Note: Descriptions are shown in the official language in which they were submitted.
WO 95/16783
PCT/US94/14574
CONTROLLED EXPRESSION OF TRANSGENIC CONSTRUCTS IN
PLANT PLASTIDS
Field of the Invention
This invention relates to the application of genetic
engineering techniques to plants. More specifically, the
invention relates to uses of nuclear constructs for
expression of specific viral RNA polymerases in conjunction
with chloroplast expression constructs using promoters
recognized by the specific viral polymerases.
Backcrround
The plastids of higher plants are an attractive target
for genetic engineering. Plant plastids (chloroplasts,
amyloplasts, elaioplasts, chromoplasts, etc.) are the major
biosynthetic centers that in addition to photosynthesis are
responsible for production of industrially important
compounds such as amino acids, complex carbohydrates, fatty
acids, and pigments. Plastids are derived from a common
precursor known as a proplastid and thus the plastids
present in a given plant species all have the same genetic
content. Plant cells contain 500-10,000 copies of a small
120-160 kilobase circular genome, each molecule of which
has a large (approximately 25kb) inverted repeat. Thus, it
is possible to engineer plant cells to contain up to 20,000
copies of a particular gene of interest which potentially
can result in very high levels of foreign gene expression.
DNA sequence and biochemical data reveal a similarity
of the plastid organelle's transcriptional and
translational machineries and initiation signals to those
found in prokaryotic systems. In fact, plastid derived
promoter sequences have been reported to direct expression
of reporter genes in prokaryotic cells. In addition,
plastid genes are often organized into polycistronic
operons as they are in prokaryotes.
Despite the apparent similarities between plastids and
prokaryotes, there exist fundamental differences in the
methods used to control gene expression in plastids and
1
WO 95/16783 ~. PCT/US94/14574
prokaryotes. As opposed to the transcriptional control
mechanisms typically observed in prokaryotes, plastid gene
expression is controlled predominantly at the level of
translation and mRNA stability by traps-acting nuclear
encoded proteins.
Previous studies directed to stable transformation of
plant chloroplasts have relied on homologous recombination
to incorporate desired gene constructs into leaf plastids.
In this manner, transgenic plants homoplastic, or near-
homoplastic, for a recombinant DNA construct may be
obtained. However, a major drawback to genetic engineering
for plastid gene expression is the lack of tissue specific
and/or developmental regulation mechanisms to control the
timing and/or sites of expression of the desired gene
products. Since the entire complement of plastid
organelles in the transgenic plants are transformed, the
integrated construct is expressed in all plastid containing
plant tissues.
A mechanism for controlling expression of sequences
inserted into plastids would be useful for optimum
modification of plastid pathways which occur in particular
tissue types, such as the starch and fatty acid
biosynthesis pathways in potato tubers or oilseeds,
respectively, flower color pathways, fruit ripening related
reactions in various fruit plastids, and pathways which can
be targeted to produce herbicide resistance in green plant
tissues. In addition, unregulated modification of existing
plastid metabolism, for example by reducing expression of a
native plastid gene using antisense constructs, and/or
introduction of new biochemical pathways could result in
the inability to obtain viable plants. For example,
alteration of certain pathways in vegetative tissues at an
early developmental stage, such as would be observed using
non-regulated E. coli or chloroplast gene promoters, could ,
result in the production of detrimental end products and
thus limit the ability to obtain transgenic plants.
However, if the gene for a desired biochemical reaction
could be programmed for expression only at a particular
stage of development, the reaction could be controlled so
2
CA 02178645 2004-10-O1
as to produce the desired product at the desired period,
for example when there is sufficient plant biomass to
harvest. In this manner, substantial quantities of the
desired end product may be obtained.
Relevant Literature
Stable transformation of plastids has been reported in
the green algae Chlamydomonas (BOynton et aI. (1988)
Science 240:1534-1538) and most recently in higher plants
10 (Swab et a1. (1990) Proc. Natl. Acad. Sci. USA 87:8526-
8530; Svab and Maliga (1993) Proc. Natl. Acad. Sci. USA
90:913-917). These methods rely on particle gun delivery
of DNA containing a selectable marker and targeting to the
plastid genome by homologous recombination.
15 The complete DNA sequences of the plastid genomes from
liverwort (Ohyama et a1. -(1986) Nature 322:572-574), rice
(Hiratsuka et al. (1989) Mol. Gen. Genet. 217:185-194), and
tobacco (Shinozaki et a1. (1986) EMBO J. 5:2043-2x49) have
been reported.
20 Plastid promoters have been reported to direct
expression of reporter genes in prokaryotic cells (Gruissem
et a1. (1993) Critical Reviews in Plant Sciences 12:19-55).
Selective expression of cloned genes in E. coli by T7
polymerase has been reported by Rosenberg et a1. (Gene
25 (1987) 56:125-135) .
Targeting of T7 RNA polymerase to nuclei in tobacco
(Lassner et a1. (1991) Plant Mol. Biol. 17:229-234), mouse
cells (Lieber et a1. (1989) Nucl. Acids Res. 17:8485-8493),
and Saccharomyces cerevisiae (Benton et a1. (1990) Mol.
30 Cell. Biol. 10:353-360) has been reported.
3
CA 02178645 2004-10-O1
Summary of the Invention
Various embodiments of this invention provide a method
of providing for transcription of a DNA sequence of
interest in a plant plastid organelle wherein. said method
comprises: growing a plant comprising cells, wherein the
nuclei of said plant cells comprise a DNA construct
comprising the following operably joined components in the
5' to 3' direction of transcription; a promoter functional
in said nuclei, an encoding sequence for a plastid transit
peptide, an encoding sequence for a viral single subunit
RNA polymerise from a member of the T7 class of
bacteriophage, and a transcriptional termination region
functional in said nuclei, wherein said transit peptide
encoding sequence and said RNA polymerise encoding
sequences are present in the same translational reading
frame; and wherein the genome of said plastid organelle
comprises a DNA construct comprising the following operably
joined components in the 5' to 3' orientation of
transcription, a promoter specific for said viral single
subunit RNA polymerise, said DNA sequence of interest, and
a transcription termination region.
Other embodiments of this invention provide a plant
cell comprising: a) a nuclear expression construct
comprising as operably joined components in the 5' to 3'
direction of transcription a promoter functional in the
nucleus of said cell, an encoding sequence for a plastid
transit peptide, an encoding sequence for a viral single
subunit RNA polymerise from a member of the T7 class of
bacteriophage, and a transcriptional termination region
functional in said nucleus, wherein said transit peptide
encoding sequence and said RNA polymerise encoding sequence
are present in the same translational reading frame; and
b) a DNA construct in the genome of a plastid organelle of
3a
CA 02178645 2004-10-O1
said cell, said DNA construct comprising as operably joined
components in the 5' to 3' direction of transcription a
promoter specific for said viral single subunit RNA
polymerase, a DNA sequence of interest and a transcription
termination region.
By this invention, constructs useful for genetic
engineering of plant cells to provide a method of
controlling the timing or tissue pattern of expression of
foreign DNA sequences inserted into the plant plastid
genome are provided. Constructs for nuclear transformation
provide for expression of a viral single subunit RNA
polymerase in plant cell tissues, and targeting of the
3b
WO 95/16783 L ~ PCT/US94/14574
expressed polymerase protein into the plant cell plastids.
Nuclear constructs include those which provide for
constitutive expression of the viral polymerase in all
plant cells and those which provide for expression
preferentially in particular plant tissues and/or at
particular developmental stages.
DNA sequences, also referred to herein as
polynucleotides, for use in plastid transformation contain
a plastid expression construct comprising a viral gene
promoter region which is specific to the RNA polymerase
expressed from the nuclear expression constructs described
above, and a DNA sequence of interest to be expressed in
the transformed plastid cells. This portion of the
polynucleotide for plastid transformation is referred to
herein as the "plastid expression construct". The DNA
sequence of interest may be a single encoding region in a
sense orientation or in the antisense orientation, for
example where reduction of expression of a native plastid
gene is desired. The DNA sequence of interest may contain
a number of consecutive encoding sequences to be expressed
as an operon, for example where introduction of a foreign
biochemical pathway into plastids is desired. The
polynucleotide for plastid transformation will also include
a DNA construct providing for expression of a marker in a
plant plastid organelle, wherein said marker provides for
selection of plant cells comprising a plastid organelle
expressing said marker. This plastid construct is also
refered to herein as the "plastid selection construct".
The polynucleotide for use in plastid transformation will
also contain a means of providing for transfer of the
expression and selection constructs into the plastid
genome. Conveniently, regions of homology to the target
plastid genome which flank the constructs to be transferred
are included. Other means of transfer to the plastid
genome are also considered herein, such as by methods
involving the use of transposable elements.
Plant cells and plants comprising the nuclear and/or
plastid constructs described herein are also considered in
this invention. Such plants or plant cells may be used in
4
WO 95/16783 ~ PCT/US94/14574
plant breeding or transformation methods to provide plant
cells having both the nuclear and plastid constructs of
this invention. It is recognized that plant cells
comprising both the nucleus and plastid expression
constructs of this invention will have an altered phenotype
as the result of expression of the DNA sequence of interest
in the plastid genome under control of the viral promoter
region.
In addition, a method of providing for tissue and/or
developmental preferential expression in plant plastids, as
well as the resultant phenotype alteration, is provided in
plant cells comprising both the nuclear polymerase
construct and the plastid expression construct of this
invention.
Description of the Ficrures
Figure 1. A schematic of a T7 RNA polymerase
expression binary construct, pCGN4026, for nuclear
transformation is shown. LB, left T-DNA border; RB, right
T-DNA border; 35S, CaMV 35S promoter; nptII, neomycin
phosphotransferase gene; tml3', tumor morphology 'large' 3'
region; d35S, enhanced CaMV 35S promoter; TP, tobacco small
subunit 5' untranslated region, chloroplast transit peptide
plus intron I and the first 12 amino acids of the mature
protein; T7 RNAP, coding region of the phage T7 RNA
polymerase gene minus the start codon; nos3', nopaline
synthase 3' region.
Figure 2. A construct for preparation of
transplastomic tobacco lines containing a T7 RNA polymerase
dependent GUS expression marker, and Southern analysis of
chloroplast DNA are shown. A schematic of the pCGN4276
construct and representation of incorporation into the
tobacco plastid genome are shown at the top. Expected
sizes for Barr~iI fragments are provided for the incoming DNA
as well as the wild type DNA. As there is no BamHI site on
the 5' end of the incoming DNA, the combined size of the
two chimeric genes is indicated. Also shown are the
location of probes A and B used for Southern analysis.
Probe A determines degree of transformation and probe B
5
217$45
WO 95/16783 PCTIUS94/14574
reveals presence of the GUS gene. Results of Southern
analysis are shown at the bottom of Figure 2. 4276/4026-3
clones 1 and 2 represent two independent spectinomycin
resistant transformants in N. tabacum var. 'Xanthi' line
4026-3. 4276/Xanthi represents a spectinomycin resistant
transformant in wild type N. tabacum var. 'Xanthi'.
Control DNA is from untransformed 'Xanthi'.
DETAILED DESCRIPTION OF THE INVENTION
A nuclear transformation construct of the instant
invention includes any sequence of nucleotides which can be
inserted into the genome of a plant cell nucleus and
provide for expression of a viral single subunit RNA
polymerise fused to a transit peptide region capable of
providing for transport of the polymerise protein into a
plastid organelle. The viral polymerise encoding sequences
of this invention are obtained from a group of
morphologically similar bacterial viruses which provide for
the synthesis of a DNA-dependent RNA polymerise upon
infection of their bacterial host. In contrast to other
known DNA-dependent RNA polymerises, the polymerises
encoded by this class of bacterial viruses consist of a
single protein species (of approximate 100kD molecular
weight, and selectively recognize and provide for
transcription from a specific promoter sequence. Some well
characterized viruses which encode this type of polymerise
include the E. coli T3 and T7 phages and the SP6 phage of
Salmonella typhimurium. Encoding sequences for such
polymerises have been reported by McGraw et a1. (Nucl.
Acids Res. (1985) 13:6753-6766) and Kotani et al. (Nucl.
Acids Res. (1985) 15:2653-6664). Other members of this
class of bacteriophage include Pseudomonas phage gh-1,
Klebsiella phage K11, Citrobacter phage ViIII, and Serratia
phage IV. Thus, encloding sequences for related polymerises
from any member of this class of phage can be obtained and
used in nuclear expression constructs, such as exemplifed
herein by constructs comprising a T7 polymerise encoding
sequence.
6
WO 95/16783 ~ PCT/US94114574
The sequences which encode a transit peptide region to
provide for transport of the viral polymerase into plant
plastids are preferably obtained from a plant nuclear-
encoded plastid protein, such as the small subunit (SSU) of
ribulose bisphosphate carboxylase, plant fatty acid
biosynthesis related genes including acyl carrier protein
(ACP), stearoyl-ACP desaturase, Q-ketoacyl-ACP synthase and
acyl-ACP thioesterase, or LHCPII genes. The encoding
sequence for a transit peptide which provides for transport
to plastids may include all or a portion of the encoding
sequence for a particular transit peptide, and may also
contain portions of the mature protein encoding sequence
associated with a particular transit peptide. There are
numerous examples in the art of transit peptides which may
be used to deliver a target protein into a plastid
organelle. The particular transit peptide encloding
sequence used in the instant invention is not critical, as
long as delivery to the plastid is obtained. In the
examples provided herein a tobacco RuBISCO SSU gene 5'
untranslated region plus coding sequences for the
chloroplast transit peptide and 12 amino acids of mature
SSU (including intron I) are included in a construct to
provide for delivery of nuclear expressed T7 polymerase to
tobacco plastids. For delivery of a nuclear expressed T7
polymerase to Brassica plastids, a similar construct in
which the tobacco SSU intron I region has been deleted may
be employed.
The plant promoter which provides for expression of
the transit peptide viral polymerase encoding sequences in
the plant cell nucleus may provide for constitutive
expression in all plant tissues, or may provide for
expression preferentially in particular plant tissues
and/or at particular stages in plant development.
Constitutive promoters may exhibit higher or lower levels
of expression in particular plant tissues, but will
. generally provide for at least some level of expression in
all parts of the plant. Examples of plant constitutive
promoters include the 19S and 35S promoters from CaMV, and
the promoters from the mas, nos and ocs Agrobacterium T-DNA
7
WO 95/16783 ~ PCT/US94/14574
genes. For developmental or tissue preferential
expression, useful promoters include those from genes
expressed preferentially in plant seeds, fruit, tubers,
fiber cells, floral tissues and pollen.
Preferential expression in seed plastids is desirable
where modification of fatty acid biosynthesis pathways,
modification of storage proteins, or introduction of a new
pathway in seeds, such as the bacterial polyhydroxybutyrate
(PHB) pathway. is desired. Examples of plant functional
promoters which may be useful for such applications include
those from plant storage protein genes or from genes
involved in fatty acid biosynthesis in oilseeds. Examples
of such promoters include the 5' regulatory regions from
such genes as napin Kridl et a1. (1991) Seed Sci. Res.
1:209:219), phaseolin, zein, soybean trypsin inhibitor,
ACP, stearoyl-ACP desaturase and oleosin. Seed specific
gene regulation is discussed in EP 0 255 378 (2/3/88).
Preferential expression in fruit plastids is
desirable, for example, where modification of fruit color
or flavor development pathways is desired, or where one
wishes to alter the carbohydrate content in plant fruits.
Examples of plant functional promoters which may be useful
for such applications include those from such fruit related
genes as polygalacturonase (Bird et al. (1988) Plant Mol.
Biol. 11:651-662), the E-8 gene from tomato (Deilanan et a1.
(1988) EGO J. 7:3315-3320; DellaPenna et a1. (1989) Plant
Cell 1:53-63), tomato 2A11 (Pear et al. (1989) Plant Mol.
Biol. 13:639-651), or ovary specific promoter regions such
as described in WO 91/01324 (2/7/91).
Modification to starch synthesis pathways in major
starch storage tissues such as potato tubers or corn seeds
may also be accomplished by the plastid expression methods
described herein. In such cases, promoters from patatin
(Twell et a1. (1987) Plant Mol. Biol. 9:365-375), zero or .
plant starch synthase (Visser et a1. (1989) Plant Sci.
64:185-192) may be particularly useful for nuclear
expression of a viral single subunit RNA polymerase.
Other plant tissues which can be selectively modified
by the constructs and methods described herein include
8
CA 02178645 2004-10-O1
plant floral tissues, and such specialized tissues as
cotton boll fibers. Promoters which may be used for
nuclear expression of a viral polymerase selectively in
floral tissues include those from a chalcone synthase gene,
5 such as the CHS gene A from petunia (Koes et al. (1986)
Nucl. Acids Res. 14:5229-5239). For floral color
modification, expression or antisense control of
anthocyanin or flavonoid type pigments in floral tissues is
desired. For a review of plant flower color gene
10 manipulation, see van Tunen et a1. (in Plant Biotechnology
Series, Volume 2 (1990) Developmental Regulation of Plant
Gene Expression, D. Grierson ed.). For fiber tissue
modification, use of a tomato p7Z gene promoter for
expression in cotton fiber tissues is described in U.S.
15 5175095; U.S. 5530185; WO 91/01324; and EP 0 409 629. Other
promoters useful for expression in cotton fiber cells have
also been reported (Crow, et al., Proc. Natl. Acad. Sci.
USA (1992) 89:5769-5773). Desirable cotton fiber
modifications include, improvement of strength or texture.
20 Examples of genes which may be used for such improvements
included PHB biosynthesis genes, cellulose synthase genes
(Saxena et a1. (1990) Plant Mol. Hiol. 15:673-683) and
fungal chitin synthase genes (Bowen et a1. (Proc. Nat.
Acad. Sci. (1992) 89:519-523).
25 Another example of useful phenotypic modification to
cotton fibers is the production of colored cotton, for
example having blue or black colored fibers. Methods for
nuclear expression of encoding sequences for pigment
production in cotton fibers is described in 07/998,158.
30 For example, for melanin production, two protein encoding
sequences from Streptomyces (Bernan et a1. (1985) Gene
37:101-110) may be used. The mRNAs for the two proteins,
the ORF438 product and tyrosinase, are transcribed from a
single promoter Streptomyces. By the instant. invention, the
35 .operon may be adapted for expression from a specific viral
promoter region, such as the T7 promoter described herein,
and used for plastid transformation. Similarly, two or
more gene products may be required for production of indigo
in transformed host cells. Where the responsible enzyme is
9
WO 95/16783 PCT/US94114574
a monooxygenase, as described in unexamined Japanese Patent
Application Kokai 2-119777 (Suzuki et a1.), two gene
products are required. Where the enzyme is a dioxygenase,
such as the naphthalene dioxygenase (ND) described in
Kurkela et a1. (Gene (1988) 73:355-362), three gene
products are required. Use of a tryptophanase encoding
sequence may also be desired to increase the amount of
indole available for conversion to indigo. Sources of
tryptophanase gene sequences include E. coli (see, for
example Deeley et a1. (1982) J. Bacteriol. 151:942-951).
Thus, the encoding sequences for such proteins may be
provided as operons behind a viral promoter specifically
recognized by a single subunit viral polymerase and used in
plastid expression constructs as described herein.
In a further embodiment, the instant application
provides for methods to preferentially modify plastid
pathways which are present in green tissues, or which are
preferentially present in actively growing plant tissues,
such as meristematic regions. In particular, use of light
inducible promoters, such as those from SSU or chlorophyll
A/B binding protein genes, for expression of a viral
polymerase in green tissues is considered. For actively
growing plant tissues, a promoter from an EF-1~ gene may be
used. See, for example, USPN 5,177,011 (Shewmaker et al.)
issued 1/5/93. Such green tissue or meristematic promoters
may find use in conjunction with plastid expression
constructs for modifications which provide herbicide
tolerance, for example to glyphosate, bromoxynil or
imidazolinone herbicides using resistance genes such as
described in Stalker et al. (J. Biol. Chem. (1985)
260:4724-4728, Stalker et a1. (J. Biol. Chem. (1985)
263:6310-6314, and Sathasivan et a1. (Nucl. Acids Res.
(1990) 18:2188. In addition, the plastids of such tissues
are desirable targets for modifications to provide .
increased photosynthetic capacity or to provide mechanisms
for disease and/or stress resistance.
The DNA sequences, or polynucleotides, for use in
plastid transformation of this invention will contain a
plastid expression construct comprising a viral gene
WO 95116783 ~ PCT/US94/14574
promoter specifically recognized by the RNA polymerise
expressed from the nuclear expression constructs described
above, and a DNA sequence of interest to be expressed in
the transformed plastid cells under the control of the
viral promoter. Thus, where the nuclear polymerise
expression construct encodes a T7 polymerise, as discussed
in the examples which follow, the plastid construct for
expression of the DNA sequence of interest will contain a
T7 gene promoter region, so that the DNA sequence of
interest is only expressed in the presence of the T7
polymerise. Similarly, where a T3, SP6 or other viral
polymerise is expressed as the result of a nuclear
transformation, the plastid expression construct will
utilize a corresponding gene promoter region.
The specific viral promoter regions used in the
constructs described herein may also include portions of
the 5' untranslated DNA region of the selected viral gene.
For example, the 5' untranslated region from gene 10 of
phage T7 has been reported to provide for enhanced
translation, and is included in the T7 plastid expression
constructs described herein. Different or additional 5'
untranslated regions from various sources may find use in
the plastid constructs for expression of DNA sequences of
interest.
The plastid viral promoter expression constructs will
generally include a transcription termination region that
is recognized by the viral polymerise encoded by the
nuclear construct. Typically, a strong transcription
termination region is required when using the specific
viral promoters of this invention, and it is thus
convenient to use the transcription termination region from
the same gene as that from which the specific promoter
region was obtained. Thus, in the examples described
herein, a T7 gene 10 promoter region and the corresponding
gene 10 transcription termination region are used in the
plastid T7 expression constructs.
It is noted that various other genes in phage T7 also
contain promoter sequences specifically recognized by the
T7 single subunit polymerise. Notably, gene 10 of T7 is
11
WO 95/16783 ~ PCT/US94/14574
one of six T7 genes which have an identical 24 by promoter
region. Thus, the promoter from any one of these genes,
with or without the corresponding 5' untranslated region
may be used for plastid expression constructs encompassed
by this invention.
The DNA sequence of interest in the plastid viral
promoter expression constructs may be an encoding sequence
which is oriented for expression of a particular structural
gene, such that the protein encoded by the structural gene
sequence is produced in the transformed plastid. In
addition, the DNA sequence of interest may include a number
of individual structural gene encoding regions such that an
operon for expression of a number of genes from a single
viral promoter region is produced. Thus, it is possible to
introduce and express multiple genes from an engineered or
synthetic operon or from a pre-existing prokaryotic gene
cluster. Such a method would allow large scale and
inexpensive production of valuable proteins and fine
chemicals in a particular desired plant tissue or a
particular stage of development, depending upon the
promoter used to drive nuclear expression of the specific
viral polymerise. Such an approach is not practical by
standard nuclear transformation methods since each gene
must be engineered into a monocistron including an encoded
transit peptide for plastid uptake and appropriate promoter
and terminator signals. As a result, gene expression levels
would be expected to vary widely between cistrons, and
generation of a number of transgenic plant lines would be
required. Ultimately crosses would be required to
introduce all of these cistrons into one plant to get
expression to the target biochemical pathway.
Alternatively, the DNA sequence of interest in the
plastid constuct may be a fragment of an endogenous plastid
gene oriented such that an RNA complementary to the
endogenous gene mRNA is produced in the transformed
plastid. Such antisense constructs may be used to decrease
the expression of the target plastid gene.
In order to provide a means of selecting the desired
plant cells following plastid transformation, the
12
~iT~64~
WO 95/16783 PCT/US94/14574
polynucleotides for plastid transformation will also
contain a construct which provides for expression of a
marker gene. Expression of the marker gene product allows
for selection of plant cells comprising plastid organelles
which are expressing the marker protein. In the examples
provided herein, a bacterial aadA gene is expressed under
the regulatory control of chloroplast 5' promoter and 3'
transcription ternnination regions. The use of such an
expression construct for plastid transfornlation of plant
cells has been described by Svab and Maliga (1993, supra).
Expression of the aadA gene confers resistance to
spectinomycin and streptomycin, and thus allows for the
identification of plant cells expressing this marker gene.
Selection for the aadA marker gene is based on
identification of plant cells which are not bleached by the
presence of streptomycin, or more preferably spectinomycin,
in the plant growth medium. Other genes which encode a
product involved in chloroplast metabolism may also be used
as selectable markers. For example, genes which provide
resistance to plant herbicides such as glyphosate,
bromoxxynil or imidazolinone may find particular use. Such
genes have been reported by Stalker et a1. (J. Biol. Chem.
(1985) 260:4724-4728; glyphosate resistant EPSP), Stalker
et al. (J. Biol. Chem. (1985) 263:6310-6314; bromoxynil
resistant nitrilase gene), and Sathasivan et a1. (Nucl.
Acids Res. (1990) 18:2188; AHAS imidazolinone resistance
gene).
In the examples described herein, the aadA gene is
under the control of a tobacco 16S rRNA promoter, rrn
region and a tobacco rpsl6 3' termination region. Numerous
additional promoter regions may also be used to drive
expression of the selectable marker gene, including various
plastid promoters and bacterial promoters which have been
shown to function in plant plastids.
The polynucleotides for use in plastid transformation
will also contain a means of providing for stable transfer
of the viral promoter expression construct and the
selectable marker construct into the plastid genome.
Conveniently, regions of homology to the target plastid
13
WO 95/16783 PCT/US94114574
genome which flank the constructs to be transferred and
provide for transfer to the plastid genome by homologous
recombination via a double crossover into the genome.
Where the regions of homology are present in the inverted
repeat regions (IRA and IRB) of the plastid genome, two
copies of the transgene are expected per plastid genome.
Typically, the regions of homology with the plastid genome
will be approximately lkb in size. Smaller regions of
homology may also be used, for example as little as 100 by
can provide for homologous recombination into the plastid
genome. However, the frequency of recombination and thus
the frequency of obtaining plants having transformed
plastids may decrease with decreasing size of the homology
regions. Example of constructs comprising such regions of
homology for tobacco plastid transformation are descibed in
Svab etal. (1990 supra) and Svab and Maliga (1993 supra).
Regions useful for recombination into tobacco and Brassica
plastid genomes are also described in the following
examples. Similar homologous recombination and selection
constructs may be prepared using plastid DNA from the
target plant species.
Other means of transfer to the plastid genome are also
considered herein, such as by methods involving the use of
transposable elements. For example, the constructs to be
transferred into the plastid genome may be flanked by the
inverted repeat regions from a transposable marker which
functions in plant plastids. A DNA construct which
provides for transient expression of the transposase
required to tranfer the target DNA into the plastids is
also introduced into the chloroplasts. In this manner, a
variety of phenotypes may be obtained in plants transformed
with the same expression construct depending on positional
effects which may result from insertion of the expression
constructs into various locations on the plastid genome.
Appropriate transposons for use in such plastic
transformation methods include bacterial TnlO,
bacteriophage Mu and various other known bacterial
transposons.
14
CA 02178645 2004-10-O1
In developing the constructs of the instant invention,
the various fragments comprising the regulatory regions and
open reading frame may be subjected to different processing
conditions, such as ligation, restriction enzyme digestion,
PCR, in vitro mutagenesis, linkers and adapters addition,
and the like. Thus, nucleotide transitions, t.ransversions,
insertions, deletions, or the like, may be performed on the
DNA which is employed in the regulatory regions, the viral
polymerase encoding sequence and/or the DNA sequences of
interest for expression in the plastids. Methods for
restriction digests, Klenow blunt end treatments,
ligations, and the like are well known to those in the art
and are described, for example, by Maniatis et a1. (in
Molecular cloning: a laboratory manual (1982) Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY).
During the preparation of the constructs, the various
fragments of DNA will often be cloned in an appropriate
cloning vector, which allows for amplification of the DNA,
modification of the DNA or manipulation by joining or
removing of sequences, linkers, or the like. Normally, the
vectors will be capable of replication in at least a
relatively high copy number in E. coli. A number of
vectors are readily available for cloning, including such
vectors as pBR322, pUC series, M13 series, and pBluescriptT""
(Strategene; La Jolla, CA).
Any one of a number of methods for transforming the
nucleus of plant cells with a viral polymerase expression
construct may be used in this invention. Methods for plant
cell nuclear transformation may include the use of Ti- or
Ri-plasmids, microinjection, electroporation, liposome
fusion, DNA bombardment or the like.
4~lhere Agrobacterium is used for transformation of
plant cell nuclei, a vector may be used which is introduced
into the Agrobacterium host for homologous recombination
with T-DNA or the Ti- on Ri-plasmid present in the
Agrobacterium host. Alternatively, binary vectors which
provide for tranfer of the construct to plant cells on a
plasmid maintained in Agrobacterium independently of the
Ti-plasmid may be used. It is desirable to have the
WO 95/16783 PCT/US94/14574
construct bordered on one or both sides by T-DNA,
particularly having the left and right borders, more
particularly the right border. Included with the nuclear
expression construct and the T-DNA borders will be one or
more markers, which allow for selection of transformed
Agrobacterium and transformed plant cells. A number of
markers have been developed for use with plant cells, such
as resistance to kanamycin, the aminoglycoside 6418,
hygromycin, or the like. The particular marker employed is
not essential to this invention, one or another marker
being preferred depending on the particular host and the
manner of construction.
The vector is used for introducing the DNA of interest
into a plant cell by transformation into an Agrobacterium
having vir-genes functional for transferring T-DNA into a
plant cell. The Agrobacterium containing the broad host
range vector construct is then used to infect plant cells
under appropriate conditions for transfer of the desired
DNA into the plant host cell under conditions where
replication and normal expression will occur. This will
also usually include transfer of the marker, so that cells
containing the desired DNA may be readily selected.
Methods of plant nuclear transformation and selection
which employ a biolistic, or bombardment, method to
transfer the target DNA constructs to plant cells may also
be used in the instant invention. Such methods are
particularly useful in transformation of plant cells which
are less susceptible to Agrobacterium-mediated
transformation methods. Bombardment tranforination methods
are described in Sanford et al. (1991) Technique 3:3-16;
Klein et a1. (1992) BiolTechnology 10:286-291
Generally in transformation of plant cells target
explants are incubated with the transformed Agrobacterium
or bombarded with DNA coated particles. The plant cells
are then grown in an appropriate medium to selectively
culture those plant cells which have obtained the desired
constructs. Once callus forms, shoot formation can be
encouraged by employing the appropriate plant hormones in
accordance with known methods and the shoots transferred to
16
~~~86~~
WO 95/16783 PCT/US94/14574
rooting medium for regeneration of plants. The plants may
then be grown and either pollinated with the same
transformed strain or different strains. For production of
a homozymgous line, self pollination is used.
Stable transformation of tobacco plastid genomes by
particle bombardment has been reported (Swab et al. (1990)
Proc. Natl. Acad. Sci. USA 87:8526-8530; Svab and Maliga
(1993) Proc. Natl. Acad. Sci. USA 90:913-917). The methods
described in the above references may be employed to obtain
plants transformed with the plastid transformation
constructs described herein. Briefly, such methods involve
DNA bombardment of a target host explant, preferably from a
tissue which is rich in metabolically active plastid
organelles, such as green plant tissues including leaves,
and cotyledons. The bombarded tissue is then cultured for
-2 days on a cell division promoting media. The plant
tissue is then transferred to a selective media containing
an inhibitory amount of the particular selective agent, as
well as the particular hormones and other substances
necessary to obtain regeneration for that particular plant
species. For example, in the above publications and the
examples provided herein, the selective marker is the
bacterial aadA gene and the selective agent is
spectinomycin. The aadA gene product allows for continued
growth and greening of cells whose chloroplasts comprise
the marker gene product. Cells which do not contain the
marker gene product are bleached. The bombarded explants
will form green shoots in approximately 3-8 weeks. Leaves
from these shoots are then subcultured on the same
selective media to ensure production and selection of
homoplasmic shoots. As an alternative to a second round of
shoot formation, the initial selected shoots may be grown
to mature plants and segregation relied upon to provide
transformed plants homoplastic for the inserted gene
construct.
The transformed plants so selected may then be
analyzed to determine whether the entire plastid content of
the plant has been transformed (homoplastic transformants).
Typically, following two rounds of shoot formation and
17
2~78~4:~
WO 95/16783 PCT/US94/145?4
spectinomycin selection, approximately 50~ of the
transgenic plantlets analyzed are homoplastic as determined
by Southern blot analysis of plastid DNA. These plantlets
are selected for further cultivation, both for analysis of
the transgenic plastid phenotype (where the nuclear viral
polymerase expression construct is also present in the
plastid transformant), or for use in methods to transform
the viral polymerase construct into the nucleus of the
transplastomic plants.
As is demonstrated in the examples herein, the
inserted plastic gene construct is maternally inherited in
all crosses and expression can be achieved by sexual
transmission of an active nuclear gene encoding plastid-
targeted T7 RNA polymerase. Thus, there are several
possible ways to obtain the plant cells of this invention
which have both the nuclear viral polymerase expression
construct and the plastid expression construct. In one
method, a homozygous nuclear transformed plant expressing
the polymerase activity is obtained and retransformed by
bombardment to transfer the plastid expression construct
into the plastid genome. Conversely, a plastid transformed
plant may be obtained by bombardment protocols such as
described herein and used in nuclear transformation
methods, such as by Agrobacterium-mediated transformation
or through particle bombardment, to generate transgenic
plants having both nuclear and plastid transgenic
constructs. In a third method, the transplastomic plants
and nuclear transgenic plants may be ontained independently
using the respective transformation methods, and plants
having both nuclear and plastid transgenic constructs
prepared by crossing the nuclear transgenic and plastid
transgenic plants using plant breeding techniques. In such
a cross, the plastid transgenic plant is used as the
maternal parent and the nuclear transgenic plant is the .
paternal parent .
lnThere transformation and regeneration methods
involving such tissues have been adapted for a given plant
species, either by Agrobacterium-mediated transformation,
bombardment or some other method, the techniques may be
18
2~~~65
WO 95/16783 PCT/US94/14574
modified for use in selection and regeneration methods to
produce plastid-transformed plants. For example, the
methods described herein for tobacco are readily adaptable
to other solanaceous species, such as tomato, petunia and
potato. For Brassica, Agrobacterium-mediated
transformation and reneration protocols generally involve
the use of hypocotyl tissue, a non-green tissue which might
contain a low plastid content. Thus, for Brassica,
preferred target tissues include microspore-derived
hypocotyl or cotyledonary tissues (which are green and thus
contain numerous plastids) or leaf tissue explants.
Although the regeneration rates from such tissues may be
low, positional effects, such as seen with Agrobacterium-
mediated transformation are not expected, and it will not
be necessary to screen numereous successfully transformed
plants in order to obtain a desired phenotype.
Thus, the constructs and methods described herein may
be employed with a wide variety of plant life, depending on
the type of pathway to be modified or added to the plant.
For example, for starch modification, potato or corn plants
may be transformed. For flower color modification,
petunia, rose and carnation are target plant hosts. For
modification of fruit quality, tomato may be used. For
modification of seed oil quality or seed protein content,
oilseed crops such as Brassica, soybean, corn, safflower or
sunflower may be used.
In the following examples, introduction of a GUS
marker under the control of a phage T7 gene 10 promoter
into the plastid genome of plants either expressing or not
expressing a nuclear encoded/plastid targeted T7 polymerase
is described. The ability to manipulate plastid transgene
expression via the action of nuclear encoded/plastid
targetted T7 RNA polymerase is demonstrated. The plastid-
borne reporter gene, GUS, under control of the phage T7
gene 10 promoter and 5' untranslated region, is only
expressed when incorporated into a tobacco line containing
an active T7 RNA polymerase gene. The results demonstrate
that the viral polymerase is successfully introduced into
the plant plastid genome and actively transcribes the GUS
19
.~ ~ 6 .:~.
WO 95/16783 PCT/US94/14574
gene from the T7 gene 10 promoter. In addition, GUS
activity is expressed in the presence, but not the absense
of T7 polymerise activity, thus demonstrating the
specificity of this reaction and the ability to selectively
control expression of plastid transgenic constructs by
controlling expression of a nuclear transgenic construct
encoding a selective viral single subunit RNA polymerise.
The following examples are provided by way of
illustration and not by way of limitation.
EXAMPLES
Example 1 Polymerise Expression Constructs
A. CaMV 35S Promoter Construct
The construct pAR3283 (Dune et a1. (1988) Gene 68:259-
266) is digested with BglIIlEcoRI to remove the SV40 T-
antigen nuclear location signal fused to codon 11 of the T7
polymerise gene. A synthetic adapter (top strand:
5'-GATCTGGATCCAACACGATTAACATCGCTAAGAACG-3' and bottom
strand: 5'-AATTCGTTCTTAGCGATGTTAATCGTGTTGGATCCA-3') is
introduced, resulting in pCGN4023. The adapter restores
the wild type amino terminal coding region of the T7 RNA
polymerise gene except that the methionine start codon is
replaced by a BamHI restriction site. The BamFiI fragment
from pCGN4023 is subcloned into BamHI digested pCGN566 (a
plasmid related to pUCl8 but conferring resistance to
chloramphenicol rather that ampicillin) to provide
pCGN4024.
Plasmid pCGN2113 (ATCC Deposit Number 40587 made on
3/2/89) containing a double 35S promoter (-941 to -90/-363
to +2) and tm1 3' regulatory region, was digested with
SacIlEcoRI to remove the tml 3' region. A SacIlEcoRI
fragment from pBI101 (Jefferson et al. (1987) E1~0 J.
6:3901-3907) containing the nos 3' was introduced in place
of the tml 3'. The resulting plasmid, pCGN1575 was then
cut with SphI/XbaI, the ends blunted with Klenow and the
plasmid re-ligated to create pCGN1577. BglII linkers were
added to the EcoRI site following EcoRI digestion and
Klenow treatment of pCGN1577. The NcoI sites in the
resulting plasmid, pCGN1579, were then removed by digestion
278645
WO 95/16783 PCT/US94114574
with NcoI, Klenow treatment and re-ligation. The new
plasmid, pCGN1594, consists of a shortened version of the
double 35S promoter (-526 to -90/-363 to +2 relative to the
transcription start site) and a 260bp nos 3'.
'S A DNA fragment harboring the tobacco RuBISCO SSU gene
5' untranslated region plus coding sequences for the
chloroplast transit peptide and 12 amino acids of mature
SSU (including intron I) is PCR amplified using the top
strand primer
5'-CCCAAGCTTAGATCTCATCTTGGAAGTTTAAAGG-3' and bottom strand
primer 5'-GGGGAGCTCGTCGACGGATCCGTACTTCTTCTTGTTAATTGG-3'
using clone TSSU 3-8 (0'Neal et a1. (1987) Nucleic Acids
Res. 15:8661-8677) as template. PCR reactions are done in
100 ~.1 volumes using conditions recommended by Perkin-
Elmer/Cetus in a PerkinElmer thermal cycler (GeneAmp System
9600) set for 25 cycles of 94~c/30 sec, 55~c/30 sec, and
72~c/30 sec. The resulting fragment is cloned into
pBluescriptII SK+ (Stratagene; LaJolla, CA) by digestion
with HindIII/SacI. Following DNA sequence verification the
resulting plasmid, pCGN3669, is digested with BglIIlSacI
and the SSU sequences cloned into BamFiI/SacI digested
pCGN1594. The resulting plasmid, pCGN3672, is cut with
BamHI and the modified T7 polymerase gene introduced as a
BamFiI fragment from pCGN4024. A clone, pCGN4025, in which
the T7 polymerase gene is oriented such that it reads as a
translational fusion with the mature SSU is selected.
pCGN4025 is digested with HindIII/BglII and the
d35S/chloroplast transit peptide:T7 polymerase/nos 3'
expression construct introduced into HindIII/BamHI digested
binary vector pCGN1559 (McBride et a1. (1990) Plant Mol.
Biol. 14:269-276) resulting in pCGN4026 (Figure 1).
B. Napin Expression Construct
A HindIII/BamHI fragment containing the tobacco SSU 5'
untranslated region, leader peptide encoding region and the
encoding region for the first 12 amino acids of the mature
SSU protein (including the 1st intron) is obtained by
digestion of pCGN3669 (described above). The fragment is
cloned into the HindIII/BamHI sites of pCGN986 (described
21
WO 95/16783 PCT/US94/14574
below) replacing a CaMV 35S promoter region and resulting
in pCGN4095.
pCGN986 contains a cauliflower mosaic virus 35S
(CaMV35) promoter and a T-DNA tml 3'-region with multiple
restriction sites between them. The T-DNA tml 3'-sequences
were subcloned from the pTiA6 Baml9 T-DNA fragment
(Thomashow et. al., Cell (1980) 19:729-739) as a Barr~iI-
EcoRI fragment (nucleotides 9062 to 12,823, numbering as in
Barker et a1. (Plant Mol. Biol. (1982) 2:335-350). The
unique SmaI site at nucleotide 11,207 of the Baml9 fragment
was changed to a SacI site and the BamHI site was changed
to an EcoRI site using linkers. The expression cassette
pCGN986 contains a HindIII site followed by the CaMV 35S
promoter, two SalI sites, XbaI, BamHI, SmaI, and KpnI sites
and the tml 3' region (nucleotides 11207-9023 of the T-DNA)
as a SacI/EcoRI fragment.
The intron region in the SSU portion of pCGN4095 is
removed using a synthetic oligonucleotide corresponding to
the SSU leader peptide/mature protein region bordered by
SphI and BamHI sites. The intronless SphI/BamHI fragment
is ligated into pCGN4095, replacing the intron containing
SphI/BamHI fragment, and resulting in pCGN4096.
The T7 polymerase encoding region from pCGN4024
(described above) is obtained as an approximately 2.2kb
fragment and cloned into pCGN4096, resulting in pCGN4205
containing the encoding region for the SSU leader peptide
plus 12 amino acids of SSU mature and the T7 polymerase
encoding region in the same translational reading frame.
An approximately l.7kb napin promoter region is cloned
as a BglII/HindIII fragment from pCGN3223 into a cloning
vector providing chloramphenicol resistance resulting in
pCGN4212. pCGN3223 is a napin expression cassette
containing 1.725 napin 5' and 1.265 napin 3' regulatory
sequences in an ampicillin resistant background. The
napin 5' and 3' regulatory regions are the same as those
present in pCGN1808 (Kridl et a1. Seed Science Research
(1991) 1:209-219) but are flanked by different restriction
site. The regulatory regions in pCGN3223 are flanked by
HindIII, NotI and KpnI restriction sites and unique SalI,
22
WO 95/16783
PCT/US94/14574
BglII, PstI, and XhoI cloning sites are located between the
5' and 3' noncoding regions.
The napin 5' regulatory region is moved as a
BglII/HindIII fragment from pCGN4212 into BglIIlHindIII
digested pCGN4205, resulting in pCGN4217 containing the
SSU:T7 polymerase encoding construct positioned in a sense
expression orientation between the napin 5' and tml 3'
regulatory regions. The napin/SSU:T7 polymerase/tml
chimeric gene is cloned as a HindIII/PstI partial digest
fragment into binary vector plasmids pCGN1559 and pCGN1548
(McBride et al., supra) resulting in pCGN4225 and pCGN4226,
respectively.
C. Phaseolin Expression Construct
An 850bp BglII fragment of the i3-phaseolin 5'
noncoding region was obtained from p8.8pro (Hoffman et a1.
(1987) EM80 J. 6:3213-3221) and cloned into pUC9 (Vieira
and Messing (1982) Gene 19:259-268) at the BamHI site to
yield pTV796. The phaseolin fragment in pTV796 is oriented
such that SmaI site of pUC9 is located 3' to the phaseolin
promoter. The phaseolin is subcloned from pTV796 as a
HindIII/SmaI fragment into a cloning vector providing
chloramphenicol resistance. The resulting clone, pCGN4230,
is digested with HindIII and BglII, and the -800 by
fragment containing the phaseolin promoter is cloned into
HindIII/BglII digested pCGN4205 (described above) resulting
in pCGN4231. pCGN4231 contains the SSU:T7 polymerase
encoding construct positioned in a sense expression
orientation between phaseolin 5' and tml 3' regulatory
regions. The phaseolin/SSU:T7 polymerase/tml chimeric gene
is cloned as a HindIII/Pstl partial digest fragment into
binary vector plasmids pCGN1559 and pCGN1548 (McBride et
al., supra) resulting in pCGN4232 and pCGN4233,
respectively.
Example 2 Constructs for Transformation and Expression
in Plastids
A. GUS Plastid Expression Construct
The phage T7 polymerase gene 10 promoter and entire
5' untranslated region is PCR amplified (PCR conditions as
23
~1185~
WO 95116783 PCT/US94/14574
described above) from pET3a (Rosenberg et a1. (1987) Gene
56:125-135) using the top strand primer
5'-GGGAAGCTTGCGAAATTAATACGACTCAC-3' and bottom strand
primer 5'-CCCCCATGGGTATATCTCCTTCTTAAAG-3'. The resulting
PCR reaction product consists of a 24bp T7 promoter region
and 66bp of the T7 5' untranslated region. The 5'
untranslated region includes a stem-loop structure at the
very 5' end followed by sequences containing a
translational enhancer (Olins et al. (1988) Gene (Amst.)
73:227-235), a strong prokaryotic ribosome-binding site,
and the start codon of gene 10. The T7 PCR fragment is
digested with HindIII/NcoI and cloned into HindIII/NcoI
digested pUC120 to create pCGN4028. pUC120 is an E. coli
expression vector based on pUC118 (Vieria and Messing,
Methods in Enzymology (1987) 153:3-11) with the lac region
inserted in the opposite orientation and an NcoI site at
the ATG of the lac peptide (Vieira, J. PhD. Thesis,
University of Minnesota, 1988).
To create a 3' regulatory region, a fusion was
created between the psbA3' untranslated region (base pairs
533 to 435 of the tobacco chloroplast genome sequence
reported by Shinozaki et al. (1986) EMBO J. 5:2043-2049)
and the T7 gene 10 terminator region from pET3a by PCR. In
a first reaction, the psbA 3' untranslated region is
amplified using the top strand primer
5'GGGGAATTCGATCCTGGCCTAGTCTATAAG3' and bottom strand primer
5'GGTTATGCTAGTTATTGCTCAAAAGAAAAAAAGAAAGGAGC3' with
Nicotiana tabacum var. 'Xanthi' total DNA as template.
Also, the T7 gene 10 terminator is amplified using top
strand primer 5'-GCTCCTTTCTTTTTTTCTTTTGAGCAATAACTAGCATAACC-
3' and bottom strand primer 5'-CCCCTGCAGCCGGATATAGTTCCTCC-
3' with pET3a DNA as template. In an additional PCR
reaction, 5 ~.1 of each of the reaction products from the
above psbA 3' and T7 terminator reactions are combined into
a final 100,1 reaction mix in which a fusion product is
amplified using the top strand primer used in the psbA 3'
reaction and the bottom strand primer used in the T7 gene
10 terminator reaction. The fusion product is digested with
24
~ 11865
WO 95/16783 PCT/US94/14574
EcoRI and PstI and cloned into EcoRI/PstI digested
pBluescriptII KS(-) (Stratagene) resulting in pCGN4027.
Through further manipulation the T7 promoter region
(HindIII/NcoI) and psbA3'/T7 terminator (EcoRI/PstI) are
combined with an NcoIlEcoRI GUS gene fragment from pKiwi101
(Janssen et al. (1989) Plant Mol. Biol. 14:61-72) in a
pBluescriptIIKS(-) backbone (Stratagene) resulting in
pCGN4055.
Thus, in pCGN4055, the GUS gene is situated
downstream from the E. coli phage T7 gene 10 promoter
region (sequences -24 to +66 relative to the transcription
start site) such that the start codon for gene 10 is the
start codon of GUS. The T7 gene 10 5' untranslated region
is retained since it has been reported to be important for
translational enhancement in E. coli. The 3' region of the
GUS gene construct contains the psbA 3' regulatory element
shown to be important in stabilizing the mRNA in green
tissues (Gruissem et a1. (1993) Critical Reviews in Plant
Sciences 12:19-55), as well as the strong rho independent
phage T7 gene 10 terminator.
B. Plastid Expression Construct for PHB Operon
A construct for plastid expression of an operon
containing the genes involved in the polyhydroxybutyrate
(PFiB) pathway in Brassica is prepared as follows. The PHB
operon from Alcaligenes eutrophus is obtained by digesting
pAeT41 (Peoples et a1. (1989) J. Biol. Chem. 264:15298-
15303) with SfuI and EcoRI and cloning the approximately
4.2kb fragment into ClaI/EcoRI digested BluescriptIIKS(-)
(Stratagene), resulting in pCGN4077. pCGN4077 is
mutagenized to remove the NcoI site in phbB, and the
resulting construct is designated pCGN4082. pCGN4077 is
also mutagenized to remove the NcoI site in the phbC coding
region and to add an NcoI site at the ATG translation
initiation codon. The resulting construct is designated
pCGN4081. pCGN4081 and pCGN4082 are digested with XhoI and
BglII and the XhoIlBgIII fragment of pCGN4081 containing
the mutagenized phbC coding region is ligated to the
XhoI/BglII fragment of pCGN4082 containing the mutagenized
phbB region and the cloning vector sequences. The
CA 02178645 2004-10-O1
resulting construct, pCGN4086, contains the entire PHB
operon with the internal NcoI sites removed and having an
added NcoI site at the ATG translational initiation codon.
The PHB operon is obtained by digestion of pCGN4086 with
EcoRI and XhoI and cloned into EcoRIlXhoI digested
pBluescriptIIKS(+), resulting in pCGN4089, pCGN4089 is
digested with EcoRIlNdeI to remove the PHB operon 3'
untranslated region, and ligated with an EcoRI/NdeI linker
adapter to produce pCGN4098. The PHB operon is obtained by
digestion of pCGN4098 with EcoRI and NcoI and cloned into
EcoRI/NcoI digested pCGN4211, resulting in pCGN4216.
pCGN4211 contains the T7/GUS/psbA3':T73' fragment of
pCGN4055 (described above) which was transferred as a
HindIII/PstI fragment to HindIII/PstI digested
pBluescriptII(-) to provide an ampicillin resistant clone.
Digestion of pCGN4211 with EcoRI and NcoI drops out the GUS
region. Thus, pCGN4216 contains the PHB operon under the
control of the T7 gene 10 promoter region and the
psbA3'.:T73' regions.
C. Tobacco Transformation Constructs
pCGN4055 is digested with HindIII/PstI and the T7
5'/GUS/psbA 3':T7 3' expression construct cloned into a
HindIII/PstI digested vector designed for integration of
chimeric genes into the tobacco plastid genome by
homologous recombination. The resulting construct is
designated pCGN4276 (Figure 2). Bacterial cells comprising
the pCGN4276 construct have been deposited at the American
Type Culture Collection (ATCC), Rockville, 1~ (ATCC#69518).
The homologous recombination vector, plasmid
OVZ44B, contains a streptomycin/spectinomycin selectable
marker gene, aadA, expressed from the tobacco 16S rRNA
promoter, rrn (the rrn promoter and aadA regions are
described in Svab and Maliga (1993; supra), and having an
approximately 150bp rpsl6 3' termination region (sequence
of the rpsl6 gene is reported by Shinozaki, K. et al.,
supra). Similarly, a HindIII/BamHI fragment from pCGN4216
containing the T7/PHB/psbA3':T73' region is transferred as
a HindIII/SpeI fragment into HindIII/XbaI digested OVZ44B,
resulting in pCGN4295_
26
WO 95/16783 ~ ~ PCT/US94114574
...
The aadA selectable marker construct for plastid
transformation is present in OVZ44B on a tobacco
chloroplast genome fragment so that it is located just
upstream of the trnV locus in the intergenic region between
trnV and rpsl2, and such that at least lkb of chloroplast
genome DNA borders the aadA expression construct. The
plastid DNA bordering fragments provide regions for
homologous recombination to occur between the vector and
the target plastid DNA sequences. As the homologous
recombination site is present in the chloroplast inverted
repeat regions (IRA and IRB) (Shinozaki et al.,supra), two
copies of the transgene are expected per plastid genome
(Svab, et a1. (1990) supra).
D. Brassica Transformation Construct
In order to obtain a region of homology for
recombination into the genome of Brassica plastids, a
fragment comprising the rbcL gene which encodes the large
subunit of ribulose bisphosphate carboxylase is cloned from
Brassica plastid DNA. Plastid DNA may be isolated as
described by Doyle et a1 (Phytochem. Bull. (1987) 19:11-
15). Maps of the Brassica napus plastid genome (Warwick et
al. (1991) Theor. Appl. Genet. 82:81-92; Palmer et a1.
(1983) Theor. Appl. Genet. 65:181-189) indicate that the
rbcL locus is present on either a 4.3 or 4.8kb KpnI
fragment. To clone this fragment, the plastid DNA is
digested with Asp718 (same recognition sequence as KpnI)
and cloned into Asp718 digested BluescriptIIKS(-). DNA
from resulting clones is analyzed by Southern hybridization
using radiolabeled probe containing the rbcL encoding
region from tobacco. A clone, pCGN5034, containing an
approximately 4.3kb band which hybridizes to the labeled
clone is selected for further localization of the rbcL
gene. Following location of the rbcL gene by DNA sequence
analysis, appropriate regions for insertion of plastid
expression constructs, such as a PHB operon construct as
described above, are identified. Desirable regions are
those where insertion of the desired gene constructs does
not interrupt expression of native plasmid genes, and where
the inserted plastid constructs are flanked by regions of
27
~~~8~4
WO 95/16783 - PCT/US94/14574
homology to provide for homologous recombination by double
crossover into the Brassica plastid genome.
Example 3 Agrobacterium-Mediated Nuclear Plant
Transformation
Binary constructs for nuclear expression are
transformed into cells of an appropriate Agrobacterium
strain, such as LBA4404 (Ooms et al. (1982) Plasmid 7:15-
29) or EHA101 (Hood et a1. (1986) J. Bacteriol. 168:1291-
1301) as per the method of Holsters et al. (Mol. Gen.
Genet. (1978) 163:181-187) for use in preparation of
transgenic plants.
Transgenic tobacco plants are obtained by
Agrobacterium-mediated transformation as described by
Horsch et a1. (Science (1985) 227:1229-1232). Transgenic
Brassica plants are obtained by Agrobacterium-mediated
transformation as described by Radke et a1. (Theor. Appl.
Genet. (1988) 75:685-694; Plant Cell Reports (1992) 11:499-
505). Transformation of Gossypium hirsutum L. cotyledons
by co-cultivation with Agrobacterium tumefaciens has been
described by Firoozabady et al., Plant Mol. Bio. (1987)
10:105-116 and Umbeck et al., BiolTechnology (1987) 5:263-
266.
Other plant species may be similarly transformed using
related techniques. Alternatively, microprojectile
bombardment methods, such as described by Klein et a1.
(BiolTechnology 10:286-291) may also be used to obtain
nuclear transformed plants comprising the viral single
subunit RNA polymerise expression constructs described
herein. Cotton transformation by particle bombardment is
reported in WO 92/15675, published September 17, 1992.
For example, the binary vector, pCGN4026, harboring a
T7 RNA polymerise gene with chloroplast targetting signal
sequences is introduced into A. tumefaciens LBA4404 and the
resulting Agrobacterium strain used to generate transgenic
tobacco lines expressing plastid localized T7 RNA
polymerise activity. The chimeric T7 RNA polymerise gene
lacking its ATG start codon is expressed from a d35S
promoter as a translational fusion to the tobacco small
28
WO 95/16783 PCT/US94I14574
...
subunit (SSU) transit peptide (TP) and first 12 amino acids
of mature SSU. Due to the more or less constitutive nature
of the 35S promoter T7 polymerase activity is expected to
be expressed in plastids in most all tissues.
Similarly, binary plasmid vectors pCGN4225, pCGN4226,
pCGN4232 and pCGN4233 are introduced into A. tumefaciens
EHA101 and the resulting Agrobacterium strains used to
generate transgenic Brassica plants, such as B. napus var.
A112, expressing plastid localized T7 RNA polymerase
activity. As the napin and phaseolin promoters providing
for expression of the T7 RNA polymerase in these constructs
provide for preferential expression in plant seed tissues,
T7 polymerase activity is expected to be expressed mainly
in the seed tissue plastids.
Example 4 Analysis and Selection of Polymerase Expressing
Transgenic Plants
Approximately twenty kanamycin resistant tobacco lines
resulting from transformation with pCGN4026 are generated
and screened for T7 RNA polymerase activity. T7 RNA
polymerase assays are carried out by measuring
incorporation of 32P-UTP into pBluescriptII KS(-)
transcripts in a reaction containing 40 mM Tris-HC1 pH 7.9,
8 mM MgCl2, 5 mM dithiothreitol, 4 mM spermidine-HC1, 0.4
mM each ATP, GTP, CTP, and UTP, and 2 ~.Ci 32p-gyp.
Detectable T7 RNA polymerase activity in the leaf tissue of
primary transformants (T1 generation) varied from 0.01 to
2.25 units per ~g total protein.
Kanamycin segregation assays are conducted on the
seeds of all the positive lines to determine segregation
ratios. Three lines, 4026-3, 4026-9, and 4026-11,
segregated 3:1 for the resistance gene, indicating that the
T7 polymerase construct was inserted at a single
chromosomal location. 4026-3, 4026-9, and 4026-11 were
self pollinated to create homozygous lines. A T7 RNA
polymerase assay on leaves from the homozygous lines
demonstrated that 4026-3 had the lowest level of T7 RNA
polymerase activity while 4026-9 and 4026-11 had higher
levels of polymerase activity. See Table I below.
29
WO 95/16783 : PCT/CTS94/14574
Table 1
T7 Polvmerase Activity in Homozvaous 4026 Tobacco Lines
Tobacco Specific Activity
Line !units T7 RNAP*/mcr protein)
4026-3 0.3
4026-9 1.0
4026-11 0.8
*Unit values for T7 RNA polymerase are derived by
comparison to a purified enzyme preparation using the assay
described above.
Tobacco lines expressing higher levels of plastid-
targetted T7 RNA polymerase were observed to have a
crinkled leaf morphology. It is possible that excess
polymerase is detrimental to the plastids either by
providing some level of non-specific transcription or by
negatively interacting with the plastid transcriptional
complex. If such is the case, addition of a T7
transcriptional unit could further compromise the viability
of the plastid organelles. It is noted that the low T7 RNA
polymerase producing line, 4026-3, never exhibited a
crinkled leaf phenotype until its plastids were transformed
with the T7-GUS transcriptional unit (described below).
Example 5 Plant Plastid Transformation Methods
Tobacco plastids are transformed by particle gun
delivery of microprojectiles (Svab and Maliga (1993),
supra). Since integration into the plastid genome occurs by
homologous recombination and the target site is near the
ribsomal RNA operon in the inverted repeat, two copies of
CA 02178645 2004-10-O1
the transgene are expected per plastid genome (Swab et a1.
(1990) supra).
Tobacco seeds (N. tabacum v. Xanthi N/C) wildtype and
homozygous for pCGN4026 T-DNA are surface sterilized in a
50% chlorox solution (2.5% sodium hypochlorite) for 20
minutes and rinsed 4 times in sterile H20. The seeds are
then plated asceptically on a 0.2X MS salts media and
allowed to germinate. The seedlings are grown on agar
solidified MS media with 30g/1 sucrose (Murashige and Skoog
(1962) Physiol. Plant 15:493-49?).
Tungsten microprojectiles (l.OEtm) are coated with DNA,
such as the T7/GUS expression construct, pCGN4276, and the
coated microprojectiles used to bombard mature leaves,
placed abaxial side up on RMOP media (MS salts, 1 mg/1 BAP,
0.1 mg/1 NAA, 30 g/1 sucrose and 0.7% phytager) (Svab et
a1. (1990) supra) using the-Bio-Rad PDS 1000/He bombardment
system (Sanford et a1. (1991) Technique 3:3-16; Klein et
a1. (1992) Bio/Technology 30:286-291). Development of
transformed plants on RMOP media supplemented with 500 mg/1
spectinomycin dihydrochloride and subsequent subcloning on
the same selective medium is conducted according to Svab et
al. (1990); Svab and Maliga (1993); supra). Selected
plants are rooted in MS media containing 1 mg/1 IBA, 500
mg/1 spectinomycin dihydrochloride and 0.6% phytagarT"".
Several homoplasmic non-T7 RNA polymerase producing
'Xanthi' 4276 lines were created in parallel as controls.
No fertile transformants were obtained from attempts to
transform plastids of the high level T7 RNA polymerase
producing line 4026-9 with the pCGN4276 T7/Gus expression
construct. A possible explanation for the lack of plastid
transformants from 4026-9 is that high level expression of
the plastid transgene poses a metabolic drain on the
organelle, as has been reported to occur in E. coli when a
T7 expression system is used.
ExamD a 6 Analysis of Plants for.Expression from a
Plastid T7 Promoter Construct
Following plastid transformation as described above,
two independently isolated homoplasmic lines in the T7 RNA
31
CA 02178645 2004-10-O1
polymerase producing background of 4026-3 were generated
and designated as 4026-3 clones 1 and 2. Homoplasmy was
demonstrated by Southern blot analysis as shown in Figure
2. A schematic of pCGN4276 construct and a representation
of incorporation into the tobacco plastid genome are shown
at the top of Figure 2. The upper line represents the
incoming DNA donated from pCGN4276 and the lower line
represents the integration target region. Expected sizes
for BamHI fragments are shown for the incoming DNA as well
as for wild type DNA. As there is no BamHI site on the 5'
end of the incoming DNA the combined size of the two
chimeric genes is indicated. Also shown are the location of
the two probes, A and B, used for Southern analysis.
4276/4026-3 clones 1 and 2 represent two independent
spectinomycin resistant transformants in N. tabacum var.
'Xanthi' line 4026-3. 4276/Xanthi represents one
spectinomycin resistant transformant in wild type N.
tabacum var. 'Xanthi'. The control DNA is from
untransformed Xanthi. DNA molecular weight markers are in
kilobase pairs.
Southern analysis is shown at the bottom of Figure 2.
Total plant cellular DNA is prepared as described by
Dellaporta et a1. (1983) Plant Mol. Biol. Rep. 1:19-21).
Approximately 2 )tg DNA for each sample is digested with
BamHI, electrophoresed through 1% agarose, transferred to
Nytran+T"'' and the filters hybridized v~ith alpha 3~-dCTP
labeled probe. Probe A demonstrates degree of
transformation (homoplasmy) and probe B reveals presence of
the GUS gene. Hybridization with probe A demonstrates that
the introduction of a new BamHI site from the transgene
changes the size of the probed fragment from 3.3kb to 0.8kb
in the transplastosomic lines. The degree of homoplasmy is
measured by the presence of a residual 3_3kb band. Only a
trace of the wild type 3.3kb band is observed in the
original blots, and the level is not detectable in the
reproduction of this blot shown at Figure 2. It is not
apparent if the trace 3.3kb band represents plastids in
which the initial copy of the transgene was not duplicated
32
2i7864~
WO 95/16783 PCT/US94/14574
onto the other inverted repeat, or if a small population of
untransformed plastids is present.
To measure T7 RNA polymerase dependent transcription
of the GUS gene, total cellular RNA samples from leaf
tissue of one clone each of 4276/'Xanthi' and 4276/4026-3
are subjected to Northern analysis with a GUS specific
probe. Total plant RNA was prepared as described by Hughes
et al. (1988) Plant Mol. Biol. Rep. 6:253-257. A single
abundant mRNA band of the expected size (2.lkb) is present
only in the 4276/4026-3 RNA sample. This indicates that
transcription of the GUS transgene is dependent on the
presence of T7 RNA polymerase. To demonstrate that T7 RNA
polymerase does not affect the levels of other transcripts
in the two genetic backgrounds a duplicate filter is
hybridized with an aadA transgene specific probe and the
GUS filter is rehybridized with a psbA specific probe. The
results demonstrate that the genetic background has no
affect on the relative transcript levels of either the
linked aadA transgene or the unlinked psbA gene.
Curiously, an aadA-specific transcript of l.3kb is present
in both lanes in addition to the expected 0.9kb band. This
may be the result of either the aadA transcript not being
processed within the boundaries of the rpsl6 3' or
initiation of transcription occurring upstream within the
GUS coding region. The intensity of the hybridization
signals for each of the mRNAs was quantitated using an
Ambis autoradiography scanner and the results indicate that
the GUS signal is approximately five-fold higher than the
aadA combined signal and five-fold lower than the psbA
signal.
To demonstrate that the T7 GUS transcripts are
translated in the transgenic plastids, B-glucuronidase
specific activity was measured in various tissues. GUS
assays are conducted as described by Jefferson et al. (F.1~0
J. (1987) 6:3901-3907). The results of these assays in
various tissues from a 4276/4026-3 clone are shown below in
Table 2.
33
~Il$6~.5
WO 95/16783 PCTIUS94/14574
Table 2
B-g~lucuronidase Activitv in Transolastomic Tobacco
4276 B-glucuronidase
Background 's a Specific Activity*
LnMoles MU/min/mg protein)
4026-3 leaf 3000
4026-3 stem 107
4026-3 root 17
4026-3 petal 759
4026-3 seed 4
Xanthi leaf 0.14
Xanthi stem 0.36
Xanthi root 1.2
Xanthi petal 0.09
Xanthi seed 0.08
°iiu, ilu~rescenL reacr.ivn ena proaucL 4-meznyl umoelli=erone;
values based on the average of triplicate tissue samples.
The above results indicate that GUS activity is
expressed in all tissues and is highest in leaves and
flower petals. Furthermore, expression is dependent on the
presence of T7 RNA polymerase since no GUS activity is
observed in the Xanthi background. By comparison to
activity noted in leaf, stem, and petal, GUS activity in
34
WO 95/16783 ~ PCT/US94/14574
~..
developing seed tissue is close to the background level
observed for the 4276/Xanthi tissues. The activity seen in
root tissue is also low but well above background. GUS
activity has also been assayed in leaf and root tissue of a
second 4276/4026-3 clone. The same relationship between
the level of expression in these two tissues as was
observed in the first clone is seen in the leaf and root
tissues of the second clone.
The level of GUS mRNA accumulation and i3-glucuronidase
activity observed in leaf tissue is comparable to levels
previously described for tobacco having a psbAS'-GUS-psbA3'
plastid transgene (Staub and Maliga (1993) EM80 J. 12:601-
606). By comparison of these results, the levels of iS-
glucuronidase in the above described tobacco plants is
estimated to be approximately 1.5-2~ of the total soluble
protein in these plants. Furthermore, it appears that the
level of translational stimulation by the phage mRNA leader
is similar to that of the psbA mRNA leader under conditions
shown to be optimal for the psbA leader, i.e. fully
illuminated leaf tissue (Staub and Maliga, supra). Thus,
even with the relatively low level of T7 RNA polymerase
activity measured in the 4026-3 transgenic plant, the level
of mRNA produced from the plastid T7-transgene is as high
as that produced from the psbA promoter, which has been
reported to be one of the strongest endogenous plastid
promoters (Rapp et a1. (1992) J. Biol. Chem. 267:21404-
21411).
The lower activity levels in root and developing seed
tissue can be explained in part by decreased plastid genome
copy number per cell in these tissues. In addition, the
psbA3' region in the plastid expression construct has been
reported to provide a six-fold increase in mRNA
accumulation during light-induced development of
photosynthetically active chloroplasts (Deng et a1. (1988)
F.M80 J. 7:3301-3308). Different expression levels of the
nuclear-encoded T7 RNA polymerase in various tissues could
also be a factor in the f~-glucuronidase levels observed.
The CaMV 35S promoter which drives expression of the T7
polymerase has been reported to have greater active in
WO 95/16783 r~- PCT/US94/14574
leaves and roots than in late developing seeds, the stage
at which the above seed samples were analyzed.
In contrast to non-green root and seed tissues, i3-
glucuronidase accumulation in the upper expanding portion
of the flower corolla (post-anthesis) approaches that found
in leaf. It has been reported that neither plastid
ribosomes nor plastid-specific translational activity can
be detected in fully matured chromoplasts of bell pepper
fruit and sunflower petals as compared to leaf tissue
(Kuntz et a1.(1989) Mol. Gen. Genet. 216:156-163). A lack
of ribosomes has also been reported in the fully mature
daffodil corolla even though roughly 500 chromoplasts are
present in each cell (Hansmann et a1. (1987) J. Plan t
Physiol. 131:133-143). Thus, although the translational
apparatus may be reduced to a low level in chromoplasts, we
are able to detect high levels of expression from the
T7/GUS construct in petals, although the levels are 4-5
fold lower than the levels seen in leaves. Messenger RNAs
for certain plastid genes, psbA in particular, have been
shown to decrease at least 4 to 5-fold in fully mature
chromoplasts of bell pepper fruit and sunflower petals (33)
as well as in tomato fruit. Furthermore, the lower level of
trans-activating T7 RNA polymerase in petal tissue may be
explained by reduced activity of the 35S promoter in the
expanding portion of the flower corolla. Thus, the lower
level of GUS activity compared to the leaf value may be a
result of differential mRNA accumulation caused by the
psbA3', and/or a decrease in transcriptional or
translational activity.
Fxample 7 Inheritance Studies
To demonstrate that the GUS reporter gene behaves as a
maternally inherited character, several crosses were
conducted. Seed derived from test and self-crosses were
germinated and the seedlings scored for iS-glucuronidase
activity by staining with the histochemical substrate X-
gluc. A self-cross for 4026-3/4276 resulted in 129
positives and no negatives as expected since the nuclear
encoded polymerase is homozygous. The wild type
36
CA 02178645 2004-10-O1
nucleus/4276 plastid (female) X 4026-3 nucleus
(homozygous)/ Xanthi plastid (male) cross resulted in 192
positives and no negatives while for the reciprocal cross
there were no positives in 119 seedlings. A cross between
homozygous 4026-3/4276 (female) and wild type 'Xanthi' male
resulted in 135 out of 135 seedlings tested having a
slightly less blue phenotype than the seedlings from the
female parent implying a T7 polymerase dosage effect in the
heterozygotes. The reverse cross yielded no positives for
the 143 seedlings examined. These data confirm that the
reporter gene is maternally inherited in all crosses and
can be successfully activated by sexual transmission of an
active gene encoding plastid-targeted T7 RNA palymerase.
All publications and patent applications mentioned in
this specification are indicative of the level of skill of
those skilled in the art to which this invention pertains.
25 Although the foregoing invention has been described in
some detail by way of illustration and example for purposes
of clarity of understanding, it will be obvious that
certain changes and modifications may be practiced within
the scope of the appended claim.
37
