Note: Descriptions are shown in the official language in which they were submitted.
CA 02211784 1997-07-29
WO96/23517 PCT~S9610~952
Anti-Obesity Proteins
The present invention is in the field of human
medicine, particularly in the treatment of obesity and
disorders associated with obesity. Most specifically the
invention relates to anti-obesity proteins that when
administered to a patient regulate fat tissue.
Obesity, and especially upper body obesity, is a
common and very serious public health problem in the United
States and throughout the world. According to recent
statistics, more than 25% of the United States population and
27% of the Canadian population are overweight. Kuczmarski,
Amer. J. of Clin. Nutr. 55: 495S - 502S (1992)i Reeder et.
al., Can. Med. Ass. J., 23: 226-233 (1992). Upper body
obesity is the strongest risk factor known for type II
diabetes mellitus, and is a strong risk factor for
cardiovascular disease and cancer as well. Recent estimates
for the medical cost of obesity are $150,000,000,000 world
wide. The problem has become serious enough that the surgeon
general has begun an initiative to combat the ever increasing
adiposity rampant in American society.
Much of this obesity induced pathology can be
attributed to the strong association with dyslipidemia,
hypertension, and=insulin resistance. Many studies have
demonstrated that reduction in obesity by diet and exercise
reduces these risk factors dramatically. Unfortunately,
these treatments are largely unsuccessful with a failure rate
reaching 95%. This failure may be due to the fact that the
condition is strongly associated with genetically inherited
factors that contribute to increased appetite, preference for
highly caloric foods, reduced physical activity, and
increased lipogenic metabolism. This indicates that people
inheriting these genetic traits are prone to becoming obese
regardless of their efforts to combat the condition.
Therefore, a pharmacological agent that can correct this
adiposity handicap and allow the physician to successfully
CA 02211784 1997-07-29
W O 96/23517 PCTrUS9G~'~U9S2
treat obese patients in spite of their genetic inheritance is
needed.
Physiologists have postulated for years that, when
a mammal overeats, the resulting excess fat signals to the
brain that the body is obese which, in turn, causes the body
to eat less and burn more fuel. G. R. Hervey, Nature 227:
629-631 (1969). This "feedback" model is supported by
parabiotic experiments, which implicate a circulating hormone
controlling adiposity.
The ob /ob mouse is a model of obesity and diabetes
that is known to carry an autosomal recessive trait linked to
a mutation in the sixth chromosome. Recently, Yiying Zhang
and co-workers published the positional cloning of the mouse
gene linked with this condition. Yiying Zhang et al. Nature
372: 425-32 (1994). This report disclosed a gene coding for
a 167 amino acid protein with a 21 amino acid signal peptide
that is exclusively expressed in adipose tissue. ~ikewise,
Murakami et al., in Biochemical and sio~hvsical Research
Communications 209(3):944-52 (1995) report the cloning and
expression of the rat obese gene. The protein, which is
apparently encoded by the ob gene, is now speculated to be an
adiposity regulating hormone. No pharmacological activity is
reported by Zhang et al.
However, we have discovered that the proteins
disclosed by Zhang et al. are poor pharmacological agents due
to chemical and/or physical instability. The human protein,
for example, is more prone to precipitation. Pharmaceutical
formulations of the natural protein containing a precipitate
increase the risk of producing an immunological response in
the patient. Accordingly, there remains a need to develop
pharmacological agents that provide improved physical and
chemical stability and that are useful to help patients
regulate their appetite and metabolism.
Most significantly, it has now been determined that
specific substitutions to amino acid residues 77, 97 to 111,
118, and/or 138 of the human obesity protein lead to a
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/009~2
--3--
superior therapeutic agent with improved stability.
Accordingly, the present invention provides biologically
active obesity proteins. The proteins of the present
invention are more readily formulated and stored.
Furthermore, the present compounds are more pharmaceutically
elegant, which results in superior delivery of therapeutic
doses. Thus, such agents allow patients to overcome their
obesity handicap and live normal lives with a more normalized
risk for type II diabetes, cardiovascular disease and cancer.
Summarv of Invention
The present invention is directed to a protein of
the Formula (I):
(SEQ ID NO: 1)
Val Pro Ile Xaa Lys Val Xaa Asp Asp Thr Lys Thr Leu Ile Lys Thr
1 5 10 15
Ile Val Thr Arg Ile Xaa Asp Ile Ser His Xaa Xaa Ser Val Ser Ser
20 25 30
Lys Xaa Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
35 . 40 45
Leu Thr Leu Ser Lys Xaa Asp Xaa Thr Leu Ala Val Tyr Xaa Xaa Ile
50 55 60
Leu Thr Ser Xaa Pro Ser Arg Xaa Val Ile Xaa Ile Xaa Xaa Asp Leu
~0 Glu Xaa Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
100 105 110
Val Leu Glu Ala Ser Xaa Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
115 120 125
Leu Xaa Gly Ser Leu Xaa Asp Xaa Leu Trp Xaa Leu Asp Leu Ser Pro
130 135 140
145
Gly Cys ( I)
wherein:
Xaa at position 4 is Gln or Glu;
Xaa at position 7 is Gln or Glui
CA 022ll784 l997-07-29
W 096123517 PCTtUS96tO0952
Xaa at position 22 is Asn, Asp or Glu;
Xaa at position 27 is Thr or Ala;
Xaa at position 28 is Gln, Glu, or absent;
Xaa at position 34 is Gln or Glu;
Xaa at position 54 is Met, methionine sulfoxide, Leu,
Ile, Val, Ala, or Gly;
Xaa at position 56 iS Gln or Glu;
Xaa at position 62 iS Gln or Glu
Xaa at position 63 is Gln or Glu;
Xaa at position 68 is Met, methionine sulfoxide, Leu,
Ile, Val, Ala, or Gly;
Xaa at position 72 is Asn, Asp or Glu;
Xaa at position 75 is Gln or Glu;
Xaa at position 77 is Ser or Ala;
Xaa at position 78 iS Gln, Asn, or Asp;
Xaa at position 82 iS Gln, Asn, or Asp;
Xaa at position 118 is Gly or Leu;
Xaa at position 130 is Gln or Glu;
Xaa at position 13 4 is Gln or Glu;
Xaa at position 136 is Met, methionine sulfoxide, Leu,
Ile, Val, Ala, or Gly;
Xaa at position 139 is Gln or Glu;
said protein having at least one substitution selected from
the group consisting of:
His at position 97 iS replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
30 Pro, Thr, or Val;
Ser at position 102 is replaced with Arg;
Gly at position 103 iS replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 iS replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
CA 02211784 1997-07-29
WO96/23517 PCT~S96/009~2
Gly at position lll is replaced with Asp; or
Trp at position 138 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
or a pharmaceutically acceptable salt thereof.
The invention further provides a method of treating
obesity, which comprises administering to a mammal in need
thereof a protein of the Formula (I).
The invention further provides a pharmaceutical
formulation, which comprises a protein of the Formula (I)
together with one or more pharmaceutically acceptable
diluents, carriers or excipients therefor.
An additional embodiment of the present invention
is a process for producing a protein of Formula (I), which
comprises:
(a) transforming a host cell with DNA that encodes
the protein of Formula (I), said protein having an optional
leader sequence;
(b) culturing the host cell and isolating the
protein encoded in step (a); and, optionally,
(c) cleaving enzymatically the leader sequence to
produce the protein of Formula (I).
Detailed Descri~tion
For purposes of the present invention, as disclosed
and claimed herein, the following terms and abbreviations are
defined as follows:
Base pair (bp) -- refers to DNA or RMA. The
abbreviations A,C,G, and T correspond to the 5'-monophosphate
forms of the nucleotides (deoxy)adenine, (deoxy)cytidine,
(deoxy)guanine, and (deoxy)thymine, respectively, when they
occur in DNA molecules. The abbreviations U,C,G, and T
correspond to the 5'-monophosphate forms of the nucleosides
uracil, cytidine, guanine, and thymine, respectively when
they occur in RNA molecules. In double stranded DNA, base
CA 02211784 1997-07-29
W O 96/23517 PCTAUS96/00952
--6--
pair may refer to a partnership of A with T or C with G. In
a DNA/RNA heteroduplex, base pair may refer to a partnership
of T with U o~ C with G.
DNA -- Deoxyribonucleic acid.
EDTA -- an abbreviation for ethylenediamine
tetraacetic acid.
Immunoreactive Protein(s) -- a term used to
collectively describe antibodies, fragments of antibodies
capable of binding antigens of a similar nature as the parent
antibody molecule from which they are derived, and single
chain polypeptide binding molecules as described in PCT
Application No. PCT/US 87/02208, International Publication
No. WO 88/01649.
mRNA -- messenger RNA.
Plasmid -- an extrachromosomal self-replicating
genetic element.
PMSF -- an abbreviation for phenylmethylsulfonyl
fluoride.
Reading frame -- the nucleotide sequence from which
translation occurs ~read" in triplets by the translational
apparatus of tRNA, ribosomes and associated factors, each
triplet corresponding to a particular amino acid. Because
each triplet is distinct and of the same length, the coding
sequence must be a multiple of three. A base pair insertion
or deletion (termed a frameshift mutation) may result in two
different proteins being coded for by the same DNA segment.
To insure against this, the triplet codons corresponding to
the desired polypeptide must be aligned in multiples of three
from the initiation codon, i.e. the correct "reading frame~
must be maintained.
Recombinant DNA Cloning Vector -- any autonomously
replicating agent including, but not limited to, plasmids and
phages, comprising a DNA molecule to which one or more
additional DNA segments can or have been added.
CA 02211784 1997-07-29
W O 96/23517 PCTrUS96100952
Recombinant DNA Expression Vector -- any
recombinant DNA cloning vector in which a promoter has been
incorporated.
Replicon -- A DNA sequence that controls and allows
for autonomous replication of a plasmid or other vector.
RNA -- ribonucleic acid.
RP-HPLC -- an abbreviation for reversed-phase high
performance liquid chromatography.
Transcription -- the process whereby information
contained in a nucleotide sequence of DNA is transferred to a
complementary RNA sequence.
Translation -- the process whereby the genetic
information of messenger RNA is used to specify and direct
the synthesis of a polypeptide chain.
Tris -- an abbreviation for tris(hydroxymethyl)-
aminomethane.
Treating -- describes the management and care of a
patient for the purpose of combating the disease, condition,
or disorder and includes the administration of a compound of
present invention to prevent the onset of the symptoms or
complications, alleviating the symptoms or complications, or
eliminating the disease, condition, or disorder. Treating
obesity therefor includes the inhibition of food intake, the
inhibition of weight gain, and inducing weight loss in
patients in need thereof.
Vector -- a replicon used for the transformation of
cells in gene manipulation bearing polynucleotide sequences
corresponding to appropriate protein molecules which, when
combined with appropriate control sequences, confer specific
properties on the host cell to be transformed. Plasmids,
viruses, and bacteriophage are suitable vectors, since they
are replicons in their own right. Artificial vectors are
constructed by cutting and joining DNA molecules from
different sources using restriction enzymes and ligases.
Vectors include Recombinant DNA cloning vectors and
Recombinant DNA expression vectors.
CA 02211784 1997-07-29
W O96123517 PCTrUS~ g~2
X-gal -- an abbreviation for 5-bromo-4-chloro-3-
indolyl beta-D-galactoside.
The amino acid abbreviations are accepted by the
United States Patent and Trademark Office as set forth in 37
C.F.R. 1.822 (b)(2) (1993). One skilled in the art would
recognize that certain amino acids are prone to
rearrangement. For example, Asn may rearrange to aspartic
acid and isoaspartate as described in I. Schon et al., Int.
J. Pe~tide Protein Res. 14: 485-94 (1979) and references
cited therein. These rearrangement derivatives are included
within the scope of the present invention. Unless otherwise
indicated the amino acids are in the ~ configuration,
As noted above the present invention provides a
protein of the Formula (I). Preferred proteins are those of
Formula (II):
(SEQ ID NO: 2)
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser~ Val Ser Ser
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
~ .
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
30 65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
40 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys (II)
wherein:
= ~
CA 02211784 1997-07-29
W O96/23517 PCTAJS96/00952
Asn at position 22 is optionally Gln or Asp;
Thr at position 27 is optionally Ala;
Gln at position 28 is optionally Glu or absent;
Met at position 54 is optionally Ala;
Met at position 68 is optionally Leu;
Asn at position 72 is optionally Glu, or Asp;
Ser at position 77 is optionally Ala;
Gly at position 118 is optionally Leu;
said protein having at least one substitution selected from
the group consisting of:
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
Pro, Thr, or Val;
Ser at position 102 is replaced with Arg;
Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or
Trp at position 138 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
or a pharmaceutically acceptable salt thereof.
Preferred proteins are of the Formula II, wherein:
Trp at position 100 is Gln, Tyr, Phe, Ile, Val, or Leu; or
Trp at position 138 is Gln, Tyr, Phe, Ile, Val, or Leu.
.,
Other preferred proteins of the Formula III:
(SEQ ID NO: 3)
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
CA 02211784 1997-07-29
W O96/23517 PCTrUS96JC~~2
--10--
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
5 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
0 65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
2 0 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys (III)
wherein:
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val, or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
Pro, Thr or Val;
Ser at position 102 is replaced with Arg;
Gly at position 103 iS replaced with Ala;
Glu at position 105 iS replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 iS replaced with Glu;
Gly at position 111 is replaced with Asp; or
Trp at position 138 iS replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
45 or a pharmaceutically acceptable salt thereof.
CA 02211784 1997-07-29
W O 96/23517 PCTAUS~GJ'~5~2
Most preferred proteins are those of Formula III,
wherein: '
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn,
Met, Ile/ Phe, Tyr, Ser, Thr, Gly, Gln, Val, or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
Pro, Thr or Val;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is ~eplaced with ASp; or
Trp at position 138 is Ala, Glu, Asp, Asn, Met, Ile,
Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu.
Still more preferred proteins of the Formula III
are those wherein:
His at position 97 is replaced with Ser or Pro;
Trp at position 100 is replaced with Ala, Gly, Gln, Val,
Ile, or Leu;
Ala at position 101 is replaced with Thr; or
Trp at position 138 is Ala, Ile, Gly, Gln, Val or Leu.
Additional preferred proteins of the Formula III
are those wherein:
His at position 97 is replaced with Ser or Pro;
Trp at position 100 is replaced with Ala, Gln or Leu;
Ala at position 101 is replaced with Thr; or
Trp at position 138 is Gln.
Additional preferred proteins of the present
invention include proteins of SEQ ID NO: 3, wherein the amino
acid residues at positions 97, 100, 101, 105, 106, 107, 108,
and 111 are substituted as follows in Table 1:
CA 022ll784 l997-07-29
W Og6123517 PCTrU~G~52
Table 1
Amino Acid Position
Protein 97 100 101 105 106 107 108 111
1 Ser Trp Ala Glu Thr Leu Asp Gly
2 His Gln Ala Glu Thr Leu Asp Gly
3 His Trp Thr Glu Thr Leu Asp Gly
4 His Trp Ala Gln Thr Leu Asp Gly
His Trp Ala Glu Lys Leu Asp Gly
6 His Trp Ala Glu Thr Pro Asp Gly
7 His Trp Ala Glu Thr Leu Glu Gly
8 His Trp Ala Glu Thr Leu Asp Asp
9 Ser Gln Ala Glu Thr Leu Asp Gly
Ser Trp Thr Glu Thr Leu Asp Gly
11 Ser Trp Ala Gln Thr Leu Asp Gly
12 Ser Trp Ala Glu Lys Leu Asp Gly
13 Ser Trp Ala Glu Thr Pro Asp Gly
14 Ser Trp Ala Glu Thr Leu Glu Gly
Ser Trp Ala Glu Thr Leu Asp Asp
16 His Gln Thr Glu Thr Leu Asp Gly
17 His Gln Ala Gln Thr Leu Asp Gly
18 His Gln Ala Glu Lys Leu Asp Gly
19 His Gln Ala Glu Thr Pro Asp Gly
His Gln Ala Glu Thr Leu Glu Gly
21 His Gln Ala Glu Thr Leu Asp Asp
22 His Trp Thr Gln Thr Leu Asp Gly
23 His Trp Thr Glu Lys Leu Asp Gly
24 His Trp Thr Glu Thr Pro Asp Gly
His Trp Thr Glu Thr Leu Glu Gly
26 His Trp Thr Glu Thr Leu Asp Asp
27 His Trp Ala Gln Lys Leu Asp Gly
28 His Trp Ala Gln Thr Pro Asp Gly
29 His Trp Ala Gln Thr Leu Glu Gly
His Trp Ala Gln Thr Leu Asp Asp
31 His Trp Ala Glu Lys Pro Asp Gly
32 His Trp Ala Glu Lys Leu Glu Gly
CA 022ll784 l997-07-29
W O 96123517 PCTrUS9r'~52
33 His Trp Ala Glu Lys Leu Asp Asp
34 His Trp Ala Glu Thr Pro Glu Gly
His Trp Ala Glu Thr Pro Asp Asp
3 6 His Trp Ala Glu Thr Leu Glu Asp
3 7 Ser Gln Thr Glu Thr Leu Asp Gly
38 Ser Gln Ala Gln Thr Leu Asp Gly
39 Ser Gln Ala Glu Lys Leu Asp Gly
Ser Gln Ala Glu Thr Pro Asp Gly
41 Ser Gln Ala Glu Thr Leu Glu Gly
42 Ser Gln Ala Glu Thr Leu Asp Asp
43 Ser Trp Thr Gln Thr Leu Asp Gly
44 Ser Trp Thr Glu Lys Leu Asp Gly
Ser Trp Thr Glu Thr Pro Asp Gly
4 6 Ser Trp Thr Glu Thr Leu Glu Gly
47 Ser Trp Thr Glu Thr Leu Asp Asp
48 Ser Trp Ala Gln Lys Leu Asp Gly
49 Ser Trp Ala Gln Thr Pro Asp Gly
Ser Trp Ala Gln Thr Leu Glu Gly
51 Ser Trp Ala Gln Thr Leu Asp Asp
52 Ser Trp Ala Glu Lys Pro Asp Gly
53 Ser Trp Ala Glu Lys Leu Glu Gly
54 Ser Trp Ala Glu Lys Leu Asp Asp
Ser Trp Ala Glu Thr Pro Glu Gly
5 6 Ser Trp Ala Glu Thr Pro Asp Asp
57 Ser Trp Ala Glu Thr Leu Glu Asp
58 His Gln Thr Gln Thr Leu Asp Gly
59 His Gln Thr Glu Lys Leu Asp Gly
His Gln Thr Glu Thr Pro Asp Gly
61 His Gln Thr Glu Thr Leu Glu Gly
62 His Gln Thr Glu Thr Leu Asp Asp
63 His Gln Ala Gln Lys Leu Asp Gly
64 His Gln Ala Gln Thr Pro Asp Gly
His Gln Ala Gln Thr Leu Glu Gly
66 His Gln Ala Gln Thr Leu ASp Asp
67 His Gln Ala Glu Lys Pro Asp Gly
68 His Gln Ala Glu Lys Leu Glu Gly
CA 022ll784 l997-07-29
W O96123517 PCTrUS~61C~352
-14-
69 His Gln Ala Glu Lys Leu Asp Asp
His Gln Ala Glu Thr Pro Glu Gly
71 His Gln Ala Glu Thr Pro Asp Asp
72 HiS Gln Ala Glu Thr Leu Glu Asp
73 His Trp Thr Gln Lys Leu Asp Gly
74 His Trp Thr Gln Thr Pro Asp Gly
His Trp Thr Gln Thr Leu Glu Gly
76 His Trp Thr Gln Thr Leu Asp Asp
77 HiS Trp Thr Glu Lys Pro Asp Gly
78 HiS Trp Thr Glu Lys Leu Glu Gly
79 His Trp Thr Glu Lys Leu Asp Asp
His Trp Thr Glu Thr Pro Glu Gly
81 His Trp Thr Glu Thr Pro Asp Asp
82 His Trp Thr Glu Thr Leu Glu Asp
83 His Trp Ala Gln Lys Pro Asp Gly
84 His Trp Ala Gln Lys Leu Glu Gly
His Trp Ala Gln Lys Leu Asp Asp
86 His Trp Ala Gln Thr Pro Glu Gly
87 His Trp Ala Gln Thr Pro Asp Asp
88 His Trp Ala Gln Thr Leu Glu Asp
89 His Trp Ala Glu Lys Pro Glu Gly
His Trp Ala Glu Lys Pro Asp Asp
91 His Trp Ala Glu Lys Leu Glu Asp
92 His Trp Ala Glu Thr Pro Glu Asp
93 Ser Gln Thr Gln Thr Leu Asp Gly
94 Ser Gln Thr Glu Lys Leu Asp Gly
Ser Gln Thr Glu Thr Pro Asp Gly
96 Ser Gln Thr Glu Thr Leu Glu Gly
97 Ser Gln Thr Glu Thr Leu Asp Asp
98 Ser Gln Ala Gln Lys Leu Asp Gly
99 Ser Gln Ala Gln Thr Pro Asp Gly
100 Ser Gln Ala Gln Thr Leu Glu Gly
101 Ser Gln Ala Gln Thr Leu Asp Asp
102 Ser Gln Ala Glu Lys Pro Asp Gly
103 Ser Gln Ala Glu Lys Leu Glu Gly
104 Ser Gln Ala Glu Lys Leu Asp Asp
CA 022ll784 l997-07-29
PCTrUS96/00952
W 096/23517
105 Ser Gln Ala Glu Thr Pro Glu Gly
106 Ser Gln Ala Glu Thr Pro Asp Asp
107 Ser Gln Ala Glu Thr Leu Glu Asp
108 Ser Trp Thr Gln Lys Leu Asp Gly
109 Ser Trp Thr Gln Thr Pro Asp Gly
110 Ser Trp Thr Gln Thr Leu Glu Gly
111 Ser Trp Thr Gln Thr Leu Asp Asp
112 Ser Trp Thr Glu Lys Pro Asp Gly
113 Ser Trp Thr Glu Lys Leu Glu Gly
114 Ser Trp Thr Glu Lys Leu Asp Asp
115 Ser Trp Thr Glu Thr Pro Glu Gly
116 Ser Trp Thr Glu Thr Pro Asp Asp
117 Ser Trp Thr Glu Thr Leu Glu Asp
118 Ser Trp Ala Gln Lys Pro Asp Gly
119 Ser Trp Ala Gln Lys Leu Glu Gly
120 Ser Trp Ala Gln Lys Leu Asp Asp
121 Ser Trp Ala Gln Thr Pro Glu Gly
122 Ser Trp Ala Gln Thr Pro Asp Asp
123 . Ser Trp Ala Gln Thr Leu Glu Asp
124 Ser Trp Ala Glu Lys Pro Glu Gly
125 Ser Trp Ala Glu Lys Pro Asp Asp
12 6 Ser Trp Ala Glu Lys Leu Glu Asp
127 Ser Trp Ala Glu Thr Pro Glu Asp
12 8 His Gln Thr Gln Lys Leu Asp Gly
129 His Gln Thr Gln Thr Pro Asp Gly
130 His Gln Thr Gln Thr Leu Glu Gly
131 His Gln Thr Gln Thr Leu Asp Asp
132 His Gln Thr Glu Lys Pro Asp Gly
133 His Gln Thr Glu Lys Leu Glu Gly
134 His Gln Thr Glu Lys Leu Asp Asp
135 His Gln Thr Glu Thr Pro Glu Gly
136 His Gln Thr Glu Thr Pro Asp Asp
137 His Gln Thr Glu Thr Leu Glu Asp
13 8 His Gln Ala Gln Lys Pro Asp Gly
139 His Gln Ala Gln Lys Leu Glu Gly
140 His Gln Ala Gln Lys Leu Asp Asp
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
-16-
141 His Gln Ala Gln Thr Pro Glu Gly
142 His Gln Ala Gln Thr Pro Asp Asp
143 His Gln Ala Gln Thr Leu Glu Asp
144 His Gln Ala Glu Lys Pro Glu Gly
145 His Gln Ala Glu Lys Pro Asp Asp
146 His Gln Ala Glu Lys Leu Glu Asp
147 His Gln Ala Glu Thr Pro Glu Asp
148 His Trp Thr Gln Lys Pro Asp Gly
149 His Trp Thr Gln Lys Leu Glu Gly
150 His Trp Thr Gln Lys Leu Asp Asp
151 His Trp Thr Gln Thr Pro Glu Gly
152 His Trp Thr Gln Thr Pro Asp Asp
153 His Trp Thr Gln Thr Leu Glu Asp
154 His Trp Thr Glu Lys Pro Glu Gly
155 His Trp Thr Glu Lys Pro Asp Asp
156 His Trp Thr Glu Lys Leu Glu Asp
157 His Trp Thr Glu Thr Pro Glu Asp
158 His Trp Ala Gln Lys Pro Glu Gly
159 His Trp Ala Gln Lys Pro Asp Asp
160 His Trp Ala Gln Lys Leu Glu Asp
161 His Trp Ala Gln Thr Pro Glu Asp
162 His Trp Ala Glu Lys Pro Glu Asp
163 His Trp Ala Gln Lys Pro Glu Asp
164 His Trp Thr Glu Lys Pro Glu Asp
165 His Trp Thr Gln Thr Pro Glu Asp
166 His Trp Thr Gln Lys Leu Glu Asp
167 His Trp Thr Gln Lys Pro Asp Asp
168 His Trp Thr Gln Lys Pro Glu Gly
169 His Gln Ala Glu Lys Pro Glu Asp
170 His Gln Ala Gln Thr Pro Glu Asp
171 His Gln Ala Gln Lys Leu Glu Asp
172 His Gln Ala Gln Lys Pro Asp Asp
173 His Gln Ala Gln Lys Pro Glu Gly
174 His Gln Thr Glu Thr Pro Glu Asp
175 His Gln Thr Glu Lys Leu Glu Asp
176 His Gln Thr Glu Lys Pro Asp Asp
;
CA 022ll784 l997-07-29
PCTrUS96100952
W 096/23517
-17-
177 His Gln Thr Glu Lys Pro Glu Gly
178 His Gln Thr Gln Thr Leu Glu Asp
179 His Gln Thr Gln Thr Pro Asp Asp
180 His Gln Thr Gln Thr Pro Glu Gly
181 His Gln Thr Gln Lys Leu Asp Asp
182 His Gln Thr Gln Lys Leu Glu Gly
183 His Gln Thr Gln Lys Pro Asp Gly
184 Ser Trp Ala Glu Lys Pro Glu Asp
185 Ser Trp Ala Gln Thr Pro Glu Asp
186 Ser Trp Ala Gln Lys Leu Glu Asp
187 Ser Trp Ala Gln Lys Pro Asp Asp
188 Ser Trp Ala Gln Lys Pro Glu Gly
189 Ser Trp Thr Glu Thr Pro Glu Asp
190 Ser Trp Thr Glu Lys Leu Glu Asp
191 Ser Trp Thr Glu Lys Pro Asp Asp
192 Ser Trp Thr Glu Lys Pro Glu Gly
193 Ser Trp Thr Gln Thr Leu Glu Asp
194 Ser Trp Thr Gln Thr Pro Asp Asp
195 Ser Trp Thr Gln Thr Pro Glu Gly
196 Ser Trp Thr Gln Lys Leu Asp Asp
197 Ser Trp Thr Gln Lys Leu Glu Gly
198 Ser Trp Thr Gln Lys Pro Asp Gly
199 Ser Gln Ala Glu Thr Pro Glu Asp
200 Ser Gln Ala Glu Lys Leu Glu Asp
201 Ser Gln Ala Glu Lys Pro Asp Asp
202 Ser Gln Ala Glu Lys Pro Glu Gly
203 Ser Gln Ala Gln Thr Leu Glu Asp
204 Ser Gln Ala Gln Thr Pro Asp Asp
205 Ser Gln Ala Gln Thr Pro Glu Gly
206 Ser Gln Ala Gln Lys Leu Asp Asp
207 Ser Gln Ala Gln Lys Leu Glu Gly
208 Ser Gln Ala Gln Lys Pro Asp Gly
209 Ser Gln Thr Glu Thr Leu Glu Asp
210 Ser Gln Thr Glu Thr Pro Asp Asp
211 Ser Gln Thr Glu Thr Pro Glu Gly
212 Ser Gln Thr Glu Lys Leu Asp Asp
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
-18-
213 Ser Gln Thr Glu Lys Leu Glu Gly
214 Ser Gln Thr Glu Lys Pro Asp Gly
215 Ser Gln Thr Gln Thr Leu Asp Asp
216 Ser Gln Thr Gln Thr Leu Glu Gly
217 Ser Gln Thr Gln Thr Pro Asp Gly
218 Ser Gln Thr Gln Lys Leu Asp Gly
219 His Trp Thr Gln Lys Pro Glu Asp
220 His Gln Ala Gln Lys Pro Glu Asp
221 His Gln Thr Glu Lys Pro Glu Asp
222 His Gln Thr Gln Thr Pro Glu Asp
223 His Gln Thr Gln Lys Leu Glu Asp
224 His Gln Thr Gln Lys Pro Asp Asp
225 His Gln Thr Gln Lys Pro Glu Gly
226 Ser Trp Ala Gln Lys Pro Glu Asp
227 Ser Trp Thr Glu Lys Pro Glu Asp
228 Ser Trp Thr Gln Thr Pro Glu Asp
229 Ser Trp Thr Gln Lys Leu Glu Asp
230 Ser Trp Thr Gln Lys Pro Asp Asp
231 Ser Trp Thr Gln Lys Pro Glu Gly
232 Ser Gln Ala Glu Lys Pro Glu Asp
233 Ser Gln Ala Gln Thr Pro Glu Asp
234 Ser Gln Ala Gln Lys Leu Glu Asp
235 Ser Gln Ala Gln Lys Pro Asp Asp
236 Ser Gln Ala Gln Lys Pro Glu Gly
237 Ser Gln Thr Glu Thr Pro Glu Asp
238 Ser Gln Thr Glu Lys Leu Glu Asp
239 Ser Gln Thr Glu Lys Pro Asp Asp
240 Ser Gln Thr Glu Lys Pro Glu Gly
241 Ser Gln Thr Gln Thr Leu Glu Asp
242 Ser Gln Thr Gln Thr Pro Asp Asp
243 Ser Gln Thr Gln Thr Pro Glu Gly
244 Ser Gln Thr Gln Lys Leu Asp Asp
245 Ser Gln Thr Gln Lys Leu Glu Gly
246 Ser Gln Thr Gln Lys Pro Asp Gly
247 His Gln Thr Gln Lys Pro Glu Asp
248 Ser Trp Thr Gln Lys Pro Glu Asp
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
-19 -
249 Ser Gln Ala Gln Lys Pro Glu Asp
250 Ser Gln Thr Glu Lys Pro Glu Asp
251 Ser Gln Thr Gln Thr Pro Glu Asp
252 Ser Gln Thr Gln Lys Leu Glu Asp
253 Ser Gln Thr Gln Lys Pro Asp Asp
254 Ser Gln Thr Gln Lys Pro Glu Gly
255 Ser Gln Thr Gln Lys Pro Glu Asp
256 His Ala Ala Glu Thr Leu Asp Gly
257 His Leu Ala Glu Thr Leu Asp Gly
258 Pro Trp Ala Glu Thr Leu Asp Gly
Most preferred species of Formula III and Table 1
include species of SEQ ID NO: 4-11:
(SEQ ID NO: 4)
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
0 Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 -70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 - 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
t 145
Gly Cys
(SEQ ID NO: 5)
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
-20-
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
5 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr GIu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
2 5 145
Gly Cys
(SEQ ID NO: 6)
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
40 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
lO0 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
Gly Cys
CA 022ll784 l997-07-29
W O96123517 PCTrUS96/00952
-21-
(SEQ ID NO: 7)
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
~ 45
0 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
~ 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
2 5 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 - 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
Gly Cys
(SEQ ID NO: 8)
5 10 15
35 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Ala Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
CA 022ll784 l997-07-29
W O 96/23517 PCTrUS96/00952
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
5 Gly Cys
(SEQ ID NO: 9)
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
15 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
3 0 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
3 5 145
Gly Cys
(SEQ ID NO: 10)
5 10 15
40 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
35 40 45
Ly~ Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn. Asp Leu
55 G1U Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
Ser Leu Pro Gln Thr Ser Gly Leu Glu Thr Leu Asp. Ser Leu Gly Gly
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/C~~2
-23-
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
Gly Cys
(SEQ ID NO~
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
Ser Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
4 0 Gly Cys
The present inven~ion provides biologically active
proteins that provide effective treatment for obesity.
Unexpectedly, the claimed proteins have improved properties
due to specific substitutions to the human obesity protein.
The claimed proteins are more stable than both the mouse and
human obesity protein and, therefore, are superior
therapeutic agents.
The claimed proteins ordinarily are prepared by
recombinant techniques. Techniques for making substitutional
mutations at predetermined sites in DNA having a known
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00~2
-24-
sequence are well known, for example M13 primer mutagenesis.
The mutations that might be made in the DNA encoding the
present anti-obesity proteins must not place the sequence out
of reading frame and preferably will not create complementary
regions that could produce secondary mRNA structure. See
DeBoer et al., EP 75,444A (1983).
The compounds of the present invention may be
produced either by recombinant DNA technology or well known
chemical procedures, such as solution or solid-phase peptide
synthesis, or semi-synthesis in solution beginning with
protein fragments coupled through conventional solution
methods.
A. Solid Phase
The synthesis of the claimed proteins may proceed
by solid phase peptide synthesis or by recombinant methods.
The principles of solid phase chemical synthesis of
polypeptides are well known in the art and may be found in
general texts in the area such as Dugas, H. and Penney, C.,
Bioor~anic ChemistrY Springer-Verlag, New York, pgs. 54-92
(1981). For example, peptides may be synthesized by solid-
phase methodology utilizing an PE-Applied Biosystems 433A
peptide synthesizer (commercially available from Applied
Biosystems, Foster City California) and synthesis cycles
supplied by Applied Biosystems. Boc amino acids and other
reagents are commercially available from PE-Applied
Biosystems and other chemical supply houses. Sequential Boc
chemistry using double couple protocols are applied to the
starting p-methyl benzhydryl amine resins for the production
of C-terminal carboxamides. For the production of C-terminal
acids, the corresponding PAM resin is used. Arginine,
Asparagine, Glutamine, Histidine and Methionine are coupled
using preformed hydroxy benzotriazole esters. The following
side chain protection may be used:
Arg, Tosyl
Asp, cyclohexyl or benzyl
Cys, 4-methylbenzyl
CA 02211784 1997-07-29
W O96/23517 PCTrUS9C/00~52
-25-
Glu, cyclohexyl
His, benzyloxymethyl
Lys, 2-chlorobenzyloxycarbonyl
Met, sulfoxide
Ser, Benzyl
Thr, Benzyl
Trp, formyl
Tyr, 4-bromo carbobenzoxy
Boc deprotection may be accomplished with trifluoroacetic
acid (TFA) in methylene chloride. Formyl removal from Trp is
accomplished by treatment of the peptidyl resin with 20%
piperidine in dimethylformamide for 60 minutes at 4~C.
Met(O) can be reduced by treatment of the peptidyl resin with
TFA/dimethylsulfide/conHCl (95/5/1) at 25~C for 60 minutes.
Following the above pre-treatments, the peptides may be
further deprotected and cleaved from the resin with anhydrous
hydrogen fluoride containing a mixture of 10% m-cresol or m-
cresol/10~ p-thiocresol or m-cresol/p-thiocresol/dimethyl-
sulfide. Cleavage of the side chain protecting group(s) and
of the peptide from the resin is carried out at zero degrees
Centigrade or below, preferably -20~C for thirty minutes
followed by thirty minutes at 0~C. After removal of the HF,
the peptide/resin is washed with ether. The peptide is
extracted with glacial acetic acid and lyophilized.
Purification is accomplished by reverse-phase C18
chromatography (Vydac) column in .1% TFA with a gradient of
increasing acetonitrile concentration.
One skilled in the art recognizes that the solid
phase synthesis could also be accomplished using the FMOC
strategy and a TFA/scavenger cleavage mixture.
B. Recombinant Svnthesis
The claimed proteins may also be produced by
recombinant methods. Recombinant methods are preferred if a
high yield is desired. The basic steps in the recombinant
production of protein include:
CA 02211784 1997-07-29
W O96/23517 P~TrUS9''00~S2
-26-
a) construction of a synthetic or semi-synthetic
(or isolation from natural sources) DNA
encoding the claimed protein,
b) integrating the coding sequence into an
expression vector in a manner suitable for the
expression of the protein either alone or as a
fusion protein,
c) transforming an appropriate eukaryotic or
prokaryotic host cell with the expression
vector, and
d) recovering and purifying the recombinantly
produced protein.
a. Gene Construction
Synthetic genes, the i vitro or i vivo
transcription and translation of which will result in the
production of the protein may be constructed by techniques
well known in the art. Owing to the natural degeneracy of
the genetic code, the skilled artisan will recognize that a
sizable yet definite number of DNA sequences may be
constructed which encode the claimed proteins. In the
preferred practice of the invention, synthesis is achieved by
recombinant DNA technology.
Methodology of synthetic gene construction is well
known in the art. For example, see Brown, et al. (1979)
Methods in Enzymology, Academic Press, N.Y., Vol. 68, pgs.
109-151. The DNA sequence corresponding to the synthetic
claimed protein gene may be generated using conventional DNA
synthesizing apparatus such as the Applied Biosystems Model
380A or 380B DNA synthesizers (commercially available from
Applied Biosystems, Inc., 850 Lincoln Center Drive, Foster
City, CA 94404).
It may desirable in some applications to modify the
coding sequence of the claimed protein so as to incorporate a
convenient protease sensitive cleavage site, e.g., between
the signal peptide and the structural protein facilitating
CA 022ll784 l997-07-29
W O96/23517 PCTrUS9G~00~52
the controlled excision of the signal peptide from the fusion
A protein construct.
The gene encoding the claimed protein may also be
created by using polymerase chain reaction (PCR). The
5 template can be a cDNA library (commercially available from
CLONETECH or STRATAGENE) or mRNA isolated from human adipose
tissue. Such methodologies are well known in the art
Maniatis, et al. Molecular Clonina: A Laboratorv Manual, Cold
Spring Harbor Press, Cold Spring Harbor Laboratory, Cold
10 Spring Harbor, New York (1989).
b. Direct ex~ression or Fusion ~rotein
The claimed protein may be made either by direct
expression or as fusion protein comprising the claimed
protein followed by enzymatic or chemical cleavage. A
15 variety of peptidases (e.g. trypsin) which cleave a
polypeptide at specific sites or digest the peptides from the
amino or carboxy termini (e.g. diaminopeptidase) of the
peptide chain are known. Furthermore, particular chemicals
(e.g. cyanogen bromide) will cleave a polypeptide chain at
20 specific sites. The skilled artisan will appreciate the
modifications necessary to the amino acid seauence (and
synthetic or semi-synthetic coding sequence if recombinant
means are employed) to incorporate site-specific internal
cleavage sites. See e.g., Carter P., Site Specific
25 Proteolysis of Fusion Proteins, Ch. 13 in Protein
Purification: From Molecular Mechanisms to Larae Scale
Processes, American Chemical Soc., Washington, D.C. (1990).
c. Vector Construction
Construction of suitable vectors containing the
30 desired coding and control seauences employ standard ligation
techniques. Isolated plasmids or DNA fragments are cleaved,
tailored, and religated in the form desired to form the
plasmids required.
To effect the translation of the desired protein,
35 one inserts the engineered synthetic DNA seauence in any of a
plethora of appropriate recombinant DNA expression vectors
CA 02211784 1997-07-29
W O96/23S17 PCTrUS96100952
-28-
through the use o~ appropriate restriction endonucleases. A
synthetic coding sequence is designed to possess restriction
endonuclease cleavage sites at either end of the transcript
to facilitate isolation from and integration into these
expression and amplification and expression plasmids. The
isolated cDNA coding sequence may be readily modified by the
use of synthetic linkers to facilitate the incorporation of
this sequence into the desired cloning vectors by techniques
well known in the art. The particular endonucleases employed
will be dictated by the restriction endonuclease cleavage
pattern of the parent expression vector to be employed. The
choice of restriction sites are chosen so as to properly
orient the coding sequence with control sequences to achieve
proper in-frame reading and expression of the claimed
protein.
In general, plasmid vectors containing promoters
and control sequences which are derived from species
compatible with the host cell are used with these hosts. The
vector ordinarily carries a replication site as well as
marker sequences which are capable of providing phenotypic
selection in transformed cells. For example, E. coli is
typically transformed using pBR322, a plasmid derived from an
E. coli species (Bolivar, et al., Gene 2: 95 (1977)).
Plasmid pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides easy means for identifying
transformed cells. The pBR322 plasmid, or other microbial
plasmid must also contain or be modified to contain promoters
and other control elements commonly used in recombinant DNA
technology.
The desired coding sequence is inserted into an
expression vector in the proper orientation to be transcribed
from a promoter and ribosome binding site, both of which
should be functional in the host cell in which the protein is
to be expressed. An example of such an expression vector is
a plasmid described in Belagaje et al., U.S. patent No.
5,304,493, the teachings of which are herein incorporated by
-
CA 02211784 1997-07-29
W O 96/23517 PCTrUS96/00952
-29-
reference. The gene encoding A-C-B proinsulin described in
U.S. patent No. 5,304,493 can be removed from the plasmid
pRB182 with restriction enzymes NdeI and BamHI. The genes
encoding the protein of the present invention can be inserted
into the plasmid backbone on a NdeI/BamHI restriction
fragment cassette.
d. Procarvotic ex~ression
In general, procaryotes are used for cloning of DNA
sequences in constructing the vectors useful in the
invention. For example, E. coli K12 strain 294 (ATCC No.
31446) is particularly useful. Other microbial strains which
may be used include E coli B and E. coli X1776 (ATCC No.
31537). These examples are illustrative rather than limiting.
Prokaryotes also are used for expression. The
aforementioned strains, as well as E. coli W3110
(prototrophic, ATCC No. 27325), bacilli such as Bacillus
subtilis, and other enterobacteriaceae such as Salmonella
typhimurium or Serratia marcescans, and various pseudomonas
species may be used. Promoters suitable for use with
prokaryotic hosts include the ~-lactamase (vector pGX2907
[ATCC 39344] contains the replicon and ~-lactamase gene) and
lactose promoter systems (Chang et al., Nature, 275:615
(1978)i and Goeddel et al., Nature 281:544 (1979)), alkaline
phosphatase, the tryptophan (trp) promoter system (vector
pATH1 [ATCC 37695] is designed to facilitate expression of an
open reading frame as a trpE fusion protein under control of
the trp promoter) and hybrid promoters such as the tac
promoter (isolatable from plasmid pDR540 ATCC-37282).
However, other functional bacterial promoters, whose
nucleotide sequences are generally known, enable one of skill
in the art to ligate them to DNA encoding the protein using
linkers or adaptors to supply any required restriction sites.
Promoters for use in bacterial systems also will contain a
Shine-Dalgarno sequence operably linked to the DNA encoding
protein.
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00~2
-30-
e. Eucarvotic ex~ression
The protein may be recombinantly produced in
eukaryotic expression systems. Preferred promoters
controlling transcription in m~mm~l ian host cells may be
obtained from various sources, for example, the genomes of
viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus,
retroviruses, hepatitis-B virus and most preferably
cytomegalovirus, or from heterologous mammalian promoters,
e.g. ~-actin promoter. The early and late promoters of the
0 SV40 virus are conveniently obtained as an SV40 restriction
fragment which also contains the SV40 viral origin of
replication. Fiers, et al., Nature, 273:113 (1978). The
entire SV40 genome may be obtained from plasmid pBRSV, ATCC
45019. The immediate early promoter of the human
cytomegalovirus may be obtained from plasmid pCMB~ (ATCC
77177). Of course, promoters from the host cell or related
species also are useful herein.
Transcription of a DNA encoding the claimed protein
by higher eukaryotes is increased by inserting an enhancer
sequence into the vector. Enhancers are cis-acting elements
of DNA, usually about 10-300 bp, that act on a promoter to
increase its transcription. Enhancers are relatively
orientation and position independent having been found 5'
(Laimins, L. et al., PNAS 78:993 (1981)) and 3' (Lusky, M.
L., et al., Mol. Cell Bio. 3:1108 (1983)) to the
transcription unit, within an intron (Banerji, J. L. et al.,
Cell 33:729 (1983)) as well as within the coding sequence
itself (Osborne, T. F., et al., Mol. Cell Bio. 4:1293
(1984)). Many enhancer sequences are now known from
mammalian genes (globin, RSV, SV40, EMC, elastase, albumin,
a-fetoprotein and insulin). Typically, however, one will use
an enhancer from a eukaryotic cell virus. Examples include
the SV40 late enhancer, the cytomegalovirus early promoter
enhancer, the polyoma enhancer on the late side of the
replication origin, and adenovirus enhancers.
CA 02211784 1997-07-29
W O96/23517 PCTrUS9G/00952
-31-
Expression vectors used in eukaryotic host cells
(yeast, fungi, insect, plant, animal, human or nucleated
cells from other multicellular organisms) will also contain
sequences necessary for the termination of transcription
which may affect mRNA expression. These regions are
transcribed as polyadenylated segments in the untranslated
portion of the mRNA encoding protein. The 3' untranslated
regions also include transcription termination sites.
Expression vectors may contain a selection gene,
also termed a selectable marker. Examples of suitable
selectable markers for mammalian cells are dihydrofolate
reductase (DHFR, which may be derived from the BalII/HindIII
restriction fragment of pJOD-10 [ATCC 68815]), thymidine
kinase (herpes simplex virus thymidine kinase is contained on
the samHI fragment of vP-5 clone [ATCC 2028]) or neomycin
(G418) resistance genes (obtainable from pNN414 yeast
artificial chromosome vector [ATCC 37682]). When such
selectable markers are successfully transferred into a
m~mm~l ian host cell, the transfected m~mm~l ian host cell can
survive if placed under selective pressure. There are two
widely used distinct categories of selective regimes. The
first category is based on a cell's metabolism and the use of
a mutant cell line which lacks the ability to grow without a
supplemented media. Two examples are: CHO DHFR- cells (ATCC
CRL-9096) and mouse LTK- cells (L-M (TK-) ATCC CCL-2.3).
These cells lack the ability to grow without the addition of
such nutrients as thymidine or hypoxanthine. Because these
cells lack certain genes necessary for a complete nucleotide
synthesis pathway, they cannot survive unless the missing
nucleotides are provided in a supplemented media. An
alternative to supplementing the media is to introduce an
intact DHFR or TK gene into cells lacking the respective
genes, thus altering their growth requirements. Individual
cells which were not transformed with the DHFR or TK gene
will not be capable of survival in nonsupplemented media.
CA 02211784 1997-07-29
W O96/23517 PCTrUS~G~'~0
-32-
The second category is dominant selection which
refers to a selection scheme used in any cell type and does
not require the use of a mutant cell line. These schemes
typically use a drug to arrest growth of a host cell. Those
cells which have a novel gene would express a protein
conveying drug resistance and would survive the selection.
Examples of such dominant selection use the drugs neomycin,
Southern P. and Berg, P., J. Molec. A~l. Genet. 1: 327
(1982), mycophenolic acid, Mulligan, R. C. and Berg, P.
Science 209:1422 (1980), or hygromycin, Sugden, B. et al.,
Mol Cell. Biol . 5:410-413 (1985). The three examples given
above employ bacterial genes under eukaryotic control to
convey resistance to the appropriate drug G418 or neomycin
(geneticin), xgpt (mycophenolic acid) or hygromycin,
respectively.
A preferred vector for eucaryotic expression is
pRc/CMV. pRc/CMV is commercially available from Invitrogen
Corporation, 3985 Sorrento Valley Blvd., San Diego, CA
92121. To confirm correct sequences in plasmids constructed,
the ligation mixtures are used to transform E. coli K12
strain DH5a (ATCC 31446) and successful transformants
selected by antibiotic resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by
restriction and/or sequence by the method of Messing, et al.,
Nucleic Acids Res. 9:309 (1981).
Host cells may be transformed with the expression
vectors of this invention and cultured in conventional
nutrient media modified as is appropriate for inducing
promoters, selecting transformants or amplifying genes. The
culture conditions, such as temperature, pH and the like, are
those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan. The techniques of transforming cells with the
aforementioned vectors are well known in the art and may be
found in such general references as Maniatis, et al.,
Molecular Clonin~: A LaboratorY Manual, Cold Spring Harbor
CA 02211784 1997-07-29
W O96123517 PCTnUS96/00952
Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New
York (1989), or Current Protocols in Molecular Biolo~v
(1989) and supplements.
Preferred suitable host cells for expressing the
vectors encoding the claimed proteins in higher eukaryotes
include: African green monkey kidney line cell line
transformed by SV40 (COS-7, ATCC CRL-1651); transformed human
primary embryonal kidney cell line 293,(Graham, F. L. et al.,
J. Gen Virol. 36:59-72 (1977), Virolocv 77:319-329, Virolo~v
86:10-21)i baby hamster kidney cells (BHK-21(C-13), ATCC CCL-
10, Viroloov 16:147 (1962)); Chinese hamster ovary cells CHO-
DHFR- (ATCC CRL-9096), mouse Sertoli cells (TM4, ATCC CRL-
1715, Biol. Re~rod. 23:243-250 (1980)); African green monkey
kidney cells (VERO 76, ATCC CRL-1587); human cervical
epitheloid carcinoma cells (HeLa, ATCC CCL-2); canine kidney
cells (MDCK, ATCC CCL-34); buffalo rat liver cells (BRL 3A,
ATCC CRL-1442); human diploid lung cells (WI-38, ATCC CCL-
75); human hepatocellular carcinoma cells (Hep G2, ATCC HB-
8065);and mouse m~mm~ry tumor cells (MMT 060562, ATCC CCL51).
f. Yeast expression
In addition to prokaryotes, eukaryotic microbes
such as yeast cultures may also be used. Saccharomyces
cerevisiae, or common baker's yeast is the most commonly used
eukaryotic microorganism, although a number of other strains
are commonly available. For expression in Saccharomyces, the
plasmid YRp7, for example, (ATCC-40053, Stinchcomb, et al.,
Nature 282:39 (1979); Kingsman et al., Gene 7:141 (1979);
Tschemper et al., Gene 10:157 (1980)) is commonly used. This
plasmid already contains the trp gene which provides a
selection marker for a mutant strain of yeast lacking the
ability to grow in tryptophan, for example ATCC no. 44076 or
PEP4-1 (Jones, Genetics 85:12 (1977)).
Suitable promoting se~uences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase
(found on plasmid pAP12BD ATCC 53231 and described in U.S.
Patent No. 4,935,350, June 19, 1990) or other glycolytic
CA 02211784 1997-07-29
W O96/23517 PCTrUS96/00952
-34-
enzymes such as enolase (found on plasmid pAC1 ATCC 39532),
glyceraldehyde-3-phosphate dehydrogenase (derived from
plasmid pHcGAPC1 ATCC 57090, 57091), zymomonas mobilis
(United States Patent No. 5,000,000 issued March 19, 1991),
hexokinase, pyruvate decarboxylase, phosphofructokinase,
glucose-6-phosphate isomerase, 3-phosphoglycerate mutase,
pyruvate kinase, triosephosphate isomerase, phosphoglucose
isomerase, and glucokinase.
other yeast promoters, which are inducible
promoters having the additional advantage of transcription
controlled by growth conditions, are the promoter regions for
alcohol dehydrogenase 2, isocytochrome C, acid phosphatase,
degradative enzymes associated with nitrogen metabolism,
metallothionein (contained on plasmid vector pCL28XhoLHBPV
ATCC 39475, United States Patent No. 4,840,896),
glyceraldehyde 3-phosphate dehydrogenase, and enzymes
responsible for maltose and galactose (GA~1 found on plasmid
pRY121 ATCC 37658) utilization. Suitable vectors and
promoters for use in yeast expression are further described
in R. Hitzeman et al., European Patent Publication No.
73,657A. Yeast enhancers such as the UAS Gal from
Saccharomyces cerevisiae (found in conjunction with the CYC1
promoter on plasmid YEpsec--hIlbeta ATCC 67024), also are
advantageously used with yeast promoters.
The following examples are presented to further
illustrate the preparation of the claimed proteins. The
scope of the present invention is not to be construed as
merely consisting of the following examples.
Exam~le 1
Vector Construction
A gene of SEQ ID NO:12 is assembled from a ~220
base pair and a ~240 base pair segment which are derived from
chemically synthesized oligonucleotides.
(SEQ ID NO: 12)
1 CATATGAGGG TACCTATCCA AAAAGTACAA GATGACACCA AAACACTGAT
=~ -
CA 022ll784 l997-07-29
W O96/23517 PCTrUSg6'003~2
-35-
51 AAAGACAATA GTCACAAGGA TAAATGATAT CTCACACACA CAGTCAGTCT
101 CATCTAAACA GAAAGTCACA GGCTTGGACT TCATACCTGG GCTGCACCCC
151 ATACTGACAT TGTCTAAAAT GGACCAGACA CTGGCAGTCT ATCAACAGAT
201 CTTAACAAGT ATGCCTTCTA GAAACGTGAT ACAAATATCT AACGACCTGG
251 AGAACCTGCG GGATCTGCTG CACGTGCTGG CCTTCTCTAA AAGTTGCCAC
301 TTGCCATGGG CCAGTGGCCT GGAGACATTG GACAGTCTGG GGGGAGTCCT
351 GGAAGCCTCA GGCTATTCTA CAGAGGTGGT GGCCCTGAGC AGGCTGCAGG
401 GGTCTCTGCA AGACATGCTG TGGCAGCTGG ACCTGAGCCC CGGGTGCTAA
451 TAGGATCC
The 220 base pair segment extends from the NdeI site to the
XbaI site at position 220 within the coding region and is
assembled from 7 overlapping oligonucleotides which range in
length from between 34 and 83 bases. The 240 base pair
segment which extends from the XbaI to the BamHI site is also
assembled from 7 overlapping oligonucleotides which range in
length from between 57 and 92 bases.
To assemble these fragments, the respective 7
oligonuclçotides are mixed in equimolar amounts, usually at
concentrations of about 1-2 picomoles per microliters. Prior
to assembly, all but the oligonucleotides at the 5" -ends of
the segment are phosphorylated in standard kinase buffer with
T4 DNA kinase using the conditions specified by the supplier
of the reagents. The mixtures are heated to 95 degrees and
allowed to cool slowly to room temperature over a period of
1-2 hours to ensure proper annealing of the oligonucleotides.
The oligonucleotides are then ligated to each other and into
an appropriated cloning vector such as pUC18 or pUC 19 using
T4 DNA ligase. The buffers and conditions are those
recommended by the supplier of the enzyme. The vector for
the 220 base pair fragment is digested with NdeI and XbaI,
whereas the vector for the 240 base pair fragment is digested
with XbaI and BamHI prior to use. The ligation mixes are
used to transform E. coli DHlOB cells (commercially available
from GibcotBRL) and the transformed cells are plated on
tryptone-yeast (TY) plates containing 100 ~g/ml of
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
ampicillin, X-gal and IPTG. Colonies which grow up overnight
are grown in liquid TY medium with 100 ,ug/ml of ampicillin
and are used for plasmid isolation and DNA sequence analysis.
Plasmids with the correct sequence are kept for the assembly
5 of the complete gene. This is accomplished by gel-
purification of the 220 base-pair and the 240 base-pair
fragments and ligation of these two fragments into an
expression vector such as pRB182 from which the coding
sequence for A-C-B proinsulin is deleted and is digested with
10 NdeI and BamHI prior to use.
Exam~le 2
The plasmid containing the DNA sequence encoding
the desired protein, is digested with PmlI and Bsu36I. The
15 recognition sequences for these enzymes lie within the coding
region for the protein at nucleotide positions 275 and 360
respectively. The cloning vector does not contain these
recognition sequences. Consequently, only two fragments are
seen following restriction enzyme digestion with PmlI and
20 Bsu36I, one corresponding to the vector fragment, the other
corresponding to the -85 base pair fragment liberated from
within the protein coding sequence. This sequence can be
replaced by any DNA sequence encoding the amino acid
substitutions listed in TabIe 1. These DNA sequences are
25 synthesized chemically as two oligonucleotides with
complementary bases and ends that are compatible with the
ends generated by digestion with PmlI and Bsu36I. The
chemically synthesized oligonucleotides are mixed in
equimolar amounts (1-10 picomoles/microliter), heated to 95
30 degrees and allow to anneal by slowly decreasing the
temperature to 20-25 degrees. The annealed oligonucleotides
are used in a standard ligation reaction. Ligation products
are tranformed and analysed as described in Example 1.
CA 02211784 1997-07-29
W O96/23517 PcTrus~GJ~o952
-37-
Exam~le 3
A DNA sequence encoding a protein represented by
Protein 255 in Table 1 with a Met Arg leader sequence was
obtained using the plasmid and procedures described in
Example 2. The plasmid was digested with PmlI and Bsu36I. A
synthetic DNA fragment of the sequence 5"-SEQ ID NO:13:
(SEQ ID NO: 13)
GTGCTGGCCTTCTCTAAAAGTTGCAGCTTGCCACAGACCAGTGGCCTGCAGAAACCGGAAA
GTCTGGACGGAGTCCTGGAAGCC
annealed with the sequence 5'-SEQ ID NO:14:
(SEQ ID NO: 14)
TGAGGCTTCCAGGACTCCGTCCAGACTTTCCGGTTTCTGCAGGCCACTGGTCTGTGGCAAG
CTGCAACTTTTAGAGAAGGCCAGCAC
was inserted between the PmlI and the Bsu36I sites.
Following ligation, transformation and plasmid isolation, the
sequence of the synthetic fragment was verified by DNA
sequence analysis.
Exam~le 4
A DNA sequence encoding SEQ ID NO: 4 with a Met Arg
leader sequence was obtained using the plasmid and procedures
described in Example 2. The plasmid was digested with PmlI
and Bsu36I. A synthetic DNA fragment of the sequence 5"-SEQ
ID NO:15
(SEQ ID NO: 15)
GTGCTGGCCTTCTCTAAAAGTTGCCACTTGCCAGCTGCCAGTGGCCTGGAGACATTGGACA
GTCTGGGGGGAGTCCTGGAAGCC
annealed with the sequence 5'-SEQ ID NO:16:
(SEQ ID NO: 16)
TGAGGCTTCCAGGACTCCCCCCAGACTGTCCAATGTCTCCAGGCCACTGGCAGCTGGCAAG
TGGCAACTTTTAGAGAAGGCCAGCAC
CA 02211784 1997-07-29
W O96/23517 PCTrUS96/00952
-38-
was inserted between the PmlI and the Bsu36I sites.
Following ligation, transformation and plasmid isolation, the
sequence of the synthetic fragment was verified by DNA
sequence analysis.
The techniques of transforming cells with the
aforementioned vectors are well known in the art and may be
found in such general references as Maniatis, et al. (1988)
Molecular Cloninq: A Laboratorv Manual, Cold Spring Harbor
Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New
York or Current Protocols in Molecular Biolo~v (1989) and
supplements. The techniques involved in the transformation
of E. coli cells used in the preferred practice of the
invention as exemplified herein are well known in the art.
The precise conditions under which the transformed E. coli
cells are cultured is dependent on the nature of the E. coli
host cell line and the expression or cloning vectors
employed. For example, vectors which incorporate
thermoinducible promoter-operator regions, such as the c1857
thermoinducible lambda-phage promoter-operator region,
require a temperature shift from about 30 to about 40 degrees
C. in the culture conditions so as to induce protein
synthesis.
In the preferred embodiment of the invention E.
çoli K12 RV308 cells are employed as host cells but numerous
other cell lines are available such as, but not limited to,
E. coli K12 L201, L687, L693, L507, L640, L641, L695, L814
(E. coli B). The transformed host cells are then plated on
appropriate media under the selective pressure of the
antibiotic corresponding to the resistance gene present on
the expression plasmid. The cultures are then incubated for
a time and temperature appropriate to the host cell line
employed.
Proteins which are expressed in high-level
bacterial expression systems characteristically aggregate in
granules or inclusion bodies which contain high levels of the
CA 022ll784 l997-07-29
W O 96123517 PCTrUS96/009~2
-39-
overexpressed protein. Kreuger et al., in Protein Foldina,
Gierasch and King, eds., pgs 136-142 (1990), American
Association for the Advancement of Science Publication No.
89-18S, Washington, D.C. Such protein aggregates must be
dissolved to provide further purification and isolation of
the desired protein product. Id. A variety of techniques
using strongly denaturing solutions such as guanidinium-HCl
and/or weakly denaturing solutions such as urea are used to
solubilize the proteins. Gradual removal of the denaturing
agents (often by dialysis) in a solution allows the denatured
protein to assume its native conformation. The particular
conditions for denaturation and folding are determined by the
particular protein expression system and/or the protein in
question.
Exam~le 5
The protein of Example 3 with a Met Arg leader
sequence was expressed in E.coli, isolated and folded either
by dilution into PBS or by dilution into 8M urea (both
containing 5 mM cysteine) and exhaustive dialysis against
PBS. Little to no aggregation of protein was seen in either
of these procedures. Following final purification of the
proteins by size exclusion chromatography the proteins were
concentrated to 3-3. 5 mg/mL in PBS. Virtually no aggregation
of the protein was noted in contrast to the native human
protein for which substantial aggregation is noted upon
concentration.
Analysis of the proteins by reverse phase HPLC
indicated that the human Ob protein eluted at approximately
56. 6 % acetonitrile, the mouse protein at 55. 8 %, and the
titled protein with a Met Arg leader sequence at 53.7 %.
Thus, unexpectedly the human with the mouse insert appears to
have higher hydrophilicity than either the human or mouse
molecules.
CA 02211784 1997-07-29
W O96/23517 PCTrUS96100952
-40-
Exam~le 6
The protein of SEQ ID NO: 4 with a Met Arg leader
sequence was expressed in E.coli. Granules were isolated and
solubilized in 8M urea with 5 mM cysteine. The protein was
purified by anion exchange chromatography and folded by
dilution into 8M urea (containing 5 mM cysteine) and
exhaustive dialysis against PBS by techniques. The pH of the
protein solution was reduced to about 2.8. The Met Arg
leader sequence was cleaved by the addition of 6-10
milliunits dDAP per mg of protein. The conversion reaction
was allowed to proceed for 2-8 hours at room temperature.
The progress of the reaction was monitored by high
performance reversed phase chromatography. The reaction was
terminated by adjusting the pH to 8 with NaOH. The des(Met-
Arg) protein was further purified by cation exchangechromatography in the presence of 7-8 M urea and size
exclusion chromatography into PBS. Following final
purification of the proteins by size exclusion chromatography
the proteins were concentrated to 3-3.5 mg/mL in PBS.
Virtually no aggregation of the protein was noted.
Preferably, the present proteins are expressed with
a leader sequence. operable leader sequences are known to
one of ordinary skill in the art; however, preferably the
leader sequence is Met-Rl- , wherein Rl is any amino acid
except Pro, so that the expressed proteins may be readily
converted to the claimed protein with Cathepsin C.
Preferably, Rl is Arg, Asp, or Tyr; and most preferably, the
proteins are expressed with a Met-Arg leader sequence.
Interestingly, the leader sequence does not significantly
affect stability or activity of the active protein. However,
the leader sequence is preferably cleaved from the protein.
Thus, the proteins of the Formula: Met-Rl-SEQ ID NO:l are
useful as biological agents and, preferably, as an
intermediate.
The purification of the claimed proteins is by
techniques known in the art and includes reverse phase
-
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
-41-
chromatography, affinity chromatography, ion exchange and
size exclusion chromatography.
The claimed proteins contain two cysteine residues.
Thus, a di-sulfide bond may be formed to stabilize the
protein. The present invention includes proteins of the
Formula (I) or (II) wherein the Cys at position 96 is
crosslinked to Cys at position 146 as well as those proteins
without such di-sulfide bonds. In addition the proteins of
the present invention may exist, particularly when
formulated, as dimers, trimers, tetramers, and other
multimers. Such multimers are included within the scope of
the present invention.
The present invention provides a method for
treating obesity. The method comprises administering to the
organism an effective amount of anti-obesity protein in a
dose between about 1 and 1000 ~g/kg. A preferred dose is from
about 10 to 100 ~g/kg of active compound. A typical daily
dose for an adult human is from about 0.5 to 100 mg. In
practicing this method, compounds of the Formula (I) can be
administered in a single daily dose or in multiple doses per
day. The treatment regime may require administration over
extended periods of time. The amount per administered dose
or the total amount administered will be determined by the
physician and depend on such factors as the nature and
severity of the disease, the age and general health of the
patient and the tolerance of the patient to the compound.
The instant invention further provides
pharmaceutical formulations comprising compounds of the
present invention. The proteins, preferably in the form of a
pharmaceutically acceptable salt, can be formulated for
parenteral administration for the therapeutic or prophylactic
treatment of obesity. For example, compounds of the Formula
(I) can be admixed with conventional pharmaceutical carriers
and excipients. The compositions comprising claimed proteins
contain from about 0.1 to 90% by weight of the active
protein, preferably in a soluble form, and more generally
CA 02211784 1997-07-29
W O96123517 PCTrUS~G/O0~S2
-42-
from about 10 to 30%. Furthermore, the present proteins may
be administered alone or in combination with other anti-
obesity agents or agents useful in treating diabetes.
For intravenous (iv) use, the protein is
administered in commonly used intravenous fluid(s) and
administered by infusion. Such fluids, for example,
physiological saline, Ringer's solution or 5% dextrose
solution can be used.
For intramuscular preparations, a sterile
formulation, preferably a suitable soluble salt form of a
protein of the Formula (I) or (II), for example the
hydrochloride salt, can be dissolved and administered in a
pharmaceutical diluent such as pyrogen-free water
(distilled), physiological saline or 5% glucose solution. A
suitable insoluble form of the compound may be prepared and
administered as a suspension in an aqueous base or a
pharmaceutically acceptable oil base, e.g. an ester of a long
chain fatty acid such as ethyl oleate.
The ability of the present compounds to treat~0 obesity is demonstrated in vivo as follows:
Bioloaical Testinq
Parabiotic experiments suggest that a protein is
released by peripheral adipose tissue and that the protein is
able to control body weight gain in normal, as well as obese
mice. Therefore, the most closely related biological test is
to inject the test article by any of several routes of
administration (e.g. i.v., s.c., i.p., or by minipump or
cannula) and then to monitor food and water consumption, body
weight gain, plasma chemistry or hormones (glucose, insulin,
ACTH, corticosterone, GH, T4) over various time periods.
Suitable test ~n i m~ 1 s include normal mice (ICR,
etc.) and obese mice (ob/ob, Avy/a, KK-Ay, tubby, fat). The
ob/ob mouse model of obesity and diabetes is generally
accepted in the art as being indicative of the obesity
condition. Controls for non-specific effects for these
injections are done using vehicle with or without the active
CA 02211784 1997-07-29
W O96123517 PCTrUS~6/O0~S2
-~3-
agent of similar composition in the same animal monitoring
the same parameters or the active agent itself in animals
that are thought to lack the receptor (db/db mice, fa/fa or
cp/cp rats). Proteins demonstrating activity in these models
will demonstrate similar activity in other mammals,
particularly humans.
Since the target tissue is expected to be the
hypothalamus where food intake and lipogenic state are
regulated, a similar model is to inject the test article
directly into the brain (e.g. i.c.v. injection via lateral or
third ventricles, or directly into specific hypothalamic
nuclei (e.g. arcuate, paraventricular, perifornical nuclei).
The same parameters as above could be measured, or the
release of neurotransmitters that are known to regulate
feeding or metabolism could be monitored (e.g. NPY, galanin,
norepinephrine, dopamine, ~-endorphin release).
Representative proteins outlined in Table 2 were
prepared in accordance with the teachings and examples
provided herein. The description of the protein in Table 2,
and in subsequent Table 3, designates the substituted amino
acids of SEQ ID NO: 3 as provided in Formula I. For example,
Ala(100) designates a protein of SEQ ID NO: 3 wherein Trp at
position 100 is Ala. The designation Met Arg - indicates
that the protein was prepared and tested with the Met Arg
leader sequence attached. Amino acid sequences of the
proteins of Table 2 and 3 were confirmed by mass spectroscopy
and/or amino acid analysis. The ability of the present
proteins to treat obesity in a OB/OB mouse is also presented
in Table 2.
CA 022ll784 l997-07-29
W O96/23517 PCTrUS96/00952
.-44-
e
~ a~ ~o o ~{ ~ i-- o o~ o ~ _t ~o ( ~ ~ co ~ o a~ ~o ~ a~ ~
~ 3m 1 ~l I I , ~ ~ ~ o o ~ ~ o o ~ o N ~ N O ~ O ~ O
e
_ ~
~ a ~ , . a~ t-- o Lr) ~o~ I ~ ~ N a~ O ~ ~0 O ~0 ~
~ 3 _ o_I o ~ ~~ ~ o _~ o_I ~ o o o o .~ _I ~ o _I o _I o
m
r
~ Iooooooooooooooo~o oo oooo
_ O
m
_ ~ N N a~ N N 1~ t-- ~I LJl 0~ a~ ~o o ~o N ~'1 O N a~ In o ~ t~ ~o
o~a~ In to ~o In r-- a~ ~-- o ~ _I O a~ ~ ~ o ~o ~ a~ o ~o
~o ~ In ~ ~o ~ ~ ~n ~o ~ o~ a~ o u~ In t~
o r~ 3 ~ a~ o 1~ 0 ~'I O ~ O N 1~ a~ ~o
o ~ ~ r- m ~ ~ a~ ~ ~o ~ ~o o ~ _I ~ ~ ~ ~ a~ ~ ~o ~
O ul~o r ~ o ~o ~o ~o r~ a~ o r ~ o ~ ~o
m C~
~_~ o ~ ~~o u~ _~ a~ ~~ In _I _I Inul o~ ~ ~ a~ O o
a~ a~ o ~ ~o ~ o o a~ _I a~
8 ~ r- a~ ~o r-- ~n a~ o r 1 a~o r r u) <J~ I_ Q a~ a~
(l) ~ ~ ~ ~ ~ co o ~ ~ ~ Ln o ~ ~o u~ ~ a~ o u~ ~ a~ a~
~o:~
N ~ ~ ~ ~t ~I ~ ~7 ~ ~ (~ ~ ~ ~ _I ~ U ~ 1~ U~
'
~ ~ ~ u~ a~ r u~ ~ u~ D t~ ~ u~ ~ u~ ~ ~ ~ o~ u~ _I
~ ~: ~ ~ ~ ~ ~ ~ ~ ~r ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ u~ ~ ~ u~ ~ ~ ~ u
_ ~
~ --I
o a~ ul ~ o ~ ~ a~ r- a~ r-- ~ a~ a~ _I o l
-- ~D
~UUUUUU~ UUUUUUUU~ )U~)UUUUU
.
o o o o o o o o o o o o oo o o o o o ::) o o o o o o
o ~ o ~ o ~ o ~ o ~ o ~ o~ o ~ o ~ c~ ~ o ~ o ~
O t
O ~_ ~ ~ O
~ o
-- -- -- -- o ~ ~ ~ ~ ~
~ ~ -- O l~
_ ~ o o o ~ a~ ul ~ o ~D _ a~
C c ~ o o C h o o o o _ h
h h r~ O r-- [-- o h ~ h ~ r ~-- u~ ~ h
~I J I ~ I h ~ _ I
a ~ ~ ~ a) ~ ~ ~ ~ ~ c) ~ ~ h ~ _ _ o r
.. . .
SUBSTITUTE SHEET (RULE 26)
CA 02211784 1997-07-29
W O96123517 PCTrUS96/00952
~4~~
~ (J) ~ r~ _I ~' ~' r-- V~ O O ~ D _I ~ m
o 3 0 0 ~ I O _~ O _I O ~ o
e
~ .
N ~ O O r~ ~ N _ U'l U'l O ~ ~ I ~r m
D~ 3 o o N O ~ I O O O O O _I _I O
c m
iJ '
.C ~ t'~ _I O 11'1 ~D r-- t-- - l O ~ ~D 1~1 111 ~D
~ ~ O O ~ O O O O O O O O O O O O
m
m
~D _( U'l ~ CO N O O r~ -- 0 0~
l'J 1' ~ --r D~ N 'D U'l O N 1-- C~ IJ) CO _I
N ~'1 m N 'D ~ CO Irl ~D ~0 O O _I
~IP t~ . . . . . . . . . . . . . . .
N _I O N N ~D ~ D t~ ~~ ~~ m o o m
c ~ m ~ ~D m N O m N / - ~ ~ ~ ~ ~ ~
.~ In .--1 o~ IJ~ ~r ~ CO _ t-- O ~D ~ O ~1 ~
D t~ ~ D ~D ~D I-- r-- O 0 0 r-- 1~ 1-- O
O ~ ~ 0~ ~D O ~ 0~ ~D 1~ O 1'~ D
N N N N t'l N ~ N (--I ~ 1~1
-
O ~ N ~ D In ~ N O
'~ O ~ _I r-- ~ ~ D N ~ m U~ D
~J u u u
o o o o o o o o o o o o o o o
O ~ O ~ O ~ O ~ O ~ O rl O o 1'
O ~t
r~
~ ~. ,, h
o . _ t~
~ o o r ~ o
r1 r ~ ~ r~
tO ~ h ' ~
~ I --t ~ h ~¢ ~¢ t r1
,~ 2 ~ ~ ~ 2 2
SUBSTITUTE SHEET (RULE 26)
CA 02211784 1997-07-29
WO96/23517 PCTrUS~GI~9~2
-46-
Similar studies are accomplished in vitro using
isolated hypothalamic tissue in a perifusion or tissue bath
system. In this situation, the release of neurotransmitters
or electrophysiological changes is monitored.
The physical and chemical properties of the present
compounds is demonstrated as follows.
Shake T est
10 The starting solutions contain purified Ob protein
in phosphate-buffered saline (Gibco BRL, Dulbecco's PBS
without calcium phosphate or magnesium phosphate, from Life
Technologies, Inc., Grand Island, NY). The protein
concentrations are generally determined by their absorbence
at 280 nm. However, an alternative method is employed for Ob
proteins with a theoretical absorbance value at 280 nm of 0.5
or less for a 1 mg/mL solution in a 1-cm cuvette. The total
integrated peak areas are determined from a 25 ~L sample
injected onto an analytical size-exclusion chromatography
(SEC) column (Superdex-75, Pharmacia), which is run at
ambient temperature in PBS and monitored at 214 nm. This
peak area is then compared to the total SEC peak area of an
ob protein whose concentration was first determined by its
absorbance at 280 nm. ~rom these analyses, a dilution is
made with PBS to give each Ob protein a final concentration
of about 1.6 mg/mL. Ali~uots of these solutions are adjusted
to pH 5.0, pH 6.0, pH 7.0 and pH 8.0 using minute quantities
of dilute acetic acid or dilute NaOH. These pH-adjusted
solutions are then ~uantitated by the W absorbence or SEC
techni~ues.
The Ob protein solutions are then added to 2-mL
glass autosampler vials (Varian Instrument Group, Sunnyvale,
CA) each containing 15 Teflon balls one-eighth inch in
diameter (Curtin Matheson Scientific, Florence, KY). Air
bubbles are removed from the solutions in the vials with
gentle shaking. The vials are slightly overfilled at the top
CA 02211784 1997-07-29
W O96/23517 PCTrUS96/009S2
-47-
and then closed with the Teflon-coated seal and screw cap. A
separate vial is used for each shake test time period that is
to be evaluated.
The test vials are placed in a rotation device in
an incubator set precisely at 40~C. The vials are rotated
end-over-end at a rate of 30 revolutions per minute, allowing
the Teflon beads to move gently from the top of the vial to
the bottom while remaining completely in the solution.
After pre-determined time periods, the contents of
the vials are removed and centrifuged 5 minutes at ambient
temperature (Fisher Scientific Model 235C Centrifuge). The
pro~ein concentrations in the clear supernatants are
determined again by the W absorbence or SEC techniques. The
percent of Ob protein remaining in solution is calculated
from the Ob concentrations in the pH-adjusted starting
solutions and in the supernatants after the shake test.
The chemical and physical stability of the present
compounds is demonstrated in Table 3. The description of the
protein in Table 3 designates the substituted amino acids of
SEQ ID MO: 3 as provided in Formula (I). For example,
Ala(100) designates a protein of SEQ ID NO: 3 wherein Trp at
position 100 is replaced with Ala. For reference the human
Ob protein and the mouse ob protein are also presented.
Table 3
Time Percent
Protein mg/mL Temp rpm pH (hrs.)R~m i n;nq
Human 1.6 40 30 7 ~4.7
47 :6.
6 7 63.
6 47 56.'
7 7 98.6
7 47 ~ 7
7 l,(, 9
47 ~'J.9
Mouse 1. 6 40 30 5 ~7 7 .5
6 ~7 9~ r
7 ~7 6,.~
8 ~7 31.6
CA 022ll784 l997-07-29
W 096/23517 PCTrUS96/00952
-48-
AlalOO 1. 640 30 5 7 9~ . 4
6 ~7~' .
7 ~ 7_ .
8 ~ 7" ~ . ~
Met-Arg-(Ser97) 1.6 40 30 5 ~ 7~F 4
6 ~-7 - .9
7 ~ 7_.O
8 ~ 7~3 . 3
Met-Arg(GlnlOO)
1.6 40 30 ' ' 793 5
77.0
~ 7' . 6
8 ~ 7a o
Met-Arg- 1. 6 40 30 5 787 ~ 9
(Ser97,GlnlOO) 6 ~79_ . 8
7 ~7 "i.. 6
8 ~-7" .3
Met-Arg- 1. 6 40 30 5 7 3 .
(Ser97,GlnlOO, 6 ~ 7~6.
ThrlOl) 7 ~ 796.'
8 ~ 799.8
Met-Arg-(LyslO6, 1. 6 40 3 0 r ~ 7'~2 .
ProlO7,Glu108, F f 762 .
Asplll) , ~ 7~ 6 .
8 ~ 7~ 1 . ~
Met-Arg- 1. 6 40 3 0 5 47100 . 3
(Ser97,GlnlOO,
ThrlOl, LyslO6, 6 ~7r'G, 9
ProlO7,Glu108, 7 ~ 79 . O
Asplll) 8 ~ 79~ . 4
Met-Arg-(AlalOO) 1. 6 40 30 _ ~ 7
7. ~.
~ 7
8 ~ 7100.3
Met-Arg-(LeulOO) 1. 6 40 30 5 ~ 7~ 6 . 9
6 ~7~ . 3
7 ~ 7.2
8 ~ 7~ .8
CA 022ll784 l997-07-29
W 096/23517 PCTrUS96/C-952
-49- =
Met-Arg-(Pro97) 1.6 40 30 5 4722.4
6 ~7~-.8
7 ~7~ .1
8 ~7~.8
Met-Arg-(Ala27, 1.6 40 30 5 ~'7 ~3.8
GlnlOO) 6 ~7~7.2
7 ~7'i6.7
8 ~'7 98.0
Met-Arg-(Ala27, 1.6 40 30 5 i757.8
LeulOO) 6 ~749.3
7 ~769.3
8 ~'7 93.3
The compounds are active in at least one of the
above biological tests and are anti-obesity agents. As such,
they are useful in treating obesity and those disorders
implicated by obesity. However, the proteins are not only
useful as therapeutic agents; one skilled in the art
recognizes that the proteins are useful in the production of
antibodies for diagnostic use and, as proteins, are useful as
feed additives for ~ni m~l s . Furthermore, the compounds are
useful for controlling weight for cosmetic purposes in
mammals. A cosmetic purpose seeks to control the weight of a
mammal to improve bodily appearance. The mammal is not
necessarily obese. Such cosmetic use forms part of the
present invention.
The principles, preferred embodiments and modes of
operation of the present invention have been described in the
foregoing specification. The invention which is intended to
be protected herein, however, is not to be construed as
limited to the particular forms disclosed, since they are to
be regarded as illustrative rather than restrictive.
Variations and changes may be made by those skilled in the
art without departing from the spirit of the invention.
