Note: Descriptions are shown in the official language in which they were submitted.
WO96tl1277 2 2 J 1 7 2 1 PCT~103921
MI~ROO~ NI~ A~ T~R~P~UTIC n~r~Iv~y SYSTRM~
FIELD OF THE INVENTION
The invention relates to the use of microorganisms
as vehicles for delivery of therapeutic compounds to
animals.
BACRGROUND OF THE INV~NTION
The advent of compounds which are generated using
recombinant DNA technology has facilitated development
of a vast array of therapeutic agents having the
potential to treat a great variety of disease states in
animals, in particular in humans. These agents are
primarily protein in nature.
While recombinant proteins represent one of the
most promising groups of therapeutic agents since the
discovery of antibiotics, several problems accompany
their use. In particular, systemic administration of
such proteins to a animal almost always evokes an immune
response which may result in destruction of the protein.
Thus, the fate of many recombinant proteins, obtained
following laborious and costly procedures, may be rapid
destruction in the animal by proteolytic mechanisms. The
aforementioned difficulties may be exacerbated in
situations in which the target site for the action of
the dru~ is the mucous membranes of the animal which are
known sites of enhanced proteolysis. Such mucous
membrane surfaces include the oral/intestinal tract, the
bronchial/nasopharyngeal tract and the reproductive
system in the animal.
Local administration of recombinant protein drugs
circumvents some of these difficulties by facilitatin~
CONFIRMATION COPY
WO96/11277 PCT~5/03921
220~72i
enhanced efficacy of the protein and a diminution in the
catabolism thereof. However, there is a paucity of
methods for local administration of drugs into areas
such as the intestine, the bronchial tract and even the
S reproductive system.
It has now been surprisingly found that the in vivo
administration of a B. subtilis engineered with IL-lra
gene results in detectable plasma levels of the
expressed IL-lra, showing therefore the possibility of a
trans-mucosal absorption of proteins having
pharmacological activity.
This finding opens therefore new therapeutic
possibilities by using E~L ~Q known transformed
microorganisms, until now described and used for the
fermentative production of bulk recombinant proteins, as
carriers for the in vivo release of said drugs having
protein structure.
Most of the microorganisms until now used for the
production of recombinant proteins can be in fact safely
administered to humans and animals, being usual
components of the physiological flora or being devoid of
any pathogenetic risk. This is particularly true for
Bacillus subtilis which has been widely used as a
cloning vector for producing a large number of
eukaryotic proteins (Microbiol. Rev. 1993, 57:l09) in
view of its recognized advantageous properties.
Other species, already used for the production of
recombinant proteins, can also be used provided they
meet the requisites of non-pathogenicity and ability to
colonize human or animal mucosae. The present invention
allows therefore, by suitably selecting and adapting the
WO96/11277 2 2 U 1 7 2 ~ PCT~S/03921
microorganism, the protein to be expressed and the
expression vectors, previously used for the production
in laboratory or industrial environment, to address
specific therapeutic problems.
The present invention concerns therefore the
therapeutic use of said engineered microorganisms and
compositions containing the same, thereby satisfying a
long felt need in the area of therapeutic delivery of
drugs to an animal.
PRIOR-~RT
The in vivo administration of genetically
engineered microorganisms has been already proposed as a
means to induce immunization against antigens of
pathogenic microorganisms. In this case the gene coding
for protective antigens has been suitably inserted into
bacterial DNA.
Examples of said antigens comprise HIV proteins or
fragments thereof (WO 92/21376, Nature, Vol. 351, p.
479-482, 1991), B. anthracis toxins (WO 92/19720), E7
protein from human papilloma virus type 16 (Infection
and Immunity, 60, 1902-1907, 1992), binding region BB of
streptococcal protein G and a protein fragment from
human Rous Sarcoma Virus (Gene, 128, 89-94, 1993).
In most cases, these antigens are expressed on the
cell surface of the transformed microorganism from which
they are not released. The microorganism act therefore
as a carrier and adjuvant for the selected antigen which
preferably should not be released in order to exert
their immunogenic and vaccinogenic activity.
This approach, which could be defined as
vaccinological approach, has been up to now exploited
WO96/11277 PCT~5/03921
2~ 1 2 ~
using Staphylococcus xylosus, Bacillus anthracis,
Streptococcus pyogenes or Mycobacteria (BCG) strains.
In contrast to the rather large number of reports
concerning the use of genetically engineered
microorganisms as vaccines, to the best of our knowledge
there is only one report suggesting that a vaccine
strain of Salmonella typhimurium could be engineered to
deliver therapeutic proteins in vivo (J. Immunol., 148,
1176-1181, 1992).
However, the results obtained using human lL-1~ as
recombinant protein were disappointing since, in the
considered experimental model, only the intravenous
administration of the transformed bacteria gave an
adequate protection whereas the oral or the i.p. route
of administration gave inconsistent protection even at a
high dose range. Since the practical possibility of
injecting I.V. living bacteria in humans is ruled out,
this report, rather than suggesting the possibility of a
mucosal biodelivery by administration of engineered
microorganism, actually teaches away from our approach.
SUMMARY OF THE INVENTION
The invention refers to pharmaceutical compositions
containing, as the active principle, engineered
microorganisms expressing non-vaccinogenic
pharmacologically active recombinant therapeutic
proteins, wherein said microorganism is not Salmonella
specles .
DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic diagram of the IL-lra
expressing plasmid, pSETA-IL-lra.
Figure 2 is a schematic diagram of the plasmid
WO96/11277 2 2 0 1 7 2 1 PCT/~9S~*3921
pSM441.
Figure 3 depicts a densitometric analysis of
proteins following SDS-PAGE of IL-lra-containing samples
obtained from Bacillus subtilis expressing the same. l:
Molecular weight (in kDa) markers obtained from Bio-Rad
(15 ~l; 2: Cell lysate supernatant (15 ~l); 3: partially
purified IL-lra obtained from cell lysate supernatant
(15 ~l); 4: Sporulation supernatant (15 ~l); 5:
partially purified IL-lra from sporulation supernatant
(l5 ~l). The arrows indicate the electrophoretic
migration of IL-lra.
Figure 4 is the nucleotide and corresponding amino
acid se~uence of human IL-lra. The numbering of the
amino acid sequence (in one letter code) refers to the
complete protein including the signal peptide (first 25
amino acids). The mature protein begins at the amino
acid arginine, amino acid number 26 (R26).
~ igure 5 , comprising parts A, B and C depicts in
(A) a schematic representation of the life cycle of
Bacillus subtilis including sporulation; in (B) there is
shown a photograph of a Western blot experiment
detecting the presence of Il-lra in the sporulating
supernatant of Bacillus subtilis. Lane l, wild type
Bacillus subtilis; lane 2, Bacillus subtilis comprising
pSM539 and expressing recombinant IL-lra; in (C) there
is shown a graph depicting detection of IL-lra in a
sporulation supernatant as assessed by SDS-PAGE and
laser scanning densitometry.
Figure 6 is a graph depicting the serum
concentration of IL-lra in rabbits administered a single
intracolonic instillation of 2 X lO9 live Bacillus
~2131 721
WO96/11277 PCT/~r95~3921
subtilis per rabbit comprising pSM539 or pSM214. Il-lra
was assessed by ELISA.
Figure 7 is a graph depicting the serum
concentration of IL-lra in rabbits administered two
intracolonic instillation of 2 X 109 live Bacillus
subtilis comprising pSM539 or pSM214. IL-lra was
assessed by BIAcore. Each circle represents an
individual rabbit.
Figure 8 is a graph depicting the increase in body
temperature of rabbits treated intravenously with
recombinant human IL-1~3 at 75 ng/kg one hour following a
single intracolonic instillation of 2 X 109 live
Bacillus subtilis per rabbit comprising pSM539 or
pSM214.
Figure 9 is a graph depicting increase in body
temperature of rabbits receiving a single intracolonic
instillation of 2 x 109 live Bacillus subtilis per
rabbit comprising pSM261 or pSM214. In the group treated
with Il-1~ expressing bacteria, 40% of the animals died
of hypotensive shock.
Yigure 10 is a graph depicting hypoglycemia induced
by IL-1~ administered intraperitoneally at a dose of 100
ng/mouse. The animals were also administered
subcutaneously either saline (filled bar) or 100 ~g of
IL-lra (cross-hatched bar) or 5 x 108 live Escherichia
coli comprising pT7MILRA-3 (hatched bar) each of which
was administered 2 hours prior to IL-1~ treatment.
DBTAILBD DESCRIPTION
The present invention relates to the preparation of
pharmaceutical compositions comprising recombinantly
engineered microorganisms, which microorganisms are
WO96/11277 2 2 0 1 7 2 1 rcT~Pg5l0392l
useful for therapeutic treatment of a variety of disease
states in animals. The invention further includes
methods of administration of such pharmaceutical
compositions to an animal having a disease state
requiring treatment with the pharmaceutical compositions
of the invention.
The invention includes pharmaceutical compositions
comprising recombinantly engineered microorganisms which
are useful for therapeutic treatment of various
pathological conditions. The methods of the invention
exploit the ability of certain microorganisms to survive
in the mucosal surfaces of animals, which mucosae
represent the interface between the exterior and
interior regions of the body, and/or undergo sporulation
or lyse and release the recombinant proteins expressed
at said mucosal surfaces. Once administered to the
animal, the recombinant microorganisms of the invention
which encode the desired therapeutic protein, express
and produce the same. The protein so produced then has
the desired therapeutic effect either at the site of
production, or is selectively transported to the desired
anatomical site at which it then exerts the desired
therapeutic effect.
In the present invention, microorganisms are
manipulated to express desired recombinant proteins,
which microorganisms have properties which render them
particularly useful for generation of the compositions
of the invention and in the methods of their use.
Certain properties of bacteria and other microorganisms
are exploited in order to render them useful as vehicles
for administration of therapeutic recombinant proteins
WO96/11277 2 2 G 1 7 2 'i PCT~Sl03921
to animals. These properties include, but are not
limited to, the ability of the microorganism to adhere
to epithelial cells (Rarlsson et al, 1989, Ann. Rev.
Biochem. 58:309); microorganisms which form spores which
are resistant to adverse conditions and which are
capable of producing large quantities of proteins
(Kaiser et al., Cell 1993, 73:237).
Microorganisms are known to possess selective
tropism for the mucosa of the intestinal tract, the
mucosa of the mouth and oesophagus, the mucosa of the
nose, pharynx, trachea, the vaginal mucosa, the skin,
the bronchopulmonary system, the eye, the ear.
Specifically, according to the methods of the
invention, a microorganism, preferably a bacterium, is
manipulated such that it comprises a desired gene, which
gene encodes a desired protein useful for treatment of a
particular disease state in an animal. The microorganism
is administered to the animal following which
- administration, the protein is produced therefrom to
provide the desired therapeutic treatment in the animal.
In addition to comprising the desired gene, the
microorganism may also be manipulated to encode other
sequence elements which facilitate production of the
desired protein by the bacterium. Such sequence elements
include, but are not limited to, promoter/regulatory
sequences which facilitate constitutive or inducible
expression of the protein or which facilitate
overexpression of the protein in the bacterium.
Additional sequence elements may also include those
which facilitate secretion of the protein from the
bacterium, accumulation of the protein within the
WO96111277 22 0 1 12 I PCT~5/03921
bacterium, and/or programmed lysis of the bacterium in
order to release the protein from the same. Many of the
sequence elements referred to above are known to those
skilled in the art (Hodgson J., 1993, Bio/Technology
11:887).
For example, heat induction, galactose induction,
viral promoter induction and heat shock protein
induction systems are well described in the art and are
readily understood by those skilled in the art.
Additional inducible expression systems include gene
expression systems which respond to stress, metal ions,
other metabolites and catabolites. Other elements which
may be useful in the invention will depend upon the type
of bacterium to be used, the type of protein to be
expressed and the type of target site in the animal.
Such elements will be readily apparent to the skilled
artisan once armed with the present disclosure.
This invention includes microorganisms which are
capable of producing a pharmacologically active protein.
The pharmacologically active protein may be produced
within the microorganism and be released upon lysis of
the same: the protein may be excreted by the
microorganism, or may be released by the microorganism
upon sporulation, or upon germination of the spore to
form a vegetative cell, or upon lysis.
The types of microorganisms which are useful in the
invention include, but are not limited to, yeast and
bacteria. Yeast microorganisms suitable in the invention
include, but are not limited to, Hansenula polymorpha,
Kluiveromyces lactis, Kluiveromyces marxianus subspecies
lactis, Pichia pastoris, Saccharomyces cerevisiae and
WO96/11277 2 2 ~ 1 7 ~ ~ PCT~5/03921
Schizosaccharomyces pombe.
Bacterial microorganisms suitable for use in the
invention include, but are not limited to, Bacillus
subtilis and other suitable sporulating bacteria;
members of the genus Bifidobacterium including but not
limited to, Bifidobacterium adolescentis,
Bifidobacterium angulatum, Bifidobacterium bifidum,
Bifidobacterium breve, Bifidobacterium catenulatum,
Bifidobacterium infantis, Bifidobacterium longum, and
Bifidobacterium pseudocatenulatum; members of the genus
Brevibacterium including but not limited to,
Brevibacterium epidermis and Brevibacterium
lactofermentum; members of the genus Enterobacter
including but not limited to, Enterobacter aerogenes,
Enterobacter cloacae; members of the genus Enterococcus
including but not limited to Enterococcus faecalis;
members of the genus Escherichia, including but not
limited to, Escherichia coli; members of the genus
Lactobacillus including but not limited to,
Lactobacillus acidophilus, Lactobacillus amylovorus,
Lactobacillus bulgaricus, Lactobacillus brevis,
Lactobacillus casei, Lactobacillus crispatus,
Lactobacillus curvatus, Lactobacillus delbrueckii,
Lactobacillus delbrueckii subspecies bulgaricus,
Lactobacillus delbrueckii subspecies lactis,
Lactobacillus fermentum, Lactobacillus gasseri,
Lactobacillus helveticus, Lactobacillus hilgardii,
Lactobacillus jensenii, Lactobacillus paracasei,
Lactobacillus pentosus, Lactobacillus plantarum,
Lactobacillus reuterii, Lactobacillus sake and
Lactobacillus vaginalis; members of the genus
WO96/11277 2201 121 PCT~P95103921
Lactococcus including but not limited to, Lactococcus
lactis, Lactococcus lactis subspecies cremoris and
Lactococcus lactis subspecies lactis; members of the
genus Propionibacterium including but not limited to
Propionibacterium jesenii; members of the genus
Staphylococcus including but not limited to,
Staphylococcus epidermidis; members of the genus
Streptococcus, including but not limited to,
Streptococcus lactis, Streptococcus foecalis,
Streptococcus gordonii, Streptococcus pyogenes,
Streptococcus mutans, Streptococcus thermophilus and
Streptococcus salivarius subspecies thermophilus.
Preferably, the microorganism of the invention is a
bacterium. More preferably, the microorganism is an
enteric microorganism or a member of the genus Bacillus,
particularly B. subtilis and, even more preferably, the
microorganism of the invention is either a member of the
genus Lactobacillus or the organism is Bacillus subtilis
encoding recombinant interleukin l receptor antagonist
(IL-lra).
Examples of other microorganisms which are useful
in the invention include Streptococcus pyogenes,
Streptococcus mutans or Streptococcus gordonii, each
being capable of colonizing the oral mucosa and
e~pressing and releasing an anti-inflammatory protein
capable of ameliorating inflammatory diseases of the
gums and teeth.
Similarly, it is possible to exploit the ability
of, for example, Escherichia coli, to colonize the
intestinal mucosa in order to introduce therapeutic
proteins into this region of the body for treatment of
WO96tll277 22~ 72~ PCT~5/03921
intestinal disease including among others for example,
ulcerative colitis and Crohn's disease. Such bacteria
may be administered to the animal either orally or
rectally. In view of the high absorption capacity of the
intestinal mucosa, according to the methods of the
invention, expression of recombinant proteins by
recombinant bacteria in the intestinal mucosa can result
in transport of the produced recombinant protein across
the mucosal surface into the bloodstream. Thus, systemic
delivery of recombinant proteins is also contemplated by
the invention using recombinant microorganisms capable
of expressing the same.
It is also possible to use spore-forming bacteria
(i.e., Clostridium and Bacillus) which, when in spore
form, are naturally resistant to extreme environments
and are therefore particularly suitable for oral
administration as they are resistant to the effects of
gastric acids. Such bacteria, when administered orally
to an animal, should reach the intestinal mucosa in an
intact, unchanged state. Upon germination, these
bacteria then produce the desired active protein in the
intestinal mucosa, which protein otherwise may not have
survived the effects of the gastric acids.
Spore-forming bacteria may be additionally
exploited for their ability to produce spores and
thereby deliver proteins to target mucosal sites in the
body. In this instance, vegetative state spore-forming
bacteria encoding the desired protein are prepared in a
formulation suitable for oral or rectal administration.
Upon reaching the intestinal mucosa, such organisms are
induced to sporulate wherein the vegetative cells lyse
WO96tll277 2 2 0 1 /~1 PCT~5/03921
13
thereby releasing the expressed protein into the mucosa.
~ In this manner, a well defined dose of the desired
protein is released into the mucosa. Induction of
sporulation by bacteria in the intestine or induction of
germination of spores is accomplished by further
manipulating the genes of these organisms which control
such events. Importantly, spore-forming bacteria may be
engineered such that they are induced to initiate the
process of sporulation but are incapable of forming
spores. In this case, the cells containing the desired
expressed protein lyse thereby releasing the protein;
however, since spores are not in fact formed, no live
bacteria remain in the host.
The therapeutic protein, the gene of which is
inserted into a suitable expression vector, must meet
the following requisites in order to be effectively
used:
- it must be non-toxic and non-pathogenic;
- it must be non-vaccinogenic, i.e. it should not
induce a significant immune response which is
protective for the host against the protein itself;
- it must be active in the expressed form or, at
least, it must be converted into the active form
once released by the microorganism.
Examples of proteins which may be administered according
to the invention are mostly eukaryotic proteins,
particularly those the expression of which in B.
subtilis has been disclosed in Microbiol: Rev. 1993,
57:lO9. More particularly, genes encoding proteins which
are useful in the invention as recombinant therapeutic
proteins include, but are not limited to, the following
WO96/11277 2 2 U 1 7 2 1 PCT~5/03921
genes. Members of the interleukin family of genes,
including but not limited to IL-2, IL-3, IL-4, IL-S,
IL-6, IL-7, IL-8, IL-9, IL-lO, IL-ll, IL-12, IL-13,
IL-14 and IL-lS and genes encoding receptor antagonists
S thereof. Genes which encode hemopoietic growth factors,
including but not limited to, erythropoietin,
granulocyte colony stimulating factor, granulocyte
macrophage colony stimulating factor, macrophage colony
stimulating factor, stem sell factor, leukaemia
inhibitory factor and thrombopoietin are also
contemplated in the invention. Genes encoding
neurotropic factors are also contemplated, including but
not limited to, nerve growth factor, brain derived
neurotropic factor and ciliary neurotropic factor. In
lS addition, genes which encode interferons, including but
not limited to IFN-alpha, IFN-beta and IFN-gamma are
included. Further contemplated in the invention are
genes encoding chemokines such as the C-C family and the
C-X-C family of cytokines, genes encoding hormones, such
as proinsulin and growth hormone, and genes encoding
thrombolytic enzymes, including tissue plasminogen
activator, streptokinase, urokinase or other enzymes
such as trypsin inhibitor. The invention further
includes genes which encode tissue repair factors,
growth and regulatory factors such as, but not limited
to, oncostatine M, platelet-derived growth factors,
fibroblast growth factors, epidermal growth factor,
hepatocyte growth factor, bone morphogenic proteins,
insulin-like growth factors, calcitonin and transforming
growth factor alpha and beta. Preferably, the gene to be
used in the invention encodes an interleukin receptor
WO96/11277 PCT~/03921
- 22~172~
antagonist, and most preferably, the gene encodes IL-l
receptor antagonist (IL-lra).
It is well known that proteins which are active
only in glycosylated form must be expressed in
microorganisms such as yeast.
It is however preferred the use of genes encoding
eukariotic proteins active in non-glycosylated form as
that they can be expressed in bacteria such as B.
subtilis, E. coli or Lactobacillus species. It is also
preferred the use of proteins which do not require an
activat1on from a pro-form or post-expression
processlng.
Particularly preferred proteins which may be
administered via engineered microorganisms according to
the invention are IL-lra, interferons, IL-lO, growth
hormone, alpha l-antitrypsin.
Preferably, the gene to be used in the invention
encodes an interleukin receptor antagonist, and most
preferably, the gene encodes IL-l receptor antagonist
(IL-lra).
Importantly, IL-lra does not have IL-l biological
activity; rather, IL-lra binds to IL-l cell receptors
without activating the cell, thereby functioning as an
antagonist of IL-l activity.
The preferred embodiment of the invention, the use
of IL-lra expressed in bacteria as a therapeutic
treatment, should not be construed to be limited to wild
type IL-lra protein. As described in the example herein,
the invention includes other forms of IL-lra having IL-
lra activity, which forms of IL-lra typically comprise
mutations in the wild type protein. Such mutations may
WO96/11277 2 2 0 1 7 2 I PCT/~95~397
16
confer enhanced IL-lra activity on the expressed protein
or they may confer enhanced stability, enhanced mucosal
absorption or other properties on the expressed protein
which render it even more suitable as a therapeutic
agent for use in the methods of the invention. Thus, by
"IL-lra" as used herein is meant a protein having IL-lra
activity, which protein includes the wild type protein
and mutants thereof having Il-lra activity having
characteristics substantially similar to wild type IL-
lra. Such properties include, for example, the abilityof the mutated protein to bind IL-l receptor and to act
as an antagonist of IL-l biological activity. Mutations
of IL-lra which retain IL-lra activity include point
mutations, deletions, insertions, frameshift mutations
and other mutations which alter the primary sequence of
the protein while preserving IL-lra activity.
Preferably, the mutation in IL-lra comprises an
amino acid subtitution at amino acid 9l (see Figure 4)
wherein amino acid 9l is replaced by an amino acid
selected from the group consisting of glutamine,
arginine, lysine, histidine and tyrosine. The mutation
may also comprise an amino acid substitution at position
lO9 wherein the amino acid at position lO9 is replaced
by an amino acid selected from the group consisting of
serine, alanine, phenylalanine, valine, leucine,
isoleucine and methionine. In some instances, the
protein may be mutated such that there is an amino acid
substitution in the protein at both positions 9l and
lO9. Preferably, in the mutated IL-lra, amino acid 9l is
replaced by arginine and/or IL-lra amino acid lO9 is
replaced by alanine.
WO96111277 2 2 0 1 7 2 i PCT~5/03921
Other amino acid substitutions are also
contemplated by the invention and include substitutions
which comprise conservative amino acid sequence
differences compared with the wild type protein at
positions other than amino acids 9l and l09. For
example, conservative amino acid changes may be made,
which although they alter the primary sequence of the
protein or peptide, do not normally alter its function.
Conservative amino acid substitutions typically include0 substitutions within the following groups:
glycine, alanine:
valine, isoleucine, leucine;
aspartic acid, glutamic acid;
asparagine, glutamine;
serine, threonine;
lysine, arginine;
phenylalanine, tyrosine.
The procedures for introduction of mutations into a
gene are well known in the art and are described for
example, in Sambrook et al., (1989, Molecular Cloning; A
Laboratory Manual, Cold Spring Harbor, NY).
The types of diseases in humans which are treatable
by administration of the pharmaceutical compositions of
the invention include, inflammatory bowel diseases
including Crohn's disease and ulcerative colitis
(treatable with IL-lra or IL-l0); autoimmune diseases,
including but not limited to psoriasis, rheumatoid
arthritis, lupus erythematosus (treatable with IL-lra or
IL-l0); neurological disorders including, but not
limited to Alzheimer's disease, Parkinson's disease and
amyotrophic lateral sclerosis (treatable with brain
WO96/11277 2 2 ~ 1 7 2 ~ PCT~P9S/03921
18
devated neurotropic factor and ciliary neurotropic
factor); cancer (treatable with IL-l, colony stimulating
factors and interferon- ~); osteoporosis (treatable with
transforming growth factor ~); diabetes (treatable with
insulin); cardiovascular disease (treatable with tissue
plasminogen activator); atherosclerosis (treatable with
cytokines and cytokine antagonists); hemophilia
(treatable with clotting factors); degenerative liver
disease (treatable with hepatocyte growth factor or
interferon a); pulmonary diseases such as cystic
fibrosis (treatable with alpha-l antitrypsin); and,
viral infections (treatable with any number of the
above-mentioned compositions).
The invention also contemplates treatment of
diseases in other animals including dogs, horses, cats
and birds. Diseases in dogs include but are not limited
to canine distemper (paramyxovirus), canine hepatitis
(adenovirus Cav-l), kennel cough or laryngotracheitis
(adenovirus Cav-2), infectious canine enteritis
(coronavirus) and haemorrhagic enteritis (parvovirus).
Diseases in cats include but are not limited to viral
rhinotracheitis (herpesvirus), feline caliciviral
disease (calicivirus), feline infectious peritonitis
(parvovirus) and feline leukaemia (feline leukaemia
virus). Other viral diseases in horses and birds are
also contemplated as being treatable using the methods
and compositions of the invention. To this purpose, the
use of microorganisms expressing recombinant interferons
will be particularly preferred.
The recombinant microorganisms of the invention are
suspended in a pharmaceutical formulation for
- -
WO96/11277 22 0 1 7 2 ~ PCT~P95/03921
19
administration to the human or animal having the disease
to be treated. Such pharmaceutical formulations include
live microorganisms and a medium suitable for
administration. The recombinant microorganisms may be
lyophilized in the presence of common excipients such as
lactose, other sugars, alkaline and/or alkali earth
stearate, carbonate and/or sulfate (for example,
magnesium stearate, sodium carbonate and sodium
sulfate), kaolin, silica, flavorants and aromas.
Microorganisms so lyophilized may be prepared in the
form of capsules, tablets, granulates and powders, each
of which may be administered by the oral route.
Alternatively, some recombinant bacteria, or even spores
thereof, may be prepared as aqueous suspensions in
suitable media, or lyophilized bacteria or spores may be
suspended in a suitable medium just prior to use, such
medium including the excipients referred to herein and
other excipients such as glucose, glycine and sodium
saccharinate. For oral administration, gastroresistant
oral dosage forms may be formulated, which dosage forms
may also include compounds providing controlled release
of the microorganisms and thereby provide controlled
release of the desired protein encoded therein. For
example, the oral dosage form (including tablets,
pellets, granulates, powders) may be coated with a thin
layer of excipient (usually polymers, cellulosic
derivatives and/or lipophilic materials) that resists
dissolution or disruption in the stomach, but not in the
intestine, thereby allowing transit through the stomach
in favour of disintegration, dissolution and absorption
in the intestine. The oral dosage form may be designed
WO96/11277 PCT/~9S`~3~21
22G1 721
to allow slow release of the microorganism and of the
recombinant protein thereof, for instance as controlled
release, sustained release, prolonged release, sustained
action tablets or capsules. These dosage forms usually
contain conventional and well known excipients, such as
lipophilic, polymeric, cellulosic, insoluble, swellable
excipients. Controlled release formulations may also be
used for any other delivery sites including intestinal,
colon, bioadhesion or sublingual delivery (i.e., dental
mucosal delivery) and bronchial delivery. When the
compositions of the invention are to be administered
rectally or vaginally, pharmaceutical formulations may
include suppositories and creams. In this instance, the
microorganisms are suspended in a mixture of common
excipients also including lipids. Each of the
aforementioned formulations are well known in the art
and are described, for example, in the following
references: Hansel et al. (1990, Pharmaceutical dosage
forms and drug delivery systems, 5th edition, William
and Wilkins); Chien 1992, Novel drug delivery system,
2nd edition, M. Dekker); Prescott et al. (1989, Novel
drug delivery, J. Wiley & Sons); Cazzaniga et al, (1994,
Oral delayed release system for colonic specific
delivery, Int. J. Pharm. 108:77).
Thus, according the invention, recombinant
microorganisms encoding a desired gene may be
administered to the animal or human via either an oral,
rectal, vaginal or bronchial route. Dosages of
microorganisms for administration will vary depending
upon any number of factors including the type of
bacteria and the gene encoded thereby, the type and
W096111277 22 0 1 i 2 î PCT~StO3921
severity of the disease to be treated and the route of
administration to be used. Thus, precise dosa~es cannot
be defined for each and every embodiment of the
invention, but will be readily apparent to those skilled
in the art once armed with the present invention. The
dosage could be anyhow determined on a case by case way
by measuring the serum level concentrations of the
recombinant protein after administration of
predetermined numbers of cells, using well known
methods, such as those known as ELISA or Biacore (See
examples). The analysis of the kinetic profile and half
life of the delivered recombinant protein provides
sufficient information to allow the determination of an
effective dosage range for the transformed
microorganisms. As an example, Bacillus subtilis
encoding IL-lra may be administered to an animal at a
dose of approximately lO9 colony forming units (cfu)/kg
body weight/day.
In a preferred embodiment of the invention, the
recombinant gene is IL-lra and the bacterium is Bacillus
subtilis. IL-lra is a protein which is structurally
similar to that of IL-l which binds with high affinity
to IL-l receptor but which does not activate target
cells (Dinarello et al,, l99l, Immunol. Today 11:404).
IL-lra therefore functions as an antagonist to the
effects of IL-l and has potential as a therapeutic agent
useful for treatment of inflammatory and
matrix-destruction diseases which are mediated through
the action of IL-l. Such diseases include rheumatoid
arthritis, osteoporosis and septic shock. However, in
order to be useful in vivo as a therapeutic agent, it is
WO96/11277 2 2 U 1 1 ~ 1 PCT~5/03921
necessary in some cases that IL-lra be given
continuously in high doses.
Thus, according to the present invention, Bacillus
subtilis which has been manipulated to encode IL-lra is
adminlstered in vivo to an animal at various anatomical
sites such as the peritoneal cavity, the small intestine
or the large intestine. Recombinant IL-lra, produced at
the site of administration of the bacterium then
functions in many cases, as a continuously produced
therapeutic agent capable of counteracting the effects
of IL-l in that region of the animal.
While the examples provided include the nucleotide
sequences for a variety of promoter regions and the
coding sequence of human IL-lra, the invention should
also be construed to include other sequences which share
substantial homology with those sequences presented
herein.
"Homologous", as used herein, refers to the subunit
- sequence similarity between two polymeric molecules,
e.g., between two nucleic acid molecules, DNA molecules
or two RNA molecules, or between two polypeptide
molecules. When a subunit position in both of the two
molecules is occupied by the same monomeric subunit,
e.g., if a position in each of two DNA molecules is
occupied by adenine, then they are homologous at that
position. The homology between two sequences is a direct
function of the number of matching or homologous
positions, e.g., if half (e.g., five positions in a
polymer ten subunits in length) of the positions in two
compound sequences are homologous then the two sequences
are 50% homologous, if 90% of the positions, e.g., 9 of
WO96/11277 2 2 ~ 1 / 2 ~ pCT/~:~5~103~2l
23
lO, are matched or homologous, the two sequences share
90% homology. By way of example, the DNA sequences
3'ATTGCC5' and 3'TATGGC share 50~ homology. By
"substantial homology" as used herein refers to a
nucleotide or amino acid sequence which is at least 50~
homologous, preferably 60% homologous, more preferably
80% homologous and most preferably 90% homologous to a
nucleotide or amino acid sequence described herein.
The following provides some examples of the present
invention. These examples are not to be considered as
limiting the scope of the appended claims.
EXAMPLES
Example l. Examples of systems for expression of
heterologous genes in bacteria
8acillus subtilis. Constitutive expression of
heterologous genes into Bacillus subtilis may be
accomplished by cloning a cDNA encoding the protein to
be expressed downstream of the bacteriophage T5 promoter
region, comprising the se~uence (Sequence Id N. 3):
5'TCTAGAAAAATTTATI~9~TTTCAGGAAAAllllLlATGTATAATAGATT
XbaI -35 -lO
CATAAATTTGAGAGCTCAAAGGAGGAATTCGAGCTCGGTACCCGGGGATCCTCT
EcoRI SacI KpnI SmaI BamHI
AGAGTCGACCTGCAGGCATGCAAGCTT
XbaI SalI PstI SphI HindIII
The T5 promoter is cloned into a suitable vector
such as pSM214 (Velati Bellini et al., l99l, Biotechnol.
18:177); a suitable strain of B. subtilis is for
example, SMSl18. The cDNA encoding the desired protein
is cloned into the polylinker region shown above.
Cloning of heterologous genes in B. subtilis is
WO96/11277 22'~ 1 1 2 I PCT/~1~5~'~3321
24
well known and is described, for example, in Sonenshein
et al. (1993, Bacillus subtilis and Other Gram Positive
Bacteria, American Society for Microbiology, Washington,
D.C.).
Inducible expression of a heterologous gene in
Bacillus subtilis is accomplished by cloning a cDNA
encoding the desired protein downstream from a
regulatory region comprising the TS promoter region and
the lac operator region. Inducible expression of the
desired protein is effected by IPTG-mediated inhibition
of the LacI repressor gene expressed in an appropriate
host strain (Schon et al., 1994, Gene 147:91-94). In
this instance, a minimal T5 promoter region may be used
comprising approximately the following nucleotide
tSequence Id N. 4):
5'TTGCTTTCAGGAAAA~ lATGTATAATAGATTCATAAA
-35 -10
The lac operator region is cloned upstream and the
heterologous gene is cloned downstream from this
sequence. The procedures to accomplish cloning are well
known to those skilled in the art and are described, for
example, in Sambrook et al. (1989, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor, NY). Procedures
for induction of gene expression via the lac operator or
other inducible expression systems are also well known
in the art and are described in Sambrook (supra).
Escherichia coli. Constitutive expression of a
heterologous protein in Escherichia coli may be
accomplished in the same manner as described for
Bacillus subtilis. Additional cloning vectors and
expression systems are described in Sambrook (1989,
WO96111277 2 2 0 1 1~ ~ PCT/~95J~3921
Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor, NY).
Inducible expression in Escherichia coli is
accomplished using any number of procedures including
that which is now described. A cDNA encoding the desired
heterologous protein is cloned downstream of the
promoter region of gene 10 of the bacteriophage T7
(Studier et al., 1986, J. Mol. Biol. 189:113-130) "and
the cDNA coding for the T7-specific RNA polymerase is
cloned under the control of lac promoter in the
bacterial host strain such as Escherichia coli BL21
(DE3)". Inducible expression of the desired protein is
effected by IPTG-mediated inhibition of the LacI
repressor gene as described above.
The DNA sequence of the T7 promoter is as follows
(Sequence Id N. 5) 5'TAATACGACTCACTATAGGGAGA. This
region may be cloned into a suitable vector, such as the
ones of the bluescript series (Stratagene, La Jolla,
CA), expression vectors that use the T7 system (pRSET
series Invitrogen Corporation, San Diego, CA or pET
series Novagen Inc., Madison, WI). Additional elements
may be added to this sequence (and to that described
above for expression of genes in Bacillus subtilis)
which provide a ribosome binding site (RBS), and ATG
translation start codon and a multiple cloning region as
follows (Sequence Id N. 6):
5'CGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAA
T7 promoter
TAATTTTGTTTAACTTTAAGAAGGAGATATACATATG
RBS NdeI
The NdeI site is the site of choice for cloning of
WO96/11277 22 ~ 1 7 ~ ~ PCT~5/03921
a cDNA encoding a heterologous protein.
Lactococcus lactis. Constitutive expression of
heterologous genes cloned into Lactococcus lactis is
accomplished using the p32 promoter which controls
expression of Lactococcus lactis fructose-
1,6-diphosphate aldolase (Van de Guchte et al., 1990,
Appl. Environ. Microbiol. 56:2606-2611). This region may
be cloned into a suitable vector, for istance those
derived essentially from pWV01 or from pSH71 (Kok et
10al., 1984, Appl. Environ. Microbiol. 48:726). Another
suitable expression vector is pMG36e (Van de Guchte,
su~ra) and additional sequences may be added as
described above which sequences include a ribosome
binding site and a translation start codon.
15Inducible expression of heterologous genes in
Lactococcus lactis is accomplished using the T7 gene 10
promoter as described above (Wells et al, 1993, Mol.
Microbiol. 8:1155-1162).
Lactobacillus spp. Constitutive expression of genes
in Lactobacillus spp. is accomplished using the
Lactobacillus casei L(+)-lactate dehydrogenase promoter
(Pouwels et al., 1993, Genetics of lactobacilli:
plasmids and gene expression, Antonie van Leeuwenhoek
64:85-107). This promoter has the following sequence
(Sequence ~d N. 7)
5'AAAAGTCTGTCAATTTTGTTTCGGCGAATTGATAATGTGTTATACTCACAA
-35 -10
As described above, additional sequence elements
may be added including a ribosome binding site and a
translation start codon.
A cDNA encoding the desired heterologous gene is
WO96/11277 2 2 0 ~ 12 I PCT~5/03921
27
cloned downstream of this promoter region into a
suitable vector, such as those disclosed in Pouwels et
al., 1993, su~ra and in Posno et al. l99l, Appl.
Environ. Microbiol. 57:1882.
Inducible expression of a heterologous gene in
Lactobacillus spp. is accomplished using the alpha
amylase promoter sequence of Lactobacillus amylovirus.
This promoter is induced in the presence of cellobiose
and is repressed in the presence of glucose ~Pouwels et
al., 1993, Genetics of lactobacilli; plasmids and gene
expression, Antonie van Leeuwenhoek 64:85-107). The
nucleotide sequence of the alpha amylase gene is as
follows (Sequence Id N. 8)
5'GCAAA~AAATTTTCGATTTTTATGAAAACGGTTGCAAAGAAGTTAGCAAAAA
glucose operator/-35
TATATAAT 3'
-10
TTCTTTTGAAATTGTTCACTTGGCCAAGCTGCAGTTTCAAATATTTTAAT
AAAGGGGGCAGTAAAAA.
RBS
This sequence is cloned into a suitable vector, and
as described above, additional elements may be added
including a translation start codon.
Inducible expression may also be accomplished using
the D xylose isomerase promoter region of Lactobacillus
pentosus. This promoter is induced in the presence of
xylose (Pouwels et al., 1993, Genetics of lactobacilli:
plasmids and gene expression, Antonie van Leeuwenhoek
64:85-107). The nucleotide sequence of the D-xylose
isomerase promoter region is as follows (Sequence Id N.
9)
WO96tll277 2 2 i~ 1 7 2 i PCT~5/03921
5'AGAAAGCGTTTACAAAAATAAGCCAATGCCGCTGTAATCTTAC 3'
~35 -lO
As described herein, additional elements may also
be added to this sequence including a ribosome binding
site and a translation start codon.
Introduction of recombinant protein expressed by
colonizing bacteria can be obtained by providing locally
the appropriate inducer, for example by giving
cellobiose orally for the amy-driven expression system.
Example 2. Mutant and wild type forms of IL-lra
having Il-lra activity
Cloning and expression of human recombinant IL-lra
in Escherichia coli was performed as follows. A cDNA
encoding IL-lra was obtained by performing RT-PCR on a
cDNA pool of RNAs expressed in monocyte/macrophage cells
using standard methods (Sambrook et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor, NY).
The primers used for amplification were as follows
(Sequence Id N. lO and ll)
IL-lra forward - 5' GATCATATGCGACCCTCTGGGAGAAAATCC 3'
NdeI Arg
Il-lra reverse - 5' GATCTGCAGCTACTCGTCCTCCTGGAAG 3'
PstI
The forward primer was designed to create an NdeI
site having an ATG translation start codon, the NdeI
site being immediately upstream from the first amino
acid of the mature IL-lra protein (Arginine, R26). The
reverse primer was designed such that it contains a PstI
site downstream from the translation stop codon in the
IL-lra cDNA. The amplified fragment was cloned into the
NdeI and PstI sites of the plasmid, pRSETA-IL-lra. This
WO96/11277 2 2 0 1 7 ~ ~ PCT~S/03921
29
plasmid was introduced into Escherichia coli strain BL21
(DE3) (F-, ompT, hsdDB, (rB~mB~) gal, dom, (DE3)) using
standard procedures. A map of the expression plasmid
pSETA-IL-lra is shown in Figure l.
To obtain mutations in IL-lra, a portion of the
coding region of the IL-lra gene (that encoding amino
acids 30-lS2) is excised from the plasmid pRSETA-IL-lra
and is recloned into the mutagenesis Bluescript plasmid
SK+ beetween the PstI sites thereby generating the
plasmid BSK-IL-lra. Mutagenesis of the gene is effected
using synthetic oligonucleotides obtained using an
Applied Byosystems 392 oligonucleotide synthesizer and
phosphoramidite chemistry.
To mutate the IL-lra gene at the codon coding for
amino acid asparagine 9l the complementary sequence
(Sequence Id N. 12)
5' GCT CTG CTT TCT 9~ CTC GCT CAG 3'
91
was used. To obtain the plasmid BSK-MILRA-l (containing
a mutation at codon 9l) the synthetic oligonucleotide
was mixed with single stranded plasmid BSK-IL-lra DNA in
a standard hybridization buffer (containing 5 pmol of
oligonucleotide and 0,2 pmol of single stranded DNA in
l0 ml of buffer). The mixture was heated to 70C, it was
cooled slowly to 30C for 40 minutes and was placed on
ice. One Ml of standard synthesis buffer, l Ml (3 units)
of T4 DNA ligase and l Ml (0,~ units) of T7 DNA
polymerase were added to the mixture. Following l hour
of incubation at 37-C, the mixture was used to transform
competent cells. Identification of positive clones is
performed by nucleotide sequence analysis.
WO96/11277 PCT~/03921
2~Q1 72~
Mutated IL-lra comprising an amino acid subtitution
at position lO9 was generated in a similar manner using
the synthetic oligonucleotide
5' CTC AAA ACT GGC CGT GGG GCC 3' (Sequence id N. l3)
In each instance, a different codon may be used to
generate a mutated IL-lra having different amino acid
substitutions at either or both of positions 9l or lO9
using the procedures and oligonucleotides described
above by inserting the desired codon at the appropriate
position.
Each of the mutated sequences is then cloned into
an expression vector, for example, the sequences may be
cloned back into the vector pRSETA-IL-lra between sites
SpeI and PstI generating a variety of expression
plasmids comprising mutated IL-lra. The plasmid
comprises a mutation in amino acid position 9l of IL-lra
cloned into the vector RSETA-IL-lra. This plasmid
(T7MILRA-l) encodes an arginine residue at position 9l
and expresses mutated IL-lra having biological activity
of IL-lra (see below). Similarly, plasmid pT7MILRA-2
encodes mutated IL-lra comprising the amino acid
substitution Ala in the place of Thr in position lO9 and
gives rise to plasmid BSR-MILRA-2, and plasmid pT7MILRA-
3 encodes mutated IL-lra comprising both amino acid
substitutions Arg in the place of Asn in position 9l and
Ala in the place of Thr in position lO9 and gives rise
to plasmid BSK-MILRA-3.
Example 3. Generation of Bacillus subtilis capable
of producing large amounts of recombinant protein
The natural process of sporulation of Bacillus,
which process induces natural lysis of vegetative cells,
Wo96111277 2 2 ~ PCT~P95103921
is exploited in order that large amounts of heterologous
protein may be expressed in and recovered from this
organism. Although the examples given herein relate to
the genus Bacillus, the invention should be construed to
encompass other sporulating bacteria, such as those in
the genus Clostridium.
Sporulation of Bacillus is induced by placing the
bacteria in medium suitable for sporulation (Jongman et
al., 1983, Proc. Natl. Acad. Sci. USA 80:2305). Both
vegetative growth and sporulation may be obtained in the
same medium, i.e., potato extract medium, provided the
cell concentration is high (Johnson et al., 1981, J.
Bacteriol. 146:972) During sporulation, the bacterial
vegetative cells lyse; thus, following sporulation,
expressed proteins are released from the lysed cells and
recovered in the supernatant.
Thus, we have evidence that sporulating bacteria
effectively produce recombinant proteins in the
sporulation supernatant.
Moreover, the following data provide guide-lines
for the applicability of the invention.
The experiments described below exemplify (i)
cloning, expression and release of a recombinant
protein, IL-lRA , in Bacillus; (ii) purification of a
recombinant protein so expressed;
(i) Cloning, expression end release of recombinant
IL-lra from Bacillus. A cDNA encoding IL-lra was
obtained using a reverse transcriptase (RT) polymerase
chain reaction (PCR) from a cDNA library of RNAs
transcribed in monocyte/macrophage cells using standard
methods (Sambrook et al., 1989, Molecular Cloning: A
WO96/11277 2 2 U 1 7 2 1 pCT~/03921
Laboratory Manual, Cold Spring Harbor, NY). The primers
used for amplification were as follows (Sequence Id N.
14 and 15)
IL-lra forward - 5'GGGAATTCTTATGCGACCCTCTGGGAGAAAATCC 3'
EcoR I
IL-lra reverse - 5'GGCTGCAGCTACTCGTCCTCCTGGAAG 3'
PstI
The forward primer was designed to create an EcoRI
site just 5' to the initial ATG codon upstream of the
first codon of the mature protein (R26). Similarly, the
reverse oligonucleotide was designed to introduce a PstI
site downstream of the translation stop codon of the
protein. The amplified fragment was cloned into the
EcoRI PstI sites in the vector pSM214 thereby generating
pSM441 (Figure 2). This plasmid was used to transform
Bacillus subtilis strain SMS 18 (leu~, pyrDL, npr~,
apr~) using standard techniques. The transformed culture
was maintained at -80-C in glycerol until use.
Generation of mutated IL-lra proteins in Bacillus
subtilis is performed by cloning the SpeI-PstI
restriction fragments of BSK-MILRA-1, BSK-MILRA-2 or
BSK-MILRA-3 in pSM441 between the same sites.
To generate IL-lra in Bacillus subtilis which
expressed extracellularly, the forward primer which is
used contains the forward primer sequence provided
above, in addition to the sequence encoding the protein
subtilis in which is essential for the secretion of the
protein from cells. The nucleotide sequence of this
forward primer is as follows (Sequence Id N. 16)
5'GGGAATTCTTATGAGAAGCAAAAAATTGTGGATCAGCTTGTTGTTTGCGTTAA
CGTTAATCTTTACGATGGCATTCAGCAACATGAGACGCGTCCGGCGACCCTCTGGG
WO96/11277 2 2 0 1 12 I PCT~S/03921
AGAAAATCC 3'
The reverse primer in this reaction is as described
above. An amplified fragment comprising these sequences
is cloned into the corresponding EcoRI and PstI sites in
the expression vector pSM241 to generate the plasmid
pSM441sec. Transformation of Bacillus subtilis with this
plasmid is as described above for the plasmid pSM441.
To generate IL-lra, two ali~uots of 100 ml of Luria
broth (LB) medium containing 5 mg/l of chloramphenicol
were inoculated with a 1:200 dilution (in LB) of primary
inoculum derived from the glycerol stock. The cultures
were incubated for 7 hours at 37-C with shaking.
Bacteria were harvested by centrifugation at 3000 x g
for 20 minutes at 4-C. The cells were washed once in 50
mM Morpholinoethansulfonic acid (MES)-NaOH solution, pH
6.25 containing 1 mM EDTA (Buffer A). At this point,
cells were either stored at 80-C until preparation of
lysates, or they were processed immediately for
sporulation.
To prepare lysates, the cells were thawed and were
resuspended in 10 ml of Buffer A and were then disrupted
using an XL2020 sonicator (Heat System, Farming dale,
NY) at an output power of 80W for 14 cycles of 30
seconds of sonication and 30 seconds in ice water. The
cell lysate was centrifuged at 30,000 x g for 30 minutes
at 4-C and the supernatant was recovered while avoiding
the layer of lipid at the top of the centrifuge tube.
The lysate was stored at -80 D C until use. This
supernatant was termed "Sc".
To induce sporulation, bacteria were resuspended in
10 ml of Difco sporulation medium without
Wos6/11277 220 1 1~ i PCT~P95/03921
34
chloramphenicol (3 g/l Bacto beef extract, 5 g/l
Peptone, 0.25 mM NaOH, l0 mM MgSO4, 0.1% KCl, 0.l mM
MnCl2, l mM Ca(NO3)2 and l mM FeSO4 at pH 6.8). Cells
were incubated for approximately 12 hours at 35C with
sha~ing. Spores which had formed were harvested by
centrifugation at 3,000 x g for 20 minutes at 4C. The
supernatant was stored at -80C until use. This
supernatant was termed "Ss".
(ii) Purification and assessment of IL-lra. To
obtain IL-lra, supernatants Sc and Ss were thawed and
filtered through a Millex HV 0.45 mm unit (Millipore)
The pH of supernatant Ss was adjusted to 6.25 using HCL.
Both supernatants were incubated for 3 hours at 4C with
gentle shaking in the presence of l ml of Q-Sepharose
Fast Flow anionic exchanger (Pharmacia). The anionic
exchanger was equilibrated in Buffer A prior to
incubation with the supernatants and a column comprising
the same wax formed in a Poly-Prep disposable column
(Bio-Rad). Non-adsorbed material was collected and
incubated as described above in the presence of l ml of
S-Sepharose Fast Flow cationic exchanger (Pharmacia)
which had been equilibrated in Buffer A. After washing
in Buffer A, the S-Sepharose was batch eluited using 2
ml of Buffer A containing 0.5 M NaCl. The eluited
material was concentrated to a volume of 0.25 ml using a
Centricon l0 centrifugal concentrator (Amicon).
Proteins which were obtained as described above
were analyzed by electrophoresis through 13.5% mini
SDS-PAGE and were visualized by staining using standard
technology. The protein bands were further analyzed by
laser scanning using a Molecular Dynamics Personal
WO96/11277 PCT~/03921
. _
220~ 12~
Densitometer and a densitometric image was obtained
using Image Quant software (Molecular Dynamics). The
results of this analysis are summarized in Figure 3 and
in Table 1. It is apparent from these results that IL-
lra was expressed in these cells.
TART.~ 1
Determination of IL-lra in the cell lysate supernatant
(Sc) and in the Sporulation supernatant (Ss) of Bacillus
su~tilis engineered to express human IL-lra
intracellularly
________________________________________________________
Sample Total Protein IL-lra(l) Biological
(mg) ---________ Activity(2)
% mg
________________________
Sc: crude 12.5 10 1.250 n.t.
enriched 0.675 66 0.445 0.9 x 106
________________________________________________________
Ss: crude 9.6 12 1.152 n.t.
enriched 0.440 80 0.350 1.1 x 106
________________________________________________________
(1) Determined by laser scanning densitometry of SDS-
PAGE.
(2) Specific activity is expressed in inhibitory units
(IU)/mg IL-lra. Specific activity of an IL-lra
standard preparation (human recombinant IL-lra from
Escherichia coli) is 0.9 x 106 IU/mb.
n.t. Not tested.
The amount of protein in each of the
above-described preparations was assessed using a
standard Bio-Rad protein assay following the
manufacturer's instructions. Bio-Rad protein standard I
was used as the standard when assessing the amount of
WO96/11277 PCT~5/03921
2201 721
36
protein in the starting material. A purified standard of
recombinant IL-lra was used as a standard to assess the
amount of IL-lra in the purified fractions. The
concentration of IL-lra was determined by measuring the
absorption at 280 nm (A280) of the protein in a 6 M
guanidinium hydrochloride solution in 20 mM phosphate
buffer, pH 6.5. Under these conditions, the A28o0-1% of
IL-lra calculated using PC/GENE software
(Intelligenetics) was 0.9l0.
The biological activity of IL-lra was measured in a
murine thymocyte proliferation assay. Thymocytes plated
at a concentration of 6 X 105 cells per well of a 96
well plate were obtained from 5 to 7 week old C3H/HeJ
mice (The Jackson Laboratories). The thymocytes were
cultured in ~PMI-1640 (Gibco) and 5% heat-inactivated
fetal bovine serum (Hyclone), 25 mM betamercaptoethanol,
50 mg/ml gentamicin (Sigma) and l.5 mg/ml PHA
(Wellcome). A fixed concentration of recombinant human
IL-l beta (l unit = 30 pg/ml) either alone or in the
presence of differing amounts of standard IL-lra or IL-
lra containing fractions (at concentrations of l0 pg/ml
to l00 ng/ml) was added to triplicate wells. Following
addition, thymocytes were incubated at 37-C in moist air
having 5% CO2 for 72 hours; An amount of 0.5mCi of
3H-thymidine (DuPont-NEN) was added and incubation was
continued overnight. Cells were then harvested onto
glass fiber filters. The level of incorporation of
3H-thymidine into the cells was determined by
scintillation counting. One unit of IL-lra is calculated
as the amount which inhibits 50% of IL-l induced
proliferation. The data which are provided in Table l
WO96/11277 2 ~ O ~ 7 2 ~ PCT/~l95~'~3~21
suggests that there are no significant differences
between the activity of IL-lra in preparations of
lysates or preparations of sporulating bacteria of the
invention.
Example 4. Expression of IL-lra in Bacillus
subtilis in vivo
The nucleotide and corresponding amino acid
sequence of human IL-lra is given in Figure 4. Bacillus
subtilis encoding IL-lra was administered
intraperitoneally to mice. At various times post-
administration, which times are indicated in the
accompanying Table 2, peritoneal samples were obtained
by lavage of the peritoneum and in addition, serum
samples were obtained. Western blot analysis was
performed on each sample using a rabbit anti-recombinant
human IL-lra antibody.
Essentially, Bacillus subtilis was propagated in LB
medium in the presence of 5 mg/l of chloramphenicol at
37-C overnight with continuous stirring. The bacteria
were collected by centrifugation and the cells were
resuspended in phosphate buffered saline (PBS). Female
C3H/HeOuJ mice, having a body weight of approximately 20
g, were inoculated with 3 X 107 bacteria per mouse in
0.2 ml PBS. Untreated animals served as controls.
At 3, 6 and 24 hours post-administration,
peritoneal lavage was performed using 3 ml of
physiological saline. Two animals were sacrificed at
each time point. Serum samples were also obtained from
the mice at the indicated times. The lavage samples were
centrifuged at 5,000 x g for 30 minutes at 4C and the
supernatant was recovered. Aliquots of l and 3 ~l of
WO96/11277 2 2 ~ ~ 7 ~ ~ PCT~Pg~l~3g2l
supernatant were analyzed by electrophoresis and Western
blotting. Rabbit anti-IL lra antibody was diluted
l:lO0,000 and was conjugated to GAR/BRP (Bio-Rad) at a
l:15,000 ratio and an IBI Enzygraphic Web (Kodak) system
was used to detect the presence of the proteins. As a
positive control, experiments were conducted wherein lO
ng of IL-lra was added to a sample of ra-negative serum.
The results which are presented in Table 2 reflect the
relative amounts of IL-lra which were detectable in each
sample using this method. It is evident that IL-lra is
detectable in the mice, in particular, by 3 hours post
administration. Anti-IL-lra antibody was prepared in
rabbits which were inoculated with recombinant IL-lra
using standard procedures (Harlow et al., 1988, In:
Antibodies, A Laboratory Manual, Cold Spring Harbor,
NY). As a positive control, experiments were conducted
wherein lO ng of IL-lra was added to a sample of IL-lra-
negative serum. The results which are presented in Table
2 reflect the relative amount of IL-lra which were
detected in each sample using this method. It is evident
that IL-lra may be detected in the mice, in
particularly, by 3 hours post administration, following
administration of bacteria expressing the same.
WO96/11277 2 2 0 1 1 2 I PCT~5/03921
T~Rr.~ 7
Identification of IL-lra BY Western blot analysys after
in vivo administration of engineered Bacillus subtilis.
_________________ _ ______ _________________
SAMPLE
________________________________________________________
SAMPLING TIME
________________________________________________________
Peritoneal lavage serum
____ ___ ___________
Basal
________________________________________________________
3 hours +++ +
_______________________________________________________
6 hours +
________________________________________________________
24 hours
_______ ________________________________________________
Example 5. Release of IL-lra from Bacillus subtilis
~rin; stered in vivo to rats
Male Sprague-Dawley rats weighing about 200-250 g
were fasted for 24 to 48 hours. The rats were
anaesthetized with phenobarbital (45 mg/kg administered
intramuscularly) or with ether. The abdomen was opened
along the linea alba to permit access to the
gastrointestinal tract. The end portion of the colon
and/or the end portion of the ileum ( O . 5-1 cm above the
ileocaecal valve) were identified and isolated using a
ligature.
For administration of bacteria into the large
intestine, volumes of 5 to lO ml of 0.25 X LB ti.e.~ LB
having one quarter of the concentration of the
components normally contained therein) containing 3 to 6
- X 108 bacteria (propagated as described herein) were
-
WO96/11277 2 2 ~ 1 7 ~1 PCT~5/03921
aspirated with a syringe and were injected above the
ileocaecal valve such that the caecum and a large
portion of the colon was filled. An occlusion was formed
by surgical ligature immediately below to point of entry
of the needle so as to prevent bacteria from entering
the peritoneal cavity.
For administration of bacteria to the small
intestine, volumes ranging from l to lO ml, containing 3
to 6 x 108 bacteria were injected into the proximal
portion of the small intestine about 0.5 to l cm below
the pylorus. As described above, an occlusion was formed
by surgical ligature immediately below the point of
entry of the needle to prevent entry of bacteria into
the peritoneal cavity.
At 3, 4, 6, 8 and 24 hours post-administration, the
animals were sacrificed and the abdomen was opened to
expose the intestines. The intestinal lumen was washed
with 10-50 ml of sterile physiological saline at
constant pressure (lO0 cm H2O) by means of a needle
introduced into the caecum or the duodenum depending
upon the site of administration. Aliquots of lavage (1-2
ml) were centrifuged at 5,000 x g for 30 minutes at 4C
and the amount of IL-lra contained therein was assessed
by Western blotting as described. These results are
presented in Table 3. It is evident from the data that
IL-lra was released in both the large and small
intestine following administration of Racillus subtilis
encoding the same. A greater amount of IL-lra was
present in the large intestine compared with the small
intestine and IL-lra appeared to persist in the large
intestine for a longer period of time.
WO96/11277 ~ 2 '~ 1 7 ~ PCT~5/03921
L ,
41
TART~ 3
Identification of IL-lra by Western blot analysis in the
intestinal lumen following in situ administration of
engineered Bacillus subtilis
_________
TIME (hours)
________________________________________________________
INTESTINAL TRACT
________________________________________________________
Basal 3 4 5 8 24
________________________________________________________
Small Intestines - +~ ++ ~ - -
________________________________________________________
Large Intestine - ++++++ +++++ ++ ++ ++
____________________
Example 6. Protection of mice from endotoxic shock
following intraperitoneal administration of Bacillus
subtilis encoding IL-lra
Female C3H/HeOuJ mice having a body weight of
approximately 25 g were administered a single dose of
Bacillus subtilis intraperitoneally as described. The
mice each received 3 X l06 bacteria in 0.2 ml PBS.
Control mice included those which received wild type
Bacillus subtilis and mice which received PBS alone. At
24 hours post-administration, all of the animals were
administered 15-20 mg/kg of LPS ~y intraperitoneal
injection. Each test group comprised 10-20 animals. The
number of deaths in each group of mice was recorded
until 5 to 7 days following administration of LPS when
no further deaths occurred within a 48 hour period.
These data are presented in Table 4. From these data it
is evident that inoculation of mice with Bacillus
subtilis encoding IL-lra enabled these mice to survive
WO96/1l277 2 ~ ~ 1 7 ~l PCT~5103921
42
lethal doses of LPS.
TARr.~ 4
Inhibition of endotoxic shock in mice treated with
engineered bacillus subtilis
S ____________________
MORTALITY AFTER TREATMENT WITH:
________________________________________________________
D~SE OF LPS
________________________________________________________
PBS B. subtilis wt B. subtilis-il-lra
________________________________________________________
15 mg/kg 40% 40~ 0%
________________________________________________________
20 mg/kg 100% 100% 70%
_ ____________________
Example 7. Expression of IL-lra in Bacillus
subtilis administered to rabbits
The strains of Bacillus subtilis which were used in
the experiments described below were as follows: Strain
SMS118 containing the plasmid pSMS39, encodes human IL-
lra which is expressed intracellularly; strain SMS118
containing the plasmid pSM261, encodes human mature IL-1
beta which is expressed intracellularly; strain SMS118
containing the plasmid pSM214 deriving from pSM671
encodes beta-lactamase which is expressed in secreted
form: each of these strains has the genotype leu~,
pyrDL, npr~, apr- pSM261 and pSM214 are disclosed in
Velati 8ellini et al. 1991, J. Biotechnol. 18:177.
pSM539 is disclosed in IT-A-MI94001916. Bacteria were
propagated and lysates were prepared therefrom as
described herein.
Female New Zealand rabbits having a body weight of
1.9 to 2.3 kg were maintained in standard cages at
WO96tll277 2 2 ~ 1 7 2 l PCT~P9~/03921
~.
22+1C under a 12 hour light 12 hour dark cycle. The
rabbits received 100 g of a standard diet daily and
water ad libitum.
For administration of Bacillus subtilis to the
colon of the rabbits, the rabbits were fasted for a
period of 16 to 18 hour treatment. The rabbits were than
placed in standard stock restraints and were acclimated
for l hour prior to treatment. A rounded tip urethral
catheter (Rush, Germany) was gently inserted into the
distal colon via the anus. Approximately 10 cm of the
catheter was inserted. A suspension of Bacillus subtilis
in 2 ml of PBS was administered through the catheter
while the rabbits remained conscious.
To determine the temperature of the rabbits,
rabbits were gently restrained in conventional stocks
throughout the experiment and in each cave, prior to
experimentation, were acclimated to the stocks for about
2 hours. The body temperature of the animals was
measured by means of a cutaneous thermistor probe
(TM-54/S and TMN/S; L.S.I. Italy) which was positioned
between the left posterior foot and the abdomen and was
allowed to stabilize for 2 minutes. A suspension of
Bacillus subtilis (containing plasmids pSM214 or pSM539
at 2 X 109 cells per rabbit) was instilled in the distal
2S colon 1 hour before intravenous-administration of highly
purified LPS-free recombinant human IL-1 beta in
pyrogen-free saline through the marginal ear vein. The
temperature of the animals was recorded every 20 minutes
for 3 hours beginning at the time of administration of
IL-1 beta. To measure IL-1 induced hypoferremia in the
rabbits, the concentration of iron in the rabbits was
wos6/11277 2 2 ~ 1 1 2 i PCT~5/03921
assessed in samples obtained at 2, 4, 6, 8 and 24 hours
following intravenous inoculation of l microgram/kg of
recombinant human IL-l beta. The iron assay was a
colorimetric assay using a commercially available kit
(Fe; Boehringer Mannheim, Mannheim, Germany). Normal
iron levels prior to administration of IL-l beta was
134.7 + 6.6 micrograms/dl mean + of 25 animals).
Hypoferremia (a 60-75% decrease in the level of iron in
the plasma) was evident at about 4 to about 24 hours
following IL-l beta administration. Bacillus subtilis
strains containing pSM214 or pSM539 at a concentration
of 2 X lO9 cells per rabbit were instilled into the
distal colon twice, once at 3 hours prior to
administration of IL-l beta and once at lO minutes after
IL-l beta administration.
To detect IL-lra in rabbit serum, serum was
obtained from the animals through the marginal ear vein
at 0, l, 2, 4 and 8 hours following administration of
Bacillus subtilis. Quantitative determination of IL-lra
was accomplished in a specific ELISA (Amersham
International, Amersham, UK) following the
manufacturer's instructions. In this assay, the lower
detection limit is 20 pg/ml. Purified IL-lra was used as
a standard.
IL-lra in serum was also measured using a Biosensor
BIAcoreTM system (Pharmacia Biosensor AB, Uppsala,
Sweden) which allows real time biospecific interaction
analysis by means of the optical phenomenon of surface
plasmon resonance (Lofas et al., l990, J. Chem. Soc.
Chem. Commun. 21:1526). The immobilization run was
performed at a flow of 5 ~l/minute in HBS at pH 7.4 (lO
WO96/11277 2 2 0 ~ 7 2 l PCT~5/0392l
mM HEPES, 150 mM NaCl, 3.4 mM EDTA, 0.05% Surfactan P20
- as described (Lofas et al., 1990, J. Chem. Soc. Chem.
Commun. 21:1526; Fagerstam et al., 1990, J. Mol. Recogn.
3:208). Purified polyclonal IgG anti-IL-lra was linked
via primary amino groups to the dextran matrix of a CM5
sensor chip according to the following optimized
procedure. The carboxylated matrix of the sensor chip
was first activated with 45 ~1 of a 1:1 mixture of
N-hydroxysuccinimide and N-ethyl-N'-(3 diethylamino-
propyl-) carbodiimide. Then 70 ~1 of antibody solution
(150 ~g/ml in 10 ml sodium acetate at pH 4.5) was
injected. The free amino groups were blocked with 40 ~l
of 1 M ethanolamine hydrochloride. Samples containing
IL-lra were introduced in a continuous flow passing over
the surface of the sensor chip, allowing interaction
with the immobilized antibodies. Interaction was
detected in terms of resonance angles and was expressed
in resonance units (RU). For evaluation of serum IL-lra
concentration, a standard curve of IL-lra in HBS was
constructed (from 0.1 ng/ml to 1 ~g.ml at a flow rate of
3 ~l/minute). Rabbit serum samples were filtered on
Centricon Plus (Amicon, Beverly, MA) before analysis.
The concentration of IL-lra in serum samples was
calculated by comparing the sample RU to the standard
curve using a Prefit program.
The results of the experiments now described are
presented as the mean + SEM. Body temperature
differences were assessed by one-way ANOVA and the
significance was designed at the 95% confidence level.
Induction of in vitro sporulation in Bacillus
subtilis manipulated to express IL-lra intracellularly
W096/11277 22U I 72 1 PCT~5/03921
46
(Figure 5A) renders this bacterium capable of releasing
large amounts of intact, active recombinant IL-lra
(Figure 5B) within a few hours following induction of
sporulation (Figure 5C). IL-lra was also detectable in
the serum of rabbits administered intracolonically with
bacteria capable of producing IL-lra (pSM539) but not
with control beta-lactamase expressing bacteria
(pSM214). When rabbits were administered
intracolonically bacteria capable of producing IL-lra
(pSM539) or control beta-lactamase (pSM214) IL-lra was
also observed to be expressed (Figure 6). Here, the
presence of IL-lra, as measured by a specific ELISA, was
observed for several hours in the rabbit serum following
a single inoculation of 2 X 109 live Bacillus subtilis
comprising pSM539. The rabbits which were administered
pSM214 tested negative in the ELISA. The presence of IL-
lra in rabbit serum following treatment was confirmed in
the BIAcore assay (Figure 7).
The ability of IL-lra delivered by Bacillus
subtilis to antagonise the effects of parenterally
administered IL-l beta was investigated. In Figure 8 it
can be seen that the increase in body temperature
induced in rabbits following intravenous injection of
IL-l beta was significantly reduced in rabbits which had
2S received pSM539 compared with rabbits which had received
pSM214. Further, this reduction was dose dependent. In
addition, IL-l beta induced hypoferremia was reversed in
rabbits treated with pSM539 compared with rabbits
treated with pSM214.
To further establish that administration of
bacteria to animals is an effective drug delivery
WO96/11277 2 ~ U I i 2 I PCT~,95~U321
-
47
method, rabbits were administered Bacillus subtilis
comprising pSM261 (encoding IL-l beta). Rabbits which
were administered this type of bacterium exhibited a
significant increase in body temperature, up to 40 of
the animals died and, generally, the rabbits presented
as if they had been administered IL-l beta intravenously
(Figure 9).
Example 8. Expression of IL-lra in Escherichia coli
administered to mice
To express IL-lra in this Escherichia coli, the
Escherichia coli transformed with the plasmid, pT7MILRA-
3, were grown in LB containing lO0 mg/l ampicillin until
an optical density of 0.4 to 0.7 at 600 nm was reached.
Expression of the protein was then induced by the
addition of a final concentration of 2-4 mM of IPTG to
the medium. The cells were incubated for 2.5-3.0 hours
at 37-C with shaking. Bacteria were then collected by
centrifugation and were resuspended in a suitable volume
of saline for administration to mice.
Female C3H/HeJ mice having a body weight of
approximately 20-25 g were administered a single
subcutaneous dose of Escherichia coli comprising the
plasmid pT7MILRA-3. The number of bacteria administered
ranged from 5 x 107 to l.5 x lOl0 cells/dose; the time
of administration of Escherichia coli to the mice varied
from l to 3 hours prior to administration of IL-l~ to
the mice. In all cases, the results obtained, i.e., the
efficacies of the IL-lra in the mice were comparable.
At time zero, mice were administered 4 ~g/kg of
recombinant human IL-l~ intraperitoneally. Two hours
post-administration of IL-l~, the mice were sacrificed
WO96/11277 22~ 721 ` PCT/~9S~3921
48
and samples of serum were obtained. The level of glucose
in the serum was assessed by reaction with glucose-
oxidase using a commercially available kit (Glucose GOD
Perid: Boehringer Mannheim). The results are presented
in Figure l0. The extent of hypoglycemia induced by
intraperitoneal IL-l~ is shown (filled column).
Hypoglycemia was markedly reduced in mice pretreated
with IL-lra expressing Escherichia coli (hatched
column). As a positive control, purified IL-lra (4
mg/kg) was administered subcutaneously 15 minutes before
administration of IL-l~ and was observed by IL-l~
(cross-hatched column). As a negative control, mice were
subcutaneously administered Escherichia coli strain BL21
(D3) containing the plasmid pRSET-A (i.e., a plasmid
which does not encode IL-lra) prior to administration of
IL-l~. IL-l~ induce hypoglycemia in these mice was
unaffected by administration of Escherichia coli
containing pRSET-A establishing that it is the
expression of IL-lra in Escherichia coli which accounts
for the observed reduction in hypoglycemia in the
animals.
The data described herein thus establish that
bacteria which express recombinant proteins when
administered to an animal serve as efficient and
effective drug delivery vehicles for treatment of
disease in the animal.
The data described herein thus establish that
bacteria which express recombinant proteins when
administered to an animal serve as efficient and
effective drug delivery vehicles for treatment of
disease in the animal. Intracolonic administration of
WO g6/11277 2 2 0 1 7 2 I PCT/~9~1~3~2l
49
bacteria establishes a source of drug for the animal
~ having therapeutic effec~.
WO 96tll277 2 2 0 1 7 2 1 PCT/~5s~392~
O
.~ ~
,r~l _
Cl
.r~
n
J >
U~
O O
u~ a cn
O ~rl ~
o ~ r_~
V ~ ,r~ ~ Y ~r U~
Z ~ U
~ ~ a_ oq
0~ rlH ~I t~ ~ ~ U OC ~- ~rl
R. ~P. ¢ r~ X ~ O C~ a~ t~ o
a H ~ - O ,r~ L C O ~ Q
~ Z ~ ~ ~ U
~ ~ ~ a L ~rl V~ O
a~ 1 H Z ~ -~ H J! p~ H ~ r~ IL) Un~4
a ~ m 4 J ~.r/ l~
Z E~ O ~ ~ U 'Z; -
o o ~ - u z - w CY c ~ ~ z ~ ~ ~ _l a
C~ - ~ ~ o ~ ;~ W .~
~C X U ~ ~ Z ~`1
1) 0 ~ 3 ~ L1 ~ O V '-1 ~ O
O ~ ~ ~ H O O ~ ~' O J-- ~ L O _~ ~,1 U ~ O
~ Z ~ ~ U ~ ~ ~ W >~ wl ~ u V u~ O W ~
H ~ ~ a ~ ;4 ~ ~ ~~ H P ~ ~~~
a u ~ u a F~ v c~
o
rl rl rl
_ ~rl ~ri
~ ~r~ ~ H
~ 1~
WO96111277 2~Ul /21 PCTIEP9~103921
CO ~o
o :~ o U
U ~ I E~
~ ~ ''S ~ U h
U ~ ~ ~U~ ~ U7
O
h
U o h ~ U ~:
P -l U
U O p ,
UU h
~.~ 5 h
C~ U :: U
Q ~ 1.!1 h,
~p, U~P.l ~ IZ; U ~; ~ H ~: H
U ~ V ,~
V ~yi X U
U ~ .) ~ C~ :5 U
~ ~ ,~ r ~ ~ I ~ p
~. H ~ 3 U ~ c
~ ~ ---- ~ ~ U ~ U ~
O ~ ~ U ~ U ~ U JJ -I
~: o .. S~ ~ n E---H~
X ~ X ,~
U
E~ V
TA~ CTG AGG AAC AAC CAA CTA GTT GCT GGA TAC TTG C~A GGA CCA AAT 192
Tyr LQU Ar9 Asn Asn Gln Leu Val Ala Gly Tyr Leu Gln Gly Pro Asn
25 30 35
GTC AAT TTA GAA GAA AAG ATA GAT GTG GTA CCC ATT GAG CCT CAT GCT 240
Val A~n Leu Glu Glu ~y~ Ile ASP Val Val Pro Ile GlU Pro Hi~ Ala
~0 45 50 55
CTG TTC TTG GGA ATC CAT GGA GGG AAG A~G TGC CTG TCC TGT GTC AAG 288 r~
~eu Phe Leu Gly Ile ~is Gly Gly Lys Met Cys ~eu Ser Cy~ Yal ~y~ r~
60 65 70 C
TCT GGT GAT GAG ACC AGA CTC CAG CTG GA~ GCA GTT AAC ATC ACT GAC 336 r~
Ser Gly Asp Glu T~r Arg Leu Gln Leu Glu Ala Val Asn Ile Thr Asp
75 80 85
CTG AGC GAG AAC AGA AAG CAG GAC AAG CG~ T~C GCC TTC ATC CGC TCA 384
Leu Ser Glu Asn Arg Lys Gln A~p ~ys Arg Phe Ala Phe Ile Arg Ser
go 95 100
GAC AGT GGC CCC ACC ACC AGT TTT GAG TCT GCC GCC TG~ CCC ~GT TGG 432
Asp Ser Gly ~ro Thr Thr Ser Phe Glu Ser Ala Ala Cys Pro Gly Trp
105 110 115
TTC CTC TGC ACA GCG ATG GAA GCT GAC CAG CCC GTC AGC CTC ACC AAT 480
Phe Leu Cys Thr ~la Met Glu Ala Asp Gl~ Pro Val Ser Leu Thr Asn
120 12~ 130 135
ATG CCT GAC G~A GGC GTC ATG GTC ACC AAA TTC TAC TTC CAG GAG GAC 528 3
~et Pro Asp Glu Gly Val Met Val Thr ~ys Phe Tyr Phe Gln Glu A~p
140 145 150 ~g
GAG 5 31
Glu
WO 96/11277 ~ 2 0 1 1 2 I PCr/EP95/03921
5
s tn
:~ ~ ~ o ~n ~ o
H 1-1
.C: ~ ~ ~ S ~ ~ ~ S C~
U U~
-~ ~ O ~ ~ O O
¢
H ~ O O~
W ~Iq U E~
O ~ 0 ~ Z ~ ~ ~ ~ ¢
z ~ ~ o
,~ ' r O~
a t ~ " ., ~ ~ O ~ m ~ bg
a
O V ~ ~ O ~ ~ I ~I Ll~
~ ~ ~ O U
Z ~ E z ~ 0
~ ¢ ~ t~ O tJ~
O -- _ _
Z ~ X ~ Lq .C
b ~ Ln ~
WO 96/11277 2 ~ ~ 1 7 2 1 PCT/~9~,~3921
54
o o ,~
~1 ~1
~7
S~ ~q ~ O - :
h ~ r
,~ h ~ O
S
V~
o
~ Q) ~ ~2 V
U u~
U
O o ~I n ~ Cl
O
C 00 ~ E~ Z
U t5`
p~ Ll L
Ul ~ o
o uq
U O C7~
~O r.~ J
Ll O ~ '` ~ r'
a r ul~ o
x ~ q a I Q : ~ ~t
v ~ a ~ J " C~
o r a ~ L
tn
~0 ~ ;r~ ; a C3
o ~ ~ z z ~ ~ U~ h t ;1: 0 Z ~ I
S -~ o 1
o~ a ~
uq ~ o v.
O ~
O ~ ,~ c J
o a~ ~ z ~ t ~ x a ~ ,-
J
F~ ~ U
O ,~
WO96111277 22f~ T 721 PCT/EP95/03921
~n O
o
~ ~ o R" R -~ , C sc U ~c ,C ~, R
~, ~ ~ ~ ~, " ~ ~ G ~ R c ~ P
~ . ~ ~ ~ g ~ ; ~ , Z C~ " ,
~ 3 ~ a " 2 9~ a ~
~j V, X ~ V ~ ~ J~1
O ~ ~ ~` ~ ~ O
~ X Z _rl ~ X
V ~
WO 96/11277 2 2 U 1 7 2 i PCT/EP9~S/03921
56
o C~
~ to U~
~C
r~ g
~ U
C~ ~
. . C
a~
.. ~ Yl .. -I
r~ o ~ ~ o
~ Z _ U Z
U ~ ~ ~ ~ V
.. s~ ~ ~ o~ e _ o~
~ o -- L
O ~ 0 0.a,~ -- ' , , ~ _ ,c ~
r ~ U ~ U ~ J
a ~ o z ~ o z
H ~ L ~ ~ a ~ rJ
~ ~ ~ ~ ~ u z - .. .~ -
p ~ ~ ~ w o~ x ~ a ~ -~ x
~n ~ 4 D U~ ~tJ E~ ~ ~ 4 _ r,q ~ ~
~ O H ~ o ~ X a o u
4~o ~ ~ 5 ~ ~u ~ 2
U ~ ~ O ~ ~ U ~ V ~ ~- O
Z !Z ~ ~ 0 Z ~ ~ ~ æ ~ % o ~ ~
-. ~3 tJ H 1~ t ~ O W ~ H 1
~ ~ D ~ t~ H D ~_~ 3
~: ~ u a ~ H ~ o~ a
---- O ~ -- O ~,--
n :E o U~ o u~
C~ _ _ _ _ ~ o _ ~
z _ ~ X E~ Z ~ X
H -- `' -- ~ I' H --
N
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE C~ARAcTERIsTIcs:
(A) LENGT~: 126 ba~e pairs
(~) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA (genomic)
(vi) ORIGINAL SOURCE:
(A) ORG~NISM: ~actobacillus amylovorus
txi) SEQUENCE DESC~IPTION: SEQ ID NO: 8:
GCAAAAAAAT TTTCGATTTT TATGAAAACG GTTGCAAAGA AGTTAGCAAA AATATATAAT 60
~,~
~ GAA ATTGrTCACT TGGCCA~GCT GCAGTTTCAA TATTTTAATA A~GGGGGCAG 120 ~ C~
T~AAAA 126 ~~
(2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUE~CE C~ARACTE~ISTICS:
(A~ LENGTH: ~3 baqe pair~
(B TYPE: nucleic acid
(C STRA~DEDNESS: both
(Dl TOPO~OGY: both
(ii) MOLECULE TYPE: DNA (genomic)
(vi) ORIGINAL SOURCE:
(A) ORGA~ISM: Lactobacillus pento~us
-
WO 96111277 ') ') ~ `1 71~ PCTIEP95/03921
LL ~J I I L I
58
..
~ ~ ,1
O ~5 0
Z ~ Z
H
~ 1 0 --I tD ~ - - h 0
2~ 0 V~ W rl;.
~n C~ r ~ ~ ~ U ~ r ~'a tr~
U~ U~
Z ~ O J.; ~ ~ 0 OJ ~7 A O J~
o ~ 5 o ~ ~ z --~ ~ c
~ Z ~ U - ~: z
~ ~ . a ~ I o ~ L ~ ' a
CJ H ~ 0 V~ Z 5 L ~_ H - C~
a , ~ v z - - - u - ~ ~ o~ , ~ c~ z .. ..
J ~ P~ a ~
~ U 4 ~ V, O V) ~ C ~ 0 4
EL1 ~ X ~ ~ ;d ~ W ~ ~0
g ~ W ~
h! ~ O ~ t ~ Z Z ~ æ ~ E
u a ti ~ r ~ CJ â O
J. ~ n
-- ~ o ~
r~ z ~ X ~ Z ~ ~--
d
22~ 1 72 1
WO 96/11277 PCTtEP9~103921
-
N ~
O :~
c ~ u~ a
_, ~ o h ~ a~ a
v . ~ ~ ~ O ~ O~ U ~ e
U r ~ ~ H - C U~ H
X ~ ~ ~ a ~
g Ul U~ e! C 1~ ~ 4 4 g U~ U ' ~.q
Z~ t Z. ~P U
Z O ;~ Z Z ~ E-l cn ~ ~ ~ H ~ ~ o
â , ~ P ~ H
X ~ ~ X ~ Z
~ _
WO 96/11277 PCI/EP95/03921
22~1 72`~
.. rl
0 2:
a ~n H U
~r~ ,. W
1 U ~ ~ rn ~c'
a 0 ~d ~ Z O ~ z
O ~ Z ~ ~ --
- C ~ ~ ~ -I r ~ V ~ ~. Z J~
L ~ r U)-rT C ~ O ''I a ~ a I o ~
r~ ~ r U~ ~ V æ
S ~ V ~. 4 P u~ ~. J u~
o ~ ~ o ~ ~ a o ~ ~ o ~ ~
u ~ a ~ O ~ E~ O E~
Z ,4 ~ o ~ W ~, ~ W ~ ~ ~ o t~ z ~ W
Z- Z o ~ 0 3
OJ~ ~ U a ~ o~ CY~ U a ~ ¢ C~ ~
C ~ ------ C ~ ~-- W
u~ :E ~ O cn ~ ~n ~
X ~ X ~~ T ~ ~ X
U -- ~
WO 96/11277 2 2 ~ 1 -1 2 1 PCI/EP95/03921
_
61
O a~
r ~D r ~
~ u
f 1~1
E- t
~ 3
o Z ~`
a, H U ~ ¢
t) ~ U r9 ~ ~ z
Ot U nl t~ ~r `I Z ~' O J~ 0 ,~
r ~ ~, .. C Z J E~ ~ I ~ U
a Q~r u~ r n o ~
H~ ~r n _ t~ u. :~: 4 , ~ 00 C~ rl Z _ ~ J
a ~ z- ~ J a r~ Z~ ~
a Q G ~ ~ O ~ ~ .~ Q ~ ~4 a t,
t U~ ~ a ~ O E~ w
~ ~ ~4 ~ ~4 ~ ~ t~ U kl P~
t
Ot ~ -t1 P~ V a
X ~ O-- ~ E~ ~---- 't -3
r~ .r~ t
~ ~ ~ ~ X Z; _ _ X
~) ~ t~ ~
