Note: Descriptions are shown in the official language in which they were submitted.
CA 02207278 1999-02-18
1
METHOD OF PRODUCING AND PURIFYING ENZYMES
Field of the Invention
The present invention relates generally to enzymes;
and more particularly to the production and purification of
enzymes.
Background of the Invention
A number of valuable enzymes are currently produced
only intracellularly, presenting significant purification
problems. Most of these enzymes currently can only be
produced in a purified form, free of cellular and other
detrimental materials, by use of lengthy and costly
procedures. It would be advantageous to be able to produce
such enzymes in a purified form by a simple method.
There also are a significant number of intracellular
and extracellular enzymes that are not currently available in
stabilized forms, and there are a number of enzymes that would
be more useful if they were immobilized on a nontoxic
biodegradable support. It would be advantageous to be able to
produce enzymes in a stabilized form or immobilized on a non-
toxic biodegradable support.
Brief Summarv of the Invention
The method of the present invention comprises
selecting a spore-forming host organism, forming a genetic
construct comprising a first DNA sequence encoding a desired
enzyme and a second DNA sequence directing synthesis of the
desired enzyme during sporulation. The host organism is then
transformed with the genetic construct and cultured under
24080-706
CA 02207278 1999-02-18
2
sporulating conditions so that the desired enzyme is produced
in a form which is integrally associated with the mature
spore, thus making it possible to remove undesired impurities
from the spore-enzyme combination by methods for the
purification of spores known to those skilled in the art.
The invention particularly provides a method of
producing and isolating a fusion protein comprising the steps
of
(a) providing a genetic construct encoding a protein,
wherein the genetic construct comprises a first portion
encoding a desired target enzyme and a spore coat protein
which, when transcribed and translated, expresses a fusion
protein between the spore coat protein and the target enzyme,
and a second portion comprising a DNA sequence causing the
transcription of the DNA encoding the fusion protein during
sporulation of the organism;
(b) transforming a suitable spore-forming host organism
with the genetic construct of step (a);
(c) culturing the transformed organism under sporulating
conditions wherein spores are formed which have the fusion
protein integrally associated with the spore coat; and
(d) removing undesired impurities from the spore bearing
the spore coat-fusion protein combination.
In a preferred form of the invention, the construct
comprises a DNA sequence encoding a spore coat protein which,
when transcribed and translated, expresses a fusion protein
between the spore coat protein and the target enzyme. This
24080-706
CA 02207278 1999-02-18
2a
spore coat protein will preferably form part of the spore coat
of the wild type organism and provide a means whereby the
desired enzyme may be integrally associated with the spore
coat of the transformed organism.
In a preferred form of the present invention, the
enzyme is an active form. By "active form" we mean that on
average, each spore expresses enzyme activity equivalent to
the activity of at least 1 x 103 molecules, and preferably at
least 1 x 104 molecules, of the native enzyme.
If it is desired to isolate the enzyme from the
spore of the host organism, the fusion protein between the
spore coat protein and the target enzyme can be cleaved, as by
use of a protease, or acid treatment or other known methods,
to obtain the enzyme separated from the spore coat. A
covalent bond may like the spore coat protein and the enzyme.
The spore of the host organism with the enzyme
integrally associated thereto is a preferred stable form of
the enzyme and can be used as an immobilized form of the
enzyme.
It is an aim of the present invention to provide a
simple, novel method of producing and purifying enzymes.
It also is an aim to produce intracellular enzymes
extracelluarly so that the enzymes can be more simply
purified.
Further aims are to disclose a novel method of
producing stabilized enzymes and the stabilized enzymes thus
produced.
24080-706
CA 02207278 1999-02-18
2b
Still further aims are to disclose a method of
producing enzymes immobilized on a non-toxic biodegradable
support and the immobilized enzymes thus produced.
It will be apparent to those skilled in the art that
other aims, advantages and features will become apparent after
review of the specification, claims and figures presented
herein.
Description of the Drawing's
Figs. lA and 1B are diagrams of lysozyme sensitivity
of spores from strains PY79 and the cotC-lacZ fusion strain.
Fig. lA diagrams the light scattering properties of PY79
24080-706
CA 02207278 1997-06-06
WO 96!23063 PCTIUS96/00728
3
spores with intact coats in the absence or presence of
lysozyme and decocted PY79 spores in the absence or presence
of lysozyme. Fig. 1B diagrams the light scattering properties
of spores of the cotC-lac2 fusion strain in the absence or
presence of lysozyme and decocted cotC-lacZ fusion strain in
the absence or presence of lysozyme.
Fig. 2 is a graph of the stability of spores of the cotC-
IacZ fusion strain under turnover conditions.
Fig. 3 is a graph of KM values for native j3-galactosidase
and the CotC-J3-galactosidase fusion in the spore coat of
spores from the cotC-lacZ fusion strain.
Fig. 4 is a pH activity profile for native ~i-
galactosidase and the CotC-J3-galactosidase fusion in the spore
coat of spores for the cotC-lacZ fusion strain.
Fig. 5 is a diagram of temperature sensitivity of native
~3-galactosidase and the CotC-~i-galactosidase fusion in the
spore coat of spores from the cotC-lacZ fusion. strain.
Description of Preferred Embodiment
Especially preferred as a host organism for non-
glycosylated enzymes that normally are produced by their
parent organism intracellularly are spore forming strains of
Bacillus subtilis. B. subtilis is a nonpathogenic, GRAS
(Generally Recognized As Safe) organism which forms spores
when cultured at about 36°C to about 38°C in the presence of
an assimilable source of carbon and nitrogen and other
minerals in a nutrient medium that will support growth
(described in detail below).
The spore coat of B. subtilis is the outermost protective
layer of the spore. It is composed more than a dozen proteins
(J. Errington, Microbiol. Rev. 57:1-33, 1993). A number of
the genes encoding proteins comprising the spore coat have
been cloned by reverse genetic techniques in which proteins
are extracted from the spore coat, purified, sequenced, and
the gene cloned using the deduced nucleotide sequence of the
protein.
At present, the coat genes cotA, cotB, cotC, cotD (W.
Donovan, et al., J. Mol. Biol. 196:1-10, 1987), cotE (L.
CA 02207278 1999-02-18
4
Zheng, et al., Genes & Develop. 2:1047-1054, 1988), cotF (S.
Cutting, et al., J. Bacteriol. 173:2915-2919, 1991), cotT (A.
Aronson, et al., Mol. Microbiol. 3:437-444, 1989), cotta, cotX,
cotY and cotZ (J. Zhang, et al., J. Bacteriol. 175:3757-3766,
1993) have been cloned and at least partially sequenced.
The sequences and
amino acid compositions of the genes and proteins are highly
diverse, testifying to the intricacy of this macromolecular
assembly process.
Fusions to spore coat genes have proven to be a tool for
the study of the genetic regulation of this complex
developmental process (P. Youngman, et al., Science 228:285-
291, 1985). These fusions consist of the promoter region of
the gene of interest, a short stretch of the coding sequence
of the spore coat gene, and, fused in frame, lacZ, the gene
encoding ~-galactosidase. The construct is then reintroduced
into the B. subtilis chromosome, and the resultant strain is
induced to sporulate. The measured level of ~-galactosidase
catalytic activity serves as a reporter for the level of gene
expression of the original spore coat gene.
We have discovered that the products of cotC-lac2 and
cotD-lacZ fusions are efficiently directed to the spore coat.
The mature engineered spores bear ~-galactosidase as a stable
and catalytically active component of an otherwise intact
spore coat. This observation allows us to predict that other
combinations of enzymes and spore coat proteins and/or
suitable promoters will beg effective to produce a suitable
association between the spore and the desired enzyme. The
present invention comprises enzymes that are integrally
associated with the spore coat. By "integrally associated" we
mean that the enzyme form; an integral part of the spore coat.
The enzyme may be entrappEd in a matrix of spore coat
proteins, may become cross-linked to existing sporulation
proteins, or may become integrally associated by virtue of its
covalent attachment as a fusion protein to a spore coat
protein. A combination of these or other mechanisms which
24080-706
CA 02207278 1997-06-06
WO 96/23063 PCTIUS96/00728
would be apparent to those skilled in the art may act to
render the target enzyme integrally associated.
An enzyme is integrally associated with a spore coat if
the enzyme activity cannot easily be separated from the spore.
5 For example, the Examples below disclose purified transgenic
. spores which are retained on a filter substrate (which itself
does not retain the soluble form of the target enzyme) and are
subjected to a flow through the filter of a solution conducive
to stability of the soluble target enzyme will lose less than
10~ of the activity that would be lost if the soluble target
enzyme were treated under the same conditions for the same
period of time which, in the Example, is 24 hours. Spore-
associated enzymes of the present invention will be at least
as firmly associated with the host spore.
To practice the present invention, one must form a
genetic construct encoding a desired enzyme. This construct
must contain DNA sequences sufficient to promote expression of
the desired enzyme during the process of sporulation. The
Examples below demonstrate a preferred way of linking the
promoter associated with the cotC gene, a DNA sequence
encoding a portion of the cotC gene, and the IacZ gene
arranged so that the gene product, a transJ_ational fusion of
the proteins encoded by the cotC and IacZ genes, is
appropriately expressed. One skilled in the art of molecular
biology would realize that there are many suitable variations.
Briefly, one must link a promoter which can be made
active in the host organism during the process of sporulation
with a DNA sequence encoding the enzyme of interest. This
genetic construct must be used to transform the host organism.
By "transform" we mean that the host organism will undergo a
genetic change following incorporation of new DNA. This
transformation process is most typically performed by either
' of two methods employed by those skilled in the art. In the
first method, the construct is inserted in a plasmid which is
' 35 not viable (cannot replicate) in B. subtilis and which bears a
marker selectable in B. subtilis (antibiotic resistance, for
example). A host strain of B. subtilis is rendered competent
for transformation by either electroporation or chemical
CA 02207278 1997-06-06
WO 96123063 PCT/US96100728
6
treatment (C. R. Harwood, et al., "Molecular Biological Methods
for Bacillus," John Wiley & Sons, New York, USA, p. 33, 1990)
and is treated with the plasmid. The transformed B. subtilis
are selected for antibiotic resistance. Only those bacteria
which integrate the construct via homologous (Campbell-type)
recombination will be able to express the antibiotic
resistance gene and survive. These bacteria will then have
the desired construct stably integrated into their genome
(C. R. Harwood, et al., supra, pp. 228-230).
Alternatively, a specialized transducing bacteriophage
SPf3 can be employed. In this approach, the construct is
inserted in the phage and the host strain is infected with the
phage. The bacteriophage then integrates at a site homologous
to the host DNA it carries. Selection is accomplished by an
antibiotic resistance marker on the phage (C.R. Harwood, et
al., supra, pp. 56-58).
Any strain of B. subtilis that can be made competent for
transformation and can form spores is suitable for the present
invention. Representative of the strains of B. subtilis that
can be used in the method are strain PY79 (W. Donovan, et al.,
J. Mol. Biol. 196:1-10, 1987); strains 4670 and 4673 (S.
Nakashio, et al., J. Bact. 162:571-578, 1985); and strain ATCC
6051 (T. Koshikawa, et al., J. Gen. Microb. 135:2717-2722,
1989).
Representative of the DNA sequences of. spore coat
proteins which can be used with B. subtilis as the host
organism are the sequences for the cotC gene (Donovan, et al.,
J. Mol. Biol. 196:1-10, 1987) and the cotD gene (Donovan,
supra). These sequences are described below at SEQ ID NOs:l
and 2.
Representative of the enzymes which can be produced
extracellularly by use of B. subtilis as the host organism are
monomeric enzymes, such as carbonic anhydrase; dimeric
enzymes, such as luciferase; monomeric fusions of dimeric
enzymes, such as luciferase, trimeric enzymes, such as triose
phosphate isomerase; and tetrameric enzyme and higher enzyme
oligomers, such as aspartate transcarbamylase. Functional
classes that could be produced extracellularly include
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
7
hydrolases, such as phosphodiesterases; transferases, such as
phosphorylases; oxidoreductases, such as peroxidases; and
isomerases, such as triose phosphate isomerase. Other
examples of both structural and functional classes of enzymes
that could be produced using the method would be apparent to
one skilled in the field.
In a preferred form of the present invention, the enzyme
is an active form. By "active form" we mean that on average,
each spore expresses enzyme activity equivalent to the
activity of at least 1 x 103, and preferably 1 x 104,
molecules of the native enzyme.
Glycosylated enzymes cannot be produced by the method of
the present invention using B. subtilis. In order to produce
the glycosylated enzymes it is necessary to use an organism,
such as yeast, that is capable of producing a glycosylated
gene expression product.
Representative of the yeast strains that can be used in
the method of the present invention are the following: Strain
PB2-1C (Briza, et al., Genes and Development 4:1775-1787,
1990); and strain AP3 (Briza, et al., J. Biol. Chem.
265:15118-1513, 1990).
When yeast is the host organism, the preferred second DNA
segment is ditl gene from Saccharomyces cerevisiae (P. Briza,
et al., Genes Dev. 4:1775-1789, 1990), the DNA sequence of
which is described below at SEQ ID N0:3.
Representative of other DNA segments encoding for spore
coat proteins suitable for the present invention are the
following: The dit2 gene from Saccharomyces cerevisiae (P.
Briza, et al., Genes Dev. 4:1775-1789, 1990).
Representative of glycosylated enzymes that can be
produced and purified by the practice of the present invention
are glucose oxidase (A. de-BaeLSelier, et al., J. Biotechnol.
24:141-148 (1992)); mono-and diacylglycerol lipase (S.
Yamaguchi, et al., Biosci., Biotechnol., Biochem. 56:315-199
(1992); and beta-glucanase (0. Olsen, et al., J. Gen. Microb.
137:579-585 (1991).
In the preferred practice of the present invention,
impurities are removed from the combination of spore and
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
8
enzyme. By "impurities" we mean molecules that would
adversely affect the activity of the enzyme. Examples of
impurities that are preferably removed include soluble
constituents of the culture medium; soluble proteins and other
compounds secreted by B. subtilis during the course of growth
and sporulation; soluble proteins and other compounds which
comprise the remnant of the mother cells in which the spores
were produced; and insoluble material which is not pelleted by
centrifugation for 30 sec. to 1 minute at 10,000-12,000 x g.
A preferable manner of removing undesired impurities from
the spore/enzyme combination is to simply wash the combination
with distilled water or an appropriate aqueous solution.
In one embodiment of the present invention, the active
enzyme is separated from the purified spore-enzyme
combination. Representative of cleaving agents which can be
used to isolate the active enzyme from the sporulated cells
are proteases, mild acid treatment, and hydroxylamine
treatment (T. E. Creighton, "Proteins, 2nd Edition" W.H.
Freeman, New York, USA, pp. 38-40, 1993). The choice of
treatment will depend on the properties of the desired enzyme.
Especially preferred are cleaving agents which do not disrupt
the enzyme's activity or stability.
The spore forming host organism with the enzyme attached
to the spore coat can be a more stable form of the enzyme than
the enzyme per se. It also can be a biodegradable form of
immobilized enzyme.
In the preferred practice of the method of the present
invention, the genetic construct is formed from a DNA sequence
obtained from Escherichia coli (J. Errington, J. Gen.
Microbiol. 132:2953-2966, 1986) which encodes the enzyme j3-
galactosidase and the cotC DNA sequence obtained from _B.
subtilis, strain PY 17 (W. Donovan, et al., J. Mol. Biol.
196:1-10, 1987) which encodes for the spore coat protein CotC.
The genetic construct is then inserted into the DNA of
the B. subtilis by either of the two methods described above.
The transformed B. subtilis is preferably cultured at
about 36°C-38°C in the presence of an assimilable source of
carbon and nitrogen and other minerals in a nutrient medium
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
9
that will support growth and sporulation, such as Difco
sporulation medium, which consists of 8 grams per liter medium
Bacto-nutrient broth (Sigma Chemical Co., Catalog # N-7519 or
equivalent from other suppliers) and 0.1~ KC1, 0.012 MgS04,
0.005 M NaOH, 0.001 M CaN03, and 1 x 10-6 M FeS04) (C.R.
Harwood, et al., "Molecular Biological Methods for Bacillus,"
John Wiley & Sons, New York, USA, p. 549, 1990).
Once the enzyme production by the spore-forming host is
complete, the sporulated cells with the desired enzymes
attached are washed to remove impurities and extraneous
material to obtain a purified host spore and enzyme
combination. If it is desired to have the enzyme isolated
from the host organism, the enzyme is then cleaved from the
sporulated cell by using a cleaving agent, such as a protease.
The enzyme is then readily isolated from the cellular material
by conventional techniques, e.g. filtering.
The practice of the present invention will be better
understood from the examples which follow.
Example 1: Materials and Methods
j3-galactosidase assay. The assay is based on that of
Sambrook, et a1. (J. Sambrook, et al., "Molecular Cloning (A
laboratory manual)", 2nd Ed. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York, USA, 1989) with minor
modifications. The assay mixture contains 0.1 M sodium
phosphate, pH 7.5, containing 3 mM o-nitrophenyl
J3-D-galactopyranoside 6-phosphate (ONPG), 40.5 mM
2-mercaptoethanol and 90 uM MgCl2 in a total volume of 600 uL.
Reactions were initiated by addition of enzyme, and carried
out at room temperature unless otherwise noted. Activity was
determined from the slopes of initial rates monitored at 420
nm. O-nitrophenol, the product of (3-galactosidase-catalyzed
- hydrolysis of ONPG, has a molar extinction coefficient at 420
nm under assay conditions of 3.1 x 103 M-lcm-1 (R. C. Weast,
"Handbook of Chemistry and Physics", 60th ed. CRC Press, Boca
Raton, Florida USA, 1979). J3-galactosidase activity is
reported in units of umol ONPG hydrolyzed/min.
CA 02207278 1997-06-06
WO 96123063 PCT/US96/00728
cot-lacZ fusions. Strains bearing the cotC-IacZ and
cotD-IacZ fusions were generously provided by L. Kroos.
(Department of Biochemistry, Michigan State University, East
Lansing, MI 48824 USA). These fusions were constructed and
5 characterized previously (L. Zheng, et al., J. Mol. Biol.
212:645-660, 1990). The DNA sequence of cotC gene product and
its associated upstream sequences (Genbank Accession number
X05680), as inserted in the fusion protein are described at
SEQ ID N0:1. The deduced amino acid sequence contributed by
10 the cotC gene product to the cotC-lacZ fusion product begins
at nucleotide 356 of the above DNA sequence and is described
below at SEQ ID N0:4. SEQ ID N0:4 includes the initial
methionine. The lacZ DNA sequence which comprises the fusion
to cotC was constructed from the BamHI-BglII lacZ-cat cassette
of plasmid pSGMU31 (J. Errington, J. Gen. Microb. 132:2953-
2966, 1986). Plasmid pSGMU31 is in turn derived from plasmid
pMC1871 (M. J. Casadaban, et al., Adv. Enzymol. 100:293-308,
1983) such that the coding sequences of cotC and lacZ are in-
frame and are translated as a fusion protein. Those skilled
in the art will recognize that many variations in the sequence
comprising the region of lacZ to which the cotC sequence is
fused could be employed.
The DNA sequence of cotD which is present in the cotD-
lacZ fusion sequence (data from L. Zheng, et al., J. Mol.
Biol. 212:645-660, 1990 and Genbank, Accession Number X05681)
is described at SEQ ID N0:2. This sequence was blunt-end
ligated to plasmid pLZ206 (L. Zheng, et al., supra) which was
opened at its unique BalnHI site and rendered blunt with Klenow
fragment. Plasmid pLZ206 is a derivative of plasmid pSGMU31
(J. Errington, 1986, supra). Variant means of constructing
the fusion to lacZ will be apparent to those skilled in the
field (see, for example M.J. Casadaban, et al., supra).
The cotC-lacZ fusion includes 355 by upstream of the open
reading frame of cotC and 47 codons of the open reading frame
fused in frame to lacZ from plasmid pSGMU31. The cotD-Zac2
fusion includes 237 upstream by and 58 codons of the open
reading frame of cotD. The gene fusions were recombined into
the SP~i prophage of B. subtilis strain ZB493 (available from
CA 02207278 1999-02-18
11
L. Kroos, Dept. of Biochemistry, Michigan State University, E.
Lansing, MI 48824 USA, or from R. Losick, Dept. of Cellular
and Developmental Biology, The Biological Laboratories,
Harvard University, 16 Divinity Avenue, Cambridge MS 02138
USA). Lysates of the resulting strains were then introduced
- into strain PY79 by specialized transduction (P. Youngman, et
al., supra). Spores from the prototrophic strain PY79
(available from L. Kroos, Dept. of Biochemistry, Michigan
State University, E. Lancing, MI 48824 USA, or from R. Losick,
Dept. of Cellular and Developmental Biology, The Biological
Laboratories, Harvard University, 16 Divinity Avenue,
Cambridge MS 02138 USA) were employed as wild-type controls.
Note that in both cases, the wild-type genes for cotC and cotD
are present in the fusion strains.
Spore purification. A 10 L culture of sporulation medium
(C. R. Harwood, et al., "Molecular Biological Methods for
Bacillus," John Wiley & eons, Inc. New York USA, p. 549, 1990)
was inoculated with 400 mL of exponentially growing bacteria,
and permitted to grow at 37°C with vigorous aeration and
stirring until the mediums was exhausted and no further growth
was observed for 16 hours. Spores were collected by
centrifugation, and washed twice with 2$ Triton X-100 0.2 M
NaCl, once with 0.2 M NaCl, and three times with H20. Yields
of ca. 1 x lOs spores/ml of medium were typical. The washed
spore preparations were examined by light microscopy and
consisted of uniformly sized highly refractile particles; the
spores of cotC-lacZ and cotD-lacZ strains appeared identical
to wild-type B. subtilis spores. No cell debris could be
detected. Spore concentration was estimated from light
scattering in HZO at 550 run. An absorbance of 1.0 at 550 nm
was taken as representing a concentration of 2 X 108
spores/ml.
Lvsozyme sensitivity of spores. Spores were suspended in
0.1 M potassium phosphate buffer, pH 7.5 at t = 0. Lysozyme
treatment consisted of the addition of 200 ~g/ml lysozyme
(Boehringer Mannheim) to 'the buffer prior to spore addition.
Spore coats were removed by the SDS/DTT method (C. R. Harwood,
et al., "Molecular Biological Methods for Bacillus," John
*Trade-mark
24080-706
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
12
Wiley & Sons, Inc. New York USA, p. 442, 1990). 5 x 109
spores were centrifuged from their suspension and resuspended
in 1 ml HZO containing to SDS and 50 mM DTT, prewarmed to
70°C. The suspension was incubated for 30 min. at 70°C with
occasional vortexing. Spores were then collected by
centrifugation and washed by resuspension and centrifugation
three times with HzO, and finally resuspended in 0.1 M
potassium phosphate buffer, pH 7.5.
Flow reactor measurement of Q-Qalactosidase in spores.
4 x 108 spores were injected on the upstream side of a 0.22 ~m
syringe filter (Millipore GS filter unit). The filter was
inserted in line between an HPLC pump and a UV-vis detector
(Waters, Inc.). j3-galactosidase assay buffer was deaerated by
repeated vacuum degassing and Ar purging prior to addition of
2-mercaptoethanol to ensure that adventitious oxidation would
not occur during the course of the experiment. The buffer
showed no significant absorbance at 420 nm either before or
after the experimental run. Buffer was pumped through the
syringe filter at 50 ~L/min. beginning at t = 0, and the
absorbance at 420 nm was monitored.
Example 2: Expression of Fusion Protein in B Subtilis
When a suspension of 1.2 x 10$ spores from the cotC-lacZ
fusion strain was assayed for ~i-galactosidase activity, the
observed rate of absorbance increase in the assay to 420 nm
was 0.10 abs/min., equivalent to 0.02 units of j3-galactosidase
activity. The j3-galactosidase activity of 1.2 x 108 spores
bearing the cotD-lacZ fusion was 0.024 abs/min., 4-fold lower
than the activity expressed by spores bearing the cotC-IacZ
fusion. The measured activity was linear with volume of added
spores, and the assays were linear with time, as is the case
with native j3-galactosidase. Wild-type B. subtilis spores did
not exhibit detectable /3-galactosidase activity. Although the
spore suspension is turbid and has an appreciable absorbance
at 550 nm due to light scattering, the light scattering
properties of the sample did not change during the period of
assay.
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
13
Stability of engineered spores. The CotC:J3-galactosidase
fusion was well integrated into the spore coat. When purified
spores were subjected to 10 cycles of suspension in O.lo
Triton X-100 in HZO followed by centrifugation, less than 10~
of the total activity initially present was lost from the
spore pellet. Spores of both the cotC-lacZ and cotD-lacZ
strains did not lose catalytic activity upon storage for
several months at -20°C.
Fig. 1 diagrams the lysozyme sensitivity of spores from
strains PY79 and the cotC-IacZ fusion strain. Fig. lA
diagrams the light scattering properties of PY79 spores with
intact coats in the absence (0) or presence (A) of 200 ug/ml
lysozyme, and decoated PY79 spores in the absence (~) or
presence (~) of 200 ~g/ml lysozyme. Fig. 1B diagrams light
scattering properties of spores of the cotC-lacZ fusion
strain. The symbols are the same as in Fig. lA. Spore
concentrations were adjusted to give ca. 0.5 absorbance units
as the initial absorbance in each case. Data have been
normalized to a common initial absorbance for clarity of
comparison.
Fig. 1 demonstrates that spores of both PY79 and the
strain bearing the cotC-lacZ fusion are resistant to lysozyme.
When the spore coat is removed from either spore type, the
spores become lysozyme sensitive.
Fig. 2 diagrams the stability of spores of the cotC-lacZ
fusion strain under turnover conditions. The operation of the
flow reactor is described above. The measured absorbance
values are directly proportional to the steady state velocity
of catalysis by J3-galactosidase at the indicated times.
Fig. 2 demonstrates the long-term stability of j3-
galactosidase immobilized in B. subtilis spore. Spore-
immobilized J3-galactosidase catalyzed ONPG hydrolysis with
undiminished efficiency for more than 24 hours. Native J3-
galactosidase is not retained on these filters, so the enzyme
must remain physically associated with intact spores
throughout the course of this experiment.
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
14
The affinity of wild-type spores for Q-ctalactosidase.
The close association of the CotC:J3-galactosidase fusion with
the spore coat might occur through the normal pattern of spore
coat deposition, or, alternatively, spores of B. subtilis
might interact directly with j3-galactosidase, in which case
the observed immobilization would be due to an adventitious
interaction between the enzyme and spore coat components.
We tested for interactions between wild type spores and
~3-galactosidase by mixing a quantity of native soluble J3-
galactosidase (equivalent to that found in ca. 1 x 108 spores
from the cotC-IacZ fusion strain) with aliquots of from 2 x
106 to 7 x 101° wild-type B. subtilis spores, and then the
spores were removed by centrifugation. There was not
detectable loss of J3-galactosidase activity from the
supernatant. Sonicates of the cotC-lacZ fusion strain taken 8
hours after induction of sporulation by medium exhaustion
contained appreciable quantities of soluble CotC:j3-
galactosidase fusion protein (L. Zheng, et al., supra, 1990).
When PY79 spore suspensions were treated with this sonicate as
was done for the purified enzyme, no J3-galactosidase remained
associated with the spores. Neither native J3-galactosidase
nor the CotC:J3-galactosidase fusion protein exhibits
appreciable affinity for mature wild-type spores.
Catalytic properties of f3-ctalactosidase in the spore
coat. Fig. 3 diagrams KM values for native ~3-galactosidase
(~) and the CotC-j3-galactosidase fusion in the spore coat of
spores from the cotC-IacZ fusion strain (e). Data sets were
normalized to the same V~X value, set equal to 100. The
smooth curve is a theoretical curve for an enzyme obeying the
3 0 Michaelis-Menten equation Vobs = V~X* [ GNPG ] / ( KM + ( ONPG J ) with
V~X = 100 and KM = 0.40 mM. Fig. 3 shows that the KM values
are essentially identical for native J3-galactosidase and for
the enzyme immobilized in the spore coat.
The pH-activity curves for native and immobilized J3-
galactosidase are also superimposable from pH 6.0 - 9.2. At
lower pH values, the immobilized enzyme is relatively less
active (Fig. 4). Fig. 4 diagrams pH-activity profiles for
native J3-galactosidase fusion in the spore coat of spores from
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
the cotC-lacZ fusion strain (O) versus native J3- galactosidase
(~). Buffers employed were 4-morpholine-ethanesulfonic acid
(Mes), pH 3.9 - 6.0, phosphate, pH 6.0-7.5, 4-(2-
hydroxyethyl)-1-piperazine-ethanesulfonic acid, (Hepes) pH
5 6.7-7.2, and N,N-bis(2-hydroxyethyl)-glycine (Bicine), pH 8.0-
9.2. All buffers were 50 mM final concentration in the assay
mixture. Other assay reagents were as described above. The
two data sets were normalized with respect to each other to
give the best fit over the pH 5.5 - 8.5 region.
10 The sensitivities of native j3-galactosidase and CotC:j3-
galactosidase in the B. subtilis spore coat to elevated
temperatures are essentially identical (Fig. 5). Fig. 5
diagrams temperature sensitivity of native ~i-galactosidase
(solid data points) and CotC:j3-galactosidase fusion (open data
15 points) in the spore coat of spores from the cotC-IacZ fusion
strain. Samples of native ~i-galactosidase or of spores from
the cotC-lacZ fusion strain spores were diluted 1 - 10 into a
0.1 M NaHP04 buffer, pH 7.5, equilibrated at the indicated
temperature. Samples were withdrawn at intervals and chilled
on ice, and subsequently assayed for ~i-galactosidase activity.
Data are normalized to 100% activity as measured at t = 0.
Temperatures tested were 40°C (o), 45°C (~), and 50°C
(0).
The data above demonstrate that fusions of lacZ with
truncated genes encoding B. subtilis spore coat proteins are
stably incorporated into the surface protein layer of the
mature spore. The extent of incorporation, as judged by
expressed catalytic activity, varies with the choice of spore
coat protein. The cotC-lacZ fusion exhibits more activity
than the cotD-lacZ fusion. This might be simply a consequence
of a higher level of expression of the cotC-lacZ fusion, or it
could reflect the effects of different spore coat environments
on fusion protein activity. The gene encoding CotD, cotD, is
part of a regulon which is expressed earlier in spore coat
formation than is cotC (L. Zheng, et al., supra, 1990). This
may imply that CotD is a constituent of the inner layers of
the mature spore coat, while CotC is predominantly found in
the outer spore coat (J. Errington, supra). Despite this
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
16
difference in location, both fusion proteins are accessible to
substrate.
Native ~i-galactosidase is a tetramer of 116 kDa subunits
(U. Karlsson, et al., J. Ultrastruct. Res. 10:457-469, 1964);
the cotC segment of the fusion encodes a protein of
approximately 5~ of the size of J3-galactosidase. Apparently,
the task of folding and assembling this large protein and
inserting it into the spore coat can be successfully
accomplished in the course of normal spore development even
when the vast majority of the protein to be expressed is of
foreign origin. Some, but not all, spore coat proteins can be
individually deleted from the genome without gross changes in
spore phenotype (L. Zheng, et al., supra, 1988; W. Donovan, et
al., supra). The present invention demonstrates that
substantial additions to the complement of spore coat proteins
can also be successfully integrated into the spore coat.
An order-of-magnitude estimate of the efficiency of the
insertion process can be obtained by assuming that the fusion
protein has the same molar specific activity as native
galactosidase, in which case each spore from the cotC-lacZ
fusion strain bears 1.0 x 104 molecules of J3-galactosidase.
Taking an estimate of the size of the j3-galactosidase from
electron microscopy (U. Karlsson, et al., supra), each
molecule subtends an area of 8 x 10-1' mz, and the total area
covered by J3-galactosidase is approximately
8 x 10-13 mz. A B. subtilis spore is somewhat ellipsoidal,
with a major axis of approximately 500 nm (Y. Fujita, et al.,
Microbiol. Immunol. 33:391-401, 1989). The surface area of a
geometric form of this size is approximately 3 x 1C-13 mz.
Thus, the ~3-galactosidase molecules occupy an area roughly 3-
fold larger than the minimum estimate for the spore surface
area. The surface of the spore is a multilayered
macromolecular assembly (Aronson, et al., Bacteriol. Rev.
40:360-402, 1976); the present calculation confirms that the
spore presents a highly elaborated surface to its environment.
Despite this extensive modification of the spore coat,
spores bearing j3-galactosidase fusions are stable to long-
term storage and possess spore coats which still ccnfer
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
17
lysozyme resistance. Mutant spores in which coat synthesis or
assembly is defective frequently manifest a lysozyme sensitive
phenotype (Aronson, et al., supra, 1976), so this is an
. important test of the integrity of the coat bearing these
fusions.
The catalytic properties of the immobilized ~3-
galactosidase fusion protein closely resemble those of the
native enzyme. Evidently active site structure and overall
protein stability are not compromised either by the presence
of the amino terminal residues from CotC or by the process of
insertion in the spore coat.
The fact that j3-galactosidase does not appear to interact
strongly with mature wild-type spores suggests that
integration occurs as a part of the normal developmental cycle
of sporulation, and is not dependent on the particular
properties of the protein to be expressed. This gives us
reason to believe that the same strategy can be applied for
the expression and immobilization of other proteins of
interest.
The methodology we have identified for expression and
immobilization of J3-galactosidase in the spore coat provides a
general method for purification of an expressed protein as a
component of the spore, without the need to separate it by
conventional protein purification techniques. In addition to
facilitating purification of proteins, this method provides a
route to applications where the expressed protein can be
usefully employed in immobilized form. This could serve as a
significant improvement over the use of wild-type enzymatic
activities of fungal spores, which have previously been
employed to carry out biotransformations for fine chemical
synthesis (C. Vezina, et al., "Transformation of organic
compounds by fungal spores." in The Filamentous Fungi John
Wiley & Sons, Inc., New York USA, 1(9):158-192, 1974), as the
spore can be appropriately engineered for the desired
biotransformation.
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
18
Example 3: Purification of Q-Qalactosidase Linked to
Sporulated B. Subtilis
The following is envisioned to be a typical method of
purifying the enzyme-linked spore coats: One would isolate
spores from culture medium by centrifugation at 10,000 x g
from 5 minutes and then remove the supernatant. The pellet
would be resuspended in lOx volume of an aqueous solution of
2°s Triton X-100 and 0.2 M NaCl and centrifuged again at 10,000
x g for 5 minutes. The supernatant would be removed. The
resuspension, centrifugation and supernatant removal would be
repeated with the following successive wash solutions: once
more with aqueous 2% triton X-100 and 0.2 M NaCl; once with an
aqueous solution of 0.2 M NaCl; three times with HzO. The
pellet from the last centrifugation represents the washed
spores.
Example 4: Isolation of Enzyme by Protease
The following represents a proposed method for isolating
an enzyme from the attached spore coat by use of a protease:
One would typically first resuspend washed spores in an
aqueous solution of 25 mM Tris-C1, pH 8.0 containing 0.1 mg/ml
trypsin and then incubate the suspension for 1 hour at 24°C-
26°C. The suspension would be centrifuged, for example at
10,000 x g for 5 minutes, to remove the spores. The
supernatant after centrifugation contains the soluble form of
the desired enzyme.
This protocol presumes that the desired enzyme is cleaved
from the coat protein support by trypsin at the indicated
concentration and that trypsin has no deleterious effect on
CA 02207278 1999-02-18
~19
the desired properties of the enzyme. Those skilled in the
art can readily devise alternative treatments involving
different buffers, different proteases, and different reaction
conditions suitable for the production of the soluble forms of
different enzymes.
The above paragraph describes a hypothetical example; our
constructs described in the.Examples above are not suitable
for such a protease treatment. (This statement also applies
to Examples 5-8 below.)
Example 5: Preparation of a Genetic Construct Encoding a
Fusion Protein for a Glycosylated Enzyme
A genetic construct suitable for expression of a fusion
protein in yeast could be created by first identifying by
reverse genetics a suitable yeast ascospore coat protein.
This could be accomplished by isolation of yeast ascospores
(A. Hartig, et al., Curr. Genet. 4:29-36, 1981). Ascospore
isolation is accomplished by growth of one of many suitable
strains of yeast (strain AP-3 is an example) (A. Hartig, et
al., supra) at 29°C-31°C in U.5~ glucose and 1$ yeast extract
overnight, then diluting 1:1 with media composed of 0.3~
glucose and 1$ yeast extract. After 2 hours of further growth
at 29°C-31°C, the cells werE harvested by centrifugation at
3,000 x g for 5 minutes, washed in water, and resuspended in
to potassium acetate and grown with shaking at 29°C-31°C for
48-72 hours. The resulting spores were collected by
centrifugation and treated with mercaptoethanol and glusulase.
The spore tetrads were disrupted by glass bead homogenization
in 0.5~ Triton X-100, and layered on a 75~-90~ Percoll* 0.25 M
*Trade-mark
24080-706
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
saccharose gradient. Spores were collected from the pellet
after centrifugation for 1 hour at 10,000 rpm in a Beckman SS-
34 rotor (or equivalent). Purification of ascospore walls (P.
Briza, et al., J. Biol. Chem. 261:4288-4294, 1986) can be
5 accomplished by disruption by homogenization of ascospores
purified as described above in the presence of glass beads
followed by centrifugation at 3,000 x g. The pellet is
suspended in an aqueous solution of 60~ Percoll and 2~ Triton
X-100 and centrifuged at 23,000 rpm in a Beckman SW 25.2 rotor
10 or equivalent for 1 hour. The ascospore wall layer is removed
and washed by repeated centrifugation in water.
The ascospore walls would be solubilized by an
appropriate treatment, such as a combination of reducing agent
and strong detergent (e.g., 100 mM dithiothreitol and 1~
15 sodium dodecyl sulfate). The solubilized proteins would be
purified using methods known to practitioners of the art, such
as polyacrylamide gel electrophoresis, followed by
identification of purified proteins from the polyacrylamide
gel by staining the gel using one of a number of available
20 methods, such as Coomassie Blue staining, and elution of the
bands from the gel. A representative method of accomplishing
elution would be electroelution with transfer to a
polyvinylidene difluoride (PVDF) membrane. The membrane would
then be subjected to automated Edman degradation or other
method of determining a portion of its amino acid sequence.
From this amino acid sequence, a deduced nucleotide sequence
could be inferred, and appropriate oligonucleotides
synthesized based on the inferred sequence. These
oligonucleotides would then be used to identify the gene
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
21
associated with the ascospore coat gene product. This could
be accomplished in a number of ways familiar to practitioners
of the art, including screening of a yeast cDNA library by
using the synthetic oligonucleotides as a probe, or by PCR
techniques. It would then be necessary to isolate the genomic
copy of the gene, identify its promoters and intron sequences,
and insert the appropriate sequence into an expression vector
suitable for use in the desired strain of yeast. Appropriate
expression vectors are well known (F. M. Ausubel, et al.,
"Current Protocols in Molecular Biology", John Wiley & Sons,
New York USA, Vol. 2, Chapter 13, 1994).
Example 6: Insertion of Genetic Construct- Into Yeast Cells
Transformation with lithium acetate (F.M. Ausubel, et
al., "Current Protocols in Molecular BioloQV", John Wiley &
Sons, New York USA, Vol. 2, Chapter 13, 1994). Yeast are
grown from an inoculum density of 3 x 106 cells/ml to a
density of 1-2 x 10' cells/ml in 50 ml in a medium consisting
of 2o glucose, 2% peptone and 1~ yeast extract at 29°C-31°C.
yeast are harvested by centrifugation at 1,100 x g for 10
minutes. The pellet is resuspended in 10 ml of an aqueous
solution of 10 mM Tris-C1, 1 mM ethylenediamine tetraacetic
acid, pH 8Ø The suspension is centrifuged at 1,1000 x g for
10 minutes and the pellet resuspended 10 ml of an aqueous
solution of 10 mM lithium acetate. After centrifugation at
1,100 x g for 10 minutes, the pellet is resuspended in 0.5 ml
of an aqueous solution of 10 mM lithium acetate. The
suspension is incubated with gentle shaking (50 rpm) for 1
hour at 29°C-31°C. Transformation is accomplished by mixing
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
22
0.1 ml of the suspension with 1-5 x 106 gm donor DNA plus 2 x
105 gm carrier DNA (sheared calf thymus DNA or E. coli DNA).
The suspension then is incubated for 30 minutes at 29°C-
31°C.
Add 0.7 ml 40% w/v polyethylene glycol 3350, 0.1 M lithium
acetate, 10 mM Tris-C1, 1 mM ethylenediamine tetraacetic acid,
pH 8.0 and incubate 45 minutes at 29°C-31°C, then at 42°C
for
5 minutes. Plate 0.2 ml of the solution on appropriate
selective plates (for example, CM -ura plates with yeast
strain YEp24). The transformed cells will be able to grow on
the selective medium.
Example 7: Production and Purification of
Glycosylated Enzyme
Yeast ascospores can be prepared in pure form by the
methods described above for the preparation of pure
ascospores, as described in Example 5.
Example 8: Isolation of Glycosylated Enzyme
Glycosylated enzyme could be removed from purified
ascospores by chemical or enzymatic treatments as described in
Example 4.
It will be readily apparent to those skilled in the art
that a number of modifications and changes can be made without
departing from the spirit and scope of the invention.
Therefore, it is intended that the scope of the invention be
restricted only by the claims.
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
23
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Deits, Thomas L.
(ii) TITLE OF INVENTION: METHOD OF PRODUCING AND
PURIFYING ENZYMES
(iii) NUMBER OF SEQUENCES: 4
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Quarles & Brady
(B) STREET: 411 East Wisconsin Avenue
(C) CITY: Milwaukee
(D) STATE: Wisconsin
(E) COUNTRY: U.S.A.
(F) ZIP: 53202-4497
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Baker, Jean C.
(B) REGISTRATION NUMBER: 35,433
(C) REFERENCE/DOCKET NUMBER: 660336.90489
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (414) 277-5709
(B) TELEFAX: (414) 271-3552
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 602 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
AAGCTTCACA AAAATACTCG TTATTTTGTT TGTGGGTTTT TTAGTATTTG GGCCTGATAA 60
ACTGCCGGCG CTTGGCCGTG CAGCAGGAAA AGCCTTATCA GAATTTAAAC AAGCAACAAG 120
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
24
CGGACTGACTCAGGATATCAGAAAAAATGACTCAGAAAACAAAGAAGACAAACAAATGTA 180
GGATAAATCGTTTGGGCCGATGAAAAATCGGCTCTTTATTTTGATTTGTTTTTGTGTCAT 240
CTGTCTTTTTCTATCATTTGGACAGCCCTTTTTTCCTTCTATGATTTTAACTGTCCAAGC 300
CGCAAAATCTACTCGCCGTATAATAAAGCGTAGTAAAAATAAAGGAGGAGTATATATGGG 360
TTATTACAAAAAATACAAAGAAGAGTATTATACGGTCAAAAAAACGTATTATAAGAAGTA 420
TTACGAATATGATAAAAAAGATTATGACTGTGATTACGACAAAAAATATGATGACTATGA 480
TAAAAAATATTATGATCACGATAAAAAAGACTATGATTATGTTGTAGAGTATAAAAAGCA 540
TAAAAAACACTACTAAACGCCATTAACAAAAGCATAAAAAACACTACTAAACGCCATTAA 600
CA 602
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 249 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
TTATGGAAAGGGGATTTTATCATGCATCACTGCAGACCGCATATGATGGCGCCAATTGTC 60
CATCCTACTCATTGCTGTGAACACCATACGTTTTCGAAGACTATCGTGCCGCACATTCAC 120
CCACAGCATACAACAAACGTAAACCACCAGCATTTTCAGCACGTTCACTACTTTCCACAC 180
ACTTTCTCAAATGTTGACCCGGCTACGCATCAGCATTTTCAAGCAGGAAAACCTTGCTGC 240
GACTACTAG 249
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2306 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
GGCGCCTTAA GGGACCTTCT ATGACAAATA TGGTGAGGTA TGCAACCTCA ATGAAGAGCA 60
ATGAGAAAAT TTAAGGGGTA AGTAAGCATC GGAATTTGTT GTTTCCTAAC AATTTGTCTA 120
CA 02207278 1997-06-06
WO 96/23063 PCT/US96I00728
ATTTACTCAA TAATATCAGGAGAATTGATCGAAAAAAGCAAACCAGGAACCCCTCACAAA 180
TAAGGGAACA TAAAGTAATTGCTCGTCTTTACATACATGGCACTCAATCCCAGACGTCGC 240
GTGCTAAAAA TCCTTATATTATTGGCCCCTCAGGAGTTTATTTGAATTTTGATTGCATTG 300
CTTTCAGTGG ACAGTATATCATAAAATTTGCAAGGGCATAGTGCCTGCCCTACGATGTTG 360
TAAAACAATT TCTGAAAATAGGTTCAGAATCAAAAATGATGTATAAATATTGAAATAAAT 420
TTTCACATAA ATTGTGCTCCTCCGCAAAGTCTTGACTAAATAAACAATTTGTTAATATCC 480
TAATTCGGTA AAGCTTTGTCGAGACATTAACAAAAATGACATTTACTAGCAACTTGCCCT 540
CAAGCTCCGA GCAGTCAATATCACCACCTGCCTCTTCATTTTCTTCATCGACTGATACGT 600
TGAAAGATAT TGATATTCCCCATAATGGGGCCGATTTGTCTACATATAGTAAATTTCTGG 660
CCCTGTATTG CAGAAGCGACAAATGTGACGATTTTTACTCTTTAGAGGAAAAACAGAATT 720
GTAAATTTGG AGACCAATGGCTCGACTTTATCAACACTATTCACAATCTGGACTTTTCTG 780
AATCCGAAGT AAGTGGACGGGTTTCTGAAAGAATTTTGCCAGCTTCTTTAGCAAATAAAT 840
TTACCAATAA TTTAGGAGTGGCAATAAAGATTTCTGAATATACACGCGATGACGAACGCC 900
AGATTCGTGG GTGTGTTACAACAGTTGAGAATGAAAATTCTTTCAATAACTGGTTCGTAT 960
ATCATATTTT AGACCAATCTCAATTATCTCTAAGTGAACATCCAATTGTAACCAAAGAAG 1020
TTAAGTATCA CGAATTATTTGCAGATTTTTTTGAGAAAAATTTGAAAAACACAATAGTTA 1080
ATGATCAATG GAATTTTGGTGGCCGTGATTATTTTATTGAACGTTCAAGATATTTTACCG 1140
ATCGATATTT GAGAATTGAATGCATCTTGCCAGCGTTTCCATGTAAGTCATCTAA.TGAGC1200
AAAAAGTGTA CGGTTCCGTTCCTGACAAAGGCGAAGAACTCGCTTTGAAAAGATTAATAA 1260
AAGCCACACA AGACCTTGTCAAGATATATCCACCGGGTATGAAAATTTGGATAGTTAGTG 1320
ATGGCCATGT TTCCTCCGATTGTATTGGGGTCGATGATGACGTCGTGAGTACTTACACGA 1380
CCAAATTGCA CGAACTGTATAAAAGAGTGGCTATACCTGGTGTTGACGCCATTGGCTTTT 1440
GTGGATTGAA CGATTTATTTTTTAGCGGTGCAGCTAGTAAAGTTTTCGATCCAAAGTGGG 1500
7TAGTGATGT TGAAGTTGCACACTACACAGGAACTCAAATCTGTCCTAAGTCCGATTTGT 1560
CGAGACAGAT TTTGATGAAAGGCTGTGATACAGATGCAGGTCGTTTGAGAAAGCAGATTG 1620
CAATAGAAGG ACATCCAAGATTGCATCTGTATAGGGGCTTTTCACGTTTTATGATGGAAG 1680
ATTTATCTCT ACTGGAACATTTCCAAAGTTATTCCAGAAAAAAATTCAAGAAAATCATTT 1740
CAATGATCGC TTTTAACATGATTAAGAGAAATGACGCGTATTCGAACTTAGTGGAATTGA 1800
TATTCCCTCA TCATTTGAGAATTTCTATTCATGCGCACACTAACAGCGGGCCCAAATTTG 1860
CA 02207278 1997-06-06
WO 96/23063 PCT/US96/00728
26
GTATAAAAGTAATCTCCAACGAACAGTGTTCTATTGTTAGTTCGTTAGAAGACCTTGATG 1920
AACCCAAATTTGAAGATTTTTTACATATTCCCACACCTTGGCATAATTGTGTCGTGAAGG 1980
TTGAGGATGAAAAGGAGAAATACTTTTTGACAAAATCAAAAGTAGTCAAGGAGGCTCTCG 2040
AAAAGGGTATGTATGATGGTGTATGGAAAGATACTCGTTTCGATATTGGAGAAGGAGGAC 2100
ATTTCGTTATCAAGAAAATCTCTTAATAAAGTAAGAGCGCTACATTGGTCTACCTTTTTG 2160
TTCTTTTACTTAAACATTAGTTAGTTCGTTTTCTTTTTCTCATTTTTTATGTTTCCCCCC 2220
AAAGTTCTGATTTTATAATATTTTATTTCACACAATTCCATTTAACAGAGGGGAATAGAT 2280
TCTTTAGCTTAGAAAATTACTGATCC 2306
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met Gly Tyr Tyr Lys Lys Tyr Lys Glu Glu Tyr Tyr Thr Val Lys Lys
1 5 10 15
Thr Tyr Tyr Lys Lys Tyr Tyr Glu Tyr Asp Lys Lys Asp Tyr Asp Cys
20 25 30
Asp Tyr Asp Lys Lys Tyr Asp Asp Tyr Asp Lys Lys Tyr
35 40 45
