Note: Descriptions are shown in the official language in which they were submitted.
WO 95/34650 ?1926/8 PC1/US95/07628
-1-
MN GENE AND PROTEIN
FIELD OF THE INVENTION
The present invention is in the general area of
medical genetics and in the fields of biochemical engineering
and immunochemistry. More specifically, it relates to the
identification of a new gene--the MN gene--a cellular gene
coding for the MN protein. The inventors hereof found MN
proteins to be associated with tumorigenicity. Evidence
indicates that the MN protein appears to represent a
potentially novel type of oncoprotein. Identification of MN
antigen as well as antibodies specific therefor in patient
l0 samples provides the basis for diagnostic/prognostic assays
for cancer.
BACKGROUND OF THE INVENTION
A novel quasi-viral agent having rather unusual
properties was detected by its capacity to complement mutants
of vesicular stomatitis virus (VSV) with heat-labile surface G
protein in HeLa cells (cell line derived from human cervical
adenocarcinoma), which had been cocultivated with human breast
carcinoma cells. [Zavada et al., Nature New Biol., 240: 124
(1972); Zavada et al., J. Gen. Viral.. 24: 327 (1974);
Zavada, J., Arch. Virol., 50: 1 (1976); Zavada, J., J. Gen.
Viral., 63: 15-24 (1982); Zavada and Zavadova, Arch, Virol..
118: 189 (1991).] The quasi viral agent was called MaTu as
it was presumably derived from a human mammary tumor.
There was significant medical. interest in studying
and characterizing MaTu as it appeared to be an entirely new
type of molecular parasite of living cells, and possibly
originated from a human tumor. Zavada et al., International
Publication Number WO 93/18152 (published 1 September 1993),
describes the elucidation of the biological and molecular
nature: of MaTu which resulted in the discovery of the MN gene
and protein. MaTu was found by the inventors to be a two-
' 92,67-R ,
WO 95134650 PCT(US95/07628 =
-2-
component system, having an exogenous transmissible component,
MX, and an endogenous cellular component, MN. The MN
component was found to be a cellular gene, showing only very
little homology with known DNA sequences. The MN gene was
found to be present in the chromosomal DNA of all vertebrates
tested, and its expression was found to be strongly correlated
with tumorigenicity.
The exogenous MaTu-MX transmissible agent was
identified as lymphocytic choriomeningitis virus (LCMV) which
persistently infects HeLa cells. The inventors discovered
that the MN expression in HeLa cells is positively regulated
by cell density, and also its expression level is increased by
persistent infection with LCMV.
Research results provided herein show that cells
transfected with MN cDNA undergo changes indicative of
malignant transformation. Further research findings indicate
that the disruption of cell cycle control is one of the
mechanisms by which MN may contribute to the complex process
of tumor development.
Described herein is the cloning and sequencing of
the MN gene and the recombinant production of MN proteins.
The full-length MN cDNA sequence [SEQ. ID. NO.: 1], the amino
acid sequence deduced therefrom [SEQ. ID. NO.: 2], a full-
length genomic sequence for MN [SEQ. ID. NO.: 5] including a
proposed promoter sequence [SEQ. ID. NO.: 27] are provided.
Eleven exons [SEQ. ID. NOS. 28-38] and ten introns [SEQ. ID.
NOS.: 39-481 are comprised by the MN gene. Also a 1.4
kilobase region [SEQ. ID. NO. 49] within the middle of the MN
genomic sequence is described herein, which has the character
of a typical CpG-rich island, and which contains multiple
putative binding sites for transcription factors AP2 and Spi.
Also described are antibodies prepared against
proteins/polypeptides. MN proteins/ polypeptides can be used
in serological assays according to this invention to detect
MN-specific antibodies. Further, MN proteins/polypeptides
and/or antibodies reactive with MN antigen can be used in
immunoassays according to this invention to detect and/or
CA 02192678 2000-05-18
-3-
quantitate MN antigen. Such assays may be diagnostic and/or
prognostic for neoplastic/pre-neoplastic disease.
SUMMARY OF THE INVENTION
This invention is directed to the MN gene, fragments
thereof and the related cDNA which are useful, for example, as
follows: 1) to produce MN proteins/ polypeptides by
biochemical engineering; 2) to prepare nucleic acid probes to
test for the presence of the MN gene in cells of a subject; 3)_
to prepare appropriate polymerase chain reaction (PCR) primers
for use, for example, in PCR-based assays or to produce
nucleic acid probes; 4) to identify MN proteins and
polypeptides as well as homologs or near homologs thereto; 5)
to identify various mRNAs transcribed from MN genes in various
tissues and cell lines, preferably human; and 6) to identify
mutations in MN genes. The invention further concerns
purified and isolated DNA molecules comprising the MN gene or
fragments thereof, or the related cDNA or fragments thereof.
Thus, this invention in one aspect concerns isolated
nucleic acid sequences that encode MN proteins or polypeptides
wherein the nucleotide sequences for said nucleic acids are
selected from the group consisting of:
(a) SEQ. ID. NO.: 1;
(b) nucleotide sequences that hybridize under
stringent conditions to SEQ. ID. NO.: 1 or to its complement;
(c) nucleotide sequences that differ from SEQ. ID.
NO.: 1 or from the nucleotide sequences of (b) in codon
sequence because of the degeneracy of the genetic code.
Further, such nucleic acid sequences are selected from
nucleotide sequences that but for the degeneracy of the
genetic code would hybridize to SEQ. ID. NO.: 1 or to its
complement under stringent hybridization conditions.
Further, such isolated nucleic acids that encode MN
proteins or polypeptides can also include the MN nucleic acids
of the genomic sequence shown in Figure 3(A-F), that is, SEQ.
ID. NO.: 5, as well as sequences that hybridize to it or its
complement under stringent conditions, or would hybridize to
SEQ. ID. NO.: 5 or to its complement under such conditions,
2 1926 7.8 WO 95134650 PCT/CUS95PO7628 =
-4 -
but for the degeneracy of the genetic code. Degenerate
variants of SEQ. ID. NOS.: i and 5 are within the scope of
the invention.
Further, this invention concerns nucleic acid probes
which are fragments of the isolated nucleic acids that encode
MN proteins or polypeptides as described above. Preferably
said nucleic acid probes are comprised of at least 29
nucleotides, more preferably of at least 50 nucleotides, still
more preferably at least 100 nucleotides, and even more
preferably at least 150 nucleotides.
Still further, this invention is directed to
isolated nucleic acids containing at least twenty-seven
nucleotides selected from the group consisting of:
(a) SEQ. ID. NOS.: 1, 5 and 27-49 and that are
complementary to SEQ. ID. NOS.: 1, 5 and 27-49;
(b) nucleotide sequences that hybridize under
standard stringent hybridization conditions to one or more of
the following nucleotide sequences: SEQ. ID. NOS.: 1, 5, and
27-49 and the respective complements of SEQ. ID. NOS.: 1, 5
and 27-49; and
(c) nucleotide sequences that differ from the
nucleotide sequences of (a) and (b) in codon sequence because
of the degeneracy of the genetic code. The invention also
concerns nucleic acids that but for the degeneracy of the
genetic code would hybridize to the nucleic acids of (a) and
(b) under standard stringent hybridization conditions.
Further this invention concerns nucleic acids of (b) and (c)
that hybridize partially or wholly to the non-coding regions
of SEQ. ID. NO.: 5 or its complement as, for example,
sequences that function as nucleic acid probes to identify MN
nucleic acid sequences. Conventional technology can be used
to determine whether the nucleic acids of (b) and (c) or of
fragments of SEQ. ID. NO.: 5 are useful to identify MN
nucleic acid sequences, for example, as outlined in Benton and
Davis, Science, 196: 180 (1977) and Fuscoe et al. Genomics.
5: 100 (1989). In general, such nucleic acids are preferably
at least 29 nucleotides, most preferably at least 50
nucleotides and still more preferably at least 100
CA 02192678 2000-05-18
-5-
nucleotides. An exemplary and preferred nucleic acid probe is
SEQ. ID. NO.: 55 (a 470 bp probe useful in RNase portection
assays).
Test kits of this invention can comprise the nucleic
acid probes of the invention which are useful
diagnostically/prognostically for neoplastic and/or pre-
neoplastic disease. Preferred test kits comprise means for
detecting or measuring the hybridization of said probes to the
MN gene or to the mRNA product of the MN gene, such as a
visualizing means.
Fragments of the isolated nucleic acids of the
invention, can also be used as PCR primers to amplify segments
of MN genes, and may be useful in identifying mutations in MN
genes. Typically, said PCR primers are olignucleotides,
preferably at least 16 nucleotides, but they may be
considerably longer. Exemplary primers may be from about 16
nucleotides to about 50 nucleotides, preferably from about 19
nucleotides to about 45 nucleotides.
Further, the invention concerns the use of such PCR
primers in methods to detect mutations in an isolated MN gene
and/or fragment(s) thereof. For example, such methods can
comprise amplifying one or more fragment(s) of an MN gene by
PCR, and determining whether any of said one or more fragments
contain mutations, by, for example, comparing the size of the
amplified fragments to those of similarly amplified
corresponding fragments of MN genes known to be normal, by
using a PCR-single-strand conformation polymorphism assay or a
denaturing gradient gel electrophoretic assay.
This invention also concerns nucleic acids which
encode MN proteins or polypeptides that are specifically bound
by monoclonal antibodies designated M75 that are produced by
the hybridoma VU-M75 deposited at the American Type Culture
Collection (ATCC) at 10801 University Blvd., Manassas,
Virginia 20110-2209 (USA) under ATCC No. HB 11128, and/or by
monoclonal antibodies designated MN12 produced by the
hybridoma MN 12.2.2 deposited at the ATCC under ATCC No. HB
11647.
CA 02192678 2000-05-18
-6-
This invention further concerns isolated nucleic
acids containing at least sixteen nucleotides, preferably at
least twenty-nine nucleotides, more preferably at least fifty
nucleotides, wherein said nucleic acid is selected from the
group consisting of:
(a) the MN nucleic acids contained in plasmids A4a,
XE1 and XE3 which were deposited at the American Type Culture
Collection (ATCC) in Manassas, Virginia in the United States
of America under the respective ATCC Nos. 97199, 97200, and
97198;
(b) nucleic acids that hybridize under stringent
conditions to the MN nucleic acids of (a); and
(c) nucleic acids that differ from the nucleic acids
of (a) or (b) in codon sequence due to the degeneracy of the
genetic code. Such isolated nucleic acids, for example, can
be polymerase chain reaction (PCR) primers.
The invention further concerns isolated nucleic
acids that code for an MN protein, MN fusion protein or MN
polypeptide that is operatively linked to an expression
control sequence within a vector; unicellular hosts,
prokaryotic or eukaryotic, that are transformed or transfected
therewith; and methods of recombinantly producing MN proteins,
MN fusion proteins and MN polypeptides comprising transforming
or transfecting unicellular hosts with said nucleic acid
operatively linked to an expression control sequence,
culturing said transformed or transfected unicellular hosts so
that said MN proteins, fusion proteins or polypeptides are
expressed, and extracting and isolating said MN protein fusion
protein or polypeptide.
Recombinant nucleic acids that encode MN fusion
proteins are claimed as consisting essentially of an MN
protein or MN polypeptide and a non-MN protein or polypeptide
wherein the nucleotide sequence for the portion of the nucleic
acid encoding the MN protein or polypeptide is selected from
the group consisting of:
(a) SEQ. ID. NO.: 1;
CA 02192678 2000-05-18
-7-
(b) nucleotide sequences that hybridize under
stringent conditions to SEQ. ID. NO.: 1 or to its complement;
and
(c) degenerate variants of SEQ. ID. NO.: 1, and of
the nucleotide sequences of (b);
wherein the nucleic acid encoding said MN protein or
polypeptide contains at least twenty-nine nucleotides.
Said non-MN protein or polypeptide may preferably be
nonimmunogenic to humans and not typically reactive to
antibodies in human body fluids. Examples of such a DNA
sequence is the alpha-peptide coding region of beta-
galactosidase and a sequence coding for glutathione S-
transferase or a fragment thereof. However, in some
instances, a non-MN protein or polypeptide that is
serologically active, immunogenic and/or antigenic may be
preferred as a fusion partner to a MN antigen. Further,
claimed herein are such recombinant fusion proteins/
polypeptides which are substantially pure and non-naturally
occurring. Exemplary fusion proteins of this invention are
GEX-3X-MN, MN-Fc and MN-PA, described infra.
In HeLa and in tumorigenic HeLa x fibroblast hybrid
(H/F-T) cells, MN protein is manifested as a "twin" protein
p54/58N; it is glycosylated and forms disulfide-linked
oligomers. As determined by electrophoresis upon reducing
gels, MN proteins have molecular weights in the range of from
about 40 kd to about 70 kd, preferably from about 45 kd to
about 65 kd, more preferably from about 48 kd to about 58 kd,
upon non-reducing gels. MN proteins in the form of oligomers
have molecular weights in the range of from about 145 kd to
about 160 kd, preferably from about 150 to about 155 kd, still
more preferably from about 152 to about 154 kd. A predicted
amino acid sequence for a preferred MN protein of this
invention is shown in Figure 1(A-C) [SEQ. ID. NO. 2].
Other particular MN proteins or polypeptides are
exemplified by the putative MN signal peptide shown as the
irst thirty-seven amino acids in Figure 1(A-C) [SEQ. ID. NO.:
6], preferred MN antigen epitopes [SEQ. ID. NOS.: 10-16], and
domains of the MN protein represented in Figure 1(A-C) as amino
CA 02192678 2003-09-15
-8-
acids 38-135 [SEQ. ID. NO.: 50], 136-391 [SEQ. ID. NO.: 51],
415-434 [SEQ. ID. NO.: 52], and 435-459 [SEQ. ID. NO.: 53].
The discovery of the MN gene and protein and thus,
of substantially complementary MN genes and proteins encoded
thereby, led to the finding that the expression of MN proteins
was associated with tumorigenicity. That finding resulted in
the creation of methods that are diagnostic/ prognostic for
cancer and precancerous conditions. Methods and compositions
are provided for identifying the onset and presence of
neoplastic disease by detecting and/or quantitating MN antigen
in patient samples, including tissue sections and smears, cell
and tissue extracts from vertebrates, preferably mammals and
more preferably humans. Such MN antigen may also be found in
body fluids.
MN proteins and genes are of use in research
concerning the molecular mechanisms of oncogenesis, in cancer
diagnostics/prognostics, and may be of use in cancer
immunotherapy. The present invention is useful for detecting
a wide variety of neoplastic and/or pre-neoplastic diseases.
Exemplary neoplastic diseases include carcinomas, such as
mammary, bladder, ovarian, uterine, cervical, endometrial,
squamous cell and adenosquamous carcinomas; and head and neck
cancers; mesodermal tumors, such as neuroblastomas and
retinoblastomas; sarcomas, such as osteosarcomas and Ewing's
sarcoma; and melanomas. Of particular interest are head and
neck cancers, gynecologic cancers including ovarian, cervical,
vaginal, endometrial and vulval cancers; gastrointestinal
cancer, such as, stomach, colon and esophageal cancers;
urinary tract cancer, such as, bladder and kidney cancers;
skin cancer; liver cancer; prostate cancer; lung cancer; and
breast cancer. Of still further particular interest are
gynecologic cancers; breast cancer; urinary tract cancers,
especially bladder cancer; lung cancer; and liver cancer.
Even further of particular interest are gynecologic cancers
and breast cancer. Gynecologic cancers of particular interest
are carcinomas of the uterine cervix, endometrium and ovaries;
more particularly such gynecologic cancers include cervical
squamous cell carcinomas, adenosquamous carcinomas,
CA 02192678 2000-05-18
-9-
adenocarcinomas as well as gynecologic precancerous
conditions, such as metaplastic cervical tissues and
condylomas.
The invention further relates to the biochemical
engineering of the MN gene, fragments thereof or related cDNA.
For example, said gene or a fragment thereof or related cDNA
can be inserted into a suitable expression vector, wherein it
is operatively linked to an expression control sequence; host
cells, preferably unicellular, can be transformed or
transfected with such an expression vector; and an MN
protein/polypeptide, preferably an MN protein, is expressed
therein. Such a recombinant protein or polypeptide can be
glycosylated or nonglycosylated, preferably glycosylated, and
can be purified to substantial purity. The invention further
concerns MN proteins/polypeptides which are synthetically or
otherwise biologically prepared.
Said MN proteins/polypeptides can be used in assays
to detect MN antigen in patient samples and in serological
assays to test for MN-specific antibodies. MN
proteins/polypeptides of this invention are serologically
active, immunogenic and/or antigenic. They can further be
used as immunogens to produce MN-specific antibodies,
polyclonal and/or monoclonal, as well as an immune T-cell
response.
The invention further is directed to MN-specific
antibodies, which can be used diagnostically/prognostically
and may be used therapeutically. Preferred according to this
invention are MN-specific antibodies reactive with the
epitopes represented respectively by the amino acid sequences
of the MN protein shown in Figure 1(A-C) as follows: from AA
62 to AA 67 [SEQ. ID. NO.: 10]; from AA 55 to AA 60 [SEQ. ID.
NO.: 11]; from AA 127 to AA 147 [SEQ. ID. NO.: 12]; from AA
36 to AA 51 [SEQ. ID. NO.: 13]; from AA 68 to AA 91 [SEQ. ID.
NO.: 14]; from AA 279 to AA 291 [SEQ. ID. NO.: 15]; and from
AA 435 to AA 450 [SEQ. ID. NO.: 16]. More preferred are
antibodies reactive with epitopes represented by SEQ. ID.
NOS.: 10, 11 and 12. Still more preferred are antibodies
reactive with the epitopes represented by SEQ. ID NOS: 10 and
CA 02192678 2000-05-18
-10-
11, as for example, respectively Mabs M75 and MN12. Most
preferred are monoclonal antibodies reactive with the epitope
represented by SEQ. ID. NO.: 10.
Also preferred according to this invention are
antibodies prepared against recombinantly produced MN proteins
as, for example, GEX-3X-MN, MN 20-19, MN-Fc and MN-PA. Also
preferred are MN-specific antibodies prepared against
glycosylated MN proteins, such as, MN 20-19 expressed in
baculovirus infected Sf9 cells.
A hybridoma that produces a representative MN-
specific antibody, the monoclonal antibody M75 (Mab M75), was
deposited at the ATCC under Number HB 11128 as indicated
above. The M75 antibody was used to discover and identify the
MN protein and can be used to identify readily MN antigen in
Western blots, in radioimmunoassays and immunohistochemically,
for example, in tissue samples that are fresh, frozen, or
formalin-, alcohol-, acetone- or otherwise fixed and/or
paraffin-embedded and deparaffinized. Another representative
MN-specific antibody, Mab MN12, is secreted by the hybridoma
MN 12.2.2, which was deposited at the ATCC under the
designation HB 11647.
MN-specific antibodies can be used, for example, in
laboratory diagnostics, using immunofluorescence microscopy or
immunohistochemical staining; as a component in immunoassays
for detecting and/or quantitating MN antigen in, for example,
clinical samples; as probes for immunoblotting to detect MN
antigen; in immunoelectron microscopy with colloid gold beads
for localization of MN proteins and/or polypeptides in cells;
and in genetic engineering for cloning the MN gene or
fragments thereof, or related cDNA. Such MN-specific
antibodies can be used as components of diagnostic/prognostic
kits, for example, for in vitro use on histological sections;
such antibodies can also and used for in vivo diagnostics/
prognostics, for example, such antibodies can be labeled
appropriately, as with a suitable radioactive isotope, and
used in vivo to locate metastases by scintigraphy. Further
such antibodies may be used in vivo therapeutically to treat
cancer patients with or without toxic and/or cytostatic agents
CA 02192678 2000-05-18
-11-
attached thereto. Further, such antibodies can be used in
vivo to detect the presence of neoplastic and/or pre-
neoplastic disease. Still further, such antibodies can be
used to affinity purify MN proteins and polypeptides.
This invention also concerns methods of treating
neoplastic disease and/or pre-neoplastic disease comprising
inhibiting the expression of MN genes by administering
antisense nucleic acid sequences that are substantially
complementary to mRNA transcribed from MN genes. Said
antisense nucleic acid sequences are those that hybridize to
such mRNA under stringent hybridization conditions. Preferred
are antisense nucleic acid sequences that are substantially
complementary to sequences at the 51 end of the MN cDNA
sequence shown in Figure 1(A-C). Preferably said antisense
nucleic acid sequences are oligonucleotides.
This invention also concerns vaccines comprising an
immunogenic amount of one or more substantially pure MN
proteins and/or polypeptides dispersed in a physiologically
acceptable, nontoxic vehicle, which amount is effective to
immunize a vertebrate, preferably a mammal, more preferably a
human, against a neoplastic disease associated with the
expression of MN proteins. Said proteins can be
recombinantly, synthetically or otherwise biologically
produced. A particular use of said vaccine would be to
prevent recidivism and/or metastasis. For example, it could
be administered to a patient who has had an MN-carrying tumor
surgically removed, to prevent recurrence of the tumor.
The immunoassays of this invention can be embodied
in test kits which comprise MN proteins/polypeptides and/or
MN-specific antibodies. Such test kits can be in solid phase
formats, but are not limited thereto, and can also be in
liquid phase format, and can be based on immunohistochemical
assays, ELISAs, particle assays, radiometric or fluorometric
assays either unamplified or amplified, using, for example,
avidin/biotin technology.
Abbreviations
The following abbreviations are used herein:
CA 02192678 2000-05-18
-12-
AA - amino acid
ATCC - American Type Culture Collection
bp - base pairs
BLV - bovine leukemia virus
BSA - bovine serum albumin
BRL - Bethesda Research Laboratories
CA - carbonic anhydrase
CAT - chloramphenicol acetyltransferase
Ci - curie
cm - centimeter
CMV - cytomegalovirus
cpm - counts per minute
C-terminus - carboxyl-terminus
C - degrees centigrade
DEAE - diethylaminoethyl
DMEM - Dulbecco modified Eagle medium
EDTA - ethylenediaminetetraacetate
EIA - enzyme immunoassay
ELISA - enzyme-linked immunosorbent assay
F - fibroblasts
FCS - fetal calf serum
FITC - fluorescein isothiocyanate
GEX-3X-MN - fusion protein MN glutathione S-transferase
H - HeLa cells
HEF - human embryo fibroblasts
HeLa K - standard type of HeLa cells
HeLa S - Stanbridge's mutant HeLa D98/AH.2
H/F-T - hybrid HeLa fibroblast cells that are
tumorigenic; derived from HeLa D98/AH.2
H/F-N - hybrid HeLa fibroblast cells that are
nontumorigenic; derived from HeLa D98/AH.2
HRP - horseradish peroxidase
Inr - initiator
IPTG - isopropyl-beta-D-thiogalacto-pyranoside
kb - kilobase
kbp - kilobase pairs
kd - kilodaltons
LCMV - lymphocytic choriomeningitis virus
CA 02192678 2000-05-18
-13-
LTR - long terminal repeat
M - molar
mA - milliampere
MAb - monoclonal antibody
ME - mercaptoethanol
MEM - minimal essential medium
min. - minute(s)
mg - milligram
ml - milliliter
mm - millimolar
MMC - mitomycin C
MLV - murine leukemia virus
N - normal concentration
NEG - negative
ng - nanogram
nt - nucleotide
N-terminus - amino-terminus
ODN - oligodeoxynucleotide
ORF - open reading frame
PA - Protein A
PBS - phosphate buffered saline
PCR - polymerase chain reaction
PEST - combination of one-letter abbreviations for
proline, glutamic acid, serine, threonine
pI - isoelectric point
PMA - phorbol 12-myristate 13-acetate
POS - positive
Py - pyrimidine
RIA - radioimmunoassay
RIP - radioimmunoprecipitation
RIPA - radioimmunoprecipitation assay
RNP - RNase protection assay
SDRE - serum dose response element
SDS - sodium dodecyl sulfate
SDS-PAGE - sodium dodecyl sulfate-polyacrylamide gel
electrophoresis
SINE - short interspersed repeated sequence
- - -------- ------ -------
WO 95/34650 2192678 PCTIUS95/07628
-14-
SP-RIA - solid-phase radioimmunoassay
SSDS - synthetic splice donor site
SSPE - NaCl (0.18 M), sodium phosphate (0.01 M), EDTA
(0.001 M)
TBE - Tris-borate/EDTA electrophoresis buffer
TCA - trichloroacetic acid
TC media - tissue culture media
TMB - tetramethylbenzidine
Tris - tris (hydroxymethyl) aminomethane
pCi - microcurie
pg - microgram
Al - microliter
AM - micromolar
VSV - vesicular stomatitis virus
X-MLV - xenotropic marine leukemia virus
Cell Lines
HeLa K -- standard type of HeLa cells; aneuploid,
epithelial-like cell line isolated from a
human cervical adenocarcinoma [Gey et al.,
Cancer Res., 12: 264 (1952); Jones et al.,
Obstet. Gvnecol., 38: 945-949 (1971)]
obtained from Professor B. Korych, [Institute
of Medical Microbiology and Immunology,
Charles University; Prague, Czech Republic)
HeLa D98/AH.2 -- Mutant HeLa clone that is hypoxanthine
(also HeLa S) guanine phosphoribosyl transferase-deficient
(HGPRT') kindly provided by Eric J. Stanbridge
[Department of Microbiology, College of
Medicine, University of California, Irvine,
CA (USA)] and reported in Stanbridge et al.,
Science, 215: 252-259 (15 Jan. 1982); parent
of hybrid cells H/F-N and H/F-T, also
obtained from E.J. Stanbridge.
NIH-3T3 -- murine fibroblast cell line reported in
Aaronson, Science, 237: 178 (1987).
2192678
WO 95/34650 PCTIUS95/07628
-15-
xC -- cells derived from a rat rhabdomyosarcoma
induced with Rous sarcoma virus-induced rat
sarcoma [Svoboda, J., Natl. Cancer Center
Institute Monograph No. 17, IN:
"International Conference on Avian Tumor
Viruses" (J.W. Beard ed.), pp. 277-298
(1964)), kindly provided by Jan Svoboda
[Institute of Molecular Genetics,
Czechoslovak Academy of Sciences; Prague,
Czech Republic]; and
CGL1 -- H/F-N hybrid cells (HeLa D98/AH.2 derivative)
CGL2 -- H/F-N hybrid cells (HeLa D98/AH.2 derivative)
CGL3 -- H/F-T hybrid cells (HeLa D98/AH.2 derivative)
CGL4 -- H/F-T hybrid cells (HeLa D98/Ah.2 derivative)
Nucleotide and Amino Acid Sequence Symbols
The following symbols are used to represent
nucleotides herein:
Base
Symbol Meaning
A adenine
C cytosine
G guanine
T thymine
U uracil
I inosine
M A or C
R A or G
W A or T/U
S C or G
Y C or T/U
K G or T/U
V A or C or G
H A or C or T/U
CA 02192678 2000-05-18
-16-
D A or G or T/U
B C or G or T/U
N/X A or C or G or T/U
There are twenty main amino acids, each of which is
specified by a different arrangement of three adjacent
nucleotides (triplet code or codon), and which are linked
together in a specific order to form a characteristic protein.
A three-letter or one-letter convention is used herein to
identify said amino acids, as, for example, in Figure 1(A-C)
as follows:
3 Ltr. 1 Ltr.
Amino acid name Abbrev. Abbrev.
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic Acid Asp D
Cysteine Cys C
Glutamic Acid Glu E
Glutamine Gln Q
Glycine Gly G
Histidine His H
Isoleucine Ile I
Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
Tryptophan Trp W
Tyrosine Tyr Y
Valine Val V
Unknown or other X
BRIEF DESCRIPTION OF THE FIGURES
Figure 1(A-C) provides the nucleotide sequence for a
full-length MN cDNA [SEQ. ID. NO.: 1] clone isolated as
CA 02192678 2000-05-18
-17-
described herein. Figure 1(A-C) also sets forth the predicted
amino acid sequence [SEQ. ID. NO.: 2] encoded by the CDNA.
Figure 2 compares the results of immunizing baby
rats to XC tumor cells with rat serum prepared against the
fusion protein MN glutathione S-transferase (GEX-3X-MN) (the
IM group) with the results of immunizing baby rats with
control rat sera (the C group). Each point on the graph
represents the tumor weight of a tumor from one rat. Example
2 details those experiments.
Figure 3(A-F) provides a 10,898 bp complete genomic
sequence of MN [SEQ. ID. NO.: 5]. The base count is as
follows: 2654 A; 2739 C; 2645 G; and 2859 T. The 11 exons
are shown in capital letters.
Figure 4 is a restriction map of the full-length MN
cDNA. The open reading frame is shown as an open box. The
thick lines below the restriction map illustrate the sizes and
positions of two overlapping cDNA clones. The horizontal
arrows indicate the positions of primers R1 [SEQ. ID. NO.: 7]
and R2 [SEQ. ID. NO.: 8] used for the 5' end RACE. Relevant
restriction sites are BamHI (B), EcoRV (V), EcoRI (E), PstI
(Ps) , PvuII (Pv) .
Figure 5 is a map of the human MN gene. The
numbered cross-hatched boxes represent exons. The box
designated LTR denotes a region of homology to HERV-K LTR.
The empty boxes are Alu-related sequences.
Figure 6 is a nucleotide sequence for the proposed
promoter of the human MN gene [SEQ. ID. No.: 27]. The
nucleotides are numbered from the transcription initiation
site according to RNase protection assay. Potential
regulatory elements are overlined. Transcription start sites
are indicated by asterisks (RNase protection) and dots (RACE).
The sequence of the 1st exon begins under the asterisks.
Figure 7 provides a schematic of the alignment of MN
genomic clones according to their position related to the
transcription initiation site. All the genomic fragments
except Bd3 were isolated from a lambda FIX III genomic library
derived from HeLa cells. Clone Bd3 was derived from a human
fetal brain library.
T-_
WO 95134650 219267 PCT(US95/07628
-18-
Figure 8 shows the construction and cloning of a
series of 5' deletion mutants of MN's putative promoter region
linked to the bacterial CAT gene.
DETAILED DESCRIPTION
The MN gene is shown herein to be organized into 11
exons and 10 introns. Described herein is the cloning and
sequencing of the MN cDNA and genomic sequences, and the
genetic engineering of MN proteins -- such as the GEX-3X-MN,
MN-PA, MN-Fc and MN 20-19 proteins. The recombinant MN
proteins can be conveniently purified by affinity
chromatography.
MN is manifested in HeLa cells by a twin protein,
p54/58N. Immunoblots using a monoclonal antibody reactive
with p54/58N (MAb M75) revealed two bands at 54 kd and 58 kd.
Those two bands may correspond to one type of protein that
differs by glycosylation pattern or by how it is processed.
Herein, the phrase "twin protein" indicates p54/58N.
The expression of MN proteins appears to be
diagnostic/prognostic for neoplastic disease. The MN twin
protein, p54/58N, was found to be expressed in HeLa cells and
in Stanbridge's tumorigenic (H/F-T) hybrid cells [Stanbridge
et al., Somatic Cell Genet. 7: 699-712 (1981); and Stanbridge
et al., Science, 215: 252-259 (1982)) but not in fibroblasts
or in non-tumorigenic (H/F-N) hybrid cells [Stanbridge et al.,
,id.]. In early studies reported in Zavada et al. WO 93/18152,
supra, MN proteins were found in immunoblots prepared from
human ovarian, endometrial and uterine cervical carcinomas,
and in some benign neoplasias (as mammary papilloma) but not
from normal ovarian, endometrial, uterine or placental
tissues. Example 1 herein details further research on MN gene
expression wherein MN antigen, as detected by
immunohistochemical staining, was found to be prevalent in
tumor cells of a number of cancers, including cervical,
bladder, head and neck, and renal cell carcinomas among
others. Further, the immunohistochemical staining experiments
of Example 1 show that among normal tissues tested, only
normal stomach tissues showed-routinely and extensively the
CA 02192678 2000-05-18
-19-
presence of MN antigen. MN antigen is further shown herein to
be present sometimes in morphologically normal-appearing areas
of tissue specimens exhibiting dysplasia and/or malignancy.
MN Gene--Cloning and Sequencing
Figure 1(A-C) provides the nucleotide sequence for a
full-length MN cDNA clone isolated as described below [SEQ.
ID. NO.: 1]. Figure 3(A-F) provides a complete MN genomic
sequence [SEQ. ID. NO.: 5]. Figure 6 shows the nucleotide
sequence for a proposed MN promoter [SEQ. ID. NO.: 27].
It is understood that because of the degeneracy of
the genetic code, that is, that more than one codon will code
for one amino acid [for example, the codons TTA, TTG, CTT,
CTC, CTA and CTG each code for the amino acid leucine (leu)],
that variations of the nucleotide sequences in, for example,
SEQ. ID. NOS.: 1 and 5 wherein one codon is substituted for
another, would produce a substantially equivalent protein or
polypeptide according to this invention. All such variations
in the nucleotide sequences of the MN cDNA and complementary
nucleic acid sequences are included within the scope of this
invention.
It is further understood that the nucleotide
sequences herein described and shown in Figures 1(A-C), 3(A-F)
and 6, represent only the precise structures of the cDNA,
genomic and promoter nucleotide sequences isolated and
described herein. It is expected that slightly modified
nucleotide sequences will be found or can be modified by
techniques known in the art to code for substantially similar
or homologous MN proteins and polypeptides, for example, those
having similar epitopes, and such nucleotide sequences and
proteins/ polypeptides are considered to be equivalents for
the purpose of this invention. DNA or RNA having equivalent
codons is considered within the scope of the invention, as are
synthetic nucleic acid sequences that encode proteins/
polypeptides homologous or substantially homologous to MN
proteins/polypeptides, as well as those nucleic acid sequences
that would hybridize to said exemplary sequences [SEQ. ID.
NOS. 1, 5 and 27] under stringent conditions, or that, but for
_T
CA 02192678 2003-09-15
-20-
the degeneracy of the genetic code would hybridize to said
cDNA nucleotide sequences under stringent hybridization
conditions. Modifications and variations of nucleic acid
sequences as indicated herein are considered to result in
sequences that are substantially the same as the exemplary MN
sequences and fragments thereof.
Partial cDNA clone
In Zavada et al., id., the isolation of a partial MN
cDNA clone of 1397 bp in length was described. A lambda gtll
cDNA library of LMCV-infected HeLa cells was prepared and
subjected to immunoscreening with Mab M75 in combination with
goat anti-mouse antibodies conjugated with alkaline
phosphatase. One positive clone was picked and subcloned into
the NotI site of pBlusecript KS [Stratagen; La Jolla, CA
(USA)] thereby creating pBluscript-MN.
Two oppositely oriented nested deletions were made
using Erase-a-BaseTM kit [Promega; Madison, WI (USA)] and
sequenced by dideoxy method with a T7 sequencing kit
[Pharmacia; Piscataway, NJ (USA)]. The sequencing showed a
partial cDNA clone, the insert being 1397 bp long. The
sequence comprises a large 1290 bp open reading frame and 107
bp 3' untranslated region containing a polyadenylation signal
(AATAAA). However, the sequence surrounding the first ATG
codon in the open reading frame (ORF) did not fit the
definition of a translational start site. In addition, as
followed from a comparison of the size of the MN clone with
that of the corresponding mRNA in a Northern blot, the cDNA
was shown to be missing about 100 bp from the 5' end of its
sequence.
Full-Length cDNA Clone
Attempts to isolate a full-length clone from the
original cDNA library failed. Therefore, the inventors
performed a rapid amplification of cDNA ends (RACE) using MN-
specific primers, R1 and R2 [SEQ. ID. NOS.: 7 and 8], derived
from the 5' region of the original cDNA clone. The RACE
product was inserted into pBluescript, and the entire
* trade-mark
CA 02192678 2000-05-18
-21-
population of recombinant plasmids was sequenced with an MN-
specific primer ODN1 [SEQ. ID. NO.: 3]. In that way, a
reliable sequence at the very 5' end of the MN cDNA as shown
in Figure 1(A-C) [SEQ. ID. NO.: 1] was obtained.
Specifically, RACE was performed using 5' RACE
System [GIBCO BRL; Gaithersburg, MD (USA)] as follows. 1 g
of mRNA (the same as above) was used as a template for the
first strand cDNA synthesis which was primed by the MN-
specific antisense oligonucleotide, R1 (5'-
TGGGGTTCTTGAGGATCTCCAGGAG-3') [SEQ. ID. NO.: 7]. The first
strand product was precipitated twice in the presence of
ammonium acetate and a homopolymeric C tail was attached to
its 3' end by TdT. Tailed cDNA was then amplified by PCR
using a nested primer, R2 (5'-CTCTAACTTCAGGGAGCCCTCTTCTT-3')
[SEQ. ID. NO.: 8] and an anchor primer that anneals to the
homopolymeric tail (5'-CUACUACUACUAGGCCACGCGTCGACTAGTACGGGI
IGGGIIGGGIIG-3') [SEQ. ID. NO.: 9]. The amplified product
was digested with BamHI and Sall restriction enzymes and
cloned into pBluescript II KS plasmid. After transformation,
plasmid DNA was purified from the whole population of
transformed cells and used as a template for sequencing with
the MN-specific primer ODN1 [SEQ. ID. NO.: 3; a 29-mer 5'
CGCCCAGTGGGTCATCTTCCCCAGAAGAG 3'].
Based upon results of the RACE analysis, the full-
length MN cDNA sequence was seen to contain a single ORF
starting at position 12, with an ATG codon that is in a good
context (GCGCATGG) with the rule proposed for translation
initiation [Kozak, J. Cell. Biol., 108: 229-241 (1989)].
[See below under Mapping of MN Gene Transcription Initiation
Site for fine mapping of the 5' end of the MN gene.] The AT
rich 3' untranslated region contains a polyadenylation signal
(AATAAA) preceding the end of the cDNA by 10 bp.
Surprisingly, the sequence from the original clone as well as
from four additional clones obtained from the same cDNA
library did not reveal any poly(A) tail. Moreover, just
downstream of the poly(A) signal, an ATTTA motif that is
thought to contribute to mRNA instability [Shaw and Kamen,
Cell, 46: 659-667 (1986)] was found. That fact raised the
CA 02192678 2003-09-15
-22-
possibility that the poly (A) tail is missing due to the
specific degradation of the MN mRNA.
Genomic clones
To study MN regulation, MN genomic clones were
isolated. One MN genomic clone (Bd3) was isolated from a
human cosmid library prepared from fetal brain using both MN
cDNA as a probe and the MN-specific primers derived from the
5' end of the cDNA ODN1 [SEQ. ID. NO.: 3, supra] and ODN2
[SEQ. ID NO.: 4; 19-mer (5' GGAATCCTCCTGCATCCGG 3')].
Sequence analysis revealed that that genomic clone covered a
region upstream from a MN transcription start site and ending
with the BamHI restriction site localized inside the MN cDNA.
Other MN genomic clones can be similarly isolated.
In order to identify the complete genomic region of
MN, the human genomic library in Lambda FIX it vector
(Stratagene) was prepared from HeLa chromosomal DNA and
screened by plaque hybridization using MN cDNA as described
below. Several independent MN recombinant phages were
identified, isolated and characterized by restriction mapping
and hybridization analyses. Four overlapping recombinants
covering the whole genomic region of MN were selected,
digested and subcloned into pBluescript. The subclones were
then subjected to bidirectional nested deletions and
sequencing. DNA sequences were compiled and analyzed by
computer using the DNASIS software package.
The details of isolating genomic clones covering the
complete genomic region for MN are provided below. Figure 7
provides a schematic of the alignment of MN genomic clones
according to the transcription initiation site. Plasmids
containing the A4a clone and the XE1 and XE3 subclones were
deposited at the American Type Culture Collection (ATCC) at
10801 University Blvd., Manassas, Virginia 20110-2209 (USA) on
June 6, 1995, respectively under ATCC Deposit Nos. 97199,
97200, and 97198.
* trade-mark
CA 02192678 2003-09-15
-23-
Isolation of Genomic DNA Clones
The Sau3AI human HeLa genomic library was prepared
in Lambda FIX II vector [Stratagene; La Jolla, CA (USA)]
according to manufacturer's protocol. Human fetal brain
cosmid library in SuperCos*cosmid was from Stratagene.
Recombinant phages or bacteria were plated at 1 x 105 plaque
forming units on 22x22 cm Nunc plates or 5 x 104 cells on 150
mm Petri dishes, and plaques or colonies were transferred to
Hybond N membranes (Amersham). Hybridization was carried out
with the full-length MN cDNA labeled with [P32]PdCTP by the
Multiprime*DNA labeling method (Amersham) at 65 C in 6 x SSC,
0.5% SDS, 10 x Denhardt's and 0.2 mg/1 ml salmon sperm DNA.
Filters were washed twice in 2 x SSC, 0.1% SDS at 65 C for 20
min. The dried filters were exposed to X-ray films, and
positive clones were picked up. Phages and bacteria were
isolated by 3-4 sequential rounds of screening.
Subcloning and DNA Sequencing
Genomic DNA fragments were subcloned into a
pBluescript KS and templates for sequencing were generated by
serial nested deletions using the Erase-a-Base system.
Sequencing was performed by the dideoxynucleotide chain
termination method using T7 sequencing kit (Pharmacia).
Nucleotide sequence alignments and analyses were carried out
using the DNASIS*software package (Hitachi software
Engineering).
Exon-Intron Structure of Complete MN Genomic Region
The complete sequence of the overlapping clones
contains 10,898 bp (SEQ. ID. NO.: 5). Figure 5 depicts the
organization of the human MN gene, showing the location of all
11 exons as well as the 2 upstream and 6 intronic Alu repeat
elements. All the exons are small, ranging from 27 to 191 bp,
with the exception of the first exon which is 445 bp. The
intron sizes range from 89 to 1400 bp.
Table 1 below lists the splice donor and acceptor
sequences that conform to consensus splice sequences including
the AG-GT motif [Mount, "A catalogue of splice junction
sequences," Nucleic Acids Res. 10: 459-472 (1982)].
* trade-mark
CA 02192678 2000-05-18
-24-
TABLE 1
Exon-Intron Structure of the Human MN Gene
SEQ SEQ
Genomic ID 5'splice ID
Exon Size Position** NO donor No
1 445 *3507-3951 28 AGAAG gtaagt 67
2 30 5126-5155 29 TGGAG gtgaga 68
3 171 5349-5519 30 CAGTC gtgagg 69
4 143 5651-5793 31 CCGAG gtgagc 70
5 93 5883-5975 32 TGGAG gtacca 71
6 67 7376-7442 33 GGAAG gtcagt 72
7 158 8777-8934 34 AGCAG gtgggc 73
8 145 9447-9591 35 GCCAG gtacag 74
9 27 9706-9732 36 TGCTG gtgagt 75
10 82 10350-10431 37 CACAG gtatta 76
11 191 10562-10752 38 ATAAT end
SEQ SEQ
Genomic ID 3'splice ID
Intron Size Position** NO acceptor NO
1 1174 3952-5125 39 atacag GGGAT 77
2 193 5156-5348 40 ccccag GCGAC 78
3 131 5520-5650 41 acgcag TGCAA 79
4 89 5794-5882 42 tttcag ATCCA 80
5 1400 5976-7375 43 ccccag GAGGG 81
6 1334 7443-8776 44 tcacag GCTCA 82
7 512 8935-9446 45 ccctag CTCCA 83
8 114 9592-9705 46 ctccag TCCAG 84
9 617 9733-10349 47 tcgcag GTGACA 85
10 130 10432-10561 48 acacag AAGGG 86
** positions are related to nt numbering in whole genomic
sequence including the 5' flanking region [Figure 3(A-F)]
* number corresponds to transcription initiation site
determined below by RNase protection assay
2192678
WO 95134650 PCT1US95107628
-25-
A search for sequences related to MN gene in the
EMBL Data Library did not reveal any specific homology except
for 6 complete and 2 partial Alu-type repeats with homology to
Alu sequences ranging from 69.8% to 91% (Jurka and
Milosavljevic, "Reconstruction and analysis of human Alu
genes," J. Mol. Evol. 32: 105-121 (1991)]. Below under the
Characterization of the 5' Flanking Region, also a 222 bp
sequence proximal to the 5' end of the genomic region is shown
to be closely homologous to a region of the HERV-K LTR.
Mapping of MN Gene Transcription Initiation Site
In the earlier attempt to localize the site of
transcription initiation of the MN gene by RACE (above), the
obtained a major PCR fragment whose sequence placed the start
site 12 bp upstream from the first codon of the ORF. That
result was obtained probably due to a preferential
amplification of the shortest form of mRNA. Therefore, the
inventors used an RNase protection assay (RNP) for fine
mapping of the 5' end of the MN gene. The probe was a
uniformly labeled 470 nucleotide copy RNA (nt -205 to +265)
[SEQ. ID. NO.: 55], which was hybridized to total RNA from
MN-expressing HeLa and CGL3 cells and analyzed on a sequencing
gel. That analysis has shown that the MN gene transcription
initiates at multiple sites, the 5' end of the longest MN
transcript being 30 nt longer than that previously
characterized by RACE.
RNase Protection Assay
32P-labeled RNA probes were prepared with an RNA
Transcription kit (Stratagene). In vitro transcription
reactions were carried out using 1 Ftg of the linearized
plasmid as a template, 50 tCi of [P32P]rUTP (800 Ci/mmol), 10 U
of either T3 or T7 RNA polymerase and other components of the
Transcription Kit following instructions of the supplier. For
mapping of the 5' end of MN mRNA, the 470 bp NcoI-BamHI
fragment (Ncol filled in by Klenow enzyme) of Bd3 clone (nt -
205 to +265 related to transcription start) was subcloned to
EcoRV-BamHI sites of pBiuescript SK+, linearized with Hindlil
CA 02192678 2000-05-18
-26-
and labeled with T3 RNA polymerase. For the 3' end mRNA
analysis, probe, that was prepared using T7 RNA polymerase on
KS-dXE3-16 template (one of the nested deletion clones of MN
genomic region XE3 subclone) digested with Sau3AI (which cuts
exon 11 at position 10,629), was used. Approximately 3 x 105
cpm of RNA probe were used per one RNase protection assay
reaction.
RNase protection assays (RNP) were performed using
Lysate RNase Protection Kit (USB/Amersham) according to
protocols of the supplier. Briefly, cells were lysed using
Lysis Solution at concentration of approximately 10' cells/ml,
and 45 iti of the cell homogenate were used in RNA/RNA
hybridization reactions with 32P-labeled RNA probes prepared as
described above. Following overnight hybridizations at 42 C,
homogenates were treated for 30 min at 37 C with RNase cocktail
mix. Protected RNA duplexes were run on polyacrylamide/urea
denaturing sequencing gels. Fixed and dried gels were exposed
to X-ray film for 24 - 72 hours.
Mapping of MN Gene Transcription Termination Site
An RNase protection assay, as described above, was
also used to verify the 3' end of the MN cDNA. That was
important with respect to our previous finding that the cDNA
contains a poly(A) signal but lacks a poly(A) tail, which
could be lost during the proposed degradation of MN mRNA due
to the presence of an instability motif in its 3' untranslated
region. RNP analysis of MN mRNA with the fragment of the
genomic clone XE3 covering the region of interest corroborated
our data from MN cDNA sequencing, since the 3' end of the
protected fragment corresponded to the last base of MN cDNA
(position 10,752 of the genomic sequence). That site also
meets the requirement for the presence of a second signal in
the genomic sequence that is needed for transcription
termination and polyadenylation [McLauchlan et al., Nucleic
Acids Res., 13: 1347 (1985)]. Motif TGTGTTAGT (nt 10,759-
10,767) corresponds well to both the consensus sequence and
the position of that signal within 22 bp downstream from the
polyA signal (nt 10,737-10,742).
CA 02192678 2000-05-18
-27-
Characterization of the 5' Flanking Region
The Bd3 genomic clone isolated from human fetal
brain cosmid library was found to cover a region of 3.5 kb
upstream from the transcription start site of the MN gene. It
contains no significant coding region. Two Alu repeats are
situated at positions -2587 to -2296 [SEQ. ID. NO.: 56] and -
1138 to -877 [SEQ. ID. NO.: 57] (with respect to the
transcription start determined by RNP). The sequence proximal
to the 5' end is strongly homologous (91.4% identity) to the
U3 region of long terminal repeats of human endogenous
retroviruses HERV-K [Ono, M., "Molecular cloning and long
terminal repeat sequences of human endogenous retrovirus genes
related to types A and B retrovirus genes," J. Virol, 58:
937-944 (1986)]. The LTR-like fragment is 222 bp long with an
A-rich tail at its 3' end. Most probably, it represents part
of SINE (short interspersed repeated sequence) type nonviral
retroposon derived from HERV-K [Ono et al., "A novel human
nonviral retroposon derived from an endogenous retrovirus,"
Nucleic Acids Res., 15: 8725-8373 (1987)]. There are no
sequences corresponding to regulatory elements in this
fragment, since the 3' part of U3, and the entire R and U5
regions of LTR are absent from the Bd3 genomic clone, and the
glucocorticoid responsive element as well as the enhancer core
sequences are beyond its 5' border.
However, two keratinocyte-dependent enhancers were
identified in the sequence downstream from the LTR-like
fragment at positions -3010 and -2814. Those elements are
involved in transcriptional regulation of the E6-E7 oncogenes
of human papillomaviruses and are thought to account for their
tissue specificity [Cripe et al., "Transcriptional regulation
of the human papillomavirus-16 E6-E7 promoter by a
keratinocyte-dependent enhancer, and by viral E2 trans-
activator and repressor gene products: implications for
cervical carcinogenesis," EMBO J., 6: 3745-3753 (1987)].
Nucleotide sequence analysis of the DNA 5' to the
transcription start (from nt -507) revealed no recognizable
TATA box within the expected distance from the beginning of
the first exon (Figure 6). However, the presence of potential
-T_
1 r '3
WO 95134650 PCT1LS95107628
-28-
binding sites for transcription factors suggests that this
region might contain a promoter for the MN gene. There are
several consensus sequences for transcription factors APi and
AP2 as well as for other regulatory elements, including a p53
binding site [Locker and Buzard, "A dictionary of
transcription control sequences," J DNA Seauencina and
Mapping, 1: 3-11 (1990); Imagawa et al., "Transcription
factor AP-2 mediates induction by two different signal-
transduction pathways: protein kinase C and cAMP," Cell. 51:
251-260 (1987); El Deiry et al., "Human genomic DNA sequences
define a consensus binding site for p53," Nat. Genet.. 1: 44-
49 (1992)]. Although the putative promoter region contains
59.3% C+G, it does not have additional attributes of CpG-rich
islands that are typical for TATA-less promoters of
housekeeping genes (Bird, "CpG-rich islands and the function
of DNA methylation," Nature, 321: 209-213 (1986)]. Another
class of genes lacking TATA box utilizes the initiator (Inr)
element as a promoter. Many of these genes are not
constitutively active, but they are rather regulated during
differentiation or development. The Inr has a consensus
sequence of PyPyPyCAPyPyPyPyPy [SEQ. ID. NO.: 23] and
encompasses the transcription start site [Smale and Baltimore,
"The `initiator' as a transcription control element," Cell.
57: 103-113 (1989)]. There are two such consensus sequences
in the MN putative promoter; however, they do not overlap the
transcription start (Figure 6).
In the initial experiments, the inventors were
unable to show promoter activity in human carcinoma cells HeLa
and CGL3 that express MN, using the 3.5 kb Bd3 fragment and
series of its deletion mutants (from nt -933 to -30) [SEQ. ID.
NO.: 58] fused to chioramphenicol acetyl transferase (CAT)
gene in a transient system. This might indicate that either
the promoter activity of the region 5' to the MN transcription
start is below the sensitivity of the CAT assay, or additional
regulatory elements not present in our constructs are required
for driving the expression of MN gene.
With respect to this fact, an interesting region was
found in the middle of the MN gene. The region is about 1.4
E` 1 ` 26 78 PCTIUS9510762S
WO 95134650
-29-
kb in length [nt 4,600-6,000 of the genomic sequence; SEQ. ID.
NO.: 49] and spans from the 3' part of the 1st intron to the
end of the 5th exon. The region has the character of a
typical CpG-rich island, with 62.8% C+G content and 82 CpG:
131 GpC dinucleotides. Moreover, there are multiple putative
binding sites for transcription factors AP2 and Spi [Locker
and Buzard, supra; Briggs et al., "Purification and
biochemical characterization of the promoter-specific
transcription factor Sp-1," Science, 234: 47-52 (1986)]
concentrated in the center of this area. Particularly the 3rd
intron of 131 bp in length contains three Spl and three AP2
consensus sequences. That data indicates the possible
involvement of that region in the regulation of MN gene
expression. However, functionality of that region, as well as
other regulatory elements found in the proposed 5' MN
promoter, remains to be determined.
MN Promoter Analysis
To define sequences necessary for MN gene
expression, a series of 5' deletion mutants of the putative
promoter region were fused to the bacterial chloramphenicol
acetyltransferase (CAT) gene. [See Figure 8.] The pMN-CAT
deletion constructs were transfected using a DEAE dextran
method for transient expression into HeLa and CGL3 cells.
Those cells were used since they naturally express MN protein,
and thus, should contain all the required transcription
factors.
After 48 hours, crude cell lysates were prepared and
the activity of the expressed CAT was evaluated according to
acetylation of [14C]chloramphenicol by thin layer
chromatography. However, no MN promoter CAT activity was
detected in either the HeLa or the CGL3 cells in a transient
system. On the other hand, reporter CAT plasmids with viral
promoters (e.g. pBLV-LTR + tax transactivator, pRSV CAT and
pSV2 CAT), that served as positive controls, gave strong
signals on the chromatogram. [pSV2 CAT carries the SV40
origin and expresses CAT from the SV40 early promoter (PE).
CA 02192678 2000-05-18
-30-
pRSV CAT expresses CAT from the Rous sarcoma virus (RSV)LTR
promoter (PLTR) = l
No detectable CAT activity was observed in
additional experiments using increasing amounts of transfected
plasmids (from 2 to 20 g DNA per dish) and prolonged periods
of cell incubation after transcription. Increased cell
density also did not improve the results (in contrast to the
expectations based on density-dependent expression of native
MN protein in HeLa cells). Since the inventors had found
consensus sequences for transcription factors AP2 and AP1 in
the putative MN promoter, they studied the effect of their
inducers dexamethasone (1 m) and phorbol ester phorbol 12-
myristate 13-acetate (PMA 50 ng/ml) on CAT activity. However,
the MN promoter was unresponsive to those compounds.
The following provides explanations for the results:
--the putative MN promoter immediately preceding the
transcription initiation site is very weak, and its activity
is below the sensitivity of a standard CAT assay; --additional
sequences (e.g enhancers) are necessary for MN transcription.
To further shed light on the regulation of MN
expression at the level of transcription, constructs,
analogously prepared to the MN-CAT constructs, are prepared,
wherein the MN promoter region is upstream from the neomycin
phosphotransferase gene engineered for mammalian expression.
Such constructs are then transfected to cells which are
subjected to selection with G418. Activity of the promoter is
then evaluated on the basis of the number of G418 resistant
colonies that result. That method has the capacity to detect
activity of a promoter that is 50 to 100 times weaker in
comparison to promoters detectable by a CAT assay.
Deduced Amino Acid Sequence
The ORF of the MN cDNA shown in Figure 1(A-C) has
the coding capacity for a 459 amino acid protein with a
calculated molecular weight of 49.7 kd. MN protein has an
estimated pI of about 4. As assessed by amino acid sequence
analysis, the deduced primary structure of the MN protein can
be divided into four distinct regions. The initial
T __--
CA 02192678 2003-09-15
-31-
hydrophobic region of 37 amino acids (AA) corresponds to a signal peptide. The
mature protein has an N-terminal part of 377 AA, a hydrophobic
transmembrane segment of 20 AA and a C-terminal region of 25
AA. Alternatively, the MN protein can be viewed as having five
domains as follows: (1) a signal peptide [amino acids (AA) 1-
37; SEQ. ID. NO.: 6]; (2) a region of homology to collagen
alphal chain (AA 38-135; SEQ. ID. NO.: 50); (3) a carbonic
anhydrase domain (AA 136-391; SEQ. ID. NO.: 51); (4) a
transmembrane region (AA 415-434; SEQ. ID. NO.: 52); and (5)
an intracellular C terminus (AA 435-459; SEQ. ID. NO.: 53).
(The AA numbers are keyed to Figure 1.)
More detailed insight into MN protein primary
structure disclosed the presence of several consensus
sequences. One potential N-glycosylation site was found at
position 346 of Figure 1. That feature, together with a
predicted membrane-spanning region are consistent with the
results, in which MN was shown to be an N-glycosylated protein
localized in the plasma membrane. MN protein sequence deduced
from cDNA was also found to contain seven S/TPXX sequence
elements [SEQ. ID. NOS.: 25 AND 26] (one of them is in the
signal peptide) defined by Suzuki, J. Mol. Biol., 207: 61-84
(1989) as motifs frequently found in gene regulatory proteins.
However, only two of them are composed of the suggested
consensus amino acids.
Experiments have shown that the MN protein is able to
bind zinc cations, as shown by affinity chromatography using
Zn-charged chelating sepharose. MN protein immunoprecipitated
from HeLa cells by Mab M75 was found to have weak catalytic
activity of CA. The CA-like domain of MN has a structural
predisposition to serve as a binding site for small soluble
domains. Thus, MN protein could mediate some kind of signal
transduction.
MN protein from LCMV-infected HeLA cells was shown by
using DNA cellulose affinity chromatography to bind to
immobilized double-stranded salmon sperm DNA. The binding
activity required both the presence of zinc cations and the
absence of a reducing agent in the binding buffer.
CA 02192678 2003-09-15
-32-
Sequence similarities
Computer analysis of the-MN cDNA sequence was
carried out using DNASIS and PROSI] (Pharmacia Software
packages). GenBank* EMBL, Protein Identification Resource and
SWISS-PROT databases were searched for all possible sequence
similarities. In addition, a search for proteins sharing
sequence similarities with MN was performed in the MIPS
databank with the FastA program [Pearson and Lipman, PNAS
(USA), 85: 2444 (1988)].
The MN gene was found to clearly be a novel sequence
derived from the human genome. Searches for amino acid
sequence similarities in protein databases revealed as the
closest homology a level of sequence identity (38.9% in 256 AA
or 44% in an 170 AA overlap) between the central part of the
MN protein [AAs 136-391 (SEQ. ID. NO: 51)] or 221-390 [SEQ.
ID. NO.: 54] of Figure 1(A-C) and carbonic anhydrases (CA).
However, the overall sequence homology between the cDNA MN
sequence and cDNA sequences encoding different CA isoenzymes
is in a homology range of 48-50% which is considered by ones
in the art to be low. Therefore, the MN cDNA sequence is not
closely related to any CA cDNA sequences.
Only very closely related nt sequences having a
homology of at least 80-90% would hybridize to each other
under stringent conditions. A sequence comparison of the MN
cDNA sequence shown in Figure 1(A-C) ahd a corresponding cDNA
of the human carbonic anhydrase II (CA II) showed that there
are no stretches of identity between the two sequences that
would be long enough to allow for a segment of the CA II cDNA
sequence having 50 or more nucleotides to hybridize under
stringent hybridization conditions to the MN cDNA or vice
versa.
Although MN deduced amino acid sequences show some-
homology to known carbonic anhydrases, they differ from them
in several repects. Seven carbonic anhydrases are known
[Dodgson et al. (eds.), The Carbonic Anhydrases, (Plenum
Press; New York/London (1991)]. All of the known carbonic
anhydrases are proteins of about 30 kd, smaller than the
p54/58N-related products of the MN gene. Further, the
* trade-mark
CA 02192678 2000-05-18
-33-
carbonic anhydrases do not form oligomers as do the MN-related
proteins.
The N-terminal part of the MN protein (AA 38-135;
SEQ. ID. NO.: 50) shows a 27-30% identity with human collagen
alphal chain, which is an important component of the
extracellular matrix.
MN Proteins and/or Polypeptides
The phrase "MN proteins and/or polypeptides" (MN
proteins/polypeptides) is herein defined to mean proteins
and/or polypeptides encoded by an MN gene or fragments
thereof. An exemplary and preferred MN protein according to
this invention has the deduced amino acid sequence shown in
Figure 1(A-C). Preferred MN proteins/polypeptides are those
proteins and/or polypeptides that have substantial homology
with the MN protein shown in Figure 1(A-C). For example, such
substantially homologous MN proteins/ polypeptides are those
that are reactive with the MN-specific antibodies of this
invention, preferably the Mabs M75, MN12, MN9 and MN7 or their
equivalents.
A "polypeptide" is a chain of amino acids covalently
bound by peptide linkages and is herein considered to be
composed of 50 or less amino acids. A "protein" is herein
defined to be a polypeptide composed of more than 50 amino
acids.
MN proteins exhibit several interesting features:
cell membrane localization, cell density dependent expression
in HeLa cells, correlation with the tumorigenic phenotype of
HeLa x fibroblast somatic cell hybrids, and expression in
several human carcinomas among other tissues. As demonstrated
herein, for example, in Example 1, MN protein can be found
directly in tumor tissue sections but not in general in
counterpart normal tissues (exceptions noted infra in Example
1 as in normal stomach tissues). MN is also expressed
sometimes in morphologically normal appearing areas of tissue
specimens exhibiting dysplasia and/or malignancy. Taken
together, these features suggest a possible involvement of MN
CA 02192678 2000-05-18
-34-
in the regulation of cell proliferation, differentiation
and/or transformation.
It can be appreciated that a protein or polypeptide
produced by a neoplastic cell in vivo could be altered in
sequence from that produced by a tumor cell in cell culture or
by a transformed cell. Thus, MN proteins and/or polypeptides
which have varying amino acid sequences including without
limitation, amino acid substitutions, extensions, deletions,
truncations and combinations thereof, fall within the scope of
this invention. It can also be appreciated that a protein
extant within body fluids is subject to degradative processes,
such as, proteolytic processes; thus, MN proteins that are
significantly truncated and MN polypeptides may be found in
body fluids, such as, sera. The phrase "MN antigen" is used
herein to encompass MN proteins and/or polypeptides.
It will further be appreciated that the amino acid
sequence of MN proteins and polypeptides can be modified by
genetic techniques. One or more amino acids can be deleted or
substituted. Such amino acid changes may not cause any
measurable change in the biological activity of the protein or
polypeptide and result in proteins or polypeptides which are
within the scope of this invention, as well as, MN muteins.
The MN proteins and polypeptides of this invention
can be prepared in a variety of ways according to this
invention, for example, recombinantly, synthetically or
otherwise biologically, that is, by cleaving longer proteins
and polypeptides enzymatically and/or chemically. A preferred
method to prepare MN proteins is by a recombinant means.
Particularly preferred methods of recombinantly producing MN
proteins are described below for the GEX-3X-MN, MN 20-19, MN-
Fc and MN-PA proteins.
Recombinant Production of MN Proteins and Polypeptides
A representative method to prepare the MN proteins
shown in Figure 1(A-C) or fragments thereof would be to insert
the full-length or an appropriate fragment of MN cDNA into an
appropriate expression vector as exemplified below. In Zavada
et al., WO 93/18152, supra, production of a fusion protein
2192678
WO 95134650 PCT/US95107628
-35-
GEX-3X-MN using the partial cDNA clone (described above) in
the vector pGEX-3X (Pharmacia) is described. Nonglycosylated
GEX-3X-MN (the Mn fusion protein MN glutathione S-transferase)
from XL1-Blue cells. Herein described is the recombinant
production of both a glycosylated MN protein expressed from
insect cells and a nonglycosylated MN protein expressed from
E. coli using the expression plasmid pEt-22b [Novagen Inc.;
Madison, WI (USA)].
Baculovirus Expression Systems. Recombinant
baculovirus express vectors have been developed for infection
into several types of insect cells. For example, recombinant
baculoviruses have been developed for among others: Aedes
aeaypti, Autographa californica, Bombyx mor, Drosphila
melanogaster, Heliothis zea, Spodoptera fruaiperda, and
Trichoplusia ni [PCT Pub. No. WO 89/046699; Wright, Nature,
321: 718 (1986); Fraser et al., In Vitro Cell Dev. Biol.. 25:
225 (1989). Methods of introducing exogenous DNA into insect
hosts are well-known in the art. DNA transfection and viral
infection procedures usually vary with the insect genus to be
See, for example, Autoarapha [Carstens et al.,
Virology. 101: 311 (1980)]; Spodoptera [Kang, "Baculovirus
Vectors for Expression of Foreign Genes," in: Advances in
Virus Research. 35 (1988)]; and Heliothis (virescens) [PCT
Pub. No. WO 88/02030].
A wide variety of other host-cloning vector
combinations may be usefully employed in cloning the MN DNA
isolated as described herein. For example, useful cloning
vehicles may include chromosomal, nonchromosomal and synthetic
DNA sequences such as various known bacterial plasmids such as
pBR322, other E. coli plasmids and their derivatives and wider
host range plasmids such as RP4, phage DNA, such as, the
numerous derivatives of phage lambda, e.g., NB989 and vectors
derived from combinations of plasmids and phage DNAs such as
plasmids which have been modified to employ phage DNA
expression control sequences.
Useful hosts may be eukaryotic or prokaryotic and
include bacterial hosts such as E. col, and other bacterial
strains, yeasts and other fungi, animal or plant hosts such as
21
1926 78
WO 95/34650 PCT/US95107628
-36-
animal or plant cells in culture, insect cells and other
hosts. Of course, not all hosts may be equally efficient.
The particular selection of host-cloning vehicle combination
may be made by those of skill in the art after due
consideration of the principles set forth herein without
departing from the scope of this invention.
The particular site chosen for insertion of the
selected DNA fragment into the cloning vehicle to form a
recombinant DNA molecule is determined by a variety of
factors. These include size and structure of the protein or
polypeptide to be expressed, susceptibility of the desired
protein or polypeptide to endoenzymatic degradation by the
host cell components and contamination by its proteins,
expression characteristics such as the location of start and
stop codons, and other factors recognized by those of skill in
the art.
The recombinant nucleic acid molecule containing the
MN gene, fragment thereof, or cDNA therefrom, may be employed
to transform a host so as to permit that host (transformant)
to express the structural gene or fragment thereof and to
produce the protein or polypeptide for which the hybrid DNA
encodes. The recombinant nucleic acid molecule may also be
employed to transform a host so as to permit that host on
replication to produce additional recombinant nucleic acid
molecules as a source of MN nucleic acid and fragments
thereof. The selection of an appropriate host for either of
those uses is controlled by a number of factors recognized in
the art. These include, for example, compatibility with the
chosen vector, toxicity of the co-products, ease of recovery
of the desired protein or polypeptide, expression
characteristics, biosafety and costs.
Where the host cell is a procaryote such as E. coli,
competent cells which are capable of DNA uptake are prepared
from cells harvested after exponential growth phase and
subsequently treated by the CaCl2 method by well known
procedures. Transformation can also be performed after
forming a protoplast of the host cell.
CA 02192678 2000-05-18
-37-
Where the host used is an eukaryote, transfection
methods such as the use of a calcium phosphate-precipitate,
electroporation, conventional mechanical procedures such as
microinjection, insertion of a plasmid encapsulated in red
blood cell ghosts or in liposomes, treatment of cells with
agents such as lysophosphatidyl-choline or use of virus
vectors, or the like may be used.
The level of production of a protein or polypeptide
is governed by three major factors: (1) the number of copies
of the gene or DNA sequence encoding for it within the cell;
(2) the efficiency with which those gene and sequence copies
are transcribed and translated; and (3) the stability of the
mRNA. Efficiencies of transcription and translation (which
together comprise expression) are in turn dependent upon
nucleotide sequences, normally situated ahead of the desired
coding sequence. Those nucleotide sequences or expression
control sequences define, inter alia, the location at which an
RNA polymerase interacts to initiate transcription (the
promoter sequence) and at which ribosomes bind and interact
with the mRNA (the product of transcription) to initiate
translation. Not all such expression control sequences
function with equal efficiency. It is thus of advantage to
separate the specific coding sequences for the desired protein
from their adjacent nucleotide sequences and fuse them instead
to known expression control sequences so as to favor higher
levels of expression. This having been achieved, the newly
engineered DNA fragment may be inserted into a multicopy
plasmid or a bacteriophage derivative in order to increase the
number of gene or sequence copies within the cell and thereby
further improve the yield of expressed protein.
Several expression control sequences may be
employed. These include the operator, promoter and ribosome
binding and interaction sequences (including sequences such as
the Shine-Dalgarno sequences) of the lactose operon of E. coli
("the lac system"), the corresponding sequences of the
tryptophan synthetase system of E. coli ("the trp system"), a
fusion of the trp and lac promoter ("the tac system"), the
major operator and promoter regions of phage lambda (Or,P, and
- ------------- ---------- -
21926 78
WO 95134650 PCTIUS95/07625
-38-
ORPR,), and the control region of the phage fd coat protein.
DNA fragments containing these sequences are excised by
cleavage with restriction enzymes from the DNA isolated from
transducing phages that carry the lac or trp operons, or from
the DNA of phage lambda or fd. Those fragments are then
manipulated in order to obtain a limited population of
molecules such that the essential controlling sequences can be
joined very close to, or in juxtaposition with, the initiation
codon of the coding sequence.
The fusion product is then inserted into a cloning
vehicle for transformation or transfection of the appropriate
hosts and the level of antigen production is measured. Cells
giving the most efficient expression may be thus selected.
Alternatively, cloning vechicles carrying the lac, trp or
lambda PL control system attached to an initiation codon may be
employed and fused to a fragment containing a sequence coding
for a MN protein or polypeptide such that the gene or sequence
is correctly translated from the initiation codon of the
cloning vehicle.
The phrase "recombinant nucleic acid molecule" is
herein defined to mean a hybrid nucleotide sequence comprising
at least two nucleotide sequences, the first sequence not
normally being found together in nature with the second.
The phrase "expression control sequence" is herein
defined to mean a sequence of nucleotides that controls and
regulates expression of structural genes when operatively
linked to those genes.
The following are representative examples of
genetically engineering MN proteins of this invention. The
descriptions are exemplary and not meant to limit the
invention in any way.
Expression of MN 20-19 Protein
A representative, recombinantly produced MN protein
of this invention is the MN 20-19 protein which, when produced
in baculovirus-infected Sf9 cells [Spodoptera fruoiperda
cells; Clontech; Palo Alto, CA (USA)], is glycosylated. The
MN 20-19 protein misses the putative signal peptide (AAs 1-37)
CA 02192678 2000-05-18
-39-
of SEQ. ID. NO.: 6 [Figure 1(A-C)], has a methionine (Met) at
the N-terminus for expression, and a Leu-Glu-His-His-His-His-
His-His [SEQ. ID NO.: 22] added to the C-terminus for
purification.
In order to insert the portion of the MN coding
sequence for the GEX-3X-MN fusion protein into alternate
expression systems, a set of primers for PCR was designed.
The primers were constructed to provide restriction sites at
each end of the coding sequence, as well as in-frame start and
stop codons. The sequences of the primers, indicating
restriction enzyme cleavage sites and expression landmarks,
are shown below.
Primer #20:N-terminus
rTranslation start
5'GTCGCTAGCTCCATGGGTCATATGCAGAGGTTGCCCCGGATGCAG 3'
NheI NcoI NdeI -MN cDNA #1 [SEQ. ID. NO. 17]
Primer #19:C-terminus
1Translation stop
5' GAAGATCTCTTACTCGAGCATTCTCCAAGATCCAGCCTCTAGG 3'
BglII XhoI -MN cDNA [SEQ. ID. NO. 18]
The SEQ. ID. NOS.: 17 and 18 primers were used to amplify the
MN coding sequence present in the GEX-3X-MN vector using
standard PCR techniques. The resulting PCR product (termed MN
20-19) was electrophoresed on a 0.5% agarose/1X TBE gel; the
1.3 kb band was excised; and the DNA recovered using the Gene
Clean II kit according to the manufacturer's instructions
[Biol01; LaJolla, CA (USA)].
MN 20-19 and plasmid pET-22b were cleaved with the
restriction enzymes NdeI and XhoI, phenol-chloroform
extracted, and the appropriate bands recovered by agarose gel
electrophoresis as above. The isolated fragments were ethanol
co-precipitated at a vector:insert ratio of 1:4. After
CA 02192678 2003-09-15
-40-
resuspension, the fragments were ligated using T4 DNA ligase.
The resulting product was used to transform competent Novablud,
E. coli cells [Novagen, Inc.]. Plasmid mini-preps (Magic
Minipreps* Promega] from the resultant ampicillin resistant
colonies were screened for the presence of the correct insert
by restriction mapping. Insertion of the gene fragment into
the pET-22b plasmid using the NdeI and XhoI sites added a 6-
histidine tail to the protein that could be used for affinity
isolation.
to To prepare MN 20-19 for insertion into the
baculovirus expression system, the MN 20-19 gene fragment was
excised from pET-22b using the restriction endonucleases Xbal
and Pvul. The baculovirus shuttle vector pBacPAK8 [Clontech]
was cleaved with XbaI and PacI. The desired fragments (1.3 kb
for MN 20-19 and 5.5 kb for pBacPAK8) were isolated by agarose
gel electrophoresis, recovered using Gene Clean.II; and co-
precipitated at an insert:vector ratio of 2.4:1.
After ligation with T4 DNA ligase, the DNA was used
to transform competent NM522 E. coli cells (Stratagene).
Plasmid mini-preps from resultant ampicillin resistant
colonies were screened for the presence of the correct insert
by restriction mapping. Plasmid DNA from an appropriate
colony and linearized BacPAK6 baculovirus DNA [Clontech] were
used to transform Sf9 cells by standard techniques.
Recombination produced BacPAK'tviruses carrying the MN 20-19
sequence. Those viruses were plated onto' Sf9 cells and
overlaid with agar.
Plaques were picked and plated onto Sf9 cells. The
conditioned media and cells were collected. A small aliquot
of the conditioned media was set aside for testing. The cells
were extracted with PBS with 1% Triton X100.
The conditioned media and the cell extracts were dot
blotted onto nitrocellulose paper. The blot was blocked with
5% non-fat dried milk in PBS. Mab M75 were used to detect the
MN 20-19 protein in the dot blots. A rabbit anti-mouse Ig-HRP
was used to detect bound Mab M75. The blots were developed
with TMB/H202 with a membrane enhancer [KPL; Gaithersburg, MD
(USA)]. Two clones producing the strongest reaction on the
* trade-mark
CA 02192678 2003-09-15
-41-
dot blots were selected for expansion. One was used to
produce MN 20-19 protein in High Five cells (Invitrogen Corp.,
San Diego, CA (USA); BTI-TN-5BI-4; derived from Trichoplusia
ni egg cell homogenate]. MN 20-19 protein was purified from
the conditioned media from the virus infected High Five cells.
The MN 20-19 protein was purified from the
conditioned media by immunoaffinity chromatography. 6.5 mg of
Mab M75 was coupled to 1 g of Tresyl activated ToyopearlTM
[Tosoh, Japan (#14471)]. Approximately 150 ml of the
conditioned media was run through the M75-Toyopearl column.
The column was washed with PBS, and the MN 20-19 protein was
eluted with 1.5 M MgCl. The eluted protein was then dialyzed
against PBS.
Fusion Proteins with C-Terminal Part Including Transmembrane
Region Replaced by Fc or PA
MN fusion proteins in which the C terminal part
including the transmembrane region is replaced by the Fc
fragment of human IgG or by Protein A were constructed. Such
fusion proteins are useful to identify MN binding protein(s).
In such MN chimaeras, the whole N-terminal part of MN is
accessible to interaction with heterologous proteins, and the
C terminal tag serves for simple detection and purification of
protein complexes.
Fusion Protein MN-PA (Protein A)
_
In a first step, the 3' end of the MN cDNA encoding
the transmembrane region of the MN protein was deleted. The
plasmid pFLMN (e.g. pBluescript with full length MN cDNA) was
cleaved by EcoRI and blunt ended by S1 nuclease. Subsequent
cleavage by Sacl resulted in the removal of the EcoRI-SacI
fragment. The deleted fragment was then replaced by a Protein
A coding sequence that was derived from plasmid pEZZ
(purchased from Pharmacia), which had been cleaved with RsaI
and Sacl. The obtained MN-PA construct was subcloned into a
eukaryotic expression vector pSG5C (described in Example 3),
and was then ready for transfection experiments.
*trade-mark
W0 95134650 2 j 9 2 (~ 7 -42- PCT1U5951076.28
Fusion Protein MN-Fc
The cloning of the fusion protein MN-Fc was rather
complicated due to the use of a genomic clone containing the
Fc fragment of human IgG which had a complex structure in that
it contained an enhancer, a promoter, exons and introns.
Moreover, the complete sequence of the clone was not
available. Thus, it was necessary to ensure the correct in-
phase splicing and fusion of MN to the Fc fragment by the
addition of a synthetic splice donor site (SSDS) designed
according to the splicing sequences of the MN gene.
The construction procedure was as follows:
1. Plasmid pMH4 (e.g. pSV2gpt containing a genomic
clone of the human IgG Fc region) was cleaved by BamHI in
order to get a 13 kb fragment encoding Fc. [In pSV2gpt, the
E. coli xanthine-guanine phosphoribosyl transferase gene (gpt)
is expressed using the SV40 early promoter (PE) located in the
SV40 origin, the SV40 small T intron, and the SV40
polyadenylation site.]
2. At the same time, plasmid pFLMN (with full
length MN cDNA) was cleaved by SalI-EcoRI. The released
fragment was purified and ligated with a synthetic adapter
EcoRI-Bg1II containing a synthetic splice donor site (SSDS).
3. Simultaneously, the plasmid pBKCMV was cleaved
by Sa1I-BamHI. Then advantage was taken of the fact that the
BamHI cohesive ends (of the Fc coding fragment) are compatible
with the Bg1II ends of the SSDS, and Fc was ligated to MN.
The MN-Fe ligation product was then inserted into pBKCMV by
directional cloning through the Sail and BamHI sites.
Verification of the correct orientation and in-phase
fusion of the obtained MN-Fc chimaeric clones was problematic
in that the sequence of Fc was not known. Thus, functional
constructs are selected on the basis of results of transient
eukaryotic expression analyses.
Synthetic and Biologic Production of
MN Proteins and Polypeptides
MN proteins and polypeptides of this invention may
be prepared not only by recombinant means but also by
21 92678
WO 95134650 PCT/US95107628
-43-
synthetic and by other biologic means. Synthetic formation of
the polypeptide or protein requires chemically synthesizing
the desired chain of amino acids by methods well known in the
art. Exemplary of other biologic means to prepare the desired
polypeptide or protein is to subject to selective proteolysis
a longer MN polypeptide or protein containing the desired
amino acid sequence; for example, the longer polypeptide or
protein can be split with chemical reagents or with enzymes.
Chemical synthesis of a peptide is conventional in
the art and can be accomplished, for example, by the
Merrifield solid phase synthesis technique (Merrifield, J.,
Am. Chem. Soc., 85: 2149-2154 (1963); Kent et al., Synthetic
Peptides in Biology and Medicine, 29 f.f. eds. Alitalo et al.,
(Elsevier Science Publishers 1985); and Haug, J.D., "Peptide
Synthesis and Protecting Group Strategy", American
Biotechnology Laboratory, 5(1): 40-47 (Jan/Feb. 1987)].
Techniques of chemical peptide synthesis include
using automatic peptide synthesizers employing commercially
available protected amino acids, for example, Biosearch [San
Rafael, CA (USA)] Models 9500 and 9600; Applied Biosystems,
Inc. [Foster City, CA (USA)] Model 430; Milligen [a division
of Millipore Corp.; Bedford, MA (USA)] Model 9050; and Du
Pont's RAMP (Rapid Automated Multiple Peptide Synthesis) [Du
Pont Compass, Wilmington, DE (USA)].
Recrulation of MN Expression and MN Promoter
MN appears to be a novel regulatory protein that is
directly involved in the control of cell proliferation and in
cellular transformation. In HeLa cells, the expression of MN
is positively regulated by cell density. Its level is
increased by persistent infection with LCMV. in hybrid cells
between HeLa and normal fibroblasts, MN expression correlates
with tumorigenicity. The fact that MN is not present in
nontumorigenic hybrid cells (CGL1), but is expressed in a
tumorigenic segregant lacking chromosome 11, indicates that MN
is negatively regulated by a putative suppressor in chromosome
11.
21926 %6
WO 95134650 PCTIUS95107628
-44-
Evidence supporting the regulatory role of MN
protein was found in the generation of stable transfectants of
NIH 3T3 cells that constitutively express MN protein as
described in Example 3. As a consequence of MN expression,
the NIH 3T3 cells acquired features associated with a
transformed phenotype: altered morphology, increased
saturation density, proliferative advantage in serum-reduced
media, enhanced DNA synthesis and capacity for anchorage-
independent growth. Further, as shown in Example 4, flow
cytometric analyses of asynchronous cell populations indicated
that the expression of MN protein leads to accelerated
progression of cells through G1 phase, reduction of cell size
and the loss of capacity for growth arrest under inappropriate
conditions. Also, Example 4 shows that MN expressing cells
display a decreased sensitivity to the DNA damaging drug
mitomycin C.
Nontumorigenic human cells, CGL1 cells, were also
transfected with the full-length MN cDNA. The same pSG5C-MN
construct in combination with pSV2neo plasmid as used to
transfect the NIH 3T3 cells (Example 3) was used. Also the
protocol was the same except that the G418 concentration was
increased to 1000 gg/ml.
Out of 15 MN-positive clones (tested by SP-RIA and
Western blotting), 3 were chosen for further analysis. Two
MN-negative clones isolated from CGL1 cells transfected with
empty plasmid were added as controls. Initial analysis
indicates that the morphology and growth habits of MN-
transfected CGL1 cells are not changed dramatically, but their
proliferation rate and plating efficiency is increased.
MN cDNA and promoter. When the promoter region from
the MN genomic clone, isolated as described above, was linked
to MN cDNA and transfected into CGL1 hybrid cells, expression
of MN protein was detectable immediately after selection.
However, then it gradually ceased, indicating thus an action
of a feedback regulator. The putative regulatory element
appeared to be acting via the MN promoter, because when the
full-length cDNA (not containing the promoter) was used for
transfection, no similar effect was observed.
2192676
WO 95134650 PCTIUS95107628
-45-
An "antisense" MN cDNA/MN promoter construct was
used to transfect CGL3 cells. The effect was the opposite of
that of the CGL1 cells transfected with the "sense" construct.
Whereas the transfected CGL1 cells formed colonies several
times larger than the control CGL1, the transfected CGL3 cells
formed colonies much smaller than the control CGL3 cells.
For those experiments, the part of the promoter
region that was linked to the MN cDNA through a BamHI site was
derived from a Ncol -nHI fragment of the MN genomic clone
(Bd3] and represents a region a few hundred bp upstream from
the transcription initiation site. After the ligation, the
joint DNA was inserted into a pBK-CMV expression vector
[Stratagene]. The required orientation of the inserted
sequence was ensured by directional cloning and subsequently
verified by restriction analysis. The tranfection procedure
was the same as used in transfecting the NIH 3T3 cells
(Example 3), but co-transfection with the pSV2neo plasmid was
not necessary since the neo selection marker was already
included in the pBK-CMV vector.
After two weeks of selection in a medium containing
G418, remarkable differences between the numbers and sizes of
the colonies grown were evident as noted above. Immediately
following the selection and cloning, the MN-transfected CGL1
and CGL3 cells were tested by SP-RIA for expression and
repression of MN, respectively. The isolated transfected CGL1
clones were MN positive (although the level was lower than
obtained with the full-length cDNA), whereas MN protein was
almost absent from the transfected CGL3 clones. However, in
subsequent passages, the expression of MN in transfected CGL1
cells started to cease, and was then blocked perhaps
evidencing a control feedback mechanism.
As a result of the very much lowered proliferation
of the transfected CGL3 cells, it was difficult to expand the
majority of cloned cells (according to SP-RIA, those with the
lowest levels of MN), and they were lost during passaging.
However, some clones overcame that problem and again expressed
MN. '_t is possible that once those cells reached a higher
quantity, that the level of endogenously produced MN mRNA
CA 02192678 2000-05-18
-46-
increased over the amount of ectopically expressed antisense
mRNA.
Transformation and Reversion
As illustrated in Examples 3 and 4, vertebrate cells
transfected with MN cDNA in suitable vectors show striking
morphologic transformation. Transformed cells may be very
small, densely packed, slowly growing, with basophilic
cytoplasm and enlarged Golgi apparatus. However, it has been
found that transformed clones revert over time, for example,
within 3-4 weeks, to nearly normal morphology, even though the
cells may be producing MN protein at high levels. MN protein
is biologically active even in yeast cells; depending upon the
level of its expression, it stimulates or retards their growth
and induces morphologic alterations.
Full-length MN cDNA was inserted into pGD, a MLV-
derived vector, which together with standard competent MLV
(murine leukemia virus), forms an infectious, transmissible
complex [pGD-MN + MLV]. That complex also transforms
vertebrate cells, such as, NIH 3T3 cells and mouse embryo
fibroblasts BALB/c, which also revert to nearly normal
morphology. Such revertants again contain MN protein and
produce the [pGD-MN + MLV] artificial virus complex, which
retains its transforming capacity. Thus, reversion of MN-
transformed cells is apparently not due to a loss, silencing
or mutation of MN cDNA, but may be the result of the
activation of suppressor gene(s).
Nucleic Acid Probes and Test Kits
Nucleic acid probes of this invention are those
comprising sequences that are complementary or substantially
complementary to the MN cDNA sequence shown in Figure 1(A-C)
or to other MN gene sequences, such as, the complete genomic
sequence of Figure 3(A-F) [SEQ. ID. NO.: 5] and the putative
promoter sequence [SEQ. ID. NO.: 27 of Figure 6]. The phrase
"substantially complementary" is defined herein to have the
meaning as it is well understood in the art and, thus, used in
the context of standard hybridization conditions. The
CA 02192678 2000-05-18
-47-
stringency of hybridization conditions can be adjusted to
control the precision of complementarity. Two nucleic acids
are, for example, substantially complementary to each other,
if they hybridize to each other under stringent hybridization
conditions.
Stringent hybridization conditions are considered
herein to conform to standard hybridization conditions
understood in the art to be stringent. For example, it is
generally understood that stringent conditions encompass
relatively low salt and/or high temperature conditions, such
as provided by 0.02 M to 0.15 M NaCl at temperatures of 50 C to
70 C. Less stringent conditions, such as, 0.15 M to 0.9 M salt
at temperatures ranging from 20 C to 55 C can be made more
stringent by adding increasing amounts of formamide, which
serves to destabilize hybrid duplexes as does increased
temperature.
Exemplary stringent hybridization conditions are
described in Sambrook et al., Molecular Cloning: A Laboratory
Manual, pages 1.91 and 9.47-9.51 (Second Edition, Cold Spring
Harbor Laboratory Press; Cold Spring Harbor, NY; 1989);
Maniatis et al., Molecular Cloning: A Laboratory Manual,
pages 387-389 (Cold Spring Harbor Laboratory; Cold Spring
Harbor, NY; 1982); Tsuchiya et al., Oral Surgery, Oral
Medicine, Oral Pathology, 71(6): 721-725 (June 1991).
Preferred nucleic acid probes of this invention are
fragments of the isolated nucleic acid sequences that encode
MN proteins or polypeptides according to this invention.
Preferably those probes are composed of at least twenty-nine
nucleotides, more preferably, fifty nucleotides.
Nucleic acid probes of this invention need not
hybridize to a coding region of MN. For example, nucleic acid
probes of this invention may hybridize partially or wholly to
a non-coding region of the genomic sequence shown in Figure
3(A-F) [SEQ. ID. NO.: 5]. Conventional technology can be
used to determine whether fragments of SEQ. ID. NO.: 5 or
related nucleic acids are useful to identify MN nucleic acid
sequences. [See, for example, Benton and Davis, supra and
Fuscoe et al., supra.]
CA 02192678 2000-05-18
-48-
Areas of homology of the MN nt sequence to other
non-MN nt sequences are indicated above. In general,
nucleotide sequences that are not in the Alu or LTR-like
regions, of preferably 29 bases or more, or still more
preferably of 50 bases or more, can be routinely tested and
screened and found to hybridize under stringent conditions to
only MN nucleotide sequences. Further, not all homologies
within the Alu-like MN genomic sequences are so close to Alu
repeats as to give a hybridization signal under stringent
hybridization conditions. The percent of homology between MN
Alu-like regions and a standard Alu-J sequence are indicated
as follows:
Region of Homology within
MN Genomic Sequence SEQ. % Homology to
[SEQ. ID. NO.: 5; ID. Entire Alu-J
Figure 3(A-F)] NOS. Sequence
921-1212 59 89.1%
2370-2631 60 78.6%
4587-4880 61 90.1%
6463-6738 62 85.4%
7651-7939 63 91.0%
9020-9317 64 69.8%
% Homology to
One Half of
Alu-J Sequence
8301-8405 65 88.8%
10040-10122 66 73.2%.
Nucleic acid probes of this invention can be used to
detect MN DNA and/or RNA, and thus can be used to test for the
presence or absence of MN genes, and amplification(s),
mutation(s) or genetic rearrangements of MN genes in the cells
of a patient. For example, overexpression of an MN gene may
a30 be detected by Northern blotting and RNase protection analysis
using probes of this invention. Gene alterations, as
amplifications, translocations, inversions, and deletions
among others, can be detected by using probes of this
2192678
WO 95134650 PCT/US95107628
-49-
invention for in situ hybridization to chromosomes from a
patient's cells, whether in metaphase spreads or interphase
nuclei. Southern blotting could also be used with the probes
of this invention to detect amplifications or deletions of MN
genes. Restriction Fragment Length Polymorphism (RFLP)
analysis using said probes is a preferred method of detecting
gene alterations, mutations and deletions. Said probes can
also be used to identify MN proteins and/or polypeptides as
well as homologs or near homologs thereto by their
hybridization to various mRNAs transcribed from MN genes in
different tissues.
Probes of this invention thus can be useful
diagnostically/prognostically. Said probes can be embodied in
test kits, preferably with appropriate means to enable said
probes when hybridized to an appropriate MN gene or MN mRNA
target to be visualized. Such samples include tissue
specimens including smears, body fluids and tissue and cell
extracts.
PCR Assays
To detect relatively large genetic rearrangements,
hybridization tests can be used. To detect relatively small
genetic rearrangements, as, for example, small deletions or
amplifications, or point mutations, PCR would preferably be
used. [U.S. Patent Nos. 4,800,159; 4,683,195; 4,683,202; and
Chapter 14 of Sambrook et al., Molecular Cloning: A
Laboratory Manual. supra]
An exemplary assay would use cellular DNA from
normal and cancerous cells, which DNA would be isolated and
amplified employing appropriate PCR primers. The PCR products
would be compared, preferably initially, on a sizing gel to
detect size changes indicative of certain genetic
rearrangements. If no differences in sizes are noted, further
comparisons can be made, preferably using, for example, PCR-
single-strand conformation polymorphism (PCR-SSCP) assay or a
denaturing gradient gel electrophoretic assay. [See, for
example, Hayashi, K., "PCR-SSCP: A Simple and Sensitive
Method for Detection of Mutations in the Genomic DNA," in PC
WO 95134650 , ! 9 2L) 7 -50- PCTIUS95107628
Methods and Applications, 1: 34-38 (1991); and Meyers et al.,
"Detection and Localization of Single Base Changes by
Denaturing Gradient Gel Electrophoresis," Methods in
Enzvmoloav. 155: 501 (1987).]
Assays
Assays according to this invention are provided to
detect and/or quantitate MN antigen or MN-specific antibodies
in vertebrate samples, preferably mammalian samples, more
preferably human samples. Such samples include tissue
specimens, body fluids, tissue extracts and cell extracts. MN
antigen may be detected by immunoassay, immunohistochemical
staining, immunoelectron and scanning microscopy using
immunogold among other techniques.
Preferred tissue specimens to assay by
immunohistochemical staining include cell smears, histological
sections from biopsied tissues or organs, and imprint
preparations among other tissue samples. Such tissue
specimens can be variously maintained, for example, they can
be fresh, frozen, or formalin-, alcohol- or acetone- or
otherwise fixed and/or paraffin-embedded and deparaffinized.
Biopsied tissue samples can be, for example, those samples
removed by aspiration, bite, brush, cone, chorionic villus,
endoscopic, excisional, incisional, needle, percutaneous
punch, and surface biopsies, among other biopsy techniques.
Preferred cervical tissue specimens include cervical
smears, conization specimens, histologic sections from
hysterectomy specimens or other biopsied cervical tissue
samples. Preferred means of obtaining cervical smears include
routine swab, scraping or cytobrush techniques, among other
means. More preferred are cytobrush or swab techniques.
Preferably, cell smears are made on microscope slides, fixed,
for example, with 55% EtOH or an alcohol based spray fixative
and air-dried.
Papanicolaou-stained cervical smears (Pap smears)
can be screened by the methods of this invention, for example,
for retrospective studies. Preferably, Pap smears wruld be
decolorized and re-stained with labeled antibodies against MN
2192678
WO 95/34650 PCTIUS95/07628
-51-
antigen. Also archival specimens, for example, matched smears
and biopsy and/or tumor specimens, can be used for
retrospective studies. Prospective studies can also be done
with matched specimens from patients that have a higher than
normal risk of exhibiting abnormal cervical cytopathology.
Preferred samples in which. to assay MN antigen by,
for example, Western blotting or radioimmunoassay, are tissue
and/or cell extracts. However, MN antigen may be detected in
body fluids, which can include among other fluids: blood,
serum, plasma, semen, breast exudate, saliva, tears, sputum,
mucous, urine, lymph, cytosols, ascites, pleural effusions,
amniotic fluid, bladder washes, bronchioalveolar lavages and
cerebrospinal fluid. it is preferred that the MN antigen be
concentrated from a larger volume of body fluid before
testing. Preferred body fluids to assay would depend on the
type of cancer for which one was testing, but in general
preferred body fluids would be breast exudate, pleural
effusions and ascites.
MN-specific antibodies can be bound by serologically
active MN proteins/polypeptides in samples of such body fluids
as blood, plasma, serum, lymph, mucous, tears, urine, spinal
fluid and saliva; however, such antibodies are found most
usually in blood, plasma and serum, preferably in serum.
Correlation of the results from the assays to detect and/or
quantitate MN antigen and MN-specific antibodies reactive
therewith, provides a preferred profile of the disease
condition of a patient.
The assays of this invention are both diagnostic
and/or prognostic, i.e., diagnostic/prognostic. The term
"diagnostic/ prognostic" is herein defined to encompass the
following processes either individually or cumulatively
depending upon the clinical context: determining the presence
of disease, determining the nature of a disease,
distinguishing one disease from another, forecasting as to the
probable outcome of a disease state, determining the prospect
as to recovery from a disease as indicated by the nature and
symptoms of a case, monitoring the disease status of a
patient, monitoring a patient for recurrence of disease,
Ii)20' 78
WO 95/34650 PCT/13595/07628
-52-
and/or determining the preferred therapeutic regimen for a
patient. The diagnostic/prognostic methods of this invention
are useful, for example, for screening populations for the
presence of neoplastic or pre-neoplastic disease, determining
the risk of developing neoplastic disease, diagnosing the
presence of neoplastic and/or pre-neoplastic disease,
monitoring the disease status of patients with neoplastic
disease, and/or determining the prognosis for the course of
neoplastic disease. For example, it appears that the
intensity of the immunostaining with MN-specific antibodies
may correlate with the severity of dysplasia present in
samples tested.
The present invention is useful for screening for
the presence of a wide variety of neoplastic diseases as
indicated above. The invention provides methods and
compositions for evaluating the probability of the presence of
malignant or pre-malignant cells, for example, in a group of
cells freshly removed from a host. Such an assay can be used
to detect tumors, quantitate their growth, and help in the
diagnosis and prognosis of disease. The assays can also be
used to detect the presence of cancer metastasis, as well as
confirm the absence or removal of all tumor tissue following
surgery, cancer chemotherapy and/or radiation therapy. It can
further be used to monitor cancer chemotherapy and tumor
reappearance.
The presence of MN antigen or antibodies can be
detected and/or quantitated using a number of well-defined
diagnostic assays. Those in the art can adapt any of the
conventional immunoassay formats to detect and/or quantitate
MN antigen and/or antibodies.
Many formats for detection of MN antigen and MN-
specific antibodies are, of course available. Those can be
Western blots, ELISAs, RIAs, competitive EIA or dual antibody
sandwich assays, immunohistochemical staining, among other
assays all commonly used in the diagnostic industry. In such
immunoassays, the interpretation of the results is based on
the assumption that the antibody or antibody combination will
2192678
WO 95134650 PCT1US95107628
-53-
not cross-react with other proteins and protein fragments
present in the sample that are unrelated to MN.
Representative of one type of ELISA test for MN
antigen is a format wherein a microtiter plate is coated with
antibodies made to MN proteins/polypeptides or antibodies made
to whole cells expressing MN proteins, and to this is added a
patient sample, for example, a tissue or cell extract. After
a period of incubation permitting any antigen to bind to the
antibodies, the plate is washed and another set of anti-MN
antibodies which are linked to an enzyme is added, incubated
to allow reaction to take place, and the plate is then
rewashed. Thereafter, enzyme substrate is added to the
microtiter plate and incubated for a period of time to allow
the enzyme to work on the substrate, and the adsorbance of the
final preparation is measured. A large change in absorbance
indicates a positive result.
It is also apparent to one skilled in the art of
immunoassays that MN proteins and/or polypeptides can be used
to detect and/or quantitate the presence of MN antigen in the
body fluids, tissues and/or cells of patients. In one such
embodiment, a competition immunoassay is used, wherein the MN
protein/polypeptide is labeled and a body fluid is added to
compete the binding of the labeled MN protein/polypeptide to
antibodies specific to MN protein/polypeptide.
In another embodiment, an immunometric assay may be
used wherein a labeled antibody made to a MN protein or
polypeptide is used. In such an assay, the amount of labeled
antibody which complexes with the antigen-bound antibody is
directly proportional to the amount of MN antigen in the
sample.
A representative assay to detect MN-specific
antibodies is a competition assay in which labeled MN
protein/polypeptide is precipitated by antibodies in a sample,
for example, in combination with monoclonal antibodies
recognizing MN proteins/polypeptides. One skilled in the art
could adapt any of the conventional immunoassay formats to
detect and/or quantitate MN-specific antibodies. Detection of
the binding of said antibodies to said MN protein/polypeptide
19261-8 WO 95/34650 -54- PCT/US95107628
could be by many ways known to those in the art, e.g., in
humans with the use of anti-human labeled IgG.
An exemplary immunoassay method of this invention to
detect and/or quantitate MN antigen in a vertebrate sample
comprises the steps of:
a) incubating said vertebrate sample with one or
more sets of antibodies (an antibody or antibodies) that bind
to MN antigen wherein one set is labeled or otherwise
detectable;
b) examining the incubated sample for the presence
of immune complexes comprising MN antigen and said antibodies.
Another exemplary immunoassay method according to
this invention is that wherein a competition immunoassay is
used to detect and/or quantitate MN antigen in a vertebrate
sample and wherein said method comprises the steps of:
a) incubating a vertebrate sample with one or more
sets of MN-specific antibodies and a certain amount of a
labeled or otherwise detectable MN protein/polypeptide wherein
said MN protein/ polypeptide competes for binding to said
antibodies with MN antigen present in the sample;
b) examining the incubated sample to determine the
amount of labeled/detectable MN protein/polypeptide bound to
said antibodies; and
c) determining from the results of the examination
in step b) whether MN antigen is present in said sample and/or
the amount of MN antigen present in said sample.
Once antibodies (including biologically active
antibody fragments) having suitable specificity have been
prepared, a wide variety of immunological assay methods are
available for determining the formation of specific
antibody-antigen complexes. Numerous competitive and
non-competitive protein binding assays have been described in
the scientific and patent literature, and a large number of
such assays are commercially available. Exemplary
immunoassays which are suitable for detecting a serum antigen
include those described in U.S. Patent Nos. 3,984,533;
3,996,345; 4,034,074; and 4,098,876.
2192678
WO 95/34650 PCT/[JS95/07628
-55-
Antibodies employed in assays may be labeled or
unlabeled. Unlabeled antibodies may be employed in
agglutination; labeled antibodies may be employed in a wide
variety of assays, employing a wide variety of labels.
Suitable detection means include the use of labels
such as radionuclides, enzymes, coenzymes, fluorescers,
chemiluminescers, chromogens, enzyme substrates or co-factors,
enzyme inhibitors, free radicals, particles, dyes and the
like. Such labeled reagents may be used in a variety of well
known assays, such as radioimmunoassays, enzyme immunoassays,
e.g., ELISA, fluorescent immunoassays, and the like. See for
example, U.S. Patent Nos. 3,766,162; 3,791,932; 3,817,837; and
4,233,402.
Immunoassay Test Kits
The above outlined assays can be embodied in test
kits to detect and/or quantitate MN antigen and/or MN-specific
antibodies (including biologically active antibody fragments).
Kits to detect and/or quantitate MN antigen can comprise MN
protein(s)/polypeptides(s) and/or MN-specific antibodies,
polyclonal and/or monoclonal. Such diagnostic/prognostic test
kits can comprise one or more sets of antibodies, polyclonal
and/or monoclonal, for a sandwich format wherein antibodies
recognize epitopes on the MN antigen, and one set is
appropriately labeled or is otherwise detectable.
Test kits for an assay format wherein there is
competition between a labeled (or otherwise detectable) MN
protein/polypeptide and MN antigen in the sample, for binding
to an antibody, can comprise the combination of the labeled
protein/polypeptide and the antibody in amounts which provide
for optimum sensitivity and accuracy.
Test kits for MN-specific antibodies preferably
comprise labeled/detectable MN proteins(s) and/or
polypeptides(s), and may comprise other components as
necessary, such as, controls, buffers, diluents and
detergents. Such test kits can have other appropriate formats
for conventional assays.
WO 95134650 2 1 7 2 6 7 8 -56- PCr[US95/07625
A kit for use in an enzyme-immunoassay typically
includes an enzyme-labelled reagent and a substrate for the
enzyme. The enzyme can, for example, bind either an MN-
specific antibody of this invention or to an antibody to such
an MN-specific antibody.
Preparation of MN-Specific Antibodies
The term "antibodies" is defined herein to include
not only whole antibodies but also biologically active
fragments of antibodies, preferably fragments containing the
antigen binding regions. Such antibodies may be prepared by
conventional methodology and/or by genetic engineering.
Antibody fragments may be genetically engineered, preferably
from the variable regions of the light and/or heavy chains (VH
and VL), including the hypervariable regions, and still more
preferably from both the VH and VL regions. For example, the
term "antibodies" as used herein comprehends polyclonal and
monoclonal antibodies and biologically active fragments
thereof including among other possibilities "univalent"
antibodies [Glennie et al., Nature, 295: 712 (1982)]; Fab
proteins including Fab' and F(ab')2 fragments whether
covalently or non-covalently aggregated; light or heavy chains
alone, preferably variable heavy and light chain regions (VH
and V1 regions), and more preferably including the
hypervariable regions [otherwise known as the complementarity
determining regions (CDRs) of said V. and VL regions]; FC
proteins; "hybrid" antibodies capable of binding more than one
antigen; constant-variable region chimeras; "composite"
immunoglobulins with heavy and light chains of different
origins; "altered" antibodies with improved specificity and
other characteristics as prepared by standard recombinant
techniques and also by oligonucleotide-directed mutagenesis
techniques [Dalbadie-McFarland et al., PNAS (USA), 22: 6409
(1982)].
It may be preferred for therapeutic and/or imaging
uses that the antibodies be biologically active antibody
fragments, preferably genetically engineered fragments, more
preferably genetically engineered fragments from the V. and/or
CA 02192678 2000-05-18
-57-
VL regions, and still more preferably comprising the
hypervariable regions thereof.
There are conventional techniques for making
polyclonal and monoclonal antibodies well-known in the
immunoassay art. Immunogens to prepare MN-specific antibodies
include MN proteins and/or polypeptides, preferably purified,
and MX-infected tumor line cells, for example, MX-infected
HeLa cells, among other immunogens.
Anti-peptide antibodies are also made by
conventional methods in the art as described in European
Patent Publication No. 44,710 (published Jan. 27, 1982).
Briefly, such anti-peptide antibodies are prepared by
selecting a peptide from an MN amino acid sequence as from
Figure 1(A-C), chemically synthesizing it, conjugating it to
an appropriate immunogenic protein and injecting it into an
appropriate animal, usually a rabbit or a mouse; then, either
polyclonal or monoclonal antibodies are made, the latter by a
Kohler-Milstein procedure, for example.
Besides conventional hybridoma technology, newer
technologies can be used to produce antibodies according to
this invention. For example, the use of the PCR to clone and
express antibody V-genes and phage display technology to
select antibody genes encoding fragments with binding
activities has resulted in the isolation of antibody fragments
from repertoires of PCR amplified V-genes using immunized mice
or humans. [Marks et al., BioTechnology, 10: 779 (July 1992)
for references; Chiang et al., BioTechniques, 7(4): 360
(1989); Ward et al., Nature, 341: 544 (Oct. 12, 1989); Marks
et al., J. Mol. Biol., 222: 581 (1991); Clackson et al.,
Nature, 352: (15 August 1991); and Mullinax et al., PNAS
(USA), 87: 8095 (Oct. 1990).]
Descriptions of preparing antibodies, which term is
herein defined to include biologically active antibody
fragments, by recombinant techniques can be found in U.S.
Patent No. 4,816,567 (issued March 28, 1989); European Patent
Application Publication Number (EP) 338,745 (published Oct.
25, 1989); EP 368,684 (published June 16, 1990); EP 239,400
(published September 30, 1987); WO 90/14424 (published Nov.
2192676
WO 95/34650 PCT/US95107628
-58-
29, 1990); WO 90/14430 (published May 16, 1990); Huse et al.,
Science. 246: 1275 (Dec. 8, 1989); Marks et al.,
BioTechnoloay. 10: 779 (July 1992); La Sastry et al., PNAS
(USA), 86: 5728 (August 1989); Chiang et al., BioTechniaues,
7(40): 360 (1989); Orlandi et al., PNAS (USA), 86: 3833 (May
1989); Ward et al. Nature. 341: 544 (October 12, 1989);
Marks et al., J. Mol. Biol.. 222: 581 (1991); and Hoogenboom
et al., Nucleic Acids Res., 19(15): 4133 (1991).
Representative Mabs
Monoclonal antibodies for use in the assays of this
invention may be obtained by methods well known in the art for
example, Galre and Milstein, "Preparation of Monoclonal
Antibodies: Strategies and Procedures," in Methods in
Enzymology: Immunochemical Techniques 73: 1-46 [Langone and
Vanatis (eds); Academic Press (1981)]; and in the classic
reference, Milstein and Kohler, Nature, 256: 495-497 (1975).]
Although representative hybridomas of this invention
are formed by the fusion of murine cell lines, human/human
hybridomas [Olsson et al., PNAS (USA), 77: 5429 (1980)] and
human/murine hybridomas [Schlom et al., PNAS (USA), 77: 6841
(1980); Shearman et al. J. Immunol.. 146: 928-935 (1991); and
Gorman et al., PNAS (USA), 88: 4181-4185 (1991)] can also be
prepared among other possiblities. Such humanized monoclonal
antibodies would be preferred monoclonal antibodies for
therapeutic and imaging uses.
Monoclonal antibodies specific for this invention
can be prepared by immunizing appropriate mammals, preferably
rodents, more preferably rabbits or mice, with an appropriate
immunogen, for example, MaTu-infected HeLa cells, MN fusion
proteins, or MN proteins/polypeptides attached to a carrier
protein if necessary. Exemplary methods of producing
antibodies of this invention are described below.
The monoclonal antibodies useful according to this
invention to identify MN proteins/polypeptides can be labeled
in any conventional manner, for example, with enzymes such as
horseradish peroxidase (HRP), fluorescent compounds, or with
radioactive isotopes such as, 1251, among other labels. A
CA 02192678 2000-05-18
-59-
preferred label, according to this invention is 1252, and a
preferred method of labeling the antibodies is by using
chloramine-T [Hunter, W.M., "Radioimmunoassay," In: Handbook
of Experimental Immunology, pp. 14.1-14.40 (D.W. Weir ed.;
Blackwell, Oxford/London/Edinburgh/Melbourne; 1978)].
Representative mabs of this invention include Mabs
M75, MN9, MN12 and MN7 described below. Monoclonal antibodies
of this invention serve to identify MN proteins/polypeptides
in various laboratory diagnostic tests, for example, in tumor
cell cultures or in clinical samples.
Mabs Prepared Against HeLa Cells
MAb M75. Monoclonal antibody M75 (MAb M75) is
produced by mouse lymphocytic hybridoma VU-M75, which was
initially deposited in the Collection of Hybridomas at the
Institute of Virology, Slovak Academy of Sciences (Bratislava,
Slovak Republic) and was deposited under ATCC Designation HB
11128 on September 17, 1992 at the American Type Culture
Collection (ATCC) in Manassas, VA (USA). The production of
hybridoma VU-M75 is described in Zavada et al., WO 93/18152.
Mab M75 recognizes both the nonglycosylated GEX-3X-
MN fusion protein and native MN protein as expressed in CGL3
cells equally well. Mab M75 was shown by epitope mapping to
be reactive with the epitope represented by the amino acid
sequence from AA 62 to AA 67 [SEQ. ID. NO.: 10] of the MN
protein shown in Figure 1(A-C).
Mabs Prepared Against Fusion Protein GEX-3X-MN
Monoclonal antibodies of this invention were also
prepared against the MN glutathione S-transferase fusion
protein (GEX-3X-MN). BALB/C mice were immunized
intraperitoneally according to standard procedures with the
GEX-3X-MN fusion protein in Freund's adjuvant. Spleen cells
of the mice were fused with SP/20 myeloma cells [Milstein and
Kohler, supra] .
Tissue culture media from the hybridomas were
screened against CGL3 and CGL1 membrane extracts in an ELISA
employing HRP labelled-rabbit anti-mouse. The membrane
CA 02192678 2000-05-18
-60-
extracts were coated onto microtiter plates. Selected were
antibodies reacted with the CGL3 membrane extract. Selected
hybridomas were cloned twice by limiting dilution.
The mabs prepared by the just described method were
characterized by Western blots of the GEX-3X-MN fusion
protein, and with membrane extracts from the CGL1 and CGL3
cells. Representative of the mabs prepared are Mabs MN9, MN12
and MN7.
Mab MN9. Monoclonal antibody MN9 (Mab MN9) reacts
to the same epitope as Mab M75, represented by the sequence
from AA 62 to AA 67 [SEQ. ID. NO.: 101 of the Figure 1(A-C)
MN protein. As Mab M75, Mab MN9 recognizes both the GEX-3X-MN
fusion protein and native MN protein equally well.
Mabs corresponding to Mab MN9 can be prepared
reproducibly by screening a series of mabs prepared against an
MN protein/polypeptide, such as, the GEX-3X-MN fusion protein,
against the peptide representing the epitope for Mabs M75 and
MN9, that is, SEQ. ID. NO.: 10. Alternatively, the Novatope
system [Novagen] or competition with the deposited Mab M75
could be used to select mabs comparable to Mabs M75 and MN9.
Mab MN12. Monoclonal antibody MN12 (Mab MN12) is
produced by the mouse lymphocytic hybridoma MN 12.2.2 which
was deposited under ATCC Designation HB 11647 on June 9, 1994
at the American Type Culture Collection (ATCC) at 10801
University Blvd., Manassas, VA 20110-2209 (USA). Antibodies
corresponding to Mab MN12 can also be made, analogously to the
method outlined above for Mab MN9, by screening a series of
antibodies prepared against an MN protein/polypeptide, against
the peptide representing the epitope for Mab MN12. That
peptide is AA 55 - AA 60 of Figure 1(A-C) [SEQ. ID. NO.: 11].
The Novatope system could also be used to find antibodies
specific for said epitope.
Mab MN7. Monoclonal antibody MN7 (Mab MN7) was
selected from mabs prepared against nonglycosylated GEX-3X-MN
as described above. It recognizes the epitope on MN
represented by the amino acid sequence from AA 127 to AA 147
[SEQ. ID. NO.: 12] of the Figure 1(A-C) MN protein. Analo-
gously to methods described above for Mabs MN9 and MN12, mabs
2192678
WO 95134650 PCT1US95107628
-61-
corresponding to Mab MN7 can be prepared by selecting mabs
prepared against an MN protein/polypeptide that are reactive
with the peptide having SEQ. ID. NO.: 12, or by the stated
alternative means.
Epitope Mapping
Epitope mapping was performed by the Novatope
system, a kit for which is commercially available from
Novagen, Inc. [See, for analogous example, Li et al., Nature,
363: 85-88 (6 May 1993).] In brief, the MN cDNA was cut into
overlapping short fragments of approximately 60 base pairs.
The fragments were expressed in E. coli, and the E. coli
colonies were transferred onto nitrocellulose paper, lysed and
probed with the mab of interest. The MN cDNA of clones
reactive with the mab of interest was sequenced, and the
epitopes of the mabs were deduced from the overlapping
polypeptides found to be reactive with each mab.
Therapeutic Use of MN-Specific Antibodies
The MN-specific antibodies. of this invention,
monoclonal and/or polyclonal, preferably monoclonal, and as
outlined above, may be used therapeutically in the treatment
of neoplastic and/or pre-neoplastic disease, either alone or
in combination with chemotherapeutic drugs or toxic agents,
such as ricin A. Further preferred for therapeutic use would
be biologically active antibody fragments as described herein.
Also preferred MN-specific antibodies for such therapeutic
uses would be humanized monoclonal antibodies.
The MN-specific antibodies can be administered in a
therapeutically effective amount, preferably dispersed in a
physiologically acceptable, nontoxic liquid vehicle.
Imaging Use of Antibodies
Further, the MN-specific antibodies of this
invention when linked to an imaging agent, such as a
radionuclide, can be used for imaging. Biologically active
antibody fragments or humanized monoclonal antibodies, may be
preferred for imaging use.
WO 95134650 21926 ( PCT!US95/07628
-62-
A patient's neoplastic tissue can be identified as,
for example, sites of transformed stem cells, of tumors and
locations of any metastases. Antibodies, appropriately
labeled or linked to an imaging agent, can be injected in a
physiologically acceptable carrier into a patient, and the
binding of the antibodies can be detected by a method
appropriate to the label or imaging agent, for example, by
scintigraphy.
Antisense MN Nucleic Acid Sequences
MN genes are herein considered putative oncogenes
and the encoded proteins thereby are considered to be putative
oncoproteins. Antisense nucleic acid sequences substantially
complementary to mRNA transcribed from MN genes, as
represented by the antisense oligodeoxynucleotides ODN1 and
ODN2 [SEQ. ID. NOS.: 3 and 4] can be used to reduce or
prevent expression of the MN gene. [Zamecnick, P.C.,
"Introduction: Oligonucleotide Base Hybridization as a
Modulator of Genetic Message Readout," pp. 1-6, Prospects for
Antisense Nucleic Acid Therapy of Cancer and AIDS, (Wiley-
Liss, Inc., New York, NY, USA; 1991); Wickstrom, E.,
"Antisense DNA Treatment of HL-60 Promyelocytic Leukemia
Cells: Terminal Differentiation and Dependence on Target
Sequence," pp. 7-24, j.; Leserman et al., "Targeting and
Intracellular Delivery of Antisense Oligonucleotides
Interfering with Oncogene Expression," pp. 25-34, id.;
Yokoyama, K., "Transcriptional Regulation of c-mvc Proto-
oncogene by Antisense RNA," pp. 35-52, id.; van den Berg et
al., "Antisense fos Oligodeoxyribonucleotides Suppress the
Generation of Chromosomal Aberrations," pp. 63-70, ,id.;
Mercola, D., "Antisense fos and fun RNA," pp. 83-114,.;
Inouye, Gene, 72: 25-34 (1988); Miller and Ts'o, Ann. Reports
Med. Chem., 23: 295-304 (1988); Stein and Cohen, Cancer Res..
48: 2659-2668 (1988); Stevenson and Inversen, J. Gen. Virol.,
7Q: 2673-2682 (1989); Goodchild, "Inhibition of Gene
Expression by Oligonucleotides," pp. 53-77,
Oligodeoxvnucleotides: Antisense Inhibitors of Gene
Expression (Cohen, J.S., ed; CRC Press, Boca Raton, Florida,
CA 02192678 2000-05-18
-63-
USA; 1989); Dervan et al., "Oligonucleotide Recognition of
Double-helical DNA by Triple-helix Formation," pp. 197-210,
id.; Neckers, L.M., "Antisense Oligodeoxynucleotides as a Tool
for Studying Cell Regulation: Mechanisms of Uptake and
Application to the Study of Oncogene Function," pp. 211-232,
id.; Leitner et al., PNAS (USA), 87: 3430-3434 (1990);
Bevilacqua et al., PNAS (USA), 85: 831-835 (1988); Loke et
al. Curr. Top. Microbiol. Immunol., 141: 282-288 (1988);
Sarin et al., PNAS (USA), 85: 7448-7451 (1988); Agrawal et
al., "Antisense Oligonucleotides: A Possible Approach for
Chemotherapy and AIDS," International Union of Biochemistry
Conference on Nucleic Acid Therapeutics (Jan. 13-17, 1991;
Clearwater Beach, Florida, USA); Armstrong, L., Ber. Week, pp.
88-89 (March 5, 1990); and Weintraub et al., Trends, 1: 22-25
(1985).] Such antisense nucleic acid sequences, preferably
oligonucleotides, by hybridizing to the MN mRNA, particularly
in the vicinity of the ribosome binding site and translation
initiation point, inhibits translation of the mRNA. Thus, the
use of such antisense nucleic acid sequences may be considered
to be a form of cancer therapy.
Preferred antisense oligonucleotides according to
this invention are gene-specific ODNs or oligonucleotides
complementary to the 5' end of MN mRNA. Particularly
preferred are the 29-mer ODN1 and 19-mer ODN2 [SEQ. ID. NOS.:
3 and 4]. Those antisense ODNs are representative of the many
antisense nucleic acid sequences that can function to inhibit
MN gene expression. Ones of ordinary skill in the art could
determine appropriate antisense nucleic acid sequences,
preferably antisense oligonucleotides, from the nucleic acid
sequences of Figures 1(A-C) and 3(A-F).
Also, as described above, CGL3 cells transfected
with an "antisense" MN cDNA/promoter construct formed colonies
much smaller than control CGL3 cells.
Vaccines
It will be readily appreciated that MN proteins and
polypeptides of this invention can be incorporated into
vaccines capable of inducing protective immunity against
CA 02192678 2000-05-18
-64-
neoplastic disease and a dampening effect upon tumorigenic
activity. Efficacy of a representative MN fusion protein GEX-
3X-MN as a vaccine in a rat model is shown in Example 2.
MN proteins and/or polypeptides may be synthesized
or prepared recombinantly or otherwise biologically, to
comprise one or more amino acid sequences corresponding to one
or more epitopes of the MN proteins either in monomeric or
multimeric form. Those proteins and/or polypeptides may then
be incorporated into vaccines capable of inducing protective
immunity. Techniques for enhancing the antigenicity of such
polypeptides include incorporation into a multimeric
structure, binding to a highly immunogenic protein carrier,
for example, keyhole limpet hemocyanin (KLH), or diphtheria
toxoid, and administration in combination with adjuvants or
any other enhancers of immune response.
Preferred MN proteins/polypeptides to be used in a
vaccine according to this invention would be genetically
engineered MN proteins. Preferred recombinant MN protein are
the GEX-3X-MN, MN 20-19, MN-Fc and MN-PA proteins.
Other exemplary vaccines include vaccinia-MN (live
vaccinia virus with full-length MN cDNA), and baculovirus-MN
(full length MN cDNA inserted into baculovirus vector, e.g. in
suspension of infected insect cells). Different vaccines may
be combined and vaccination periods can be prolonged.
A preferred exemplary use of such a vaccine of this
invention would be its administration to patients whose MN-
carrying primary cancer had been surgically removed. The
vaccine may induce active immunity in the patients and prevent
recidivism or metastasis.
It will further be appreciated that anti-idiotype
antibodies to antibodies to MN proteins/polypeptides are also
useful as vaccines and can be similarly formulated.
An amino acid sequence corresponding to an epitope
of an MN protein/polypeptide either in monomeric or multimeric
form may also be obtained by chemical synthetic means or by
purification from biological sources including genetically
modified microorganisms or their culture media. [See Lerner,
"Synthetic Vaccines", Sci. Am. 248(2): 66-74 (1983).] The
2192678,
WO 95134650 PCTIUS95/07628
-65-
protein/polypeptide may be combined in an amino acid sequence
with other proteins/polypeptides including fragments of other
proteins, as for example, when synthesized as a fusion
protein, or linked to other antigenic or non-antigenic
polypeptides of synthetic or biological origin. In some
instances, it may be desirable to fuse a MN protein or
polypeptide to an immunogenic and/or antigenic protein or
polypeptide, for example, to stimulate efficacy of a MN-based
vaccine.
The term "corresponding to an epitope of an MN
protein/polypeptide" will be understood to include the
practical possibility that, in some instances, amino acid
sequence variations of a naturally occurring protein or
polypeptide may be antigenic and confer protective immunity
against neoplastic disease and/or anti-tumorigenic effects.
Possible sequence variations include, without limitation,
amino acid substitutions, extensions, deletions, truncations,
interpolations and combinations thereof. Such variations fall
within the contemplated scope of the invention provided the
protein or polypeptide containing them is immunogenic and
antibodies elicited by such a polypeptide or protein cross-
react with naturally occurring MN proteins and polypeptides to
a sufficient extent to provide protective immunity and/or
anti-tumorigenic activity when administered as a vaccine.
Such vaccine compositions will be combined with a
physiologically acceptable medium, including immunologically
acceptable diluents and carriers as well as commonly employed
adjuvants such as Freund's Complete Adjuvant, saponin, alum,
and the like. Administration would be in immunologically
effective amounts of the MN proteins or polypeptides,
preferably in quantities providing unit doses of from 0.01 to
10.0 micrograms of immunologically active MN protein and/or
polypeptide per kilogram of the recipient's body weight.
Total protective doses may range from 0.1 to about 100
micrograms of antigen. Routes of administration, antigen
dose, number and frequency of injections are all matters of
optimization within the scope of the ordinary skill in the
art.
WO 95134650 2192678 1 9 PCTIUS95I07628
-66-
The following examples are for purposes of
illustration only and not meant to limit the invention in any
way.
Example 1
Immunohistochemical Staining of Tissue Specimens
To study and evaluate the tissue distribution range
and expression of MN proteins, the monoclonal antibody M75 was
used to stain immunohistochemically a variety of human tissue
specimens. The primary antibody used in these
immunohistochemical staining experiments was the M75
monoclonal antibody. A biotinylated second antibody and
streptavidin-peroxidase were used to detect the M75 reactivity
in sections of formalin-fixed, paraffin-embedded tissue
samples. A commercially available amplification kit,
specifically the DAKO LSABTM kit [DAKO Corp., Carpinteria, CA
(USA)] which provides matched, ready made blocking reagent,
secondary antibody and steptavidin-horseradish peroxidase was
used in these experiments.
M75 immunoreactivity was tested according to the
methods of this invention in multiple-tissue sections of
breast, colon, cervical, lung and normal tissues. Such
multiple-tissue sections were cut from paraffin blocks of
tissues called "sausages" that were purchased from the City of
Hope [Duarte, CA (USA)]. Combined in such a multiple-tissue
section were normal, benign and malignant specimens of a given
tissue; for example, about a score of tissue samples of breast
cancers from different patients, a similar number of benign
breast tissue samples, and normal breast tissue samples would
be combined in one such multiple-breast-tissue section. The
normal multiple-tissue sections contained only normal tissues
from various organs, for example, liver, spleen, lung, kidney,
adrenal gland, brain, prostate, pancreas, thyroid, ovary, and
testis.
Also screened for MN gene expression were multiple
individual specimens from cervical cancers, bladder cancers,
renal cell cancers, and head and neck cancers. Such specimens
were obtained from U.C. Davis Medical Center in Sacramento, CA
2192678
WO 95134650 PCT/US95/07628
-67-
and from Dr. Shu Y. Liao [Department of Pathology; St. Joseph
Hospital; Orange, CA (USA)].
Controls used in these experiments were the cell
lines CGL3 (H/F-T hybrid cells) and CGL1 (H/F-N hybrid cells)
which are known to stain respectively, positively and
negatively with the M75 monoclonal antibody. The M75
monoclonal antibody was diluted to a 1:5000 dilution wherein
the diluent was either PBS [0.05 M phosphate buffered saline
(0.15 M NaCl), pH 7.2-7.4] or PBS containing 1% protease-free
BSA as a protein stabilizer.
Immunohistochemical Staining Protocol
The immunohistochemical staining protocol was
followed according to the manufacturer's instructions for the
DAKO LSABTM kit. In brief, the sections were dewaxed,
rehydrated and blocked to remove non-specific reactivity as
well as endogenous peroxidase activity. Each section was then
incubated with dilutions of the M75 monoclonal antibody.
After the unbound M75 was removed by rinsing the section, the
section was sequentially reacted with a biotinylated antimouse
IgG antibody and streptavidin conjugated to horseradish
peroxidase; a rinsing step was included between those two
reactions and after the second reaction. Following the last
rinse, the antibody-enzyme complexes were detected by reaction
with an insoluble chromogen (diaminobenzidine) and hydrogen
peroxide. A positive result was indicated by the formation of
an insoluble reddish-brown precipitate at the site of the
primary antibody reaction. The sections were then rinsed,
counterstained with hematoxylin, dehydrated and cover slipped.
Then the sections were examined using standard light
microscopy.
Interpretation. A deposit of a reddish brown
precipitate over the plasma membrane was taken as evidence
that the M75 antibody had bound to a MN antigen in the tissue.
The known positive control (CGL3) had to be stained to
validate the assay. Section thickness was taken into
consideration to compare staining intensities, as thicker
W095/34650 2192678
-68- PCTITTS95/07628
sections produce greater staining intensity independently of
other assay parameters.
Results
Preliminary examination of cervical specimens showed
that 62 of 68 squamous cell carcinoma specimens (91.2%)
stained positively with M75. Additionally, 2 of 6
adenocarcinomas and 2 of 2 adenosquamous cancers of the cervix
also stained positively. In early studies, 55.6% (10 of 18)
of cervical dysplasias stained positively. A total of 9
specimens including both cervical dysplasias and tumors,
exhibited some MN expression in normal appearing areas of the
endocervical glandular epithelium, usually at the basal layer.
In some specimens, whereas morphologically normal-looking
areas showed expression of MN antigen, areas exhibiting
dysplasia and/or malignancy did not show MN expression.
M75 positive immunoreactivity was most often
localized to the plasma membrane of cells, with the most
apparent stain being present at the junctions between adjacent
cells. Cytoplasmic staining was also evident in some cells;
however, plasma membrane staining was most often used as the
main criterion of positivity.
M75 positive cells tended to be near areas showing
keratin differentiation in cervical specimens. In some
specimens, positive staining cells were located in the center
of nests of non-staining cells. often, there was very little,
if any, obvious morphological difference between staining
cells and non-staining cells. In some specimens, the positive
staining cells were associated with adjacent areas of
necrosis.
in most of the squamous cell carcinomas of the
cervix, the M75 immunoreactivity was focal in distribution,
i.e., only certain areas of the specimen stained. Although
the distribution of positive reactivity within a given
specimen was rather sporadic, the intensity of the reactivity
was usually very strong. In most of. the adenocarcinomas of
the cervix, the staining pattern was more homogeneous, with
the majority of the specimen staining positively.
2 1 /2678
WO 95134650 PCT/US95/07628
-69-
Among the normal tissue samples, intense, positive
and specific M75 immunoreactivity was observed only in normal
stomach tissues, with diminishing reactivity in the small
intestine, appendix and colon. No other normal tissue stained
extensively positively for M75. Occasionally, however, foci
of intensely staining cells were observed in normal intestine
samples (usually at the base of the crypts) or were sometimes
seen in morphologically normal appearing areas of the
epithelium of cervical specimens exhibiting dysplasia and/or
malignancy. In such, normal appearing areas of cervical
specimens, positive staining was seen in focal areas of the
basal layer of the ectocervical epithelium or in the basal
layer of endocervical glandular epithelium. In one normal
specimen of human skin, cytoplasmic MN staining was observed
in the basal layer. The basal layers of these epithelia are
usually areas of proliferation, suggesting the MN expression
may be involved in cellular growth. In a few cervical
biopsied specimens, MN positivity was observed in the
morphologically normal appearing stratified squamous
epithelium, sometimes associated with cells undergoing
koilocytic changes.
Some colon adenomas (4 of 11) and adenocarcinomas (9
of 15) were positively stained. One normal colon specimen was
positive at the base of the crypts. Of 15 colon cancer
specimens, 4 adenocarcinomas and 5 metastatic lesions were MN
positive. Fewer malignant breast cancers (3 of 25) and
ovarian cancer specimens (3 of 15) were positively stained.
Of 4 head and neck cancers, 3 stained very intensely with M75.
Although normal stomach tissue was routinely
positive, 4 adenocarcinomas of the stomach were MN negative.
Of 3 bladder cancer specimens (1 adenocarcinoma, 1 non-
papillary transitional cell carcinoma, and 1 squamous cell
carcinoma), only the squamous cell carcinoma was MN positive.
Approximately 40% (12 of 30) of lung cancer specimens were
positive; 2 of 4 undifferentiated carcinomas; 3 of 8
adenocarcinomas; 2 of 8 oat cell carcinomas; and, 5 of 10
squamous cell carcinomas. one hundred percent (4 of 4) of the
renal cell carcinomas were MN positive.
PC f1US95/07628
WO 95/34650 2192678
-70-
In summary, MN antigen, as detected by M75 and
immunohistochemistry in the experiments described above, was
shown to be prevalent in tumor cells, most notably in tissues
of cervical cancers. MN antigen was also found in some cells
of normal tissues, and sometimes in morphologically normal
appearing areas of specimens exhibiting dysplasia and/or
malignancy. However, MN is not usually extensively expressed
in most normal tissues, except for stomach tissues where it is
extensively expressed and in the tissues of the lower
gastrointestinal tract where it is less extensively expressed.
MN expression is most often localized to the cellular plasma
membrane of tumor cells and may play a role in intercellular
communication or cell adhesion. Representative results of
experiments performed as described above are tabulated in
Table 2.
2192678
WO 95134650 PCT/US95/07628
-71-
TABLE 2
Immunoreactivity of M75 in Various Tissues
POS/NEG
TISSUE TYPE (#nos/#tested)
liver, spleen, lung,
kidney, adrenal gland,
brain, prostate, pancreas,
thyroid, ovary, testis normal NEG (all)
skin normal POS (in basal
layer) (1/1)
stomach normal POS
small intestine normal POS
colon normal POS
breast normal NEG (0/10)
cervix normal NEG (0/2)
breast benign NEG (0/17)
colon benign POS (4/11)
cervix benign POS (10/18)
breast malignant POS (3/25)
colon malignant POS (9/15)
ovarian malignant POS (3/15)
lung malignant POS (12/30)
bladder malignant POS (1/3)
head & neck malignant POS (3/4)
kidney malignant POS (4/4)
stomach malignant NEG (0/4)
cervix malignant POS (62/68)
The results recorded in this example indicate that
the presence of MN proteins in a tissue sample from a patient
may, in general, depending upon the tissue involved, be a
marker signaling that a pre-neoplastic or neoplastic process
is occurring. Thus, one may conclude from these results that
diagnostic/prognostic methods that detect MN antigen may be
particularly useful for screening patient samples for a number
of cancers which can thereby be detected at a pre-neoplastic
stage or at an early stage prior to obvious morphologic
IVO 95134650 21 9 2 1' 78 PCT1US95107628
1 0
-72-
changes associated with dysplasia and/or malignancy being
evident or being evident on a widespread basis.
Example 2
Vaccine -- Rat Model
As shown above in Example 7 of WO 93/18152
(International Publication Date: 16 September 1993), in some
rat tumors, for example, the XC tumor cell line (cells from a
rat rhabdomyosarcoma), a rat MN protein, related to human MN,
is expressed. Thus a model was afforded to study antitumor
immunity induced by experimental MN-based vaccines. The
following representative experiments were performed.
Nine- to eleven-day-old Wistar rats from several
families were randomized, injected intraperitoneally with 0.1
ml of either control rat sera (the C group) or with rat serum
against the MN fusion protein GEX-3X-MN (the IM group).
Simultaneously both groups were injected subcutaneously with
106 XC tumor cells.
Four weeks later, the rats were sacrificed, and
their tumors weighed. The results are shown in Figure 2.
Each point on the graph represents a tumor from one rat. The
difference between the two groups -- C and IM -- was
significant by Mann-Whitney rank test (U = 84, c < 0.025).
The results indicate that the IM group of baby rats developed
tumors about one-half the size of the controls, and 5 of the
18 passively immunized rats developed no tumor at all,
compared to 1 of 18 controls.
Example 3
Expression of Full-Length MN cDNA in NIH 3T3 Cells
The role of MN in the regulation of cell
proliferation was studied by expressing the full-length cDNA
in NIH 3T3 cells. That cell line was chosen since it had been
used successfully to demonstrate the phenotypic effect of a
number of proto-oncogenes [Weinberg, R.A., Cancer Res., 49:
3713 (1989); Hunter, T., Cell. 64: 249 (1991)J. Also, NIH
3T3 cells express no endogenous MN-related protein that is
detectable by Mab M75.
2132678
WO 95/34650 PCTIUS95/07628
-73-
The full length MN cDNA was obtained by ligation of
the two cDNA clones using the unique BamHI site and subcloned
from pBluescript into KpnI-SacI sites of the expression vector
pSG5C. pSG5C was kindly provided by Dr. Richard Kettman
[Department of Molecular Biology, Faculty of Agricultural
Sciences, B-5030 Gembloux, Belgium]. pSG5C was derived from
pSG5 [Stratagene] by inserting a polylinker consisting of a
sequence having several neighboring sites for the following
restriction enzymes: EcoRI, Xhol, Kvnl, BamHI, SacI, 3 times
TAG stop codon and BgllII.
The recombinant pSG5C-MN plasmid was co-transfected
in a 10:1 ratio (10 pg : 1 g) with the pSV2neo plasmid
[Southern and Berg, J. Mol. Appl. Genet., 1: 327 (1982)]
which contains the neo gene as a selection marker. The co-
transfection was carried out by calcium phosphate
precipitation method [Mammalian Transfection Kit; Stratagene]
into NIH 3T3 cells plated a day before at a density of 1 x 105
per 60 mm dish. As a control, pSV2neo was co-transfected with
empty pSG5C.
Transfected cells were cultured in DMEM medium
supplemented with loo FCS and 600 pg ml-1 of G418 [Gibco BRL]
for 14 days. The G418-resistant cells were clonally selected,
expanded and analysed for expression of the transfected cDNA
by western blotting using iodinated Mab M75.
For an estimation of cell proliferation, the clonal
cell lines were plated in triplicates (2 x 104 cells/well) in
24-well plates and cultivated in DMEM with 10% FCS and 1% FCS,
respectively. The medium was changed each day, and the cell
number was counted using a hemacytometer.
To determine the DNA synthesis, the cells were
plated in triplicate in 96-well plate at a density of 104/well
in DMEM with 10% FCS and allowed to attach overnight. Then
the cells were labeled with 3H-thymidine for 24 hours, and the
incorporated radioactivity was counted.
For the anchorage-independent growth assay, cells (2
x 104) were suspended in a 0.3% agar in DMEM containing 10% FCS
and overlaid onto 0.5% agar medium in 60 mm dish. Colonies
grown in soft agar were counted two weeks after plating.
W095134650 21 9 26 1 PCT/Ufi95l07628
t ~r -74-
Several clonal cell lines constitutively expressing
both 54 and 58 kd forms of MN protein in levels comparable to
those found in LCMV-infected HeLa cells were obtained.
Selected MN-positive clones and negative control cells (mock-
transfected with an empty pSG5C plasmid) were subjected to
further analyses directed to the characterization of their
phenotype and growth behavior.
The MN-expressing NIH 3T3 cells displayed spindle-
shaped morphology, and increased refractility; they were less
adherent to the solid support and smaller in size. The
control (mock transfected cells) had a flat morphology,
similar to parental NIH 3T3 cells. In contrast to the control
cells that were aligned and formed a monolayer with an ordered
pattern, the cells expressing MN lost the capacity for growth
arrest and grew chaotically on top of one another.
Correspondingly, the MN-expressing cells were able to reach
significantly higher (more than 2x) saturation densities
(Table 3) and were less dependent on growth factors than the
control cells.
MN transfectants also showed faster doubling times
(by 15%) and enhanced DNA synthesis (by 10%), as determined by
the amount of [3H]-thymidine incorporated in comparison to
control cells. Finally, NIH 3T3 cells expressing MN protein
grew in soft agar. The diameter of colonies grown for 14 days
ranged from 0.1 to 0.5 mm; however, the cloning efficiency of
MN transfectants was rather low (2.4%). Although that
parameter of NIH 3T3 cells seems to be less affected by MN
than by conventional oncogenes, all other data are consistent
with the idea that MN plays a role in cell growth control.
Table 3
Growth Properties of NIH 3T3 Cells Expressing MN Protein
Transfected pSG5C/ pSG5C-MN/
DNA pSV2neo pSV2neo
Doubling time' 27.9 0.5 24.1 1.3
(hours)
CA 02192678 2003-09-15
-75-
Saturation densityb 4.9 0.2 11.4 0.4
(cells x 104/cm2)
Cloning < 0.01 2.4 0.2
efficiency
'For calculation of the doubling time, the proliferation rate
of exponentially growing cells was used. bThe saturation cell
density was derived from the cell number 4 days after reaching
confluency. `Colonies greater than 0.1 mm in diameter were
to scored at day 14. Cloning efficiency was estimated as a
percentage of colonies per number of cells plated, with
correction for cell viability.
Example 4
Acceleration of G1 Transit and Decrease in Mitomycin C
Sensitivity Caused by MN Protein
For the experiments described in this example, the
stable MN transfectants of NIH 3T3 cells generated as
described in Example 3 were used. Four selected MN-positive
clones and four control mock-transfected clones were either
used individually or in pools.
Flow cytometric analyses of asynchronous cell
populations. Cells that had been grown in dense culture were
plated at 1 x 106 cells per 60 mm dish. Four days later, the
cells were collected by trypsinization, washed, resuspended in
PBS, fixed by dropwise addition of 70% ethanol and stained by
propidium iodine solution containing RNase. Analysis was
performed by FACStal using DNA cell cycle analysis software
(Becton Dickinson; Franklin Lakes, NJ (USA)].
Exponentially growing cells were plated at 5 x 105
cells per 60 mm dish and analysed as above 2 days later.
Forward light scatter was used for the analysis of relative
cell sizes. The data were evaluated using Kolmogorov-Smirnov
test [Young, J. Histochem Cytochem.. 25: 935 (1977)].
The-flow cytometric analyses revealed that clonal
populations constitutively expressing MN protein showed a
*trade-mark
B 4 ;'
WO 45134650 40 PCTIIIS95l07628
-76-
decreased percentage of cells in G1 phase and an increased
percentage of cells in G2-M phases. Those differences were
more striking in cell populations grown throughout three
passages in high density cultures than in exponentially
growing subconfluent cells. That observation supports the
idea that MN protein has the capacity to perturb contact
inhibition.
Also observed was a decrease in the size of MN
expressing cells seen in both exponentially proliferating and
high density cultures. It is possible that the MN-mediated
acceleration of G1 transit is related to the above-noted
shorter doubling time (by about 15%) of exponentially
proliferating MN-expressing NIH 3T3 cells. Also, MN
expressing cells displayed substantially higher saturation
density and lower serum requirements than the control cells.
Those facts suggest that MN-transfected cells had the capacity
to continue to proliferate despite space limitations and
diminished levels of serum growth factors, whereas the control
cells were arrested in G1 phase.
Limiting conditions. The proliferation of MN-
expressing and control cells was studied both in optimal and
limiting conditions. Cells were plated at 2 x 104 per well of
24-well plate in DMEM with 10% FCS. The medium was changed at
daily intervals until day 4 when confluency was reached, and
the medium was no longer renewed. Viable cells were counted
in a hemacytometer at appropriate times using trypan blue dye
exclusion. The numbers of cells were plotted versus time
wherein each plot point represents a mean value of triplicate
determination.
The results showed that the proliferation of MN
expressing and control cells was similar during the first
phase when the medium was renewed daily, but that a big
difference in the number of viable cells occurred after the
medium was not renewed. More than half of the control cells
were not able to withstand the unfavorable growth conditions.
In contrast, the MN-expressing cells continued to proliferate
even when exposed to increasing competition for nutrients and
serum growth factors.
2192678
WO 95/34650 PCTIUS95107628
-77-
Those results were supported also by flow cytometric
analysis of serum starved cells grown for two days in medium
containing 1% FCS. While 83% of control cells accumulated in
GO-G1 phase (S = 5%, G2-M = 12%), expression of MN protein
partially reversed the delay in Cl as indicated by cell cycle
distribution of MN tranfectants (GO-G1 = 65%, S = 10%, G2-M =
26%). The results of the above-described experiments suggest
that MN protein might function to release the G1/S checkpoint
and allow cells to proliferate under unfavorable conditions.
MMC. To test that assumption, unfavorable
conditions were simulated by treating cells with the DNA
damaging drug mitomycin C (MMC) and then following their
proliferation and viability. The mechanism of action of MMC
is thought to result from its intracellular activation and
subsequent DNA alkylation and crosslinking [Pier and
Szybalski, Science, 145: 55 (1964)]. Normally, cells respond
to DNA damage by arrest of their cell cycle progression to
repair defects and prevent acquisition of genomic instability.
Large damage is accompanied by marked cytotoxicity. However,
many studies [for example, Peters et al., Int. J. Cancer, 54:
450 (1993)] concern the emergence of drug resistant cells both
in tumor cell populations and after the introduction of
oncogenes into nontransformed cell lines.
The response of MN-transfected NIH 3T3 cells to
increasing concentrations of MMC was determined by continuous
[3H]-thymidine labeling. Cells were plated in 96-well
microtiter plate concentration of 104 per well and incubated
overnight in DMEM with 10% FCS to attach. Then the growth
medium was replaced with 100 Ml of medium containing
increasing concentrations of MMC from 1 gl/ml to 32 Mg/ml.
All the drug concentrations were tested in three replicate
wells. After 5 hours of treatment, the MMC was removed, cells
were washed with PBS and fresh growth medium without the drug
was added. After overnight recovery, the fractions of cells
that were actively participating in proliferation was
determined by continuous 24-hr labeling with [3H]-thymidine.
The incorporation by the treated cells was compared to that of
the control, untreated cells, and the proliferating fractions
CA 02192678 2003-09-15
-78-
were considered as a percentage of the control's
incorporation.
The viability of the treated cells was estimated
three days later by a CellTiter*96 AQ Non-Radioactive Cell
Proliferation Assay [Promega] which is based on the
bioreduction of methotrexate (MTX) into a water soluble
formazan that absorbs light at 490 nm. The percentage of
surviving cells was derived from the values of absorbance
obtained after substraction of background.
The control and MN-expressing NTH 3T3 cells showed
remarkable differences in their responses to MMC. The
sensitivity of the MN-transfected cells appeared considerably
lower than the control's in both sections of the above-
described experiments. The results suggested that the MN-
transfected cells were able to override the negative growth
signal mediated by MMC.
ATCC Deposits. The material listed below was
deposited with the American Type Culture Collection (ATCC) at
10801 University Blvd., Manassas, VA 20110-2209 (USA). The
deposits were made under the provisions of the Budapest Treaty
on the International Recognition of Deposited Microorganisms
for the Purposes of Patent Procedure and Regulations
thereunder (Budapest Treaty). Maintenance of a viable culture
is assured for thirty years from the date of deposit. The
hybridomas and plasmids will be made available by the ATCC
under the terms of the Budapest Treaty, and subject to an
agreement between the Applicants and the ATCC which assures
unrestricted availability of the deposited hybridomas and
plasmids to the public upon the granting of patent from the
instant application. Availability of the deposited strain is
not to be construed as a license to practice the invention in
contravention of the rights granted under the authority of any
Government in accordance with its patent laws.
Hybridoma Deposit Date ATCC
VU-M75 September 17, 1992 HB 11128
MN 12.2.2 June 9, 1994 HB 11647
* trade-mark
CA 02192678 2003-09-15
-79-
Plasmid Deposit Date ATCC
A4a June 6, 1995 97199
XE1 June 6, 1995 97200
XE3 June 6, 1995 97198
The description of the foregoing embodiments of the
invention have been presented for purposes of illustration and
description. They are not intended to be exhaustive or to
limit the invention to the precise form disclosed, and
obviously many modifications and variations are possible in
light of the above teachings. The embodiments were chosen and
described in order to explain the principles of the invention
and its practical application to enable thereby others skilled
in the art to utilize the invention in various embodiments and
with various modifications as are suited to the particular use
contemplated.
