Note: Descriptions are shown in the official language in which they were submitted.
WO 95/13376 ;~ ~ 8 ~ 5 ~i 1 PCT/IIS94/13066
.
-- 1 --
GENE TllERaPY VECTOR FOR TEIE 'rR~~ ~T OF ~O~ OR
Dl~ lV~: RED BI,OOD CELI- PRODUCTION
p- ~ ;r OF TEI~ INVENTION
Field of fhl~ Tnvention
The present invention relates to a novel approach
to the treatment of low or defective red blood cell
production. In particular, the invention provides for
the sustained systemic productlon of erythropoietln
following the modification of target cells by gene
transfer .
Desl rlption of the Baekcrround
Erythropoiesis, the production of red blood
cells, occurs continuously to offset cell destruction.
Erythropoiesis is a precisely controlled physiological
mechanism enabling suf f icient numbers of red blood
cells to be avallable for proper tissue oxygenatlon,
but not so many that the cells would impede
circulation. The formation of red blood ceLls occurs
in the bone marrow and is under the control of the
hormone, erythropoietin.
Erythropoietin is normally present in very low
concentrations in plasma when the body is in a healthy
state wherein tissues receive sufficient oxygenation
from the existing number of erythrocytes. This normal
low concentration is sufficient to stimulate the
replacement o red blood cells which are naturally
lost through aging.
The amount of erythropoietin in the circulatory
system is increased under conditions of hypoxia when
oxygen transport by blood cells to tissue is reduced.
E~ypoxia may be caused by loss of large amounts of
blood due to h -rrhAge, destruction of red blood
WO 9~/13376 ~ PCT/US94/13n66
cells by over-exposure to radiatlon, reduction in
oxygen intake due to high altltudes or prolonged
unconsciousness, or various forms of anemia. In
response to tissues undergoing hypoxic stress,
5 erythropoietin increases red blood cell prorillrt ~ nn by
8t~-l1At~ng the conversion of precursor cells in the
bone marrow into erythroblasts. The erythroblasts
subsequently mature, synthesize hemoglobin and are
released into the circulatory system as red blood
10 cells. When the number of red blood cells in
circulation is greater than needed for normal ~issue
oxygen requirements, erythropoietin in circulation is
decreased .
Because erythropoietin is essentlal in the
15 process of red ~lood cell formation, the hormone is
useful in the treatment of blood disorders
characteri~ed by low or defective red blood cell
production. While the in~ection of re~ '~nAntly
produced human erythropoietin is a proven therapy for
20 the treatment of blood disorders, it would be
advantageous to enhance the endogenous production of
erythropoletln in a patient or l ~ An sub~ect .
S~rMMARY OF TEIE: INVli NTION
The present invention provides, for the flrst
time, the successful development of a method for the
enhancement of red blood cell production by gene
30 therapy. The invention demonstrates that expresslon
vectors can be constructed uslng an expresslon control
sequence and an erythropoietin gene, operatlvely
llnked to the control sequence and capable of
expression ln transfected target cells, wherein the
35 nucleic acid construct is capable of eliciting the
WO 95/13376 21~ 3 ~1 PCT/USg4/13066
- 3 -
S'-'
expresslon of erythropoietin sufficlent to increase
red blood cell production.
Having elucidated the means for the er,hancement
of red blood cell production by increasing the
5 presence of erythropoietin ~n vivo, the present
invention supports the development of gene therapy
techniques for the treatment of low or defective red
blood cell production. Also comprehended by the
invention are pharmaceutical compositions involving
10 effective amounts of the nucleic acid constructs
together with a pharmaceutically acceptable delivery
vehicle including suitable diluents, buffers and
ad~uvants. The compositions can further include a
carrier capable of promoting target cell uptake of the
15 nucleic acid constructs. Such carriers include
liposomes, protein complexes and viral carriers
suitable for gene transfer techniques.
We have found no previous report of the use of
target cells for the purpose of erythropoietin gene
20 transfer and subsequent ~n vivo production of
re~ ; nAnt erythropoietin wlth a demonstrated
rhA~-r~-logical response. In a speciflc embodiment,
the invention involves the development of myoblast-
mediated gene therapy for the in vivo production of
25 erythropoietin. ~rhe invention further describes the
use of expression vectors involving non-specific and
muscle-specific promoters, and the suitability of such
vectors for generating stable myogenic cell lines
which, following introduction into skeletal muscle,
30 can elicit sufficient production and secretion of
erythropoietin to present a physiologically
significant systemic response.
WO 95/13376 2 ~ 8 3 ~ri 1 PCT/US94/13n66
--; 4 --
. ~ .
BRIEF DESCRIPTION OF TEIE DRAW~NGS
Figure 1 illustrates a DNA sequence for erythropoietin.
DETAILED Dl!:SCRIPTION OF T~E INVENTION
Gene therapy for anemia comprises the delivery of
a gene for erythropoietin to cells, either ln v~vo or
10 in vitro. Delivery and expression of the gene results
in the production of erythropoietin in a
physiologically-functional amount 3ufficient to
increase red blood cell production. The
erythropoietin gene used in the present invention, is
15 a nucleic acid sequence which encodes a functional
erythropoietin protein. Thus, variations in the
actual sequence of the gene can be tolerated provided
that functional erythropoietin is expressed. An
erythropoietin gene used in the practice of the
20 present invention can be obtained through conventional
methods such as DNA cloning, artificial construction
or other means.
Gene transfer of the erythropoietin gene in
accordance with the present invention can be
25 accomplished by any suitable gene therapy technique
involving a nucleic acid construct or recombinant
vector containing a DNA sequence that encodes
erythropoietin. The nucleic acid constructs generally
will be provided as an expression cassette or - --
30 expression control system which will include asoperatively linked components in the direction of
transcription, a transcriptional initiation region,
the erythropoietin nucleic acid sequence of interest
and a transcriptional termination region wherein the
35 transcriptional regulatory regions are fllnc~ i on~ l in a
l; An host . It may be preferred that a
_ _ . . . .
WO 95/13376 '2 1 ~ 3 ~ 1 ; PC'r/US94113066
", -- 5 --
' !
re~ ~ nAnt vector construct not become lntegrated
into the host cell genome of the patient or 7 ~ An
sub~ect, and therefore, it may be introduced into the
host as part of a non-integrating nucleic acid
construct. A coding sequence is "operatively linked
to" or "under the control of " the expression control
system in a cell when DNA polymerase will bind the
promoter sequence and transcribe the erythropoietin-
encoding sequence into mRNA. Thus, the nucleic acld
construct includes a DNA sequence which encodes a
polypeptide directly responsible for a therapeutic
effect, as well as a sequence ~s) controlling the
expresxion of the polypeptide.
The nucleic acid constructs in the invention
include several forms, depending upon the intended use
of the construct. The transcriptional and
translational initiation region ~also herein referred
to as a "promoter"), preferably comprises a
transcriptional initiation regulatory region and a
translational initiation regulatory region of
untranslated 5 ' sequences . In alternate embodlments,
the promoter may be modified by the addition of
sequences, such as ~nh~n~rs~ or deletions of
nonessential and/or undesired sequences. The promoter
will have a DNA sequence suEficiently similar to that
of a native promoter to provide for the desired
specificity of transcription of the erythropoietin DNA
sequence. The promoter may include natural and
synthetic sequences as well as sequences which may be
a combination of synthetic and natural sequences. It
will also be appreciated by those skilled in the art
that the expression control sequence may contain a
suppresser sequence to regulate the expression of
erythropo iet in .
For the transcriptional initiation region, or
promoter element, any region may be used with the
2~3551 ~ .
WO 95/13376 PCT/US94113066
-- 6 --
proviso that it provides the desired level of
tr2nscription of the erythropoietin nucleic acid
sequence. The transcrlptional initiation region may
be native to or homologous to the host cell, and/or to
5 the DNA sequence to be transcribed, or foreign or
heterologous to the host cell and/or the DNA sequence
to be transcribed. By foreign to the host cell is
intended that the transcriptional initiation region is
not found in the host into which the construct
lO comprising the transcriptional initiatlon region is to
be inserted . By f oreign to the DNA sequence is
intended a transcriptional initiation region that is
not normally assoclated with the DNA sequence of
interest. Efficient promoter elements for
15 transcrlption initiation include the SV40 (simian
virus 40) early promoter, the RSV ~Rous sarcoma virus)
promoter, the Adenovirus ma~or late promoter and the
human CMV (cytomegalovirus) promoter.
Inducible promoters also find use with the
20 expression control sequences where it is desired to
control the timing of transcription. Examples of
promoters include those obtained from a ~-interferon
gene or those obtained from steroid hormone-responsive
genes. Such inducible promoters can be used to
25 regulate transcription of the transgene by the use of
external stimuli such as interferon or
glucocorticoids. Because the arrangement of
eukaryotic promoter elements is highly flexible,
combinations of constitutive and inducible elements
30 also can be used. Tandem arrays of two or more
inducible promoter elements may increase the level of
induction above baseline levels of transcription which
can be achieved when compared to the level of
induction above baseline achieved with a single
35 inducible element.
WO 95/13376 2 1 8 3 ~ 1 PCrlUS94113066
-- 7 --
Transcriptional enhancer ~ q may also be
included in the expresæion control seguence. The term
"transcriptional enhancer elements" includes DNA
seguences which are primary regulators of
5 transcriptional activity and which can act to increase
transcription from a promoter element. The
combination of promoter and enhancer element (s) used
in a particular expression cassette can be selected by
one skilled in the art to maximize specific effects.
lO Different enhancer elements can be used to produce a
desired level of transgene expression in a wide
variety of tissue and cell types. For example, the
human CMV immediate early promoter-enhancer element
can be used to produce high level transgene expression
15 in vivo.
Examples of other en_ancer elements which confer
a high level of transcription on linked genes in a
number of different cell types from many species
include enhancers from SV40 and RSV-LTR. The SV40 and
20 RSV-~TR are essentially constitutive. They may be
combined with other enhancers which have specific
effects, or the specific ~nh;ln~-Pr~ may be used alone.
Thus, where specific control of transcription is
desired, efficient ~nh~nC~r elements that are active
25 only in a tissue-, developmental-, or cell-specific
fashion are of interest.
Tandem repeats of two or more enhancer elements
or combinations of enhancer elements may signif icantly
increase erythropoietin expression when compared to
30 the use of a single copy of an enhancer element.
Fnh~ncl~r elements from the same or different sources
flanking or within a single promoter can in some cases
produce transgene expression in each tissue in which
each individual enhancer acting alone would have an
35 effect, thereby increasing the number of tissues in
which transcription is obtained. In other cases, the
W0 95/13376 2 1 8 ~ 5 5 1 PCrlUS94/13066 ~
-- 8 --
presence of two different enhan'cer elements results in
~;1 f.n.; ng of the enhancer e~fects . Evaluation of
particular combinations of enhancer elements for a
particular desired effect or tissue of expression is
within the level of skill in the art.
Gene transfer procedures are known to those
skilled in the art and include cell transformation
using calcium phosphate coprecipitation, lipofection
of the target cells with liposome/gene or lipid/gene
con 5ugates, plasmid-mediated transfer, DNA protein
complex-mediated transfer and viral vector-mediated
transfer. Viral vector transfer can include suitable
techniques such as transfer by recombinant retroviral
vectors, adenovirus vectors and adeno-associated virus
vectors . Thus, the present invention; n~ rl.o.c the use
of carriers to facilitate gene transfer, and different
carriers may be selected as appropriate to optimize
transfer to the desired cell-type which is targeted
for vector delivery. It will also be appreciated that
the various carriers may be selected or modified for
preferential uptake by the cell-type which is targeted
for vector delivery. For example, the carrier can
include a selected ligand to effectively target the
cells of interest. In addition, the vector may
contain one or more~targeting sequences, generally
located at both ends of the exogenous DNA sequence to
be expressed. Such a construct is useful to integrate
exogenous DNA into the target cell.
The cells targeted for gene transfer in
accordance with the present invention include any `'
cells to which delivery of the erythropoietin gene is
desired. While a variety of cells may be transfected,
it was determined that muscle cells are especially
appropriate targets for gene transfer and the
expression of physiologically active amounts of
WO 9S113376 2 1 ~ 3 ~ ~ 1 PCTll~S94113066
_ 9 _
erythropoletin. For the purposes of the present
invention, a physiologically active or acceptable
level of erythropoletin gene function refers to a
level of ln vivo erythropoietin manufacture and
5 function sufficient to cause an increase in red blood
cell production. Increased red blood cell production
can be readily determined by an appropriate indicator
such as detection of changes in hematpcrit levels.
The level of erythropoietin gene function sufficient
lO to cause an increase in red blood cell production can
readily be determined by a comparison of pretreatment
or baseline hematocrit level to the post-treatment
hematocrit level.
Cells or cell populations can be treated in
15 accordance with the present invention either ~n v~ vo
or ln vltro. For example, in in vivo treatments,
recombinant erythropoietin vectors can be administered
to the patient, preierably in a biologically
compatible solution or pharmaceutically acceptable
20 delivery vehicle. ~rhe dosages administered can vary
from patient to patient and will be determined by the
level of ~nhAnc~ of erythropoietin function
h~l~n~ ed against any risk of side effects . Monitoring
levels of transduction, erythropoietin expression
25 and/or the levels of red blood cells will assist in
selectlng and ad~usting the dosages administered.
In vitro transduction is also contemplated within
the present invention. Cell populations can be
removed from the patient, or otherwise be provided,
30 transfected with the erythropoietin gene in accordance
wlth the present invention, and then administered to
the patient. ~he transfected target cells may be
reintroduced by any suitable means, such as in~ection
or implantation, and the cells will typically be
35 delivered to target tissue of the same cell type as
the target cells. For example, muscle cells may serve
~1~3~51
WO 95/13376 - PCT/US94/13066
-- 10 --
as the target cells. Myoblasts can be isolated and
~-nlr~ ted in vltro, transfected with the
erythropoietin vector, and the transformed cells are
then relntroduced into muscle tissue. The unique
5 biology of muscle cells allows the transfected cells
to form new myofibers or fuse into old ones. It was
discovered that the transplanted nuclei are sustained
and active for prolonged periods of time in a normal,
mult;nl~r1e~te~ environment with little or no nuclear
10 replication for up to six months. Moreover, it was
discovered that the muscle cells will sustain the
production and secretion of the erythropoietin protein
sufficient to result in increased red blood cell
production .
The present invention is also amenable to the use
of homologous recombination genome-modification
methods. E~omologous recombination is a technique
originally developed for targeting genes to induce or
correct mutations in transcriptionally active genes
(Kucherlapati, Prog. in Nucl_ Ac~d Res. and ~ol. Biol.
36:301 (1989) ) . The basic technique was developed as
a method for introducing specific mutations into
specific regions of the l; ~n genome (Thomas et
al., Cell. 44:419-428, 1986; Thomas and Capecchi,
Cell. 51:503-512, 1987; Doetschman et al., Proc. Natl.
Acad. SCl. 85:8583-8587, 1988) or to correct specific
mutations within defective genes (Doetschman et al.,
Nature. 330:576-578, 1987).
Through homologous recombination, a piece of DNA
that one desires to insert into the genome can be
directed to a specific region of the gene of interest
by attaching it to "targeting DNA". "Targeting DNA"
is DNA that is complementary (homologous) to a region
of the genomic DNA. When two homologous pieces of
single stranded DNA (i.e., the targeting DNA and the
genomic DNA) are in close proximity, they will
WO 95/13376 ~18 3 5 51 PCT/USg4ll3066
-- 11 --
hybridize to form a double stranded helix. Attached
to the targeting DNA is the DNA sequence that is to be
inserted into the genome.
Small pieces of targeting DNA that are
5 complementary to a specific region of the genome are
put in contact with the parental strand during the DNA
replication process. It is a general property of DNA
that has been inserted into a cell to hybridize and
therefore recombine with other pieces of endogenous
10 DNA through shared homologous regions. If this
complementary strand is attached to an oligonucleotide
that contains a mutation or a different sequence of
DNA, it too is incorporated into the newly synthesized
strand as a result of the recombination. As a result
15 of-the proofreading function, it is possible for the
new sequence of DNA to serve as the template. Thus,
the transfered DNA is incorporated into the genome.
If the sequence of a particular :gene is known, a
piece of DNA that is complementary to a selected
20 region of the gene can be synthesized or otherwlse
obtained, such as by appropriate restriction of the
native DNA at specific recognition sites bounding the
region of interest. This piece serves as a targeting
sequence upon insertion into the cell and will
25 hybridize to lts homologous region within the genome.
If this hybridization occurs during DNA replication,
this piece of DNA, and any additional sequence
attached thereto, will act as an Okazaki fragment and
will be backstitched into the newly synthesized
30 daughter strand of DNA.
In the present invention, attached to these
pieces of targeting DNA are regions of DNA will
- interact with the nuclear regulatory proteins present
within the cell and, optionally, amplifiable and
35 selectable DNA markers. Thus, the expression of
erythropoietin may be achieYed not by transfection of
WO 95/13376 ~ l 8 3 55 1 PCr/lTS94113066
-- 12 --
DNA that encodes the erythropoietin gene itself, but
rather by the use of targeting~ ~NA (regions of
homology with the endogenou$ gene of interest) coupled
with DNA regulatory segments that provide the
5 endogenous erythropoletin gene with recognizable
signals for transcription. With this technology, it
is possible to express and to amplify any cognate gene
pre~ent within a cell type without actually
transfecting that gene. In addition, the expression
lO of this gene is controlled by the entire genomic DNA
rather than portions of the gene or the cDNA, thus
improving the rate of transcription and efficiency of
mRNA processing. Furthermore, the expression
characteristics of any cognate gene present within a
15 cell type can be modified by appropriate insertion`of
DNA regulatory segments and without inserting entire
coding portions of the gene of interest.
In accordance with the present invention,
homologous recombination provides new methods for
20 expressing a normally transcriptionally silent
erythropoietin gene, or for modifying the expression
of an endogenously expressing gene. The
erythropoietin gene will be provided with the
necessary cell-specific DNA sequences (regulatory
25 and/or amplification segments) to direct or modify
expression of the gene within the muscle cell_ The
resulting DNA will comprise the DNA sequence coding
for erythropoietin directly linked in an operative way
to heterologous (for the cognate DNA sequence)
30 regulatory and/or amplification segments. A positive
selectable marker is optionally included within the
construction to facilitate the screening of resultant
cells. The use of the neomycin resistance gene is
preferred, although any selectable marker may be
35 employed. Negative selectable markers may,
optionally, also be employed. For instance, the
.. . , . ... .. . .. _ _ _ _ _ _ _ _ _ _ _
WO 95113376 2 1 8 3 ~5 1 PCTII~S94113066
13 --
He~pes Simplex Virus thymidine kinase (HSVtk) gene may
be used as a marker to select against randomly
integrated vector DNA. The fused DNAs, or existing
expressing DNAs, can be amplified if the targeting DNA
5 is linked to an amplifiable marker.
In the specific examples which follow, a myoblast
cell line was est~hl; shf~d which stably expressed the
human erythropoietin gene. The cell line was
l0 established by transfecting the cells with a plasmid
containing the erythropoieti~L gene driven by a CMV
promoter. The plasmid was derived from pCD vector l
(Okayama et al., A cDNA cloning vector that permits
expression of cDNA inserts in ~ n cells. Mol.
Cell. Bio. 3:280-289, 1993) as described in the
following examples. Genes encoding erythropoietin are
described in United States Patent Number 4, 703, 008
issued October 27, 1987, and entitled DNA Sequences
Encoding Erythropoietin, and Figure la-d. The plasmid
20 included a gene for neomycin resistance such that
transformed cells could be selected by antibiotic
resistance. After the expansion of 23 randomly
selected clones, the clones were screened for the
secretion of erythropoietin into the culture media by
Western blot and radio~ Rsay.
2183~5i
WO 95/13376 PCT/US94113066
-- 14 --
Table 1~L
Erythropoietln (EPO) Ex~prèssion in Transformed
Myoblasts as Determined by RIA
C2 cell clone Erythropoietin
(units/ml)
60k, EPO2, #6, 1/14 4. 9
60k, EPO1, #5, 1/11 28.7
30k, 7, 1/11 0.16
60k, EPO1--2, #1, 1/11 11.8
60k, EPO1, #4, 1/19 2.37
60k, 3a, #6, 1/11 ~ 1.27
120k, 4, 1/11 0.38
60k, EPO1-1, #1, 1/11 2. 6
60k, EPO1, #10, 1/11 2.17
60k--2, EPO1, #10, 1/11 22.8
60k--2, EPO1, #8, 1/11 2.3
60k, EPO1, #8, 1/11 0.18
As illustrated in Table 1, twelve clones had
measurable erythropoietin production. The assay
involved a typical RIA procedure and was performed
substantially in accordance with the method described
10 by Egrie et al., .Journal of rznrnunolo~ical Nethods,
99:235-241 (1987). Values for erythropoietin levels
in the media of the positive clones ranged from 0.18
to 28 l~nits per ml. This represented a
production/secretion range of approximately 2 x 1o-8
15 to as much as 5 x 10-7 Units per cell per hour
(assuming linear synthesis and secretion and no
significant decay of activity) .
The present invention demonstrates the efficacy
of gene transfer to obtain sustained in v~vo
20 production of a therapeutic polypeptide, such as
21~3~1
WO 95113376 - PCr/US94113066
-- 15 --
erythropoietin, at levels sufficient to enhance red
blood cell production. It will be appreciated by
those skilled in the art that refinements in the
selection of promoter and enhancer genes will Yerve to
optimize the e~pression of erythropoietin in the
transfected target cells. For example, it is also
within the present invention to use muscle-specific
expre3sion control sequences for high level
recombinant protein expression ln transformed muscle
cells. High activity promoter and erhancer cassettes
can be used to intensify recombinant gene expression.
Such promoters will increase the levels of therapeutic
re, ~ n~nt proteins synthesized and secreted by both
newly formed myofibers as well as muscle fibers that
contain a mixture of donor and recipient myonuclei.
The ma ~or contractile proteins of thin and thick
:Eilaments (e.g., alpha-actins, troponln C, myosin
heavy chains, as well as several muscle enriched
enzymes, such as creatine kinase and carbonic
anhydrase III) all have genes that are expressed at
high levels in muscle. Promoters and enhancers of
most of these genes have been the sub ~ects of intense
investigation and analysis (reviewed in Bishopric, et
al., The molecular biology of cardiac myocyte
hypertrophy p. 399-412. In L.EI. Kedes and F.E.
Stockdale [ed. ] . Cellular and Molecular E!iology of
Muscle DevelopmeDt. vol. 93, Alan R. Liss, Inc. New
York 1986; and Wade, et al., Developmental regulation
of contractile protein genes p. 179-188 . [ed. ], Annu.
Rev. Phys~ol. vol. 51, Annual Reviews, Inc. Palo
Alto, 1989). Muscle-specific gene e~pression is
usually associated with muscle-specific transcription
factors including members of the MyoD family
(Weintraub, et al., The myoD gene family: nodal point
during ~pe~-~ f i ~tion of the muscle cell lineage .
Science. 251:761-766, 1991) and the MEF-2 site binding
2183~1
WO 95/13376 PCT/US94/13066
- 16 --
factors (Cser~esi, P. and E.N. Olson Myogenin lnduces
the myocyte-speclflc enhanceriblnding factor MEF-2
in~el~elldently of other muscl~e--specific gene products.
Molecular And Cellular ~loiogy. 11:4854-62, 1991; and
5 Olson, et al., Molecular control of myogenesis:
antagonism between growth and differentiation. Mol.
Cell . Biochem. 104 :1-2, 1991. ) . The approprlate
selectlon and combination of vector elements will
provlde for optlmal regulation of muscle cell gene
10 expression and sustained high levels of expresslon of
recomblnant genes lntroduced lnto muscle cells.
A number of muscle-speclfic genes have been
cloned, and the promoters analyzed: these lnclude
skeletal actln, cardiac actin, Troponln C fast,
15 Troponin C slow and Troponin I slow, as well as beta
and gamma cytoskeletal actins. Other muscle specific
promoters that have been the sub~ect of detailed
analysis include creatine kinase, myosin light chains
and various myosin heavy chain genes as well as
20 Troponins I, T and C. Detailed analyses of such
enhancer and promoter regions that provide muscle
speclflcity are available, as illustrated by the
following brief summary.
Skeletal C~-acti n, The tissue speclfic distal
25 promoter of the human skeletal a-actin gene ~-1282 to
-708) induces transcription in myogenic cells
approximately 10-fold and, with the most proximal
promoter domain (-153 to -87), it synergistically
lncreases transcrlptlon 100-fold (Muscat, et al.,
30 Multiple 5 ' flanking regions of the human skeletal
actin gene synergistically modulate muscle specific
gene expression. Nol. Cell Biol. 7:4089-4099, 1987)
A short fragment of the distal promoter, the distal
regulatory element (DRE) from -1232 to -lI77,--
35 functions as a muscle-specif ic composite enhancer
(Muscat, et al., The human skeletal c~-actin gene is
. . . _ _ _ _ _ _ . . . _ _ _ _ _ _ _ . _ _ . _ . .
WO 95/13376 2 1 % 3 ~ 1 PCT/US94113066
-- 17 --
regulated by a muscle-specific enhancer that binds
three nuclear factors.
~ ;.r~i~s,c a-actln: The cardiac a-actln gene is the
fetal isoform of a-actin in rodents and human muscle,
5 ~ut it does not express after birth in rodents. The
down regulation appears to be dependent on nucleotide
sequences far downstream of the transcribed gene. In
adult human muscle, cardiac a-actin represents about
5~6 of the a-actin mRNA. The cardiac a-actin promoter
lO and endogenous gene are highly expressed in cell lines
derived from skeletal muscle. Thus, the cardiac actin
gene promoter and upstream elements are candidate
elements as positive regulators of muscle specific
gene expression in skeletal muscle cells.
SkeletA 1 F~ Ct-twitch Tro~on; n C ~ene: The
expression of the human fast-twitch skeletal muscle
troponin C (TnC or TnCfast) gene is muscle-specific
and confined to the class of fast-twitch myofibers in
adult skeletal muscle There is a strong classical
20 PnhAnr~Pr element within the 5 '-flanking sequence of
this gene which is required for the transcriptional
activity. A MEF-2 site alone in this enhancer is
sufficient to support high level transcription.
Interestingly, and unlike enhancers of o~her muscle
25 genes, the human fast TnC enhancer is muscle cell
specific, but only if linked to its own basal promoter
which is itself not muscle cell restricted. This
suggests that interactions between the enhancer and
the basal promoter of the human fast TnC gene are
30 responsible for its muscle restricted expression.
Slow-Twitch/c~r~ c Trop~nln C crene: At least
four separate elements cooperate to confer muscle
specific expression on the human slow twitch
skeletal/cardiac troponin C ~HcTnC or TnCslow) gene:
35 a basal promoter ~from -61 to -13) aug~ents
wo gs1l3376 2 ~ 8 3 ~ 5 ~ PCTIUS94/13066
-- 18 --
transcription 9-fold, upstream ma~or regulatory
ser~uences ~from -64 to -1318 and from -1318 to -4500)
augment transcription 18-fold ànd 39-fold,
respectively, and a positipr~`and orlentation
5 ~n~l.or~n~iont enhancer in the first intron (from +58 to
+1519) augments transcription 5-fold. This enhancer
increa~es muscle specific CAT activity when linked to
its own promoter elements or to a heterologous SV40
promoter, and the effects appear to be multiplicative
10 rather than additive. When the various promoter/CAT
chimeric plasmids are cotransfected with a MyoD
expression vector into 10 T 1/2 cells, constructs
carrying either the TnC promoter or the f irst intron
of the gene are >500-fold induced. Thus, each of
15 these regulatory regions is capable of responding
directly or indirectly to the myogenic determination
factor, MyoD. These observations suggest that
skeletal muscle expression of the HcTnC gene is
cooperatively regulated by the complex interactions of
20 multiple regulatory elements.
Slow-twitrh Tro~rn ~ n I ~ene: At least three
separate elements spaced over 1 kb of the 5 ' upstream
regions of the human slow twitch troponin I gene
(HsTnI) combine to synergistically regulate muscle
25 specific gene expression. A basal promoter lies
within 300 base pairs of the transcription start site
and two in~l~r~n~ipnt muscle specific enhancers 800 and
lO00 base pairs upstream. All three appear to be
re~uired for expression. These observations suggest
30 that muscle expression of the HsTnI gene is
cooperatively regulated by the complex interactions of
multiple regulatory elements.
cDNAs encoding the erythropoietin gene may be
35 cloned into a variety of in-frame expression vectors.
A non-muscle-specific beta-actin promoter, constructed
_ _ _ _ _ _ . _ _ _ _ = = .. . . .
2~ 83'S~1
WO 95113376 PCrlUS94113066
- 19 --
as a high level expresslon vector with neomycin
selection capacity, contains the promoter and first
intron of the human ~-actin gene, a neomycin
resistance gene, a bacterial origin and the SV40 late
region polyadenylation signal (Gunning, et al., A
human beta-actin expression vector system directs
high-level ~-CIlml-lAtion of antisense transcripts.
Proc. Natl. Acad. Scl. USA. 84:4831-5; 1987). The use
of such a construct fosters high level transcription
of inserted sequences in 1; iln cells .
The erythropoietin sequence may also be cloned
into an internally deleted human skeletal ~c-actin gene
promoter that carries high level muscle specific
expression. This construct carries an upstream
element (from -1282 to -1177) linked to its own
promoter from -153. This enhancer/promoter
combination may be inserted in the place of beta-actin
sequences to create a new muscle specific expression
vector with neomycin selectability (pHaSKApr-l-neo) .
Typically, the plasmid vectors are sequenced
after construction to insure in-frame accuracy. The
plasmids may be co-transfected into C2 myogenic cells
along with a ~-galactosidase expression vector.
Twenty four hours after infection, the cells may be
split 1:20 into 60 mm dishes with D~EM containing 20%
fetal calf serum (FCS) and 0 . 4 mg/ml of neomycin
(Geneticin~lD G418; Gibco Laboratories, Grand Island,
NY). After 14 days of selection, individual clones
may be isolated and .o~r7~ntl~1 in DME~ containing 20%
FCS and 0 . 2 mg/ml of G418 . Since the ability of
- transferred cells to differentiate into myotubes ln
vivo is a likely requirement for their stability and
- longevity ln situ, the clones are tested for their
ability both to differentiate into myotubes in D~IEM
supplemented with 2% horse serum and to express beta-
galactosidase. The ,13-galactosidase expression serves
,,
2183551
Wo 95/13376 PCT/US94/13066
- 20 -
as a histological marker to monltor survival, as well
a3 both macroscoplc and microycopic location, of =~
in~ected myoblasts at the conclusion of the studies.
Individual clones ar~ PYr~n~ and the culture
media tested for polype`ptide production by Western
blot and radioimmunoassay. High level expressing
clones are selected for further analysis.
Novel combinations of muscle-specific enhancer
and promoter elements may be constructed and tested
for increased polypeptide expression ~n vltro. The
creation of myogenic cells expressing exceptionally
high levels of recombinant polypeptides provides a
means of reducing both the numbers of primary cells
required for ex v~vo manipulation and the numbers of
cells required for gene therapy muscle cell
transplant .
As described above, there are a number of strong
muscle specific promoter and enhancer elements in the
genes for contractile proteins Plasmid expression
vectors may be constructed from several of these
components linked together. For example, a construct
may include the parent skeletal actin chl~ hPnl col
acetyltransferase (CAT) expression vector containing
the upstream enhancer and the muscle specific
promoter. To this may be added single copies of the
TnCfast upstream enhancer, the TnCslow first intron
enhancer element, and the MCK enhancer ~Johnson, et
al., Muscle creatine kinase sequence elements
regulating skeletal and cardiac muscle expression in
transgenic mice. ~ol. Cell. Biol. 9:3393-3399;
1989. ) . One or more of these elements may be added as
3-5 multimers. After checking the validity of the
constructs by DNA sequencing, they may be used in
calcium phosphate mediated gene transfer for transient
transfection CAT assays by standard techniques. The
plasmids may be cotransfected into C2 cells with RSV-
WO 95/13376 2 1~ 3 S 5 ~ PCT/US94/13066
luciferase as a positive control standard in the
search for promoters with heightened transcriptional
activity. The plasmids may also be transfected into
non .t~r~lr~ (Hela or CVl) cells to evaluate their
5 degree of muscle specificity. Beta-actin and RSV CAT
constructs may be transfected into the same cells in
parallel to serve as comparisons. Once a ~ nAt~r n
of enhancer/promoter elements that significantly
augment transcription is identified, the regulatory
l0 region is transferred to replace the promoter in the
neomycin vector (pHaSEApr-l-neo) described above along
with a beta-galactosidase expression vector.
The present invention is further described by the
following specific examples, which are illustrative
15 but non-limiting.
EXA~IP I.E S
Example l
Construction of Erythropoietin cDNA for expression
A polylinker was inserted in the unique PstI site
of a pCD vector l (Okayama et al., A cDNA cloning
vector that permits expression of cDNA inserts in
l~An cells. ~ol. Cell. Bio. 3:280-289, 1993) to
generate the Vl9 vector. The Vl9 . l vector was derived
from the Vl9 vector by switching direction of Eco R I
and Hind III sites in relation to the SV40 promoter
(see Table 2). This vector was then digested with
- Eco R I and Hind III to which the Bst E II to Hind III
fragment of EPO cDNA and a Bst E II-Eco R I linker
- (see Table 2) were ligated to form Vl9 . l EPO.
2183~51
WO 95113376 pcTlus94ll3n66
; ~ -- 2 2
Table 2
Linker and Adapter Constructs
the ~fl~ter to c~nctruct V19 from Drr~
5' agctgaattctctagaaaagctt 3'
1111111111111111111
3' cttaagagatcttttcgaattaa 5'
10 thf~ Bst E II-Eco R I 1 inker:
5 ' aattcccccccgtgtg 3 '
111111111111
3' yyyyyyy~:~caccagtg 5'
EPO cDNA was isolated from the vector V19.1 as an
Eco R I-Hind III fragment. The sticky ends were
filled in using T4 DNA polymerase in the presence of
deoxyribonucleotides. A human cytomegalovirus vector
20 (CMV/RC; Invitrogen Corporation, San Diego, CA), was
digested with the restriction enzyme Hind III and was
blunted using T4 DNA polymerase. An erythropoietin
cDNA fragment was ligated to the CMV/RC vector to form
a pRC/CMV-huEPO expression construct. E. coli DH5
25 alpha competent cells were transformed with the
pRC/CMV-huEPO plasmid. Plasmid DNA was isolated,
sequenced and used for transfection of 1 ~;~n
cells .
3 0 Example 2
Transfection and screening of clones
~ouse myogenic C2 cells (Yaffe and Saxel, A
myogenic cell line with altered serum requirements for
differentiation, Differen. 7:159-166; 1977; and Serial
passaging and differentiation of myogenic cells
isolated form dystrophic mouse muscle. Nature.
270:725-727; 1977) were cultured in growth medium
WO 95113376 2 18 ~ S ~ ~ PCTIUS94113066
1 .
~ i - 23 --
consisting of Dulbecco's modified Eagle medium ~DMEM)
supplemented with 20% fetal bovine serum, 0 . 5% chick
embryo extract ~Gibco Laboratories) and 100 llg/ml of
kanamycin ~Gibco ~aboratories) in 10% Co2.
5 Subconfluent C2 myoblast cells, in 100 mm dishes, were
split 1: 4 the day before transfection .
C2 cells were transfected by the calcium
phosphate precipitation method using the pRC/CMV-huEPO
pla3mid of Example 1. Transfection mixtures were
prepared as follows: a 501ution of 250 mM CaC12 ~ 5
ml) was added dropwise to 8 llg of DNA in 0 . 5 ml of 2 x
N-2-hydroxyethylpiperazine-N' -2-ethanesul f onic acid
~HEPES) -buffered saline (42 m~ E~EPES [pH 7 . 05], 270 mM
NaCl, 10 mM KCl, 1.4 mM Na2HPO4, 11 mM dextrose).
This was done with constant mixing. The calcium
phosphate-DNA precipitate was left for 20 minutes at
room temperature after which it was added to the
cells. The cells were incubated for 16 hours, washed
with phosphate-buffered saline (PBS), and incubated in
growth medium (10 ml of 10% fetal calf serum in DMEM)
for ~8 hours.
Three days a~iter transfection, the cells were
split at 1:10 and incubated for 12 hours. For
neomycin resistance selection, G418 was added to the
medium at a final concentration of 400 llg/ml. The
cells were supplemented with fresh growth medium
c~nt~n~ng 400 llg/ml of G418 every three days. After
two weeks of incubation, 23 colonies were selected,
and expanded.
For detection of erythropoietin producing clones,
each clone was cultured at 1 x 106/100 mm dish in
growth medium overnight, and incubated in serum-free
- DMEM (3 ml) for three days. The culture medium from
each clone was collected, and erythropoietin
concentration was det~rm~n~l by radi~ qc~ay. The
clones were aliquoted and stored in liquid nitrogen.
2 7 83~51
Wo 95/13376 PCTNS94113066
-- 24 --
Example 3
Myoblast Transplantation
The highest produclng clone was cultured in 150
mm dishes in growth medlum contalnlng 200 ~Lg/ml of
G418. When the cells reached 80% cnnfl~lonce~ they
were trypslnized and collected ln lce-cold PBS. Total
cell number was determined by hemocytometer. Cells
10 were rinsed once again with PBS to remove resldual
trypsln, pelleted, and resuspended ln a small volume
of PBS to a concentratlon of 1 x 108 cells/ml. We
routlnely collected 2-3 x 108 cells for each
experiment. Cells were kept on lce until use to
15 prevent aggregation.
C3H mice syngeneic to the C2 cell llne and nude
mlce (both 6-8 week-old) were used for
transplantation. Animals were anesthetized by
intraperltoneal admlnlstratlon of a mlxture of
20 ketamlne ~30 mg/kg) and xylane (4 mg/kg). A total of
4 x 107 cells per mouse were ln~ected percutaneously
through a 27 gauge needle at~40 dlfferent sites (1 x
106 cells/10 ~Ll/site) into skeletal muscle tissue of
both hlnd limbs. As a control, the same number of
25 parental C2 cells were transplanted ln the same
manner .
Example 4
Hematocrit Measurement
Hematocrlt was measured by mlcrohematocrlt
method. Under general anesthesia, a total amount of
approxlmately 200 111 of blood was collected by a
retroorbltal approach lnto three heparlnized capillary
35 tubes. Blood collection waS performed one week prior
to transplantation, three days and one week after
_ .
WO 9S/13376 2 1 8 ~ 5 5 ~ PCTIUS9~113D66
-- 25 --
transplantation, and weekly thereafter. Control
animals showed that this amount of blood collection
did not significantly affect basal hematocrit levels.
On several occasions, the hematocrit was also measured
5 using a Coulter counter which showed parallel results
with micro-hematocrit method. After hematocrit
measurement, the plasma was collected and stored at
-20C for huEPO concentration measurement.
Example 5
Cell monitoring
a) Tr~nq~l~ntation of C2 cel 1~: oYnre88~ n~ B-
ctosi~lA~e
To monitor the fate of in~ected cells, another C2
cell line which stabily expressed ,l~-galactosidase was
established. The cells were selected by neomycin
resistance, and several clones expressing p-
galactosida8e were collected. One clone was used for
transplantation into right hind limb (2 x 107
cells/mouse) .
b) B ~AlActo8i~1ARe Assays
The mice were sacrificed by cervical dislocation
for the histochemical detection of ~-galactosidase
expression. Skeletal muscle tissue was excised and
frozen i ~ Ately on dry ice. The excised muscles
were then sectioned with a freezing microtome. The 10
~m thick sections were attached to microscope slides,
fixed in 0.25% glutaraldehyde for 10 minutes, washed
- in PBS for 10 minutes, and stained in PP,S containing 1
mg/ml of 5-bromo-4-chloro-3-indolyl-~D-galactoside, 5
- mM potassium ferricyanide, 5 mM potassium
ferrocyanide, and 2 mM MgC12. Sections were incubated
at 37C overnight, rinsed in PBS, mounted and studied
under microscope.
2183551
WO 95/13376 PCT/US94/13066
- 26 -
; s'
c) Reveræe tran~cription-pol -ra~e ehA;n reaction
(RT--PCR )
To confirm ~n vivo huEPO gene expression, muscle
5 tissue was excised from the mlce ln~ected with the
huEPO expresslng C2 cells. The excised muscles were
frozen by li~uid nitrogen and homogenized by Polytron
homogenizer (Brinkman Instruments, Company, NY) .
Total RNA was isolated using Tri Reagent (Molecular
10 Research Center, ~-ln~lnnptl, OH) accordlng to the
manufacturer's protocol. The RNA (7011g) was
resuspended in 50 ~Ll of Tris/EDTA (pH 7 . 4) . To this
was added 50 111 of Tris/EDTA (pH 7.4) containing 8 U
of RNAse-free DNAseI (30ehringer MAnnh~;m,
15 Indianapolis, IN), 4 U of placental RNAse inhibitor
(Promega, Madison, WI), 20 mM MgC12, and 2 mM
dithiothreitol. The reaction was stopped by the
addition of DNAse stopping mixture l -~ntAln;ng 50 mM
EDTA, 1.5 M sodium acetate ~pH 4.8) and 196 sodium
20 dodecyl sulfate. The RNA was treated with
phenol/chloroform, chloroform, and ethanol-
precipitated. For reverse transcription reaction,
approximately 5 llg of RNA and 4 pmol primer
complimentary to the 3 ' untranslated region of huEPO
25 RNA were incubated at 70C, rapidly cooled on ice, and
treated with 100 U of reverse transcriptase
(Superscript; Gibco Labor~tories). The obtained cDNA
was amplified by known PCR methods using primers
including the initiation and stop codons.
d) Results
Table 3 shows the time course of mean hematocrit
change after the transplantation of C2 cells
expressing huEPO gene. Hematocrit started to increase
35 three days after the transplantation of 4 x 107 cells
into C3H syngeneic mice (A in Table 3). The pea3c
WO95/13376 218 3~ ~ PCT/us94ll3n66
-- 27 --
hematocrit was achieved two weeks after the
transplantation. Hematocrit declined gradually
thereafter, becoming lower than the basal level after
wee3c 4.
RT-PCR showed persistent huEPO mRNA expression
for at least one month in the injected muscle, but not
in the muscle from unin~ected left hind limb. Mice
transplanted with parental C2 cells did not show
significant hematocrit increase. In contrast to C3H
mice, nude mice (B) showed significantly higher and
more sustained hematocrit increase for at least tw~
months. When half the number of cells (2 x 107) were
in~ected, the net hematocrit increase was also
approximately half of that observed with 4 x 107
cells, thereby indicating that huEPO production can be
regulated by cell number.
The mice transplanted with the C2 cells
expressing ~-galactosidase showed positive myofibers
over the entire in ~ected sites three months later.
The in~ected C2 cells appeared to fuse among
themselves as well as with preexisting myofibers. No
¦3-galactosidase positive myoblasts were observed.
Serum huEPO c~nc~on~rAtion as determined at several
points after transplantation by either
25 r~ say or bioassay using an erythropoietin-
responsive human leukemic cell line (UT-7/EPO) showed
significantly elevated erythropoietin concentrations
ranging from 90 to 3500 mU/ml. Erythropoietin
concentrations before transplantation in these mice
30 were <25 m~/ml.
2183~1
Wo 95/13376 - PCTIUS94113066
- 28 --
~ ':
Tab~1e ~3
Mean Hematocrits in C3H Mice (A, n=7 )
and Nude Mice (B, n=5)
pre-injection 3d lw 2w 3w 4w 5w 6w 7w
(A) 42.9 45.1 53.5 58.6 50.2 41.8 36.5 33.1 34.4
~B) 43.0 55.8 60.0 67.0 59.1 67.4 57.3 64.0 66.3
Example 6
Myoblast Gene Transfer to Correct Anemia Associated
with Renal Failure
The current ma~or indication for recombinant
human EPO administration is anemia associated with
end-stage renal failure (Faulds et al ., Drugs. 38: 863-
899 (1989) ) . Here, the efficacy of a myoblast gene
therapy approach is demonstrated using an animal model
of renal failure in nude mice. The experiment was
designed to determine whether myoblasts can be
transplanted and then secrete functional human EPO in
20 a~L~a~o~ sllff~ri~nt ~o c4rrec:t anemia for a long ter~in these uremic sub~ects. Transplantation of EPO-
producing C2 cells generated marked erythropoiesis as
efficiently as in non-uremic mice, indicating that a
myoblast gene transfer approach can be applied in
25 renal failure subjects as effectively as in normal
sub~ects. Thus, myoblast gene transfer is means to
correct anemia associated with renal failure as well
as other types of EPO-responsive anemia.
WO 95/13376 2 1 ~ ~ ~ 5 1 PCrlUS94113066
-- 29 --
~Q~
a) TrAnRfeoti~n and soreen~ng of ~10neR
Human EPO-secreting C2 myoblast clones were
prepared as described above. The clone3 carry the
1.34 kb human EPO cDNA (starting at + 190 nucleotide
from the major transcription inltiatlon site to the
end of poly A tail) cloned into the plasmid pRC/CMV
(Invitrogen, San Diego, CA. ) . This plasmid bears the
cytomegalovirus enhancer/promoter to drive the EPO
gene, and a neomycin resistance gene. The highest
EPO-producing clone, hereafter called C2-EPO9,
produced approximately 33 IJ/106 cells/day of human EPO
as determined by radioi OARqay. The fllnt-t;onAl
activity of EPO produced by this clone was confirmed
by an ln vitro bioassay.
b) ~yohlARt tranq~pl AntAtion
Myoblasts from C2-EPO9 were cultured and
harvested as previously described. Under general
anesthesia, a total of 4 x 107 cells were in~ected
through a 27-gauge needle at 40 different sites (1 x
106 cells/lOml/site) of skeletal muscle of both hind
limbs in nude mice. Anesthetic agents included 20
mg/kg of ketamine hydrochloride and 3 mg/kg of
xylazine hydrochloride (Sigma, St. Louis, MO).
c) il :oerit - Rll
Hematocrit was measured by the microhematocrit
method (Koepke, J.A., ed. Practical Laboratory
Hematolo~y,. 1991, Churchill Livingstone: New York.
112-114). Each week, under general anesthesia, 150 ml
of blood was collected by a retroorbital approach into
two heparinized capillary tubes. On several
occasions, the hematocrit was also measured using a
35 Coulter Counter ~which showed results parallel to those
obtained by the microhematocrit method (not shown).
~83~51
WO 95/13376 PCT/US94/13066
-- 30 --
After hematocrit measurement, serum was recovered from
the capillary tubes and stored at -20 C degree for the
measurement of EPO concentration,~ànd BUN.
d) rr~AtiOn of r~nAl fA~ lure 1 del u~in~ nude mlce
A renal failure model was created by a two-step
nephrectomy (Chanutin et al., Arch. ~ntern ~ed.
49:767-787 (1932) ) using 7-8 week old male nude mice
(Charles River Labs., Wilmington, MA). Under general
anesthesia using sterile techniques, the right kldney
was exposed through a flank incision and decapsulated,
and the upper and lower poles (2/3 of the right
kidney) were resected. The remnant right kidney was
allowed to recover from swelling for a week, and then
the total left kidney was resected. The animals were
fed standard chow (Harlan Tekland #8656; Harlan
Tekland, Madlson, WI) ~r~ntA~n~n~ 24.0% protein and
1.0% phosphorus, and water ad libitum. Renal failure
was ronf~ ~ by the development of both anemia and
uremia. For uremia, blood urea nitrogen (BUN) was
deternLined weekly with a BUN kit (Sigma 535--A; Sigma,
St. Louis, MO) using four milliliters of serum.
e) ~oA,'Ill -nt of serum EPO . r,ncentrat~on
Serum concentrations of human EPO were determined
by an en2yme linked immunosorbent assay ~ELISA) system
using a mouse monoclonal antibody accordlng to the
manufacturer's protocol (Quantikine IVD; R & D
Systems, Minneapolis, MN). This method has a linear
range between 2 . 5 and 200 mU/ml of human EPO with a
detection threshold of 0.25 mU/ml.
f) B--~A 1 ACtosi(:Ase assavs
After euthanasia, skeletal muscle tissue was
excised and frozen immediately on dry ice. The
exclsed muscles were then sectloned with a freezinc
_ _ _ _ _ _ . _ . . . , . _
WO 9~113376 ~18 3 5 ~ i PCT/IJS94113066
-- 31 --
mlcrotome. The sections were attached to microscope
31ides, fixed in 0.25~ glut~rAl~7~hyde for 10 minutes,
washed in PBS for 10 minutes, and stained in PBS
c~nts~n;ng 1 mg/ml o~ X-gal, 5 mM potassium
5 ferrocyanide, 5 mM potassium ferrocyanide, and 2 mM
MgCl2. Sections were incubated at 37 C overnight,
rinsed in PBS, mounted, studied under microscope, and
photographed .
g) Stat ~ Rti- A 1 ~nA 1 ysis
Statistical signi~icance was assessed by
Student ' s t-test . p<0 . 05 was taken as significant .
Data were expressed as means + 5 . D .
15 RESULTS
a) Tr~ns~ ntation o~ EPO-produc;n~r m~vobl~qts lnto
nor~-l nudo m~-e
After the transfection with pRC/CMV-EPO, the
clones were screened by G418, and 23 clones were
20 randomly selected. Eleven of twenty-three C2 myoblast
clones had measurable EPO as det-rm; nf.fl by RIA ranging
from 0.18 to 32.8 U/ml/106 cells/day. Using an ~n
vltro bioassay with EPO-dependent human leukemic cell
line, it was confirmed that the EPO secreted from
25 these engineered muscle cells is fllnr~;on~l ly active.
Transplantation of the cells from C2-EPO9 yielded a
marked hematocrit increase ~or at least three months
in healthy normal nude mice, while mice transplanted
with parental C2 cells did not show a significant
30 hematocrit change during the period, as summarized in
Table 4.
~183551
WO 95/13376 PCTNS9~/13066
-- 32 --
Table 4
Persistent Elematocrit Increase by Transplantation of
E~uman EPO-producing Myoblasts into Non-uremic Nude
Mice .~ -
Time
( weeks ) n 2 4 ~ 1
control 44.8 47.0 47.2 48.8 49.0
C2 cells i 2 . 4 i 3 .1 i 208 i 3 . 0 i 2 . 3
~n=6)
C2--EPO9 44.6 71.2 72.2 67.8 58.0
(N=9) i 3 .0* i 7 . 9:1: i 7 . 9:1~ i 11.8~ i 8.1
Nude mice were transplanted with 4xlO 7 cells from
either control C2 or C2-EPO9, and the microhematocrit
was measured weekly by a retroorbital approach.
~Significantly different from *.
Significantly different from * and ~
b) rreatirln of r~nAl ~l lure I ~df l ln m~ce
Ten of twenty-seven nephrectomized mice died
within four days after surgery (two after the first,
and eight after the second surgery), a mortality rate
comparable to a previous report (Gibb et al ., Cl inl cal
Irrununology and ~mmunopathology. 35:276-284 (1985)).
Survivors of the acute phase of surgery (17 mice) were
followed weekly with hematocrit and BUN
determinations. After three weeks, the mice were
divided into two groups. Group I included five mice
that showed only transient anemia during the three
week observation period and were followed without
transplantation. Group II included 13 mice that
showed persistent anemia with a hematocrit decrease of
more than 15% from the preoperative level in three
consecutive measurements after the second nephrectomy
and were used for transplantation experiments.
In Group II, the mean hematocrit decreased from a
preoperative level of 45.2i2.7 to 33.9i3.7 (%0) three
weeks after the second nephrectomy. The Group I mice
-
WO 95/13376 ~ 1 8 3 ~ ~ PCT/IJS94/13066
-- 33 --
did not develop further anemia, and the degree of BUN
increase was much lower than that of the Group II mice
(52.6il3.2 vs. 95.4~16.5 three week3 after the second
nephrectomy); presumably due to insufficient
5 nephrectomy.
Among Group II mice, eight mice were transplanted
with C2-EPO9 cells, and three mice were followed
without transplantation as a non-transplantation
control (one mouse died ~ust before transplantation,
10 presumably due to severe uremia). All of the
transplanted mice of Group II had a marked hematocrit
increase, despite the presence of severe uremia as
indicated by the high BUN levels. The rise in
hematocrit was comparable to that observed in normal
nude mice (Table 4). A mean hematocrit of 68.6+4.2
was achieved two weeks after the transplantation, and
this hematocrit increase persisted thereafter. Those
without transplantation showed persistent or even
deteriorating anemia. All of the Group II mice,
except one, died between six and eleven weeks (8.2:t1.8
weeks) after the second nephrectomy, while in Group I
only one mouse died during the experimental period.
The observed survival rate is consistent with previous
observations (Kumano et al., ~i~ney International.
30:433-436 ~1986) ) . The one long term survivor in
Group I also had the lowest levels of BUN in that
group. These data clearly demonstrate the feasibility
and potential efficacy of a myoblast gene transfer
system even in the face of severe renal failure in
mice.
c) Serl-m PPO level
To examine the secretion of EPO protein from the
transplanted cells, serum human EPO concentration was
measured using an EEISA. As previously <l~t~orm1 n~
this method did not detect a significant level of
2183~51
WO 95ll3376 PCTIUS94/13066 ~,
- 34 -
mouge EPO (<2.5 mU/ml) in Sera of nude mice
phlebotomlzed (150 mll weekly over three months
(unpublished observation). This observation was
confirmed in the non-transplanted renal failure mice
in Group II (not shown). Serum EPO measured by this
method, therefore, represents ~ust the human EPO
produced by the transplanted muscle cells and not
endogenous EPO levels. A week after transplantation
with C2-EPO9 cells, the serum EPO level was
87.3i22.1mU/ml in group II uremic mice. It declined
to 53.8:t:18.7 mU/m at week 2, and a similar
concentration was maintained thereafter until week 8.
Thus, the transplanted C2-EPO9 cells persistently
produced human EPO at a steady rate for at least two
months after transplantation into mice with severe
renal failure.
d) The fate of tr;~n~lAnted EPO-secre~ ng myol~lA~ts
~n rPn;ll faill-re r ,IP1
To analyze the fate of transplanted myoblasts,
C2-EPO9 cells were transduced with BAG retrovirus
(Price et al., Proc. Natl. Acad. Sci. USA. 84:156--160
(1987) ) bearing ~-galactosidase and neomycin
resistance genes. Since the C2-EPO9 clone had already
been maintalned ln the presence of G418, BAG-
transduced clones were selected by positive X-gal
stainlng. Cells from one X-gal posltive clone (clone
9-BAG) were .oxr~n~lP~ and transplanted lnto nude mice
wlth renal fallure accordlng to the same protocol used
for C2-EPO transplantatlon. These mlce also showed a
marked hematocrit increase as observed ln the C2-EPO9
transplanted group II mlce (not shown). Slx weeks
later, X-gal posltlve myofibers were detected in the
entire area of transplantation. At some sites, most
of the myofibers were X-gal positive, while at other
sites, both X-gal posltlve and negative myofibers
_ _ _ _ _ _ _ _ _ . _ _ _ _ _ _ _ _ _ _ _ _
WOg5111376 218 35S 1 PCT/US94113066
- 35 -
coexlsted. These results demonstrated that the
transplanted EPO-secreting myoblasts differentiated by
fusing with preexisting host myofibers or themselves
and that the transgenes were actively expressed from
5 the transplanted cells for the duration of the
experimental protocol.
Di.qcucsion
It is unknown how other abnormalities in the
lO uremic syndrome including electrolyte disorders,
metabolic acidosis (i . e ., glucose intolerance),
gastrointestinal disorders, neurologic abnormalities,
and metabolic disorders, might affect the outcome of
myoblast transplantation. Furthermore, the erythroid
15 response to EPO is significantly reduced, and red
blood celL survival is shortened in uremia. In the
present experiment, however, it was demonstrated that
the transplantation of transformed myoblasts could,
even in the face of severe uremia, deliver more than a
20 suf f icient amount of human EPO to correct anemia due
to renal failure. Furthermore, the therapeutic
effects lasted for at least two months. l.onger
periods of analysis were limited by animal death
probably due to severe renal failure. However, wlth
25 concomitant treatment of renal failure, it ls likely
the hematocrit increase would persist for more than
two months, as was the case with non-uremic mice
(Table 4) .
The observation that the serum EPO concentration
30 was still high at two months, together with the fact
that the half-life of red blood cells in mice is 20-45
days, also suppgrts the likelihood that the increased
hematocrit would have been sustained longer than two
months, if the uremia had been corrected by dialysis.
35 The sustained high serum human EPO concentration due
to transformed myoblast transplantation ~ nf; ~--~ that
WO 95/13376 21 g 3 ~ ~ 1 PCT/US94/13066
-- 36 --
the observed hematocrit lncrease was due to human EPO
derived from the transplanted~cells rather than from
endogenous mouse EPO. The perslstent presence of
X-gal positlve myofibers after clone 9-BAG
5 transplantation further supports the notion that the
transplanted myoblasts differentiate into myofibers
and become a stable source of EPO production in the
face of renal failure.
End-stage renal failure patients as well as
10 patients with hypoproliferative anemia secondary to
3 ' -azido-3 ' deoxythymidine (AZT) administration are
currently treated with 100-150 U of re~ '-;nAnt EPO
per kg of body weight per week to maintain a target
hematocrit level between 30 and 33, which is equal to
857-1286 U/day for a 60 kg patient. Since C2-EP09
secreted 32. 8 U of EPO/106 cells/day, 2 . 6-3 . 9 x 107
cells would, in theory, be sufficlent to provlde 1286
U/day. The dellvery of this number of muscle cells
appears to be ~R~hl~, since in a phase I clinical
trial of myoblast transfer in Duchenne muscular
dystrophy patients, as many as 108 myoblasts could be
prepared from small muscle biop3y (0.5-l.Og) of first
degree relatives and transplanted into patients
(Gussoni et al., Nature. 356:435-438 (1992)).
The present myoblast gene transfer system could
further be optimized for clinical a~elications. For
example, the technique may be modified to include:
(1) the use of primary myoblasts and/or (2) the use of
an implantable; ~,~ Rolation device. Although
primary myoblasts might be transfected with EPO cDNA
to secrete EPO and increase hematocrit in mice, this
approach would require customized preparation of cells
for an individual patient to avoid immunore~ection.
In this regard, a stocked cell line with an
immunoisolation device might be a more practical
approach for a large population o~ patients. Withln
2183$51
WO 95/13376 PCTtUS94tl3n66
-- 37 --
such a device transformed myoblasts appear to retain
an ability to differentiate ~Liu et al., Numan Gene
Therapy. 4 :291-301 (1993~ ) aQd are likely to become a
stable source of recombinant protein production.
While mice appear to tolerate the unusually high
hematocrit for several months, overproduction of EPO
could have potentially deleterious conse~uences
including polycythemia. Although recombinant gene
production can be controlled to some degree by the
number of cells transplanted, regulated transgene
expression could also be achieved, such as by the use
of inducible promoters to drive genes of interest, as
mentioned above.
The present study demonstrated (1) that myoblast
gene transfer technology could correct a disease
condition (correction of anemia) as a systemic
response to E~O transgene expression, and (2) that
myoblast gene trans~er is feasible for the delivery of
genes of interest (not restricted to EPO) in the
setting of severe uremia, a disease condition
previously untested for this approach.
WO9S/13376 2 18 3 ~ ~1 PCT/US94/13066
-- 38 --
SEQUENCE LISTING
(1) GENERAL INFORMATION: ,
5 .
(1) APPLICANTS: ANGEN INC. . .
UNlVl:.KSl'l~ OF bOUTHERN CALIFORNIA
.' ., '
0 (li) TITLE OF INVENTION: GENE THERAPY VECTOR FOR THE
TREATNENT OF LOW OR DEFECTIVE RED BLOOD CELL
~IWLJU~
(iii) NUNBER OF SEQUENCES: 2
(iv) (~ ADDRESS:
AI ADDRESSEE: AMGEN INC.
BI STREET: 1840 DEHAVILLAND DRIVE
ICI CITY: THOUSAMD OARS
IDI STATE: CALIFORNIA
~ E I COUNTAY: U . S . A .
rFl ZIP: 91320--1789
(v) CONPUTER READABLE FORN:
(A) ~gEDIUN TYPE: Floppy cisX
(B) CONPUTER: IBN PC . ~
(C) OPERATING SYSTEM: PC--DOS/NS--DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUNBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(2) INFORMATION FOR SEQ ID NO:l:
(i) SECUENOE rRARA~ b:
~A) LENGTH: 1789 b~se pairs
~B) TYPE: nucleic acid
~C) STpA -: unknown
ID) TOPOLOGY: unXnown
(ii) NOLECULE TYPE: cDNA
( iY ) FEATURE:
(A) NAME/REY: CDS
(B) LOCATION: 625.. 1203
(Yi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
AAGCTTCTGG GCTTCCAGAC CCAGCTACTT TGCGGAACTC Arr~rcrAr GCATCTCTGA 60
AAr.Arcrr.r.A Tr~rcrrcrAr~ GGGAGGTGTC rr7GnAr~crA ~ ,A 120
r.ATArrAr~ TCCGCCAGTC cr~ Trr r7rAArcr~r-rT GCACTCCCCT rrrr,rr.Arrr 180
Arr"3~CCGr7r7 Ar~rAr~rcrrc ATr:ArrrArA cr7rArr~TrTr~ rAr~rAr~crrr GCTCACGCCC 240
WO 95/13376 ~ 1 8 ~ PCT/US94113066
- 39 --
rrGrr~Ar~rrT rAArcrAr~r~r ~ ,C TGCTCTGACC ~ ~l CCTACCCCTG 300
GCGACCCCTC Arfir.ArArAr. C~ ArrrcrArrr GrGrArGrAr ACATGCAGAT 360
~rArrcrrG Arrcrcr.r.CC Ar.Arrrr,rAr. AGTCCCTGGG rrArccrr~r~c C~ 7c, 420
ACCGCGCTGT CCTCCCGGAG rcr-r~Arrr~r~ rrArrGrrr ~ 480
0 Crr.ArArrGr ~ .A rA~:rrrrrrT CTCCTCTAGG r~ a 540
rrr,rrrAr.rT TCcrrGr.ATr. Ar~rGrccrrr~ r~TrTGr~TrAr ~ CCAGGTCGCT 600
~Arrr.ArCcr r~rrAr~rGr GGAG ATG GGG GTG CAC GAA TGT CCT GCC TGG 651
Met Gly Val His Glu Cy~ Pro Ala Trp
CTG TGG CTT CTC CTG TCC CTG CTG TCG CTC CCT CTG GGC CTC CCA GTC 6 9 9
Leu Trp Leu Leu Leu Ser Leu Leu Ser Leu Pro Leu Gly Leu Pro Val
10 15 20 25
CTG GGC GCC CCA CCA CGC CTC ATC TGT GAC AGC CGA GTC CTG GAG AGG 747
Leu Gly Ala Pro Pro Arg Leu Ile Cys Asp Ser Arg Val Leu Glu Arg
30 35 40
TAC CTC TTG GAG GCC AAG GAG GCC GAG AAT ATC ACG ACG GGC TGT GCT 795
Tyr Leu Leu Glu Ala Lya Glu Ala Glu Asn Ile Thr Thr Gly Cy:l Ala
45 50 55
3 0 GAA CAC TGC AGC TTG AAT GAG AAT ATC ACT GTC CCA GAC ACC AAA GTT 8 43
Glu His Cys Ser Leu Asn Glu Asn Ile Thr Val Pro Asp Thr Lys Val
60 65 70
AAT TTC TAT GCC TGG AAG AGG ATG GAG GTC GGG CAG CAG GCC GTA GAA 8 91
Asn Phe Tyr Ala Trp Lys Arg Met Glu Val Gly Gln Gln Ala Val Glu
75 80 85
GTC TGG CAG GGC CTG GCC CTG CTG TCG GAA GCT GTC CTG CGG GGC CAG 939
Val Trp Gln Gly Leu Ala Leu Leu Ser Glu Ala Val Leu Arg Gly Gln
90 95 100 105
GCC CTG TTG GTC AAC TCT TCC CAG CCG TGG GAG CCC CTG CAG CTG CAT 987
Ala Leu Leu Val Asn Ser Ser Gln Pro Trp Glu Pro Leu Gln Leu Hi3
110 115 120
GTG GAT AAA GCC GTC AGT GGC CTT CGC AGC CTC ACC ACT CTG CTT CGG 1035
Val Asp Lys Ala Val Ser Gly Leu Arg Ser Leu Thr Thr Leu Leu Arg
125 130 135
GCT CTG GGA GCC CAG AAG GAA GCC ATC TCC CCT CCA GAT GCG GCC TCA 1083
Ala Leu Gly Ala Gln Lys Glu Ala Ile Ser Pro Pro Asp Ala Ala Ser
140 145 150
GCT GCT CCA CTC CGA ACA ATC ACT GCT GAC ACT TTC CGC AAA CTC TTC 1131
Ala Ala Pro Leu Arg Thr Ile Thr Ala A~ip Thr Phe Arg Lys Leu Phe
155 160 165
2183~1
WO 95/13376 PCT/US94113066
- 40 -
CGA GTC TAC TCC AAT TTC CTC CGG GGA AAG CTG AAG CTG TAC ACA GGG 1179
Arg Val Tyr Ser Asn Phe Leu Arg Gly Lys Leu Lys Leu Tyr Thr Gly
170 175 180 185
5 GAG GCC TGC AGG ACA GGG GAC AGA TGACCAGGTG TGTCCACCTG GGCATATCCA 1233
Glu Ala Cya Arg Thr Gly Asp Ar~
CCACCTCCCT CACCAACATT ~ A CACCCTCCCC CGCCACTT GAACCCCGTC 1293
GAGGGGCTCT r~rrTr~-rr, rr~rr~TrTr CCATGGACAC TCCAGTGCCA GCAATGACAT 1353
CTCAGGGGCC AGAGGAACTG TCCAGAGAGC AACTCTGAGA TCTAAGGATG TCACAGGGCC 1413
15 AACTTGAGGG rcr~r.~rr~r. GAAGCATTCA r~r~r.r~rT TTAAACTCAG G~:~r~r~r~rr 1473
ATGCTGGGAA GACGTGAG CTCACTCGGC AcccTGcAaA ATTTGATGCC ~r~r~r~rG~T 1533
TTGGAGGCGA TTTACCTGTT TTCGCACCTA rrATr~t3~ CAGGATGACC TGGAGAACTT 1593
AGGTGGCAAG CTGTGACTTC TCCAGGTCTC ACGGGCATGG GCACTCCCTT GGTGGCAAGA 1653
x~ ~ CACCGGGGTG GTGGGAACCA TGAAGACAGG ATGGGGGCTG ~.~X, I C~ 1713
25 CTCATGGGGT CCAAGTTTTG TGTATTCTTC AACCTCATTG ACAAGAACTG A~rrArr~ 1773
I~Al~A~AAI~ AAAAAA 1789
30 (3) INFORMATION FOR SEQ ID NO:2:
~i) SEQUENCE r~ ;S
~A) LENGTH: 193 amlno acids
~i3) TYPE: amino acid
~D) TOPOLOGY: linear
~ii) MOLECULE TYPE: protein
~xi) SEQUENCE DESCRIPTION: SEQ ID No:2:
~5et Gly Val ili3 Glu Cy8 Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu
5 10 15
Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu
20 25 30
Ile Cy3 Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu
35 40 45
50 Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu llis Cys Ser Leu Asn Glu
50 55 60
Asn Ile Thr val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg
65 70 75 80
et Glu Val Gly Gln Gln Ala Val GIu Val Trp Gln Gly Leu Ala Leu
2183~51
O WO 95/13376 PCTIUS94/13066
-- 41 --
Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val AYn Ser Ser
100 105 110
Gln Pro Trp Glu Pro Leu Gln Leu EliY Val AYp LyY Ala Val Ser Gly
115 120 lZ5
Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Ly3 Glu
130 135 140
0 Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile
145 150 155. 160
Thr Ala AYp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser AYn Phe Leu
165 170 175
Arg Gly LyY Leu Lys Leu Tyr Thr Gly Glu Ala CYB Arg Thr Gly AYP
180 185 190
Arg
