Note: Descriptions are shown in the official language in which they were submitted.
CA 02203629 1997-04-24
W O96/12737 PCTrUS95/13682
Compositions and Tr~tment for Multiple Sclerosis
5 Related Applications
This application is a continuation-in-part of USSN 08/328,224 filed October
25, 1994. This application is also a continuation in part of USSN 08/300,811 filed
September 1, 1994 which is a continuation-in-part of USSN 08/116,824 filed
September 3, 1993. This application is also a continuation-in-part of USSN
08/241,246 filed May 10, 1994. The above applications are hereby incorporated
herein by reference in their entirety.
Back,eround of the Invention
Autoimmune diseases are a significant human health problem and are
15 relatively poorly understood. As there is no microbial or viral culprit apparently
directly responsible, prevention, treatment and diagnosis of such diseases must be
based on the etiology of the disease. This invariably involves a complex series of
reactions of endogenous metabolic intermediates, structural components, cells and so
forth. Implicit however in the nature of an autoimmune condition is the notion that at
20 least one autoantigen must be involved in creating the sequence of events that results
in the symptoms. Autoimmune demyelinating diseases such as multiple sclerosis are
no exception.
MS usually presents in the form of recurrent attacks reflecting lesions within
the central nervous system (CNS). Attacks recur, remit and recur, seemingly
25 randomly over many years. The frequency of flare-ups is greatest during the first 3 to
4 years of disease, but a first attack, which may have been so mild as to have escaped
medical attention and can barely be recalled, may not be followed by another attack
for 10-20 years. The extent of recovery after an episode varies markedly betweenpatients. Remission may be complete, particularly after early attacks; often, however
30 remission is incomplete and as one attack follows another. a stepwise downward
progression ensues with increasing permanent deficit. The clinical picture of MS is
determined by the location of foci of demyelination within the CNS. Classic features
include impaired vision, nystagmus, dysarthria, decreased perception of vibration and
position sense, ataxia and intention tremor, weakness or paralysis or one or more
35 limbs, spasticity and bladder problems. Criteria for diagnosis of clinically definite
MS must include a reliable history of at least two episodes of neurological deficit and
CA 02203629 1997-04-24
wo 96/12737 PCrlUS95/13682
objective clinical sign of lesion at more than one site within the CNS. No effective
treatment for MS is known. Present therapeutic efforts are directed towards
amelioration of the acute episode and prevention of relapses or progression of the
disease. (Harrison's Principles of Internal Medicine, 12th Edition, Vol. 2, pp. 2038-
2043, McGraw Hill, 1991)
A commonly used animal model for human multiple sclerosis is experimental
allergic encephalomyelitis (EAE), a demyelinating disease of the central nervoussystem which can be induced in susceptible strains of mice by immunization with
myelin basic protein (MBP), proteolipid protein (PLP), myelin oliogodendrocyte
protein (MOG), or synthetic peptides based on the sequences of these myelin
associated proteins. MBP is one of the presumed autoantigens in multiple sclerosis
(MS) and has been epitope-mapped in both human (Ota et al., Nature, 346:183-187
(1990)) and rodent (Zamvil et al., Nature, 324:258-260 (1986)) systems. Peptideswhich are believed to comprise at least one T cell epitope of MBP (myelin basic
protein), have been identified in WO 93/21222, EP 0 304 279, WO 91/15225, Ota etal, Letters to Nature, 346: 183- 187 (1990), Wucherpfennig et al., J. Exp. Med.,170:279-290 (1994). Other MBP T cell epitope-containing peptides have been
identified in applications which are incorporated in their entirety herein by reference
U.S.S.N. 08/328,224 filed on October 25, 1994 and U.S.S.N. 08/241,246 filed on May
10, 1994. MOG peptides having T cell activity have been identified in USSN
08/300,811 incorporated by reference herein.
Proteolipid protein (PLP) and myelin associated glycoprotein (MAG) have
also been implicated as possible autoantigens in multiple sclerosis. Studies describing
the pathogenesis of the autoimmune response to PLP in multiple sclerosis have been
described in Trotter et al., J. Neuroimmunol., 33:55-62 (1991); T cell epitopes of PLP
have been described in Pelfrey et al., J.Neuroimmunol., 46:33-42 (1993). Studiesdescribing MAG as a potential autoantigen in multiple sclerosis are described inJohnson et al., J. Neuroimmunol., 13:99-108 (1986).
Experimental autoimmune encephalomylitis (EAE) is a CD4+ T cell-mediated
autoimmune disease which resembles multiple sclerosis in some of its clinical and
histological features, and serves as an experimental model for this and other
autoimmune diseases. EAE is an inflammatory disease of the central nervous system,
resulting in paralysis and other neurologic abnormalities. It is typically induced with
purified myelin proteins and peptides. Nevertheless, the EAE model has been usedextensively to examine mechanisms of autoimmunity, and to investigate potential
therapeutics for autoimmune disease.
CA 02203629 1997-04-24
W O 96/12737 PCTAUS95/13682
As early as 1965, the observation was made that EAE could be treated by
~lmini.stration of MBP in a non-encephalitogenic form, presumably by the induction
of immunological non-responsiveness, or tolerance (Alvord, E.C., et al., Ann. NYAcad Sci., 1965, 122:333, Levine, S.E., et al., Science, 1968, 161:1155, Bernard, C.C.
A., 1977 Clin. Exp. Immunol., 1977, 29:100). This early observation has been
extended over the past several years, with a number of investigators showing that
neonatal or adult ~lmini.ctration of MBP and MBP peptides prevents EAE (Bernard,C.C. A., 1977 Clin. Exp. Immunol., 1977, 29:100, Clayton, J.P., et al., J. Exp. Med.,
1989, 169:1681, Smilek, D.E., et al., Proc. Nat'l. Acad. Sci., 1991, 88:9633, Guar, A.,
et al., Science, 1992, 258: 1491, Metzler, B. et al., Int. Immunol, 1993, 5: 1159, Miller,
A., et al., J. Neuroimmunol., 1993, 46:73, Critchfield, J.M., et al., Science, 1994,
263: 1139, Miller, A., et al., Proc. Nat'l. Acad. Sci., USA, 1992, 89:421). These
studies suggest various routes of ~lmini~tration which include subcutaneous,
intraperitoneal, intranasal, intravenous, and oral. Induction of immunological non-
responsiveness in adults ~nim~l~ with intravenous peptides has been demonstrated in a
variety of antigen systems. For many of the reasons described herein, there are limits
to the clinical applicability of oral, enteral or aerosol administration of autoantigens
such as an inability to characterize the active component of a therapeutic composition
once introduced in the stomach due to subsequent enzymatic degradation in the
stomach. Thus, predictable and reproducible therapeutic effects may be difficult to
achieve using these methods, not to mention the potential for adverse side effects as a
result of the body's further processing of the therapeutic which may not be predictable.
The mechanism of disease prevention or tolerance induction in most of these
examples has been attributed to clonal anergy (Gaur et al., supra), peripheral deletion
(Critchfield, et al. supra), or other forms of antigen-specific tolerance. However,
TGF-~-mediated bystander suppression appears to be an additional mechanism by
which orally ~dmini.~tered MBP and MBP peptides may inhibit EAE (Miller et al.,
supra at Proc. Nat'l Acad. Sci.). MBP peptides as well as substituted MBP peptide
analogs have been examined as alternative therapeutics for EAE in PLJ, B lO.PL, and
(PLJ x SJL) Fl mice. MBP Acl-l l is the immunodominant encephalitogenic peptide
for each of these strains, and is recognized bound to AaUA~u (Wraith, D.C. et al.,
supra). MBP Acl-l l has been studied extensively by substitution analysis, and its
requirements for T cell recognition and major histocompatibility complex (MHC)
binding have been well established. Side chains of residues 3 and 6 contribute mainly
to T cell recognition, while those of residues 4 and 5 contribute mainly to MHC
binding. Binding of MBP Acl-l l to AaUA~u can be dramatically improved by a
CA 02203629 1997-04-24
W O96/12737 PCTrUS95/13682
variety of amino acid substitutions at residue 4, including alanine (Acl-11 [4A]) and
tyrosine (Ac l - 11 [4Y]) (Wraith, D.C. et al., supra, Fairchild, P.J. et al., Int. Immunol.,
1993, 5:1151). The residue 4 substitutions, especially with tyrosine, appear to
improve the stability of the peptide-MHC complexes formed with these peptides.
Ac l - 11 [4A] and Ac l - 11 [4Y] retain the T cell receptor (TCR) contact residues
necessary for antigenicity, and are more potent than MBP Ac l - 11 in stimulating
MBP-specific T cells in vitro. Ac l - 11 [4Y] is also encephalitogenic in vivo (Ac l -
I l [4A] is poorly encephalitogenic, for unknown reasons). Both Ac l - 11 [4A] and Ac l -
I l [4Y] have been shown to prevent EAE, and are thought to operate by antigen-
specific mechanisms (Smilek, et al, supra, Wraith, D.C. et al., supra).
In previous studies, MBP peptides or peptide analogs ~mini.~tered in
incomplete adjuvant just prior to disease onset prevented subsequent development of
EAE (Smilek, et al, supra, Gaur et al., supra). In a separate study using Iymphocytes
from an MBP-specific TCR transgenic mouse, adoptively transferred EAE was
prevented by early and aggressive ~tlmini~tration of intravenous MBP prior to the
onset of clinical signs (Critchfield, et al. supra). These studies indicated that it may
be possible to prevent EAE by injecting MBP peptides after encephalitogenic T cells
have been activated, but did not address the issue of whether ongoing paralysis (and
presumably active central nervous system infl~mm:~tion) could be reversed, or
relapses following remission could be prevented, using this approach. Moreover, in
some of the previous experiments by others, frequent aAmini.~tration of extremely
large doses of MBP or MBP peptide were required for effective treatment. The
present inventors were the first to describe reversal of paralysis as well as prevention
of relapses following remission in their previous case, USSN 08/328,224 filed
October 25, 1994, which has been continued herein. Since the filing of the present
inventor's previous case, others working in the field have also been surprised to find
that injection of certain MBP derived peptide analogs could reverse ongoing paralysis
in EAE (Karin et al., J. Exp. Med., 180:2227-2237 (Dec. 1994)).
The present invention overcomes the drawbacks described above and provides
novel peptides, compositions and methods for treating multiple sclerosis, using
preparations comprising at least one peptide having a sequence of amino acid residues
which comprises T cell activity of MBP. Further, the present invention addresses the
yet unsolved problem that, in order to be generally applicable, treatments for multiple
sclerosis using peptides or peptide analogs must be effective even when administered
late in the course or at an advanced stage of disease, either during remissions or
relapses while the undesirable immune response is ongoing.
CA 02203629 1997-04-24
wo 96tl2737 PCT/US95/13682
Accordingly, it is an object of the present invention to provide peptides and
combinations of peptides suitable as a therapeutic for multiple sclerosis including
prevention of the onset of the disease. It is yet another object of this invention to
identify prophylactically and therapeutically effective dosage regimens and modes of
~(lminictration of identified proteins, peptides and peptide analogs for effective
treatment of MS. It is still another object of this invention to identify treatment which
successfully treats late stage MS, prevent relapses, arrest disease and/or reverse the
progression of MS.
Summary of the Invention:
The present invention provides isolated peptides and combinations of peptides
derived from myelin autoantigens such as MBP, MOG, PLP, and MAG suitable for
treating multiple sclerosis, including prophylactic and therapeutic compositions and
methods for preventing or treating multiple sclerosis. Preferred compositions of the
invention comprise at least one isolated, purified peptide, substantially free from all
other polypeptides or cont~min~nts, the peptide comprising an amino acid sequence of
the myelin autoantigen which has T cell activity. A therapeutic composition of the
invention is capable of down regulating the autoantigen specific immune response to
the myelin autoantigen in a popu1ation of humans suffering from, or susceptible to
multiple sclerosis, such that disease symptoms are reduced, e]imin~ted, or reversed
and/or the onset or progression of disease symptoms is prevented or slowed.
Additionally, compositions and methods of the instant invention when ~(lminictered in
an advanced stage of disease, reverse ongoing para]ysis or other signs of disease when
~rlmini.stered during the acute phase of disease or prevents re]apse when administered
during remission.
Brief Description of the Drawin,es
Fig. I shows the ful] length amino acid sequence of human MBP, also
indicating the numbering of amino acid residues as referred to herein.
3Q Fig. 2 shows the amino acid sequence of preferred peptides derived from MBP.
Fig. 3 shows the amino acid sequence of overlapping peptides as well as
longer peptides used in Example 1.
Fig. 4a is a graphic representation of the percent of total MBP response for
each peptide shown in Fig. 3. MBP reactivity was calculated based on the percent of
MBP positive microtiter cultures in each group of individual patients which also
CA 02203629 1997-04-24
W O 96tl2737 PCT~US95/13682
scored positive for one of the MBP peptides. Total MBP positive microtiter cultures
ranged from 89- 184 in each group of 19-43 patients tested for each peptide.
Fig. 4b is a graphic representation of the percent of MBP responders which
recognize each peptide shown in Fig. 3. Patients were considered to MBP responders
S if at least one of their microtiter cultures scored positive for MBP reactivity. There
were 12-31 MBP responder patients in each group of 19-43 patients tested for each
peptide. Peptide reactivity was calculated based on the percent of MBP responderpatients in each group with at least one microtiter culture which scored positive for
one of the MBP peptides.
Fig. Sa is a graph of mean clinical scores over a period of 0-40 days after
disease induction of mice treated with I.V. injections of MBP Acl-11 alone compared
to a control.
Fig. Sb is a graph of mean clinical scores over a period of 0-40 days after
disease induction of mice treated with I.V. injections of MBP Ac l - 11 combined with
l S MBP 31 -47 compared to a control.
Fig. Sc is a graph of mean clinical scores over a period of 0-40 days after
disease induction of mice treated with I.V. injections of OVA 323-339 compared to a
control.
Fig. 6a is a graph of the mean clinical scores over a period of 0 to at least 30days after disease induction of subjects treated with either 250 nmol injection of Ac l -
11 [4Y] or Ac 1 - 11 as compared to a control.
Fig. 6b is a graph of the mean clinical scores over a period of 0 to at least 30days after disease induction of mice treated with 2.5 nmol Ac l - 11 [4Y] as compared to
a control.
Fig. 6c is a graph of the mean clinical scores over a period of 0 to at least 30days after disease induction of mice treated with 2.5 nmol Ac I - 11 as compared to a
control.
Fig. 7 is a bar graph showing the mean histological scores of peptide treated
mice versus control treated mice where a lower score means a reduced number and
severity of infl~rnm~tory CNS infiltrates.
Fig. 8 is a bar graph representing relative T cell activation at periods of 0- 10
hours after mice were injected with 250 nmol. Ac l - 11 [4Y] .
Fig. 9 is a graph showing a comparison of treatment of mice with 250 nmol
Ac l- 11 [4Y] versus a control, PBS and OVA 323-337.
Fig. 10 is a graph showing a comparison of treatments initiated during
remission with 25 nmol Ac l-11 [4Y] versus a control.
CA 02203629 1997-04-24
wo 96/12737 PCTtUSgS/13682
Fig. 11 a is a graph representing in vitro Iymph node proliferation (as indicated
by 3H-thymidine incorporation) of mice receiving I.V. pretreatment with 250 nmoles
MBP Ac l - 11 compared to controls.
Fig. 1 lb is a bar graph showing relative Iymph node IL2 production in
response to MBP Ac 1 - 11 in mice pretreated with Ac 1 - 11 [4Y] as compared to a
control.
Fig. 12a is a graphic depiction of an experiment showing the effects of IFN-,B
on EAE in two groups of 10 (SJL x TLP) Fl adult female mice in which EAE was
induced with guinea pig MBP in complete adjuvant plus pertussis toxin on day 0 and
were ~minictered either incomplete Freund's Adjuvant only (control) or were treated
with 2000 units of IFN-~ interperitoneally (i.p.) on days 9, 12, 16, and 20 (indicated
by arrows on the x axis), the Y axis represents the mean clinical score (MCS) for each
group, 0=no clinical signs of EAE, l=limp, unresponsive tail, 2=partial hind limb
paralysis, 3=complete hind limb paralysis, 4=partial to complete forelimb paralysis
and 5=moribund.
Fig. 12b is a graphic depiction of an experiment showing the effects of MBP
peptide Ac 1 - 11 in two groups of 10 (SJL x TLP) F 1 adult female mice induced with
EAE using guinea pig MBP in complete adjuvant plus pertussis toxin on day 0 and
were ~rlmini~tered either PBS (control) or were treated with 250 nmol Ac 1-11
intravenously on days 10, 13, 17, and 21 (indicated by arrows on the x axis), the Y
axis represents the average mean clinical score for each group as described for Fig. 1 a.
Fig. 12c is a graphic depiction of an experiment showing the effects of MBP
peptide Ac 1-11 ~-lmini.~tered in combination with IFN-~ on EAE in two groups of 10
(SJL x TLP) F1 adult female mice who were induced EAE in complete adjuvant plus
pertussis toxin on day 0 and were atlmini~tered either PBS (control) or were treated
with 250 nmol Ac 1 - 11 intravenously on days 10, 13, 17, and 21 (indicated by open
arrows on the x axis), and were treated with 2000 units of IFN-~ interperitoneally
(i.p.) on days 9, 12, 16, and 20 (indicated by closed arrows on the x axis), the Y-axis
indicates the mean clinical score as discussed for Fig. 1 a.
Fig. 13 is a graphic depiction of an experiment showing the effects of various
dose of IFN-~ (10,000 units and 2,000 units respectively) on induced EAE in two
groups of 10 (SJL x TLP) F1 adult female mice induced with EAE using guinea pig
MBP plus pertussis toxin on day 0 and were administered either PBS (control) or
were treated with 10,000 units and 2000 units respectively of IFN-,B interperitoneally
(i.p.) on days 9, 13, 16, (indicated by closed arrows on the x axis), the Y-axis indicates
the mean clinical score as discussed for Fig. la.
CA 02203629 1997-04-24
wo 96/12737 PCr/US95/13682
Fig. 14 shows various peptides derived from MBP which may be suitable in
compositions and methods of the invention.
Fig. 15 is a graphic representation of the positivity index (y axis) (the average
S.I./MBP responder patient) multiplied the percentage of individuals responding to
each peptide (x-axis) which is derived from the same experimental data shown in
Figs. 4a and 4b and described in Example 1.
Detailed Description of the Invention
The patent and scientific literature referred to herein establishes the knowledge
10 that is available to those with skill in the art. The issued U.S. patents, PCT
publications, and other publications cited herein are hereby incorporated by reference.
The present invention provides isolated peptides and combinations thereof
derived from myelin autoantigens useful for treating multiple sclerosis as well as
therapeutic compositions and methods for treating multiple sclerosis. As used herein
15 the term "treating multiple sclerosis" includes: prophylactic treatment of those
m~mm~l.c susceptible to MS; treatment at the initial onset of MS; and treatment of all
"advanced stage" MS including relapsing-remitting MS, chronic progressive MS,
primary progressive MS and benign MS. Therapeutic compositions of the invention
comprise at least one purified peptide, substantially free from all other proteins or
20 cont~min~nts, and comprising a defined sequence of amino acid residues of a myelin
antigen having T cell stimulating activity, which peptide may also be an isolated
peptide. As used herein, the term "isolated" refers to a peptide which is free of all
other polypeptides, con~min~nts, starting reagents or other materials~ and which is
unconjugated to any other molecule.
In accordance with this invention, a "peptide" refers to a defined sequence of
amino acid residues which is less than the amino acids of the native protein antigen.
A peptide of the invention preferably comprises at least approximately seven amino
acid residues in length, and preferably at least about 12-40 amino acid residues in
length, and more preferably at least 13-30 amino acid residues in length and which,
30 when derived from a protein antigen, contains less than the amino acids of the entire
protein antigen and preferably no more than about 7557c of the amino acid residues of
the entire protein antigen. Peptides used in accordance with the invention have T cell
activity. A peptide having "T cell activity" may possess any one or more of the
following characteristics: a) the ability to elicit a T cell response, such as stimulation
35 (i.e. proliferation or Iymphokine secretion); b) the ability to cause T cell non
responsiveness or reduced T cell responsiveness of applopliate T cell subpopulations
CA 02203629 1997-04-24
wo 96/12737 Pcr/uS9Stl3682
such that they do not participate in stimul~ting an immune response to the offending
autoantigen (e.g. via anergy, tolerance, or apoptosis); c) the ability to modify the
Iymphokine secretion profile as compared with exposure to the naturally occurring
autoantigen; d) the ability to cause induction of T suppressor cells; and e) is capable of
5 causing down regulation of autoimmune disease symptoms by any mech~ni~m; or f) is
derived from a bystander antigen and possesses the ability to elicit suppressor T cells
at the site of myelin autoimmune attack which in turn results in down regulating the
immune responses in the locality of the myelin autoimmune attack.
Peptides comprising at least one T cell epitope have T cell activity and are
10 capable of eliciting a T cell response such as T cell stimulation (i.e. T cell
proliferation or Iymphokine secretion) and/or are capable of down regulating theautoantigen specific T cell response which may result in autoantigen specific T cell
non-responsiveness or a reduced level of autoantigen specific T cell responsiveness.
A T cell epitope is the basic element or smallest unit of recognition by a T cell
15 receptor, where the epitope comprises amino acids essential to receptor recognition. T
cell epitopes are believed to be involved in the initiation and perpetuation of the
immune response to an antigen or autoantigen. These T cell epitopes are thought to
trigger early immune response events at the level of the T helper cell by binding to an
appropliate HLA molecule on the surface of an antigen presenting cell and stimulating
20 the relevant T cell subpopulation. These events lead to T cell proliferation,Iymphokine secretion, local infl~mm~tory reactions, recruitment of additional immune
cells to the site, and activation of the B cell cascade leading to production ofantibodies. In the case of an autoimmune disease, the antibodies produced are
autoantibodies against an autoantigen such as MBP resulting in the clinical symptoms
25 of an autoimmune disease.
Peptides having defined amino acid compositions and which comprise T cell
epitopes may be identified for any myelin autoantigen, including MBP. One methodincludes dividing the protein antigen into non-overlapping, or overlapping peptides
of desired lengths and synthesizing, purifying and testing those peptides to determine
30 whether the peptides comprise at least one T cell epitope of MBP using any number
of assays (i.e. T cell proliferation assays, Iymphokine secretion assays, and T cell
non-responsiveness studies). In another method an algorithm is used for predicting
those peptides which are likely to comprise T cell epitopes and then synthesizing,
purifying and testing the peptides predicted by the algorithm in T cell assays or in
35 vivo studies to determine if such predicted peptides cause T cell proliferation or
Iymphokine secretion, or T cell non-responsiveness and are therefore likely to
CA 02203629 1997-04-24
wo 96112737 PCr/US95/13682
contain T cell epitopes. As discussed in many of the documents cited above, human
T cell activity can be tested by culturing T cells obtained from an individual sensitive
to an autoantigen such as MBP with a peptide derived from the antigen and
determining whether proliferation of T cells occurs in response to the peptide as
5 measured, e.g., by cellular uptake of tritiated thymidine. Stimulation indices for
responses by T cells to peptides can be calculated as the maximum counts per minute
(CPM) in response to a peptide divided by the control CPM. A T cell stimulation
index (S.I.) equal to or greater than two times, and preferably three times, thebackground level is considered "positive". Positive results are used in the analysis of
10 a peptides potential therapeutic effectiveness as discussed later herein and in
Example l. Preferred peptides useful in accordance with this invention comprise at
least one T cell epitope and preferably at least two or more T cell epitopes.
One algorithm for predicting peptides having T cell stimulating activity is
reported in Rothbard, I st Forum in Virology, Annals of the Pasteur Institute, pp 518-
526 (December, 1986), Rothbard and Taylor, Embo, 7:93-100 (1988), and EP 0 304
279. These documents report defining a general pattern (algorithm) for binding of a
peptide to class II MHC, its statistical significance and the correlation of the pattern
with known T cell epitopes as well as its successful use in predicting previously
unidentified T cell epitopes of various protein antigens and autoantigens. The general
20 pattern for a peptide known to bind Class II MHC well as reported in the above-
mentioned documents appears to contain a linear pattern composed of a charged
amino acid residue or glycine followed by two hydrophobic residues. After
determining if a peptide conforms to the general pattern~ the peptide can then be tested
for T cell reactivity. Other algorithms that have been used to predict T cell epitopes of
25 previously undefined proteins include an algorithm reported by Margalit et al., J.
Immunol.. 138:2213-2229 (1987), which is based on an amphipathic helix model.
Additionally peptides comprising "cryptic T cell epitopes" may be determined
and are also useful in the methods and compositions of the invention. Cryptic T cell
epitopes are those determinants in a protein antigen which, due to processing and
30 presentation of the native protein antigen to the appropriate MHC molecule, are not
normally revealed to the immune system. However, a peptide comprising a cryptic T
cell epitope is capable of causing T cells to become non-responsive, and when a
subject is primed with the peptide, T cells obtained from the subject will proliferate in
vitro in response to the peptide or the protein antigen from which the peptide is
35 derived. Peptides which comprise at least one cryptic T cell epitope derived from a
protein antigen are referred to herein as "cryptic peptides". To confirm the presence
CA 02203629 1997-04-24
W 096tl2737 PCTrUS95113682
11
of cryptic T cell epitopes a T cell proliferation assay may be used as is known in the
art in which antigen primed T cells are cultured in vitro in the presence of each
peptide separately to establish peptide-reactive T cell lines. A peptide is considered to
comprise at least one cryptic T cell epitope if a T cell line can be established with a
5 given peptide and T cells are capable of proliferation upon challenge with the peptide
and the protein antigen from which the peptide is derived.
In addition, it is not necessary that a peptide used in accordance with the
method of this invention be derived from the amino acid sequence of the myelin
autoantigen such as MBP. Any peptide comprising a defined sequence of amino acid10 residues and which is capable of down-regulating an antigen specific immune
response to the myelin autoantigen may be used in accordance with the method of the
present invention. For example, peptides may be synthesized comprising a definedamino acid sequence not based on the myelin antigen amino acid sequence, and yetare capable of down regulating an antigen specific immune response e.g. the peptide
15 mimics a T cell epitope of the myelin autoantigen and causes down regulation of the
immune response to the myelin autoantigen, or causes down regulation of the immune
response for another reason, such as it is derived from a bystander antigen. Without
being limited to any theory, it is believed that bystander antigens, which are also tissue
specific (but are not the target of immune or autoimmune attack) may possess the20 ability to elicit suppressor T cells at the site of immune attack which may in turn result
in down regulating the immune responses in the locality of the immune attack (e.g.
afflicted "self" tissue in the case of autoimmune disease or nasal mucosa, skin and
lung in the case of allergy). Bystander antigens include but are not limited to portions
of the antigen or autoantigen which are not themselves the target of immune attack,
25 and which possess suppressive activity at the site of immune attack. As used herein,
the terms "myelin antigen" or "myelin auLoantigen" includes bystander antigens which
may possess suppressive activity at the site of mye!in autoimmune attack.
In addition, any compound that mimics a peptide capable of down regulating
an antigen specific immune response to a myelin autoantigen may be used in
30 accordance with the invention (e.g. a peptidomimetic). Such a compound may not be
composed entirely of subunits joined by peptide bonds, but joined by other linkages
(e.g. thiolester bonds, reduced bond analogs, amide bond isosterases), providing that
the non-peptide compound mimics a peptide capable of down regulating an antigen
specific immune response to the antigen of interest as indicated by effective
35 therapeutic/prophylactic treatment of symptoms. Peptidomimetics may be based on
any of the peptides of the invention but may include for example, peptide bond
CA 02203629 1997-04-24
W O96/12737 PCTrUS95/13682
12
analogs (e.g. N-methyl amide bonds NH Ca2[-CO-NCH3-]Cal ) and reduced bond
analogs (NH-Ca2[-CH2-NH-]CoCI)) in place of one or more normal peptide bonds.
Once T-cell epitope-containing peptides have been identified, it is also
possible to modify the structure of such peptides for use in accordance with the5 present invention for such purposes as increasing solubility (particularly desirable if
the composition is to be injected), enhancing therapeutic or preventative efficacy (see
discussion of peptide analogs having enhanced MHC binding below), or stability
(e.g., shelf life ex vivo, and resistance to proteolytic degradation in v ) or for ease of
peptide synthesis. A modified peptide or peptide analog can be produced in which the
10 amino acid sequence has been altered as compared to the native protein sequence from
which it is derived, or as compared to the unmodified peptide from which the
modified peptide is to be derived, such as by amino acid substitution, deletion, or
addition, in order to modify immunogenicity, improve peptide solubility or increase
the ease of peptide synthesis (e.g. automated peptide synthesis).
For example, a peptide can be modified so that it at least maintains, if not
improves, the ability to down regulate the autoimmune response in MS (e.g. by
inducing T cell non-responsiveness or reduced T cell responsiveness) and still retains
the ability to bind MHC proteins. In this instance, critical binding residues for the T
cell receptor can be determined using known techniques (e.g., substitution of each
20 residue and determination of the presence or absence of T cell reactivity). Those
residues shown to be essential to interact with the T cell receptor can be modified by
replacing the essential amino acid with another, preferably similar amino acid residue
(a conservative substitution) whose presence is shown to enhance, (limini~h but not
elimin~t~ or not affect T cell activity. In addition, those amino acid residues which
25 are not essential for T cell receptor interaction can be modified by being replaced by
another amino acid whose incorporation may enhance. diminish but not elimin~te or
not affect T cell activity but does not elimina~e binding to relevant MHC.
Additionally, peptides of the invention can be modified by replacing an amino acid
shown to be essential to interact with the MHC protein complex with another,
30 preferably similar amino acid residue (conservative substitution) whose presence is
shown to enhance, diminish but not eliminate or not affect T cell activity. In addition,
amino acid residues which are not essential for interaction with the MHC proteincomplex but which still bind the MHC protein complex can be modified by being
replaced by another amino acid whose incorporation may enhance, not affect, or
35 tliminish but not eliminate T cell reactivity. Preferred amino acid substitutions for
non-essential amino acids include, but are not limited to substitutions with alanine,
CA 02203629 1997-04-24
wo 96/12737 PCTIUSg5/13682
glutamic acid, or a methyl amino acid. In one example, WO 94/06828 describes
substituted peptides in which essentially every amino acid residue may be substituted
with a conservative amino acid, an amino acid not found in nature, or alanine, and yet
the substituted peptide is still capable of down regulating an antigen specific immune
response. In another example Karin et al. J. Exp. Med. 180:2227-2237 (1994)
describe studies using analogs of an immunodominant rat epitope of MBP having the
amino acid sequence of 87-99 as shown in Fig. 14. The analogs were a series of 13
substituted peptides based on the 87-99 sequence that differed from the original 87-99
peptide by a single alanine substitution at each position along the 87-99 peptides.
10 These studies were designed to show putative sites where the immunodominant
peptide interacts with MHC and TCR in the Lewis rat as well as elucidate modified
peptides having improved desired characteristics for potential therapeutic use. These
studies showed that substituting the Iysine (K) at position 91 of the 87-99 peptide with
alanine (A) (see, 87-99[K>A] in Fig. 14) prevented and reversed EAE in Lewis rats.
15 Based on this information one would expect that substituting alanine (A) for Iysine
(K) at the only Iysine(K) present in peptides which contain the 87-99 sequence within
their amino acid sequences i.e. MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4,
MBP-2.5, and MBP-2.6, all as shown in Fig. 2, would also result in increased T cell
activity of the substituted peptides. For example MBP-2.1 substituted with alanine
20 (A) for the Iysine (K) at position 10 of the MBP-2.1 peptide (i.e.
DENPVVHFFANIVTPRTPPPSQGK) may have enhanced T cell activity resulting in
enhanced therapeutic plo~el~ies as compared to the "parent" MBP-2.1 peptide.
In order to enhance stability and/or reactivity, peptides can also be modified to
incorporate one or more polymorphisms in the amino acid sequence of the protein
25 antigen resulting from natural allelic variation. Additionally, D-amino acids, non-
natural amino acids or non-amino acid analogs can be substituted or added to produce
a modified protein or peptide within the scope of this invention. Furthermore,
peptides of the present invention can be modified using the polyethylene glycol (PEG)
method of A. Sehon and co-workers (Wie et al. supra) to produce a protein or peptide
30 conjugated with PEG. In addition, PEG can be added during chemical synthesis of a
protein or peptide of the invention. Modifications of peptides or portions thereof can
also include reduction/ alkylation (Tarr in: Methods of Protein Microcharacterization,
J.E. Silver ed. Humana Press, Clifton, NJ, pp 155- 194 (1986)); acylation (Tarr.supra); chemical coupling to an appropriate carrier (Mishell and Shiigi. eds., Selected
35 Methods in Cellularlmmunolog~, WH Freeman, San Francisco, CA (1980); U.S.
CA 02203629 1997-04-24
WO96112737 PCT~US95/13682
14
Patent 4,939,239; or mi]d formalin treatment (Marsh Inten~ational Archives of Allergy
and Applied Immunology, 41:199-215 (1971)).
To facilitate purification and potentially increase solubility of proteins or
peptides of the invention, it is possible to add reporter group(s) to the peptide
5 backbone. For example, poly-histidine can be added to a peptide to purify the peptide
on immobilized metal ion affinity chromatography (Hochuli, E. et al.,
Bio/Iechnology, 6:1321-1325 (1988)). In addition, specific endoprotease cleavagesites can be introduced, if desired, between a reporter group and amino acid sequences
of a peptide to facilitate isolation of peptides free of irrelevant sequences. To
10 potentially aid proper antigen processing of T cell epitopes within a peptide, canonical
protease sensitive sites can be recombinantly or synthetically engineered between
regions, each comprising at least one T cell epitope. For example, charged amino acid
pairs, such as KK or RR, can be introduced between regions within a peptide during
recombinant construction of the peptide. The resulting peptide can be rendered
15 sensitive to cathepsin and/or other trypsin-like enzymes cleavage to generate portions
of the peptide containing one or more T cell epitopes.
Another example of a modification of peptides is substitution of cysteine
residues preferably with serine, threonine, leucine or glutamic acid to minimi7lo
dimerization via disulfide linkages. In addition peptides may be modified to increase
20 the solubility of a peptide for use in buffered aqueous solutions such as
pharmaceutically acceptable carriers or diluents by adding functional groups to the
peptide, terminal portions of the peptide, or by not including hydrophobic regions in
the peptides. For example, to increase solubility, charged amino acids or charged
amino acid pairs or triplets may be added to the carboxy terminus or amino terminus
25 or both, of the peptide. Examples of charged amino acids include arginine (R). Iysine
(K), histidine (H), glutamic acid (E), and aspartic acid (D). For ease of peptide
synthesis such as automated peptide synthesis, it may be desirable to delete or
substitute amino acids which may make peptide synthesis more difficult or costly.
For example, if the N-terminal or C terminal amino acid of the peptide is capable of
30 cyclization, or may be subject to degradation either during or after peptide synthesis.
such amino acids may be deleted, or substituted, or alternatively. one or more
additional amino acid may be added to "block" the less desirable amino or carboxy
terminal amino acid. Such added amino acids may either be derived from the native
protein sequence or may be a non-native amino acid residue. Additional amino acids
35 may be added to either the amino terminus, carboxy terminus or both, of a peptide for
the purpose of increasing the peptide's T cell activity as defined above. Such
CA 02203629 1997-04-24
Wo 96/12737 PCT/US95/13682
additional amino acids may be derived from the native protein sequence or be non-
native amino acid residues.
Peptide compositions ~lmini.~tered in accordance with the invention preferably
comprise a sufficient percentage of the T cell epitopes of the myelin autoantigen (i.e.
at least about 20%, more preferably about 30%, more preferably about 40%, and even
more preferably about 60% or greater) of the total T cell reactivity to the myelin
autoantigen in a population of individuals who respond to the autoantigen and who
have multiple sclerosis (e.g. at least 10 individuals and more preferably at least 20
individuals) are included in the composition such that a therapeutic regimen of
10 a~lmini.ctration of the composition to an individual with MS in accordance with the
invention, results in down regulation of the MS autoimmune response. To determine
whether a peptide (preferred therapeutic candidate peptide) or a combination of
candidate peptides are likely to contain a sufficient percentage of the total T cell
reactivity of the myelin autoantigen to down regulate the MS autoimmune response in
15 a substantial percentage of a population of individuals with MS, several analytical
schemes may be used
In accordance with one analytical scheme (using MBP as an example), T cell
epitope-containing peptides are ranked according to the number of MBP microtiterculture lines responding to epitope-containing peptides and according to the number
20 of MS patients responding to them. As the MBP -specific T cell frequency in the PBL
of MS patients can be very low, it is often not possible to test all MBP peptides on
every single MS patient. Therefore, the following means for determining the mostuseful therapeutic peptides is suitable and is further described in Example 1. PBL are
isolated from blood and cultures are initiated in 96 well microtiter plates PBLs are
25 purified from fresh peripheral blood specimens (approximately 75 cc) from patients
with definite MS using a Ficoll density gradient. Microtitel cultures are initiated with
2 x 105 PBL per well and 10 ug/ml purified human spinal cord MBP in RPMI 1640
culture medium supplemented with 5~o human AB serum, penicillin-streptomycin,
and L-glutamine. Cultures are supplemented with IL2 (20 units/ml) and with IL4 (5
30 units/ml) beginning at day 6-7. After I I-13 days, the microtiter cultures are washed,
resuspended in fresh media, and split into 12 fresh microtiter wells. Autologousfrozen PBLs are added as antigen presenting cells at 5 x 104 PBL per well. Screening
antigens are added in duplicate to the 12 replicate wells from each microtiter culture.
Media is always used as a negative control, and purified human recombinant MBP at
10 ug/ml is used as a positive control. Each patient is also tested for reactivity with a
maximum of 4 MBP peptides, each at a concentration of 10 uM. After 48 hours, the
CA 02203629 1997-04-24
wo 96/12737 PCTtUS95/13682
assays are pulsed with 0.75 uCi of 3H-thymidine, and harvested after a 6-16 hourpulse. Cultures are scored as positive for each peptide according to the following
criteria: stimulation index greater than 3.0, change in cpm greater than or equal to
500, and standard error of the mean less than the change in CPM. In addition, for the
5 purposes of analysis, cultures are scored as "peptide-positive" only if they respond to
both MBP and to the peptide, and if they did not respond to more than one non-
overlapping peptide. Groups of about 10-50 patients are preferably tested with each
of the MBP peptides and each group of patients is tested with a maximum of four
peptides. The peptides are then ranked in accordance with the following criteria: 1)
10 the percent of MBP positive microtiter cultures in each group of patients (total MBP
reactivity) which also scored positive for one of the MBP peptides; 2) the percent of
MBP responder individuals in each group with at least one microtiter culture which
scored positive for one of the MBP peptides, where an MBP responder individual is
defined as a patient with at least one microtiter culture which scored positive for
15 MBP. Individual peptide candidates are then selected if 1) they contain at least 5%,
more preferably at least 10%, and most preferably at least 20% of the total MBP
reactivity; and 2) reactivity to them is found in at least 20%, more preferably at least
30%, more preferably at least 40%, more preferably at least 50% and most preferably
at least 60% of the MBP responder individuals. Optionally, additional criteria for
20 ranking peptides may be considered such as the positivity index for a given peptide.
The positivity index represents both the strength of the T cell response to a peptide
(S.I.) and the frequency of a T cell response to a peptide in a population of individuals
who respond to the myelin autoantigen. For example as shown in Fig. 15, the
positivity index of 141-165 (MBP-4) is approximately 2500 which was calculated
using data described in Example 1 herein. The mean S.I. of peptide MBP-4 per MBPresponder patient was multiplied by the percent of individuals responding to MBP-4
in a population of patients responding to MBP.
Highly purified peptides substantially free from all other polypeptides and
contaminants having a defined sequence of amino acid residues comprising at least
30 one T cell epitope, used in therapeutic compositions of this invention, may be
produced synthetically by chemical synthesis using standard techniques. Various
methods of chemically synthesizing peptides are known in the art such as solid phase
synthesis which has been fully or semi automated on commercially available peptide
synthesizers. Synthetically produced peptides may then be purified, preferably to
35 homogeneity, more particularly at least 90%, more preferably at least 95% and even
more preferably at least 97% purity, substantially free from all other polypeptides and
CA 02203629 1997-04-24
Wo 96/12737 PCT/US95/13682
17
cont~min~nts using any number of techniques known in the literature for protein
purification.
Synthetically produced peptides of the invention comprising up to
approximately forty-five amino acid residues in length, and most preferably up to
5 approximately thirty amino acid residues in length are particularly desirable as
increases in length may result in difficulty in peptide synthesis. Peptides of longer
length may be produced by recombinant DNA techniques as discussed below.
Peptides useful in the methods of the present invention may also be produced
using recombinant DNA techniques in a host cell transformed with a nucleic acid
10 sequence coding for such peptide. When produced by recombinant techniques, host
cells transformed with nucleic acid encoding the desired peptide are cultured in a
medium suitable for the cells and isolated peptides can be purified from cell culture
medium, host cells, or both using techniques known in the art for purifying peptides
and proteins including ion-exchange chromatography, ultra filtration. electrophoresis
15 or immunopurification with antibodies specific for the desired peptide. Peptides
produced recombinantly may be isolated and purified, preferably to homogeneity,
substantially free of cellular material, other polypeptides or culture medium for use in
accordance with the methods described above for synthetically produced peptides.In certain limited circumstances, peptides may also be produced by chemical
20 or enzymatic cleavage of a highly purified full length or native protein of which the
sites of chemical digest or enzymatic cleavage have been predetermined and the
resulting digest is reproducible. Peptides having defined amino acid sequences can be
highly purified and isolated substantially free of any other polypeptides or
contaminants present in the enzymatic or chemical digest by any of the procedures
25 described above for highly purified, and isolated synthetically or recombinantly
produced peptides.
Additionally, peptides of the instant invention can be used in conjugates as
disclosed, for example, in U.S. Patent 5,130,297 (Sharrna et al.) where therapeutic
agents are prepared using the formula X--MHC--peptide or MHC--peptide--X wherein30 X represents a functional moiety selected from a toxin and a labeling group; MHC is
an effective portion of the MHC glycoprotein, said glycoprotein dissociated from the
cell surface on which it normally resides; and "peptide" represents any of the peptides
listed herein, more particularly MBP or MOG, even more particularly peptides shown
in Figures 2 and 14.
CA 02203629 1997-04-24
W O 96/12737 PCTrUS95/13682
` 18
Still further, preferred peptides of the invention comprise at least one T-cell
epitope of the full length protein, more particularly MBP or MOG. The peptides may
contain tandem repeats of a single epitope and/or more than one epitope.
In accordance with procedures described herein, for identifying peptides
comprising T cell activity of MBP (see, discussion above as well as Example 1,
below) preferred peptides derived from MBP and are candidates for therapeutic use
comprise the following peptides: MBP- 1, MBP-2, MBP-3, MBP-4 and MBP-5 all as
shown in Fig. 2 or any portion thereof or any modification thereof. These peptides
were tested for T cell activity as described in Example 1, and shown to comprise at
least one T cell epitope as indicated by proportion of MBP positive microtiter cultures
which also scored positive for one of the MBP peptides (Fig. 4a), and the detectable
response for each of the preferred peptides in a significant percentage of MBP patients
tested (Fig. 4b). MBP-4 (141-165) is the most reactive of the four peptides,
accounting for 21 % of the total MBP response, and detectable in 64~o of the MBP-
responder patients tested. MBP-4 surprisingly showed dramatically more reactivity
than the combined reactivities of MBP 141-160 and MBP 151-170 as shown in Fig. 3.
The present inventors are the first to identify this immunodominant peptide which
appears to comprise multiple T cell epitopes. This novel peptide is particularlypreferred for therapeutic use.
In addition, MBP-l.l, MBP-1.2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4,
MBP-2.5, MBP-2.6 and MBP-3.1 as shown in Fig. 2 are also believed to be suitablecandidate peptides for therapeutic use. These peptides are modified versions of MBP-
1, MBP-2, and MBP-3 respectively and are expected to have similar T cell activity as
that of their respective "parent" peptides. These peptides have been modified byamino acid deletion, addition or both in accordance with peptide modification
techniques as described above, mainly for the purpose of ease of peptide synthesis.
Other peptides which have been shown to be immunodominant (i.e. have T
cell activity of MBP), or have been derived from peptides known to have T cell
activity of MBP, have been identified by the present inventors or by others working in
this field (see, for example U.S.S. N. 08/328,224 filed on October 25; 1994; U.S.S.N.
08/241,246 filed on May 10, 1994; WO 93/21222; EP 0 304 279, WO 91/15225; Ota
et al, Letters to Nature, 346: 183- 187 (1990); Wucherpfennig et al.. J. Exp. Med.,
170:279-290 (1994); Martin et al., J. Immunol., (1990) 145:540-548); Karin et al.. J.
Exp. Med., 180:2227-2237 (1994)). Such peptides may also be suitable for
35 therapeutic use in compositions and methods of this invention, particularly when
combined with the preferred peptide candidates described above. Such peptides
CA 02203629 1997-04-24
wo 96/12737 PCrlUS95/13682
~9
include but are not limited to, all or a portion of the following peptides having residue
numbers which correspond to the amino acid residues of human MBP protein shown
in Fig. 1 and having individual amino acid sequences which are shown in Fig. 14: 13-
25, 31-50, 61-80, 82-92, 82-96, 82-97, 82-98, 82-100, 82-100 [100 P>Y], 83-100, 83-
101, 84-97, 84-100, 84-100, 85-100, 86-105, 87-99, 87-99 [9lK>A], 88-100, 88-99,111-135, 122-140, 139-170, 141-160, 142-166, 142-168, 146-160, and 153-170. evenmore preferably comprise the following peptides: 13-25, 87-99, 87-99 [9lK>A], 82-
100, 82-100 [100P>Y], all as shown in Fig. 14. Preferred portions of these peptides
or preferred modifications would preferably have similar or greater T cell activity in
the same or greater percentage of patients tested and/or have similar or greatertherapeutic effectiveness in the methods of the invention as that of the "parent"
peptide from which the modified peptide was derived.
One aspect of the present invention provides therapeutic compositions
comprising at least one peptide derived from a myelin antigen having T cell activity,
or a combination of peptides derived from a myelin antigen, each peptide having T
cell activity, and a pharmaceutically acceptable carrier or diluent. Preferred
thel~eulic compositions comprise a sufficient percentage of the T cell activity of the
myelin autoantigen such when ~lministered to an MS patient in a therapeutic regimen,
preferably in a non-immunogenic form, are capable of down regulating the myelin
autoantigen specific immune response in a population of humans subject to such
antigen specific immune response. As used herein, "down regulation" includes. but is
not limited to, preventing initial onset of disease symptoms, reducing the disease
symptoms of multiple sclerosis caused by the antigen specific immune response toMBP or other myelin autoantigen, more particularly, reduction, reversal, non-
progression or alleviation of symptoms. Non-progression may be characterized by,but is not limited to (a) shorter periods of active disease or exacerbation, (b) less
severe symptoms or disability, (c) delay in disease progression wherein the baseline
health does not go down as quickly, (d) extension or elongation of the lengths of time
between periods of active disease or exacerbation (e.g. Ionger periods of remission),
(e) fewer relapses or exacerbations and/or (f) slowing or arresting progression of MRI-
detected lesion load. The Expanded Disability Status Scale (EDSS) scoring systemand Neurological Rating Scale are other assessment tools used by those skilled in the
relevant art. As used herein, "advanced stage" is any point beyond clear clinical signs
of overt disease whether the disease is relapsing-remitting MS, chronic progressive
MS, benign MS or primary progressive MS. Further to this definition, "advanced
stage" may comprise acute phase(s), remission(s) and exacerbation(s). As used herein
CA 02203629 1997-04-24
W O96/12737 PCT~US95/13682
23
the term "acute phase" shall mean ongoing attack, acute disease, active disease, and
exacerbation and are used interchangeably. As they are used herein, these terms
generally refer to the state where the subject suffering from the disease (whether
diagnosed or not) presents with active symptoms or signs commonly understood by
those skilled in the art as associated with the specific immune response characteristic
of multiple sclerosis. A "relapse" is understood to mean an acute phase which follows
a remission. The term exacerbation, if used in the approp,iate in context, can also be
interpreted to mean new and worsening symptoms or signs. "Symptoms" are those
indicia of disease of which the patient complains. "Signs" are those indicia observed
10 or measured by the diagnostician. However, the terms symptoms and signs shall be
used interchangeably unless otherwise indicated.
Therapeutic compositions of the invention preferably comprise at least one T
cell epitope-containing peptide or modified peptide or peptide analog and a
pharmaceutically acceptable carrier or diluent. Such compositions may preferably15 comprise a MBP peptide selected from the following group of peptides: MBP-I,
MBP-l.l,MBP-1.2,MBP-2,MBP-2.1,MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5,
MBP-2.6,MBP-3,MBP-3.1,MBP-4 and MBP-5, more preferably an MBP peptide is
selected from MBP-l.l,MBP-2.1,MBP-4 and MBP-5, and even more preferably an
MBP peptide is MBP~.
Compositions of the invention may comprise at least two peptides (e.g. a
physical mixture of at least two peptides), each peptide having T cell activity and
preferably comprising at least one T cell epitope of a myelin autoantigen such as
MBP. Such compositions can be ~-lrnini.ctered in the form of a therapeutic
composition with a pharmaceutically acceptable carrier or diluent. A therapeutically
25 effective amount of one or more of such compositions can be administered
simultaneously or sequentially to an individual suffering from MS. Preferred
compositions comprise at least one and preferably comprise at least two peptidesselected from the following group of peptides: MBP-I,MBP-I.I,MBP-1.2,MBP-2,
MBP-2.1,MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5,MBP-2.6,MBP-3,MBP-3.1,
30 MBP-4, and MBP-5 all as shown in Fig 2, and even more preferably are selected from
the following group of peptides: MBP-l.l,MBP-1.2,MBP-2.1.MBP-2.2,MBP-2.3,
MBP-2.4,MBP-2.5,MBP-2.6,MBP-3.1,MBP-4, and MBP-5 and most preferably is
selected from the following group of peptides: MBP-l.l,MBP-2.1,MBP-4 and
MBP-5. Additionally, compositions of the invention may further comprise peptides35 derived from MBP having residue numbers which correspond to the amino acid
residues of the human MBP protein shown in Fig. I and have individual amino acid
CA 02203629 1997-04-24
wo 96/12737 PCr/US95/13682
21
sequences as shown in Fig. 14:13-25,31-50,61-80,82-92,82-96,82-97,82-98,82-
100,82-lOO[IOOP>Y],83-100,83-101,84-97,84-100,85-100,86-105,87-99,87-99
[9lK>A],88-100,88-99,111,-135,122-140,139-170,141-160,142-166,142-168,
146-160, and 153-170, and even more preferably comprise the following peptides:
13-25,87-99,87-99[9lK>A],82-100,82-lOO[lOOP>Y]. Preferably, compositions
of the invention comprise at least two peptides wherein at least one peptide is MBP-4
and at least one peptide is selected from the following group of peptides: MBP-I,
MBP-l.l,MBP-1.2,MBP-2,MBP-2.1,MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5,
MBP-2.6,MBP-3,MBP-3.1, and MBP-5 all as shown in Fig. 2, and may further
10 comprise at least one of the following peptides derived from MBP as shown in Fig.
14:13-25,31-50,61-80,82-92,82-96,82-97,82-98,82-100,82-lOO[lOOP>Y],83-
100,83-101,84-97,84-100,85-100,86-105,87-99,87-99[9lK>A],88-100,88-99,
111,-135,122-140,139-170,141-160,142-166,142-168,146-160, and 153-170, and
even more preferably comprise at least one of the following peptides: 13-25.87-99,
87-99[9lK>A],82-100,82-lOO[lOOP>Y].
Preferred compositions of the invention comprise the following peptides:
MBP-l,MBP-2,MBP-3, and MBP-4, and MBP-5;
MBP-l.l,MBP-2.1,MBP-3,MBP-4, and MBP-5
MBP-l.l,MBP-2,MBP-4, and MBP-5;
MBP-l,MBP-2.1,MBP-4, and MBP-5;
MBP-l,MBP-2,MBP-4, and MBP-5;
MBP-l.l,MBP-2.1,MBP-4, and MBP-5;
MBP-l.l,MBP-2.1, and MBP-4;
MBP-l,MBP-2.1, and MBP-4;
MBP-l.l,MBP-2, and MBP-4;
MBP-l.l,MBP-2.1, and MBP-5;
MBP-l.l,MBP-2.1, and MBP-3;
MBP-l, and a peptide selected from the group consisting of: MBP-2,MBP-2.1,
MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6;
MBP-l.l, and a peptide selected from the group consisting of: MBP-2,MBP-2.1,
MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6;
MBP-4, and a selected from the group consisting of: MBP-2,MBP-2.1,MBP-2.2,
MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6;
MBP-4, and a peptide selected from the group consisting of: MBP-l, or MBP-l.l;
MBP-l.l,MBP-4, and a peptide selected from the group consisting of: 82-100,82-
lOO[lOOP>Y],87-99, and 87-99[9lK>A], all as shown in Fig. 14;
CA 02203629 1997-04-24
W O 96/12737 PCTrUS95/13682
22
MBP-l.l, and MBP-4, and a peptide selected from the group consisting of: MBP-2.2,
MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
MBP-l.l,MBP-5,MBP-4, and a peptide selected from the group consisting of: 82-
100,82-lOO[lOOP>Y],87-99, and 87-99[9lK~A], all as shown in Fig. 14;
S MBP-l.l,MBP-S,MBP-4, and a peptide selected from the group consisting of MBP- 2.2,MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
MBP-l.l,MBP-S,MBP-4, and a peptide selected from the group consisting of: 82-
100,82-lOO[lOOP>Y],87-99, and 87-99[91K~A], all as shown in Fig. 14;.
MBP-l.l,MBP-3,MBP-4, and a peptide selected from the group consisting of:
MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
The present invention also contemplates a treatment regimen comprising
~lmini.~tering combinations of therapeutically effective peptides as a single treatment
episode. Such combinations of peptides may be ~lministered simultaneously or
15 sequentially as therapeutic compositions comprising only one peptide or comprising
several peptides. Such a treatment regimen may not necessarily be a physical mixture
of more than one peptide, but does comprise a combination of peptides ~(lmini~tered
simultaneously or sequentially as a single treatment episode. Preferred combinations
of peptides (in the form of one or more compositions each comprising one or morepeptides) which can be :~Amini~tered simultaneously or sequentially as a single
treatment episode include the following combinations of peptides:
MBP-l,MBP-2,MBP-3, and MBP-4, and MBP-S;
MBP-l.l,MBP-2.1,MBP-3,MBP-4, and MBP-S
MBP-l.l,MBP-2,MBP-4, and MBP-S;
MBP-l,MBP-2.1,MBP-4, and MBP-S;
MBP-l,MBP-2,MBP-4, and MBP-S;
MBP-I.l,MBP-2.1,MBP-4, and MBP-S;
MBP-l.l,MBP-2.1, and MBP-4;
MBP-l,MBP-2.1, and MBP-4;
MBP-l.l,MBP-2, and MBP-4;
MBP-l.l,MBP-2.1, and MBP-5;
MBP-l.l,MBP-2.1, and MBP-3;
MBP-l, and a peptide selected from the group consisting of: MBP-2,MBP-2.1,
MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5. or MBP-2.6;
MBP-l.l, and a peptide selected from the group consisting of: MBP-2,MBP-2.1.
MBP-2.2,MBP-2.3,MBP-2.4,MBP-2.5.orMBP-2.6;
CA 02203629 l997-04-24
W O96/12737 ~CT~US95/13682
23
MBP-4, and a selected from the group consisting of: MBP-2, MBP-2.1, MBP-2.2,
MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6;
MBP-4, and a peptide selected from the group consisting of: MBP- 1, or MBP- 1.1;MBP-l.l, MBP-4, and a peptide selected from the group consisting of: 82-100, 82-100 [lOOP>Y], 87-99, and 87-99 [9lK>A], all as shown in Fig. 14;
MBP-l.1, and MBP-4, and a peptide selected from the group consisting of: MBP-2.2,
MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
MBP- 1.1, MBP-5, MBP-4, and a peptide selected from the group consisting of: 82-100, 82-100 [lOOP>Y], 87-99, and 87-99 [91K>A], all as shown in Fig. 14;
MBP-1.1, MBP-5, MBP-4, and a peptide selected from the group consisting of MBP-
2.2, MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
MBP-1.1, MBP-5, MBP-4, and a peptide selected from the group consisting of: 82-
100, 82-100 [lOOP>Y], 87-99, and 87-99 [91K>A], all as shown in Fig. 14;.
MBP-1.1l MBP-3, MBP-4, and a peptide selected from the group consisting of:
MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
In addition, preferred compositions and preferred combinations of MBP
peptides which can be arlminictered simultaneously and/or sequentially may include
any of the above compositions and combinations and in addition, may also comprise
at least one T cell epitope-containing peptide derived from myelin oligodendrocyte
protein (MOG), another protein which is believed to be one of the autoantigens
involved in multiple sclerosis (see, Lebar, et al., J. Immunol. (1976) 116:1439-1446;
Lebar et al., J.Exp. Immunol (1986) 66:423-443; Linington and Lassman, J.
Neuroimmunol. (1987) 17:61-69; Lassman et al., Acta Neuorpathol. (Berl) (1988)
75:566-576; and Sun et al., J. Immunol. (l991) 146: 1490-1495) Peptides which may
comprise T cell epitopes derived from MOG, are disclosed in USSN 08/116,824 filed
September 3, 1993 and USSN. 08/300,811 filed September l, 1994, (incorporated
herein by reference), and which are expected to be effective in the treatment ofmultiple sclerosis when prepared and/or administered in conjunction with the above-
described compositions and combinations of MBP T cell epitope-containing peptides
according to the instant invention are:
HumanMOG 1-13 GQFRVIGPRHPIR
HumanMOG 103-115 HSYQEEAAMELKV
35 HumanMOG 1-121 GQFRVIGPRHPIRALVGDEV
ELPCRTSPGKNATGMEVGWY
RPPFSRVVHLYRNGKDQDGD
QAPEYRGRTELLKDAIGEGK
VTLRIRNVRFSDEGGFTCFF
CA 02203629 1997-04-24
WO 96/12737 PCT/US95/13682
24
RDHSYQEEAAMELKVEDPFYW
Additional epitope-containing peptides of MOG have been identified by the present
inventors using an experimental analysis similar to that described above and in
5 Example 1 (data not shown) such peptides include:
HumanMOG 1-20 GQFRVIGPRHPIRALVGDEV;
HumanMOG 11-30 PIRALVGDEVELPCRISPGK;
HumanMOG21-40 ELPCRISPGKNATGMEVGWY;
10 HumanMOG31-50 NATGMEVGWYRPPFSRVVHL;
HumanMOG 141-160 TVGLVFLCLQYRLRGKLRAE;
HumanMOG 151-170 YRLRGKLRAEIENLHRTFDP;
HumanMOG 161-180 IENLHRTFDPHFLRVPCWKI;and
HumanMOG 199-218 YNWLHRRLAGQFLEELRNPF.
The present invention further contemplates modifications or analogs (discussed
earlier) of the above T cell epitope-containing MOG peptides which retain similar or
greater T cell activity as the parent peptide from which the modification or analog is
derived.
It is believed that compositions comprising T cell epitope-containing peptides
of both MOG and MBP, modifications thereof, analogs thereof, or peptidomimetics
based thereon, and combinations of such peptides which can be a-lministered
simultaneously or sequentially have the advantage of maximizing the down-regulating
effect on both MBP and MOG specific T cells participating in the autoimmune
25 response in MS. In this manner a range of T cells which may participate in the
autoimmune response to either MBP or MOG resulting in the clinical manifestations
of MS (demyelation) may be targeted for down regulation thereby enhancing the
therapeutic effect of the compounds and compositions of the invention. Likewise. T
cell epitope containing peptides derived from other myelin antigens believed to be
30 autoantigens in MS (e.g. proteolipid protein (PLP) and myelin associated glycoprotein
(MAG)) may also be suitable in compositions and methods of the invention.
A therapeutic/prophylactic treatment regimen in accordance with the
invention (which results in reversal of, prevention of, or delay in, the onset of disease
symptoms caused by an offending autoantigen or results in reduction, non-
35 progression, or alleviation of symptoms caused by an offending autoantigen i.e. down
regulation of an autoantigen specific immune response) comprises ~dmini.stration, in
non-immunogenic form of a therapeutic composition of the invention comprising atleast one isolated peptide derived from an autoantigen responsible for the disease
condition being treated (e.g. MBP, MOG, PLP, MAG). While not intending to be
40 limited to any theory, it is believed that ~ministration of a therapeutic composition of
CA 02203629 1997-04-24
W O96/12737 PCTnUS95/13682
the invention may: a) cause T cell non responsiveness of a~",ro~;.iate T cell
subpopulations such that they become unresponsive to the offending antigen and do
not participate in stimulating an immune response upon exposure to the offendingprotein antigen (e.g. via anergy or apoptosis); b) modify the lymphokine secretion
5 profile as compared with exposure to the offending autoantigen; c) cause T cell
subpopulations which normally participate in the response to the offending antigen to
be drawn away from the sites of normal exposure towards the sites of ~-lmini.stration
of the composition (this redistribution of T cell subpopulations may ameliorate or
reduce the ability of an individual's immune system to stimulate the usual immune
10 response at the site of normal exposure to the offending antigen, resulting in
diminution or reversal in symptoms); d) cause induction of T suppressor cells or e)
cause induction of suppressor cells via a bystander antigen.
Highly purified and isolated peptides produced as discussed above may be
formulated into therapeutic compositions of the invention suitable for human therapy.
15 If a therapeutic composition of the invention is to be ~(lmini.stered by injection (e.g.
subcutaneous injection, intravenous injection), then it is preferable that the highly
purified peptide be soluble in an aqueous solution at a pharmaceutically acceptable pH
(i.e. pH range of about 4-9) such that the composition is fluid and easy syringability
exists. The composition also preferably includes a pharmaceutically acceptable
20 carrier. As used herein "pharmaceutically acceptable carrier" includes any and all
excipients. solvents, dispersion media, coatings, antibacterial and antifungal agents,
toxicity agents, buffering agents, absorption delaying or enhancing agents, surfactants,
and micelle forming agents, lipids, liposomes, and liquid complex forming agents,
stabilizing agents, and the like. The use of such media and agents for
25 pharmaceutically active substance is known in the art. Except insofar as any
conventional media or agent is incompatible with the active compound, use thereof in
the therapeutic compositions is contemplated. Supplementary active compounds canalso be incorporated into the compositions.
As discussed above, therapeutic compositions of the invention suitable for
30 injectable use are preferably sterile aqueous solutions prepared by incorporating active
compound (i.e., one or more highly purified and isolated peptides as described above)
in the required amount in an applop.iate vehicle with one or a combination of
ingredients enumerated above and below, as required, followed by filtered
sterilization. Preferred pharmaceutically acceptable carriers include at least one
35 excipient such as sterile water, sodium phosphate, mannitol, sorbitol, or sodium
chloride or any combination thereof. Other pharmaceutically acceptable carriers
CA 02203629 1997-04-24
W O96/12737 ~CTnUS95/13682
2S
which may be suitable include solvents or dispersion medium containing, for
example, water, ethanol, polyol (for example glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The
proper fluidity can be maintained for example by the use of coating such as lecithin,
5 by the maintenance of the required particle size in the case of dispersions and by the
use of surfactants. Prevention of the action of microorganisms can be achieved by
various antibacterial and antifungal agents, for example, parabens, chlorobutanol,
phenol, ascorbic acid, thirmerosol and the like. Prolonged absorption of the injectable
compositions can be brought about by including in the composition, an agent which
10 delays absorption, for example, aluminum monostearate and gelatin.
Preferable therapeutic compositions of the invention should be sterile, stable
under conditions of manufacture, storage, distribution and use and should be
preserved against the cont~min~ting action of microorganisms such as bacteria and
fungi. A preferred means for manufacturing a therapeutic composition which
15 maintains the integrity of the composition (i.e. prevent cont~min~rion~ prolong
storage, etc.) is to prepare the formulation of peptide and pharmaceutically acceptable
carrier(s) such that the composition may be in the form of a Iyophilized powder which
is reconstituted in a pharmaceutically acceptable carrier, such as sterile water, just
prior to use. In the case of sterile powders for the preparation of sterile injectable
20 solutions, the preferred methods of preparation are vacuum drying, freeze-drying or
spin drying which yields a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof.
As discussed above, a therapeutic composition of the invention may comprise
more than one isolated peptide. A therapeutic composition comprising a multipeptide
25 formulation suitable for pharmaceutical ~rlministration to humans may be desirable
for ~mini~tration of several active peptides. The multipeptide formulation includes
at least two or more isolated peptides having a defined amino acid sequence and is
capable of down regulating an antigen specific immune response. Any of the
compositions described earlier which comprise at least two peptides may be suitable
30 as a multipeptide formulation. As discussed earlier, highly preferred peptides suitable
for use in a multipeptide formulation include at least two of the following peptides:
MBP-l, MBP-l.l, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-
2.5, MBP-2.6, MBP-3, MBP-3. 1 MBP-4 and MBP-5. Special considerations when
preparing a multipeptide formulation include maintaining the solubility, and stability
35 of all peptides in the formulation in an aqueous solution at a physiologically
acceptable pH. This requires choosing one or more pharmaceutically acceptable
CA 02203629 1997-04-24
WO 96/12737 PCT/USg5l13682
27
solvents and excipients which are compatible with all the peptides in the multipeptide
formulation. For example, suitable excipients include sterile water, sodium
phosphate, mannitol or both sodium phosphate and mannitol. An additional
consideration in a multipeptide formulation is the prevention of dimerization of the
5 peptides if necessary.
Administration of the therapeutic compositions as described above to an
individual, in a non-immunogenic form, can be carried out using known procedures at
dosages and for periods of time effective to cause down regulation of the MBP
antigen specific immune response of the individual being treated for MS. Down
10 regulation of an antigen specific immune response to an antigen associated with a
disease condition in humans may be determined clinically whenever possible, or may
be determined subjectively (i.e. the patient feels as if some or all of the symptoms
related to the disease condition being treated have been alleviated).
Effective amounts of the therapeutic compositions of the invention may vary
15 according to factors such as the degree of sensitivity of the individual to the antigen,
the age, sex, and weight of the individual, and the ability of peptide to cause down
regulation of the antigen specific immune response in the individual. A therapeutic
composition of the invention may be ~!ministered in non-immunogenic forrn, in a
convenient manner such as by injection (subcutaneous, intravenous, etc.), oral
20 ;~1ministration, sublingual, inhalation, transdermal application, rectal administration,
or any combination of routes of ~cimini.ctration designed to enhance therapeuticeffectiveness, or any other route of arlmini.stration known in the art for administering
therapeutic agents. It may be desirable to administer simultaneously or sequentially a
therapeutically effective amount of one or more of the therapeutic compositions of the
25 invention to an individual. Each of such compositions for administration
simultaneously or sequentially, may comprise only one peptide or may comprise a
multipeptide formulation as described above.
To ~(lminister peptide or peptide composition by other than parenteral
administration, it may be necessary to coat the peptide with. or co-administer the
30 peptide with, a material to prevent its inactivation. For example. a peptide
composition may be co-administered with enzyme inhibitors or in liposomes.
Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate
(DEP) and trasylol. Liposomes include water-in-oil-in-water CGF emulsions as well
as conventional liposomes (Strejan et al., (1984) J. Neuroimmunol. 7:27). When a3~ peptide is suitably protected, as described above, the peptide may be orally
administered, for example, with an inert diluent or an assimilable edible carrier. The
CA 02203629 1997-04-24
W O 96/12737 PCTrUS95/13682
28
peptide composition and other ingredients may also be enclosed in a hard or soft shell
gelatin capsule, compressed into tablets, or incorporated directly into the individual's
diet. For oral therapeutic ~(lminictration, the active compound may be incorporated
with excipients and used in the form of ingestible tablets, buccal tablets, troches,
capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and
preparations should contain at least 1% by weight of active compound. The
percentage of the composition and preparations may, of course, be varied and mayconveniently be between about 5 to 80% of the weight of the unit. The amount of
active compound in such therapeutically useful compositions is such that a suitable
10 dosage will be obtained. Preferred compositions or preparations according to the
present invention are prepared so that an oral dosage unit contains between from about
10 ~g to about 200 mg of active compound. The tablets, troches, pills, capsules and
the like may also contain the following: a binder such as gum gragacanth, acacia, corn
starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such
15 as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium
stearate; and a sweetening agent such as sucrose, lactose or saccharin or a flavoring
agent such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage
unit form is a capsule, it may contain, in addition to materials of the above type, a
liquid carrier. Various other materials may be present as coatings or to otherwise
20 modify the physical form of the dosage unit. For instance, tablets, pills, or capsules
may be coated with shellac, sugar or both. A syrup or elixir may contain the active
compound, sucrose as a sweetening agent, methyl and propylparabens as preservative,
a dye and flavoring such as cherry or orange flavor. Of course, any material used in
preparing any dosage unit form should be pharmaceutically pure and substantially25 non-toxic in the amounts employed. In addition, the active compound may be
incorporated into sustained-release preparations and formulations.
For injection, (subcutaneous, I.V., I.M., intraperitoneal) of one or more
therapeutic compositions of the invention, preferably about I ~lg- 3 mg and morepreferably from about 20 ~Lg-1.5 mg, and even more preferably about 50 '~lg- 750 '~lg,
and even more preferably about 75 ~g to about 750 ~lg. of each active component
(peptide) per dosage unit may be ~tlmini.ctered. Depending upon the regimen as
described below, doses as high as 1500 ~g or more may be used. It is especially
advantageous to formulate parenteral compositions in unit dosage form for ease of
a~minictration and uniformity of dosage. "Unit dosage" forrn as used herein refers to
35 physically discrete units suited as unitary dosages for human subjects to be treated;
each unit containing a predetermined quantity of active compound calculated to
CA 02203629 1997-04-24
W O96/12737 PCTrUS9~/13682
2~
produce the desired therapeutic effect in association with the desired pharmaceutical
carrier. The specification for the novel unit dosage forms of the invention are dictated
by and directly dependent on (a) the unique characteristics of the active compound
and the particular thel~uLic effect to be achieved, and (b) the limitations inherent in
the art of compounding such an active compound for the treatment of human subjects.
Dosage regimen may be adjusted to provide the optimum prophylactic or
therapeutic response. For example, several divided doses may be a~lministered over
the course of days, weeks, months or years, or the dose may be proportionally
increased or reduced with each subsequent injection as indicated by the exigencies of
the therapeutic situation. In one preferred therapeutic regimen, subcutaneous
injections of thel~peutic compositions are given once a day during an acute phase and
once every other day during remission for the lifetime of the individual suffering from
the disease. Alternatives would include, weekly, monthly or other periodic injections.
The dosage may remain constant for each injection or may increase or decrease with
each subsequent injection. A continual, lifetime treatment program may be most
desirable. In the alternative, a booster injection may be administered at intervals of
about three months to about one year after an initial treatment period and may involve
only a single injection or may involve another series of injections similar to that of the
initial treatment.
Because of the highly individual immune system response of individuals
suffering from either relapsing remitting MS, primary progressive MS, benign MS,and chronic progressive MS, careful and varied dosage regimens will need to be
developed. First, an intake evaluation of the presenting patient must be completed. A
complete exam is conducted looking for, among other things, impaired vision.
nystagamus, dysarthria, decreased perception of vibration and position sense. ataxia
and intention tremor, weakness or paral~sis of one or more limbs. spasticity andbladder problems. Those skilled in the art would IlSe accepted tools such as EDSS,
Neurological Rating Scale or other similar tools known in the art as well as thepreviously discussed indicia of disease state to determine a baseline from which any
change, including disability progression, but preferably down regu]ation, could be
measured. Although there is no typical MS acute or remitting phase, certain patterns
have emerged which would guide the experienced practitioner. As mentioned above,the frequency of flare-ups or acute stages is greatest during the first 3 to 4 years of
disease, but a first attack, may not be followed by another observable attack for 10 to
20 years ( although lesion load detectable only by MRI might give a different clinical
picture) . During typical episodes, symptoms worsen over a period of a few days to 2
CA 02203629 1997-04-24
W O96/12737 PCTnUS95/13682
3~
to 3 weeks and then remit. Recovery is usually rapid over a period of weeks, although
at times it may extend over several months.
MS is a chronic disease and continual therapy is contemplated. On going, long
term treatment may be the most effective treatment to stem the progression of disease
and disability. A dosage regimen of every other day, at least once a week or once a
month may be applo~liate. Reasonable modifications are within the abilities of one
skilled in the art. Intervention at onset of an attack is considered an important
component in effective treatment.
For a patient presenting in the acute stage, the severity of attack must
evaluated. An initial injection may be given at the onset of the acute stage. The
obvious benefit would be to initiate treatment as early into the acute phase as possible.
If desired, this therapy could be combined with simultaneous treatment with ~-
interferon, steroids and/or other therapies especially those designed to decrease
inflammation. The patient would be observed daily after the first treatment,
preferably by injection. It is suggested that additional treatments be given every day,
or at least every third day during the acute phase. As with any medication, the treating
physician should modify the dosage based upon clinical changes which indicate the
need for modification. Any such discretion is within the scope of those skilled in the
art using the suggested dosage schedule and amounts as guidelines. The dosage range
from about 75 to about 750 ,ug per dose gives a great deal of latitude (and not an
unreasonable amount) to the treating physician. Options include but are not limited to
daily treatments during acute phase after which the course of treatment for remission
set out above is followed. This by no means excludes the possibility of more or less
frequent dosing if the treating physician determine intervention is indicated.
The present invention discloses that "advanced stage" multiple sclerosis can be
treated in accordance with compositions and methods of the invention. Compositions
comprising at least one peptide having T cell activity and derived from a myelinautoantigen is suitable for treating advanced stage MS. Compositions of MBP
peptides. MOG peptides and combinations thereof described earlier are suitable for
treating advanced stage MS. As described above these peptides include but are not
limited to: MBP-I,MBP-I.I,MBP-1.2,MBP-2,MBP-2.1,MBP-2.2,MBP-2.3,
MBP-2.4,MBP-2.5,MBP-2.6,MBP-3,MBP-3.1,MBP-4,MBP-5,13-25,31-50,61-
80,82-92,82-96,82-97,82-98,82-100,82-100[100P>Y],83-100,83-101,84-97,84-
100,85-100,86-105,87-99,87-99 [91K>A], 88-100,88-99,111,-135,122-140,139-
170,141-160,142-166,142-168,146-160, and 153-170, and preferably MBP-I.I,
CA 02203629 1997-04-24
wo 96/12737 PCTtUS95tl3682
31
MBP-2.1, MBP-4, MBP-5, 13-25, 87-99, 87-99 [9lK>A], 82-100, 82-lOO [lOOP>Y]
as well as peptides derived from human MOG:
CA 02203629 1997-04-24
WO 96/12737 PCI/US95/13682
32
HumanMOG 1-13 GQFRVIGPRHPIR
HumanMOG 103-115 HSYQEEAAMELKV
HumarlMOG 1-121 GQFRVIGPRHPIRALVGDEV
ELPCRTS PG KNATGMEVGWY
RPPFSRVVHLYRNGKDQDGD
QAPEYRGRTELLKDAIGEGK
VTLRIRNVRFSDEGGFTCFF
RDHSYQEEAAMELKVEDPFYW
HumanMOG 1-20 GQFRVIGPRHPIRALVGDEV;
10 HumanMOG11-30 PIRALVGDEVELPCRISPGK;
HumanMOG21-40 ELPCRISPGKNATGMEVGWY;
HumanMOG31-50 NATGMEVGWYRPPFSRVVHL;
HumanMOG 141-160 TVGLVFLCLQYRLRGKLRAE;
HumanMOG 151-170 YRLRGKLRAEIENLHRTFDP;
HumanMOG 161-180 IENLHRTFDPHFLRVPCWKI;and
HumanMOG 199-218 YNWLHRRLAGQFLEELRNPF.
The present inventors have are the first to make the surprising discovery that
intervention in the midst of an ongoing attack, actually improves the condition of a
20 subject treated accordingly to the method of the instant invention. At a minimum,
such intervention does not worsen the condition of the subject. Further, applicants
show that intervention during remission down regulates the immune response and the
condition does not become activated as a result of any such intervention. Thus, not
only may the intervention cause improvement but appears to be entirely safe when25 ~minictered according to the method of the instant invention. Using the EAE model
as described above, applicants demonstrate that repeated intravenous ~minictration of
the immunodominant MBP peptide Acl-11 successfully treats EAE induced with the
entire MBP protein. Once successful treatment (indicative of T cell reactivity) is
shown with a "native peptide" (unsubstituted peptide derived from the native sequence
30 in accordance with procedures described herein for identifying T cell epitope-
containing peptides derived from a protein autoantigen) suitable modified peptides
may be identified by comparing binding affinities of the modified peptide with the
native peptide. A modified peptide which has a binding affinity lower than the native
peptide would be a suitable candidate peptide for a therapeutic composition of the
35 instant invention. Assays for determining binding affinities can be identified
according to the teachings of U.S.S.N. 08/300,811 filed September 1, 1994
incorporated herein by reference. For example, Acl-l 1 therapy was found to be
successful. Ac 1-1 1 therapy was then compared to therapy with Ac 1-1 1 [4Y], an Ac 1-
11 analog which binds to AaUA~u with higher affinity and greater stability (~Traith,
40 D.C. et al., supra and Fairchild, P.J. et al. supra). Interestingly, applicants found that
Acl-l 1[4Y] is effective at a 100-fold lower dose than Acl-l 1, and that its therapeutic
effect is longer lasting indicating that selected modified peptides would be also
CA 02203629 1997-04-24
W O 96112737 PCTrUS9S/13682
33
suitable in a therapeutic composition . Further, applicants show that the particular
peptide tested Ac l - l l [4Y] forms stable peptide-MHC complexes in vivo in the treated
mice. This indicates that modified peptides which forrn stable peptide-MHC
complexes in vivo are highly likely to be suitable peptides in the treatment of humans
5 as their potency may be greatly increase with conservative amino acid substitutions
(see also, Karin et al., J. Exp. Med.~ 180:2227-2237 (1994)). Applicants also
discovered that the MBP peptide analog Ac l- l l [4Y] reversed ongoing paralysis when
~-lrninictered during the acute phase of EAE, and that it prevented relapses when
a~lTnini.stered during remission. This indicates that selected modified peptides and
l 0 selected peptide analogs may reverse active symptoms and prevent relapses in humans
suffering from MS.
In still another model for the course of human disease, the applicant initiated
intravenous peptide therapy after the onset of EAE and during an acute phase. Quite
surprisingly, this therapy reversed ongoing disease when aclministered during the
15 acute phase. This finding is the first of its kind. In past experiments done by others,
peptide therapy was initiated at a time when the majority of the mice in the treatment
group had not yet shown signs of EAE, prior to immllni7~tion or near the onset of
disease, at the latest. For example, in Gaur et al., supra, a group of l 3 mice were
subjected to a disease provoking regimen of MBP. When only one of the 13 mice
20 showed minim~l signs of disease, i.e., one mouse had a clinical score of l (see
Example 2 for a discussion of clinical scoring in mice), seven of the mice were
injected intraperitoneally with MBP peptide mixture. The remaining six mice, one of
which was the animal showing the signs of disease received no additional treatment.
In this case, for those mice without clinical symptoms of disease. Gaur et al. is unable
25 to draw any meaningful conclusion about their data. The presence of a low clinical
score of l in one mouse cannot be interpreted to indicate active disease in any of the
other mice. Accordingly, Gaur et al. discloses treatment before onset of the disease,
and most definitely, before clinical signs of disease. By contrast. in order to be useful
in a clinical setting for treatment of humans with MS, a therapy would need to be
30 effective even if initiated well after the onset of the disease process. As a model of
ap~ulopliate human therapy, applicants administered peptide therapy to mice with 250
nmol Ac l - l l [4Y] initiated after the onset of the acute phase of EAE. Figure 5 shows
the effect of this therapy. The therapy was initiated individually in each mouse as it
exhibited initial signs of EAE. Mice were assigned as they developed EAE to the
35 Acl-l 1[4Y] peptide therapy group and to each of the three control groups (notreatment, PBS, or the AaUA~u -binding peptide OVA 323-337). Figure 9 shows that
CA 02203629 1997-04-24
wo 96/12737 PCT/US95113682
34
therapy of ongoing EAE with Ac I - I I [4Y] leads to dramatic improvement in disease
scores apparent within 48 hours of the initial injection of peptide. EAE nearly totally
resolved in these treated mice by the fourth day after onset, and the effect of an 18 day
course of peptide therapy was prolonged.
In still another surprising development, applicants discovered that intravenous
peptide therapy initiated during the remission phase of EAE prevents relapses. Again,
using the EAE as a model for human disease, as mentioned above, (PLJ x SJL)FI
mice develop relapsing EAE upon immunization with MBP (Fritz, R.B., et al., J.
Immunol., 1983,130:1024). EAE usually develops between 9 and 16 days following
immunization, and the acute phase of disease in this model lasts from approximately 3
to 20 days. Twenty percent or more of the mice may die or become moribund duringthe acute phase, depending on disease severity in the experiment. Most of the acute
phase survivors then enter a brief remission phase, displaying mild or no clinical signs
of disease for several days. In some experiments, mice all enter the remission phase at
about the same time (illustrated in Figure 5), but in most cases the length of the acute
phase of disease is more variable. The remission phase is followed by a first relapse
phase, which is generally equal in severity to the acute phase of disease.
Subsequently, surviving mice develop residual chronic paralysis, which persists until
termination of the experiment.
In the mouse model, the peptide, Ac 1-1 1 [4Y], is a remarkably effective
therapy when initiated during the remission phase of EAE. In order to examine the
capacity of Ac I -1 l [4Y] to prevent EAE relapses, mice were followed throughout their
initial episodes of paralysis which lasted from 3-19 days. As surviving mice entered
the remission period individually (defined as a reduction in clinical score to l or 0 for
at least two days), they were alternately assigned to two groups and intravenoustherapy was initiated with 25 nmoles of Ac I - I I [4Y] or with the control PBS. Mice
were treated individually beginning on their second day of remission. Figure 10
shows that intravenous treatment with Ac l - I I [4Y] beginning during the remission
phase of EAE dramatically reduced the incidence and severity of relapse, and
indicates that intravenous peptide therapy can be effective even when initiated late in
the disease course.
The mechanism of intravenous peptide therapy has not been fully elucidated,
although it has previously been suggested in a number of other antigen systems
administration of an antigenic peptide intravenously prior to immunization induces
antigen-specific non-responsiveness of the immune system. As further indication of
the viability of a therapeutic ~(lmini~tered to MS patients, applicants a~lmini~tered I.V.
CA 02203629 1997-04-24
W O 96/12737 PCTrUS9S/13682
encephalitogenic peptide or peptide analog and found that it reduced in vitro Iymph
node proliferation and IL2 production. Mice were injected intravenously with 250nmoles of MBP Acl-11 ten and five days prior to immunization with MBP protein.
Figure 1 1 a shows the Iymph node proliferative response from these treated micemeasured on day 10 following immuni7~tion. Intravenous pretreatment with the
immunodominant MBP peptide Ac 1-1 1 without adjuvant prior to immunization
reduces the subsequent in vitro proliferative T cell response to MBP Acl-11. Similar
results were obtained when mice were pretreated with intravenous injections of the
MBP peptide analog Ac 1-1 1 [4Y] (data not shown). Moreover, Iymph node IL2
10 production in response to MBP Acl-11 was prevented by intravenous pretreatment
with Ac 1-1 1 [4Y] (Figure 1 1 b). The results confirm that intravenous pretreatment
with MBP Ac 1- l l or Ac l - l l [4Y] induces T cell non-responsiveness to MBP Ac l - l l .
Thus, applicants have examined the efficacy of therapy with intravenous MBP
peptides and peptide analogs in treating relapsing EAE, and have made a number of
15 unique observations. First, and perhaps most important, treatment of an autoimmune
disease with a single autoantigenic peptide can be effective even when therapy is
initiated after the onset of disease signs. Specific disease signs used for scoring the
mice are discussed in the Examples herein. A Mean Clinical Scores of a level 2 or
above was defined as advanced stage EAE. The results indicate that intravenous MBP
20 peptides interfere with the encephalitogenic activity of autoaggressive primed cells,
even after the blood brain barrier has been disrupted and Iymphocytic infiltration of
the central nervous system has occurred. At no time were the peptides observed to
activate, aggravate or exacerbate ongoing disease, even temporarily. EAE treatedafter the onset of the acute phase was reversed within a few days of initiation of
25 therapy, even though initially the treated mice were severely affected. Histological
examination confirmed that a clinical response to peptide therapy correlated with a
marked reduction in brain and spinal cord lymphocytic infiltrates. Also, as discussed
herein I.V. ~lmini.ctration of MBP Acl-l I [4Y] was effective even beginning as late as
thirty days after immunization with MBP, in the remission phase of EAE. Thus.
initiation of treatment during an apparently quiescent phase of the disease once again
did not lead to exacerbations, and, moreover, completely prevented all but the mildest
of relapses. This result is particularly interesting since there is evidence that
recognition of a variety of MBP epitopes occurs late in the immune response to MBP,
and it has been proposed that these epitopes may contribute to disease (Lehmann,35 P.V., et al., Nature, 1992, 358:155). The present invention suggest that the
~d~nini.~tration of peptide very early in the disease course might prevent the
CA 02203629 1997-04-24
Wo 96/12737 PCTrUS9~/l3682
3~
development of a late immune response to such epitopes. However, it is notable that a
single MBP peptide analog effectively prevented relapses when ~c~mini~tered after
resolution of the severe acute phase of EAE, when the immune response to MBP andpossibly to other myelin antigens may have already progressed.
In the practice of the instant invention, the selection of a potent therapeutic is
preferred and is described earlier herein. Additionally, the present inventors theorized
that one criteria for the best peptide candidates would be those with T cell reactivity
and higher MHC binding affinity than the native peptide which form stable complexes
with class II MHC in vivo. In particular, applicants examined the MBP peptide analog
which forms stable complexes with class II MHC in vivo is more effective than Acl-
1 1 in treating EAE. It has been shown previously that the MBP peptide analog Ac I -
11 [4Y] binds to AaUA~u with a higher affinity, and that complexes formed in vitro
- between Ac 1-1 1 [4Y] and AaUA~u are more stable than those formed between Ac 1-
1 1 and AaUA,Bu. Ac 1-1 1 [4Y] also has been shown to prevent EAE when a large dose
is inhaled prior to immunization (Metzler, B. et al., supra). The instant invention
discloses that a modified MBP peptide analog Ac I - I I [4Y] is at least I 00-fold more
potent as a therapeutic agent than MBP Acl-11, and requires a less frequent dosing
schedule. This increased potency results in a therapeutic which is both more practical
and more efficacious. Applicants have observed that intravenous ~(lmini~tration of
Ac 1-1 1 [4Y] (but not Ac 1-1 1 ) results in the formation of stable peptide-MHCcomplexes in vivo. The improved potency of Ac l - l I [4Y] is believed to be related
this formation of stable peptide-MHC complexes. These complexes are detectable on
spleen cells using an MBP Acl-l l-specific hybridoma for up to ten hours after
injection. Accordingly, it is believed that formation of stable peptide-MHC
complexes may be one of the hallmarks of such a potent therapeutic peptide.
Surprisingly, the in vivo therapeutic effect of Ac I - I I [4Y] was present long after
peptide-MHC complexes became undetectable on spleen cells (see Figure 6a and
Figure 9). It is likely that the peptide-MHC complexes form antigen-specific
functional therapeutic units which exert a long-lasting effect on encephalitogenic T
cells, persistent after the complexes are no longer detectable in vivo. It is not known
whether such complexes exert their effect peripherally, or in the central nervous
system. If they operate in the central nervous system, the complexes may be formed
there, or cells bearing the complexes may migrate across the blood-brain barrier.
The present invention further provides methods for treating multiple sclerosis
comprising a-lmini~tering a therapeutically effective amount of at least one peptide of
CA 02203629 1997-04-24
WO 96/12737 PCr/US95/13682
37
MBP having T cell activity in a treatment regimen which includes a therapeutically
effective amount of IFN-,B.
As a result of the work described herein it has been discovered that a
combination of at least one peptide having T cell activity derived from a myelinS antigens (e.g. MBP). and IFN-,B, when ~ministered in a therapeutic regimen, has a
synergistic effect (Fig. 12c) which surprisingly ~liminishes the clinical symptoms of
EAE in mice to a far greater extent than the effect of each on mitigating the symptoms
of EAE when ~-1mini.ctered alone (Figs. 12a-b), and which is greater than what one
would expect for a merely additive effect of the peptide plus IFN-~.
As EAE serves as a mouse model of human MS and is induced by various
myelin antigens (e.g. PLP, MBP, MOG), it is expected that a similar effect would also
be seen in humans. Therefore, the present invention provides a method of treating
individuals who have multiple sclerosis or are susceptible to developing multiple
sclerosis, which comprises ~minictering an effective amount of a composition of the
15 invention comprising at least one peptide having T cell activity derived from a myelin
antigen preferably in non-immunogenic form, in a therapeutic regimen which also
includes the ~minictration of IFN-~. Preferred compositions include those
compositions of the invention discussed earlier comprising MBP peptides as well as
MBP peptides combined with MOG peptides, in conjunction with simultaneously or
20 sequentially a~mini.stered IFN-~.
Administration of a composition of the invention comprising at least one
peptide having T cell activity of a myelin antigen in a therapeutic regimen which
includes ~11ministration of IFN-,~ can be carried out using known procedures at
dosages and for periods of time to effectively reduce, eliminate or prevent the
25 symptoms associates with multiple sclerosis. Effective amounts of either peptide or
IFN-~ when ~lministered together in a therapeutic regimer vary according to factors
discussed above. The active compounds (e.g. the ~BP peptide or composition
thereof and IFN-~) may be ~lminictered in a convenient manner such as by injection
(subcutaneous), intravenous etc.). oral administration, inhalation. transdermal
30 application or rectal administration as discussed above.
For example, preferably about l ,ug-3mg and more preferably about 20-500 !lg
of peptide derived from a myelin antigen per dosage unit may be ~clmini.stered by
injection. Preferably, a dosage unit of 100-10,000 units of IFN-~ may be
:~rlministered by injection. The dosage regimen of these two compounds may be
35 adjusted to provide the optimum therapeutic response. For example, IFN-~ and a
composition of the invention may be ~dminictered simultaneously or may preferably
CA 02203629 1997-04-24
WO 96/12737 PCT/US95/13682
38
be ~Amini~tered at least six hours apart, preferably at least 12 hours apart, or more
preferably at least 24 hours apart. The therapeutic regimen of a-lmini~tering both
antigenic peptide and IF~ may continue over a period of days or weeks and may bereduced or extended as indicated by the exigencies of the therapeutic situation as
discussed above.
The present invention also provides a novel composition comprising a
physical mixture of a peptide having T cell activity derived from a myelin antigen
such as MBP or MOG and IFN-,B in a pharmaceutically acceptable carrier or diluent.
This composition may be used as part of a therapeutic regimen for treating or
preventing multiple sclerosis in an individual.
Other autoimmune diseases such as Type I diabetes and rheumatoid arthritis
are generally accepted as being the result of an antigen specific T cell mediated
response against an autoantigen. Various approaches to treating T cell mediated
autoimmune diseases include atlmini.stration of whole autoantigens or T cell epitope-
containing peptides derived therefrom to the patient for the purpose of down
regulating the T cell mediated response responsible for the adverse symptoms of the
autoimmune disease
In addition to myelin autoantigens which play a role in MS, a number of
antigens (i.e. autoantigens) have been found to cause disease symptoms in other
autoimmune diseases such as diabetes, Graves disease, myasthenia gravis, Good
Pasture's syndrome, psoriasis, thyroiditis, and rheumatoid arthritis ( e.g. autoantigens
such as insulin; rh factor; acetylcholine receptors; thyroid cell receptors; basement
membrane proteins; thyroid proteins; ICA-69 (PM-I); glutamic acid decarboxylase
(64K or 65 K); proteolipid, Collagen (Type II), Heat Shock Protein and
carboxypeptidase H). It is believed that compositions and methods similar to those
described herein may be used to treat autoimmune diseases such as rheumatoid
arthritis, diabetes, myasthenia gravis, Grave's disease, Good Pasture's syndrome,
psoriasis, and thyroiditis, wherein the antigen responsible for the disease is a protein
autoantigen.
Peptides comprising defined sequences of amino acid residues having T cell
activity and preferably comprising at least one T cell epitope and/or which induce T
cell nonresponsiveness or reduced T cell responsiveness, have been identified and
isolated for many of the above named autoantigens. For example, peptides which are
believed to be able to down regulate the antigen specific response to soluble Type II
collagen, a protein antigen believed to be an autoantigen in rheumatoid arthritis, have
been identified in WO 94/07520. WO 92/06704 describes methods for identifying
CA 02203629 1997-04-24
W O96/12737 PCTrUS9S/13682
39
peptides of insulin which are believed to comprise T cell epitopes and which may be
useful in compositions and the methods analogous to the those of the of the present
invention to treat Type I diabetes. In addition, suitable T cell epitope-containing
peptides may be identified for an antigen or autoantigen presumed to be responsible
5 for any of the above-named diseases by any of the procedures described above and in
the examples for identifying T cell epitope containing peptides of a protein
autoantigen. Once such T-cell epitope containing peptides have been identified for
the targeted autoantigen, such peptides may be used in compositions and methods
analogous to those described herein for treating multiple sclerosis.
This invention is illustrated by the following non-limiting examples.
EXAMPLE 1 Human Population Study of Multiple Sclerosis Immune Response to
Myelin Basic Protein and Peptides and Selection of MBP Peptides
Suitable for Therapeutic Use.
Peptide Synthesis:
Peptides were synthesized using standard Fmoc/tBoc chemistry and purified
by Reverse Phase HPLC. Figure 3 shows the MBP peptides used in these studies.
The peptide names or amino acid residues are consistent throughout.
Protocol: Analysis of Human PBL for reactivity with MBP and MBP peptides:
PBLs were purified from fresh peripheral blood specimens (approximately 75
cc) from 222 patients with definite MS using a Ficoll density gradient. Microtiter
cultures were initiated with 2 x 105 PBL per well and 10 ug/ml purified human spina]
cord MBP in RPMI 1640 culture medium supplemented with 5% human AB serum,
penicillin-streptomycin, and L-glutamine. Cultures were supplemented with IL2 (20
units/ml) and with IL4 (5 units/ml) beginning at day 6-7. After I I-13 days, themicrotiter cultures were washed, resuspended in fresh media, and split into 12 fresh
microtiter wells. Autologous frozen PBLs were added as antigen presenting cells at 5
x 104 PBL per well.
Screening antigens were added in duplicate to the 12 replicate wells from each
microtiter culture. Media was always used as a negative control, and purified human
recombinant MBP at 10 ug/ml was used a a positive control. Each patient was alsotested for reactivity with a maximum of 4 MBP peptides, each at a concentration of 10
CA 02203629 1997-04-24
wo 96/12737 PCT/US95/13682
uM. After 48 hours, the assays were pulsed with 0.75 uCi of 3H-thymidine, and
harvested after a 6- 16 hour pulse.
Cultures were scored as positive for each peptide according to the following
criteria: stimulation index greater than 3.0, change in cpm greater than or equal to
500, and standard error of the mean less than the change in cpm. In addition, for the
purposes of the analysis, cultures were scored as "peptide-positive" only if they
responded to both MBP and to the peptide, and if they did not respond to more than
one non-overlapping peptide. Reactivity with each of the peptides was tested using a
minimum of 19 and a maximum of 43 patients.
Results:
An average of 6% of the microtiter cultures scored positive for MBP reactivity
for each of the patients (range 0-37 MBP positive cultures per patient). At least one
microtiter culture scored positive for MBP reactivity in 77% of the patients, and these
15 individuals were considered to be "MBP responders". MBP responder status did not
correlate with gender, category of MS (RR vs. CP), HLA-DR type, age, or whether or
not the patient was taking Betaseron.
MBP peptides tested included a panel of 16 20-mers (Fig. 3) overlapping by 10
amino acids and covering the entire human MBP sequence (18.5 kD isoform). Two
20 additional longer peptides were also tested (MBP sequence (MBP 83-105 and MBP141-165, Fig. 3). MBP peptide reactivity was then calculated based on the proportion
of MBP positive microtiter cultures which also scored positive for one of the MBP
peptides. Four of the peptides each accounted for at least 10% of the total MBP
reactivity (MBP 11-30, MBP 81-100, MBP 83-105, and MBP 141-165). In addition,
25 reactivity to each of these peptides was detected in at least one third of the individual
MBP-responder MS patients in which they were tested. Moreover, 77% of MBP-
responder patients demonstrate reativity to either MBP 83-105 or MBP 141-165, orboth peptides.
MBP 141-165 was the most reactive of the four peptides, accounting for 21%
30 of the total MBP response, and detectable in 64% of the MBP-responder patients
tested. MBP 141-165 appears to include T cell epitopes from both MBP 141-160 andMBP 151-170, and surprisingly showed dramatically more reactivity than the two 20-
mer peptides. MBP 81-100 and MBP 83-105 are very similar in sequence and likely
to include similar if not identical T cell epitopes. They correspond to a region35 previously thought to be associated with the HLA-DR2 haplotype. Our results
indicate that both DR2 and non-DR2 MS patients have good reactivity to these
CA 02203629 1997-04-24
wo 96/12737 PCT/US95/13682
41
peptides. MBP 11-30 is an area of peptide reactivity that was previously not thought
to be recognized frequently in MS patients.
Each of the other MBP peptides accounted for less than 5% of the total MBP
reactivity, and was detected in 20% or fewer of the MBP-responder patients tested
5 (see, Figs 4a and 4b). The most reactivity among this group of peptides was found
with MBP 111-130, which accounted for 4.5% of the MBP reactivity and was found
in 19% of the MBP responders tested.
Selection of preferred MBP peptides
Preferred MBP peptides have been selected based on two criteria:
1. Number of MS patients responding to the candidate peptides (at least
75% of patients tested who respond to the protein antigen recognized at
least one of the peptides).
2. Magnitude of T cell response to the candidate peptide in MS patients
(response to the candidate peptides equals 40~o of the total response to
the antigen).
CA 02203629 1997-04-24
W O 96/12737 PCTnUS95/13682
42
MBP 83-105 (MBP-2) and MBP 141-165 (MBP-4) meet the first criteria (77%
of the MBP responders recognize one or both of them). See, Table l below. Together
these two peptides account for 32% of the MBP reactivity (see, Table 2, below).
Table 1
Responsiveness to MBP-2 and MBP-4: Analysis by individuals
% of MBP-2 MBP-4 MBP-2 and/or
individuals MBP-4
responding to
AmongMBP 11/31 [35.5%] 20/31 [64.5%] 24/31 [77.4%]
responders
Table 2
Responsiveness to MBP-2 and MBP-4: Analysis by T cell lines
% of MBP MBP positive MBP positive MBP positive
positive lines and MBP-2 and 141 - 165 and MBP-2 or
MBP-4
Among MBP 20/184 39/184 [21.1~o] 59/184 [32.1%]
positive lines [10.95%]
Thus. adding MBP 11 -30 (MBP- 1) meets the second criteria, since the three peptides
together account for 42% of the MBP reactivity. MBP l l l -130 (MBP-3) would also
be suitable as a preferred peptide for therapeutic use particularly in combination with
MBP-1, MBP-2, and MBP-4. MBP 81-100 appears equivalent to MBP 83-105 and
may also be used in conjunction with the other peptides selected as preferred.
20 EXAMPLE 2: Administration of Peptides to M~mm~ls for
Treatment of EAE as a Model for Multiple Sclerosis
Synthesis of Peptides
Peptides were prepared by automated peptide synthesis (ABI 430A, Applied
25 Biosciences, Foster City, CA) using standard 9-fluorenylmethoxycarbonyl chemistry.
Peptides were purified by high pressure liquid chromatography. and amino acid
CA 02203629 1997-04-24
wo 96/12737 PCT/US95/13682
43
composition was confirmed. Peptide sequences selected were MBP Ac l-l l
ASQKRPSQRHG; MBP Ac l - 11 [4A] ASQARPSQRHG; MBP Ac l - 11 [4Y]
ASQYRPSQRHG; MBP 31 -47 RHRDTGLDSIGRFFSG; Ova 323-339
ISQAVHAAHAEINEAGR; and Ova 323-337 ISQAVHAAHAEINEA.
s
MBP purification
MBP was prepared from guinea pig spinal cords (Keystone Biologicals,
Cleveland, OH) using a modification of the method of Smith, M.E., J. Neurochem.,1969, 16:83. Briefly, MBP was extracted from isolated myelin membranes using
10 chloroform and methanol, precipitated with potassium citrate, acid extracted, and
Iyophilized. SDS-PAGE analysis of this material showed a major band at the
expected molecular weight of 18.5 Kd.
EAE induction, scorin,~, and peptide therapy
EAE was induced in (PLJ x SJL) Fl mice obtained from the Jackson
Laboratory (Bar Harbor, ME). When the mice reached the age of 8-14 weeks, EAE
was induced by immunization with 50-100 ,ug of MBP emulsified in complete
Freund's adjuvant (Gibco Laboratories, Grand Island, NY), supplemented with an
additional 400,ug per mouse M. tuberculosis H37Ra (Difco Laboratories, Detroit,
20 MI). 200 ng pertussis toxin (JRH Biosciences, Lenexa, KS) was ~dminictered
intravenously at the time of immunization and 48 hours later. Mice were scored based
on clinical signs according to the following scale: 1, tail paralysis; 2, partial hind limb
paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or
dead. Grade 5 mice were euth~ni7ed. After death, mice were excluded from
25 subsequent calculations of mean clinical score. Peptides were ~(lministered
intravenously as described in the individual examples below.
For the Iymph node proliferation and IL2 production assays, inguinal and para-
aortic Iymph node lymphocyte suspensions were prepared from mice immunized as
described above for EAE induction (pertussis toxin was not included for the
30 proliferation experiments). Lymphocytes were cultured in round-bottom microtiter
plates at 5 x 105 per well with MBP peptides and RPMI 1640 supplemented with
0.5% fresh normal mouse serum, Penicillin-Streptomycin, L-glutamine, and 5 x 10~5
M 2-mercaptoethano]. Proliferation assay cultures were pulsed for 16 hours with 3H-
thymidine fol]owing a 72-hour incubation. For IL2 assays, culture supernatants were
35 harvested at 24 hours and examined for their ability to support the growth of the IL2-
dependent cell line HT2. In order to distinguish IL2 production from IL4 production,
CA 02203629 1997-04-24
W O96/12737 PCTAUS95/13682 44
HT2 bioassays were performed in the presence of the monoclonal antibody l l .B.11
10% culture supernatant (O'Harat J., et al., Nat~re,1985, 315:333), which inhibits IL4-
induced proliferation of the HT2 cells.
Results are shown in Figure 9 which indicates that Ac l -11 [4Y] reverses EAE
5 when a-lministered after the onset of paralysis. EAE was induced with MBP in groups
of 14 mice. Therapy was initiated in each mouse individually, after it had developed
clinical signs of EAE. Data are plotted relative to initiation of therapy for each
individual (day 1=onset of clinical signs for each individual mouse). Mice were
treated intravenously on days 1, 4, 11, and 18 of disease with PBS (open circle), 250
nmol Ac l - 11 [4Y] (closed squares), or 250 nmol Ova 323-337 (closed circles). An
additional control group received no treatment (open squares). Small crosses indicate
individual mice which died or were sacrificed for grade 5 EAE. MMS for the
untreated control group was 4.6, and mortality was 64%. MMS for the PBS treated
group was 4.4, and mortality was 35%. MMS for the Ova 323-337 treated group was
4.2, and mortality was 21 %. MMS for the Ac l - 11 [4Y] treated group was 3.2, and
mortality was 7%.
Figure 10 shows that Ac l - 11 [4Y] prevents EAE relapses when ~Aminictered
during the remission phase of disease. EAE was induced with MBP. Therapy was
initiated in each mouse individually, on the second day of remission after an initial
episode of EAE. Data are plotted relative to initiation of therapy for each individual
(day I = second day of remission). Groups of 6-7 surviving mice were treated
intravenously on days I, 4, 7, and 18 after the beginning of remission with either PBS
(open circles) or 25 nmol Ac l - 11 [4Y] (closed squares). Small crosses indicate
individual mice which died or were sacrificed for grade 5 EAE. Initial episodes of
disease prior to remission lasted from 3 to 18 days (mean 9 days for both groups).
MMS during the initial episode was similar for the two groups of mice (3.0 for the
PBS treated group, and 3.9 for the Ac l - 11 [4Y] treated group). MMS after treatment
for the PBS treated group was 4.1, and mortality was 33~o. MMS after treatment for
the peptide treated group was 0.3, and mortality was 0%.
Figure 11 showsthatintravenous~tlminictrationofAcl-ll orAcl-II[4Y]
induces T cell non-responsiveness.
a. Groups of 3-4 mice were pretreated intravenously with either PBS
(closed circles) or 250 nmol Acl-11 (closed triangles) ten and five days
prior to immunization with 150 ~lg MBP. Lymph node proliferation
assays with MBP Acl-11 were performed at day 9. Controls were as
CA 02203629 1997-04-24
wo 96/12737 PCT/US95/13682
follows: PBS pretreatment PPD 108277/medium 1855, and Acl-11
pretreatment PPD 88499/medium 1335.
b. Groups of 4 mice were pretreated intravenously with either PBS or 250
nmol Ac l - 11 [4Y] ten and five days prior to immunization with 150~g
S MBP. Lymph node IL2 production assays with 150 uM Acl-11 or 17 uM Ac l - 11 [4Y] were performed at day 10.
EXAMPLE 3
Administration of peptide in advanced sta,ee
Relapsing EAE develops in (PLJxSJL)F1 mice following immunization with
MBP (Fritz, R.B., et al., J. Immunol., 1983, 130: 1024), making this EAE model ideal
for investigating therapeutic intervention. Although MBP Ac l - l l is the
immunodominant encephalitogen in (PLJ x SJL)Fl mice, the subdominant epitope
MBP 31-47 is also encephalitogenic in this strain. In order to determine whether one
or both of these encephalitogenic peptides is required for treatment of MBP-induced
EAE, the steps of Example 2 were followed except groups of mice were treated in an
advanced stage of disease with intravenous injections of MBP Acl-11 and MBP 31-
47 together, or with Acl-11 alone. Groups of control mice were treated with
intravenous injections of PBS, or with the control peptide Ova 323-339, an Ao~UA~U
binding peptide which is unrelated to MBP and which is non-immunogenic in
(PLJxSJL)FI mice.
Flgure S shows that repeated intravenous injections of MBP Acl-l l, either
alone (Figure Sa) or in combination with MBP 31 -47 (Figure 5b). reduce the
incidence, severity, and mortality of EAE. Treatment with the two peptides appeared
to be somewhat more effective than treatment with MBP Ac l - 11 alone, consistent
with the observations of others mentioned above. Mice were treated with six
intravenous injections of peptide throughout the acute and first relapse phases. Mice
then were followed until day 125, during the chronic, remitting phase, with no
evidence of late disease in the MBP peptide-treated groups (data not shown). Thecontrol Ova 323-339 peptide had no effect on disease when administered by the
intravenous route (Figure Sc). In a separate experiment. intravenous ~rlmini.stration of
MBP 31-47 alone was not effective in treating EAE (data not shown). Figs. S(a), (b)
and (c) show the efficacy of intravenous treatment of mice with EAE induced withMBP. EAE was induced with MBP as set out above in groups of l l - 16 mice. Mice
were treated with intravenous injection of 250 nmol of each peptide beginning on days
9, 12, lS, 21, 29 and 37. Small crosses as used on all figures herein indicate
CA 02203629 1997-04-24
wo 96112737 PCr/US95/13682
46
individual mice which died or were sacrificed for grade 5 EAE. The control PBS-
treated group (closed circles) The results indicate that the immunodominant
encephalitogenic peptide of MBP is both necessary and sufficient to treat EAE
induced with MBP in (PLJ x SJL)Fl mice as indicated by a reduction in severity and
mortality of EAE in treated mice.
EXAMPLE 4
Multiple I.V. injections of Acl-l I
Following the preparation steps in Example 2, multiple injections of Acl-l I
were prepared. One injection of peptide at day 9 delayed disease for two days~ and
reduced mortality from 100% to 63%, but all of the treated mice ultimately developed
severe EAE (data not shown). Three injections of peptide during the acute phase of
EAE initially treated disease effectively, however, during the relapse phase the treated
group of mice developed late-onset disease (data not shown). Taken together, theresults indicate that multiple intravenous injections of MBP peptides during the acute
and first relapse phases of EAE are required for treating MBP-induced disease in (PLJ
x SJL)FI mice. Thus, multiple injections of Acl-l I are required for a prolongedreduction in disease severity. Figure 6 shows that Ac I - I I [4Y] treats EAE at a lower
dose than Ac I - I I, and has a longer-lasting effect on disease. EAE was induced with
MBP in groups of 8-10 mice. Figure 6a shows mice treated I.V. on days 12 and 15
with PBS (Phosphate Buffered Saline) (open circles), 250 nmol of Acl-l l(closed
squares), or 250 nmol Acl-l 1 [4Y] (open triangles). MMS for PBS treated mice was
4.4, and mortality was 60%. MMS for Ac 1-11 treated mice was 3.9, and mortality
was 37.5~o. MMS for Ac 1-1 1 [4Y] treated mice was 2.1, and mortality was 0~o.
Figure 6b shows mice treated I.V. on days 12, 115, 18, 21, 24, and 27 with either PBS
(open circles) or 2.5nmol Acl-l I (closed circles). MMS for PBS treated mice was2.9, and mortality was 20%. MMS for peptide treated mice was 4.3, and mortality
was 50%.
EXAMPLE 5
Treatment with a MBP peptide analo~ which forms stable complexes with class II
MHC in vivo
Since peptide-MHC complexes are the functional therapeutic units which treat
EAE, Applicants theorized that Ac 1-1 1 [4Y] would be more potent in treating active
MBP-induced EAE than Acl-l 1. To test this hypothesis, the steps of Example 2 were
carried out except the injection schedule and dosage was changed. Figure 6a shows
CA 02203629 1997-04-24
wo 96/12737 PCTrUS95/l3682
47
that only two injections of Ac l - 11 [4Y] early in the disease course produce a longer
lasting effect than two injections of Acl - I l . Moreover, Figure 6b shows that repeated
intravenous injections of Ac l - 11 [4Y] are highly effective at treating EAE at a dose of
2.5 nmol (Figure 6c). Thereafter, histological tests were performed. Histological
sections from EAE brains and spinal cords were prepared and stained with
hematoxylin and eosin (CVD, Inc., West Sacramento, CA). Sections were scored forinfl:~rnm~tory infiltrates on a scale of I -4 by a blinded observer. Efficacy of Ac l -
I l [4Y] was confirmed by histological e~min:~tion of brain and spinal cord sections
from peptide treated and PBS treated mice, which show markedly reduced number
and severity of inflammatory central nervous system infiltrates in the peptide treated
mice (Figure 7). Figure 7 demonstrates that inflammatory infiltrates are reduced in
mice treated with AC I - 11 [4Y]The improved potency of Ac l - 11 [4Y] was evident.
The improved potency of Ac l - 11 [4Y] was evident in the Example above.
Applicants theorized that stable peptide-MHC complexes are formed in vivo between
15 AaUA~u and Ac l - 11 [4Y] which has been injected intravenously thereby causing the
observed improved potency. These in vivo-formed complexes are detectable using the
1934 hybridoma, which was derived from an encephalitogenic MBP-specific T cell
clone. The steps in the above Example 2 were followed except injection times andamounts were adjusted as described below. The 1934 T cell hybridoma is specific for
MBP Acl-11 following the procedure outlined in Wraith, D.C., et al., Cell 1989,
59:247. Briefly, hybridoma cells were incubated at 5 x 104 per well in flat-bottom
microtiter plates with MBP peptides or peptide analogs. 5 x 105 (PLJ x SJL)FI
spleen cells, irradiated at 3000 rads, were added as antigen presenting cells. Medium
was the same as for the Iymph node proliferation assays, except the serum supplement
was 10% fetal calf serum rather than normal mouse serum. Supernatants were
harvested at 24 hours and examined for their ability to support the growth of HT2
cells. Thereafter, spleens were removed from injected mice at various times after
injection of 250 nmoles Ac l -11 [4Y], and the splenocytes used an antigen presenting
cells for the Ac 1 - l l -specific hybridoma 1934. No additional peptide was added to the
cultures. Figure 8 shows that spleen cells which have been "pulsed" in vivo with Ac l -
l l [4Y] are highly effective at activating the 1934 hybridoma. Capacity to activate the
hybridoma is maximal two hours after injection, then begins to decline by four to six
hours after injection. Activation is minim~l by ten hours after injection of Ac l -
I l [4Y], and is not present by twenty hours (data not shown). As can be seen from
35 Figure 8, experiments with Ac l - l l show no activation of the hybridoma by spleen
cells from injected mice, even at one hour following injection (data not shown). As
CA 02203629 1997-04-24
W O 96/12737 PCT~US95113682
48
shown in more detail in Figure 8, peptide-MHC complexes formed in vivo are
detectable in mice injected with Acl - 11 [4Y]. Groups of 2 mice were injected
intravenously with 250 nmol Ac l- 11 4Y] at various time points prior to removal of
spleens (1-10 hours). Splenocytes from the injected mice were examined for theircapacity to activate the 1934 hybridoma cells to produce IL2. Results are expressed in
terms of HT2 proliferation. The results support the hypothesis that formation of stable
peptide-MHC complexes in vivo contributes to the potency of a therapeutic MBP
peptide analog.
10 EXAMPLE 6
Synthesis of mouse MBP peptide Ac 1-11
Mouse MBP peptide Ac I - 11 was synthesized using standard Fmoc/tBoc
synthesis and purified by HPLC. The amino acid sequence for peptide Ac I - 11 is as
follows:
Induction of EAE
EAE was induced in 6 to 8 week old female (SJL x PL)Fl mice (Jackson Labs,
Bar Harbor, ME) by immunizing mice with 100 ~lg purified guinea pig MBP in CFA
(GIBCO Lab., Grand Island, NY) containing 400 llg H37RA strain M. tuberculosis
20 (DIFCO Lab., Detroit, MI) subcutaneously at the base of the tail. 200 ng Pertussis
Toxin (JHL BIOSCIENCE, Lenexa, Kansas) was given twice intravenously (i.v.) on
the day of immunization and also 48 hours later. Mice were monitored daily for
disease symptoms and were scored for disease severity on the following sca]e 0=no
clinical signs of EAE, I=limp, unresponsive tail, 2=partial hindlimb paralysis,
25 3=complete hindlimb paralysis, 4=partial to complete forelimb paralysis and
5=moribund. Data are expressed as the mean of the disease severity score on each day
including all the animals in the group. Mice were followed for 26 days. Once a
mouse died of EAE, a score of 5 was included in calculations for all subsequent days.
30 Effect of IFN-~ on EAE
In a titration experiment for the purposes of determining the effects of variousdosages of IFN-,B on EAE (Fig. 13). One group of mice was treated intraperitoneally
with PBS on days 9, 13, and 16 (control) after EAE induction, one group of mice were
treated with 10,000 units of IFN-~B on days 9, 13, and 16 (open circle) and one group
35 of mice were treated with 2,000 units of IFN-~ on days 9, 13, and 16 (closed circle).
As shown in Fig. 13, the symptoms of EAE are similar at each time point for both
CA 02203629 1997-04-24
wo 96/12737 PcrruS95/13682
49
dosages of IFN-,B, thereby indicating that the lower dosage would be suitable for
experiments with IFN-~ and is a preferred dosage as the chances of toxicity due to a
higher dose of IFN-~ are less likely. 2000 units of IFN-,B were then used in theremaining experiments shown in Figs 12a-12c as this dosage showed improvement inclinical score.
As shown in Fig 12a, a control group of mice was treated with PBS and
another group of mice were treated with 2000 units of IFN-,~ i.p. on days 9, 12, 16,
and 20. As shown in Fig. 12a, the group treated with IFN-,B only had slightly less
severe symptoms during the time course as those of the control group.
Effect of mouse MBP peptide Ac 1-11 on EAE
The effect of mouse MBP peptide Ac 1-11 was determined and the results are
shown in Fig. 12b. One group of mice was treated i.p. with PBS on days 10, 13, 17,
and 21 (control) after EAE induction, and one group of mice was treated i.v. with 250
nmol of peptide Ac 1-11 on days 10, 13, 17, and 21. The mice were monitored as
described above. As shown in Fig 12b, the mice treated with Ac 1-11 had less severe
symptoms than those of the control group.
Effect of treatment with a combination of peptide Ac 1-11 and IFN-~ on EAE
The effects of treatment with a combination of peptide Ac I - 11 and IFN-~ are
shown in Fig. 12c. One group of mice was treated i.p. with PBS (control) after EAE
induction, and one group of mice was treated i.v. with 250 nmol of peptide Ac 1- 11
on days 10, 13, 17 and 21 (open arrows) and treated i.p. with 2000 units of IFN-,B on
days 9, 12, 16, and 20. As shown in Fig. 12c, the group of mice treated with a
combination of peptide and IFN-~ showed a marked decrease in the severity of
symptoms as compared with the control group as well as compared to treatment with
either IFN-~ alone or peptide alone as shown in Fi~s. 12a and 12b indicating a
synergistic effect of the combination. Therefore, a treatment regimen which includes
a combination of peptide and IFN-,B provides an enhanced effect on diminishing the
severity of the symptoms of EAE.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more
than routine experimentation, numerous equivalents to the specific procedures
described herein. Such equivalents are considered to be within the scope of thisinvention and are covered by the following claims.
CA 02203629 1997-04-24
wo 96/12737 PCT/US95/13682
EXAMPLE 7: Administration of Peptides to l~mm~lc for
Tr~tm~t of Spinal Cord Homo~enate (SCH) Induced
EAE as a Model for Multiple Sclerosis
s
Synthesis of Peptides
Peptides were prepared by automated peptide synthesis (ABI 430A, Applied
Biosciences, Foster City, CA) using standard 9-fluorenylmethoxycarbonyl chemistry.
Peptides were purified by high pressure liquid chromatography, and amino acid
10 composition was confirmed. Peptide sequences selected were MBP Acl-11
ASQKRPSQRHG; MBP Ac l - 11 [4A] ASQARPSQRHG; MBP Ac l - 11 [4Y]
ASQYRPSQRHG; MBP 31 -47 RHRDTGILDSIGRFFSG; Ova 323-339
ISQAVHAAHAEINEAGR; and Ova 323-337 ISQAVHAAHAEINEA.
l S MBP purification
SCH was prepared from guinea pig spinal cords (Keystone Biologicals,
Cleveland, OH) using a modification of the method of Smith, M.E., J. Neurochem.,1969, 16:83. The SCH protein mixture was Iyophilized and used according to dry
weight.
EAE induction, scorin~, and peptide therapy
EAE was induced in (PLJ x SJL) Fl mice obtained from the Jackson
Laboratory (Bar Harbor, ME). When the mice reached the age of 8-14 weeks, EAE
was induced by immuni7~tion with 500-1000 ~lg of SCH emulsified in complete
25 Freund's adjuvant (Gibco Laboratories~ Grand Island, NY). supplemented with an
additional 400 ,~Lg per mouse M. tuberculosis H37Ra (Difco Laboratories, Detroit,
MI~. 200 ng pertussis toxin (JRH Biosciences, Lenexa, KS~ was ~mini~tered
intravenously at the time of immunization and 48 hours later. Mice were scored based
on clinical signs according to the following scale: 1, tail paralysis; 2, partial hind limb
30 paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or
dead. Grade 5 mice were euthanized. After death, mice were excluded from
subsequent calculations of mean clinical score. Peptides were ~lmini~tered
intravenously as described in the individual examples below.
Results are shown in Figure 16 which indicates that Ac l - l l [4Y] reverses
35 EAE when ~ministered after the onset of paralysis. EAE was induced with SCH in
groups of 14 mice. Therapy was initiated in each mouse individually, after it had
CA 02203629 1997-04-24
W O96/12737 PCTrUS95/13682
51
developed clinical signs of EAE. Data are plotted relative to initiation of therapy for
each individual (day l=onset of clinical signs for each individual mouse). Mice were
treated on days 1, 3, 6, and 9 of disease with PBS (closed square), 250 nmol Acl-
11 [4Y] i.v. (open triangles), or 250 nmol AcI[4Y] (open circles). A small asterisk
5 indicates individual mice which died or were sacrificed for grade 5 EAE.
Figure 17 shows that Ac l - 11 [4Y] prevents EAE onset when
:ltlmini.steredbefore symptoms of the disease are exhibited. EAE was induced with
SCH. Therapy was initiated in each mouse individually, on the eighth day after
disease induction with gpSCH. Data are plotted relative to initiation of therapy for
each individual. Groups of surviving mice were treated on days 8, 10, 13, and 17. 25
nmol Acl-11[4Y] i.v.(open triangles) or 25 nmol Acl-l lp4Y] s.c. (closed circles).
One group received no treatment (open squares).
Results shown on figs. 16 and 17 show that either route of ~mini.stration is
effective in preventing onset of symptoms.
EXAMPLE 8
The same procedure was followed as in Example 2, however, no Iymph node
proliferation and IL2 production assays were performed. EAE was induced using
gpMBP on day 0, thereafter Ac l - 11 [4Y] was administered to 3 groups of mice on day
8, 10, 13, and 17. The results are graphically represented on Fig. 18 for intravenous
adminictration (open triangles), subcutaneous injection (closed circles) and a control
(open circles). Pretreatment (e.g. treatment before display of symptoms) with Ac l -
11 [4Y] can prevent gpMBP induced EAE disease.
EXAMPLE 9 cDNA Encodin~ Human MOG Protein
In an initial attempt to obtain human DNA encoding MOG protein. a human
cDNA library was subjected to the polymerase chain reaction (PCR) using 3' and 5'
primers designed from the published rat MOG coding sequence of Gardinier et al.
(supra). The human MOG sequence could not be obtained in this manner, putativelydue to insufficient homology at the 5' and/or 3' ends of the human and rat sequences.
Therefore, four rat internal oligonucleotides were designed. Two of
them were homologous to the top strand of the gene (primers 94-111 and 166-183
(SEQ ID NO: 34), base I starting at the ATG) and two were homologous to the
bottom strand of the gene (primers 538-555 (SEQ ID NO: 35) and 685-702). The
combination of primers 166-183 (SEQ ID NO: 34) and 538-555 (SEQ ID NO: 35)
was successful in effecting the amplification of a fragment of the approximate]y 400
CA 02203629 1997-04-24
Wo 96/12737 PCr/uSg5/13682
52
bp expected size from a human brain cDNA library. The sequence of these primers
was:
a) 166-183: CAGAATCCGGGAAGAATGCCACGGGC (SEQ ID
NO: 34); and
b) 538-555: CAGCGGCCGCACGGAGTTTTCCTCTCAG (SEQ ID
NO: 35).
An EcoRI site is present in the 166-183 primer (SEQ ID NO: 34); a
NotI site is present in the 538-555 primer (SEQ ID NO: 35).
The 400 bp PCR product was cloned into expression vector pVL1393
by digesting pVL1393 (Pharmingen CA) with EcoRI and NotI, digesting the amplified
product with the same enzymes and ligating the resulting fragments. The insert was
verified by digesting several clones derived from the ligated plasmids with EcoRI and
NotI and sequencing the resulting 400 bp human MOG fragment. The resulting insert
putatively lacks 184 bp of 5' sequence and 201 bp of 3' sequence, based on the 738 bp
rat open reading frame.
Two primers were designed from the 400 bp insert from positions 346-
363 top and bottom strands as follows:
5'-CAGAATTCTCAGGTTCTCAGATGAAGGA-3' (SEQ ID NO:
36); and
5'-AAGCGGCCGCTATCCTTCATCTGAGAACCT-3' (SEQ ID NO:
37).
wherein an EcoRI site is present in the first strand and a NotI site in the second.
Underlined regions correspond to the MOG sequence.
The human MOG 346-363 top and bottom primers (SEQ ID NOS: 36
and 37) were used in combination with the above-mentioned 5' and 3' rat primers,respectively, to amplify the 5' and 3' missing ends of the gene from the same human
brain cDNA library as previously used. A PCR product corresponding the 3' end ofthe gene was obtained, but the corresponding 5' end did not result.
The 3' fragment obtained had the expected 400 bp size and this
fragment was cloned in pVL1393 and sequenced.
To obtain the 5' portion of the gene, a human brain medulla ~gtl0
library obtained from Clontech which had been previously amplified and had a titer of
8x10' pfu/ml was screened following the protocol described by the manufacturer.The library was plated onto 12 large plates at 30,000 plaques/plate and the plaques
were lifted onto nitrocellulose filters (2 replica filters/plate). Twelve filters lifted
from the 12 different plates were then hybridized to a 3~P labelled probe corresponding
CA 02203629 1997-04-24
Wo 96/12737 PCT/US95/13682
53
to the human MOG internal 400 bp fragment initially cloned (positions 184-534).
Twenty-two strong positives were obtained. A plug was picked for each positive from
the original plates and incubated overnight with ~ dilution buffer to elute the phage
from the agar. The tube was then centrifuged and the supernatant transferred.
The DNA was amplified from each individual pool using either a
gtlO forward primer with an SstII site:
5'-CTTTTGAGCAAGTTCAGCCTGGTTAAG-3' (SEQ ID NO: 38) or a ~gtlO
reverse primer with an XhoI site:
5'-ACCTCGAGGAGGTGGCTTATGAGTATTTCTTCCAGGGTA-3' (SEQ ID NO:
39) as well as a human MOG internal primer top or bottom strand:
5'-GGTGCGGGAAAGGTGACTCTCAGGATCCGGAAT-3' (SEQ ID NO:
40) or
5'-ATTCCGGATCCTGAGAGTCACCTTTCCCGCACC-3' (SEQ ID NO:
41).
The last two primers (SEQ ID NOS: 40 and 41) include a BamHI site
(underlined in the sequences) naturally present in the human MOG sequence.
The primers were used in four different combinations: 1) forward
top/internal MOG bottom; 2) reverse bottom/internal MOG bottom; 3) internal MOG
top/reverse bottom; and 4) internal MOG top/forward top.
The first two combinations provided the 5' end of the gene (up to the
BamHI site) and the last two, the 3' end of the gene. Both 5' and 3' portions include
untranslated regions. Which of the two members of each combination actually
resulted in the desired fragment depends on the orientation of the cDNAs cloned into
~gtl0.
The size of the fragments obtained varied from one pool to another.
Five of the largest 5' fragments or 3' fragments were subcloned into the SstII and
BamHI or BamHI and XhoI sites of the SK polylinker. Three clones from each pool
were then sequenced to rule out the presence of PCR errors. This provided the
complete sequence of the gene coding region as well as 174 bp of the 5' untranslated
sequence.
The complete DNA sequence recovered (SEQ ID NO: I ) and deduced
amino acid sequence (SEQ ID NO: 2) are shown in Figure 1.
The human MOG gene encodes a preprotein of 248 amino acids which
has 87~o homology with the 246 amino acids in the rat protein. The mature protein
contains 218 amino acids. numbered 1-218 in Figure I (SEQ ID NO: 2). The mature
protein begins at the glycine shown at position I and is derived from the 248 amino
CA 02203629 1997-04-24
wo 96/12737 PCT/USg5/13682
54
acid preprotein by cleavage from the presequence extending from the MET start
codon to the alanine residue immediately preceding the glycine shown in position 1.
EXAMPLE 9A Expression of truncated human MOG in SF-9 Insect cells
and E. coli
SF-9 Expression
The PVL1393 transfer vector containing the truncated human MOG cDNA
encoding amino acids I -121 of human MOG (the first 121 amino acids of SEQ ID
NO. 2) was cotransfected into SF-9 cells along with Baculogold linearized
Baculovirus DNA (Pharmingen, San Diego, CA). The culture supernatant containing
recombinant viruses was harvested after 4 days. The recombinant virus was plaquepurified and subjected to 3 rounds of amplification to obtain a high titer viral stock.
AF-9 cells were then infected with the viral stock at a MOI of 2Ø The supernatant
from infected cells was harvested 48 hours after infection and applied to a NiNTA
agarose column. The recombinant MOG protein was eluted under non-denaturing
conditions using 250 mM Imidazole, dialyzed against 5% propionic acid and H2O and
subsequently Iypophilized. The protein concentration was estimated by BCA. The
purified MOG protein was visualized on a 12.5% polyacrylamide gel stained with
Coomassie blue.
EXAMPLE 10
Truncated human MOG (huMOG) was prepared as disclosed in Examples 9
and 9A. MBP (guinea pid) was preapred as disclosed. The procedures of previous
Example 2 was followed except EAE was induced in three separate groups of mice by
using 75 ,ug gpMBP and 100 ~Lg huMOG (open triangles) and a combination of 75 ~Lg
gp MBP and 100 ~lg huMOG (closed squares). The graph in Fig. 19 shows the courseof disease for each for this example. The disease induced with both MOG and MBP
is much more severe than the disease induced by either alone. The results indicate
that both MOG and MBP contribute to the disease.
EXAMPLE 11
Disease was induced as in Example 10 using huMOG +gpMBP (Day 0 =
disease induction). Mice were treated before onset of symptoms with 250 nmoles of
Ac 1-11 [4Y] and a control (PBS) on days 6, 8, 10, 13, 17, 22 and 27 (arrows indicate
treatment). As the graph in Fig. 20 indicates, treatment with Ac I - I I [4Y] (open
CA 02203629 1997-04-24
WO 96/12737 - PCT/US95/13682
spaces) significantly reduced the mean clinical score as compared to controls (closed
squares).
