Note: Descriptions are shown in the official language in which they were submitted.
CA 022036~4 1997-04-24
W O 96/15147 PCT~US94/13206
~MAN STANNIOCALCIN-ALP~A
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention has putatively been
identified as hllmAn stanniocalcin-alpha. The invention also
relates to inhibiting the action of such polypeptides.
Stanniocalcin (formerly known as both teleocalcin and
hypocalcin) is an anti-hypercalcemic, glycoprotein hormone
that is produced by the corpuscles of stannius, endocrine
glands of the bony fishes. ~llmAn~ also produce a
stanniocalcin glycoprotein.
Stanniocalcin-alpha has sim;l Ar reported biological
activities to parathyroid hormone (PTH) and both of these
proteins ~rh;h; t dual functions in m~mmAls. They exert
hypercalcemic a^tivity possibly due to stimlll~tion of bone
resorption (Endocrinology 119:2249-2255 (1986)) and
hypocalcaemic activity in fish. The hypocalcaemic activity
is possibly due to inhibition of gill calcium influx (J. Exp.
Biol., 140:199-208 (1988)). Further, PTH has a biphasic
action on bone metabolism, i.e., at low doses it increases
bone formation, while at high doses it increases bone
--1--
CA 022036~4 1997-04-24
W O 96/15147 PCTrUS94/13206
reæorption. Accordingly, both the polypeptide itself and an
antagonist, under different circumstances, may be used to
treat osteoporosis.
The Corpuscles of Stannius protein of non-hllm~n~ has
been studied extensively. Recently, a Corpuscles of Stannius
protein has been purified and cloned from Anguilla australis.
The kidneys of teleost fish have been found to contain
secretory granules, the Corpuscles of Stannius. Electron
microscopy indicates that the granules are of a proteinaceous
nature and may represent honmones or enzymes of unrecognized
physiological and biochemical function (Butkus, A. et al.
Mol. Cell Endocrinol, 54:123-33 (1987)).
There has also been isolated and purified a glycoprotein
from the Corpuscles of Stannius of trout, which is considered
hypocalcin, the major hypocalcemic hormone of fish. This
product is present in relatively large amounts in the
Corpuscles of Stannius of several species (i.e., European
eel, tilapia goldfish, and carp). Hypocalcin is typically
released from the Corpuscles of Stannius in response to an
exper;m~nt~lly induced increase of the blood calcium
concentration. Ultrastructural observations show that after
this treatment the hypocalcin-proAllc~ng cell type of the
corpuscles of stannius are almo t completely degranulated.
The isolated glycoprotein has an apparent molecular weight of
54 kDa. (Lafeber F. P. et al., Gen Comp. Endocrinol, 69:19-30
(1988)).
Moreover, it has recently been shown that several
synthetic peptide fragments of teleocalcin inhibit calcium
uptake in juvenile rainbow trout (Salmo Gairdneri). The N-
terminal peptides (amino acids 1 to 20) of both eel and
~ l mon teleocalcin significantly inhibit 45Ca uptake at the
high point of the calcium uptake cycle (up to 75~), although
the effective doses of the peptides on a molar basis were 20
to 200 times that of the intact molecule. In contrast, the
C-terminal fragment of eel teleocalcin (amino acids 202 to
CA 022036~4 1997-04-24
W096/15147 PCT~S94/13206
231) did not have an ~nh;h~tory effect on calcium uptake
(Milliken C. E. et al., Gen. Comp. Endocrinol, 77:416-22
(1990) ) .
There has also been a description of the purification
and characterization of two s~l m~ stanniocalcins, and the
~mi n~tion of the regulation of honmone secretion in
response to calcium using both in ~itro and in vivo model
systems. The molecular cloniny and cDNA sequence analysis of
a coho g~lmnn stanniocalcin messenger RNA (mRNA) from a
s;~ on Cs 1;~mhA~ gtlO cDNA library is described. The
stanniocalcin mRNA in salmon is ~ro~imately 2 kDa in length
and PncoA~ a primary translation product of 256 amino acids.
The first 33 residues comprise the ~ e~otein region of the
hormone, whereas the re~n~ng 223 residues make up the
mature form of the hormone. (Wagner G. F. et al., Mol. Cell
Endocrinol, 90:7-15 (1992)).
The polypeptide of the present invention has been
putatively identified as hllm~n stanniocalcin-alpha. This
identification has been made as a result of amino acid
sequence homology.
In accordance with one aspect of the present invention,
there is provided a novel putative mature polypeptide which
is hllm~n stanniocalcin-alpha, as well as biologically active
and diagnostically or therapeutically useful fragments,
analogs and derivatives thereof.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
encoding hl~m~n stanniocalcin-alpha, including mRNAs, DNAs,
cDNAs, genomic DNA as well as antisense analogs thereof and
biologically active and diagnostically or therapeutically
useful fragm~n~s thereof.
In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techni~ues comprising culturing
recombinant prokaryotic and/or eukaryotic host cells,
CA 022036~4 1997-04-24
W O9611S147 PCTrUS94113206
contA~n~ng a human stanniocalcin-alpha nucleic acid sequence,
under conditions promoting expression of said protein and
subsequent recovery of said protein.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptide, or polynucleotide encoding such polypeptide, for
therapeutic purposes, for example, to treat electrolyte
disorders which lead to renal, and heart diseases and, due to
a biphasic action of the polypeptide it may be employed to
treat, osteoporosis, Paget's Disease and osteopetrosis.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
In accordance with yet another aspect of the present
invention, there are provided antagonists to such
polypeptides, which may be used to inhibit the action of such
polypeptides, for example, in the treatment of osteoporosis
and hypocalcemia. Hypocalcemia can arise from a number of
different causes including renal failure,
hyperparathyroidism, severe infections, pancreatic
insufficiency or burns which trap calcium from the inter-
cellular fluid. Hypocalcemia results in tetany, con w lsions
and other related disorders.
In accordance with still another aspect of the present
invention, there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to hllm~n stanniocalcin-alpha sequences.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
The following drawings are illustrative of embodiments
of the invention and are not meant to limit the scope of the
invention as encompassed by the claims.
Figure 1 displays the cDNA sequence and corresponding
deduced amino acid sequence of the human stanniocalcin-alpha
--4--
CA 022036~4 1997-04-24
WO 96/15147 PCTrUS94/13206
protein. The st~n~rd three-letter abbreviations for amino
acids are used.
Figure 2 is an amino acid co~r~rison of stanniocalcin
from Anguilla Australis (lower line) and hn~n stanniocalcin-
alpha (upper line). There are 35% identical amino acid
residues in a 170 amino acid overlap and a total s;m~l~rity
of 55%.
Figure 3 is an amino acid sequence comr~rison of hllm~n
stanniocalcin (upper line) and ~ n stanniocalcin-alpha
(lower line).
Figure 4 is a photograph of a gel depicting hnm~n
Stanniocalcin-alpha after bacterial expression and
purification. Lane 1 is st~nd~rd molecular weight markers
and lanes 2 and 3 are both the hllm-n stanniocalcin-alpha
protein but lane 3 has a greater concentration of protein.
Figure 5 is a gel which displays the results of
baculovirus expression of hnm~n stanniocalcin-alpha.
In accordance with an aspect of the present invention,
there is provided an isolated nucleic acid (polynucleotide)
which encodes for the mature polypeptide having the deduced
amino acid sequence of Figure 1 or for the mature polypeptide
encoded by the cDNA of the clone deposited as ATCC Deposit
No. 75831 on July 15, 1994.
The polynucleotide of this invention was discovered in
a CDNA library derived from lung fibroblast cells. It is
structurally related to the hllm~n stanniocalcin family. It
contains an open reading frame encoding a protein of about
251 amino acid residues of which approximately the first 40
amino acids residues are the putative leader sequence such
that the mature protein comprises 211 amino acids. The
protein exhibits the highest degree of homology to hllm~n
stanniocalcin with 28 ~ identity and 64 % similarity over the
entire amino acid stretch.
The polynucleotide o~ the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
--5--
~, .
CA 022036~4 1997-04-24
WO96/15147 PCT~S94/13206
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
str~n~e~ or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which encodes the mature polypeptide may be
identical to the coding sequence shown in Figure 1 or that of
the deposited clone or may be a different coding sequence
which coding sequence, as a result of the r~lm~ncy or
degeneracy of the genetic code, encodes the same mature
polypeptide as the DNA of Figure 1 or the deposited cDNA.
The polynucleotide which encodes for the mature
polypeptide of Figure 1 or for the mature polypeptide encoded
by the deposited cDNA may include: only the coding sequence
for the mature polypeptide; the coding sequence for the
mature polypeptide and additional coding sequence such as a
leader or secretory sequence or a proprotein sequence; the
coding sequence for the mature polypeptide (and optionally
additional coding sequence) and non-coding sequence, such as
introns or non-coding sequence 5' and/or 3' of the coding
sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequence of Figure 1 or the
polypeptide encoded by the cDNA of the deposited clone. The
variant of the polynucleotide may be a naturally occurring
allelic variant of the polynucleotide or a non-naturally
occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in Figure 1 or
the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides
CA 022036~4 1997-04-24
W O96/15147 PCTrUS94/13206
which variants encode for a fragment, derivative or analog of
the polypeptide of Figure 1 or the polypeptide ~nCo~pd by the
cDNA of the deposited clone. Such nucleotide variants
include deletion variants, substitution variants and addition
or insertion variants.
As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic
variant of the coding sequence shown in Figure 1 or of the
coding sequence of the deposited clone. As known in the art,
an allelic variant is an alternate form of a polynucleotide
sequence which may have a substitution, deletion or addition
of one or more nucleotides, which does not substantially
alter the function of the encoded polypeptide.
The present invention also includes polynucleotides,
wherein the coding sequence for the mature polypeptide may be
fused in the same reading frame to a polynucleotide sequence
which aids in expression and secretion of a polypeptide from
a host cell, for example, a leader sequence which functions
as a secretory sequence for controlling transport of a
polypeptide from the cell. The polypeptide having a leader
sequence is a preprotein and may have the leader sequence
cleaved by the host cell to form the mature form of the
polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 51
amino acid residues. A mature protein having a prosequence
is a proprotein and is an inactive form of the protein. Once
the prosequence is cleaved an active mature protein rem~ n~,
Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein
having a prosequence or for a protein having both a
prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for purification of the polypeptide of the
present invention. The marker sequence is preferably a hexa-
CA 022036~4 1997-04-24
W O96115147 PCT~US94/13206
histidine tag supplied by a vector, for example a pQE-9 or
pQE-60 vector, to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial
host, or, for example, the marker se~uence may be a
hemagglnttntn (HA) tag when a m~mm~ n host, e.g. COS-7
cells, is used. The HA tag corresponds to an epitope derived
from the influenza hemagglutinin protein (Wilson, I., et al.,
Cell, 37:767 (1984)).
The present invention further relates to
polynucleotides which hybridize to the herein~hove-described
sequences if there is at least 50~ and preferably 70~
identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the here;n~hove-described
polynucleotides. As herein used, the term "stringent
conditions" means hybridization will occur only if there is
at least 95~ and preferably at least 97~ identity between the
sequences. The polynucleotides which hybridize to the
her~tn~hove described polynucleotides in a preferred
embo~;mPnt encode polypeptides which retain-substantially the
same biological function or activity as the mature
polypeptide encoded by the cDNA of Figure 1 or the deposited
cDNA.
The deposit(s) referred to herein will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-org~n;smc for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides cont~ine~ in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein by
reference and are controlling in the event of any conflict
with any description of sequences herein. A license may be
CA 022036~4 1997-04-24
W O 96/15147 PCTrUS94/13206
required to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to a hllm~n
stanniocalcin-alpha polypeptide which has the deduced amino
acid sequence of Figure 1 or which has the amino acid
sequence encoded by the deposited cDNA, as well as
fragments, analogs and derivatives of such polypeptide.
The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of Figure 1 or that PncoAe~ by
the deposited cDNA, means a polypeptide which retains
ess~nt~lly the same biological function or activity as such
polypeptide. Thus, an analog includes a proprotein which can
be activated by cleavage of the ~lu~lo~ein portion to produce
an active mature polypeptide.
The polypeptide of the present invention may be a
reco~h;n~nt polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a rec~mhtn~nt polypeptide.
The fragment, derivative or analog of the polypeptide
of Figure 1 or that encoded by the deposited cDNA may be (i)
one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid
residue (preferably a conæer~ed amino acid residue) and such
substituted amino acid residue may or may not be one encoded
by the genetic code, or (ii) one in which one or more of the
amino acid residues include a substituent group, or (iii) one
in which the mature polypeptide is fused with another
compound, such as a compound to increase the half-life of the
polypeptide (for example, polyethylene glycol), or (iv) one
in which the additional amino acids are fused to the mature
polypeptide, such as a leader or secretory se~uence or a
se~uence which is employed for purification of the mature
polypeptide or a proprotein se~uence. Such fragments,
derivatives and analogs are deemed to be within the scope of
those skilled in the art from the teachings herein.
,
CA 022036~4 1997-04-24
WO96/15147 PCT~S94/13206
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
The term "isolated" means that the material is removed
from its original envilu~lllle~lt (e.g., the natural envilo~",e~lt
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a living
~n~m~l iS not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the
invention and the production of polypeptides of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
...oters, selecting transformants or amplifying the h~lm~n
stanniocalcin-alpha genes. The culture conditions, such as
temperature, pH and the like, are those previously used with
the host cell selected for expression, and will be apparent
to the ordinarily skilled artisan.
The polynucleotides of the present invention may be
employed for producing polypeptides by recombinant
techniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
-10--
CA 022036~4 1997-04-24
WO96/1~147 PCT~S94/13206
expressing a polypeptide. Such vectors include chromosomal,
nnnchromosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from
~omh;n~tions of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is
replicable and viable in the host.
The a~lu~iate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
~n~nnllclease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an d~o~riate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the E. coli. lac or trp, the phage l~mh~ PL
oter and other ~rollloters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also cont~'n~ a ribosome h~n~ng site
for translation initiation and a transcription terminator.
The vector may also include a~Lo~riate sequences for
amplifying expression.
In addition, the expression vectors preferably contain
one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
The vector cont~in~ng the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control se~uence, may be employed to transform an appropriate
host to permit the host to express the protein.
--11--
CA 022036~4 1997-04-24
WO96/1s147 PcT~ss4ll32o6
As representative examples of appropriate hosts, there
may be mentioned: bacterial cells, such as E. coli,
strePtomYces, S~lmonella tYPhimurium; fungal cells, such as
yeast; insect cells such as Droso~hila S2 and Sf9; ~n~
cells such as CHO, COS or Bowes m~l~nom~; adenoviruses; plant
cells, etc. The selection of an appropriate host is deemed
to be within the scope of those skilled in the art from the
teachings herein.
More particularly, the present invention also includes
recombinant constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of this
embo~;mPnt, the construct further comprises regulatory
sequences, including, for example, a promoter, operably
linked to the sequence. Large nllmhprs of suitable vectors
and ~Lo.~.~ters are known to those of skill in the art, and are
commercially available. The following vectors are provided
by way of example. Bacterial: pQE70, pQE6~, pQE-9 (Qiagen),
pBS, pDl0, phagescript, psiXl74, pbluescript SK, pBSKS,
pNH8A, pNHl6a, pNHl8A, pNH46A (Stratagene); ptrc99a, pKK223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Bukaryotic: pWLNEO,
pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
using CAT (chlor~mrh~n;col transferase) vectors or other
vectors with selectable markers. Two appropriate vectors are
PKK232-8 and PCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp.
Bukaryotic promoters include CMV ~mmP~l~te early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriate
CA 022036~4 l997-04-24
96/15147 PCTrUS94/13206
vector and ~L~"IoLer is well within the level of ordinary
~kill in the art.
In a further embo~mpnt~ the present invention relates
to host cells cont~n~ng the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEAB-
Dextran m~;Ated transfection, or electroporation. (Davis,
L., Dibner, M., Battey, I., Basic Methods in Molecular
Biology, (1986)).
The constructs in host cells can be used in a
conventional m~nner to produce the gene product Pnco~P~ by
the reC~mh~nAnt sequence. Alternatively, the polypeptides of
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in m~mm~ n cells,
yeast, bacteria, or other cells under the control of
d~lo~riate ~Lol~loters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
A~lo~iate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory M~nllAl, Second
Bdition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an Pnh~n~er sequence into the vector. ~nh~ncers
are cis-acting elements of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
Examples including the SV40 enhancer on the late side of the
replication origin bp 100 to 270, a cytomegalovirus early
CA 022036~4 1997-04-24
WO96/15147 PCT~S94/13206
promoter Pnh~ncer, the polyoma ~nh~ncer on the late side of
the replication origin, and adenovirus ~nh~ncers.
Generally, recomh~n~nt expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a ~lul,loter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
~ul~loters can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assembled in appropriate
phase with translation initiation and termination seguences,
and preferably, a leader seguence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics,
e.g., stabilization or simplified purification of expressed
recombinant product.
Useful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable reading phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, Salmonella tY~himurium and various species
within the genera Psell~omnn~c, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice.
As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a
-14-
CA 022036~4 1997-04-24
WO96/1~147 PCT~Ss4/13206
selectable marker and bacterial origin of replication derived
from commercially av~ hl e plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl
(Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are c~mh;ne~ with an ~ o~riate ~ro...oter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and
growth of the host strain to an ~Lu~riate cell density, the
selected promoter is induced by d~Lu~riate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the resulting
crude extract ret~ine~ for further purification.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysing agents, such methods are well know to those skilled in
the art.
Various m~m~ n cell culture systems can also be
employed to express recombinant protein. Examples of
m~m~l ian expression systems include the COS-7 lines of
monkey kidney ~ibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines capable of expressing a
compatible vector, for example, the Cl27, 3T3, CHO, HeLa and
BHK cell lines. ~mm~ n expression vectors will comprise
an origin of replication, a suitable promoter and enhancer,
and also any necessary ribosome hi n~ing sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5~ flanking
nontranscribed sequences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
-15-
CA 022036~4 1997-04-24
wos6/1sl47 PcT~S94/13206
The hllm~n stanniocalcin-alpha polypeptides can be
recovered and purified from recom.binant cell cultures by
methods including ~mm~n;um sulfate or ethanol precipitation,
acid extraction, anion or cation ~ch~nge chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding
steps can be used, as necessary, in completing configuration
of the mature protein. Finally, high performance liquid
chromatography (HPLC) can be employed for final purification
steps.
The polypeptides of the present invention may be a
naturally purified product, or a product of chemical
synthetic procedures, or produced by reco~h;n~nt techniques
from a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and ~mm~ n cells in
culture). Depending upon the host employed in a recom.binant
production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
~ lm~n stanniocalcin-alpha A~m;n; stration may be used for
therapeutic treatment of numerous electrolyte-based diseases.
One cause of arterial hypertension is abnormal Na+ transport
across the cell wall of the vascular smooth muscle cells due
to a defect in or ;nh;h;tion of the Na+-K+ pump, another is
increased permeability to Na+ as has been described in some
forms of hnm~n hypertension. The net result is an increase
in intra-cellular Na+, which makes the cell more sensitive to
vasoconstrictive agents. Since Ca++ follows Na+, it is
postulated that it is the accumulation of intra-cellular Ca++
and not Na+ per se that is responsible for increased
sensitivity to sympathetic stimulation. Accordingly, since
hllm~n stanniocalcin-alpha can function as a hypocalcemic
CA 022036~4 1997-04-24
WO96tlS147 PCT~S94/13206
agent, it can help to offset this increased intra-cellular
Ca++ and reduce or prevent hypertension.
Further, hypercalcemia has been implicated in heart
dysrhythmi~s, coma and cardia arrest. Accordingly, hllm~n
stanniocalcin-alpha may have therapeutic value for the
treatment of these disorders by lowering the concentration of
free Ca++.
Hypertension is also directly related to renal
disorders. Accordingly, a higher or lower than normal
concentration of electrolytes can cause renal m.alfunction and
directly lead to other disorders. As an exam.ple, Ca++-
phosphorous ; mh~ l~nce can cause muscle and bone pain,
rl~mineralization of the bones and calcification in various
organs including the brain, eyes, myocardia and blood
vessels. Accordingly, the polypeptide of the present
invention may be used to offset disorders that are due to a
Ca++-phosphate ; mh~ l~nce. Renal failure itself leads to an
abnormally high concentration of phosphate in the blood which
can be reduced to nonmal concentrations by hllm~n
stanniocalcin-alpha.
~ n stanniocalcin-alpha is also useful for the
treatment of certain bone diseases, in that, it may have a
biphasic action on bone metabolism, i.e., at low doses it may
increase bone formation, while at high doses it increases
bone resorption. Therefore, ~mi n; stration of low doses of
hllm~n stanniocalcin-alpha may be employed to treat
osteoporosis and ~ministration of high doses may be employed
to treat osteopetrosis, which is an ove~yLo~Lh and sclerosis
of bone with the marked thickening of the bony cortex and
narrowing or filling of the marrow cavity.
The causes of hypercalcemia may also be a number of
different disorders including hyperparathyroidism,
hypervit~minosis D, tumors that raise the serum Ca++ levels
by destroying bone, sarcoidosis, hyperthyroidism, adrenal
insufficiency, loss of serum albumin, secondary renal
CA 022036~4 1997-04-24
W O 96/15147 PCTAUS94/13206
diseases, excessive gastrointestinal calcium absorption and
elevated concentration of plasma proteins. Accordingly,
h~ n stanniocalcin-alpha is effective in re~llci n~
hypercalcemia and its related disorders.
~ llm~n stanniocalcin-alpha may also be employed for the
treatment of other disorders relating to unusual electrolyte
concentrations and fluid imh~ l~nce, for example, migraine
hPA~ches.
Fragments of the full length hllm~n stanniocalcin-~lrh~
gene may be used as a hybridization probe for a cDNA library
to isolate the full length gene and to isolate other genes
which have a high sequence s; m;l~rity to the gene or similar
biological activity. Probes of this type can be, for
example, between 20 and 2000 bases. Preferably, however, the
probes have between 30 and 50 base pairs. The probe may also
be used to i~lentify a cDNA clone corresponding to a full
length transcript and a genomic clone or clones that contain
the complete human stanniocalcin-alpha gene including
regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of
the gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a
sequence compl~m~nt~ry to that of the gene of the present
invention are used to screen a library of human cDNA, genomic
DNA or mRNA to determine which members of the library the
probe hybridizes to.
This invention provides a method for identification of
hllm~n stanniocalcin-alpha receptors. The gene encoding the
receptor can be identified by numerous methods known to those
of skill in the art, for example, ligand p~nning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1(2),
Chapter 5, (1991)). Preferably, expression cloning is
employed wherein polyadenylated RNA is prepared from a cell
responsive to human stanniocalcin-alpha, and a cDNA library
created from this RNA is divided into pools and used to
-18-
CA 022036~4 1997-04-24
WO96tlS147 PCT~S94/13206
transfect COS cells or other cells that are not responsive to
the h~ n stanniocalcin-alpha protein. Transfected cells
which are grown on glass slides are exposed to labeled hllm~n
stanniocalcin-alpha. The stanniocalcin-alpha can be labeled
by a variety of means including iodination or inclusion of a
recognition site for a site-specific protein kinase.
Following fixation and incubation, the slides are subjected
to autoradiographic analysis. Positive pools are identified
and sub-pools are prepared and retransfected using an
iterative sub-pooling and rescreening process, eventually
yielding a single clone that ~nco~es the putative receptor.
As an alternative approach for receptor identification,
labeled hllm~n stanniocalcin-alpha can be photoaffinity linked
with cell ,~ ne or extract preparations that express the
receptor molecule. Cross-linked material is resolved by PAGE
and exposed to X-ray film. The labeled complex cont~ning
the ligand-receptor can be excised, resolved into peptide
fragments, and subjected to protein microsequencing. The
amino acid se~uence obt~neA from microse~lPnc~ng would be
used to design a set of degenerate oligonucleotide probes to
screen a cDNA library to identify the gene encoding the
putative receptor.
This invention also provides a method of screening
compounds to identify agonists and antagonists of hllm~n
stanniocalcin-alpha. As an example, a bioassay may be
performed wherein the assay components comprise a m~m~l ian
cell or membrane preparation expressing a hllm~n
stanniocalcin-alpha receptor on the surface thereof, labeled
calcium, for example 45Ca++, and the compound to be screened.
If the compound is an effective human stanniocalcin-alpha
agonist it will mimic the human stanniocalcin-alpha receptor
ligand such that there is 45Ca++ uptake by the cell or
membrane in the absence of human stanniocalcin-alpha. The
amount of 45Ca++ uptake can be determined by taking advantage
of the radioactive l~bel. When screening for an antagonist,
--19--
CA 022036~4 1997-04-24
W O 96/lS147 PCTrUS94/13206
hn~n stanniocalcin-alpha is added to the bioassay and the
ability of the compound to ; nh;h; t 45Ca+~ uptake by
interfering with the interaction of hllm~n stanniocalcin-alpha
and its receptor can be determined in the same m~nner.
Alternatively, the response of a known second messenger
system following interaction of hnm~n stanniocalcin-alpha and
the receptor would be measured and comp~red in the presence
and ahsence of the compound. Such second messenger systems
include but are not limited to, cAMP guanylate cyclase, ion
ch~nn~ls or phosphoinositide hydrolysis.
Potential hll~n stanniocalcin-alpha antagonists include
antibodies or in some cases, oligonucleotides, which bind to
huam stanniocalcin-alpha and eliminate its function.
Antagonists also include polypeptides which bind to hllm~n
stanniocalcin-alpha receptors and effectively block the
receptor from hllm~n stanniocalcin-alpha. These polypeptides
are proteins which are closely related to hll~~n
stanniocalcin-alpha but have lost natural biological
function, an example is a mutated form of hll~-n
stanniocalcin-alpha.
~ llm~n stanniocalcin-alpha antagonists also include anti-
sense constructs. Antisense technology can be used to
control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on
h;n~l;ng of a polynucleotide to DNA or RNA. For example, the
5~ coding portion of the polynucleotide sequence, which
encodes for the mature polypeptides of the present invention,
is used to design an antisense RNA oligonucleotide of from
about 10 to 40 base pairs in length. A DNA oligonucleotide
is designed to be complementary to a region of the gene
involved in transcription (triple helix -see Lee et al.,
Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360
(1991)), thereby preventing transcription and the production
of hnm~n stanniocalcin-alpha. The antisense RNA
-20-
CA 022036~4 1997-04-24
W O 96/15147 PCTrUS94/13206
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the hllm~n
stanniocalcin-alpha polypeptide (Antisense - Okano, J.
Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense
Tnh;h; tors of Gene Expression, CRC Press, Boca Raton, FL
(1988)). The oligonucleotides described above can also be
delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to ;nh;h; t production of hllm:ln
stanniocalcin-alpha protein.
~ lm~n stanniocalcin-alpha antagonists also include small
molecules which bind to the active site of the polypeptide
making it unable to im.part biological function. Exam.ples of
small molecules include but are not limited to small peptides
or peptide-like molecules.
The antagonists may be employed to block the st;m~ tion
of bone resorption by a high concentration of hllm~n
stanniocalcin-alpha and, accordingly, may be employed to
treat osteoporosis.
The hllm~n stanniocalcin-alpha antagonists may also be
employed to treat hypocalcemia and Paget's disease among
other disorders where an increase in calcium levels is
desired. The antagonists may be employed in a composition
with a pharmaceutically acceptable carrier, e.g., as
hereinafter described.
The hnm~n stanniocalcin-alpha polypeptides of the
present invention, and agonist and antagonist compounds, may
be employed in combination with a suitable pharmaceutical
carrier. Such pharmaceutical compositions comprise a
therapeutically effective amount of the polypeptide, and a
pharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
~mt ni stration-
--21--
CA 022036~4 1997-04-24
WO96/1s147 PCT~S94/13206
The invention also provides a pharmaceutical pack or kit
comprising one or more cont~;nPrs filled with one or more of
the ingredients of the pharmaceutical compositions of the
invention. Associated with such contA;ner(s) can be a notice
in the form prescribed by a govPrnmPntal agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects ~Loval by the agency of
manufacture, use or sale for hllm-n ~mtn; stration. In
addition, the pharmaceutical compositions may be employed in
conjunction with other therapeutic compounds.
The pharmaceutical compositions m.ay be ~mlnl stered in
a convenient m-nn~r such as by the oral, topical,
intravenous, intraperitoneal, intramuscular, subcllt~neous,
intr~n~l or intradermal routes. The pharmaceutical
compositions are ~m;n;~tered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In general, the pharmaceutical compositions will be
~m;n; ~tered in an amount of at least about lO ~g/kg body
weight and in most cases they will be ~m~ n; stered in an
amount not in excess of about 8 mg/Kg body weight per day.
In most cases, the dosage is from about lO ~g/kg to about l
mg/kg body weight daily, taking into account the routes of
~m; n; stration, symptoms, etc.
The hll~-n stanniocalcin-alpha polypeptides, and agonists
and antagonists which are also polypeptides, may be employed
in accordance with the present invention by expression of
such polypeptides in vivo, which is often referred to as
"gene therapy."
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use of a
-22-
CA 022036~4 1997-04-24
WO96/15147 PcT~s94113206
retroviral particle cont~;ning RNA encoding a polypeptide of
the present invention.
S~m~ rly, cells may be engineered in vivo for
expreæsion of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle cont~n~ng RNA
encoding the polypeptide of the present invention may be
~m~ n~ stered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
methods for ~m~ n~ stering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the teachings of the preæent invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
be used to engineer cells in vivo after ~omh~n~tion with a
suitable delivery vehicle.
This invention is also related to the use of the
stannicalcin-alpha gene as part of a diagnostic assay for
detecting diseases or susceptibility to diseases related to
the presence of mutated h~ n stanniocalcin-alpha. Such
diseases are related to an under-expression of hllm~n
stanniocalcin-alpha, for example, hypertension.
Individuals carrying mutations in the ht-~n
stanniocalcin-alpha gene may be detected at the DNA le~el by
a variety of techniques. Nucleic acids for diagnosis may be
obt~ne~ from a patient's cells, such as from blood, urine,
saliva, tissue biopsy and autopsy material. The genomic DNA
may be used directly for detection or may be amplified
enzymatically by using PCR (Saiki et al., Nature, 324:163-166
(1986)) prior to analysis. RNA or cDNA may also be used for
the same purpose. As an example, PCR primers complementary
to the nucleic acid encoding human stanniocalcin-alpha can be
used to identify and analyze human stanniocalcin-alpha
~ mutations. For example, deletions and insertions can be
detected by a change in size of the amplified product in
CA 022036~4 1997-04-24
W O96/15147 PCTrUS94/13206
cQmr~riSon to the normal genotype. Point mutations can be
identi~ied by hybridizing amplified DNA to radiolabeled hllm~n
stanniocalcin-alpha RNA or alternatively, radiolabeled hllm~n
stanniocalcin-alpha antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting
temperatures.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic
mr~hll; ty of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be distingll;she~ on
denaturing formamidine gradient gels in which the mobilities
of different DNA fragments are retarded in the gel at
different positions according to their specific melting or
partial melting temperatures (see, e.g., Myers et al .,
Science, 230:1242 (1985)).
Sequence changes at specific locations may also be
revealed by nuclease protection assays, such as RNase and Sl
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of
restriction enzymes, (e.g., Restriction Fragment Length
Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and
DNA sequencing, mutations can also be detected by in si tu
analysis.
The sequences of the present invention are also valuable
for chromosome identification. The se~uence is specifically
targeted to and can hybridize with a particular location on
an individual hllm~n chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome. Few
-24-
CA 022036~4 1997-04-24
WO 96/15147 PCTrUS94/13206
chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with genes associated with
disease.
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA.
Computer analysis of the 3' untranslated region of the
sequence is used to rapidly select primers that do not span
more than one exon in the genomic DNA, thus complicating the
amplification process. These primers are then used for PCR
screening of somatic cell hybrids ~o~t~;n~ng individual hllm~n
chromosomes. Only those hybrids cont~;ntng the hllm~n gene
corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels of
fragments from specific chromosomes or pools of large genomic
clones in an analogous m~nnPr Other mapping strategies that
can similarly be used to map to its chromosome include in
situ hybridization, prescreening with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in si tu hybridization (FISH) of a cDNA
clone to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 500 or 600 bases;
however, clones larger than 2,000 bp have a higher likelihood
of binding to a unique chromosomal location with sufficient
signal intensity for simple detection. FISH requires use of
the clones from which an express sequence tag (EST) was
derived, and the longer the better. For example, 2,000 bp is
good, 4,000 is better, and more than 4,000 is probably not
-25-
CA 022036~4 1997-04-24
WO96/1s147 PCT~S94/13206
necessary to get good results a reasonable percentage of the
time. For a review of this technique, see Verma et al.,
n Chromosomes: a M~nll~ 1 of Basic Techniques, PeL~",
Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusick, M~n~l ;An
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkaye
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
of between 50 and 500 potential causative genes. (This
assumes l megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an ~mmllnogen to produce antibodies thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes rh~m~ric, single chain,
and hllm~n~zed antibodies, as well as Fab fragments, or the
product of an Fab expression library. Various procedures
known in the art may be used for the production of such
antibodies and fragments.
-26-
CA 022036~4 1997-04-24
W O 96/15147 PCTrUS94/13206
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obtained by direct injection of the polypeptides into an
An;mAl or by A~m; n; stering the polypeptides to an An;m~l,
preferably a nonh~ n. The antibody so obt~A;neA will then
bind the polypeptides itself. In this mAnner~ even a
sequence encoding only a fragment of the polypeptides can be
used to generate antibodies h; n~i; n~ the whole native
polypeptides. Such ~nt; hodies can then be used to isolate
the polyp~ptide from tissue expressing that polypeptide.
For preparation of monoclonal Antihodies, any technique
which provides antibodies produced by continuous cell line
cultures can be used. Examples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:4g5-497),
the trioma technique, the hnm~n B-cell hybridoma technique
(Kozbor et al., 1983, Tmmllnology Today 4:72), and the EBV-
hybridoma technique to produce hll~-n monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
Ant; hodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to ;m~llnogenic polypeptide products
of this invention. Also, transgenic mice may be used to
express hllmAnized antibodies to ;mmllnogenic polypeptide
products of this invention.
The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate underst~n~ing of the following
examples certain frequently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
-27-
CA 022036~4 1997-04-24
W O96/15147 PCTrUS94/13206
starting plasmids herein are either rsmmPrcially av~ hl e,
publicly aV~ hl e on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are cn~ ~rcially av~ hl e and their reaction
conditions, cofactors and other re~uirements were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~l
of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 units of enzyme in a larger
volume. A~ro~liate buffers and substrate amounts for
particular restriction enzymes are specified by the
manufacturer. Incubation times of about l hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier~s instructions. After digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation of the cleaved fragments is performed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without adding a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
-28-
CA 022036~4 1997-04-24
W O 96/15147 PCTnUS94/13206
"Ligation" refers to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with 10 units to T4 DNA ligase
(nligase") per 0.5 ~g of d~lo~Limately equimolar amounts of
the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
Exam~le 1
Bacterial ExF)ression and Purification of ~llm~n Stanniocalcin-
Al~ha
The DNA sequence ~ncoA~ng hl~-n stanniocalcin-alpha ATCC
# 75831, is initially amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the
stanniocalcin-alpha cotl;ng sequences. The 5' oligonucleotide
primer has the sequence 5' GACTACAl~lc~l~;CCGAGCGGCTGGCr 3'
cont~n~ a Afl III restriction enzyme site and 20 nucleotides
of stanniocalcin-alpha coding sequence starting from the
presumed methionine start codon. The 3' sequence 5'
G~CTAGAl~ lw~CTCTGGGAGGTG 3' contains complementary
sequences to a Bgl II site and is followed by 20 nucleotides
of stanniocalcin-alpha. A pQE-60 vector (Qiagen, Inc. 9259
Eton Avenue, Chatsworth, CA, 91311) Pnco~e.s antibiotic
resistance (Ampr), a bacterial origin of replication (ori), an
IPTG-regulatable promoter operator (P/O), a ribosome binding
site (RBS), a 6-His tag and restriction enzyme sites. pQE-60
is digested with Afl III and Bgl II. The amplified sequences
are ligated into pQE-60 after digestion with Afl III and Bgl
II and are inserted in frame with the sequence encoding ~or
the histidine tag and the RBS. The ligation mixture is then
used to transform the E. coli strain M15/rep 4 available ~rom
Qiagen by the procedure described in Sambrook, J. et al.,
Molecular Cloning: A Laboratory r~l~n~ , Cold Spring
--29-
CA 022036~4 1997-04-24
WO96/lSl47 PCT~S94/13206
~aboratory Press, (1989). M15/rep4 contA~n~ multiple copies
of the plasmid pREP4, which expresses the lacI repressor and
also confers kanamycin resistance (Kanr). Transformants are
i~nt; f ied by their ability to grow on LB plates and
ampicillin/kanamycin resistant colonies are selected. Plasmid
DN~ is isolated and confirmed by restriction analysis.
Clones con~A~n;ng the desired constructs are grown overnight
(O/N) in liquid culture in LB mP~1~ supplemented with both
Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used
to inoculate a large culture at a ratio of 1:100 to 1:250.
The cells are grown to an optical density 600 (O.D.~) of
between 0.4 and 0.6. IPTG ("Iso~Lo~yl-B-D-thiogalacto
pyranoside") is then ~Ae~ to a final concentration of 1 mM.
IPTG induces by inactivating the lacI repressor, clearing the
P/O l~A~;ng to increased gene expression. Cells are grown an
extra 3 to 4 hours. Cells are then harvested by
centrifugation (20 mins at 6000Xg). The cell pellet is
solubilized in the chaotropic agent 6 Molar Guanidine HCl.
After clarification, solubilized stanniocalcin-alpha is
purified from this solution by chromatography on a Nickel-
Chelate column under conditions that allow for tight h~n~;n~
by proteins ron~;n;ng the 6-His tag (Hochuli, E. et al.,
Genetic Engineering, Principles & Methods, 12:87-98 (1990)).
Protein renaturation out of GnHCl can be accomplished by
several protocols (Jaenicke, R. and Rudolph, R., Protein
Structure - A Practical Approach, IRL Press, New York
(1990)). Initially, step dialysis is utilized to remove the
GnHC~. Alternatively, the purified protein isolated from the
Ni-chelate column can be bound to a second column over which
a decreasing l;nPAr GnHCL gradient is run. The protein is
allowed to renature while bound to the column and is
subse~uently eluted with a buffer contA;n~ng 250 mM
Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10~
Glycerol. Finally, soluble protein is dialyzed against a
-30-
CA 022036~4 1997-04-24
W O96/15147 PCTrUS9~/13206
storage buffer c~n~ning 5 mM ~mmo~um Bicarbonate. The
purified protein was analyzed by SDS-PAGE (Figure 4).
ExamT~le 2
Expression of Recombinant ~llm~n stanniocalcin-alPha in COS
cells
The expression of plasmid, stanniocalcin-alpha HA is
deri~ed from a vector pcDNAI/Amp (Invitrogen) cont~n~ng: 1)
SV40 origin of replication, 2) ampir~ n resistance gene, 3)
E.coli replication origin, 4) CMV promoter followed by a
polylinker region, an SV40 intron and polyadenylation site.
A DNA fragment encoding the entire stanniocalcin-alpha
precursor and a HA tag fused in frame to its 3' end was
cloned into the polyl~nker region of the vector, therefore,
the recomh~n~nt protein expression is directed under the CMV
---oter. The HA tag correspond to an epitope derived from
the influenza hemagglutinin protein as previously described
(I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly,
and R. T-ernPr, 1984, Cell 37, 767). The infusion of HA tag
to the target protein allows easy detection of the
recombinant protein with an antibody that recognizes the HA
epitope.
The plasmid construction strategy is described as
follows:
The DNA sequence encoding stanniocalcin-alpha was
constructed by PCR on the original express sequence tag (EST)
cloned using two primeræ: the 5' primer 5~GACTAAGCTTA
l~l~l~CCGAGCGGCTGGGC 3' contains a Hind III site followed by
21 nucleotides of stanniocalcin-alpha coding sequence
starting from the initiation codon; the 3' sequence 5'
GA~-l-l~-lAGACTAAGoGTA~l~-l~GAC~l~lATGGGTACTCCTGGGCTCTGGGAGGTG
3' contains complementary sequences to an Xba I site,
translation stop codon, HA tag and the last 20 nucleotides of
the stanniocalcin-alpha coding sequence (not including the
stop codon). Therefore, the PCR product cont~n~ a Hind III
-31-
CA 022036~4 1997-04-24
W O 96/15147 PCTrUS94/13206
site, stanniocalcin-alpha coding sequence followed by HA tag
fused in frame, a translation termination stop codon next to
the HA tag, and an Xba I site. The PCR amplified DNA
fragment and the vector, pcDNAI/Amp, were digested with Hind
III and Xba I restriction enzyme and ligated. The ligation
mixture was transformed into E. coli strain SURE (aV~ hl e
from Stratagene Cloning Systems, 11099 North Torrey Pines
Road, La Jolla, CA 92037) the transformed culture was plated
on ampir;ll~n media plates and resistant colonies were
selected. Plasmid DNA was isolated from transformants and
~m~ ned by restriction analysis for the presence of the
correct fragment. For expression of the recombinant
stanniocalcin-alpha, COS cells were transfected with the
expression vector by DEAE-DEXTRAN method (J. Sambrook, E.
Fritsch, T. Maniatis, Molecular Cloning: A Laboratory ~n~
Cold Spring Laboratory Press, ~1989)). The expression of the
stanniocalcin-alpha HA protein was detected by the
radiolabelling and ~ lnoprecipitation method (E. Harlow, D.
Lane, Antibodies: A Laboratory ~nll~ l, Cold Spring Harbor
Laboratory Press, (1988)). Cells were l~h~l led for 8 hours
with 35S-cysteine two days post transfection. Culture media
was then collected and cells were lysed with detergent (RIPA
buffer (150 mM NaCl, 1~ NP-40, 0.1% SDS, 1~ NP-40, 0.5~ DOC,
50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media were precipitated with an
HA specific monoclonal antibody. Proteins precipitated were
analyzed on 15~ SDS-PAGE gels.
ExamPle 3
Cloninq and expression of Human stanniocalcin-alpha usinq the
baculovirus expression sYstem
The DNA sequence encoding the full length stanniocalcin-
alpha protein, ATCC # 75831, is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3
se~uences of the gene:
-32-
CA 022036~4 1997-04-24
W O 96/15147 PCT~US94/13206
The 5' primer has the sequence 5'
GACTGGATCCGCCACCAl~l~l~CCGAGCGGCTGG&C 3' and con~nC a BamHI
restriction enzyme site (in bold) followed by 6 nucleotides
resembling an efficient signal for the initiation of
translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950 (1987) which is just behind the first 21
nucleotides of the stanniocalcin-alpha gene (the initiation
codon for translation ~ATG~ is underltnPA).
The 3' primer has the sequence 5'
GA~ lACCCTACTCCTGGGw ~-l~aGG 3' and co~t~ nC the cleavage
site for the restriction en~nmlclease Asp 718 and 21
nucleotides compl~mPnt~ry to the 3' sequence of the
stanniocalcin-alpha gene. The amplified sequences are
isolated from a 1% agarose gel using a co~mercially av~ hle
kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment
is then digested with the ~n~onll~leases BamHI and Asp 718 and
then purified again on a 1~ agarose gel. This fragment is
designated F2.
The vector pRGl (modification of pV~941 vector,
discussed below) is used for the expression of the
stanniocalcin-alpha protein using the baculovirus expression
system (for review see: Summers, M.D. and Smith, G.E. 1987,
A m~nll~l of methods for baculovirus vectors and insect cell
culture procedures, Texas Agricultural Experimental Station
Bulletin No. 1555). This expression vector contains the
strong polyhedrin promoter of the Autographa californica
nuclear polyhedrosis virus (AcMNPV) followed by the
recognition sites for the restriction endonucleases BamHI and
Asp 718. The polyadenylation site of the simian virus (SV)40
is used for efficient polyadenylation.=For an easy selection
of recombinant viruses the beta-galactosidase gene from
E.coli is inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at
both sides by viral seguences for the cell-mediated
-33-
CA 022036~4 1997-04-24
WO96/15147 PCT~S94/13206
homologous recQ~h;n~tion of cotransfected wild-type viral
DNA. Many other baculovirus vectors could be used in place
of pRG1 such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and
Summers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymes
BamHI and Asp 718 and then dephosphorylated using calf
intestinal phosphatase by procedures known in the art. The
DNA is then isolated from a 1~ agarose gel using the
commercially av~ hle kit ("Geneclean" BI0 101 Inc., La
Jolla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are
ligated with T4 DNA ligase. E.coli B 101 cells are then
transformed and bacteria identified that contained the
plasmid (pBac-stanniocalcin-alpha) with the stanniocalcin-
alpha gene using the enzymes BamHI and Asp 718. The sequence
of the cloned fragment is confirmed by DNA se~uencing.
~g of the plasmid pBac-stanniocalcin-alpha is
cotransfected with 1.0 ~g of a commercially av~ hle
linearized baculovirus ("BaculoGold~ baculovirus DNA",
Pharmingen, San Diego, CA.) using the lipofection method
(Felgner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417
(1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid
pBac-stanniocalcin-alpha are mixed in a sterile well of a
microtiter plate contA;n;ng 50 ~1 of serum free Grace~s
medium (Life Technologies Inc., Gaithersburg, MD).
Afterwards 10 ~l Lipofectin plus 90 ~l Grace's medium are
~e~, mixed and incubated for 15 minutes at room
temperature. Then the transfection mixture is added dropwise
to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm
tissue culture plate with 1 ml Grace's medium without serum.
The plate is rocked back and forth to mix the newly ~
solution. The plate is then incubated for 5 hours at 27C.
After 5 hours the transfection solution is removed from the
plate and 1 ml of Grace's insect medium supplemented with 10
-34-
CA 022036~4 1997-04-24
WO96/lS147 PCT~S94/13206
fetal calf serum is A~ . The plate is put back into an
incubator and cultivation continued at 27C for four days.
After four days the supernatant is collected and a
pla~ue assay performed S~m; 1 ~r as described by Summers and
Smith (supra). As a modification an agarose gel with "Blue
Gal" (Life Technologies Inc., Gaithersburg) is used which
allows an easy isolation of blue st~ne~ plaques. (A
detailed description of a "plague assay" can also be found in
the user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution, the viruses are
~ to the cells, blue st~;ne~ plaques are picked with the
tip of an Eppendorf pipette. The agar contA;n;ng the
recombinant viruses is then resuspended in an Eppendorf tube
cont~;n;ng 200 ~l of Grace's medium. The agar is ~e",~ved by
a brief centrifugation and the supernatant cont~;n~ng the
recombinant baculoviruses is used to infect Sf9 cells seeded
in 35 mm dishes. Four days later the supernatants of these
culture dishes are harvested and then stored at 4C.
Sf9 cells are grown in Grace's medium supplemented with
l0~ heat-inactivated FBS. The cells are infected with the
recombinant baculovirus V-stanniocalcin-alpha at a
multiplicity of infection (MOI) of 2. Six hours later the
medium is removed and replaced with SF900 II medium minus
methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 ~Ci of 35S-methionine and 5
~Ci 35S cysteine (Amersham) are added. The cells are further
incubated for 16 hours before they are harvested by
centrifugation and the labelled proteins visualized by SDS-
PAGE and autoradiography (Figure 5). In Figure 5 the gel
indicates that stanniocalcin-alpha exists as a homodimer.
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the
-35-
-
CA 02203654 1997-04-24
W O96/15147 PCTrUS9~/13206
invention may be practiced otherwise than as particularly
described.
-36-
CA 02203654 1997-04-24
W O 96tlS147 PCTrUS94/13206
SEQu~:N~ LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: OLSEN, ET AL.
(ii) TITLE OF lNv~NllON~ m~n St~nniocalcin-alpha
(iii) NUMBER OF SEQUEN OES: 8
(iv) CO~R~-SPONDENCE ~nn~R-~S:
(A) ~nnR~.cs~ R~r.T.~, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART ~ OLSTEIN
(B) Sl~l: 6 BEC~ER FARM ROAD
(C) CITY: ROSET-~ND
(D) STATE: NEW JERSEY
(E) ~OUN-1KY: USA
(F) ZIP: 07068
(v) COM~U-1~K READABLE FORM:
(A) MEDI~M TYPE: 3.5 INCH DISKETTE
(B) COM~ul~K: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(~ri) CTJ~RRNT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Concurrently
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER:
(B) FILING DATE:
-37-
CA 02203654 1997-04-24
WO96/15147 PCT~S94/13206
(viii) ATTORNEY/AGEh-T lN~O.~IATION:
(A) NAME: FRRR~R.O, rRRr~oRy D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-200
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQ~ CHARACTERISTICS
(A) L~N~1~: 892 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRA~~l~N~:~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SEQ~ ~ DESCRIPTION: SEQ ID NO:1:
GAATTCGGCA CGAGAGGAGG AGGAGGAAGA GGGGAGCACA AAGGATCCAG ~1~- CCC~AC 60
GGGAGGTTAA TACCAAGAAC CATGTGTGCC GAGC'~G~IGG GCCAGTTCAT GACCCTGGCT 120
llG~l~l-lGG CCAC~l-l ~A CCCGGC'GCGG GGGACCGACG CCACCAACCC ACCCGAGGGT 180
CCC~ CA GGAGCTCCCA GCAGAAAGGC CGC~I~lCCC TGCAGAATAC AGCGGAGATC 240
CAGCACTGTT TGGTCAACGC TGGCGATGTG G4~.~1~GCG l~ll-l~AATG TTTCGAGAAC 300
AA~-l~-ll~lG AGAl-lCGGGG CTTACATGGG ATTTGCATGA ~-.l-l-l~-.~C'A CAACGCTGGA 360
AAATTTGATG CCCAGGGCAA GTCATTCATC A~AGACGCCT TGAAATGTAA GGCCCACGCT 420
CTGCGGCACA G~lIC~GCTG CATAAGCCGG AAGTGCCCGG CCATCAGGGA AAla~l~lCC 480
CAGTTGGAGC GGGAATGCTA CCTCAAGCAC GACCTGTGCG CGG~-lGCC'C-A GGAGAACACC 540
CGG~lGATAG TGGAGATGAT CCATTTCAAG GACTTGCTGC TGCACGAACC CTACGTGGAC 600
~-lC~lGAACT TGCTGCTGAC CTGTGGGGAG GAGGTGAAGG AGGCCATCAC CCACAGCGTG 660
CAGGTTCAGT GTGAGCAGAA ~-l~GGGAAGC CTGTGCTCCA TCTTGAGCTT CTGCACCTCG 720
GACATCCAGA AGC~-lCCLAC GGCGCCCCCC GAGCGCCAGC CCCAGGTGGA CAGAACCAAG 780
~I~-lC'~AGGG CCCACCACGG GGGAAGAAGG ACATCACCTC CCAGAGCCCA GGAGTAGGGA 840
GACTGGCCGA GGTGCCAAGG GTGAGCGAGG TAGCAAGAGC CACCCAAACG CC 892
CA 02203654 1997-04-24
WO96/15147 PCT~S94/13206
(2) INFORMATION FOR SEQ ID NO:2:
(i) SE~N~ CHARACTERISTICS
(A) L~N~l~: 251 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SE~uhN~ DESCRIPTION: SEQ ID NO:2:
Met Cys Ala Glu Arg Leu Gly Gln Phe Met Thr ~eu Ala Leu Val
-40 -35 -30
Leu Ala Thr Phe Asp Pro Ala Arg Gly Thr Asp Ala Thr Asn Pro
-25 -20 -15
Pro Glu Gly Pro Gln Asp Arg Ser Ser Gln Gln Lys Gly Arg Leu
-10 -5 1 5
Ser Leu Gln Asn Thr Ala Glu Ile Gln His Cys Leu Val Asn Ala
Gly Asp Val Gly Cys Gly Val Phe Glu Cys Phe Glu Asn Asn Ser
Cys Glu Ile Arg Gly Leu His Gly Ile Cys Met Thr Phe Leu His
Asn Ala Gly Lys Phe Asp Ala Gln Gly Lys Ser Phe Ile Lys Asp
Ala Leu Lys Cys Lys Ala His Ala Leu Arg His Arg Phe Gly Cys
Ile Ser Arg Lys Cys Pro Ala Ile Arg Glu Met Val Ser Gln Leu
Gln Arg Gly Cys Thr Leu Lys His Asp Ley Cys Ala Ala Ala Gln
100 105 110
Glu Asn Thr Arg Val Ile Val Glu Met Ile His Phe Lys Asp Leu
115 120 125
Leu Leu His Gly Pro Tyr Val Asp Leu Val Asn Leu Leu Leu Thr
130 135 140
-39-
CA 02203654 1997-04-24
W O 96/15147 PCTrUS94/13206
Cys Gly Glu Glu Val Lys Glu Ala Ile Thr His Ser Val Gln Val
145 150 155
Gln Cys Glu Gln Asn Trp Gly Ser Leu Cys Ser Ile Leu Ser Phe
160 165 170
Cys Thr Ser Asp Ile Gln Lys Pro Pro Thr Ala Pro Pro Glu Arg
175 180 185
Gln Pro Gln Val Asp Arg Thr Lys Leu Ser Arg Ala His His Gly
190 195 200
Gly Arg Arg Thr Ser Pro Pro Arg Ala Gln Glu
- 205 210
(2) INFORMATION FOR SEQ ID NO:3:
(i) SE~ L~ CHARACTERISTICS
(A) LkN~ln: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~N~SS: SINGLB
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: oligonucleotide
(xi) S~Q~ DESCRIPTION: SEQ ID NO:3:
GACTACAl~l~l~CCGAGCGGCTGGG 26
(2) lN~O~ ~TION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) Ilhl`l~l~l: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: oligonucleotide
-40-
CA 02203654 1997-04-24
W O96/15147 PCTAUS94/13206
(Xi) SEgU~ DESCRIPTION: SEQ ID NO 4
GACTAGA1-~-1~-1~-1-~CTCTGGGAGGTG 30
(2) INFORMATION FOR SEQ ID NO:5:
(i) SE~U~N~ CHARACTERISTICS
(A) L~;N~1~: 31 BASE PAIRS
(B) TYPE NUCLEIC ACID
(C) STRAN-VEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE oligonucleotide
(Xi) SE~Uk~ DESCRIPTION SEQ ID NO 5
GACTAAGCTTA1~1G1~CCGAGCGGCTGGGC 31
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEgU~N~ CHARACTERISTICS
(A) LENG~ 60 BASE PAIRS
(B) TYPE NUCLEIC ACID
(C) STR~V~V~SS SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE oligonucleotide
(Xi) SEQUENCE DESCRIPTION SEQ ID NO 6:
GACTTCTAGACTAAGCGTA~1~-1GGGAC~1~1ATGGGTA~LC~-1GGG~ W GGGAGGT 60
(2) INFORMATION FOR SEQ ID NO 7:
(1) SEQUENCE CHARACTERISTICS
- (A) LKN~1~ 37 BASE PAIRS
-41-
CA 02203654 1997-04-24
W O 96/15147 PCTrUS94/13206
(B) TYPE: NUCLEIC ACID
(C) STRAN~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: 01igOnUC1eOtide
(Xi) SEQU~N~ DESCRIPTION: SEQ ID NO:7:
GACTGGATCCGCCACCA1~1~1GCCGAGCCGGCTGGGC 37
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQU~N~ CHARACTERISTICS
(A) L~N~1~: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANI~ N~:~S: SINGLE
(D) TOPOLOGY: T.TNR~
(ii) MOLECULE TYPE: 01igOnUC1eOtide
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
GACTGGTACCCTAW-~1~GGCTCTGGGAGG 31
-42-
