way of illustration and not by
way of limitation.
WO 95/06717 PCT/US94/09957
Qi6?~3 16
(TRANSPLANTATION - GRAFT REJECTION)
F.XA~MPT .F
Fxam~le 1
PREPARATION OF MURINE RETROVIRAL PROVECTOR DNA
A. PREPARATION OF RETROVIRAL BACKBONE KT-3B
The Moloney murine leukemia virus (MoMLV) 5' long tçrmin~l repeat
(LTR) EcoR I-EcoR I fragment, including gag sequences, from N2 vector (Armentanoet al., J. Vir. 61:1647, 1987, Eglitas et al., Science 230:1395, 1985) in pUC31 plasmid
is ligated into the plasmid SK+ (Stratagene, San Diego, CA). The resulting construct is
15 called N2R5. The N2R5 construct is mutated by site-directed in vi~ro mutagenesis to
change the ATG start codon to An preventing gag ~ es~ion. This mutagenized
fragment is 200 base pairs (bp) in length and flanked by Pst I restriction sites. The Pst I-
Pst I mutated fragment is purified from the SK+ plasmid and inserted into the Pst I site
of N2 MoMLV 5' LTR in plasmid pUC31 to replace the non-mutated 200 bp fr~gm~nt
20 The plasmid pUC31 is derived from pUCl9 (Stratagene, San Diego, CA) in ~ ich
additional restriction sites Xho I, Bgl II, BssH II and Nco I are inserted betv~ ~n the
EcoR I and Sac I sites of the polylinker. This construct is called pUC31/N2R5g~l.
The 1.0 kilobase (Kb) MoMLV 3' LTR EcoR I-EcoR I fragment from
N2 was cloned into plasmid SK+ resulting in a construct called N2R3-. A 1.0 Kb Cla I-
25 Hind III fragment is purified from this construct.
The Cla I-Cla I dominant selectable marker gene fragment from
pAFVXM retroviral vector (Kriegler et al., ~11 ~483, 1984, St. Louis et al., PNAS
85:3150, 1988), comprising a SV40 early promoter driving expression of the neomycin
phosphotransferase gene, is cloned into plasmid SK+. A 1.3 Kb Cla I-BstB I gene
30 fragment is purified from the SK+ plasmid. This fragment, with the 3' LTR Cla I-
Hind III fragment and the 5' LTR in pUC31/N2RSgM make up the KT-3B backbone.
An alternative selectable marker, phleomycin resistance (Mulsant et al.,
Som. Cell and Mol. Gen. 14:243, 1988, available from Cayla, Cedex, FR) may be used
to make the retroviral backbone KT-3C, for use in transforming genes to cells that are
35 already neomycin resistant. The plasmid pUT507 (Mulsant et al., Som. Cell and Mol.
~, l4:243, 1988, available from Cayla, Cedex, FR) is digested withNde I and the
W O 95/06717 ~ 3 3 PCT~US94/099S7
ends blunted with Klenow polymerase I. The sample is then further digested with Hpa
I, Cla I linkers ligated to the mix of fr~gm~ntc and the sample further digested with Cla
I. The excess Cla I linkers are removed by digestion with Cla I and the 1.2 Kb Cla I
fragment carrying the RSV LTR and the phleomycin resistance gene isolated by
5 agarose gel electrophoresis followed by purification using Gene Clean (BiolO1, San
Diego, CA). This fragment is used in place of the 1.3 Kb Cla I-BstB I neomycin
resistance fragment to give the backbone KT-3C.
The ~Aplession vector is constructed by a three part ligation in which the
Xho I-Cla I fragment cot~ g the gene of interest and the l.0 Kb MoMLV 3' LTR
10 Cla I-Hind III fragment are inserted into the Xho I-Hind III site of pUC31/N2R5gM
plasmid. The 1.3 Kb Cla I-BstB I neo gene, or 1.2 Kb Cla I phleomycin, fragment is
then inserted into the Cla I site of this plasmid in the sense orientation.
Fxample '~
A. CLONING OF E3/19K GENE INTO KT-3B
i. ISOLATION AND PURIFICATION OF ADENOVIRUS
The isolation and purification of adenovirus is described by Green et al.,
Methods in Enzymolo~y 58: 425, 1979. Specifically, five liters of Hela cells (3-6 x 105
cells/ml) are infected with 100-500 plaque forrning units (pfu) per ml of adenovirus
type 2 (Ad2) virions (ATCC VR-846). After incubation at 37C for 30-40 hours, the
cells are placed on ice, harvested by centrifugation at 230g for 20 minutes at 4C, and
resuspended in Tris-HCl buffer (pH 8.1). The pellets are mechanically disrupted by
sonication and homogenized in trichlorotrifluoroethane prior to centrifugation at 1,000g
for 10 min. The upper aqueous layer is removed and layered over 10 mls of CsCl (1.43
g/cm3 ) and centrifuged in a SW27 rotor for 1 hour at 20,000 rpm. The opalescent viral
band is removed and adjusted to 1.34 g/cm3 with CsC1 and further centrifuged in a Ti
50 rotor for 16-20 hours at 30,000 rpm. The visible viral band in the middle of the
gradient is removed and stored at 4C until purification of adenoviral DNA.
ii. ISOLATION AND PURIFICATION OF ADENOVIRUS DNA
The adenovirus band is incubated with protease for 1 hour at 37C to
digest proteins. After centrifugation at 7,800g for 10 minutes at 4C, the particles are
WO 95106717 PCT/IJS94/09957
~a933 18
solubilized in 5% sodium dodecyl sulfate (SDS) at room temperature for 30 .~ ".~es
before being extracted with equal volumes of phenol. The upper aqueous phase is
removed, re-extracted with phenol, extracted three times with ether, and dialyzed in Tris
buffer for 24 hours. The viral Ad2 DNA is precipitated in ethanol, washed in ethanol,
S and resuspended in Tris-EDTA buffer, pH 8.1. Approximately 0.5 mg of viral Ad2 DNA is isolated from virus produced in 1.0 liter of cells.
iii. ISOLATION OF E3/19K GENE
The viral Ad2 DNA is digested with EcoR I (New Fn~l~n~ Biolabs,
Beverly, MA) and separated by electrophoresis on a 1% agarose gel. The resulting 2.7
Kb Ad2 EcoR I D fragments, located in the Ad2 coordinate region 75.9 to 83.4,
cont~inin~ the E3/19K gene (Herisse et al., Nucleic Acids Research 8:2173, 1980,Cladaras et al., Virolo~v 140:28, 1985) are eluted by electrophoresis, phenol extracted,
15 ethanol precipitated, and dissolved in Tris-EDTA (pH 8.1).
iv. CLONING OF E3/19K GENE INTO KT-3B
The E3/19K gene is cloned into the EcoR I site of PUC 1813. PUC 1813
20 is p~e~ed as essenti~lly described by Kay et al., Nucleic Acids Research 15:2778,
1987 and Gray et al., pNAS 80:5842, 1983). The E3/19K is retrieved by EcoR I
digestion and the isolated fragIr 'lt is cloned into the EcoR I site of phosphatase-treated
pSP73 plasmid, (Promega, Madison, Wl). This construct is ~lesign~tecl SP-E3/19K. The
orientation of the SP-E3/19K cDNA is verified by using ~pl~.pliate restriction enzyme
25 digestion and DNA sequencing. In the sense orientation, the 5' end of the cDNA is
adjacent to the Xho I site of the pSP73 polylinker and the 3' end adjacent to the Cla I
site. The Xho I-Cla I fra8ment cu.~ ing the E3/19K cDNA in either sense or
antisense orientation is retrieved from the SP-E3/19K construct and cloned into the Xho
I-Cla I site of the KT-3B retroviral backbone. This construct is called KT-3B/E3/19K.
B. CLONING OF PCR AMPLIFIED E3/19K GENE INTO KT-3B
i. PCR AMPLIFICATION OF E3/19K GENE
The Ad2 DNA E3/19K gene, including the amino termin~l signal
sequence, followed by the intraluminal domain and carboxy terminal cytoplasmic tail
WO 95/06717 21 ~ 2 ~ 3 ~ PCT/US94109957
19
which allow the E3/19K protein to embed itself in the endoplasmic reticulum (ER), is
located between viral nucleotides 28,812 and 29,288. Isolation of the Ad2 E3/19K gene
from the viral genomic DNA is accomplished by PCR amplification, with the primerpair shown below:
s
The îol~d primer corresponds to the Ad2 nucleotide sequences 28,812 to 28,835.
(Sequence ID No.
5'-3': TATATCTCCAGATGAGGTACATGATTTTAGGCTTG
PCT/US94/09957
WO 95/06717
933
The reverse primer corresponds to the Ad2 nucleotide sequences 29,241 to 29,213.(Sequence ID No.
5'-3': TATATATCGATTCAAGGCATTTTC l-l-l TCATCAATAAAAC
S In addition to the Ad2 complementary sequences, both primers contain a
five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the
PCT amplicon products. This sequence in the forward primer is followed by the Xho I
recognition site and by the Cla I recognition site in the reverse primer. Thus, in the 5' to
3' direction, the E3/1 9K gene is flanked by Xho I and Cla I recognition sites.
Amplification of the E3/19K gene from Ad2 DNA is accomplished with the followingPCR cycle protocol:
TemperatureC Time (min) No. Cycles
94 2
94 0.5
0.17 5
72 3.5
9~ 0.5 30
3.5
72 10 10
ii. LIGATION OF PCR AMPLIFIED E3/19K GENE INTO KT-3B
The E3/19K gene from the SK-E3/19K construct, approximately 780 bp
in length, is removed and isolated by 1% agarose/TBE gel electrophoresis as described
in Example 2Bi. The Xho I-Cla I E3/19K fragment is then ligated into the KT-3B
retroviral backbone. This construct is ~esign~tP~ KT-3B/E3/19K . It is amplified by
20 tran~rolmillg DH5a bacterial strain with the KT-3B/E3/19K construct. Specifically, the
bacteria is transformed with 1-100 ng of ligation reaction mixture DNA. The
transformed bacterial cells are plated on LB plates cont~ining ampicillin. The plates are
incubated overnight at 37C, bacterial colonies are selected and DNA prepared from
them. The DNA is digested with Xho I and Cla I. The expected endonuclease
25 restriction cleavage fragment sizes for plasmids co~ g the E3/19K gene are 780
and 1300 bp.
PCT/US94/09957
WO 95/06717
21 j8~33
21
C. CLONING OF SYNTHESIZED E3tl9K GENE INTO KT-3B
i. SYNTHESIS OF E3/19K GENE DNA
Chemical synthesis of synthetic DNA has been previously described
(Caruthers et al., Methods in Fn7ymolo~y 211 :3, 1992). Sequences which encode the
E3/19K gene are synth~ci7~ by the phosphotriester method on an Applied Biosystems
Inc. DNA synthesizer, model 392 (Foster City, CA) using the PCR primers as the 5' and
10 3' limits and keeping the same Xho I and Cla I on the ends. Short oligonucleotides of
a~ o2~ ately 14~0 nucleotides in length are purified by polyacrylamide gel
electrophoresis and ligated together to form the single-stranded DNA molecule (Ferretti
et al., PNAS 83 :599, 1986).
15 ii. SEQUENCING OF E3/19K GENE DNA
Fragments are cloned into the bacteriophage vectors M13mpl8 and
M13mpl9 (GIBCP, Gaithersburg, MD) for amplification of the DNA. The nucleotide
sequence of each fragment is determined by the dideoxy method using the single-
20 stranded M13mpl8 and M13mpl9 recombinant phage DNA as templates and selectedsynthetic oligonucleotides as primers. This confirms the identity and said structural
integrity of the gene.
iii LIGATION OF SYNTHESIZED E3/19K GENE INTO KT-3B
The E3/19K gene is ligated into the KT-3B or KT-3C vector as
previously described in Example 2B ii.
PCT/US94/09957
WO 95/06717
2~5893~ 22
Fx~mr~le 3
CLONING OF AN ANTISENSE SEQUENCE OF A CONSERVED REGION OF
MHC INTO KT-3C
A. CONSTRUCTION OF KT3CneoaMHC
The cDNA clone of the MHC class I allele CW3 (Zemmour et al., Tissue
~ntiyens 39:249, 1992) is used as a template in a PCR reaction for the amplification of
10 specific sequences conserved across dirr~ human MHC haplotypes to be inserted of
the KT-3B backbone vector, into the untr~n.~l~tPd region of the neomycin resistance
gene.
The MHC class I allele CW3 cDNA is amplified between nucleotide
sequence 147 to 1,075 using the following primer pairs:
The fol ~d primer corresponds to MHC CW3 cDNA nucleotide sequence 147 to 166:
(Sequence ID No.
5'-3': TATATGTCGACGGGCTACGTGGACGACACGC
20 The reverse primer corresponds to MHC CW3 cDNA nucleotide sequence 1,075 to
1,056:
(Sequence ID No. ~
5'-3': TATATGTCGACCATCAGAGCCCTGGGCACTG
In addition to the MHC class I allele CW3 complementary sequences,
both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient
enzyme digestion of the PCR amplicon products. The buffer sequence is followed by
the Hinc II recognition sequence in both primers. Generation of the MHC ampliconwith the primers shown above is accomplished using the PCR protocol described in30 section 2BiThis protocol is modified by using Vent polymerase (New Fngl~n~l
Biolabs, Beverly, MA) and further modified to include 1 minute extension times instead
of 3.5 minutes. The Vent polymerase generates amplicons with blunt ends.
Alternatively, the forward and reverse primers may contain only the MHC CW3
complementary sequences.
The MHC CW3 cDNA 950 bp amplicon product digested is purified
with Gene Clean (BiolO1, San Diego, CA) and digested with Hinc II. The fr~gment,
PCT/US94109957
WO 95/06717
21~3~
23
938 bp, is isolated by 1% agarose/TBE gel electrophoresis and purified with GeneClean.
The MHC CW3 cDNA 938 bp fragment is inserted in the 3' untr~ncl~tecl
region of the neomycin resistance gene in the antisense orientation. Specifically, the
Hinc II recognition sequence at nucleotide sequence number 676 of the pBluescript II
SK+ (pSK+) (Stratagene, San Diego, CA) plasmid is removed by digestion with Hinc II
and Kpn I. The Kpn I 3' end is blunted with T4 DNA polymerase and the blunt endsare ligated. This plasmid is ~lesign~te~l as pSKdlHII. As described in Example lA, the
1.3 Kb Cla I- Cla I dominant selectable marker gene fragment from pAFVXM retroviral
vector is cloned into the Cla I site of pSKdlHII. This plasmid is ~lesign~te~l as
pSKdlHII/SVneo. The MHC CW3 cDNA 938 bp fragment is inserted in an antisense
orientation into the Hinc II site of pSKdlHII/SVneo located in the 3' untr~ncl~ted region
of the neomycin resistance gene. Confinn~tion that the MHC CW1 cDNA 938 bp
fragment is present in the neomycin gene in an antisense orientation is detennine~l by
restriction endonuclease digestion and sequence analysis. This clone is designated as
pSKdlHII/SVneo/aMHC .
Construction of KT3B/SVneo/aMHC is accomplished by a three way
ligation, in which the Cla I 2.2 Kb SVneoaMHC fragment, and the 1.0 Kb MoMLV 3'
LTR Cla I-Hind III fragment from N2R3-, are inserted between the Cla I and Hind III
sites of pUC3 1/N2RSgM plasmid as described in Example 1.
B. CONSTRUCTION OF KT3C/SVneo/VARNA/aMHC
High level MHC CW3 ~nticenc~ RNA expression is accomplished by
insertion of this sequence downstream of the Ad2 VARNA1 promoter. The Ad2
VARNA promoter-MHC ~ntic~once cDNA is assembled as a RNA polymerase III (pol
III) expression cassette then inserted into the KT-3B or C backbone. In this pol III
expression cassette, the Ad2 VARNAl promoter is followed by the antisense aMHC
cDNA, which in turn is followed by the pol III consensus tennin~tion signal.
The double stranded -30/+70 Ad2 VARNA1 promoter is chemically
synthesized (Railey et al., ~ol. Cell. Biol. 8:1147, 1988) and includes Xho I and Bgl II
sites at the 5' and 3' ends, respectively.
PCT~S94/099~7
WO95/06717
~933
24
The VARNAl promoter, forward strand:
(Sequence ID No.
5'-3': TCGAGTCTAGACCGTGCAAAAGGAGAGCCTGTAAGCGGGCACTCTTCC
GTGGTCTGGTGGATAAATTCGCAAGGGTATCATGGCGGACGACCGGGGT
TCGAACCCCGGA
The VARNAl promoter, reverse strand:
(Sequence ID No.
5'-3': GATCTCCGGGGTTCGAACCCCGGTCGTCCGCCATGATACCCTTGCGAA
TTTATCCACCAGACCACGGAAGAGTGCCCGCTTACAGGCTCTCCl-l-l-l
GCACGGTCTAGAC
In order to form .. double stranded VARNAl promoter with Xho I and
Bgl II cohesive ends, equal amounts of the single strands are mixed together in 10 mM
15 MgCl2, heated at 95C for S min then cooled slowly to room te~ e.~ e to allow the
strands to anneal.
The MHC class I allele CW3 fragment, nucleotide sequence 653 to 854,
from the plasmid pSKdlHII/SVneo/aMHC is amplified using the following primer
palr:
The forward primer corresponds to nucleotide sequence 653 to 680:
5'-3': TATATCCTAGGTCTCTGACCATGAGGCCACCCTGAGGTG
25 The reverse primer colles~onds to nucleotide sequence 854 to 827:
5'-3': TATATAGATCTACATGGCACGTGTATCTCTGCTCTTCTC
In addition to the MHC class I allele CW3 complementary sequences,
both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient
enzyme digestion of the PCR amplicon products. The buffer sequence is followed by
the Avr II recognition sequence in the forward primer and by the Bgl II recognition
sequence in the reverse primer, which allows insertion in an ~nti~çn~e orientation,
relative to the Ad2 VARNAl promoter in the pol III ~s~ion cassette. Generation of
the MHC amplicon with the primers discussed above is accomplished with the PCR
PCT/US94/09957
WO 95/06717 2 1 ~7: 8 9 3 3
protocol described in Example 2Bi modified to include 0.5 minute extension timesinstead of 3.5 minutes
The MHC CW3 cDNA 223 bp amplicon product is purified with Gene
Clean (BiolO1, San Diego, CA), then digested with AvrII and BglII, and isolated by 2%
5 NuSeive-1% a~arose/TBE gel eleckophoresis. The 211 bp band is then excised from
the gel and the DNA purified with Gene Clean.
The double stranded pol III consensus tPnnin~tion sequence is
chemically synthesi7Pd (Geiduschek et al., Annu. Rev. Biochem. 57:873, 1988) andincludes Avr II and Cla I sites at the 5' and 3' ends, respectively.
The pol III termination sequence, forward primer:
(Sequence ID No.
5'-3': CTAGGGCG(~'l"l''l"l''l'GCGCAT
15 The pol III termination sequence, reverse primer:
(Sequence ID No.
5'-3': CGATGCGCAAAAAGCGCC
In order to form the double stranded pol III transcription tPrrnin~tion
20 sequence with Avr II and Cla I cohesive ends, equal amounts of the single strands are
mixed together in lO mM MgCl2, heated at 95C for 5 min then cooled slowly to room
temperature to allow the strands to anneal.
The pol III expression cassette for antisense aMHC class I allele CW3 is
assembled in a four way ligation in which the Xho I-Bgl II Ad2 VARNA1 promoter
25 fragment, the Bgl II-Avr II aMHC CW3 fragment, and the Avr II-Cla I transcription
Snrnin~Sion fragment, are cloned into pSKII+ between the Xho I and Cla I sites. This
construct is clesign~te~l pSK/VARNA/aMHC.
Construction of KT3B/SVneo/VARNA/aMHC is accomplished in a two
step ligation. The first step is a three way ligation in which the Xho I-Cla I
30 VARNA/aMHC fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from
- N2R3-, are inserted between the Xho I and Hind III sites of pUC3 1/N2R5gM plasmid as
described in Example 1. This construct is design~ted KT3B/VARNA/aMHC. In the
second ligation step the 1.3 Kb Cla I-BstB I SVneo fragment into the Cla I site of
KT3B/VARNA/aMHC. This construct is design~ted KT3B/SVneo/VARNA/aMHC.
WO 95/06717 PCT/US94/09957
93~ 26
F.xample 4
CLONING A RIBOZYME THAT WILL CLEAVE A CONSERVED REGION OF
MHC CLASS I HEAVY CHAIN INTO KT-3B
s
A. CONSTRUCTION OF pSK/VARNA~MHCHRBZ
In order to efficiently inhibit e~iession of MHC class I in tr~n~ ce~l
cells, a hairpin ribozyme with target specificity for the MHC class I allele is inserted
10 into the KT3B/SVneo vector. The ribozyme is expressed at high levels from the Ad2
VARNA1 promoter. The MHC hairpin r ~ ~7vme (HRBZ) is inserted into the pol III
pSK/VARNA/aMHC e~l,.es~ion isette ed in E~-~mple 3.
The HRBZ and the MHC j I allt CW3 have the homologous
sequence shown below:
15 (Sequence ID No.
5'-3': GATGAGTCTCTCA -CG
The HRBZ is designed to cleave after the A residue in the AGTC hairpin
substrate motif contained in the target sequence. Following cleavage, the HRBZ is
recycled and able to hybridize to, and cleave, other MHC class I RNA molecule.
Double-stranded HRBZ as defined previously (Hampel et al., Nucleic
Acids Research 18:299, 1990), co~ g a four base "tetraloop" 3 and an extended
helix 4, with specificity for the MHC class I homologous sequence shown above, is
chemically synthesi7P~l and includes Bgl II and Avr II sites at the 5' and 3' ends,
respectively.
The MHC HRBZ, sense strand:
(Sequence ID No.
5'-3': GATCTCGATGAGAAGAACATCACCAGAGAAACACACGGACT
TCGGTCCGTGGTATATTACCTGGTAC
The MHC HRBZ. antisense strand:
(Sequence ID No.
5'-3': CTAGGTACCAGGTAATATACCACGGACCGAAGTCCGTGTGTT
TCTCTGGTGATGTTCTTCTCATCGA
~ '? ?' 6? f~ ~ .G PCTIUS94/09957
WO 95/06717 ~ J ,~
In order to form the double stranded MHC class I specific HRBZ with
Bgl II and Avr II cohesive ends, equal amounts of the single strands are mixed together
in 10 mM MgCI2, heated at 95C for 5 min then cooled slowly to room lelllpeldlLIre to
allow the strands to anneal.
The pol III e~lession cassette for the MHC HRBZ is assembled by
ligation of the chemically synthesized double stranded MHC class I specific HRBZwith Bgl II and Avr II cohesive ends into Bgl II and Avr II digested and CIAP treated
pSK/VARNA/MHC~ in which the aMHC sequence has been removed from the pol III
expression vector. This plasmid is design~ted pSK/VARNA/MHCHRBZ and contains
the Ad2 VARNA1 promoter followed by the MHC HRBZ, which in turn is followed by
the pol III consensus terrnination sequence. The pol III expression components is
flanked by Xho I and Cla I recognition sites.
B. CONSTRUCTION OF KT3B/SVneo/VARNA/MHCHRBZ
Construction of KT3B/SVneo/VARNA/MHCHRBZ is accomplished in a
two step ligation. The first step is a three way ligation in which the Xho I-Cla I
VARNA/MHCHRBZ fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment
from N2R3-, are inserted between the Xho I and Hind III sites of pUC3 1/N2RSgM plasmid
described in Example 1. This construct is design~ted KT3B/VARNA/MHCHRBZ. In the
second step, the 1.3 Kb Cla I-BstB I SVneo fragment is ligated into the Cla I site of
KT3B/VARNA/MHCHRBZ. This construct is cle~ign~ted
KT3B/SVneo/VARNA/~IHCHRBZ.
Fxample 5
CLONING OF PSF1 ANTISENSE cDNA
A. CONSTRUCTION OF KT3C/SVneo/aPSF1
The cDNA clone of PSF1 (Spies et al., Nature 351:323, 1991; Spies et
al., Nature ~:744, 1990) is used as a template in a PCR reaction for the amplification
of specific sequences to be inserted into the KT-3B backbone vector, into the
35 untr~n~l~ttocl region of the neomycin resistant gene. The PSF1 cDNA is amplified
between nucleotide sequence 91 to 1,124 using the following primer pairs:
PCT/US94/09957
WO 95/06717
~5~93~
28
The forward primer corresponds to nucleotide sequence 91 to 111:
(Sequence ID No.
5'-3': TATATGTCGACGAGCCATGCGGCTCCCTGAC
The reverse primer corresponds to nucleotide sequence 1,124 to 1,105:
(Sequence ID No.
5'-3': TATATGTCGACCGAACGGTCTGCAGCCCTCC
In addition to the PSFl complelnent~ry sequences, both primers contain
a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the
PCR amplicon products. The buffer sequence is followed by the Hinc II recognition
sequence in both primers. Generation of the PSFl amplicon with the primers discussed
above is accomplished with the PCR protocol described in Example 2Bi. This protocol
15 is modified by using Vent polymerase (New F.n~l~n-l Biolabs, Beverly, MA) andfurther modified to include 1 minute extension times instead of 3.5 minutes The Vent
polymerase generates amplicons with blunt ends.
B. CONSTRUCTION OF KT3B/SVneo/VARNA/aPSF1
High level PSF1 ~nticence expression is accomplished by insertion of
this sequence downstream of the Ad ~:'ARNAl promoter. The Ad2 VARNA
promoter-PSFl antisense cDNA is first assembled as a pol III expression cacsette then
inserted into the KT-3B backbone. In this pol III e~ ession c~Csette~ the Ad2
25 VARNAl promoter is followed by the antisense PSFl cDNA, which in turn is followed
by the pol T~' consensus termination signal.
The nucleotide sequence 91 to 309 ofthe PSF1 cDNA are amplified in a
PCR reaction using the following primer pair:
30 The forward primer corresponds to nucleotide sequence 91 to 111:
(Sequence ID No.
5'-3': TATATCCTAGGGAGCCATGCGGCTCCCTGAC
The reverse primer corresponds to nucleotide sequence 309 to 288:
35 (Sequence ID No. ~
5'-3': TATATAGATCTCAGACAGAGCGGGAGCAGCAG
WO 95tO6717 21~ ~ g 3 3 PCT/US94/09957
29
In addition to the PSFl complement~ry sequences, both primers contain
a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the
PCR amplicon products. The buffer sequence is followed by the Avr II recognition5 sequence in the forward primer and by the Bgl II recognition sequence in the reverse
primer, which allows insertion in an ~nti~n~e orientation, relative to the Ad2 VARNAI
promoter in the RNA polymerase III ~ cssion cassette. Generation of the PSF1
amplicon with the primers described above is accomplished with the PCR protocol
described in Example 2Bi modified to include 0.5 minutes extension times instead of
10 3.5 mimlt~c
The MHC CW3 cDNA 240 bp amplicon product is purified with Gene
Clean (BiolO1, San Diego, CA), then digested with Avr II and Bgl II, and isolated by
2% NuSeive-1% agarose/TBE gel electrophoresis. The 211 bp band is then excised
from the gel and purified with Gene Clean.
Construction of KT3B/SVneo/VARNA/aPSF1 is accomplished in two
step ligation. The first step is a three-way ligation in which the Xho I-Cla I
VARNA/aPSF1 fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment
from N2R3-, are inserted between the Xho I and Hind III sites of pUC31/N2R5gM
plasmid as described in Example 1. This construct is ~le~ign~ted as
20 KT3B/VARNA/aPSF1. In the second ligation step, the 1.3 kb Cla I-BstB I SVneo
fragment is ligated into the Cla I site of KT3B/VARNA/aPSF1. This construct is
designated KT3B/SVneo/VARNA/aPSFl.
Fxample 6
CLONING A RIBOZYME THAT WILL CLEAVE A CONSERVED REGION
OF PSF1 INTO KT-3B
A. CONSTRUCTION OF pSK/VARNA/PSFlHRBZ
In order to efficiently inhibit expression of PSF1 in transduced cells, a
hairpin ribozyme with target specificity for the PSF 1 RNA is inserted into the
KT3B/SVneo vector. The ribozyme is expressed at high levels from the Ad2 VARNA1
promoter. The PSF 1 hairpin ribozyme (HRBZ) is inserted into the pol III
35 pSK/VARNA/aMHC expression cassette described in Example 3. The PSFl HRBZ-
pol III ~ cssion cassette is then inserted into the KT3B/SVneo backbone vector.
WO 95/06717 PCT/US94/09957
3~
The HRBZ and the PSF1 RNA have the homologous sequence shown
below:
(Sequence ID No.
5'-3': GCTCTGTCTGGCCAC
The HRBZ is designed to cleave after the T residue in the TGTC hairpin
substrate motif contained in the target sequence. Following cleavage, the HRBZ is
recycled and able to hybridize to, and cleave, other PSF1 RNA molecule.
Doub~-stranded HRBZ as defined previously (Hampel et al., Nucleic
10 Acids Research 18:~79, 1990), cont~ining a four base "tetraloop" 3 and an extended
helix 4, with specificity for the PSF1 homologous sequence shown above, is chemically
synth~si7e~ and includes Bgl II and Avr II sites at the 5' and 3' ends, respectively.
The PSFl HRBZ, sense strand:
15 (Sequence ID No.
5'-3': GATCTGTGGCCAGACAGAGCACCAGAGAAACACACGGACTTCGG
TCCGTGGTATATTACCTGGTAC
The PSF1 HRBZ, antisense strand:
20 (Sequence IDNo.
5'-3': CTAGGTACCAGGTAATATACCACGGACCGAAGTCCGTGTGTT
TCTCTGGTGCTCTGTCTGGCCACA
In order to form the double stranded PSF1 specific HRBZ with Bgl II
25 and Avr II cohesive ends, equal amounts of the single strands are mixed together in 10
mM MgC12 heated at 95C for S min then cooled slowly to room te~ e~ e to allow
the strands to anneal.
The pol III expression cassette for the PSF1 HRBZ is assembled by
ligation of the chemically synthesized double stranded PSF 1 specific HRBZ with Bgl II
30 and Avr II cohesive ends into Bgl II and Avr II digested and CIAP treated
pSK/VARNA/aMHC, in which the aMHC sequence has been gel purified away from
the pol III expression vector. This plasmid is design~ted pSK/VARNA/PSFlHRBZ
and contains the Ad2 VARNAl promoter followed by the PSFl HRBZ, which in turn
is followed by the pol III consensus terrnination sequence. The pol III e~,ession
35 component is fla~ked by Xho I and Cla I recognition sites.
wo 95/06717 21 ~ ~i 9 ~ ~ PCT/US94/09957
B. CONSTRUCTION OF KT3BlSVneo/VARNAlPSFlHRBZ
Construction of KT3B/SVneolVARNA/MHCHRBZ is accomplished in a
two step ligation. The first step is a three way ligation in which the Xho I-Cla I
5 VARNAlPSFlHRBZ fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment
from N2R3-, are inserted between the Xho I and Hind III sites of pUC3 1/N2RSgM plasmid
as described in Example 1. This construct is ~le~ign~te(l KT3B/VARNA/PSFlHRBZ. In
the second ligation step, the 1.3 Kb Cla I-BstB I SVneo fragment is ligated into the Cla I
site of KT3BlVARNAlPSFlHRBZ. This construct is designated
10 KT3BlSVneolVARNAlPSF 1 HRBZ.
Example 7
CONSTRUCTION OF THE MULTIVALENT RECOMBINANT RETROVIRAL
VECTOR KT3B-E311 9K
A variation of the retroviral vector KT3B-E311 9K can also be
constructed con1~inin~ both the E3/1 9K sequences and anti-sense sequences specific for
a conserved region between the three class I MHC alleles A2, CW3 and B27, Examples
2 and 3. This vector, known as KT3B-E3/19K/aMHC, is designed to incorporate the
MHC class I anti-sense sequences at the 3' end of the E3/19K sequence which would be
expressed as a chimeric molecule. The retroviral vector, KT3B-E3/1 9KlaMHC, can be
constructed by lig~ting a Cla I digested PCR amplified product CO1~t~;"i-~g the MHC
anti-sense sequences into the Cla I site of the KT3B-E3119K vector. More specifically,
the cDNA clone of the MHC class I allele CW3 (Zemrnour et al., Ti.~ nt~e~c
39:249, 1992) is amplified by PCR between nucleotides 653 and 854 using the
following primer pair:
The forward primer of aMHC is:
(Sequence ID No.
5'-3': ATTATCGATTCTCTGACCATGAGGCCACCCTGAGGTG
The reverse primer of aMHC is:
(Sequence ID No.
5'-3': ATTAATCGATACATGGCACGTGTATCTCTGCTCTTCTC
PCT/US94/09957
WO 95/06717
~,~5~9~
32
The primer pairs are flanked b~- Cla I restriction enzyme sites in order to
insert an amplified Cla I digested product into the partially pre-digested KT3B-E3/19K
vector in the anti-sense orientation. By placing the Cla I fragment in the reverse
orientation the vector will express the negative anti-sense strand upon transcription.
Fxarnple 8
TRANSDUCTION OF PACKAGING CELL LINE DA WITH THE
RECOMBINANT RETROVIRAL VECTOR KT3B-E3/19K
A. PLASMID DNA TRANSFECTION
293 2-3 cells (a cel! ne derived from 293 cells A~''C No. CRL 157-
WO 92/05'66) 5 x 105 cells are seeded at approxirnately 50% ec. fluence on a 6 ~15 tissue culture dish. The following day, the media is replaced w. n 4 ml fresh media 4
hours prior to transfection. A standard calcium phosphate-DNA coprecipitation isperformed by mixing 10.0 llg ~f KT3B-E3/19K plasmid and 10.0 ~lg MLP G plasmid
with a 2M CG-I2 solution, adding a lx Hepes buffered saline solution, pH 6.9, and
incubating for 15 minufPs at room t~ dlule. The calcium phosphate-DNA
20 coprecipitate is transferred to the 293 2-3 cells, which are then incubated overnight at
37C, 5% CO2. The following morning, the cells are rinsed three times in lx PBS, pH
7Ø Fresh media is added to the cells, fc'!owed by overnight incubation at 37C, 10%
CO2. The following day, the media is coliected ` the cells and passed through a 0.45
~ filter. This supem~t~nt is used to tr~nc.l~lee p~ ing and tumor cell lines. Tran,ient
25 vector supern~t~nt for other vectors are generated in a similar fashion.
B. PACKAGING CELL LINE TRANSDUCTION
DA cells (an amphotropic cell line derived from D-17 cells ATCC No.
30 183, WO 92/05266) are seeded at 5 x 105 cells/10 cm dish. Approximately 0.5 ml of
the freshly collected 293 2-3 supern~t~nt (or supernatant that has been stored at -70 C)
is added to the DA cells. The following day, G418 is added to these cells and a drug
resistant pool is generated over a period of a week. This pool of cells is dilution cloned
by adding 0.8 -1.0 cell per well of 96 well plates. Twenty-four clones are expanded to
35 24 well plates, then to 6 well plates, at which time cell supern~t~nt~ are collected fGr
titering. DA clones are selected for vector production and e~lled DA-E3/19K. Vector
PCT/US94/09957
WO 95/06717 2 1 5 8 ~ ~ 3
sup~rn~t~nts are collected from 10cm confluent plates of DA-E3/1 9K clones cultured in
normal media CO~ polybrene or pluLall~ine sulfate. Alternatively, vector
sUpern~t~nt can be harvested from bioreactors or roller bottles, processed and purified
further before use.
For those vectors without a drug resistance marker or with a marker
already in the p~ck~ging cell line, selection of stably tr~n~uced clones must beperformed by dilution cloning the DA tr~n.e(lucecl cells one to two days after
transducing the cells with 293 2-3 generated supe~t~nt The dilution clones are then
screened for the presence of E3/19K e,~ies~ion by using reverse transcription of10 messenger RNA, followed by amplification of the cDNA message by the polymerase
chain reaction~ a procedure known as the RT-PCR A commercial kit for RT-PCR is
available through Invitrogen Corp. (San Diego, CA). RT-PCR should be performed on
clones which have been prop~g~tecl for at least 10 days and approximately 50 to 100
clones will need to be screened in order to find a reasonable number of stably
15 transformed clones. In order to perform RT-PCR, specific primers will be required for
each message to be amplified. Primers designed to amplify a 401 bp product for
E3/19K message screening are as follows:
Screening primers for E3/19K are:
20 (Sequence ID No.
5'-3': ATGAGGTACATGATTTTAGGCTTG
(Sequence ID No.
5'-3': TCAAGGCATTTTCTTTTCATCAATAAAAC
E~xam.ple 9
DETECTION OF REPLICATION COMPETENT RETROVIRUSES
The extended S+L- assay deterrnines whether replication competent,
infectious virus is present in the supen ~t~nt of the cell line of interest. The assay is
based on the empirical observation that infectious retroviruses generate foci on the
indicator cell line MiCII (ATCC CCL 64.1). The MiCII cell line is derived from the
MvlLu mink cell line (ATCC CCL 64) by transduction with Murine Sarcoma Virus
35 (MSV). It is a non-producer, non-transformed, revertant clone contz~ining a murine
sarcoma provirus that forms sarcoma (S+) indicating the presence of the MSV genome
PCT/US94/099~7
WO 9~/06717
ag ~!
34
but does not cause leukemia (L-) indicating the absence of replication competent virus.
Infection of MiCll cells with replication co.l.pele..t retrovirus "activates" the MSV
genome to trigger "transfolmation" which results in foci formation.
S~e.~ t is removed from the cell line to be tested ~resence of
5 replication col..pe~e..~ retrovirus and passed through a 0.45 ~ filter to re . ~ ~ e any cells.
On day 1, MvlLu cells are seeded at 1 x 105 cells per well (one well per sample to be
tested) of a 6 well plate in 2 ml DMEM, 10% FBS and 8 llg/ml polybrene. MvlLu
cells are plated in the same manner for positive and negative controls on separate 6 well
plates. The cells are incubated overnight at 37C, 10% CO2. On day 2, 1.0 ml of test
10 supern~t~nt is added to the MvlLu cells. The negative control plates are incubated with
1.0 ml of media. The positive control consists of three dilutions (200 focus forming
units (ffu), 20 ffu and 2 ffu each in 1.0 ml media) of MA virus (Miller et al., ~olec. and
Cell Piol. 5:431, 1985) which is added to the cells in the positive control wells. The
cells are incubated overnight. On day 3, the media is aspirated and 3.0 ml of fresh
15 DMEM and 10% FBS is added to the cells. The c~.ls are allowed to grow to
confluency and are split 1:10 on day 6 and day 10, amplify` ag any replication
competent retrovirus. On day 13, the media on the MvlLu cells is aspirated and 2.0 ml
DMEM and 10% FBS is added to the cells. In addition, t~ MiCII cells are seeded at 1
x 105 cells per well in 2.0 ml DMEM, 10/~ FBS and 8 ~ ml polybrene. On day 14,
20 the supernatant from the MvlLu cells i- - asferred to the corresponding well of the
MiCII cells and incubated overnight at 37~C, 10% CO2. On day 15, the media is
aspirated and 3.0 ml of fresh DMEM and 10% FBS is added to the cells. On day 21,the cells are examined for focus formation (appearing as clustered, refractile cells that
overgrow the monolayer and remain attached) on the monolayer of cells. The test
25 article is determined to be cont~min~ted with replication competent retrovirus if foci
appear on the MiCII cells.
Fx~mple 10
30 TRANSDUCTION OF CELL LINES WITH E3/19K RETROVIRAL VECTOR
The following adherent human and mur i ~ cell lines are seeded at
5 x 105 cells/10 cm dish with 4 llg/ml polybrene: HT 1~80 (ATCC No. CCL 121),
Hela (ATCC No. CCL 2), and BClOME (Patek et al., Cell. Immuno. ~2: 113, 1982,
35 ATCC No. TIB 85). The following day, 1.0 ml of filtered supernatant from the DA
E3/19K pool is added to each of the cell culture plates. The following day, 800 ug/ml
WO 95/06717 21 5 8 9 3 3 PCT/US94/09957
G418 is added to the media of all cell cultures. The cultures are m~int~in~1 until
selection is complete and sufficient cell numbers are generated to test for genee~ ion. The tr~n~d~1ce~l cell lines are design~ted HT 1080-E3/19K, Hela-E3/19K
and BClOME-E3/19K, respectively.
EBV transformed cell lines (BLCL), and other suspension cell lines, are
tr~n~cluced by co-cultivation with irradiated producer cell line, DA-E3/19K.
Specifically, irradiated (10,000 rads) producer line cells are plated at 5 x 105 cells/6 cm
dish in growth media containing 4 ~g/ml polybrene. After the cells have been allowed
to attach for 2-24 hours, 106 ~u~ellsion cells are added. After 2-3 days, the suspension
cells are removed, pelleted by centrifugation, lcsu~l,ended in growth media Co~
lmg/ml G418, and seeded in 10 wells of a round bottom 96 well plate. The cultures
were expanded to 24 well plates, then to T-25 flasks.
Fxample 11
EXPRESSION OF E3/19K IN THE RECOMBINANT RETROVIRAL VECTOR
CONSTRUCT KT3B-E3/19K
A. WESTERN BLOT ANALYSIS FOR E3/19K
Radio-immuno precipitation assay (RIPA) Iysates are made from
selected cultures for analysis of E3/19K expression. RIPA lysates are ple~aled from
confluent plates of cells. Specifically, the media is first aspirated off the cells.
Depending upon the size of the culture plate cont~inin~ the cells, a volume of 100 to
500 ~1 ice cold RIPA lysis buffer (10 mM Tris, pH 7.4; 1%Nonidet P40 (Calbiochem,
San Diego, CA), 0.1% SDS; 150 mM NaCl) is added to the cells. Cells are removed
from plates using a micropipet and the mixture is transferred to a microfuge tube. The
tube is centrifuged for S minl~te~ to precipitate cellular debris and the supernatant is
transferred to another tube. The supen ~t~rlt.~ are electrophoresed on a 10% SDS-PAGE
gel and the protein bands are transferred to an Immobilon membrane in CAPS buffer
(Aldrich, Milwaukee, WI) (10 mM CAPS, pH 11.0; 10% methanol) at 10 to 60 volts for
2 to 18 hours. The membrane is transferred from the CAPS buffer to 5% Blotto (5%nonfat dry milk; 50 mM Tris, pH 7.4; 150 mM NaCI; 0.02% sodium azide, and 0.05%
Tween 20) and probed with a mouse monoclonal antibody to E3/19K (Severinsson et
al., J. Cell. Riol. 101 :540-547, 1985). Antibody binding to the membrane is detected by
the use of 125I-Protein A.
PCT/US94/09957
WO 95/06717
~ a~33
36
F.x~ le 12
FACS ANALYSIS OF E3/19K-VECTOR TRANSDUCED CELLS TO DEMONSTRATE DECREASED LEVELS OF CLASS I EXPRESSION COMPARED
TO NON-TRANSDUCED CELLS.
Cell lines tr~ncduced with the E3/19K-vector are examined for MHC
class I molecule expression by FACS analysis. Non-tr~n~d~ced cells are also analyzed
10 for MHC class I molecule t;~lession and collll aled with E3/19K tr~ncdnced cells to
determine the effect of transduction on MHC class I molecule ~ ssion.
Murine cell lines, BClOME, BClOME-E3/19K, P815 (ATCC No. TIB
64), and P815-E3/19K, are tested for expression of the H-2Dd molecule on the cell
surface. Cells grown to subconfluent density are removed from culture dishes by
15 tre~trnent with Versene and washed two times with cold (4C) PBS plus 1% BSA and
0.02% Na-azide (wash buffer) by centrifugation at 200g. Two million cells are placed
in microfuge tubes and pelleted in a microfuge at 200g before removing the
supernatant. Cell pellets are resuspended with the H-2Dd-specific Mab 34-2-12s (50~11
of a 1: 100 dilution of purified antibodv, ATCC No. HB 87) and incubated for 30 min at
20 4C with occasional mixing. Antibody labeled cells are washed two times with 1 ml of
wash buffer (4C) prior to removing the supern~t~nt Cells are resuspended with abiotinylated goat anti-mouse kappa light chain Mab (50~11, of a 1:100 dilution of
purified antibody) (Arnersham, Arlington Height, IL) and incubated for 30 min at 4C.
Cells are washed, resuspended with 50~11 of avidin conju~ated FITC (Pierce, Rockford,
25 IL), and incubated for 30 rnin at 4C. The cells are washed once more, resuspended in 1
ml of wash buffer, and held on ice prior to analysis on a FACStar Analyzer (Becton
Dickinson, Los Angeles, CA). The mean fluorescen~e intensity of tr~n~ ce~l cells is
compared with that of non-tr~nc~uced cells to determine the effect E3/19K protein has
on surface MHC class I molecule ~plession.
Fx~nlI?le 13
MURINE ALLOGENEIC CTL ASSAYS
H-2d turnor cells (P815 or BCilOME) irradiated with 10,000 rads are
cultured with splenocytes isolated from six to eight week old female C57BL/6 (H-2b)
PCTtUS94/09957
WO 95/06717 2 1 ~ ~ ~ 3 ~
mice (Harlan Sprague-Dawley, Tntli~n~polis, IN) inducing allogeneic CTL.
Specifically, 3 x 106 splenocytes/ml are cultured in vitro with 1.5-6.0 x 104 irradiated
tumor cells/ml for 4-5 days at 37C in T-25 flasks. Culture medium consists of RPMI
1640; 5% FBS, heat-inactivated; 1 mM pyruvate; 50 ~g/ml gentamicin and 10-5 M 2-
5 mercaptoethanol. Effector cells are harvested 5 days later and tested using variouseffecto~ g~ cell ratios in 96 well microtiter plates in a standard 4-6 hour assay. The
assay employs Na2slCrO4-labeled, 100~Ci, 1 hr at 37C, (Amersham, Arlington
Heights, IL) target cells at 4-10 x 103 cells/well with the final total volume per well of
200 ~11. Following 4-6 hour incubation at 37C, 100 ~11 of culture medium is removed
10 and analyzed in a WALLAC gamma ~lue~;Llullleter (Gaithersburg, MD). Spontaneous
release (SR) is determin~cl as CPM from targets plus medium and maximum release
(MR) is determined as counts per minute (CPM) from targets plus lM HCl. Percent
target cell lysis is calculated as: [[(effector cell + target CPM) - (SR)]/[(MR) - (SR)]] x
100. Spontaneous release values of targets are typically 10%-20% of the MR. Tumor
15 cells that have been tr~n~dl~ced with the gene of interest (ribozyme, E3/19K, ~nti~en~e,
etc.) are used as ~tim~ tor and/or target cells in this assay to demonstrate the reduction
of allogeneic CTL induction and detection.
F~rr~le 14
FACS ANALYSIS OF E3/1 9K-VECTOR TRANSDUCED HUMAN CELLS TO
DEMONSTRATE DECREASED LEVELS OF MHC CLASS I EXPRESSION
COMPARED TO NON-TRANSDUCED CELLS
Cell lines tr~n.~dllced with the E3tl9K vector are eY~mine~l for class I
molecule expression by FACS analysis. Non-tr~ncduced cells are also be analyzed for
class I molecule expression to compare with E3/19K tr~nc~ ce~l cells and to determine
the effect that transduction has on class I molecule exples~ion.
Two human cell lines JY-E3/19K and JY (ATCC No. ) are used to
test for expression of the HLA-A2 molecule on the cell surface. Suspension cellsgrown to 106 cells/ml are removed from culture flasks by pipet and washed two times
with cold (4C) PBS plus 1% BSA and 0.02% Na-azide (wash buffer) by centrifugation
at 200g. Two million (2 x 106) cells are placed in microfuge tubes, pelleted in at 200g,
and the supernatant is removed. Cell pellets are resuspended with the HLA-A2-specific
Mab BB7.2 (50~1 of a 1:100 dilution of purified antibody, ATCC No. HB 82) and
incubated with antibody for 30 min at 4C with occasional mixing. Antibody labeled
PCT/IJS94/09957
WO 95/06717
~,~,5~93~ 38
cells are washed two times with 1 ml of wash buffer (4C). Prior to removing thesupern~t~nt, the cells are resuspended with a biotinylated rat anti-mouse kappa light
chain Mab (50~1, of a 1:100 dilution of purified antibody) and incubated for 30 min at
4C. Cells are washed, l~u~l~e~ded with 50111 of avidin conjugated FITC (Pierce,5 Rockford, IL), and incllb~t~cl for 30 n~in at 4C. The cells are washed once more, and
resuspended in 1 ml of wash buffer, and held on ice prior to analysis on a FACStar
Analyzer. The mean fluorescence illlell~ily of tr~nc~ ce~l cells is compared with that of
non-tr~n~cluced cells to determine the effect E3/19K protein has on surface MHC class I
molecule ex~res~ion.
Fxan~le 15
MEASUREMENT OF THE IM~IUNE RESPONSE TO E3/1 9K-TRANSDUCED
AND NONTRANSDUCED EBV-TRANSFORMED HUMAN JY CELLS BY
ALLOGENEIC HUMAN CTL LINES
Human CTL lines can be prop~g~tecl from donor blood samples using
allog~-eic EBV-transformed cell lines as stimulators. These CTL lines are propagated
with JY cells which possess the A2 molecule and can lyse JY target cells. A chromium
20 release assay can be performed wi~h these ~TL lines and JY target cells that have been
transformed with the E3/19K gene or non-~ransformed JY target cells. The E3/19K
tr~nsformed JY target cells are used to demonstrate decreased recognition and lysis of
this cell when compared to nontransforrned JY target cells. These results indicate that
cell transformation with agents that decrease MHC class I surface expression also
25 decreases MHC class I restricted cell mt~ tecl immune responses in an in vitro human
cell model system.
An allogeneic CTL reaction is inrl~lce~l by culturing 1 o6 irradiated
(10,000 rad) JY cells with 107 PB~fC from a non-HLA-A2 person in 10 mls of culture
medium at 37C 5% CO2 for 7-10 days. The culture medium con.~i~tc of RPMI 1640
30 supplemented with 5% heat inactivated fetal bovine serurn preselected for CTL growth,
1 mM sodium pyruvate and non~ssPntial amino acids. After the 7-10 day incubation the
effector cells are harvested and tested in a standard 4-6 hour chromium release assay
using 5 I Cr labeled JY cells as the positive control and S I Cr labeled JY-E3/1 9K. JY and
JY-E3/19K cells are labeled with 300 IlCi of Na25lCrO4 for 1 hour at 37C, then
35 washed, counted, and used in the assay at 4 x 103 cells/well with the final total volume
per well of 200 ~1. Following incubation, 100 ~11 of culture medium is removed and
PCT/US94/09957
WO 95/06717
2~ 33
39
analyzed in a WALLAC gamma spectrometer (Gaithersburg, MD). Spontaneous
release (SR) is detennin~d as counts per minute (CPM) from targets plus medium and
maximum release (MR) is detenninetl as CPM from targets plus lM HCl. Percent
target cell lysis is calculated as: [[(effector cell + target CPM) - (SR)]/~(MR) - (SR)]] x
5 100. Spontaneous release values of targets are typically 10%-30% of the MR. Tumor
cells that have been tr~ncd~lced with the gene of interest (ribozyme, E3/19K, ~nti.c~nce,
etc.) are used ac stiml]l~tor and/or target cells in this assay to demonstrate the reduction
of allogeneic CTL induction and detection as compared to the non-tr~ncdnce-l line
which is the positive control.
Fxam~le 16
ALLOGENEIC MARROW GRAFTS
15 i. REMOVE 4L OF BONE MARROW FROM C3H (H-2k) AND BALB/C (H-
2d)
Mouse femurs are dissected and exposed. The bone marrow plugs are
removed using a number 23 gauge needle and syringe. The marrow is collected and
20 resuspended marrow in Hank's balanced salt solution (Mauch et al., PNAS 77:2927,
1980)
ii. TRANSDUCTION OF MARROW CELLS WITH El9 RETROVIRAL
VECTOR
Marrow cells are prepared by centrifugation and resuspension in 1.0 ml
DMEM and 10% FBS cont~inin~ E3/19K vector. The marrow cells and F3/19K
retroviral vector is incubated for 4 hours at 33C then 9 mls of Fischer's medium
supplemental with 25% donor horse serurn and 0.1 mM hydrocortisone sodium
30 succinate. After 24 hours the marrow cells were washed and resuspended in HBSS at 2
x 106 cells/ ml for injection.
iii. INJECTION OF MARROW CELLS INTO MICE
The C57BL/6 (B6, H-2b) mice are irradiated with 700 rads of gamma
irradiation just prior to injection. Two groups of B6 mice are injected intravenously
PCT/US94/09957
WO95/06717 ~33
with 0.5 ml of C3H marrow cells. After 5 days the mice are again irradiated with 700
rads and injected intravenously with 0.5 ml of either vector-tr~n~d~lcecl C3H marrow
cells or untreated C3H marrow cells. Lethally irradiated naive B6, mice are injected
intravenously with 0.5ml (1 x 106) of C3H bone marrow cells for the positive control
5 and 0.5ml (1 x 106) of Balb/c bone marrow cells for the negative control.
iv. EVALUATION OF GRAFT REJECTIONS
The bone marrow graft rejections are evaluated 5 days following
10 injection by either ofthe two methods:
a. After sacrificing the mice, the spleens are removed and placed into 10%
formalin. Spleen colonies are counted and recorded.
b. Mice are injected with FUdR (Sigma, St. Louis, MO) and 30 minutçs
later with 125I-IUdR (Amersham, Arlington Height, IL). After 18 hours
of incubation, the spleens are removed and l25I-IUdR incorporation
determined in the spleens of with replicating bone marrow cells.
c. The value o incorporated radioactivity determined in the syngeneic
growth control is ~I,iLIdl;ly set at 100 U, and all values in the
experimental groups are norm~li7e(1 relative to this control. Animals
with ~10 U show no visible spleen colonies, whereas ~nim~l~ with 50 to
100 U have greater than 200 spleen colonies. Animals that show less
than 10 U are considered to express strong rejection, those with 10 to 30
U are considered to express weak rejection, and those with greater than
30 U show no significant rejection.
RECIPIENT 1 2 RESULT (MARROWGROWTH)
B6 (H-2b) Balb/c (H-2d)
B6 (H-2b) C3H (H-2k) +
B6 (H-2b) C3H C3H
B6 (H-2b) C3H C3H-E3/19K +
WO 95/06717 ~ 3 3 PCT/US94/099S7
Fxam~le 17
A. ISOLATION AND TRANSDUCTION OF BONE MARROW CELLS
Pluripotent hematopoeitic stem cells, CD34+ are collected from the bone
marrow of a patient by a syringe evacuation p~.rol,lled by known techniques.
Alternatively, CD34+ cells may also be obtained from the cord blood of an infant if the
patient is diagnosed before birth. Generally, 20 bone-marrow aspirations are obtained
by puncturing femoral shafts or from the posterior iliac crest under local or general
anesthesia. Bone marrow aspirations are then pooled and suspended in Hepes-buffered
Hanks' balanced salt solution collt~ ;llg heparin sulfate at 100 Units/ml and
deoxyribonuclease I at 100 ~lg/ml and then subjected to a Ficoll gradient separation.
The buffy coated marrow cells are then collected and washed according to
CEPRATETM LC (CD34) Separation system (Cellpro, Bothell, WA). The washed
buffy coated cells are then stained sequentially with anti-CD34 monoclonal antibody,
washed, then stained with biotinylated secondary antibody supplied with the
CEPRATETM system. The cell ll~L~e iS then loaded onto the CEPRATETM avidin
column. The biotin-labeled cells are adsorbed onto the colurnn while unlabeled cells
pass through. The column is then rinsed according to the CEPRATETM system
directions and CD34+ cells eluted by agitation of the column by m~nll~lly sq~le~in~ the
gel bed. Once the CD34+ cells are purified, the purified stem cells are counted and
plated at a concentration of 1 x 105 cells/ml in Iscove's modified Dulbecco's medium,
IMDM (Irvine Scientific, Santa Ana, CA), cont~ining 20% pooled non-heat inactivated
human AB serurn (hAB serum).
After purification of CD34+ cells, several methods of transducing
purified stem cells may be performed. One approach involves transduction of the
purified stem cell population with vector cont~ining supernatant cultures derived from
vector producing cells. A second approach involves co-cultivation of an irradiated
monolayer of vector producing cells with the purified population of non-adherentCD34+ cells. A third and pl~f~lled approach involves a similar co-cultivation
approach, however the purified CD34+ cells are pre-stimulated with various cytokines
and cultured 48 hours prior to the co-cultivation with the irradiated vector producing
cells. Pre-stimulation prior to transduction increases effective gene transfer (Nolta
et al., Exp. Hem~tol. 20:1065; 1992). The increased level of transduction is attributed
3 5 to increased proliferation of the stem cells necessar,v for efficient retroviral
WO 95/06717 ~,3 PCT/US94/09957
42
transduction. Stimulation of these cultures to proliferate also provides increased cell
populations for re-infusion into the patient.
Pre-stimulation of the CD34+ cells is performed by incubating the cells
with a combination of cytokines and growth factors which include IL-l, IL-3, IL-6 and
5 mast cell growth factor (MGF). Pre-stimulation is performed by culturing 1-2 x 105
CD34+ cells / ml of medium in T25 tissue culture flasks co~ g bone marrow
stimulation medium for 48 hours. The bone marrow stim~ tion medium consists of
IMDM cont~ining 30% non-heat inactivated hAB serum, 2mM L-ghlt~minP, 0.1 mM 2-
mercaptoethanol, lllM hydrocortisone, and 1% deionized bovine serum albumin. All10 reagents used in the bone marrow cultures should be screened for their ability to support
maximal numbers of granulocyte erythrocyte macrophage meg~k~ryocyte colony-
forming units from normal marrow. Purified recombinant human cytokines and growth
factors (Immunex Corp., Seattle, WA) for pre-stimulation should be used at the
following concentrations: E. coli-der.ved IL-la (100 U/ml), yeast-derived IL-3 (5
15 ng/ml), IL-6 (50 U/ml), and MGF (50 ng/ml) [Anderson et al., Cell Growth D;ffer.
2:373, 1991]
After ple~ ,.ulation of the CD34+ cells, the cells are then tr~n~ ce~l by
co-cultivating on to the irradiated DA-based producer cell line (expressing the E3/19K
vector) in the contimled presence of the stimulation medium. The DA vector producing
20 cell line is first tryp~ini7Pd irradiated using 10,000 rad and replated at 1-2 x 105/ml of
bone marrow stimulation medium. The following day, 1-2 x 105 prestimulated CD34+cells /ml were added onto the DA vector producing cell line monolayer followed by
polybrene (Sigma, St. Louis, MO) to a final concentration of 4ug/ml. Co-cultivation of
the cells should be performed for 48 hours. After co-cultivation, the CD34+ cells are
25 collected from the adherent DA vector producing cell monolayer by vigorous flushing
with medium and plated for 2 hours to allow adherence of any dislodged vector
producing cells. The cells are then collected and exr~ntled for an additional 72 hours.
The cells are collected and frozen in liquid nitrogen using a cryo-protectant in aliquots
of 1 x 107 cells per vial. Once the transformed CD34+ cells have been tested for the
30 presence of adventitious agents, frozen transforr~ d CD34+ cells may be thawed, plated
to a concentration of 1 x 105 cells/rnl and cultured for an additional 48 hours in bone
marrow stimulation medium. Transformed cells are then collected, washed twice and
resuspended in normal saline. The number of transduced cells used to infuse back into
the patient per infusion is projected to be at a minimum of 107 x 108 cells per patient
35 per injection. The site of infusion may be directly into the patients bone marrow or i.v.
into the peripheral blood stream.
PCT/US94/09957
WO 95/06717
ZIS8933
43
B. ISOLATION OF PANCREATIC ISLET CELLS
Procedures for the isolation of human pancreatic islet cells have been
5 previously described (Warnock et al., Diabetologi~ ~:85 1992; Warnock et al.,
Tran.~l~nt~tion 45:957, 1988). The pancreas is obtained from adult human cadaverorgan donors at the National Disease Research Interchange in Philadelphia, PA. It is
removed by laparotomy by dividing the gastrocolic omentum and splenic lig~mPntc
The neck of the pancreas is freed from the portal vein and the rem~in-l~r of the gland is
10 detached from the retroperitoneum. The pancreas is weighed and immersed into 4C
Hanks' b~l~nced salt solution (HBSS). The pal~c~e~lic duct at the head is ç~nn~ ted
with a 16 gauge c~nn~ and then HBSS-cont~ining collagenase type XI (Sigma
Chemicals, St. Louis, MO) is injected. Upon transfer to a cooling tray, the pancreatic
duct is exposed at the middle of the gland and two additional 16 gauge c~nn~ c are
15 inserted into this portion of the duct. Each pancreatic duct is perfused with a
collagenase solution at 4C and then gradually warmed to 38~C. Digestion of the
pancreas is judged complete when the islets dissociate freely from the exocrine tissue as
determined microscopically. The digested tissue is transferred to HBSS cont~ining 2%
(v/v) newborn calf serum (Gibco, Burlington, Ontario, Canada) at 4C and gently teased
20 apart. The tissue is washed, passed through needles of progressively smaller sizes and
suspended in tissue culture medium 199 (Gibco, Burlington, Ontario, Canada) at 4C
using 0.6 g of tissue per 3.4 ml of medium. Aliquots of tissue suspension are mixed
with media and Ficoll (Density 1.125, Sigma, St. Louis, MO) and centrifuged in adiscontinuous Ficoll gradient at 550g for 25 minutes at 22C. Interfaces are collected,
25 washed, and resuspended in culture mediu~n. The cells are then transformed in one of
the several ways outlined in the specification. Since pancreatic cells do not replicate
efficiently in culture it may be useful to transform with DNA or vector systems capable
of infecting non-replicating cells, for example sindbis virus or adeno-associated virus.
The genes introduced are those described for the retroviral vector system.
Example 18
REPLACEMENT OF TRANSPLANTABLE PANCREATIC ISLET CELLS
Replacement of pancreatic islet cells can be accomplished by using the
epiploic flap method as previously described (Altman et al., Horn~one and Metabolic
PCT/US94/09957
WO 95/06717
~.15~33 44
Res. Suppl. ~:136, 1990). After transduction of islets as described above, cells are
pelleted and resuspended in 10 mls of a hep~rini7Pd solution of HBSS. The vascular
circle of the greater curve tied to the epiploon was cut in its middle part, released from
the stomach and mobilized with its epiploic flap. A retrograde injection of the cell
5 solution was embolized into the right ~L~clllil~r of the gastro-epiploic artery. This
evenly distributed the islet ~lcp~dLion into the epiploic flap which was set
subcutaneously in the paraumbilical area.
Islet encapsulation, or the development of a bioartificial pancreas can
also be used. Microe~r-~ps~ tion using an arginate poly-L-lysine membrane has been
10 demonstrated by several groups (Fritschy et al., Diabetes 40:37, 1991; Krestow et al.,
Trans.pl~ntation 51:651, 1991, Mazaheri et al., Tr~n~plant~tion 51:750, 1991) This
technique is applicable to both xenogeneic and allogeneic islets and can sustainprolonged normoglycemia.
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of illustration,
various modifications may be made without deviating from the scope of the invention.
`s- Accordingly, the invention is not limited except as by the appended claims.
