Note: Descriptions are shown in the official language in which they were submitted.
219631~
~ WO 96106165 . PCTtUS95/10250
GENETICALLY ENGrNEERED SWINE CELLS
This application is a çnnfin--qtion-in-part of: USSN 08/266,427, filed June 27,
1994; USSN 08/266, 427, filed June 26, 1994; USSN 08/243,653 by Sykes and Sachs,S filed May 16, 1994; USSN 08/220,371, filed March 29, 1994; USSN 08/212,228, f led
March 14, 1994; USSN 08/163,912, filed December 7, 1993; USSN 08/150,739, filed
November 10, 1993; USSN 08/126,122, filed on September 23, 1993; USSN 08/114,072,
filed August 30, 1993; USSN 07/838,595, filed February 19, 1992; PCT/US94/05527,filed May 16, 1994; and PCT/US94/01616, filed February 14, 1994. All ofthe U.S.
patent qpr~ qrinnc and PCT T, llr~ Applications recited herein are hereby
ihl~,ul~lulated by reference.
nA. I~ .1 ofthP TnYentinn
TheinventionrelatestothefieldoforganllA,,~l,l,..,lAI;nn
Technical advances in allogeneic orgam I, A ' ~ ' I i nn amd the availability of,15 nnncpe~-ifir; . "" ~ " ,; ve agents have revolutioni~d the field of organ
This progress has, however, resulted in a shortage of essential organs of
suitable si~ and match.
The shortage of allograft-organs has led to an increased interest in xenogeneic
It was ~ - ' more than twenty-five years ago that transplants
from . l .;. . ,~ to man could provide long-term life-supporting function. However, the
use of non-human primates as an organ source is of limited applicability. Many primate
species are scarce amd protected, and those that are more plentiful, such as the baboon,
often do not grow to a size which allows the use of their organs in adults. Moreover, in
some cultures, the use of primates as a source of organs is ethically . . . IA~C. ~
Some of these difficulties could be resolved by use of ungulate organs, especially
pig organs. Pigs are ~- - -- l, easy to breed, have large litters, and grow rapidly to
the si~ which allow the use of their organs in the very largest humam beings. In addition,
pig amd man have mamy anatomical and physiological cimilqritirc However,
.Iq. ,U.l ;.~., of a pig organ into a human results in a vigorous rejection of the graft-
organ.
Sl~mmq~y of tht Inventinn
In general, the invention features, a genetically engineered swine cell, e.g., acultured swine cell, e.g., a retrovirally trqn~.rmqç' cultured swine cell, or a cell derived
from a transgenic swine, which includes one or both of: a transgene encoding a graft-
supporting protein, e.g., a primate, e.g., a human, lL.l.a.vpù;ctic peptide; or, a tramsgene
which inhibits the expression or action of a gene product which is graft-A-S~
Examples of transgenes which inhibit the expression or action of a gene product which is
graf t ~ - include: a tr~msgene which encodes an amti-sense RNA which, directly
WO 96/06165 219 6 3 ~1 ~ 2 ¦ ' PCT/US95/10250--
or indirectly, inhibits the expression or action of a recipient-derived grafl . - - ~g " ,: ~1 ;r
protein, e.g., an anti-sense RNA which inbibits the expression of a donor-encoded
receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-
derived protein; a transgene which is a mutationally inactivated copy of a gene which
5 encodes a donor grafl-n.,~ ;r protein and which when inserted into the donor
genome, e.g., by 1~ ,g~ ,. ,~ .~ ., . ,l .;, . ;~ " " results in an ~ gene which is
l~fla~Ap~ ;;d or which is mutationally inactivated, by, e.g., the hlLludu~Liull of a
mutation, e.g., a deletion, into an rl ~ genomic copy of the gene which encodes
the donor grafl .-, l ug, ,., ;~ protein (e.g., the insertion of a transgene results in a knockout
10 for a donor-derived receptor for a recipient-derived protein which is a graft n l .~ 1 ;r
protein); a transgene which encodes an inhibitor of a donor- or recipient-derived grafl-
protein~ e g ~ a z ù~ LiLiv(: inhibitor or a protease or other molecule whichspecifically inhibits the activity of the grafl n~ l ;r protein; and a transgene which
encodes a dominant negative mutation in a gene product which is grafl-n ~ ;r, e.g.,
15 a donor cell receptor for a host cytokine.
In preferred r ~ o~ the transgene encoding a grafl-supporting protein is: a
recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
In preferred G".l,o.~ the transgene is one which inhibits the expression or
actionofadonorMHCgeneproduct(whichgeneproductisgrafl.- '~,,.":~l;~).
In preferred .. ,.l~o~l .. ~ the genetically engineered swine cell is a h~ lLu~u;~Liu
stem cell and the transgene encoding a grafl-supporting protein is: a recipient MHC gene,
e.g., a primate, e.g., a non-human primate or a human MHC gene.
In preferred ~ ..,l.c..l; ,.~ the genetically engineered swine cell is a I ~Ul. .i.,
stem cell and the transgene is one which inhibits the expression or action of a donor MHC
25 gene product (which gene product is grafl-n, ~f ~g ",: I ;r)
In preferred c ,.,l.o.l;.. .,1~ the transgene encoding a grafl-supporting protein
and/or the transgene which inhibits the expression or action of a gene product which is
grafl-n-.~ ;r. is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
In preferred r~ )o~ the genetically engineered swine cell is a h.. llatu~Ju;c;ic
stem cell and the transgene encoding a graft-supporting protein and/or the transgene
which inhibits the expression or action of a gene product which is grafl-n ~ 1;. is
other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate,
MHC gene; or a non-human MHC gene.
Inpreferredr,.,l.ull;.... l~thetransgeneencodesagrafl-supportingprotein,e.g.,a
human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor
involved in the regulation of ' ,uo;~,~;s. Examples of growth factor or cytokine
~ WO 96106165 2 1 9 6 3 ~ ~ P~
receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-I I, IL-2, Epo,
and uteroferrin.
In other preferred r~ c~ t~ the transgene encodes a graft-supporting protein,
e.g., a hl31nan adhesion molecule, e.g., an a&esion molecule involved in c..r,,.~
5 and10r " IAl~ 1 C' of I ~ po;~,~ic cells. Examples of human adhesion moleculesinclude VLA-4, c-kit, LFA-I, CDI la, Mac-1, CR3~ CDI Ib, pl50, p95, CDl lc, CD49a,
LPAM-I, CD49d, CD44, CD3~, and CD34.
In yet other preferred ~ o~1;., .~ . It~ the transgene encodes a recipient or donor
protein, e.g., a cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition
10 of the level of activity of a second cytokine), inhibits an irnmune response mounted by
donor cells against the recipient, e.g., IL-I 0, IL-4, IL-2, or TGF-~.
In yet other preferred C. . ,l)v~ the transgene encodes a chimeric molecule,e.g., a chimeric ly~ Lvkillc" e.g., PIXY123.
In yet other preferred rl . ,l)oli;. l .. .l ~ the transgene encodes a graft-supporting
15 protein, e.g., a recipient or donor cytokine, which directly, or indirectly (e.g., by the
etimnl~tinn or inhibition of the level of activity of a second cytokine), inhibits an immune
response mounted by recipient cells against donor tissue, e.g., IL- 10, IL-4, IL-2, or TGF-
!3-
In yet other preferred ~ .. ,l-o.1: ., ...,1 ~ the transgene inhibits the expression or action
20 of a gene product which is graft-~ ;., e.g., by decreasimg the expression of the
gene product. E.g., the transgene is a ml~tl~tinn ~lly inactivated copy of a gene which
encodes a donor graft-,.ll~ .", ...i~l;~ protein, e.g., the donor cellsl B-7 receptor, CD27
receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when
inserted into the donor genome, e.g., by l ~- -l l lolny,v ~ ' ;fm, results in an
25 rl~iny~ gene which is lll;~A~ a~J or which is mutationally inactivated, by, e.g., the
introduction of a mutation, e.g., a deletion, into an rl l.lng... 1.1~1~ genomic copy of the gene
which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a
donor receptor for a host cytokine.
The transgene can be one which encodes an anti-sense RNA which, directly or
30 indirectly, inhibits the expression or action of a recipient-derived graft-", a ~
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7
receptor, CD27 receptor, or LFA-3 reccptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene
product which is graft-,~ , e.g., a donor cell receptor for a host cytokine or donor
35 B-7 receptor, CD27 receptor, or LFA-3 receptor.
In yet other preferred C~ 0ll;111- ~t~ the transgene includes a nucleic acid encoding
a human peptide, e.g., a l..,.~._tvl.voi~,.ic peptide, operably linked to: a promoter other than
WO 96/06l65 2 1 ~ ~ 3 ~ i 4 PcrlUsssllo25o--
the one it naturally occurs with; a swine promoter, e.g., a swine l ,. . " ~ ir I in gene
promoter; a viral promoter; or an inducible or .L.v- lu~ 1y regulated promoter.
In yet other preferred rllll ,."l~ the genetically engineered swine cell is: a
swine h. ." ~ ,~,n:. 1;. stem cell, e.g., a cord blood l~ tvl~o;~ stem cell, a bone marrow
5 h. .., s ~ ir stem cell, or a fetal or neonatal liver or spleen L~ ;uuo;..;ic stem cell;
derived from d;~rtl~ ' blood cells, e.g. a myeloid cell, such as a ~ ,uLLLyu~"yLts,
monocytes, granulocytes, or an Pn~innphilc an erythroid cell, such as a red blood cells,
e.g. a Iymphoid cell, such as B IYIII~UIIOU~ 1~" and T Iylllpllouytu." derived from a
pluripotent l- ~,uùi~lic stem cell, e.g. a h.,lll_~u~o;~, ic precursor, e.g. a burst-forming
10 units-erythroid (BFU-E), a colony forming unit-erythroid (CFU-E), a colony forrning
unit-lllcgah~uyu~u~ (CFU-Meg), a colony forming unit-~;l~lulo~yl~-monocyte (CFU-GM), a colony forrning unit-eosinophil (CFU-Eo), or a colony forrning unit-~;.~lulol,yL~
erythrocyte-l.l.,~;dLuyu.,yl~-monocyte (CFU-GEMM); a swine cell other than a
h.,ll~ o;.,;i., stem cell, or other blood cell; a swine thymic cell, e.g., a swine thymic
15 stromal cell; a bone marrow stromal cell; a swine liver cell; a swine kidney cell; a
swine epithelial cell; a swine ' ~ ~ progenitor cell; a swine muscle cell, e.g., a
heart cell; or a dendritic cell or precursor thereof.
In yet other preferred ., . ,h. 1l;. l . " ~ the transgenic cell is: isolated or derived from
cultured cells, e.g., a primary culture, e.g., a primary cell culture of 1~ ~ r ' " stem
20 cells; isolated or derived from a transgenic animal.
In yet other preferred ~,..ho~ the transgenic swine cell is L~ .y~;uu~ for
the transgene; the transgenic swine cell is h.,t~.lu4y~;uu~ for the transgene; the transgenic
swine cell is IIUIIIU~Y~;UU~ for the transgene Q~ Itlu~y~uu~ transgenic swine can be bred to
produce offspring that are hUlllU4y~5UU~ for the transgene); the transgenic swine cell
25 includes two or more transgenes.
In another aspect, the invention features, a transgene including a swine promoter,
e.g., a swine L~,.ll~llVJJO;~,Ih, gene promoter, or a heterologous inducible or
lul~ ly regulated promoter, operably linked to either: a nucleic acid encoding agraft-supporting protein, e.g., a primate or a human grafl-supporting protein, e.g., a
30 primate, e.g., a human, I ~l~u;.,li~; peptide; or a nucleic acid which encodes or, a
transgene which inhibits the expression or action of a gene product which is grafl-
~ . ~I h~ Examples of transgenes which inhibit the expression or action of a gene
product which is grafl-,l, .~ ~, ., .: J;~ include: a transgene which encodes an anti-sense
RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived
35 grafl-., . ~ ;r protein, e.g., an anti-sense RNA which inhibits the expression of a
donor-encoded receptor for a recipient-derived protein (amd thereby inhibits the action of
the recipient-derived protein; a transgene which encodes an inhibitor of a donor- or
recipient-derived grafl-~ protein, e.g., a CUIllu~ iVt: inhibitor or a protease or
~wo 96/06165 2 1 9 ~ 3 1 1 PCT/US95/10250
other molecule which specifically inhibits the activity of the graft A~ . " . ~1 ;r protein;
and a transgene which encodes a dominant negative mutation in a gene product which is
graft~ ; i" e.g., a donor cell receptor for a host cytokine.
In preferred ~" ,ho.l; I ., ,~ ~ the transgene encoding a graft-supporting protein is: a
5 recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
In preferred . ..,1.o~ the transgene is one which inhibits the expression oraction of a donor MHC gene product (which gene product is graft - - -' ~h ~1 l '1 ;~).
In preferred c~ od;lll.,llL~ the nucleic acid encoding a graft-supporting protein
and/or the nucleic acid which inhibits the expression or action of a gene product which is
10 graft-A" I hr" i~ . is other than: an MHC gene; a swine MHC gene; a recipient MHC
gene; a non-primate MHC gene; or a non-human MHC gene.
In preferred rllll.O,l;".. .,1~ the nucleic acid encodes a graft-supporting protein, e.g.,
a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor
involved in the regulation of h.,lllaLu~ . Examples of growth factor or cytokine15 receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-I 1, IL-2, Epo,
and uteroferrin.
In other preferred c...bouh...,l.~ the nucleic acid encodes a graft-supporting
protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in and/or~ of h~,llla~ Jo;~.;ccells. Examplesofhumanadhesion
molecules include VLA-4, c-kit, LFA-I, CDI 1 a, Mac- I, CR3, CDl Ib, pl 50, p95,CDllc, CD49a, LPAM-l, CD49d, CD44, CD38, and CD34.
In yet other preferred ~mhoriin~pntc the nucleic acid encodes a recipient or donor
protein, e.g., a cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition
of the level of activity of a second cytokine), inhibits an immune response mounted by
donor cells against the recipient, e.g., IL- I 0, IL-4, IL-2, or TGF-,B.
In yet other preferred c...~ ' the nucleic acid encodes a graft-supporting
protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the
stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune
response mounted by recipient cells against donor tissue, e.g., IL- I 0, IL-4, IL-2, or TGF-
30 ~3.
The transgene can be one which encodes an anti-sense RNA which, directly or
indirectly,inhibitstheexpressionoractionofarecipient-derivedgraft-A~,I~,.-..,~I;-.
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7
receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene
product which is graft-A"~ , e.g., a donor cell receptor for a host cytokine or donor
B-7 receptor, CD27 receptor, or LFA-3 receptor.
311
2196
W096/06165 ~ ! , . ',, PCTtUS9StlO250
. j ~ 6
In yet other preferred . . ,.1 ,c,.l:. " .; ~ the transgene encodes a chimeric molecule,
e.g., a chimeric IyllluLohillc, e.g., PIXY123.
In preferred 1 ,.,lto,l;".. .,1~ the transgene further includes trh-nerriptinnh-l regulatory
sequences, e.g. a tissue-specific promoter, e.g7 a h ' ~1~~ ~ ;r specific promoter,
5 operably linked to the .~...,.,1.;., --,1 human gene sequence.
In another aspect7 the invention features, a transgene which inhibits the action of a
gene product which is graft-.."' .~ .,.:~1;~ e.g., by decreasing the expression ofthe gene
product. E.g., the transgene is a transgene which is a m~lt~tinn~lly inactivated copy of a
gene which encodes a donor graft~ protein and which when inserted into the
10 donorgenome,e.g.,by l...."rlrg.~ ull~h;ll- ;rm~ resultsinan ~rln~ genewhich
is ~ cA~lcaa~,d or which is mutationally inactivated, by, e.g., the i..l . uJ~liu~ of a
mutation, e.g., a deletion, into an nl Ir~ genomic copy of the gene which encodes
the donor graft ~ .I hr,l 1 S ~1 ;r protein (e.g., the insertion of a transgene results in a knockout
for a donor-derived receptor for a recipient-derived protein which is a graft llhpl".:~l;r
1 5 protein).
In preferred rl I ~ho~ the t~ansgene is one which inhibits the expression oraction of a donor MHC gene product (which gene product is graft- .: ~g~ .. ,i~l;. ).
In preferred U. ~ o 1 1 ~ the transgene which inhibits the action of a gene
product which is graft-~ . .- - S;. iâ other than: an MHC gene; a swine MHC gene; a
20 recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
In yet other preferred r~mhorli~-nte the transgene inhibits the expression or action
of a gene product which is graft-~mthgnnieti~ e.g., by decreasing the expression of the
gene product. E.g., the transgene is a mutationally inactivated copy of a gene which
encodes a donor graft-,- . .I h~ ' protein, e.g., the donor cells' B-7 receptor, CD27
2~ receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when
inserted into the donor genome, e.g., by homologous .cc ....l ,;, -';..,. results in an
rl rl~ gene which is Ill;~ AUI~ J or which is mutationally iUI~i~ 1, by, e.g., the
hlLIuJu.,liu..ofamutation,e.g.,adeletion,intoanr~ genomiccopyofthegene
which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a
30 donor receptor for a host cytokine.
In another aspect, the invention features, a transgenic swine having cells whichinclude one or both of: a transgene encoding a graft-supporting protein, e.g., a primate or
a human graft-supporting protein, e.g., a primate, e.g., a human, protein, preferably a
ni. ;r peptide; or, a transgene which inhibits the expression or action of a gene
35 productwhichisgraft-,...l..gl...;~ Examplesoftransgeneswhichinhibittheexpression
or ~tion of a gene product which is graft- ~ g. ;~1;. include: a transgene which encodes
an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a
recipient-derived graft-~ g,. u;. protein, e.g., an anti-sense RNA which inhibits the
~ wo 96/06165 ~ ~ 9 6 3 1 1 P~ J~'IO~V
expression of a donor-encoded receptor for a recipient-derived protein (and thereby
inhibits the action of the recipient-derived protem; a transgene which is a mntAtinnAlly
inactivated copy of a gene which encodes a donor graft-- S Ag~ protein and whichwhen inserted into the donor genome, e.g., by hl~mr~ gml~ '; .,. results in an
5 ~lldo~ .u~ gene which is Ill;~A~ d or which is mutationally hla~ 1, by, e.g., the
i~,LIudu.,Livllofamutation,e.g.~adeletion~intoanr~ genomiccopyofthegene
which encodes the donor graft .- ~ .". ".~ protein (e.g., the insertion of a transgene
results in a knockout for a donor-derived receptor for a recipient-derived protein which is
a graft A, ~ l ;r protein); a tr~msgene which encodes an inhibitor of â donor- or
10 recipient-derived graft-A,.~ protein, e.g., a ~;ulll,u.,.iLive inhibitor or a protease or
other molecule which specifically inhibits the activity of the graft A~ protein;
amd a transgene which encodes a dominant negative mutation in a gene product which is
graf -A . ,l ~,,, .. ,1~l ;~, e.g., a donor cell receptor for a host cytokine.
In preferred . ., .1.o~ . .. 5 ~ the transgene encoding a graft-supporting protein is: a
15 recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
In preferred . .,.l-o.l;",. ..I~ the transgene is one which inhibits the expression or
action of a donor MHC gene product (which gene product is graft-A l ~g. ." ~
In preferred ( .., .l ,o.l; .. ,... I ~ the tr msgene encoding a graft-supporting protein
and/or the transgene which inhibits the expression or action of a gene product which is
20 graft-A ~-g~ s other than: an MHC gene; a swine MHC gene; a recipient MHC
gene; a non-primate MHC gene; or a non-human MHC gene.
In preferred ~..,.l.c..l"". .,1~ the transgene encodes a graft-supporting protein, e.g., a
human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor
involved in the regulation of l )~ Examples of growth factor or cytokine
25 receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-67 IL-I I, IL-2, Epo,
and uteroferrin.
In other preferred ....,1 "~ the transgene encodes a graft-supporting protein,
e.g., a human a&esion molecule, e.g., an adhesion molecule involved in rl ~ A n " ,
and/o m ~ lA I It, ., -- e of I r,u;~.i., cells. Examples of human a&esion molecules
include VLA-4, c-kit, LFA-I, CD 11 a, Mac-l, CR3, CDI I b, pl 50, p95, CDl l c, CD49a,
LPAM-I, CD49d, CD44, CD38, and CD34.
In yet other preferred rl~l.OP: ....I~ the transgene encodes a recipient or donor
protein, e.g., a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition
of the level of activity of a second cytokine), inhibits an immune response mounted by
35 donor cells against the recipient, e.g., IL-I0, IL-4, IL-2, or TGF-!3.
In yet other preferred r ~ v~lh1~ the transgene encodes a graft-supporting
protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the
stimulation or inhibition of the level of activity of a second cytokine) inhibits an immume
. , .. .. . . . ...... : .. .... . .. . .. .. .. . .. . ... . . ... . ... . ... . . ....
WO96/06165 219!6~ PCT/US95/10250
g
response mounted by recipient cells against donor tissue, e.g., IL-I 0, IL-4, IL-2, or TGF-
13 .
In yet other preferred Pmho~limPnlc the transgene encodes a chimeric molecule,
e.g., a chimeric lylll,JhOhil.~, e.g., PIXY123.
S In yet other preferred Pmho~limPntC the transgene inhibits the expression or action
of a gene product which is graft-~ g. ~ S~ , e.g., by decreasing the expression of the
gene product. E.g., the transgene is a mutationally inactivated copy of a gene which
encodes a donor graft-""~ i protein, e.g., the donor cells' B-7 receptor, CD27
receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when
10 inserted into the donor genome, e.g., by homologous ~ ,., results in an
C gene which is Illi~ c, .~,d or which is mutationally Lld~Li\ ' i, by, e.g., the
introduction of a mutation, e.g., a deletion, into an r~ "1~ genomic copy of the gene
which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a
donor receptor for a host cytokine.
The transgene can be one which encodes~n anti-sense RNA which, directly or
indirectly, inhibits the expression or action of a recipient-derived graft-A, .I ~g~", ..; ;~.
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7
receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene
20 product which is graft-.. " l ~g.~ e.g., a donor cell receptor for a host cytokine or donor
B-7 receptor, CD27 receptor, or LFA-3 receptor.
In yet other preferred . .~ c~ the transgene includes a nucleic acid encoding
a graft-supporting protein, e.g., a primate or human graft-supporting protein, e.g., a
primate or human L~ LUI~Uh~I;C peptide or a transgene which inhibits the action of a gene
25 product which is a graft-,.. .~ , e.g., a gene product which is the donor receptor for
a recipient protein which is a graft Al l~ i( . protein operably linked to: a promoter
other than the one it naturally occurs with; a swine promoter, e.g., a swine h~lll.ltul~u;~L;c
gene promoter; a viral promoter; an inducible promoter; or a d~ ly regulated
promoter.
In yet other preferred .. hu~l;,., .. 1~ the transgenic swine cell is L~ yguu~ for
the transgene; the transgenic swine cell is h~,...;,, ~uu~ for the transgene; the transgenic
swine is h~t.,lu~y~;uu~ for the tr~msgene; the transgenic swine is hu~lu~y~uu~ for the
transgene (h.,t~,lu~y~5uu~ tramsgenic swine can be bred to produce offspring that are
Lulllu~y~uu~ for the transgene); the transgenic swine includes two or more transgenes.
Transgenic swine (or swine cells) of the invention can be used as a source for
'~Luulo~ I ' r ' ''~ cells for xenogeneic grafting into human subjects.
Transgenic swine or swine cells of the invention can also be used to measure and/or
219~311
WO 96/06165 ~ '
. 9
identify agonists or antagonists of a human growth factor, cytokine, or other molecule
involved in 1 Tc~u;~ , regulation.
Transgenic swine cells of the invention derived, e.g., from retrovirally
l r~ .d cultured cells, or from a transgenic animal, can be used to induce
S ;~ IrTr,~,;r tolerance m a recipient animal to a grafl from a donor svvine. For example,
cells of the invention can be combined with methods of inducing tolerance described in
USSN 08/126,122,fi1ed September 23,1993.
The invention provides for the; ~ t ;~ 1 ~ of swine donor cells which have been
engineered to increase desrrable intPrrrtinnc betwee~ the donor cells and molecules and
10 cells of a recipient, e.g., to promote the ~ n~ l or function of the donor stem cells in
the recipient ~llvhvlll~ L. (Generally, stem cells are implanted to induce tolerance to (or
other vise promote acceptance of) donor graft cells.) The invention also provides for the
h ~ Tr ~ of donor cells which have been engineered to minimi~ unwanted
intPrArtir,nc between the donor cells and molecules and cells of the recipient which, e.g.,
promote the rejection of donor grafl cells or which inhibit the function of the donor grafl
cells. The invention provides for I .. ~1,1 - ~ -' ;, .,~ methods wherein either, or both, the
stem cells and the grafl cells are so engineered. Engineered alterations which increase
desired ;":..,.. I;.",c between donor stem cells and the recipient may, in some cases, be
". .-1 ~;, ,.1 ~Ir in the cells of the grafl. Likewise engineered alterations which decrease
unwantedintrrArtil~nc between the donor grafl cells and the recipient may, in some cases,
be, ~, ..lr ~ 1P in tbe donor stem cells. Thus, the invention includes methods in which the
donor stem cells and the donor graft differ in that one has an engineered alteration which
tbe other lacks. E.g., in some ~ ,iu.,~ the donor stem cells will have a transgene not
present in the graft cells and the donor grafl cells will have a transgene not present in the
donor stem cells.
~ ccordingly, in amother aspect, the invention features, a method of inducing
tolerance in a recipient mammal, e.g., a primate, e.g., a human, to grafl cells (or otherwise
promoting the ~ceptance by a recipient marnmal of grafl cells) from a donor mammal,
e.g., a miniature swine, including:
'UILIUIIU~,;llg into the recipient, donor h.,.. _tul,u;.lic stem cells, and
iu~udu~ g into the recipient, donor grafl cells,
provided that at least one of the following conditions is met: (I) the donor stem cells
have been genetically engineered to promote a desirable inter~tion between the donor
stem cells and cells or molecules of the recipient; (2) the donor stem cells have been
genetically engineered to inhibit an unwanted interaction between cells or molecules of
the recipient and the donor stem cells; (3) the donor grafl cells have been genetically
engineered to promote a desirable inter~tion between the donor grafl (and/or stem) cells
and cells or molecules of the recipient; or (4) the donor grafl cells have been genetically
WO 96106165 2 1 9 ~ 3 1 1 PCIIUS95/10250 1
engineered to inhibit an unwanted interaction between cells or molecules of the recipient
and the donor graft (and/or stem) cells.
In prèferred r " ,l)o~ if the genetically engineered alteration in (l) or (2) is
the insertion of an MHC gene, e.g., a swine MHC, a donor MHC gene, a recipient MHC
S gene, a non-primate MHC gene, or a non-human MHC gene, then one or both of, donor
cells which are genetically altered by other than the insertion of an MHC gene, or,
genetically altered cells other than h~ luyoi~L;c stem cells, are also introduced into the
recipient.
In preferred ~ . . ,I~o,l; ~ if a cell having a transgene which is an MHC gene,
10 e.g., a swine MHC, a dûnûr MHC gene, a recipient MHC gene, a non-primate MHC gene,
or a non-human MHC gene, is a.LIli.li~Ltl.d to the recipient, then a second cell, which
has a transgene other than an MHC gene, e.g., a swine MHC, a donor MHC gene, or a
recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene, is also
adlllilli~Ltl~d to the recipient.
In preferred embodiments: genetically engineered refers to the inclusion of a
transgene; the donor stem cells have a genetically engineered alteration, e.g., a transgene,
which the donor grafl cells lack; the donor graft cells have a genetically engineered
alteration, e.g., a transgene, which the donor stem cells lack; the donor stem cells have a
first genetically engineered alteration, e.g., a frst transgene, which increases an
20 interaction between the stem cells and molecules or cells of the recipient and the donor
graft cells have a second genetically engineered alteration, e.g., a second transgene, which
decreases an interaction between the donor graft cells and molecules or cells of the
recipient.
In preferred r',Illol~ the donor stem cells include a transgene which
25 encodes a graft-supporting protein, e.g., a L~ UPO;~1;C peptide and the donor graft cells
do not include the transgene of the donor stem cells.
In other preferred rll,l,u.l;.l.r..~. the donor graft cells include a transgene which
inhibits the action of a gene product which is a graft-h ~ , e.g., a gene product
which is the receptor for a recipient protein which is a graft - ~ ~g~ ;- protein and the
donor stem cells do not include the transgene.
In yet other preferred r~ ~.l .o.l;,, l~ the donor stem cells include a transgene
which encodes a graft-supporting protein, e.g., a human growth factor or cytokine
receptor, e.g., a growth factor or cytokine receptor involved in the regulation of
Examples of growth factor or cytokine receptor include the receptors for
G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
In yet other preferred r l l 1l lc~ the donor stem cells include a transgene
encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion
moleculeinvolvedin r.ll~Ar~ and/or ~ of 1~ ;rl;Acells. Examples
~ WO 96/06165 219 6 31'~1 pcr/rTsss/lo2so
~ ~ .
of human adhesion molecules include VLA-4, c-kit, LFA-I, CD1 la, Mac-1, CR3,
CDllb, pl50, p95, CDllc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
In yet other preferred embodiments: the donor stem cells, the donor graft cells, or
both, include a transgene which encodes a recipient or donor protein, a cytokine which
5 directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a
second cytokine) inhibits an immune response mounted by donor cells agamst the
recipient, e.g., IL-I0, IL-4, IL-2, or TGF-~.
In yet other preferred . . . ,h~v~ the donor stem cells, the donor graft cells, or
both, include a transgene which encodes a graR-supporting protein, e.g., a recipient or
10 donor cytokine which directly, or indirectly (e.g., by the strmulation or inhibition of the
level of activity of a second cytokine) inhibits an immune response mounted by recipient
cells against donor tissue, e.g., IL-I0, IL-4, IL-2 or TGF-~.
In yet other preferred r~ ~ ~ho~ the donor stem cells, the donor graft cells, or
both, include a transgene which inhibits the expression or action of a gene product which
15 is graft-A, . l Ag. .";~ Examples of transgenes which inhibit the expression or action of a
gene product which is graft ;~ Ag~ l;r rnclude: a transgene which encodes an anti-sense
RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived
graft-~ protein, e.g., an anti-sense RNA which inhibits the expression of a
donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of
20 the recipient-derived protein; a transgene which is a mutationally inactivated copy of a
gene which encodes a donor graft-AntAgnni~tif protein and which when inserted into the
donor genome, e.g., by hnmnk~ml~ ;nn results in an c" 1 ,~..,.,.,~ gene which
is ~ ~A~)lcD~ i or which is mlltAtinnAlly illa~iV i~ by, e.g., the il~luJu~,~iull of a
mutation, e.g., a deletion, into an . ".lng, ...., .~ genomic copy of the gene which encodes
25 the donor graft-A" lA"l " ,;~1 ;r protein (e.g., the insertion of a transgene results in a knockout
for a donor-derived receptor for a recipient-derived protein which is a graft A. ,~
protein); a transgene which encodes an inhibitor of a donor- or recipient-derived graft-
1;. protein, e.g., a ~,UIII~ iV~ inhibitor or a protease or other molecule which
specifically inhibits the activity of the graft A ~ - protein; and a transgene which
30 encodes a dominant negative mutation in a gene product which is graft-h"l hgn. ,: ~1 ;., e.g.,
a donor cell receptor for a host cytokine.
In yet other preferred r~ ~ho~ the transgene inhibits the expression or action
of ageneproductwhichisgraft-h"~ ,e.g.,bydecreasingtheexpressionofthe
gene product. E.g., the transgene is a mnt~tinnAlly inactivated copy of a gene which
35 encodes a donor gmâft-A.~ ;. protein, e.g., the donor cells' B-7 receptor, CD27
receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when
inserted mto the donor genome, e.g., by hnmnlngml~ IC~ .h;~ results in an
~ - .1Or" ..~ gene which is llf~AIJIC~ d or which is m--totinnAlly illa~iV ' 1~ by, e.g., the
WO 96/06165 ~ PCT/US95/102~0--
udu~livll of a mutation, e.g., a deletion, into an r ~ n~ genomic copy of the gene
which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a
donor receptor for a host cytokine.
The transgene can be one which encodes an anti-sense RNA which, directly or
5 indirectly, inhibits the expression or action of a recipient-derived graft-.. " ~
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7
receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokme.
The tMnsgene can be one which encodes a dominant negative mutation in a gene
product which is graft~ ;, e.g., a donor cell receptor for a host cytokine or donor
I û B-7 receptor, CD27 receptor, or LFA-3 receptor.
In yet other preferred ~,., ,ho~ l; ~, .. . ,1~, the donor stem cells, the donor graft, or both,
include a transgene which encodes a chimeric molecule, e.g., a chimeric Iylu~llvhill~, e.g.,
plXY123.
In yet other preferred rmh~rlimrntc the donor mammal and the recipient
15 mammal are of different species, e.g., they are discordant primates, e.g., a human
recipient and a nonhuman donor; the recipient is a primate, e.g., a human; the donor is a
swine e.g., a miniature swine.
In yet other preferred r~ .hn.l;. .- ~1~ the donor mammal and the recipient
mammal are of the same species, e.g., both are primates, e.g., humans; the recipient and
20 donor are of the same species and the donor stem cells include a transgene, introduced
e.g., by retroviral I ....~r...." - ;nn of cultured donor stem cells, amd the cells of the donor
graft do not include a transgene.
In yet other preferred Pmhn~limPntc the donor of the stem cells and the donor ofthe graft are both miniature swine and: the stem cell donor is from a strain which has been
25 genetically engineered to express a graft supporting protein; the graft donor is a strain
ha been genetically engineered to have decrea ed expression for a protein which is
g,~ to gMft acceptance or function; the graft donor amd the stem cell donor are
inbred; the graft donor and the stem cell donor are MHC identical.
In yet other preferred emho~liml~ntc the transgene includes a nucleic acid operably
30 linked to; a promoter other than the one it naturally occurs with; a swine promoter, e.g., a
swine h 1~ u;~ ;, gene promoter; a viMI promoter; or an inducible or d~ ,lv~lu~lllally
regulated promoter.
In yet other preferred . . . ,I)n~ the genetically engineered swine stem cell is:
isolated or derived from cultured cells, e.g., a primary culture, e.g., a primary culture of
35 1 ,~v;~lic stem cells; isolated or derived from a transgenic animal; isolated or derived
from cord blood; obtained from an individual animal from which the graft cells are
obtained; obtained from an individual animal which is syngeneic with the individual
animal from which the graft cells are obtained; obtained from an individual animal which
2~3~1
WO 96/06165 ~ PCT/US95/10250
13
is MHC matched, and preferably identical, with the individual animal from which the
graft cells are obtained; a cord blood, a bone marrow h "- ' ~,u~: ;r stem cell, o} a fetal or
neonatal liver or spleen cell l- , stem cell.
In preferred .. I.l,,,.l;........ l~ the donor graft cells are other than a l ~
5 stem cells, or other blood cells; the donor graft cells are swine thymic cells, e.g., swine
thymic stromal cells; the donor graft cells are bone marrow stromal cells; the donor graft
cells are swine liver cells; the donor graft cells are swine kidney cells; the donor graft
cells are swine epithelial cells; the donor graft cells are swine muscle cells, e.g., heart
cells; the donor graft cells are swine neuronal cells; the graft cells include an organ, e.g., a
10 kidney, a liver, or a heart; the donor graft cells include dendritic cells or their precursors.
Other preferred ~. . ,T ,o~ include: the step of introducing into the recipient,
donor species-specific stromal tissue, preferably I ,,o;.li~ stromal tissue, e.g., fetal
liver or thymus. In preferred nlllhO.l;l~ the stromal tissue is introduced
u~ ~ly with~ or prior to~ the l~ l tu~o;~ , stem cells. In preferred ~,., .l .o.l;,.... ,
15 the stromal tissue has been: genetically engineered to promote a desirable interaction
between the stromal cells and cells or molecules of the recipient; genetically engineered
to inhibit an unwanted imteraction between cells or molecules of the recipient and the
stromal cells.
Otherpreferred ~.. ,l,o.l;.. ..,l~ include those in which: the transgenic stem cells are
d~LI;II;vt~ d to the recipient prior to or ~i.. l1,.. ,. u~ ~ with 1, .. "~ ;.... of graft cells;
the I ' r ' ~ stem cells home to a site in the recipient; the stem cells are
adllUU;v~ d by hlLl~ lluua injection.
Otherpreferredn",ho.l;"....l~include(preferablypriorto~ d..gthestem
cells): hla~.Liv~ g the natural killer cells of the recipient mammal, e.g., by illLlUdU~illg
25 into the recipient mammal am antibody capable of binding to natural killer cells of the
recipient; hl~ iillg the T cells of the recipient mammal. e.g., by illllU(IU~illg into the
recipient an antibody capable of binding to T cells of the recipient.
Other preferred f-mho~limPntc include: the step of creating h ~ ~: : ;r space,
e.g., by one or more of, irradiating the recipient with low dose, e.g., between about 100
30 and 400 rads, whole body irradiation, Alllll;l~;~.S .. ;I~g a myl~oau~ ,vaiv~ drug to the
recipient, or ~.l, ...., .~:.. ;.,g anti-class I antibodies to the recipient, to deplete or partially
deplete the bone marrow of the recipient; the method includes the a step which creates
h. .~ "~ ; space and the step is performed prior to illtlUllU~Ulg the transgenic cells
mto the recipient.
Other preferred ~,IlJvodilll~.llLa include hla~,Li VvLillg thymic T cells by one or more
of: (preferably prior to h. ~ - 5 ~1'~;: ;r stem cell I, ""~ l ;on) irradiating the recipient
mammal with, e.g., about 700 rads of thymic irradiation; ~,l, .,;. I;~lrl; ~ Ig one, or preferably
two or more, doses of an anti-T cell antibody; or ~ ' g to the recipient a short
WO 96/06165 219 6 ~1~ PCT/US9S/10250--
~ } ~ 14;
course of an ;lll.l..,.,..~,.ly,l~aa~lL as described in USSN 081220,371, filed March 29,
1994.
Other preferred r ~ ~ 5 ~ include: the step of depleting or otherwise
hla~Liv~Lllg natural antibodies in the blood of the recipient mammal, e.g., by
S l ~ p~ ~ r~ lg an organ~ e.g.~ â liver or a kidney~ obtained from a pig or ~ g a
drug, e.g., d~,u~a~ ,u~llill (DSG) which inactivates or depletes natura. antibodies; the
method includes a step which depletes or othervvise inactivates natural antibodies in the
blood of the recipient and the step is performed prior to I ~~oi~Lic stem cell
Transgenic swine cells of the invention derived, e.g., from retrovirally
1'..".,. .1 cultured cells, or from a transgenic animal, can be used in amy method callmg
for the ~llgl~ 1 of swine ? ~ ' r ' '-~' cells in a xenogeneic ~llvhulull~lL. For
example, cells of the invention can be combined with: methods which induce tolerance
or otherwise promote the acceptance of a graft by ~ l of a short course of
cy~,loa~ulhl~ or similar agents, e.g., the methods described in USSN 08/220,371, filed
March29, 1994; methodswhichusethe;~y~ l;"~,ofaxenogeneicthymicgraftto
induce tolerance, e.g., the methods described in USSN 08/163, 912 filed on December 7,
1993; methods of increasing the level of the activity of a tolerance promoting or GVHD
inhibiting cytokine or decreasing the level of activity of am a tolerance inhibiting or
GVHD promoting cytokine, e.g., the methods described in USSN 08/114,072, filed
August 30, 1993; methods of using cord blood cells to induce tolerance, e.g., the
methods described in USSN 08rlS0,739, filed November 10, 1993; the methods of
USSN 08/126,122, filed September 23, 1993; and the methods for inducing tolerance
disclosed in Sykes and Sachs, PCT/US94/01616, filed February 14, 1994.
In another aspect, the invention features, a method of promoting the ~ a, Irl 1land or rrpnp~ ti'~n of the bone marrow of a xenogeneic recipient, e.g., a pr imate, e.g., a
human, by donor swine l ,~ol~Lic stem cells and thereby inducing mixed chimerismin the xenogeneic recipient. The method includes: providing a genetica ly engineered
swine cell (which may or may not be a I pu;.,;i/, stem cell) which has been
genetically engineered to promote a desirable interaction between donor stem cells and
cells or molecules of the recipient or which have been genetically engineered to inhibit
an unwanted interaction between the recipient and donor stem cells; and, implanting the
genetically engineered swine cell in the recipient, provided that, if the genetically
engineered swine cell is not a swine l~ y~ stem cell, a swine l, I ~t ~1~u ;;~ stem
cell i5 also i?nplanted in fhe recipient
In preferred rl I ~l~o~ the genetically engineered alteration is other than the
insertion of an MHC gene, e.g., a swine MHC, a donor MHC gene, a recipient MHC
gene, a non-primate MHC gene, or a non-humam MHC gene.
~wo 96/06165 2 1 g ~ 3 1 1: PC'r/US95/10250
' 15
In preferred embodiments: genetically engineered refers to the inclusion of a
tr msgene.
In otberpreferred rll,l.O.l;",. ..1~ the genetically engineered swine cells include a
transgene which encodes a graft-supporting protein, e.g., a human growth factor or
5 cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of
h~ .., t~ Examples of growth factor or cytokine receptor include the receptors for
G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
In yet other preferred ~" .l .o.l; l . ,~ the genetically engineered swine cellsinclude a transgene encodes a graft-supporting protein, e.g., a human adhesion molecule,
e.g., am adhesion molecule mYolved in ., .~, ,. n .. ,1 and/or, . ,,,;. ,l ~, .. ~ of I r,oi~,.;c
cells. Examples of human adhesion molecules include VLA-4, c-kit, LFA- I, CD 11 a,
Mac-1, CR3, CD1 lb, pl50, p95, CD1 lc, CD49a, LPAM-1, CD49d, CD44, CD38, and
CD34.
In yet other preferred wlll,o~ L~ the genetically engineered swine cells, include
1~ a transgene which inhibits the expression or action of a gene product which is graft-
,1, ~,.."~ Examples of transgenes which inhibit the expression or action of a geneproduct which is graft-h..~ 1; include: a transgene which encodes an anti-sense
RNA which, directly or mdirectly, inhibits the expression or action of a recipient-derived
graft-,..,lug~ ,. protein, e.g., an anti-sense RNA which inhibits the expression of a
20 donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of
the recipient-derived protein; a transgene which is a mutationally inactivated copy of a
gene which encodes a donor graft-~ " protein and which when inserted into the
donor genome, e.g., by hulllolo~;uu~ .. ~...,.l. ~;.... results in an r,ll~L~ c gene which
is ll~ lc ~acd or which is m--tSltion~lly inactivated, by, e.g., the introduction of a
25 mutation, e.g., a deletion, into an rl ,.1nl,~, .. ,..~ genomic copy of the gene which encodes
the donor graR-....lu~ l,. protein (e.g., the msertion of a transgene results in a knockout
for a donor-derived receptor for a recipient-derived protein which is a graft ~
protein); a transgene which encodes an inhibitor of a donor- or recipient-derived graft-
l~nta~nnictjc protem, e.g., a cul.~ ive inhibitor or a protease or other molecule which
30 specifically inhibits the activity of the graft rlntagrmictic protein; and a tramsgene which
encodes a dominant negative mutation in a gene product which is graft-~ .1,.~. .,.:~1;., e.g.,
a donor cell receptor for a host cytokine.
In yet other preferred rll,l,,,ll;.,l- .:~, the genetically engineered swine cells include
a tramsgene which inhibits the action of, e.g., by decreasing the éxpression of, a gene
35 product which is a graft-,"-~ E.g., the transgene is a mllts~tinnhlly inactivated
copy of a gene which encodes a donor graft .- ~ ~;~ protein, e.g., the donor cells' B-7
receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and
which when inserted into the donor genome, e.g., by hnmnlogl~llc ~c~...,.l.;..,.l;.... results
2~96~
WO96/0616S PCT/US95/102S0--
16
in an ClldU~ lUU:~ gene which is 111;5~ ~pl~a~d or~which is mnt~tifm~lly inactivated, by,
e.g., the hlLIudu~,Liull of a mutation, e.g., a deletion, into an f~n~if~g~nf~u~ genomic copy of
the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor,
or a donor receptor for a host cytokine.
The transgene can be one which encodes an anti-sense RNA which, directly or
indirectly, inhibits the expression or action of a recipient-derived graft-, ~ l ~g~ ;f
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7
receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene
I û product which is graft ~, l .g~ ;f, e.g., a donor cell receptor for a host cytokine or donor
B-7 receptor, CD27 receptor, or LFA-3 receptor.
Inyetotherpreferred~,.,l.o.l;.l.~"l~ thegeneticallyengineeredswinecells,
include a transgene which encodes a recipient or donor protein, a cytokine which directly,
or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second
15 cytokine) inhibits an immune response mounted by donor cells against the recipient, e.g.,
IL-I0, IL-4, or TGF-~.
In yet other preferred embodiments: the genetically engineered swine cells,
include a transgene which encodes a graft-supportmg protein, e.g., a recipient or donor
cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of
20 activity of a second cytokine) inhibits an immune response mounted by recipient cells
against donor tissue, e.g., IL-I0, IL-4, or TGF-~.
In yet other preferred r~ o~ t~ the genetically engineered swine cells include
a transgene which encodes a chimeric molecule, e.g., a chimeric ly~ hoh;lle, e.g.,
PIXY123.
2~ In yet other preferred ~",l,o.l;.. ,l~ the genetically engineered swine cell is
isolated or derived from a cultured cell, e.g., a primary culture, e.g., a primary culture of
L~,.llflu~u;~,.ic stem cells; the genetically engineered swine cell is isolated or derived from
a transgenic animal; if the genetically engineered swine cell is not a stem cell, then the
genetically engineered swine cell and the stem cell which is also ~dll~ d are
30 obtained from the same animal, from animals which are (except for the alteration of the
invention) syngeneic, or from animals which are MHC matched, amd preferably MHC
identical; the genetically engineered swine cell is a cord blood cell, a bone marrow
L~U~1LUIJO;~L;C stem cell, or a fetal or neonatal liver or spleen cell l- " ~ .p,~.. I ;~. stem cell.
In preferred ~ u~ the genetically engineered swine cells are other than
3~ I..., ... ~ ,p...: ;~ stem cells, or other blood cells; the genetically engineered swine cells are
thymic cells, e.g., swine thymic stromal cells; the genetically engineered swine cells are
bone marrow stromal cells; the genetically engineered swine cells are swine liver cells;
the genetically engineered swine cells are swine kidney cells; the genetically engineered
~6311
~ WO 96106165 PCT~US95~10250
,. 17
swine cells are swine epithelial cells; the genetically engineered swine cells are swine
muscle cells, e.g., heart cells; the genetically engineered swine cells are swine neuronal
cells, the genetically engineered swine cells are swine dentritic cells or their precursors.
Other preferred t~ubO~ b include (preferably prior to 1 1, .; ": ~ ; l .g the stem
5 cells): iua~,LivaLillg the natural killer cells of the recipient mammal, e.g., by iu~LIudu~,iulg
imto the recipient mammal an antibody capable of binding to natural killer cells of the
recipient; hla~LiY~Itillg the T cells ofthe recipient mammal, e.g., by h.LIu.lu~,i.lg into the
recipient an antibody capable of binding to T cells of the recipient.
Otberpreferred ~",l,o.l,.". .,1~ include: the step of creating l- , ~ space,
10 e.g., by one or more of, irradiating the recipient with low dose, e.g., between about 100
amd 400 rads, whole body irradiation, ~ l8l;~lrl ;"g a lllylLvau~)plc~;vc drug to the
recipient, or d'l 1 1 1; 11;~ 1 d 1 Ig anti-class I antibodies to the recipient, to deplete or partially
deplete the bone marrow of the recipient; the method includes the a step which creates
l,.." ~ Ip.~ ;. spaceandthestepisperformedpriorto hlLludu~ g thetransgeniccells
into the recipient.
Other preferred rllll ,oll;l"~ . include hla~,Liv~Lillg thymic T cells by one or more
of: (preferably prior to 1 I stem cell ~ Al ion) irradiating the recipient
mammalwith,e.g.,about700radsofthymicirradiation;~l",;":~f. .;.,gone,orpreferablytwo or more, doses of an anti-T cell antibody; or ~ u . 81_ to the recipient a short
course of an i ~ 'Pl" c~allL as described in USSN 081220,371, filed March 29,
1994.
Other preferred ~ " ,1),~11;", ~1~ include: the step of depleting or otherwise
iua~,Livaiillg natural antibodies in the blood of the recipient mammal, e.g., by
llp an organ~ e~g~ a liver or a kidney~ obtained from a pig or .~ lrl;llp~ a
drug, e.g., d~ y~ ualhl (DSG) which inactivates or depletes natural antibodies; the
method includes a step which depletes or otherwise inactivates natural antibodies in the
blood of the recipient and the step is performed prior to l~ ;ic stem cell
, ~ " ~ ; nn
In preferred ~ , the method includes the step of hlLluLlu~illg into the
recipient a graft obtained from the donor which is obtained from a different organ than the
h~llla~u~Oi~i;c stem cells, e.g., a liver or a kidney.
Genetically engineered swine cells of the invention can be made by methods
known to those skilled in the art, e.g., by retroviral transduction of swine cells. Methods
for producing tramsgenic swine of the invention use standard transgenic technology.
These methods include, e.g., the infection of the zygote or organism by viruses including
cLIuvilu~c:~ the infection of a tissue with viruses and then lchlLIuLh._;llg the tissue into an
animal; and the h-LIu-lu-Liu-l of a .~...."1,;"- ,I nucleic acid molecule into an embryonic
stem cell of a mammal followed by appropriate n~nir~ tion of the embryonic stem cell
WO 96~06165 2 1 9 ~ 3 l i PCT/US9S/10250--
18
to produce a transgenic animal. In particular, the invention features a transgenic swine,
whose germ cells amd somatic cells contain a transgene including a DNA sequence
encoding a 1.. ." ~ . peptide and a tissue-specific promoter operably linked to the
DNA sequence, wherein the tissue-specific prornoter effects expression of the
5 h~ vuv;~,i;c peptide in bone marrow cells of the swine, the transgene being introduced
into embryonal cells of the animal, or an ancestor of the animal.
Yet another aspect of the invention features a method for identifying or testing an
agent, e.g., a therapeutic agent, e.g., an agent useful in treating a ~ disorder,
by evaluating the agent's effect on transgenic swine cells of the invention. In an
10 illustrative . ",l~o":..,..~l an agent is aLIl;ll;~ cl to a transgenic swine, and the state of a
h~ v~uoicLic tissue, an aspect of mPt~h-~licm or an aspect of gene expression, evaluated
and compared with that of a control standard, e.g., that of a control transgenic animal.
The present method may be employed, for example, to determine the in vivo efficacy of
agonisOE or antagonists of human 1~ growth factors. Analogous ~p ;,.,. .,~
15 can be performed with cultured cells.
It has been ,1........ ,~;,. d that xenogeneic donor I - r ' ''~ stem cells, when
engrafted in xenogeneic recipients, can induce a state of donor-specific tolerance to
1 donor organs. Even low levels of I c,uvicLic chimerism can be sufficient
to induce this tolerant state. However, the loss of chimerism (which often occurs) is
associated with a 1.1~ ~ .. i I - .1 Ioss of tolerance. The animals, cells, transgenes, and
methods of the invention cam be used to promote the formation amd of
chimerism. The transgenes, transgenic cells, transgenic animals, and methods of the
invention are also useful in drug testing protocols, e.g., in protocols for identifying agents
which interact with human receptor or adhesion molecules, e.g., for identifying agents
25 which act as agonists or antagonists of human growth factors or adhesion molecules. The
transgenes, transgenic cells, transgenic animals and methods of the invention are also
usefulfoml.~..,.,;";,,gthespeciesspecificityofaninteractionbetweenahumamreceptor or adhesion molecule and a swine ligand.
Other features and advantages of the invention will be apparent from the
following detailed d~''ripti~'n and from the claims.
D~t~ De~ril linn of th~ TnvPnlir)n
The drawings will first be briefly described.
n~
Fig. I is a diagram of the GS4.5 retroviral construct.
Fig. 2 is a diagram of the GS4.5 proviral genome and the expected transcripts.
Figs. 3a and 3b are lc,wu~cllL~Liull~ of flow cytometry profile of tramsduced cells.
Fig. 4 is a diagram of the 1~ .1 "~.h 1~ 1;1 .l l assay.
~ WO 96/06165 2 1 9 6 3 1 1 PCT/US95~10250
f 19
1. RepoplllAtinn of XrnnPen~ ir Bnne M
F.~ . ~h,o~ of the invention relate to genetically engineered swine cells, e.g., to
genetically engineered l~ JO~ stem cells, which express rPrr,mhin:lnt peptides,
e.g., human peptides. The peptides enhance any of: the survival, rl 1~ n .. "
S proliferation, or function of swine cells implanted in a xenogeneic host.
In an exemplary clIll,n-l;.. Il the survival, c, ~ i n ,. Il, proliferation, or function
of stem cells, or the d., ~ ~.lu~ L of the stem cells, into di~t~c~lLk. ~ l cell types of the
cells,inthepresenceofahumanl---,.-l--~,o;~ -lvhu-llll~llL~suchasfoundinhuman
. tissues, e.g., bone marrow, is promoted. The engineered cells can express,
10 e.g., a human growth factor receptor, e.g., a human growth factor involved in the conhrol
of l r ~ Examples of human growth factor receptors include the receptors for
G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-ll, IL-2, Epo, and uteroferrin. In other exemplary
r",hr,.l",.. .;~ the engineered cells express a human adhesion molecule involved in
... ,~, ~ n ., ....~ and/o m l ln l ~ r Of l ,.., ~ ,po;. I ;c cells. Examples of such molecules
includeVLA-4,c-kit,LFA-l,CDlla,Mac-l,CR3,CDllb,pl50,p95,CDllc,CD49a,
LPAM-I, CD49d, CD44, CD38, and CD34.
Competitive Ir~-ulJ l ~- ;. ., . shldies of discordant bone marrow hransfer have shown
tnat ~. .,n~" ... i. ~ r,uh,;ic cells can be at a ~;ullll~.,lilive d;;~adv~ulia~, for
rec.nnQtihlhnnofaxenogeneichost,especiallywhenl"."~ .t iasapartofanon-
20 IllykualJlaLive regimen. That is, when stem cells of the host are available, the host cells
will generally have a cw.l~ ve advantage in recn,nQtihltinn of the host. This
~,ulll~,;ilive advantage c~n be a major factor preventing Ir~ by engrafted
n~nosenrir l,. .., ,~ stem cells. Several factors may be I~ Jull~ilJlc for the
Cu~ ."iLive advantage enjoyed by autologous bone marrow over engrafted Yrnngenrir
25 stem cells. The advantage appears to derive in part, from an inability of the Y r~ g~ "rir
cells to adequately engage growth factors and rYtrAr~ Ar mah ix (ECM) .. , .l.. ; ~ of
the host.
Both rYtrAr~lllll~r mahix c.. l... ~- and growth factors play important roles in
the regulation of l.. ~ ~ S ~ amd the ,. ,~ - r of both stem and di~el~llLi~Led
30 l ~ ~ ~ s ~I ~. ; ;r cells~ and therefore are of ~ e to the survival of Yrnngen~-ir cells.
~ Stem cell . . . - .S . e, for example, require growth factor binding as well as close r~mge
i"~. ,,. l;....~ with ~ Iuu-ldillg cells for r~ "rlll~ 1, e.g. shromal cells. However, both
ECM irt~rArtinnQ and growth factor binding by l.~ to~ ,ic cells can be, at leastpartially, species dependent, such that in xenogeneic settings, the grafted marrow is at a
35 ~wll~,.iLive di~adv~lL~Ige relative to autologous marrow in at least one of mitogenic
stimulation or r~ n . , .... I For example, the species specificity of adhesion molecule
i.. .. - 1.. ~ (such as mediated by VLA-4, c-kit, LFA-I, CDl la, Mac-l, CR3, CDI lb,
pl50, p95, CDl lc, CD49a, LPAM-I, CD49d, CD44, CD38, or CD34), are thought to be
.. . == = ~ . . __ . .. _ . . ... ... .. ...
u ~
WO96/06165 ~ ' PCT/US95/10250
important in 1- ~- r ' ' The failure of such adhesion molecules to inter~t with
ligandsfromthehostspeciesmaybeamajor;~ tohomingandlc...,,J;l,,l;....
by xenogeneic stem cells. Likewise, a number of growth factors, e.g. 1,....,. 1 . ,pf~
growth factors, are known to show varying degrees of species of specificity in their
5 receptor ;., ~ .,.. 1;. ..,~ For instance, G-CSF displays sigmficant, though not absolute,
species specificity. IL-3, for example, has a very marked species specificity.
In an illustrative ~ , described in further detail below, the human c-kit
receptor (hereinafter "c-kit"), the ligand for SCF, is engineered into swine stem cells.
Because the human c-kit bearing stem cells can interact effectively with human SCF
10 bound to stromal cells, and because human SCF can act as growth factor for this
~c~.~...l~;.."..lswinestemcells,someoftheuull~p~,iilivcadvantageenjoyedbyhuman
marrow would be lost to the engrafted swine stem cells Thus, the use of c-kit humani~d
swine cells can facilitate improved rec~tihlfif~n of a human subject by swine stem cells.
A similar approach can be used for human I ~I~u;~ , growth factor receptors, such as
1, IL-3 receptors and GM-CSF receptors, as well as for human adhesion molecules that are
involved in hC~ LUIJO;~ and for which swine cells do inter~t effectively with the
human ligand. Thus, in one aspect of the invention, the subject "hul~ li~d" swine cells
can be used in ~ rl If l~ l n;. .g protocols. By virtue of an improved ability to respond to
human factors which regulate 1.. s.p~-: :;f cells (relative to the wild-type swine cell),
20 the humanized cells can be used to improve r~a~ 1nlll ~1 and/or survival of swine
SJ~ stem cells, and thereby promote tolerance, in humans subjects. Preferred
clllbOdilll~,llLa of the present invention include a method of providing a growth selective
advantage to a transgenic cell, relative to the ~ullcapulldillg wild-type cell, when used as a
source of xenogeneic graft tissue, by providing a swine cell which expresses a human
25 1.. . "~ l ,o:f tif peptide, e.g., by producing a transgenic mammal having at least l cell
containing and expressing a lC~ . ,., ,1.:..,..I nucleic acid molecule of the present invention.
The rf-f flmhin~nt nucleic acid molecule containing tramsgenic marnmal is maintained for a
time period sufficient for the h. . ., 1. ,po:. 1 ;. modulator gene present in the l~, .. "h; ", .,
nucleic acid molecule to be expressed in the cell and thereby provide a selective
30 advantage to the transgenic cell, relative to the uJll~,a~olldillg wild-type cell, when
pl,. ~t ~1 into another species. In another aspect, the u ~ "h;lln~l swine cells,
,uf I L;.,ul~ l,v transgenic swine bearing such cells, are useful for assaying the efficacy of
.1,;"~.,I humam 1.. .~ p~ factors.
As used herein, a graft-supporting protein refers to a protein which has one or
3 'i more of the following properties: when expressed in a swine cell, it prolongs or
other vise promotes the acceptance of that cell in a xenogeneic donor; when expressed in
a swine cell, it prolongs or otherwise promotes the acceptance of another swine cell in a
xenogeneic donor; when expressed in a swine cell, it increases or otherwise promotes the
21~3~1
W096106165 PCT/IJS95110250
21
function of that swine cell in a xenogeneic donor; when expressed in a swine cell, it
irlcreases or otherwise promotes the function of another swine cell in a xenogeneic donor.
The graft-supporting protein can be expressed either, or both, prior to, or after,
., . of the cell or tissue it affects is implanted in the xenogeneic host. The graft-
5 supporting protein can exert its action on a swine cell or tissue either or both, prior to or
after the affected cell or tissue is implanted in a xenogeneic recipient. E.g., the graft-
supporting protein can be expressed in a cultured cells, and then, graft-supporting protein
expressing cultured cells implanted (alone or with other swine tissue) in a donor, the
graft-supporting protein can be expressed in a transgenic swine, and graft-supporting
10 protein expressing cells from the transgenic swine implanted (alone or with other swine
tissue) in a donor. (An affected cell or tissue is a cell or tissue upon which the graft-
supporting protein has a direct or indirect (through its action on another cell) effect; the
affected cell or tissue can be the cell or tissue which expresses the graft-supporting
protein, or a cell which does not express the graft-supporting protein, e.g., a cell or tissue
15 implanted together with a graft-supporting protein expressing cell.) Examples of graft-
supporting proteins include: recipient HLA molecules; recipient growth factor receptors;
recipient adhesion molecules; and recipient or donor proteins related to the function of the
graft. Graft-supporting proteins include h~ v~ ;ctic proteins.
As used herein, a graft- ~ - protein is a protein the expression of which,
20 by the graft tissue or by the recipient, promotes an immune response directed against
donor tissue or against the recipient, or is otherwise ~lla~u~ ic to the function of the
stem cells or graft or is otherwise ,~ u. to the acceptance of the donor stem cells or
the graft by the recipient. Examples of graft ~IL~UII;.~iC proteins are donor cell surface
receptors for host proteins which mediate an immune response against the donor cell, e.g.,
25 the donor cell B7, CD27, or LFA-3 receptors, or a donor receptor for a host cytokine.
As used herein, the term "transgene" means a nucleic acid sequence (encoding,
e.g., one or more 1 r ' ' peptides), which is partly or entirely heterologous, i.e.,
foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to
an rl ,.1, ~;, . .~ .. .~ gene of the transgenic pig or cell into which it is introduced, but which is
30 designed to be inserted, or is inserted, into the animal's genome in such a way as to alter
the genome of the cell into which it is inserted (e.g., it is inserted at a location which
differs from that of the natural gene or its insertion results in a knockout). A transgene
can include one or more 1.,- ~, ;1.l ,"" 1 regulatory sequences and any other nucleic acid,
such as introns, that may be necessary for optimal expression of the selected nucleic acid,
35 all operably linked to the selected nucleic acid, and may include an enhancer sequence.
As used herein, the term "transgenic cell" refers to a cell containing a transgene.
As used herein, a "transgenic animal" is any animal in which one or more, and
preferably essentially all, of the cells of the animal includes a transgene. The transgene is
__ . , . _ . ,, .. , ., .. , :,, . . ., . _, _ .. ... _ . , ., . .... .: .. , . ~, . ,=, ... . .. . ... .
21963i~
WO 96/06165 ~ ~ PCTIUS95/10250
, ,22
introduced into the cell, directly or indirectly by introduction into a precursor of the cell,
by way of deliberate genetic monirlllotirln, such as by Ill;.lu;llJ~ ion or by infection with
a rec.r,mhino~lt virus. The term genetic ~ does nol include classical cross-
breeding, or in ~itro fertilization, but rather is directed to the introduction of a
5 IC~ ",h".,. ,I DNA molecule. This molecule may be integrated within a l_hlullloaullle, or
it may be .,Al~ ,LIvllloaull.ally replicating DNA. In the transgenic animals described
herein, the transgene causes cells to express a IC~ . ""1,;" -- .I peptide, (e.g., a 1~ . I~II1);I~AIII
h.,lll_t~L~ù;.,i;~, peptide, e.g., a human growth factor or cytokine receptor involved in
regulation of I ,L o;~;a, such as receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-
10 11, IL-2, Epo, or uteroferrin, or a human adhesion molecule involved in ~"~, r n " ,. . I l
and/or~ ,....,.".Pofl---- ' r~- -cells,suchasVLA'4,c-kit,LFA-l,CDlla,Mac-l,
CR3, CDI Ib, pl50, p95, CDI lc, CD49a, LPAM-I, CD49d, CD44, CD38, or CD34), in
cells that do not express such Lll._'u~u;~lic peptides in a wild-type, non-transgenic
animal. Transgenic swine which include one or more transgenes encoding one or more
15 human hPmf~tr~pniPtir peptides are within the scope of this invention. For example, a
double or triple transgenic animal, which includes two or three transgenes can be
produced.
As used herein, the term "germ cell line transgenic animal" refers to a transgenic
animal in which the transgene genetic illr~ ;r~l~ exists in the germ line, thereby
20 conferring the ability to transfer the i l l r. ,. ", ~ l, to offspring If such offspring in fact
possess some or all of that ;-, ru. ~ I then they, too, are transgenic animals.
The term "' , gene" is used herein to mean any gene whose gene
product, preferably a human gene product, which when expressed by a swine
1- ~ ' r " cells, is capable of enhancing the ability of a swine h~ IUL U;~I;C stem cell
25 to ~,ulllL c~ ullali~ul~ a primate, e.g., a human host. For example, the hurnan-gene
product can enhance the proliferative ability of ~ .I swine cells in human
subjects; increase the ability of swine cells to bind to P~tr~rP~ or matrix ~ or
enhance the functional activity of swine marrow cells. In preferred ....I.o.l; .... .: ~ the
human I~- 1, - .uo: ir gene encodes: a cell surface protein; a human 1~ L~r~ g-rowth
factor receptor, such as receptors for G-CSF, SCF, GM-CSF, ~L-3, IL-6, IL- 11, IL-2,
Epo; or uteroferrin, or a human adhesion molecule involved in rl 1~ n 1 " ,1 and/or
...~i.. ., -- . of' ,,oi~Lic cells, such as VLA-4, c-kit, LFA-I, CDlla, Mac-l, CR3,
CDllb,pl50,p95,CDllc,CD49a,LPAM-l,CD49d,CD44,CD38,orCD34. Thegene
products of human I ~,uu;~ , genes are referred to herein as "human h~ lllf Lu,uoi..dc
35 proteins or peptides (the terms protein, peptide, and polypeptide are in this sense used
hlt~l~.llf ,Igc.l~ly)'', and include human 1~ ." t- ~uk ' ;f growth factor receptors and hurnan
h ll,'..~u~ adhesionmolecules. Theterm"growthfactor",or"l~ L.u I; growth
factor", is used to desf,rihe biologically active molecules which can, for example,
~ WO 96106165 219 6 ~1 j PCT/US9~/102~i0
23
stimulate ,ululif,laliull ofthe lc~..,.,l.;,.,~"l swine cell, enhance binding to ECM
c~ ~ ~p~ . a ~ andlor increase the functional activity of the cell. The term "cytokine" is
used h t~La~ ,ably with growth factor. Examples of 1- ~,uo;~ic growth factors
include G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-I 1, IL-2, Epo, and uteroferrin. "Growth
S factor receptors" are protein(s) expressed by cells, typically on the PYtrrrPII~ r surface,
which facilitate binding of growth factors by the cell and which alone, or in UU~ ,Liull
with other cellular proteins, induce a biological response in the cell to the binding of the
growth factor. TT~ .p. ; genes include those which encode a hybrid protein, e.g., a
peptide which encodes both human and swine CUIllUOll~ e.g., a hybrid receptor with a
10 human PYt-~rP~ r domain and a swine intrz~rPll~llSIr or I l ,- .~ 1 " , ~. domain. A
hematopoietic protein is a protein encoded by a I r ' " ~ gene.
As used herein, the term "operably linked" means that selected DNA, e.g.,
encoding a h~ alu,uu;ctic peptide, is in proximity with a Ir m~rrirtil~nrl regulatory
sequence, e.g., tissue-specific promoter, to allow the regulatory sequence to regulate
expression of the selected DNA.
The term "genetically ,UlU~lallllll~ as used herein means to p~lllall~llLly alter the
DNA, RNA, or protein content of a cell. Typically, this genetic pr ~r~mmin~ is
a. ~ ,l by hlLlullu~;llg into a swine cell a ~~ .1 nucleic acid molecule which
encodes a l~ peptide.
As used herein, the term "I~C~ .I swine cells" refers to cells derived from
swine, preferably mrniature swine, which have been used as recipients for a r~ .. 1.;.. -- ,
vector or other transfer nucleic acid, and include the progeny of the original cell which
hasbeentransfectedor l",..~r..,~ Inapreferred 1,~..1.o,l; ..~,.l, the lc~ l swine
cell is derived from a swine 1~ t~u~ ~ 1; stem cell. e.g., a swine bone marrow
25 h~llalulJO;~h~ cell, and has been genetically ,ulu~;lall~ ,i to express a IC~'''IIIl;ll~''~l
hum~m peptide. ~,r.... ~1. - 1l swine cells include cells in which transgenes or other
nucleic acid vectors have been hl-,UI~ ' ' into the host cell's genome, as well as cells
harboring expression vectors which remain :~1 a. " " ll l~ from the host cell's genome.
As used herein, the term '~tr~ncf~cti~ means the introduction of a nucleic acid,30 e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
"Tl"..~rl.lll -:;..,l",asusedherein,referstoaprocessinwhichacell'sgenotypeischanged
as a result of the cellular uptake of exogenous DNA or RNA, and, e.g. the a ~ r ",
swine cell expresses human cell surface peptides.
As used herein, the term "vector" refers to a nucleic acid molecule capable of
35 uall ~uul lillg another nucleic acid to which it has been linked. One type of preferred
vector is an episome, i.e., a nucleic acid capable of extra-.,hl ulllusulllàl replication.
Preferred vectors are those capable of autonomous replication and/expression of nucleic
wo 96106165 219 6 31 ' 24. PCTIUS95110250 1~
acids to which they are linked. Vectors capable of directing the expression of genes to
which they are operatively linked are referred to herein as "expression vectors".
"T. n~ regulatory sequence" is a generic term used throughout the
~1,. .;(~ ~I;..,.torefertoDNAsequences,suchasinitiationsignals,enhancers,and
5 promoters, which induce or control 1, n ~ l of protein coding sequences with which
they are operably linked. In preferred r. "I .o.l;" .. ,~ . . of the 1~ ~ . .., ,l ,; . .A. ,
1,~.,. S~ geneisumderthecontrolofapromotersequence(orotherl.r.,~..,~,l;.",
regulatory sequence) which naturally controls the expression of the ~ gene in
humans, or which naturally controls expression of the ~ullc~,uulld;llg gene in swine cells.
10 In even more preferred rl ~ ~h~J~l; . . I 11~, the I l n, ~ regulatory sequence causes
h~ u~ùicl;c-speciflc expression ofthe rec.-mhinDnt protein. The above rlllhrJll;lll. .,;~
not wi~ .g, it will also be understood that the Ic . .. 1 .1.;. .~ gene can be under the
control of I l nl ,~ regulatory sequences different from those sequences naturally
controllinglln"~,.;l,l;.~aofthe~.""l,;"n.,lprotein. Tr~D~ne~ripti~nofthe~
15 gene, for example, can be under the control of a synthetic promoter sequence. Preferably,
the promoter sequence controlling L~ ,~ ofthe Icl,ulllhhlollL gene is active (i.e.,
can promote gene expression) in bone marrow cells, especially I - c~,oicL;c cells. The
promoter that controls ~ ;- ~, of the ~ " .l ~ gene may be of viral origin;examples are promoters sometimes derived from bovine herpes virus (BHV), Moloney20 murine leukemia virus (MLV), SV40, Swine vesicular disease virus (SVDV), and
cytomegalovirus (CMV).
As used herein, the term "tissue-specific promoter" means a DNA sequence that
serves as a promoter, i.e., regulates expression of a selected DNA sequence operably
linked to the promoter, and which effects expression of the selected DNA sequence in
25 specific cells, e.g., h~ U~O;~L;C cells. The tissue specific promoter directs expression
,ulcdulll;ll~lLly~ if not exclusively in l- , cells. Particularly useful promoter
sequences for directing expression of human L~llldLul,oictic genes include: promoter
sequences naturally associated with the IC~ .h i ~ . I human gene; promoter sequences
naturally associated with the h~ g~ e pig gene (i.e. I,UllC~,UUlldhlg to the 1~.. l".. ~.
30 human gene); promoters which are ~tive primarily in l, ,.- ~.1.,6. :;. cells, e.g. in
Iymphoid cells, in erythroid cells, or in myeloid cells; the immlm~-gl-~b~llin promoter
described by Brinster et al. (1983) Nat~re 306:332-336 and Storb et al. (1984) Nature
310:238-231; the ;., .., .. ~ gl~b. lin promoter described by Ruscon et al. ~1985) Nature
314:330-334 and Grosscheld et al. (1984) Cell 38:647-658; the globin promoter described
by Townes et al. (1985) MoL CelL BioL 5:1977-1983, and Magr. m et al. (1989) MoLCelL Biol 9:4581-4584. Other I .~,ù;.,.i~, promoters are described herein or will be
apparent to those skilled in the art, and may include regulatory sequences derived from
such Iymphoid genes as CDI, CD2, CD3-r, CD3-o, CD3-~, CD3-~, CD3-71, CD4, CD5,
~ wo 96i06165 ~19 6 3 ~1 PCT~US95/10250
CD7, CD8, CDI9, CD20, CD38, CD40, CD45, CD72, CD76, p561ck, IL-2R~ chain, Jl Id
(heat stable antigen), fyn, NKI, NK2, Fc Rly chain, IL-2R ,B-chain, aTCAR, ~TCAR, y
TCAR, oTCAE~, FcyRIlI~ RAG-I, RAG-2, Ig-~ (B29), or IgM-a (MB-I) and genes
associated with imnn-m~lglnb--lin isotypes Igll, Igo, Igy, Iga, Ig~; Igk and Ig~. Moreover,
5 such promoters also may include additional DNA sequences that are necessary for
expression, such as introns and enhancer sequences. The term also covers so-called
"leaky" promoters, which regulate expression of a selected DNA primarily in one tissue,
but cause expression in other tissues as well. Other regulatory elements e.g., locus
control regions, e.g., DNase I hy~ a~,llD;liv~ sites, can be included.
By "cell specific expression", it is intended that the 1, ,.. 1~, ;pl ;l l ,~1 regulatory
elements direct expression of the ~ ,, . ,1,; " ~ protein in particular cell types, e.g., bone
marrow cells. The term "h- ~ s~p~ specific expression" therefore refers to expression
of a 1~ . .. "1,;,, -, I protein which is substantially restricted to L,lllalu~)O;~,Li~, cells.
"Graft", as used herein, refers to a body part, organ, tissue, or cells. Grafts may
consist of organs such as liver, kidney, heart or lung; body parts such as bone or skeletal
matrix; tissue such as skin, intestines, endocrine glands; or progenitor stem cells of
various types.
The term "tissue" as used herein, means ariy biological material that is capable of
being ~ p~ r.1 and includes organs (especially the internal vital organs such as the
heart, lung, liver, kidney, pancreas and thyroid), cornea~ skin, blood vessels and other
cormective tissue, cells including blood and I cl.oi~ic cells, Islets of T .:lngf~rh~ne
brain cells and cells from endocrine and other organs and bodily fluids, all of which may
be candidate for ~ p~
"A discordant species ~"."1.;., ~;~"", as used herein, refers to two species in which
hyperacute rejection occurs when a graft is grafted from one to the other. In the subject
invention, the donor is of porcine origin and the recipient is human.
"TT. ." s ,p.~ . stem cell", as used herein, refers to a cell, e.g., a bone marrow
cell, a fetal or neonatal liver or spleen cell, or a cord blood cell which is capable of
developing into a mature myeloid and/or Iymphoid cell.
"Progenitor cell", as used herein, refers to a cell which gives rise to an
differentiated progeny. In contrast to a stem cell, a progenitor cell is not always self
renewmg and is relatively restricted in d~v~,lv~ llal potential.
As used herein, the term "' ,pvi~Lic cells" embraces di~tl~ ' ' ' blood cells,
including: cells derived from a myeloid lineage, including Ill~aL~ yv~y t~ monocytes,
granulocytes, and er~einAFhile~ cells derived from an erythroid lineage, such as red blood
cells; and cells of a Iymphoid lineage such as B Iylllpho~,yLt~ and T Iylll~,hO~,ylts. As is
generally Im~l.orstnol1, each of the above lineages mature from "lJh~ Jut".ll 1, ... . ,1,..:.: ;.
stem cells" (also referred to herein as "h~ stem cells" or "colony-forming stem
WO 96/06165 219 ~ 3 11 PCTIUS9S/10250 ~
26
cells"), which undergo a series of d;rf~ iiull steps leading to hl~s~ ly lineage-
restricted progenitor cells. Thus, the term h~ cell also r~ the
various he~ ,t~,~u;~ic precursor cells from which these dirrtl~ ia~ed cells develop, such
as BFU-E (burst-forming units-erythroid), CFU-E (colony forming unit-erythroid), CFU-
S Meg (colony forming unit~ e), CFU-GM (colony forming umit-~l~,ulo~ e-
monocyte), CFU-Eo (colony forming unit-eosinophil), and CFU-GEMM (colony formingunit-granulocyte-erythrocyte-megakaryocyte-monocyte).
"Stromal tissue", as used herein, refers to the supporting tissue or matrix of an
organ, as .l; ~ l.. d from its fimctional elements or pa~ llld.
"Tolerance", as used herein, refers to the inhibition of a graf recipient's immume
response which would otherwise occur, e.g., in response to the ;ll~UJdU~iUll of a nonself
MHC antigen into the recipient. Tolerance can involve humoral, cellular, or both humoral
and cellular responses. Tolerance, as used herein, refers not only to complete
;, . " " . .. ,nln~ . tolerance to an antigen, but to partial imnnnnnlogir tolerance, i.e., a degree
15 of tolerance to an antigen which is greater than what would be seen if a method of the
invention were not employed.
"MHC antigen", as used herein, refers to a protein product of one or more MHC
genes, the term includes fragments or analogs of products of MHC genes which canevoke an immune response im a recipient organism. Examples of MHC antigens include
20 the products (and fragments or analogs thereof) of the human MHC genes, i.e., the HLA
genes. MHC antigens in swine, e.g., miniature swine, include the products (and fragments
and analogs thereof) of the SLA genes, e.g., the DRB gene.
"Miniature swine", as used herein, refers to wholly or paltially inbred animal.
As described herein, the transgenic donor tissue may come from a cell culture or25 from a transgenic swine. The transgenic swine should express (or be capable of
expressing) the l~c~ ..,.l.;., - ~ human gene in at least the tissue to be u ..,.~ Ir~l
The practice of the present invention will employ, unless otherwise indicated,
techniques which are within the skill of the art. Such techniques are explained fully in the
literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by
30 Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press:1989); DNA
Cloning, Volumes I and II aD. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J.
Gaited., 1984);Mullisetal.U.S.PatentNo.4,683,195;NucleicAcidHybridizationaB.
D. Hames & S. J. Higgins eds. 1984); TranscriptionAnd Translation (B. D. Hames & S.
J. Higgins eds. 1984); Culture Of Animal Cells a~. I. Freshney, Alan R. Liss, Inc., 1987);
35 ~mmobili~d Cells And Enzymes aRL Press, 1986); B. Perbal, A Practical Guide To
Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc.,
N.Y.); Gene Transfer Vectors ~or Mammalian Cells (J. H. Miller and M. P. Calos eds.,
1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 ~Wu
~ WO 96106165 2 1 9 6 3 ~ ~ PCT/U595J10251~
27
et al. eds.), ~ 1, Meth~ods In C~ll And Molecular Biology (Mayer amd
Walker, eds., Academic Press, London, 1987); Handbook Of E~ mmunology,
Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); 11' , ''AtilZg the Mouse
limbryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Although methods and materials similar or equivalent to those described herein
cam be used in the practice or testing of the present invention, the preferred methods and
materials are described below. All publications mentioned herein are iUl~Ul~)l ' ' by
reference. In addition, the materials, methods, and examples are illustrative only and not
mtended to be limiting.
IT. R~ ~.,,i.;"~ HnnnAn (~n! c
IllLIudu~Liul~ of a human 1 ' r ~ ~ gene into a swine cell of the present
invention requires that the Ir~ ~ 1l l Ih l -- .1 human gene be transfected into the cell, or a
precursor of the cell. As will be nnri~ rctnAJ~i, the mode of introduction and the desired
mtegration phenotype of the resulting swine cell (i.e. whether the vector is integrated into
the cell's genome or remains a ' ~ ) can influence the choice of expression vector
used to generate the subject lC' ~ h .~ I swine cells. In general, expression vectors
containing the human 1 , . - gene can be constructed by operably linking an
a~ u~l;a~e 1~ regulatory sequence, e.g. a tissue-specific promoter, with a
nucleic acid, e.g. cDNA or genomic DNA, encoding the 1 , protein.
Moreover, a tissue-specific promoter can be linked to more than one cDNA, each
encoding a different human 1- r ~ protein, or a human L~llaLulJu~ , protein and
some other foreign protein, e.g., another cell surface antigen. Depending on the specific
promoter used, it may be desirable to modify the promoter-cDNA construct to include an
intron splice site andlor a pOl~ad~,ll.ylaiiull signal.
In addition to the 5' and 3' expression regulation sequences and the 1~ . " "1.;, .~ . ,
DNA (either genomic or derived from cDNA) the transgenes of the invention can also
include a "IC~"'I'h;"'"'l intervening sequence" which interrupts the transcribed but
' 5' region of the transgene. Such intervening sequences (IVS) are known in
the art. Such sequences as used herein are "hnm nlngmle, c ~., ~" .1,; ",. . .I h.t., ~ .,l~lg
sequences" in that the 5' and 3' RNA splice signals in the IVS are those normally found in
am IVS from an ~n ing~n~.l.c or h~,t~uloy,uu~ gene. Re~ , 1,: - .1 ill.~.~,Uillg sequences
may, however, also comprise a "hybrid intervening sequences". Such hybrid intervening
sequences comprise a 5' RNA splice signal and 3' RNA splice signal from intervening
sequences from different sources. In some aspects of the invention, such hybrid IVS
comprise at least one "~ ;ve RNA splice sequence". As used herein, a permissive
RNA splice signal is an RNA splice signal sequence, preferably a 3' RNA splice signal,
from an intron contained within a repertoire of germ line DNA segments which undergo
, . 1. . . I during cell dilF..~ idtion. Lxamples of such gene repertoires include the
~ == . _ _ _ . . _ , . . _ . . ...... _ .. _ . _ _ .. .. _ = ... ... _ .. _
2~9631'~
WO96/06165 PCT/US95/10250
28
immnAA,L;lAIbulin super gene family, including the i~ gll bulil~ and T-cell antigen
receptors as well as the repertoire of the major l ,;~ ; h;lity complex (MHC) genes
and others. Particularly preferred permissive splice sequences are those obtained from the
;, . " . " .. ,.~lr.l..,l;,. repertoire, preferably of the IgG class, and more preferably those 3'
S splice signal sequences associated with the J-C segment Ir-' I ' ' Ig~ of the Ig heavy
and light chain, most preferably the heavy chain. Hybrid intervening sequences
containing permissive RNA splice signals are preferably used when the l~ lh;
DNA ~UII~ UUlld:~ to a cDNA sequence.
Based on the foregoing, it is apparent that preferred transgenes can include
l O relatively large amounts of 5' and 3' expression regulation sequences. FurLher, the
.r~.,."h,;,.A..l DNA is preferably derived from genomic clones which may be tens to
hundreds of kilobases in length. Based on the present technology for cloning and~ I IA I ~;l ~ lIAl; I IL; DNA, the cu~.~.L u~liu~l and lld~,lu;llJ~,~liull of transgenes is practically
limited to linearized DNA having a length not greater than about l OOkb. However, the
l S transgenes of the invention, especially those having a length greater than about 50kb, may
be readily generated by hlLIudu~ lg two or more u . ~lla~JIJhlg fragments of the desired
transgene into an embryonal target cell. When mtroduced, the uv~llalJ,uhlg fragments
undergo 1...,, .~ g~ .l . 11.; l . ' ;-111 which results in integration of the fully lr~ . d
transgene in the genome of the target cell. In general, it is preferred that such u ~ ,u;llg
20 transgene fragments have 100% homology in those regions which overlap. However,
lower sequence homology may be tolerated provided efficient ~ 1IU~ IC~
occurs. If non-homology does exist between the h~ sequence portions, it ispreferred that the non-homology not be spread throughout the h~lmnlog~ sequence
portion but rather be located in discrete areas. Although as few as 14 base pairs at 100%
25 homology are sufficient for homologous lr.~ .,..l,;, -';..., in ,.,A..,..,AI;A.. cells (Rubnitz et
al. (1984) A~oL CelL ~ioL 4:2253-2258), longer h~ o~ ;u~ ~ sequence portions arepreferred, e.g. 500bp, more preferably l,OOObp, next most preferably 2,000bp and most
preferably greater than 2,000bp for each homologous sequence portion. It may also be
desirable to use YAC's and MAC's for mRnirll1Rti,A~n of l~ . .I nucleic acids of the
30 invention.
In further ~lllbod;lll.,.lb, the Ir<~ .,.,1; ~ --.11.. ~ t- ~1~~ ' ;~ protein can be a chimeric
peptide having a portion encoded by a human h~ gene, amd a portion encoded
by a swine h ~ S 'l"~ gene. In a preferred r~ ~ ~hO~ , the chimeric protein
comprises an r~trRrl~ Rr domain of human origin, and an intrR~ l1Rr domain (and
35 l, Al ~ r domain) of swine origin. Such a chimeric protein can be useful in
UIII:~kUlCI_.~ such as where Lhe intnRr~ lRr domain of the human molecule is less
efficient than the swine counterpart at engaging intrRl~ nlDr signal I I A..~ proteins
of the swine cell.
~ wo 96/06165 2 1 9 6 ~ . PCT/US9S/10250
29
Techniques for making fusion genes are well known. Essentially, the joining of
various DNA fragments coding for different polypeptide sequences is performed inaccordance with conventional techniques, employing blunt-ended or stagger-ended
termini for ligation, restriction enzyme digestion to provide for d,u~lul terrnini,
5 filling-in of cohesive ends as _p,UlU. ' ', alkaline ~ treatment to avoid
uud~ le joining, and enzymatic ligation. Alternatively, PCR A.l~pl;~ ;.... of gene
fragments can be carried out using anchor primers which give rise to ~ ..., ~1.l... ,...:A. ,y
overhangs between two ~iulla~,-,uLiv~ gene fragments (e.g. between the human gene and
the swine gene) which can ~ ly be annealed to generate a chimeric gene
10 sequence (see, for example, Current Protocols in Molecular Biology, Eds. Ausubel et al.
John Wiley & Sons: 1992).
Sincethemid-1980's,anumberûfl~ ;rgrowtllfactorreceptorshave
been cloned from human sources and are readily accessible by standard molecular
biological techniques for use in the present invention (see, for review, Foxwell et al.
(1992)C~in~.rplrm~n~ol90:161-169). Inmanyinstances,thel.~,~ dl.l;.. ,.Alregulatory
sequences naturally associated with the cloned genes have likewise been identified and
well ~ - ;,- I Moreover, in light of the present disclosure, it will be apparent to one
skilled in the art that other suitable genes can be obtained from human sources, and swine
trAAncAription~l regulatory sequences obtained and used with the human gene.
Inoneaspectoftheinvention,thel~ .. ll;.. A 1l swinecellsarederivedtoexpress
the human c-kit gene, or another member of the closely related tyrosine kinase receptor
family to which it belongs, such as the colony-stimulating factor I receptor (c-fms), a
platelet-derived growth factor receptor (PDGF-Ra and PDGF-RB), or a fetal liver kinase
(FLK-I or FLK-2) (see, for review, Andre et al. (1992) Oncogene 7:685-691). cDNAclones, and in some instances genomic clones, of each of human c-kit (Ogawa et al.
(1994)ExpHematol22:45-51;Vardenbarketal.(1992)0ncogene7:1259-1266;Yarden
etal. (1987)EMBOJ6:3341-3351;Blume-Jensenetal.(1991)EMBOJ10:4121-4128),
human c-fms (Bourette et al. (1993) ~Q~ 81: 2511-2520; Dibbs et al. (1990) ~th
E~f~2:301-311; Sherr(1988)Leukemia2:1325-1425),humanPDGF-Raandhuman
PDGF-Rb (Matsui et al. (1989) 12~ 86:8314-8318), and human FLK- I and human
FLK-2 (U.S. Patent No. 5,270,458; PCT Publication No. WO 93110136; PCT Publication
No. WO 93/00349; U.S. Patent No. 5,283,354) have been isolated, and as describedbelow, can be used to generate the expression vectors, including transgenes, required to
derive the subject swine cells. Moreover, the promoter sequences, and other
1.,.. ,~. ;l.l,.. l regulatory sequences, have been .. l.~ . l ;, d for each receptor (Yasuda et
al. (1993) ~iochrm ~;oph,vs Res Commun 191 :893-901; Yamamoto et al. (1993) ,~
Cnn~ pr R~ 84:l l36- l l 44)~ and can be utilized in the ~ ti- gene
construct. Al ~Iy, the regulatory sequences flanking the cwl~"uulll;llg swine gene
_ . _,, . .. _ . , . _ _ .. . = _ . = .. = . .. .... .. . .. . .. .. ... .... .
WO 96/06165 219 6 31 1 PCT/US9S/102~0 ~
(genomic) can be cloned by standard techniques and emp!oyed to regulate expression of
the human gene in the lC ' swine cell.
In another aspect ofthe invention, the lc~ swine cells are engineered to
express the human Gl~lulo~ Ma~lu~ Colony-Stimulating factor (GM-CSF)
receptor. The human GM-CSF receptor has been cloned (Sasaki et al. (1993) ~
~h~2Z268:13697-13702;Sakamakietal(1992) E~OJ11:3541-3549;Hayashidaetal.
(1992)NipponRinshoS0:1867-1871;Metcalfeetal.(1990)~,~87:4670-i674;
Gearingetal(1989)EMBOJ8:3667-3676;Locketal.(1994)PNAS91:252-256and
Kitamuraetal.(1991)1~i88:5082-5086),andfoundtoconsistoftwopolypeptide
chains, the "alpha chain" and the "beta chain", the latter of which is utilized by other
growth factor receptor complexes, such as the IL-3 receptor and the IL-5 receptor. Each
of the two chains cam be expressed from the same expression vector, or from two
separate expression vectors within the same cell. A transgenic swine which express a first
transgene can be crossed with a transgenic swine which expresses a second transgene to
provide a transgenic animal which expresses both. (~fo(1ifir~lfir,n~ of this technique can
be used to add third and subsequent genes as well.) Thus, a transgenic swine which
expresses only one transgene or the other of the alpha or beta chains, can be cross-bred
with the appropriate transgenic mate to yield offspring which are chimeric for both
chains. Alternatively, only the alpha chain need be expressed as it may form active
receptor complexes with the swine beta chain. The alpha chain provides most of the
binding specificity to the receptor complex and is therefor more likely to influence
species specific binding of GM-CSF than is the beta chain.
In similar fashion, human IL-3 receptors can be constituted in swine
h~ àlu~o;~l;c cells utilizing the cloned genes for each of the alpha and beta chain
subunits(Sakamakietal.(1992)1i~MBOJ11:3541-3549;andKitamuraetal.(1991)6/1
661165-1174) to derive appropriate expression vectors.
Thus, a nucleotide sequence derived from the cloning of the humam l S,o;~
gene, encoding all or a selected portion of the human protein, can be used to produce a
, ~ ..., .1.: ., - .I form of the human protein in swine cells. Ligating the poly.lul,le~,l;dc
30 sequence into a gene construct, such as an expression vector, and 1,, " r~ ., . . " . .g or
1.,.., F . 1;,,g into swine cells can be carried out by standard procedures.
The l~ ~ ..., .l ... ,~ .I nucleic acid constructs described above may be inserted into any
suitable plasmid, b~ I .. ,..~.l .~g~, or viral vector for ~ ;. l, . and may thereby be
propagated using methods known in the art, such as those described in Molecular
35 CloningA Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold
Spring Harbor Laboratory Press:1989). In the preferred G,.,l.o,l,.,...,l~, expression vectors
compatible with eukaryotic cells, preferably those compatible with vertebrate cells are
used. Eukaryotic cell expression vectors are well known in the art amd are available from
21 9 6 3 ~1
WO 96tO6165 :- PCT/US95/10250
31
several ~,UII~ .;~ sources. The ~nreferred swine expression vectors contain both~-uhal~uLiu sequences (to facilitate the IJlUIJa~dtiUl~ of the vector in bacteria), and one or
more eukaryotic 1~ units that are functional in swine cells. Typically, such
vectors provide convenient restriction sites for insertion of the desired ~ DNA
5 molecule. The pcDNAI, pSV2, pSVK, pMSG, pSVL, pPVV-I/PML2d and pTDTI
(ATCC, No. 31255) derived vectors are examples of 1l ", 1~-, expression vectors
- suitable for 1~ r~. l ;. ", of swine cells. Some of these vectors are modified with
sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug
resistance selection in both l luh~uLic and eukaryotic cells. Alternatively, derivatives of
10 viruses such as the bovine papilloma virus (BPV-I), or Epstein-Barr virus (pHEBo,
pREP-derived and p205) can be used for expression of proteins in swine cells. The
various methods employed in the preparation of the plasmids and ~ r, ~ " of hostcells are well known in the art. For other suitable expression systems for useful in the
present invention, as well as general l~ procedures, see Molecular CloningA
15 Laboratory Man21al, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring
Harbor Laboratory Press: 1989).
Under those .,h~ ,. . wherein the 1~ nucleic acid molecule is
introduced into swine oocytes as a transgene to be ill~.Ulp~ ' ~ into the host genome, the
construct can be lineari~d and excess vector sequences will preferably be removed, for
20 example, by cutting the 1,~,~ .,l.;,.~.,l nucleic acid molecule with one or more restriction
to produce a linear nucleic acid molecule containing as a minimum, the
desired trPn~rriptir,nPl regulatory sequences and a human I r ' gene. Preferablythe nucleic acid molecule (e.g. the transgene) is from about 5,000 base pairs to about
100,000 base pairs in length.
The suitability of particular human l ~ proteins, e.g. whether the
humam protein is more appropriate than its swine coumterpart, can be determined using
one of the assays described below, and its cDNA can then be determined by st~mdard
techniques. For example, according to the invention, one would linh a promoter with
cDNA encoding human c-hit to create a vector for expression of human c-hit in swine
cells. The expression of this promoter-? r ~ ' ~ ~ protein transgene can be verified,
for example, by direct detection of human c-hit expression in appropriate tissue culture
cells. Additionally, the ability of the human gene to potentially provide improved in vivo
surviva. of the transgenic swine cells can be predicted in vitro by comparing the relative
biologic activities of the human versus the ~ h~ protein in swine cells. Improved
survival should be correlated with the ability of the ~ ; "~ ~l cell to grow in semisolid
media in response to a humam growtb factor.
Some transgenic pigs may carry multiple copies of the transgene, with the
tr~msgene copies ;". ~ (1 at different sites in the genome. The site of transgene
WO 96/06165 32 PCT/US95/10250
inrnrrnr:~tion into the genome can strongly influence transgene expression; therefore, one
may correlate transgene expression with discrete transgene restriction fragment length
polymorphism patterns. In addition, as discussed above, two transgenic swine, each
expressing a different l ..., . ~ .. 1 ;r protein, or one I "o;.,ii, protein and some other
5 foreign antigen. e.g. a human MHC peptide, on the same, or different, tissue cells, can be
mated to produce an amimal that expresses bnth tr~ncgrn~ products. The same effect can
be achieved by introducing two separate tramsgenes into the same embryonal cell.Exemplary in vitro assays useful for ~ g whether a particular human
h. . ., ~ protein is suitable for use in methods of the invention include: (I) assays
10 that measure binding of the ligand, e.g. growth factor of ECM rnnnrnnPnt, to the
eYtrs~rp~ r domain of the humam h~ protein on the cell surface of the
l~.,,,,l.;.,~.,l swine cell; and (2) assays that test for activation ofthe signal s ~.,~.l.,. I;.,,
pathways that are activated by the interaction of the human cell surface protein and an
agonistic ligand. The first class of assays is useful to, for example, identify potential
15 human h~ tvlJu;~ ; proteins which may improve viability of xr~ nr~l swine marrow
by comparing the binding constant of the human ligand (e.g. SCF, IL-3, GM-CSF) for the
recnmhin~t swine cell versus the naturally occurring swine cell. The second class of
assays is preferred to determine which of the human I ~ proteins are suitable
for use in the present invention based upon their ability to function in the swine cell.
20 TTT Gpnptir~l~y Er~in~-Pred SwinP Cplls
Transgenic swine cells of the invention can be produced by any methods known to
those in the art. Transgenes can be introduced into cells, e.g., stem cells, e.g., cultured
stem cells, by any methods which allows expression of these genes at a level and for a
periodsufficienttopromote~"~.,.lll"..,lor.,.",l,t .A. ~ ofthecells. Thesemethods25 include e.g., tr:ln~f~rtion, cl~ u~uul~Lion~ particle gun bombardment, and tr:~m~lu~tinn by
viral vectors, e.g., by lcllvvh u,c,. Transgenic swine cells can also be derived from
transgenic animals.
RPtrovir~ ofTr~nc~enPc
Re~...,.l.h,,..lllcLIuvilu,.,,areapreferreddeliverysystem. Theyhavebeen
30 developed extensively over the past few years as vehicles for gene transfer, see e.g.,
Eglitisetal., 1988 ,Adv. Exp. Med. Biol.241:19 . ThemostaL-~I.L~vlv~al.lretroviral
vector construct is one in which the structural genes of the virus are replaced by a single
gene which is then transcribed under the control of regulatory elements contained in the
viral long terminal repeat (LTR). A variety of single-gene-vector backbones have been
35 used, including the Moloney murine leukemia virus (MoMuLV). Retroviral vectors
which permit multiple insertions of different genes such as a gene for a selectable marker
and a second gene of interest, under the control of an internal promoter can be derived
from this type of backbone, see e.g., Gilboa, 1988, Adv Exp. Med. Biol. 241:29.
~ - 21~211
_ WO 96/06165 ~ V ~J PCr~US95/10250
33
The elements of the C~ LI u~,Lio-l of Avectors for the expression of a protein product
are known to those skilled in the art. The most efficient expression from retroviral
vectors is observed when "strong" promoters are used to control transcription, such as the
SV 40 promoter or LTR promoters, reviewed in Chang et al ., 1989, Int. J. Cell Cloning
5 7:264. These promoters are ~,ull~LiLuLive and do not gcnerally per nit tissue-specific
expression. Other suitable promoters are discussed above.
The use of efficient packaging cell lines can increase both the efficiency and the
spectrum of infectivity of the produced 1~ virions, see Miller, 1990, ~uman
Gene Therapy I :5. Murine retroviral vectors have been useful for ~ f ,; "g genes
efficiently into murine embryonic, see e.g., Wagner et ai., 1985, EMBO J. 4:663;Griedley et al., 1987 Trends Genet. 3 :162, and ~ - - - ApA i~tir stem cells, see e.g.,
Lemischka et al., 1986, Cell 45:917-927, Dick et al., 1986, Trends in Genetics 2:165-170.
A recent ilU~ IIL in retroviral technology which permits attainment of much
higher viral titers than were previously possible involves AmplifirAAtiA,n by c~ c~.uLive
15 transfer bet~-veen ecotropic and ~ll~ L~ ;c p~kaging cell lines, the so-called "ping-
pong" method, see e.g., Ko ak et al., 1990, J. Yirol. 64:3500-3508; Bodine et al., 1989,
Prog. Clin. BioL Res. 319: 589-600.
T"...~.l... Ii...,efficienciescanbeenhancedbypre-selectionofinfectedmarrow
prior to hlL Udu~.Liuu into recipients, enriching for those bone marrow cells expressing
high levels of the selectable gene, see e.g., Dick et al., 1985, Cell 42:71 -79; Keller et al.,
1985,Nature318:149-154. In~ddition,recenttechniquesforincreasingviraltiters
permit the use of virus-containing ~ rather than direct incubation with virus-
producing cell lines to attam effcient 1, ,~ -, see e.g., 8Odine et al., 1989, Prog.
Clin. Biol. Res. 319:589-600. BecausereplicationofcellularDNAisrequiredfor
integration of retroviral vectors into the host genome, it may be desirable to increase the
frequency at which target stem cells which are actively cycling e.g., by inducing target
cells to divide by treatment in vitro with grow~h factors, sce e.g., Lemischka et al., 1986,
Cell45:917-927,ae..,..1,'~ ,oflL-3andIL-6apparentlybeingthemostefficacious,
see e.g., Bodine et al., 1989, Proc. NatL ~cad. Sci. 86:8897-8901, or to expose the
recipient to 5-fluorouracil, see e.g., Mori et al., 1984, Jpn. J. Clin. OncoL 14 Suppl.
1:457-463,priortomarrowhalvest,scee.g.,Lemischkaetal., 1986, Cell45:917-927;
Chang et al., 1989, Int. J Cell Cloning 7:264-280.
The inclusion of cytokines or other growth factors in the retroviral I ~ r~
can le~d to more efficient ~ r ~ of tAAArget cells.
~ 35 - Lxample I
Production of retrovirally I, ,. ., ~ r~ l l ., . ~ 1 cells and sustained expression of a swine transgene
m murine bone marrow ' - r ' " cells by retroviral-mediated gene tr~msfer
219S31~L ~ . ~
WO9CI06165 r~ s
34
The efficacy of a retroviral gene transfer approach for introducing expressible
genes was shown by using double-copy retroviral vectors engineered to express a drug-
resistance marker (neomycin) and a swine class II DRB cDNA. Although this example
uses the swine class II DRB gene, those skilled in the art will recogmze that other genes
5 described herein, e.g., the human c kit gene, can be substituted therefor.
Infectious particles containing these vectors were produced at a titer of >I x I o6
G418-resistant colony-forming units/ml using both ecotropic and ~ull,uLullu,u;~. packaging
cell lines. Flow cytometric analysis of DRA-transfected murine fibroblasts ,"l .~ lly
transduced with virus-containing '"l" . . -~ u ~ lrd that the transferred10 sequences were sufficient to produce DR surface expression. CO~ aiiUll of murine
bone marrow with high-titer producer lines leads to the ~ .l" ~ . of 40O/o of
~lall~du~,y t~,/ma~lu~lla~;c colony-forrning units (CFU-GM) as determined by thefrequency of colony forrnation under G418 selection. After nearly 5 weeks in long-term
bone marrow culture, virus-exposed marrow still contained G418-resistant CFU-GM at a
15 frequency of 25~/o. In addition, virtually all of the transduced and selected colonies
contained DRB-specific transcripts. These results show that a significant proportion of
very primitive lllr~,lu,uùh,Lic precursor cells can be transduced with the DRB 1~
vector and that vector sequences are expressed in the di~tlcllli_'~,d progeny of these cells.
These ~ ~ 1.. .; ., .~ . .~ ~ are described in detail below.
Details of retroviral constructs are given in Fig. I . Two types of retroviral
constructs, GS4.4 and GS4.5, were prepared. The diagram in Fig. I depicts the GS4.5
retroviral construct. The arrows in Fig. I indicate the directions of trslncrrirtir,n In
GS4.5, the orientation of DRB cDNA 1.,...~ ;..., is the same as viral tr~n~rrirtinn In
GS4.4 (not shown), the TK promoter and the DRB cDNA were inserted into the 3' LTR
25 ûf N2A in the reverse orientation of ~ ti. ~ . with respect to viral tr~ncrriptinn and
the simian virus 40 3' RNA processing signal was added. pBSt refers to Bluescript vector
sequence (Stratagene). The thymidine kinase (TK) promoter was contained within the
215-base-pair (bp) Pvu II-Pst I fragment from the herpes simplex virus TK gene,
McKnight, 1980 Nucleic ~cids Res. 8:5949-5964. The simian virus 40 3' RNA
30 processing signal was contained within the 142-bp Hpa l-Srna I fragment from the
pBLCAT3 plasmid, Luckow et al., (1987) Nucleic ,4cids Res. 15:5490-5497, (see Fig. 1).
Sequence analysis of the junctions of the promoter, the class II cDNA, and the vector
sequences confirmed that the elements of the constructs were properly ligated.
These retroviral constructs were transfected into the ~l~,uhullu,ul~_ packaging cell
line PA317, and 1.. , .~ were selected in G418-containing medium. A total of 24
and 36 clones, transfected, lcDu.~ti~ly, with the GS4.4 and GS4.5 l~ ~....,l,;,.~..l plasmids,
were tested by PEG ,ulc~,;,uildliul~ of culture ~ and slot-blot analysis of viral
RNA. Of these, 8 and 12 clones were found, lcDu~ ly, to be positive for DRB,
2196~
W~96106165 PCTJUS95/10250
although the DRB signal was cù~ .lLly weaker for the GS4.4-derived clones. Analysis
of genomic and spliced transcripts from GS4.5 cells by dot-blot analysis of PEG-~Ul~ 1 ~ particles revealed h~ u~,.l.,;ly among viral transcripts in various clones
transfected by GS4.5. In one ~YpPnmPnt~ two clones contained DRB+/Neo+ viral RNA,
5 two con~ained DRB+/Neo~ RNA, two contained DRB~/Neo+ RNA, and one showed no
class Il orNeosignaT. G418-resistance (G418r)titer .ll ~. .", 8 . -,"" of ~ ".from
DRB-positive clones confirmed that the average titer produced by GS4.5-transfected
clones (103-104 CFU/ml) was sig,ir,.,,.ily higher than that of the GS4.4-transfected
clones (102-103 CFU/ml). Further ~ i.." ~l~ 8,.. .,1~ were, therefore, conducted
withthebestclone,namedGS4.5C4,whichproducedaninitialG418rtiterof3xlO4
CFU/ml.
Plasmid preparation, cloning procedures, DNA sequencing, RNA pl~,p~Liul~s,
Northern blots, and RNA slot blots were performed by standard methods, Sambrook et
al., 1989, Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor Lab.,
15 Cold Spring Harbor). Final washes of blots were carried out in 0. I x SSPE (I x SSPE =
0.18 M NaCI/10 mM sodium phosphate, pH 7.411 mM EDTA) at 60~C for 30 min.
The packaging cell lines PA317, Miller et al., 1986, MoL Cell. 13iol. 6:2895-2902,
GP+E-86, Markowitz et al., 1988, J. Virol 62: 1120-1124, psiCRIP, Danos et al., 1988,
Proc NatL Acad. ScL USA 85:6460-6464, and their derivatives were maintained at 37~C
20 in Dulbecco's modified Eagle's medium (DMEM; GIBCO) with 10% (vol/vol) fetal
bovine serum (CELLect Silver; Flow T .Rh~lrRt~Alrir~ P~ t~ 1 with 0.1 mM
l ;AI amino acids (Whittaker Bioproducts), antibiotics penicillin (5 units/ml), and
~LI~,uLul~ ,h~ (5 llglml).
Il111JIU ~ ,lli of the Viral Titer of the C4 Clone. Since recent data indicated
25 that ~ containing high retroviral titers were the best candidates for ~ g
bone marrow cells, Bodine et al., 1990, Proc. Natl . Acad. Sci . USA 87:3738-3742, the
titer of the C4 producer clone was increased by "ping-pong" - I .1.1; 1~. -~ ;. ." Bestwick et
al.,1988, Proc. NatL Acad. Sci. USA 85:5404-5408. SnrPrnAtAnt from nearly confiuent
C4 cultures was used to transduce GP+E-86 ecotropic packaging cells and G418 selection
30 was applied. Forty-eight clones were isolated and screened by PEG precipitation for
production of viral particles. S~ Ip I ~ from 18 of these clones were DRB-positive by
dot-blot analysis of viral RNA and had G418r titers between 0.5 and 3.5 x 104 CFU/ml).
One positive clone was then amplified by the ping-pong technique with the allllJl.ullu~;c
Ly~ullly~,;ll-resistant packaging line psiCRlP. Sll~ from 48 I~y~u~y~
35 resist_nt clones were examined for presence of DRB-positive viral RNA by PEG
precipitation and their G418r titers were APtPrminP/1 All of the clones were positive by
dot-blot analysis with the DRB probes and produced titers between I x 105 and I x 107
CFT T/ml. A. IJI.UIIU~U;U clone GS4.5 A4, which produced the highest titer, was tested for
2~9~3~
W096/06165 PCI/US95/10250
36
the presence of helper virus by the S + L-assay. No replication-competent helper virus
was detected.
.Amplifi~rlti--n of virus titer was achieved by the ping-pong technique. Since there
is evidence that psiCRlP packaging cells are less prone to produce helper virus than
PA317 when using certain types of vectors, Miller, 1990, Hum. Gene Therapy 1:5-14,
DRB ~ virions were prepared using the psiCRlP/GP-E-86 producer
i 6 ~ ~ 'fi~ Titer values > I x 107 CFUlml with no detectable i~ LuLIu~ helper
viruses were obtained, confrrming that this strategy produced safe viral particles suitable
for in vivo I ~ p ;" .
Northem blot analysis of GS4.5-producing clones C4, A9, and A4, each derived
from a different packaging cell line, showed a conserved l.~l,.ili~Li.,.. pattern. RNA
species cull~a~nldillg to the full-length viral genome, the spliced Neo transcript, and the
DRB ~ unit were observed with additional RNA species. High molecular size
species observed in these f A~ ' may constitute a read-through transcript starting
from the TK promoter and ending in the other long terminal repeat (LTR). In contrast to
many of the virion-producer clones obtained by tr~n~f~-ction that presented erratic DRB
transcripts, those obtained by I, r ~ showed stable DRB hybridization patterns
suggesting that no Ir- ~ . ,l .; . ~f ;~ events occurred during the :implifil~til-n procedure.
Retroviral titers were determined as follows. Replication-defective retroviral
particles were produced from packaging cell lines initially transfected with l~
construct using the standard calcium phosphate precipitation method, Wigler et al., 1978,
CelZ 14:725-733. Retrovirus production was estimated by the drug-resistance titer (G418-
resistant colony-forming units/ml, CFU/ml) as described, Bodine et al., 1990, Proc. Natl
~cad. Sci. US~ 87:3738-3742. Except for the psiCRlP line, G418 (GIBC0) selectionwas carried out in active component at 500 llg/ml for 10-12 days. Hygromycin B
selection was applied to psiCRlP-derived packaging clones in medium containing active
drug at 50 llg/ml for 10 days. Replication-competent helper virus titer was assayed on
PG4 feline cells by the S+L- method, Bassen et al., 1971, Nature 229:564-566. =
PEG precipitation of viral particles was performed as follows. Virions containedin I ml of culture ~ were ~ ' with 0.5 ml of 30% (wVvol) pol,~ lf
glycol ~PEG) for 30 min. at 4~C. After ~ u; ru~ the pellets were treated with a
mixture of RNase inhibitors (vanadyl rih-~n~ e complex, BRL), phenol/chloroform-extracted, and ethanol~ , ' Pellets were then l'~ ~l .1f d in 15.7% (vol/vol)
formaldehyde and serial dilutions were dotted onto nitrocellulose membrane.
35 ~ Analysis of DRB Tr~ in Packaging Cell Clones was performed as
follows. To test for accurate ~ .. . of the introduced DRB cDNA within thedifferent producer clones, Northern blots containing RNAs isolated from these clones
were hybridized with the DRB and Neo probes. Fig. 2 depicts the structure of the
WO 96tO6165 ~ 3 ~ ~ PCT~US95/10250
37 . . fl ;
provuus genome and the expected si~s of transcripts initiated from either the viral LTR
or the TK promoters. Each of the three GS4.5-containing clones, which were derived
from PA317 (clone C4), GP + E-86 (clone A9), and psiCRlP (clone A4) cells, showed
DRB-positive transcripts. As reported, TTRnt7~-Fol1ln~ et al., 1989, Proc. Natl. Acad. Sci.
USA 86:3519-3523, the unspliced genomic RNA (band a) and the spliced Neo transcript
(band b) were observed. In addition a transcript uniquely hylL;di~ lc with the DRB
probe was detected that cull~,uulld~ to the si~ predicted (1700 bases, band c) for the
DRB cDNA i A " unit.
Surface Expression of the SLA-DR Antigen on Transduced Fibroblasts was
detected as follows. An in vitro assay was developed to examine surface expression of
tbe SLA-DR antigen on murine fibroblasts. Flow cytometry (FCM) profiles shown inFig. 3A ,.~ ..S thatG418rtitersof3xl04(cloneC4)weresufficienttopromote
expression of the DR antigen on the cell surface of transduced DRA ~ "- f ~ l I ' In Fig.
3 solid lines indicate DR cell surface expression (anti-DR antibody binding) (22% and
75~/O of the bulk population of cells 3 days after ~ ;"" with GS4.5 C4, (B) and
GS4.5 A4 (C), respectively); dashed lines indicate anti-mouse class I antibody binding
(positive control); dotted lines indicate anti-pig CD8 antibody brnding (negative control).
Twenty-two percent of the bulk population of transduced cells were DR-positive and
subclones maintained class II expression for more than 5 months. The increase in titer
20 (clone A4) correlated with an increase in the number of cells transduced (75~/O of the
transduced population was DR-positive) and with the brightness of the DR signal.The class 111~,..,~ h 1;..,. assay was performed as (I~ ,. d in Fig. 4. NIH 3T3
cells were transfected with the SLA-DRAd cDNA inserted in a plasmid expression
vector, Okayama et al., 1982, MoL Cell. BioL 2: 161 -170. A~ u~d~ ly 3 x 104 cells of
a stable DRA ~ .. .1 (clone 11/12.2F) that expressed a high level of DRA mRNA
were then transduced overnight with I ml of DRB-containing retroviral surPTq~RntCells were . .h~ 1y cultivated in fresh DMEM ~ . ". . Ilrd with 10% fetal bovineserum and antibiotics for 2 additional days and examined for cell surface expression of
the DR antigen by FCM analysis.
The class 111, ,., .~.1 1 ;. ", assay described here provides a fast and sirnple method
to test both the expression and functional titer of retroviral constructs. By using cells
transfected with DRA, the need for lengthy double selection after ~ ;, .,. by two
separated vectors, Yang et al., 1987, Mol. Cell BioL I :3923-3928; Korrnan et al., 1987,
Proc. NafL Acad. Sci USA 84:2150-2154, is obviated. Cell-surface expression of DR
35 }l~,t~lUdilll.,li~ was A,.,.,~1,,'-.l by FCM analysis 3 days after 1.~ ,~AI1;,.", providing
direct evidence that the transferred sequences were sufficient to produce significant level
of DR ~ chain. More h~ ulL~ILly, this test allows Aqt~qrrninRtinn of "functional" titers
.
WO 96~06165 I ' PcTNsssrl02so
based on the expression of the gene of interest rather than on that of the 1~ ~ L ~ 11y
regulated drug-resistance marker.
The SLA-DRB probe was an EcoRI cDNA fragment containing the complete
coding sequence of the DR ,B chain, Gustafsson et al., 1990, Proc. NatL Acad. Sci. USA
87:9798-9802. Theneomycinrl1~n~ U""~r~ . gene(Neo)probewastheBclI-XhoI
fragment of the N2A retroviral plasmid, Hantzopoulos et al., 1989, Proc. NatL Acad. Sci.
USA 86:3519-3523.
Expression of Porcine DRB cDNA Transduced into Murine Bone Marrow
Progenitor Cells
The efficiency with which myeloid clonogenic precursors were transduced was
determined by assaying for CFU-GM with and without a selecting amount of G418 aRer
exposure of bone marrow cells to GS4.5-derived virions. Comparison of the number of
colonies that formed in the presence and absence of the drug, for two . Alll-l;l~.. .1; ~,
indicated that =40% of the initial population of myeloid progenitor cells were transduced.
15 The frequency of G418r CFU-GM was again determined after a sample of the transduced
marrow was expanded under long-term culture conditions for 33 days. Twenty-five
percent of the progenitors present after 33 days in culture still gave rise to colonies under
G418 selection. Colonies of cells arisen from CFU-GM were examined for the presence
of DRB-specific transcripts by converting RNA into cDNA and then performing PCR
20 ~ ; r;. ~ ,., as described herein and in Shafer et al., 1991 Proc. Naf L Acad. Sci. USA
88:9670. A 360-bp DRB-specific product was detected in five of six G418-selectedcolonies from freshly transduced marrow, whereas all six colonies similarly derived from
transduced progenitors present after 33 days in culture were positive. An additional band
of 100 bp observed in some of the samples probably reflects the stoichastic nature of
25 nr,n~perifir priming events. DRB-specific transcripts were also detected in the bulk
population of drug-resistant colonies and in producer cells but were not detected in
controls such as a bulk population of .1.~ J colonies, fibroblasts used to provide
carrier RNA, and a bulk population of transduced colonies processed as above butwitbout reverse ~ These latter data ~ ,..,.~1. ,. Ir that the PCR signal was
30 dependent on the synthesis of cDNA, excluding the possibility that provirus, rather than
viral message, was ~ UI~;blC for the amplified fragment .
Recent illllJlU ~ including ., ~I1. r. ~t ;~ of the virus design, increase of
viral titers, use of growth factors to stimulate precursor cells, and selection of stem cells
prior to I . ,., .~.1. ..1 ;. ., . have been shown to improve long-term expression of transduced
35 genes in the Llll~liU,UU;~LiC UUIII~L/al Ll-l~ , Bo&ne et al., 1990, Proc. NatL Acad. Sci. USA
87:3738-3742; Bodine et al., 1989, Proc. NatL Acad. Sci. USA 86:8897-8901; Wilson et
al., 1990, Proc. NafL Acad. Sci USA 87:439443; Kang et al., 1990, Proc. Nafl. Acad.
Sci. USA 8759803-9807; Bender et al., 1989, A~oL CelL BioL 9:1426-1434. The
2~963ll
WO 96106165 PCTNS95/10250
,. 39
~ .p..;..,..,l~ herein showthe app,icability ofthe retroviral gene-transfertechnique in
achieving expression of major l~ v ~ ;Iity complex class Il genes transferred into
7 r ~ ~ cells. To determine the efficiency with which dcvclvp~ l~ly primitive
? ' l~v;~.Lic cells were tramsduced, the frequency of G418r CFU-GM was assessed after
S expanding infected marrow cells kept for 33 days in long-term cultures. Expression of
the exogenous DRB cDNA was also monitored in cells derived from transduced CFU-
GM present either ' Iy after infection or after an extended culture period.
Virtually all of the colonies individually tested were positive for DRB-specific transcript,
suggesting that the DRB .c....,.,~ vecto~ is suitable for expression in murine
0 1 ' r ' " cells.
Bone marrow cells were obtained from the femora of 6- to 12-week-old female
C57BL/10 mice and were prepared as descrlbed, Ildstad et al., 1984, Nature 307:168-170.
Methylcellulose colony assays for granulocylt/llla~,lv~lla~, colony-forming umits (CFU-
GM),Eaveseta7., 1978,Blood52:1196-1210,wereperformedasdescribedusingS%
(vol/vol) murine interleukin 3 culture 5llrplrmPnt (Collaborative Research). Long-term
Dexter-type bone marrow cultures were initiated in 60-mm culture dishes with 2 x 107
nucleated cells, Eaves et al., 1987, CRC Crit. Rev. Oncol . HematoL 7:125-138.
Bone marrow cells were transduced essentially as described, Bodine et al ., 1989,
Proc. Natl. Acad. Sci. US~ 86:8897-8901. Briefly, bone marrow was harvested for 6- 12-
week-old female C57BL/10 donors that had been treated 2 days with 5-fluorouracil (150
mg/kg). p~ ;. ." was performed by incuba?ing 1 x 106 cells per ml for 2 days in
long-term Dexter-type bone marrow culture medium to which was added 7.5%
interleukin 3 cu ture 5~ and .c .,..l,;"--,l human interleukin 6 (200 units/ml; gift
from J. Jule, National Institutes of Health, Bethesda, MD). Marrow cells were
transduced for 48 hr by addmg 5 x 106 cells per 10-cm plate containing nearly confluent
virus-producers, Polybrene (8 mg/ml), and the cytokines described above.
Detection of DRB-Specific Transcripts in CFU-Derived Colonies was performed
as follows. Cells Cvllc~ ~' ,, to individual CFU colonies and to colonies present on an
entire plate (bulk) were first extracted from methylcellulose cultures by dilution in
30 phosphate-buffered saline and I,;r,.r,r:;, These cells were then combined with 1 x
106 NIH 3T3 cells (to provide carrier RNA), and total RNA was prepared using thegllanidine is~a iO."yal.ctc/CsCl method. First-strand cDNA was prepared from 20 llg of
total RNA using the Invitrogen Red Module kit. cDNA was then subjected to 50 cycles
of PcR~ llinthepresenceofthesLADRB-speciflcnl~ . .
CCACAGGCCTGATCCCTAATGG) (Seq. I.D. No. 1) and 17 (5'-
AGCATAGCAGGAGCCTTCTCATG) (Seq. l.D.7~.7O. 2) u~sing t7ne Cetus GeneAmp kit
as ~c ~ ~ ...., 7~ J (Perkin-Elmer/Cetus). Reaction products were visualized after
clc~ u~ i, on a 3% NuSieve agarose gel (FMC) by staining with ethidium bromide.
21 ~
WO 96/06165 PCT/US9!iJ10250
FCM analysis was performed with a FAC-Scan II nuu.c~-,cl..,c-activated cell
sorter (Becton Dickenson) on cells stained with the anti-DR ~ oc~ l antibody 40D,
Pierres et al., 1980, l~ur. J: IrnmunoL 10:950-957, an anti-H-2d allo antiserum, or the anti-
porcine CD8 IlI. ",o~ l .1 antibody 76-2-11, Pescovitz et al., 1984, J. ~p. Med.160:1495-1505, followed by fluorescein isothiocyanate-labeled goat anti-mouse
~mtibodies (Boehringer Mannheim).
IV PrerArAtion of TrAns~rnic Swin~
According to another aspect of the invention, there is provided graftable swine
cells, e.g., l- ~-~~ r ~ '' stem cells, e.g., swine bone marrow cells, or other tissue which
10 express one or more I .,~ ,~.;,. -- ' human proteins that facilitate improved survival amd/or
n " ,. . .1 of the swine L~llla~uuu;cliu cells in human subjects
In particular, the present invention includes .c~.-,l,h;,.~ ,I swine cells expressing a
human h~lu~Lu~u;~,Lic gene. In a preferred r.l.l~o/l;l"r.,l the human hPmAtoroiPtir gene is
apartofa..,~.,-",~,;l,~,lnucleicacidmoleculethatcontainsatissuespecificpromoter,e.g.
15 '~llaLuuu;~t;C specific promoter, located proximate to the human gene and regulating
expression of the human gene in the swine cell. Tissues containing the 1. ~ ..., .1.;.._. a
human 1.~ u ,~,oi.1 ;. gene may be prepared by introducing a 1~ -. . .1.; . . - .I nucleic acid
molecule into a tissue, such as bone marrow cells, using known 1 l .. " r. ",,, , ;, .. .
techniques. These I "...~r, ., ... - ;on techniques include 1. ,.. ,~ rr~ 1 ;.... and infection by
20 IcLluvhu~c~ carrying either a marker gene or a drug resistance gene. See for example,
Cnrrrnt Protocols in MolP~ nlslr B;olo~v. Ausubel et al. eds., John Wiley and Sons, New
York (1987) and Friedmann (1989) Science 244:1275-1281. A tissue containing a
~. ~.. 1.;., -- .I nucleic acid molecule of the present invention may then be IchlLludul,cd into
an animal using . .,~ l; l . .l ;. ., . techniques (See for example, Dick et al. ( 1985) Ce/l
25 42:71). The present invention also includes swine, preferably miniature swine,
expressing in its bone marrow cells a l~v~ ....1 ;..,1 a human 1 ~pù;~,.;c protein which
improves the ability of the swine bone marrow cells to reconstitute a human host. The
I rCI ~ . a constructs described above may be used to produce a transgenic pig by any
method known in the art, including, but not limited to, lu;clu;llj~L;u..~ embryonic stem
30 (ES) cell n~ ~nirl~ ti~n eL~ ul.u-~Lion, cell gun, transfection, ~ du~,iiol~, retroviral
infection, etc.
Transgenic swine of the present invention can be produced by ;--LIuduc;llg
transgenes into the germline of the swine, particularly into the getlome of bone marrow
cells, e.g. l...,.~a..lJ.J ~ cells. Embryonal target cells at various d~,~.lu,u~ ,llLdl stages
35 can be used to introduce the human transgene construct. As is generally understood in the
art, different methods are used to introduce the transgene depending on the stagc of
d., ~IU~UIII~IIL of the embryonal target cell. One technique for tr:-n~Ernir~lly altering a pig
is to microinject a IC~ ....1.;" -- ,I nucleic acid molecule into the male pronucleus of a
219~31;~ i, t
~ WO 96/0616~ PCTAUS9~10250
41
fertilized egg so as to cause I or more copies ofthe Ir...,..h;,..,l nucleic acid molecule to
be retained in the cells of the developing anirnal. The ~ nucleic acid molecule
of interest is isolated in a linear form with most of the sequences used for replication in
bacteria removed. T; . .~ - i, _ l it.l . and removal of excess vector sequences results in a
5 greater efficiency in production of transgenic mammals. See for example, Brinster et al.
(1985) PN~S 82:4438-4442. In general, the zygote is the best target for micro-injection.
In the swine, the male pronucleus reaches a size which allows lcpludu.,;blc injection of
DNA solutions by standard lui.,luih;_~liull techniques. Moreover, the use of zygotes as a
target for gene tr~msfer has a major advantage in that, in most cases, the injected DNA
10 will be ill~Ul~ into the host genome before the first cleavage. Usuahy up to 40
percent of the animals developing from the injected eggs contain at least I copy of the
~ u . ,1, , - - a nucleic acid molecule in their tissues. These transgenic animals will
generally transmit the gene tbrough the germ line to the next generation. The progeny of
the 1., ,;.~ .. _lly 1l~ embryos may be tested for the presence ofthe construct by
15 Southern blot analysis of a segment of tissue. Typically, a small part of the tail is used
for this purpose. The stable integration of the 1~ ~ ,. . .h, 1 ~, I nucleic acid molecule into the
genome of transgenic embryos allows perrnanent transgenic mammal lines carrying the
,~"".1.;.,--,1 nucleicacidmoleculetobetet~hlicl~d
Alternative methods for producing a mammal containing a 1~ ..h -.A..I nucleic
20 acid molecule of the present invention include infection of fertilized eggs, embryo-
derived stem cells, to potent embryonal carcinoma (Ec) cells, or early cleavage embryos
with viral expression vectors containing the Ir~.. 1.;.. --.1 nucleic acid molecule See for
example, Palmiter et al. (1986) ~nn. Rev. Genet. 20:465 'L99 and Capecchi (1989) Science
244:1288-1292.
Retroviral infection can also be used to introduce transgene into a swine. The
developmg embryo can be cultured ~n vitro to the blastocyst stage. During this time, the
1,1 l-"",~r~canbetargetsforretroviMlinfection(J~nich(1976)PNAS73:1260-1264).
Efficient infection of the hl - ~ is obtained by enzymatic treatment to remove the
zona pellucida (Hogan et al. (1986) in ~ qting the Mouse Em~r,vo, Cold Spring
Harbor LaboMtory Press, Cold Spring Harbor, N.Y.). The viral vector system used to
introduce the tMnsgene is typically a replication-defective retrovirus carrying the
transgene (Jabner et al. (1985) PN~S 82:6927-6931; Van der Punen et al. (1985) PN~S
82 6148-6152). Tramsfection can be obtained by culturing the bl-~Lul-..,lc,~ on a
monolayer of virus-producing cells (Van der Punen, supra; Stewart et al. (1987) EMBO
6:383-388). Alternatively, infection can be perforrned at a later stage. Virus or virus-
producing cells can be injected into tbe blastocoele (Jahner et al. (1982) Nature 298:623-
628). Most of the folmders will be mosaic for the transgene since; .. ..1.... ~l ;. ,.. typically
occurs only in a subset of the cells which formed the transgenic swine. Further, the
219~3i1
WO 96/06165 ' PCTNS95110250 -
42
founder may contain various retroviral insertions of the transgene at different positions in
the genome which generally will segregate in the offspring. In addition, it is also possible
to introduce tramsgenes into the germ line, albeit with low efficiency, by ill~ U.~.lillC.
retrovirel infection of the mid-gestation embryo (Jahner et al. (1982) supra).
A tbird approach, which may be useful in the l;Ull:~LI U._liUI~ of tansgenic swine,
would target transgene hlllullu~liull into an embryonal stem cell (ES). ES cells are
obtained from pre-i " ~ ; " . embryos cultured in vitro and fused with embryos (Evans
et al. (1981) Nature 292:154-156; Bradley et al. (1984) Nature 309:255-258; Gossler et al.
(1986) PNAS 83:9065-9069; and Robertson et al. (1986) Nature 322:445-448).
Transgenes might be efficiently introduced into the ES cells by DNA ~ f ~ or by
retrovirus-mediated trs~nc~ ti(m Such l~ r~ .l ES cells could thereafter be
combined with blastocysts from a swine. The ES cells could be used thereafter tocolonize the embryo and contribute to the germ line of the resulting chimeric pig. For
review, see Jaenisch (1988) Science 240:1468-1474.
Introduction of the IC~ gene at the fertilized oocyte stage ensures that the
gene sequence will be present in all of the germ cells and somatic cells of the tramsgenic
"founder" swine. As used herein, foumder (abbl~,~' ' "'F") means the pig into which the
.~ .., .1.1, .~ . .I gene was introduced at the one cell embryo stage. The presence of the
1~ ... 1.'. - ' gene sequence in the germ cells of the transgenic founder animal in tum
20 means that ~ y half of the founder animal's df ;~ ,; . will carry the activated
1. ~ .. 1. - - l gene sequence in all of their germ cells amd somatic cells. Introduction of
the IC~ ....1,;,. --.1 gene sequence at a later embryonic stage might result in the gene's
absence from some somatic cells of the founder animal, but the ~ of such an
animal that inherit the gene will carry the activated 1~ ~ . .., ,1, - - ' gene in all of their germ
25 cells and somatic cells.
~;....1;1~, . 1;,1ll of swin~ oocyt.~c
In preferred . . . 11 .uS; 1 l - I c the transgenic swine of the present invention is
produced by:
i) Illh,luil~ lillg a 1~ .~..Il.,llr.ll nucleic acid molecule into a fertilized swine egg to
30 produce a genetically altered swine egg;
ii) implanting the genetically altered swine egg into a host female swine;
iii) 1 1 ...;. .1 ~, . .; . ~g the host female for a time period equal to a substantial portion of the
gestation period of said swine fetus.
iv) harvesting a transgenic swine having at least one swine cell that has developed
35 from the genetically altered ..,--.. .~ . egg, which expresses a human I .~,ù;~.ic
gene.
In general, the use of Illi~,luhlj~,~,lion protocols in transgenic animal production is
typically divided into four main phases: (a) preparation of the animals; (b) recovery and
21963~I
~ wo 96/06165 P~_l/u~ 1J~v
43 :- -
I l IAI. Ia .1 I'f ' 1~ e i n vJtro of one or two-celled embryos; (c) IlliUlU;~ ,.,iiUll of the embryos and
(d) ~ ;on of embryo5 into recipient females. The mekhods used for producing
kansgenic livestock, pv~ uLuly swine, do not differ in principle from khose used to
produce kansgenic mice. Compare, for example, Gordon et al. (1983) Methods in
En~vmolo~v 101 :411, and Gordon et al. (1980) PN,45 77:7380 rn,n~ Prnine~ gcnerally,
kansgenicmicewithHammeretal.(l985)Nature3ls:68o~Hammeretal.(l986)JAnim
Sci63:269-278,Wallet~al.(1985)BiolReprod.3Z:6iS-651,Purseletal.(1989)Science
244:1281-1288,Vizeetal.(1988)JCellScience90:295-300,Mulleretal.(1992)Gene
121:263-270,andVelanderetal(1992)PNAS)89:12003-12007,eachofwhichteach
techniques for generating kansgenic swine. See also, PCT Publication WO 90/03432,
and PCT Publication WO 92/22646 and references cited therein.
One step of the ~ y phase comprises ~ llul~ g the estrus cycle of at
least the donor females, and inducing ~u,u.,luvuLlLion in the donor females prior to mating.
Su,u~lu vulaLiuu typically involves ~ .p drugs at an appropriate stage of the
eskus cycle to stimulate follicular d~ ,IV,UUI~IIL, followed by keakment wikh drugs to
,luulli~ eskus and initiate ovulation. As described in the example below, pregnant
mare's serum is typically used to mimic the follicle-stimulating hormone (FSH) in
r,r,nnhin~tir,n with human chorionic LullàduLlul ill (hCG) to mimic luteinizing hormone
(LH). The efficient induction of ~U~IU VULliiUII in swine depend, as is well known, on
several variables including the age and weight of the females, amd the dose and timing of
the ~;UII~IULIU~;II a-l~ a,';-.l- See for example, Wall et al. (1985) BioL Reprod.
32:645 describing ~u,u~,luvuLlLion of pigs. Sul~ vvululivll increases the likelihood that a
large number of healtby embrvos will be available after mating, and further allows the
Ul ~,Liliull~,l to conkol the timing Of ~ r
After mating, one or two-cell fertilized eggs from the superovulated females areharvested for Illi~luiuljc.livu. A variety of protocols useful in collecting eggs from pigs
are known. For example, in one approach, oviducts of fertilized superovulated females
can be surgically removed and isolated in a buffer suluLioll.,ullul~ medium, and fertilized
eggs expressed from the isolated oviductal tissues. See, Gordon et al. (1980) PNAS
77:7380;andGordonetal.(1983)MethodsinEn~molo~y101:411. Alternavively,the
oviducts can be cannulated and the fertilized eggs can be surgically collected from
, .. ~;1,.: 1, . ~1 animals by flushing wikh buffer soluliulJ~,ulluu~ medium, thereby
cliullluGLillg the need to sacrifice the animal. See Hammer et al. (1985) Nature 315:600.
The timing of the embryo harvest after mating of the ~U,U~,IUV I ' ' females can depend
35 on the length of the fertilization process and the time required for adequate Pnl~rermPnt
of the pronuclei. This temporal waiting period can range from, for example, up to 48
hours for larger breeds of swine. Fertilized eggs appropriate for luiuluillj~ iull, such as
WO 96~0616S PCT/US9~/102S0 --
, 2196311 44
one-cell ova containing pronuclei, or two-cell embryos, can be readily identified under a
dissecting ll~;~,lUa~,VUC.
The equipment and reagents needed fomll;.lu;llj~cLiull of the isolated swine
embryos are similar to that used for the mouse. See, for example, Gordon et al. (1983)
MethodsinEn~y7nolo~y101:411;andGordonetal.(1980)PNAS77:7380,describmg
equipment and reagents for 1ll;~ embrvos. Briefly, fertilized eggs are
positioned with an egg holder (fabricated from I mm glass tubing), which is attached to a
micro-l_ ~r ' ' ~ which is in turn .. ,..,.l; - ' ~I with a dissecting IlI;~lUa~U,u~ optionally
fitted with differential i~lt~,lrc~wl~e contrast optics. Where vi~--oli7-tinn of pronuclei is
10 difficult because of optically dense uyLulJl~lll;c material, such as is generally the case
with swine embryos, rf ntrifil~ tinn of the embryos can be carried out without
l,UIIIplUIII;a;llg embryo viability. Wall et al. (I 985) Biol. Reprod. 32:645 ~"u i rl l~f I ;. .11
will usually be necessary in this method. A Ir~ ,h ~ ,l nucleic ~id molecule ofthe
present invention is provided, typically in lineari~d fûrm, by linearizmg the IC~ ...,.1. --
15 nucleic acid molecule with at least 1 restriction r",1..,."~1f -.c, with an end goal being
removal of any plul~f;uyuL;~ sequences as well as any unecessary flanking sequences. In
addition, the Ir~ ...,.1.;.,--.1 nucleic acid molecule containing the tissue specific promoter
and the human hf m:~tnpl~if rir gene may be isolated from the vector sequences using 1 or
more restriction rll.1l.ll.l.1~ .. Techniques for n~onir~ ting and linearizing
20 Ir~ nucleic acid molecules are well known and include the techniques described
in Mrlrr~ r (~Innir~ A L ' M ' $econd Edition. Maniatis et al. eds., Cold
Spring Harbor, N.Y. (1989).
The linearized Ir~ .."1,;., -~ nucleic acid molecule may be Ill;~,luh.jf ~,t.,d into the
swine egg to produce a genetically altered, . ,~..., ..~1 ;,.., egg using well known techniques.
25 Typically, the linearized nucleic acid molecule is Ill;~,lVh~ ,J directly into the pronuclei
ofthefertilizedeggsashasbeendescribedbyGordonetal.(1980)PNAS77:7380-7384.
This leads to the stable ulllVIIIuaullldl integration of the I . .~ "" ,1,; . .,", I nucleic acid
molecule in a significant population of the surviving embryos. See for example, Brinster
et al. (1985) PNAS 82:4438 4442 and Hammer et al. (1985) Nature 315:600-603. The30 Ill;clull.,cdl.,~ used for injection, like the egg holder, can also be pulled from glass tubing.
T_e tip of a Ill;.,lu..~,~,Jle is allowed to fill with plasmid suspension by capillary action.
By IlI;~lUaLU~)iC ~ ;,. .,.1; ,~ 1 ;~ ." the ~ ,lu..~..,Jlc is then inserted into the pronucleus of a
cell held by the egg holder, and plasmid suspension injected into the pronucleus. If
injection is successfiul, the pronucleus will generally swell noticeably. The microneedle is
35 then withdrawn, and cells which survive the Illh,~uhlje~,Liw~ (e.g. those which do not
Iysed) are ~ y used for imrl~ntotinn in a host female.
The genetically altered ", --, . " ,,.l; - -, embryo is then transferred to the oviduct or
uterine horns of the recipient. Mi~u;~ ,J embryos are collected in the implon~otinn
21963~ 1
~ WO96/0616!i . PCT/US95~10250
pipette, the pipette inserted into the surgically exposed oviduct of a recipient female, and
the Ill;ClUlll;~ ,d eggs expelled into the oviduct. After withdrawal of the ;Illp~- ,lAI;
pipette, any surgical incision can be closed, and the embryos allowed to continue
gestation in the foster mother. See, for example, Gordon et al. (1983) Methods in
S En~vmolo~101:411;Gordonetal.(1980)PNAS77:7390;Hammeretal.(1985)Nature
315:600, and Wall et aL (1985) BioL Reprod. 32:645.
The host female mammals containing the implanted genetically altered
, " -- I . . I IA1 i -, eggs are maintained for a sufficient time period to give birth to a transgenic
mammal having at least I cell, e.g. a bone mar~row cell, e.g. a I r ' cell, which
expresses the 1~ nl ,; ~ ,-, I nucleic acid molecule of the present invention that has
developed from the genetically altered ", - - " " IAI iA. . egg.
At two-four weeks of age (post-natal), tail sections are taken from the piglets and
digested with Proteinase K. DNA from the samples is phenol-chloroform extracted, then
digested with various restriction enzymes. The DNA digests are cl".,l~u~llulcaed on a
Tris-borate gel, blotted on nitrocellulose, and hybridiA. ed with a probe consisting of the at
least a portion of the coding region of the 1 ~ ~ . ,, "l ,; " - - ,I cDNA of interest which had been
labeled by extension of random hexamers. Under conditions of high stringency, this
probe should not hybridi~e with the ~ pig gene, and will allow the
i,1rn~ifirAAtir,n of trAnsgenic pigs.
According to a preferred specific ~ ., .I .o-l; ", , I of the invention, a transgenic pig
may be produced by the methods as set forth in Example 1.
~2
Production Of Transgenic Pigs which express
human c-kit (the receptor for human SCF)
Estrus is ~ ,Llulu~.,d in sexually mature gilts (:~7 months of age) by feeding an
orally active progestogen (allyl trenbolone, AT: 15 mglgilt/day) for 12 to 14 days. On the
last day of AT feeding all gilts are given an ;,.~ injection (IM) of ~.~,~,,!A .~1;"
F2a (Lutalyse: 10 I.ig/illjc~,liun) at 0800 and 1600. Twenty-four hours after the last day of
AT c~ all donor gilts are given a single IM injection of pregant mare serum
gUllddUIlU,u;ll (PMSG: 1500 IU). Hurnan chorionic ~uuadu1~up;ll (HCG: 750 IIJ) is
al.,,i.,;,u,lcd to all donors at 80 hours after PMSG.
Following AT withdrawal, donor and recipient gilts are checked twice daily for
signs of estrus using a mature boar. Donors which exhibited estrus within 36 hours
following HCG Al~ ;",, are bred at 12 and 24 hours after the onset of estrus using
artificial and natural (lc,pc~ ., .;, ,A1 ;,
Between 59 and 66 hours after the adlll .,;~l.alion of HCG, one- and two-cell ova
are surgically recovered frorn bred donors using the following procedure. General
anesthesiaisinducedbyA~ gO.5mgofdc.,~ullla~,./kgofbody~._;gl,~andl.3
..... ... . . . ........ ... .. ......... . _ .. .. . ..... . = . , ... _ _ _ _ . . . .
219~311.
WO 96/06165 PCT/US95/10250
46
mg ketamine/kg of bo.ly~ ' via a peripheral ear vein. Following ,. "~ ; ".1 ;on, the
IC~JlUJU~liVC tract is eYT~ ri~n7~d following a midventral laparotomy. A drawn glass
camnula (O.D. 5 mm, length 8 cm) is inserted into the ostium of the oviduct and anchored
to the ;~ ~r~ h ll l l usmg a single silk (2-0) suture. Ova are flushed in retrograde fashion
5 by iusertirlg a 20 g needle into the lumen of the oviduct 2 cm anterior to the uterotubal
junction. Sterile Dulbecco's phosphate buffered saline (PBS) ~ , s~J with 0.4%
bovine serum albumin (BSA) is infused into the oviduct and flushed toward the glass
cannula. The medium is collected into sterile 17 x 100 mm ~oly~Lylcue tubes. Flushings
are transferred to 10 x 60 mm petri dishes and searched at lower power (50 x). All one-
and two-cell ova are washed twice in Brinster's Modified Ova Culture-3 medium
(BMOC-3) s~ rd vvith 1.5% BSA and transferred to 50 ml drops of BMOC-3
medium under oil Ova are stored at 38~C under a 90% N2, 5% ~2, 5~/~ C~2 ~ lo~ L
until ulh,l~ lj.,CLiull is performed~
One- and two-cell ova are placed in an Eppendorf tube ( 15 ova per tube)
containing I ml HEPES Medium ~ .1.-",. .t d with 1.5% BSA and centrifuged for 6
minutes at 14000 x g in order to visuali~ pronuclei in one-cell and nuclei in two-cell ova.
Ova are then transferred to a 5-10 ml drop of HEPES medium under oil on a depression
slide. Mi~,lu;uj~ ul is performed using a Laborlux microscope with Nomarski optics
and two Leit_ nl;~.ll '~ ' 10-1700 copies of a DNA construct which includes the
human c-kit gene operably linked to a promoter (I ng/ml of Tris-EDTA buffer) areinjected into one pronuclei in one-cell ova or both nuclei in two-cell ova.
Mi~lohlj~,~t.,l ova are returned to microdrops of BMOC-3 medium under oil and
maintained at 38~C under a 90% N2, 5% CO2, 5% ~2 atmosphere prior to their transfer
to suitable recipients. Ova are transferred within 10 hours of recovery.
Onl~ recipients which exhibited estrus on the same day or 24 hours later than the
donors are utilized for embryo transfer. Recipients are Anl cthr~i7l d as described above.
Following ~ . i. . ;. ." "d ;~n of one oviduct, at least 30 injected one and/or two-cell ova and
4-6 control ova are transferred in the following manner. The tubing from a 21 g x 3/4
butterfly infusion set is connected to a I cc syringe. The ova and one to two mls of
BMOC-3 medium are aspirated into the tubing. The tubing is then fed through the ostium
of the oviduct until the tip reached the lower third or isthmus of the oviduct, The ova are
u. .~lly expelled as the tubing is slowly withdrawn.
The exposed portion of the lc~ lu~,tiYc tract is bathed in a sterile 10% glycerol/
0.9~/O saline solution and returned to the body cavity. The connective tissue
~ ;ug the linea alba, the fat and the skin are sutured as three separate layers. An
ullhlt~,,lu~Lcd Halstead stitch is used to close the lina alba. The fat and s,kin are closed
using a simple continuous and mattress stitch, l~ ,Li~ly. A topical d . . ~ 1 agent
(F-l ,.,..liol. ~"1 ) is then dJIIIilll~t~,lLJ to the incision area.
2 1 9 6 3,~
~ WO96/06165 PCT/US95~10250
47
Recipients are penned in groups of four and fed 1.8kg of a standard 16% crude
protein corn-soybean ration. Beginning on day 18 (day 0 = onset of estrus), all recipients
are checked daily for signs of estrus using a mature boar. On day 35, pregnancy detection
is performed using ultrasound. On day 107 of gestation recipients are tramsferred to the
5 farrowing suite. In order to ensure attendance at farrowing time, farrowing is induced by
the a.l. ., ~ ;. ,., of ,u..,~ ,.l ;., F2a, (10 mg/injection) at 0800 and 1400 hours on day
112 of gestation. Recipients should farrow within about 34 hours of PGF2a
V. Use of Trans~eni~ SwinP tn Te~t T~nnnan fTrowth Fa~tnr~
The animals of the mvention can be used as models to test for agents which act as
agonists or antagonists of human growth factors. The agent to be tested can be
a~ili~L~l~,d to an animal of the invention and proliferation of the transgenic
h~ nnafnFoietir cells can be monitored.
Vl. I T~r of Tranc~ ~ni~ Swine T' st~ nn Cells in X~ nr~en.-i~ Tran~rlq~t
Tbe following procedure was designed to lengthen the time an implanted swine
organ (a xenograft) survives in a xenogeneic host prior to rejection. The organ can be any
organ, e.g., a liver, e.g., a kidney, e.g., a heart. The main strategies are elimination of
natural antibodies by orgam perfusion, ~ " ~ '~l'~ ' -' ;. . - of tolerance-inducing transgenic
swine stem cells, and optionally, the ;~ .,. of donor stromal tissue. Preparation of
20 the recipient for I ~ ;( .., includes any or all of these steps. Preferably they are
caTried out in the following sequence.
First, a preparation of horse anti-human thymocyte globulin (ATG) is
ihlL a~ u~ly injected mto the recipient. The antibody preparation eliminates mature T
cells and natural killer cells. If not elimmated, mature T cells would promote rejection of
25 both the bone malrow transplant amd, after ,~ a ;,,.. ;.... the xenograft itself. Of equal
impnrtan..-, the ATG preparation also eliminates natural killer (NK) cells. NK cells
probably have no effect on the implanted organ, but would act i~ n~di~,t~.ly to reject the
newly introduced bone malrow. Anti-human ATG obtained from amy " ._, " ", l j,. " host
cam also be used, e.g., ATG produced in pigs, although thus far rreraratinn~ of pig ATG
30 have been of lower titer than horse-derived ATG. ATG is superior to anti-NK
mnnnclnnal Antibodies, as the latter are generally not Iytic to all host NK cells, while the
polyclonal mixture in ATG is capable of Iysmg all host NK cells. Anti-NK ,n. .. ",.~1. " .al
antibodies can, however, be used.
The presence of donor antigen in the host thymus during the time when host T
cells are .~.. ,.I;.. g post-transplant is critical for tolerizing host T cells. If donor
- stem cells are not able to become established in the host thymus and
mduce tolerance before host T cells regenerate repeated doses of anti-recipient T cell
antibodies may be necessary throughout the non-~ ,l.Jal L..iv~ regimen. Continuous
_ _ :, .... .. = ..... . ... _. .... ..
WO 96/06165 2 1 9 6 3 1 ~ PCr/lJsss/102so--
48
depletion of hose T cells may be required for several weeks. Alternatively, e.g. if this
approach is not successful, and tolerance (as measured by donor skin graft acceptance,
specific cellular II,~UUIC~,UUI..;~ in vitro, and humoral tolerance) is not induced in
these animals, the approach can be modified to include host Llly~ lvllly. In
5 LLy~ .".,:,~ d recipients, host T cells do not have am uul~ullLIll;ly to .lirrclcl.L;~ ~ in a
host thymus, but must dirL~ .Li_'~ in the donor thymus. If this is not possible, then the
animal has to rely on donor T cells developing in donor thymus for i~ f ~
T~","".,oc...,.l,. 1.... ~ can be measured by the ability to reject a non-donor type allogeneic
donor skin graft, and to survive in a pathogen-containing ~IIVilUIII~I~.I...
It may also be necessary or desirable to cpl~nr-ctr,mi7f the recipient in order to
avoid anemia.
Second, the recipient is a~ l;.t~,lGd low dose radiation in order to create
hf~ t~p~irtir space. A sublethal dose of between 100 rads and 400 rads whole body
radiation, plus 700 rads of local thymic radiation, has been foumd effective for this
15 purpose.
Third, natural antibodies are absorbed from the recipient's blood by
hcll~u,u~,lr~;u~ of a swine liver. Pre-formed natural antibodies (nAB) are the primary
agents of graft rejection. Natural antibodies bind to xenogeneic endothelial cells and are
primarily of the IgM class. These antibodies are ;",1. IJ' ...1. ..1 of any known previous
exposure to antigens of the xenogeneic donor. B cells that produce these naturalantibodies tend to be T cell-i . ~ ) s . .~, and are normally tolerized to self antigen by
exposure to these antigens during d~ v ~IU~UIII~ L~ The mechanism by which newlydeveloping B cells are tolerized is unknown. The liver is a more effective absorber of
natural antibodies than the kidney.
The fourth step in the non~ Ldl~lativc procedure is to implant donor stromal
tissue, preferably obtained from fetal liver, thymus, and/or fetal spleen, into the recipient,
preferably in the kidney capsule. Stem cell . ..~".r",,. .., and l~. .",.s,~ across
disparate species barriers is enhanced by providing a l~ " t .,u: ~; stromal ~.IIVilUIIIII.,I
from the donor species. The stromal matrix supplies species-specific f~tors that are
30 required for ,.. ,-- o ~ between 1 A - ~ ~ cells and their stromal ClIV;lUl~ , such
as l )l ~ - growth factors, adhesion molecules, and their ligands
The thymus is the major site of T cell maturation. Each organ includes an organ
specific stromal matrix that can support differentiation of the respective ~ldirrGlGllLi
stem cells implanted into the host. Although adult thymus may be used, fetal tissue
35 obtained sufficiently early in gestation is preferred because it is free from mature T
Lo~"~ ~ which cam cause GVHD. Fetal tissues also tend to survive better than adult
tissues when i , ' ' As an added precaution against GVHD, thymic stromal tissue
can be irradiated prior to ~ ;.. , e.g., irradiated at 1000 rads. As an alternative or
~ WO 96106165 ~ 1 9 6 ~ 1 1 . PCT/US9!i/10~50
49
an adjunct to ;~lp~ fetal l,iver cells can be a~LIi~ in fluid qnerPncirln (The
use of transgenic "humanized" swine cells (which can more effectively compete with host
stem cells to repopulate the host) may eliminate the need for this step.)
Fifth, transgenic swine bone marrow stem cells (BMC), e.g., swine BMC
S engineered to express the human c-kit gene, are injected into the recipient. Donor BMC
home to a,u~ , sites of the recipient and grow ~.., : ;~, .. ,. ,~ly with remaining host
cells and proliferate, forming a chimeric Iyl l ~ h. ~ population. By thisprocess, newly forming B cells (and the antibodies they produce) are exposed to donor
antigens, so that the transplant will be recognized as sel~ Tolerance to the donor is also
10 observed at the T cell level in animals in which b. .,. ' .~o '; stem cell, e.g., BMC,
rl".."ll..~ ~I has been achieved. When an organ graft is placed in such a recipient several
months after bone marrow chimerism has been induced, natural antibody against the
donor will have .L,al,l.~,O.ed, and the graft should be accepted by both the humoral and
the cellular arms of the immune system. This approach has the added advantage of15 permitting organ ~ SA~ , to be performed sufficiently long following tramsplant of
cells, e.g., BMT, e.g., a fetal liver encrPncinn, that normal health and
.- r will have been restored at the time of organ L. A~ I ;rm l'he use
Of x~ .... 'r donors allows the possibility of using bone marrow cells and organs from
the same animal, or from genetically matched animals.
While any of these procedures may aid the survival of an implanted organ, best
results are achieved when all steps are used in .. 1.;.. ~ ;
The donor of the implant and the individual that supplies either the tolerance-
inducmg h ., ....~,.. - ;r cells or the liver to be perfused should be the same individual or
should be as closely related as possible. For example, it is preferable to derive implant
25 tissue ~rom a colony of donors that is highly inbred.
Othr. F."l1,..1;, ..1~
As is discussed llerein, it is often desirable to expose a graft recipient to irradiation
in order to promote the d~ ,Iu"ln~,.ll of mixed chimerism. It is possible to induce mixed
chimerism with less radiation toxicity by r. A 1~ ; L the radiation dose, i.e., by
30 delivering the radiation in two or more exposures or sessions. Accordingly, in any
method of the invention calling for the irradiation of a recipient, e.g., a primate, e.g., a
human, recipient, of a xenograft, the radiation cam either be delivered in a single
exposure, or more preferably, can be fla~.Li~ ' mto two or more exposures or sessions.
The sum of the La~,Li, ' dosages is preferably equal, e.g., m rads or Gy, to the35 radiation dosage which cam result in mixed chimerism when given in a single exposure.
The fractions are preferably -yl~l~ 'y equal in dosage. For example, a single dose
of 700 rads can be replaced with, e.g., two fractions of 350 rads, or seven fractions of 100
rads. Il~l, . r. ~ . of the radiation dose can also be used in methods of the
wo96106165 ~1~ 6 ~ 50 Pcr/uss5llo2so--
invention. The fractions can be delivered on the same day, or can be separated by
intervals of one, two, three, four, five, or more days. Whole body irradiation, thymic
*adiation, or both, can be fi s~rt;(
As is discussed herein, l.~ .,.,..~ . r~ , e.g., h~l..u~ ru~;on with a donor organ,
5 can be used to deplete the host of natural antibodies. Other methods for depleting or
otherwise \'~iillg natural antibodies can be used with any of the methods described
herein. For example, drugs which deplete or inactivate natural antibodies, e.g.,d~ ,u~ lhl (DSG) (Bristol), or anti-IgM antibodies, can be lullll;~ cd to the
recipient of an allograft or a xenograft. One or more of, DSG (or similar drugs), anti-IgM
10 antibodies, and l. ~ y~ r, " . can be used to deplete or otherwise inactivate recipient
naturalantibodiesinmethodsoftheinvention. DSGata.l..~-~.sl..li..,.of6mg/kg/day,
i.v., has been found useful in :~U,U~ ;llg natural antibody function in pig to cynomolgus
kidney transplants.
Some of the methods described herein use lethal irradiation to create
15 1 I - space, and thereby prepare a recipient for the ~ of xenogeneic
genetically engineered stem cells. In any of the methods described herein, uO~
primate or clinical methods, it is preferable to create I ,,uu;~l;c space for the
1 .1S r~n of such cells by non-lethal means, e.g., by ~ l, .;,.:~ .. .g sub-lethal doses
of irradiation, bone marrow depleting drugs, or antibodies. The use of sublethal levels of
20 bone marrow depletion allows the generation of mixed chimerism in the recipient. Mixed
chimerism is generally preferable to total or lethal ablation of the recipient bone marrow
followed by complete 1~ , .1;. ., . of the recipient with ddlll;ll l~L~,Icid stem cells.
Other ~;lu11od;lll.,llt~ are within the following claims.
~ W 096106165 2 1 9 6 3 11 PCTAUS95/10250
51
SEQUENCE LISTING
(1) GENERAL INFORMATION:
ti) APPLICANT: David U. Sachs, Megan Sykes, and M_cfred Baetscher
(ii) TITLE OF INVENTION: ~nPti~Rlly Engineered Swine cell_
(iii) NUMBER OF SEQUENCE5: 2
(iv) ~ ADDRESS:
(A) ADDRESSEE: Lahive & Cockfield
(B) STREET: 60 State street
(C) CITY: Bosto~
(D) STATE: Mn~ h.
(E) COUNTRY: U.S.A.
~P) ZIP: 02109
(v) COMPUTER REAOABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC 'ih1~
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFT~ARE: ASCII
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US 000000
(B) FILING DATE: Augu_t 19, 1994
(C~ CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/266,427
(B) FILING DATE: June 27, 1994
(A) APPLICATION NUMBER: 08/266,427
(B) FILING DATE: June 26, 1994
(A) APPLICATION NUMBER: 08/243,653
(B) FILING DATE: May 16, 1994
(A) APPLICATION = ER: 08/220,371
(B) FILING DATE: March 29, 1994
(A) APPLICATION NUMBER: 08/212,228
(B) FILING DATE: March 14, 1994
(A) APPLICATION N~MSER: 08/163,912
(B) FILING DATE: December 7, 1993
(A) APPLICATION NUMBER: 08/150,739
(B) FILING DATE: Novemher 10, 1993
(A) APPLICATION NUMBER: 08/126,122
(B) FILING DATE: september 23, 1933
WO96/06165 ~ PCTrUS95110250 -
(A) APPLICATION NUMBER: 08/114,072.
(B) FILING DATE: Augu~t 30, 1993 ..
(A) APPLICATION NUMBER: 08/062,946
(B) FILING DATE: May 17, 1993
(A) APPLICATION NUMBER: 07/838,595
(B~ FILING DATE: February 19, 1992
(A) APPLICATION NUMBER: PCT~U894/01616
(B) FILING DATE: February 14, 1994
1S (viii) ATTORNEY/AGFNT INFORM~TION_
(A) NAME: MYERS, Louis
(B) REGISTRATION NUMBER: 35,965
(C) REFERENCE/DOCKET NUMBER:~MGP-015
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617) 227-7400
(B) TELEFAX: (617) 227-5941
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 1:
(i) SEQUENCE r~rT~RTqTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
( C) ~ N ~ 3ingle
(D) TOPOLOGY linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
rr~r~r.rr~T GATCCCTAAT GG 22
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 2:
(i) SEQUENCE r~R~rT~TcTIcs
(A) LENGTH: 23
(B) TYPE: nucleic acid
(C) 5TRP~nN~.qc cingle
(D) TOPOLOGY_ linear
(xi) SEQUENCE DESCRIPTION: SEQ ID~NO 2: _ L
~rr~T~rr~r GAGCCTTCTC ATG 231=
