Note: Descriptions are shown in the official language in which they were submitted.
CA 022138~7 1997-08-26
WO 96/27017 PCT/US96/02623
A METHOD FOR EXPRESSING MOD~l~;D RECOMBINANT
PROTEINS IN A BACTERIAL SYSTEM
TECHNICAL ~ I~;LD
This invention relates to a novel method for producing modified
recombinant proteins in a bacterial system. The method comprises preparing a
single vector having a nucleotide sequence encoding an exogenous protein and an
enzyme capable of modifying the protein in vivo, and expressing the vector in the
host cell to produce a modified protein. An aspect of the invention relates to ao single vector co~ g a promoter, followed by a protein encoding sequence,
followed by an enzyme encoding sequence.
BACKGROUND OF THE INVENTION
It is generally recognized that human milk is the best nutritional source
for human infants. Human milk is not only an ideal source of nutrients for the
developing infant, but also contains both immunoglobulins and non-
immunological factors that protect the infant from infection by various
org~ni.~m~. Human milk is also easily digested by the infant and is less likely
to cause allergic reactions than is infant formula based on bovine milk.
Human milk differs from bovine milk as well as the milk of other
m~mm~ n species in various ways. Overall protein content and the kinds of
protein differ between human and bovine milk. Four major bovine caseins
have been identified. Bovine milk contains 2 oc-caseins plus ,B- and K-casein,
but human milk contains only ,B- and K-casein. Additionally, the amino acid
sequences of human milk protein differ from that of other m~mm~ n milk
proteins.
Efforts have been made to develop infant milk formulas that have some
of the advantageous ~lop~llies of human milk and avoid the disadvantages
associated with bovine milk based infant formulas such as allergic reactions
and incomplete digestion by the infant. An intuitively desirable method to
achieve this is to add to the formula some of the known constituents of human
milk, including human milk proteins in their native form. The human caseins,
which differ in amino acid sequence from their bovine and other m~mm~ n
counterparts, represent important substances which, if added in their native
3s form to infant formula, would serve to enhance the nutritional value of the
formula and reduce the inherent disadvantages of non-human milk proteins.
In addition to being a source of amino acids necessary for the synthesis
of proteins required for the growth and development of infants, human milk is
recognized as cont~ining proteins, including casein, that have other important
CA 022l38~7 l997-08-26
W O96/27017 PCTrUS96/02623
biological functions. ,13-casein is one of the most abundant milk proteins
synthesized in the m~mm~ry gland. After post-translational modification in the
Golgi a~aldlus, it is excreted as large calcium-dependent aggregates called
micelles. ,13-casein is not a single entity, but is a heterogeneous group of
5 phosphoproteins secreted during lactation in response to lactogenic hormones.
The primary structure of human ~-casein was determined by Greenberg et
al.~Journal of Biological Chemistry 259:5132-5138,1984). It was shown to
be a phosphorylated protein with phosphorylation sites at specific seryl and
threonyl residues located near the amino terrninus. Comparison of human and
o bovine ~-caseins showed 47% identity. The sequence of human ~-casein was
determined by Brignon et al. (Federation of European Biolo~ical Societies
Letters 188:48-54,1985). Whereas ,B-casein is phosphorylated, K-caSein is
glycosylated.
Several biological effects have been ascribed to human milk casein
15 including: (1) enhancement of calcium absorption; (2) inhibition of angiotensin
I-converting enzyme; (3) opioid agonism; (4) and immunostim~ tin~ and
immunomo-lnl~tin~ effects.
Human casein consists largely (>80%) of the ,(~-form with a smaller
amount in the K-form (Greenberg et al., 1984). Native ,I~-casein is a 25 kDa
20 protein. In human milk, 13-casein molecules show variable degrees of post-
translational phosphorylation ranging from zero to five phosphate groups per
polypeptide chain (Greenberg et al., 1984; Hansson et al., Protein Expression
and Purification 4:373-381,1993). Phosphate groups in the native protein are
attached to serine and threonine residues located near the amino terminus
25 (Greenberg et al., 1984).
Expression of exogenous genes in bacterial cells provides a useful
method for producing recombinant eukaryotic proteins. However, bacteria,
such as E. coli, are not capable of producing the post-translational
modifications required by many eukaryotic proteins as they do not possess the
30 endogenous enzymes necessary to do so. Therefore, eukaryotic proteins
produced in E. coli lack the specific post-translational modifications which
may occur within the eukaryotic cell, such as glycosylation, phosphorylation,
acetylation, or arnidation.
Prior to the development of a~plopliate cloning techniques, the
35 phosphorylation of purified proteins by a kinase was done in vitro using
chemical reagents. This process requires the protein substrate and the kinase
CA 022138~7 1997-08-26
W O 96/27017 PCTrUS96/02623
enzyme to be purified and this is not efficient or cost-effective for commercialpurposes. The in vitro process is also inefficient when it is desired to scale-up
for commercialization. There is, therefore, a need to develop a method for
genetically engineering microorg~nisms to phosphorylate a protein in vivo.
(~:~n~ n Patent Application No. 2,083,521 to Pawson et al. teaches a
method of producing phosphorylated exogenous protein in host cells. The
method of Pawson et al. requires two vectors to be introduced into a bacterial
cell. One vector has a nucleotide sequence encoding an exogenous protein that
is capable of being phosphorylated by the catalytic domain of a protein kinase.
lo The other vector has a nucleotide sequence encoding the protein kinase catalytic
domain. Both vectors are introduced into E. coli and production of the
exogenous protein and the protein kinase catalytic domain is inclllced so that the
exogenous protein is phosphorylated. The bacterial cells are then lysed and the
exogenous phosphorylated protein is isolated using standard isolation
techniques.
CA No. 2,083,521 does not suggest or disclose the method of the
instant invention. The present invention uses a single vector expressing both
the substrate and the kinase enzyme. The method of Pawson et al. requires the
use of two vectors. The expression system disclosed herein results in specific
20 phosphorylation of the exogenous protein as determined by antibody to
phosphoserine, while the expression system of Pawson et al. results in non-
specific phosphorylation of both host proteins and exogenous proteins. This
would adversely affect the growth of host bacteria in scale-up efforts for
industrial applications. The present invention, unlike that of Pawson et al.,
2s provides for high level production of a phosphorylated, recombinant protein
suitable for commercial production.
Simcox et al., Strate~ies in molecular biolo~y 7(3):68-69 (1994)
constructed two E. coli strains that harbor a tyrosine kinase plasmid. These TK
(tyrosine kinase) strains can be used for generating phosphorylated proteins
30 when transformed with a plasmid containing sequences encoding a
phosphorylation target domain or protein. Both E. coli strains carry an
inducible tyrosine kinase gene. One strain, TKB 1, is useful for expressing
genes whose expression is directed by the T7 promoter. The system developed
by Simcox et al. differs from the present invention in that it requires two
35 constructs, i.e., a tyrosine kinase-cont~ining plasmid and a plasmid vector
containing a gene encoding a protein or domain to be phosphorylated.
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
In order to better understand the structure and function of human ,B-casein
and to perrnit studies of factors that affect regulation of its synthesis and secretion,
cDNA for this protein was cloned and sequenced (Lonnerdal et al., Federation of
European Biolo~ical Societies Letters 269:153-156,1990), and human milk ,13-
s casein was produced in Escherichia coli and Saccharomyces cerevisiae (Hanssonet al., 1993). Hansson et al. demonstrated that recombinant human ~-casein was
expressed in the yeast, S. cerevisiae, using the pYES 2.0 vector (Invitrogen
Corp., San Diego, CA). Production levels were esfim~te~l to be approximately
10% of the production found in E. coli. However, recombinant ,13-casein obtained10 from S. cerevisiae, a eukaryotic cell that has endogenous enzymes capable of
phosphorylating proteins, was phosphorylated, but the protein produced by E.
coli, a prokaryotic cell that lacks the ability, in its native state, to phosphorylate,
was non-phosphorylated. Subsequently, it was shown that recombinant human
casein kinase II (rhCKII) produced in and purified from E. coli can phosphorylate
15 protein substrates in vitro (Shi et al., Procee-lin~ of the National Academy of
Sciences. USA 91:2767-2771, 1994). One specific embodiment of the present
invention uses a nucleotide sequence encoding a recombinant human casein kinase
II in a single construct with nucleotide sequence encoding ,B-casein to transform
E. Coli and produce phosphorylated ,B-casein.
SUMMARY OF THE INVENTION
There is disclosed herein a method for producing a modified
recombinant protein in a host cell comprising pl~al;llg a single vector
encoding both an exogenous protein and an enzyme capable of modifying the
25 exogenous protein. Representative of exogenous proteins capable of being
modified through the process of the present invention include but are not
limited to human caseins, including ,13-casein, cell receptor proteins, fatty
acylated proteins including palmitoylated proteins, m~mm~ n muscle
proteins, the gag polyproteins of retroviruses, and mz~mm~ n proteins
30 targeted by retroviral src kinases. Transmembrane glycoL,lot~hls that acquirecovalent p:~lmit~t~ after synthesis include the insulin, ~2-adrenergic and
transferrin receptors. Proteins that function as cell surface receptors, tyrosine
and serine/threonine kinases, their substrates, a phosphatase, G-proteins, and
Ca2+ are known to be fatty acylated. Representative of enzymes useful in the
35 present invention because of their capacity to transfer functional groups to
specific exogenous proteins in a host cell, include but are not limited to
CA 022138~7 1997-08-26
W O 96/27017 PCTrUS96/02623
kinases, such as tyrosine kinases or casein kinase, transferases, such as
m~mmz~ n and yeast palmitoyl transferases, and kinases coded for by the src
gene of retroviruses. Representative of promoters useful in the present
invention include inducible promoters such as T7, 7~PL, 7~PR, and Tac and
s constitutive promoters such as bla and spa. Representative of host cells
capable of being transformed and then expressing the modified proteins,
include but are not limited to the bacterial cells E. coli K-12 and E. coli B,
Bacillus species, Lactobacillus species, and Streptococcus species and
eukaryotic cells such as yeast cells or m~mm~ n cells.
An exogenous protein is one that ~rigin~t--s outside the organism that is
producing it. The term is sometimes used in the relevant DNA cloning
dlùl~; also to refer to the recombinant protein produced by the transformed
recipient organism. Alternatively, an exogenous protein produced using
DNA cloning techniques may be referred to as a recombinant protein. The
terms will be used interchangeably herein since the distinction is frequently not
made in the liLeldlul~. However, in r~ c.u.C.cin~ the disclosed invention the
word "recombinant" will be used to refer to the protein produced by the
transformed org~ni.cm, and "exogenous" will be used when referring to the
native, non-recombinant protein or nucleotide sequence encoding the protein.
What is disclosed herein is a method for producing a modified
recombinant protein in a host cell comprising the steps of preparing a single
vector having a promoter sequence, an exogenous protein sequence, and a
nucleotide sequence encoding an enzyme capable of modifying the exogenous
protein; transforming the host cell with the vector; expressing the vector in the
2s host cell whereby the produced enzyme modifies the produced recombinant
protein; and isolating the produced, modified recombinant protein. Also
disclosed herein in a more specific embodiment of the invention is a method
for producing a phosphorylated recombinant protein in a host cell comprising
the steps of ~lepal;llg a single vector having a promoter sequence followed by
a nucleotide sequence encoding an exogenous protein capable of being
phosphorylated by a protein kinase, followed by a nucleotide sequence
encoding a protein kinase capable of phosphorylating the exogenous protein;
transforming the host cell with the vector; expressing the vector in the host cell
whereby the produced protein kinase phosphorylates the produced
recombinant protein; and isolating the phosphorylated protein.
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
More particularly, the present invention provides a novel method for
producing a modifled recombinant human protein in bacterial expression
systems. Using a combination of two human casein kinase encoding
sequences, expressing respectively the alpha and beta subunits of the kinase,
they demonstrated the in vivo production of recombinant phosphorylated
human ~-casein in E. coli. The sequence coding for human casein kinase II
was placed in tandem with the sequence coding for ,13-casein with the result
that a ~ignific~nt portion of the recombinant ~-casein produced in E. coli was
phosphorylated as in human milk. The method of the present invention can
also be used for in vivo specific glycosylation, amidation, or acetylation of
recombinant proteins in transformed host cells or for the transfer of fatty acids
to ~ ro~liate recombinant protein substrates in transformed host cells.
In a specific embodiment of the invention, a nucleotide sequence
encoding a human casein kinase II (hCKII ~a) is co-expressed in a single
construct with a nucleotide sequence encoding a human ~-casein in a bacterial
expression system to achieve efficient in vivo phosphorylation of the
a~lo~?liate serine and threonine residues of recombinant human ~-casein.
Experiments in which a nucleotide sequence encoding hCKII ~a and a
nucleotide sequence encoding human ~-casein were co-expressed in E. coli
using a single inducible expression vector demonstrated the ability of
recombinant hCKII ~a to phosphorylate recombinant ~-casein in vivo. This
was an unexpected, non-obvious result requiring experimentation and
inventiveness. As was demonstrated by negative results obtained in early,
control experiments, the disclosed invention showed unexpected results. The
method of the present invention produces useful and beneficial results which
will permit the addition of beneficial human proteins to nutritional and
pharm:~eutical products.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows physical maps of expression vectors pS637 and pRJB-
6 constructed for inducible intracellular expression in E. coli. 191 base pairs
were removed from pS637 to produce PRJB-6.
Figure 2 shows physical maps of expression vectors pRJB-6 and
pRJB-9 and illustrates how pRJB-6 was cut and ligated to CKII ~a to form
pRJB-9.
3s Figure 3 shows physical maps of expression vectors pS637 and pRJB-
7 and shows how pS637 was cut and ligated to CKII ,F~a to form pRJB-7.
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
pRJB-7 has T7 promoters in front of both the ,13-casein and casein kinase
genes.
Figure 4 shows the physical map of expression vector pS750,
constructed for inducible expression and to mediate production of
intracellularly localized protein in E. coli.
Figure S shows SDS-PAGE of Met-13-casein produced in E. coli BL21
strains and stained with Coomassie Brilliant Blue using the vectors pS750 and
pET-l ld-CKII ~a. The codon for methionine (Met) was placed in front of the
,B-casein encoding sequence in the construction of plasmid pS750 because in
10 E. coli and other bacteria the synthesis of their proteins begins with the arnino
acid methionine. This enables the ribosome to recognize the starting point for
growth of a polypeptide chain. Production of intracellular recombinant 13-
casein is possible only when Met is inserted before the encoding sequence for
the protein to be produced. Lane 1: molecular weight marker (Bio-Rad
prestained, relative molecular weights 106, 80, 49.5, 32.5, 27.5, 18.5 kDa);
lane 2: non-phosphorylated recombinant ~-casein; lane 3: SP-13-casein; lane 4:
pS750 in~ ecl with IPTG in BL21(DE3); lane 5: pS750/pET-l ld-CKII ,~a
incluce-1 with IPTG in BL21(DE3); lane 6: pS750 induced with IPTG in
BL21(DE3)pLysS; lane 7: pS750/pET-l ld-CKII ~a induced with IPTG in
20 BL21(DE3)pLysS; lane 8: pS750 induced with IPTG in BL21(DE3)pLysE;
lane 9: pS750/pET-1 ld-CKII ,~a inflnced with IPTG in BL21(DE3)pLysE
cells; lane 10: native 13-casein with five attached phosphate groups (5P-,13-
casein). The arrow indicates the ~-casein band.
Figure 6 shows SDS-PAGE of Met-,B-casein produced in E. coli BL21
2s strains stained with Ethyl Stains-AII using the vectors pS750 and pET-l ld-
CKII ,~oc. Lane 1: native ,(~-casein with five attached phosphate groups (5P-,13-
casein); lane 2: pS750/pET-l ld-CKII ,~a induced with IPTG in
BL21(DE3)pLysE cells; lane 3: pS750 induced with IPTG in
BL21(DE3)pLysE; lane 4: pS750/pE~T-l ld-CKII ,~a induced with IPTG in
30 BL21(DE3)pLysS; lane 5: pS750 induced with IPTG in BL21(DE3)pLysS;
lane 6: pS750/pET-1 ld-CKII ,l~oc induced with IPTG in BL21(DE3); lane 7:
pS750 induced with IPTG in BL21(DE3); lane 8: SP-~-casein; lane 9: non-
phosphorylated recombinant ,B-casein; lane 10: molecular weight marker (Bio-
Rad prestained, relative molecular weights 106, 80, 49.5, 32.5, 27.5, 18.5
3s kDa). The arrow indicates the phosphorylated ~-casein band, which is seen as
a green band in the original photographs.
CA 022l38~7 l997-08-26
W O96/27017 PCTrUS96/02623
Figure 7 shows SDS-PAGE of Met-,13-casein produced in E. coli
HMS174(DE3)pLysS stained with Ethyl Stains-All using the vectors pS750
and pET-l ld-CKII. Lane 1: molecular weight marker (Bio Rad prestained);
lane 2: pS750 llnin(1~lcecl; lane 3: pS750 in(l~lced with IPTG; lane 4:
pS750/pET-1 ld-CKII ,~a uninduced; lane 5: pS750/pET-1 ld-CKII ,~a
inclllceA with IPTG; lane 6: pET-l ld-CKII ~a uninduced; lane 7: pET-l ld-
CK~I ~a incl~lced with IPTG; lane 8: native 5P-~-casein; lane 9: recombinant
,13-casein; lane 10: molecular weight marker (Bio-Rad prestained, relative
molecular weights 106, 80, 49.5, 32.5, 27.5, 18.5 kDa). The arrow indicates
o the phosphorylated ~-casein band, which is seen as a green band in the
original photographs.
Figure 8 shows a Western immunoblot analysis using antibody to
human ~-casein. Lane 1: molecular weight marker (Gibco BRL, relative
molecular weights 43.1, 29.2, 18.8, 16.5, 6.4 kDa); lane 2: 50 ng native
human ~-casein; lane 3: nninfl~lcerl HMS174(DE3)pLysS(pRJB-7); lane 4:
intln~eA HMS174(DE3)pLysS(pRJB-7); lane 5: llnin~ ce~7
HMS174(DE3)pLysS(pET-1 ld-CKII ,~a); lane 6: induced
HMS 174(DE3)pLysS(pET-1 ld-CKII ~a); lane 7: nnin(l~l~erl
HMS174(DE3)pLysS(pRJB-9); lane 8: inducedHMSl74(DE3)pLysS(pRJB-
9).
Figure 9 shows a Western immunoblot analysis with antibody to
phosphoserine. Lane 1: low molecular weight marker (Gibco BRL, relative
molecular weights 44, 28.7, 18.5, 14.7, 5.8, 2.9 kDa); lane 2: 1 ~Lg native
human ,B-casein; lane 3: 2 ~g native human ,13-casein; lane 5: induced
HMS 174(DE3)pLysS(pET-1 ld-CKII ~a); lane 6: induced
HMS 174(DE3)pLysS(pRJB-9); lane 7: induced
HMS174(DE3)pLysS(pRJB-7); lane 8: induced
HMS 174(DE3)pLysS(pS637); lane lO: 1 ~Lg recombinant human ,B-casein;
lane l 1: 2 ,ug recombinant human ,B-casein.
Figure 10 shows an immunoblot analysis using antibody to human ~-
casein. Lane 1: molecular weight marker (Gibco BRL, relative molecular
weights 44, 28.9, 18.5, 14.7, 5.8 kDa); lane 2: native human ¦3-casein; lane 3:
induced HMS 174(DE3)pLysS(pRJB-9); lane 4: ind~l~ed
HMSl74(DE3)pLysS(pS637); lane 5: in~l~lce-l HMS174(DE3)pLysS(pET-
1 ld-CKII ~a); lane 6: recombinant human ,I~-casein.
CA 022138~7 1997-08-26
WO96/27017 PCTrUS96/02623
Figure 11 shows an immunoblot analysis using antibody to
phosphoserine. Lane 1: molecular weight marker (Gibco BRL, relative
molecular weights 44, 28.9, 18.5, 14.7, 5.8, 2.9 kDa); lane 2: 1 ,ug native
human ,13-casein; lane 3: 500 ng native human ,B-casein; lane 4: induced
HMS174(DE3)pLysS(pRJB-9); lane 5: induced
HMS174(DE3)pLysS(pS637); lane 6: in~ ce~l HMS174(DE3)pLysS(pET-
1 ld-CKII ~oc); lane 7: 1 ,~Lg recombinant human ~-casein; lane 8: 500 ng
recombinant human 13-casein.
DETAILED DESCRIPTION OF THE ~VENTION
l 0 As previously mentioned, the present invention relates to a method forproducing a modified recombinant protein in a host cell. In a more specific
embodiment, the invention relates to a method for producing a phosphorylated
human protein in a bacterial cell. The method comprises the steps of plepalillg
a single vector having both a nucleotide sequence encoding an exogenous
protein that is capable of being phosphorylated by a protein kinase and a
nucleotide sequence encoding an ~pro~liate protein kinase, expressing the
vector in a host cell whereby the produced kinase phosphorylates the produced
exogenous protein, and isolating the phosphorylated recombinant protein. The
present invention provides the unexpected discovery that placing the nucleotide
sequence encoding the protein to be phosphorylated and the nucleotide
sequence encoding the kinase in tandem in a single construct with a promoter
results in high level and specific phosphorylation while elimin~ting the
negative features associated with multiple vectors such as the need for
antibiotic rçsi~t:~nr-e genes to be used as markers. Use of the single constructsystem facilitates scaling up the procedure for industrial use. It is
conLelllplated that the method of the invention will be useful in any host cell
system that is capable of expressing the exogenous protein. Suitable host cells
include both prokaryotes such as bacteria and eukaryotes such as yeast and
animal cells.
In the plefelled embodiment of the present invention, the host cell is E.
coli. Nucleotide sequences encoding ,B-casein, in several different expression
formats, were evaluated for expression of recombinant human ~-casein in an
E. coli strain. After a series of experiments, it was determined that
recombinant human ,13-casein was efficiently phosphorylated when sequences
encoding human ,13-casein were placed in a single construct with sequences
encoding human casein kinase CKII ,Bo~. Efficiency of phosphorylation was
CA 022138~7 1997-08-26
W O 96/27017 PCTrUS96/02623
not c~ llised when both genes were placed in tandem in one plasmid
when compared with experimental systems in which sequences encoding the
kinase and the ~-casein were placed in two separate vectors.
s Materials and Methods
The following materials and methods were used in the investigations
described in Examples 1 to 5. Additional materials and/or methods are
described for individual experiments when required.
Plasmids
Plasmid construct pS637 shown in Figure 1 is identical to pS26,
constructed and described in Hansson et al., (1993), which is herein
incorporated by reference, except that it encodes an additional amino acid,
",i"t- (Gln), at position 19. The original expression vector, pS26, was
modified to create pS637 which produces a recombinant
,~-casein protein identical to the most abundant variant found in human
populations.
The construct pS637 was prepared for co-expression with the
nucleotide sequence encoding casein kinase II (Shi et al., 1994), which is
hereby inc~ ul~t~d by reference, by placing the nucleotide sequence encoding
CKII,I~a, which codes for two casein kinase subunits, b and a, as a cassette,
downstream from the nucleotide sequence encoding ~-casein. A three-cistron
tandem expression vector pET-l ld-CKII ~a is a plasmid cont~ining CKII ~a
that was generated by Shi et al.(1994). First, pS637 was cut at two sites
downstream of the 13-casein encoding sequence and religated. A plasmid,
pRJB-6, shown in Figure 1, was isolated which had lost 191 bases between
the two cut sites. The kinase CKII ~a was prepared for insertion into pRJB-
6. After insertion the resulting construct was designated pRJB-9, which is
shown in Figure 2. pRJB-9 is a single construct designed to mediate
production of phosphorylated ¦3-casein. pS637 was also modified to construct
the plasmids pS750 and pRJB-7 which will be described in further detail
below.
Host Cells
In the specific embodiment of the invention described below, the host
organism transformed by the described vectors was E coli. Other
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
11
representative org~ni.cm.s that could be used with the method of the invention
include Bacillus, Lactobacillus, and Streptococcus species.
Promoter
s In the specific embodiment of the invention described below the T7
promoter was used. Other representative promoters that could be used with the
method of the invention include the inducible promoters 7~PL and 1IPR and Tac
and the constitutive promoters bla and spa.
0 Construction of Plasmids for Bacterial Expression: Detailed Methods
Expression vector pS637
Expression vector pS637 differs from pS26, described in Hansson et al.
(1993) as it contains a nucleotide triplet encoding the ~ lllille (Gln) amino
acid residue at position 19 of the 13-casein encoding sequence. This nucleotide
sequence was isolated from a human cDNA variant that is more commonly
found in human populations than is the sequence of pS26. Two synthetic
oligonucleotides were synthesi7.e~1 for polymerase chain reaction (PCR)
amplification. The synthetic oligonucleotides provide convenient restriction
sites and incorporated codons for amino acids used preferentially by bacteria.
The two oligonucleotides were ~lesign~t~ (l SYM4174 (Seq.ID NO: 1) and
SYM4175 (Seq.ID NO: 2) and have the following sequences:
S~M4174 5'- CGCTGCAGCATATGCGTGAAACCATCGAATC-3'
SYM4175 5'-
CGGGATCCTGGTCCTCGTGTTTAAC~'l'l'l'l'l'CAAC'l'l'l'CTGTTTGTATT
CGGTGATCGATTC-3 '
PCR amplification was performed as described in Ausubel et al., (eds.)
Current Protocols in Molecular Biology (1992) and the amplified fragment was
digested with PstI and AvaII to generate an 85 bp fragment. Plasmid pS21,
described in Hansson et al. (1993) was digested with EcoRV and AccI and a
328 bp fragment was isolated by gel electrophoresis. The isolated fragment
was purified from the agarose gel by electroelution and digested with AvaJl
~ This resulted in a 197 bp Ava~/AccI fragment which was isolated. The 85 bp
3s PstI/Ava~ digested PCR-amplified fragment and the 197 bp Ava~/AccI were
ligated into PstI/AccI digested pS25, a plasmid described in Hansson et al. The
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
12
resulting plasmid construct was sequenced and ~lecign~te~l pS636. A 644 bp
NdeI and BamHI restriction fragment was isolated from pS636 and introduced
into NdeI/BamHI digested vector pS26, a plasmid described in Hansson et al.
The resulting expression vector was designated pS637.
Expression vector pRJB-9
The pET- 11 d-CKII ~a plasmid comprising the CKII ~a encoding
sequences generated by Shi et al. (1994) was prepared for
co-expression with recombinant ~-casein. First, 191 base pairs (bp) were
lo removed from pS637 by cutting two EcoRl sites downstream from the ~-
casein encoding sequence and religating pS637. A plasmid, pRJB-6 (Figure
1), was isolated, which had lost the 191 bp between the two sites and had
retained a single EcoRV site located 132 bases away from the 3' end of the ,B-
casein encoding sequence. The plasmid pET-1 ld-CKII ~a, cont~ining the
15 CKII ,~a encoding sequence, was cut with ClaI and the site was filled in withKlenow enzyme (Stratagene, CA) to create blunt ends. The filled in, ClaI cut
CKII encoding sequence was inserted into pRJB-6, downstream from the ,13-
casein encoding sequence, and the resulting construct was rll ~ign~t~-l pRJB-9
and is shown in Figure 2.
Expression vector pRJB-7
The construct pS637 was prepared for co-expression of recombinant
~-casein and the CKII ~a kinase by placing the CKII ~a encoding sequence
immediately after the ~-casein encoding sequence. The CK~I ~a encoding
25 sequence was placed as a BgllIlBamH I fragment into the BamH I site of
pS637 and ~ sign~tc-l pRJB-7. This fragment contained the T7 promoter
from its original vector, pET-1 lD-CKII ~a. Thus, as shown in Figure 3,
pRJB-7 contains two T7 promoters, one before the ,13-casein encoding
sequence and one before the CKII ~a encoding sequence.
Expression vector pS750
To change the selective marker from ampicillin resistance to kanamycin
resistance, the plasmid pS637 was digested with PvuI and treated with T4
DNA polymerase to generate blunt ends. The linearized vector was isolated
3s and ligated with a Hinc~ kanamycin resistance genblock (Pharmacia,
CA 022138~7 1997-08-26
W 096/27017 PCTrUS96/02623
13
Uppsala, Sweden). The resulting expression vector was designated pS750
(Figure 4).
Expression vector for recombinant human casein kinase II
s The expression vector pET- 1 1 d-CKII ,Bo~ (Shi et al ., 1994) was
provided by Dr. C. Walsh of the Harvard Medical School, Boston, MA.
Expression experiments were carried out as described by Studier et al.
(Methods in Enzymolo~y 185:60-89, 1990). Bacteria were grown in Luria
Broth (LB medium) cont~inin~; 50 ,ug/ml carbenicillin for pET-l ld-CKII 130c,
0 the plasmid that contains a gene conferring resistance to carbenicillin, and 50
~lg/ml kanamycin for the vector pS750, a plasmid cont~ining a gene conferring
resistance to kanamycin. The medium was supplemented with 30 ,ug/ml
chloramphenicol when the strains cont~ining the pLys plasmids, which confer
resistance to chloramphenicol, were used. For induction of the T7 expression
15 system, the cultures were grown to a density of approximately OD600=0.5,
and then 0.4 mM isopropyl ,13-D-thiogalactopyranoside (IPTG) was added.
The cells were harvested about 90 minutes after induction.
Electrophoresis and Detection of Recombinant ~oc-Casein
Cells were pelleted by centrifugation and the pellet from 1 ml of culture
was dissolved in 100 ,ul of sample buffer, which contains Tris, glycerol, SDS,
dithiothreotol (DTT), and bromophenol blue. The proteins were separated by
SDS-PAGE as described in Laemmli (Nature 227:680-685, 1970). Gradient
gels were cast and run in the discontinuous buffer system in a Protean (Bio-
2s Rad, Richmond, CA) electrophoresis unit. Gels were stained as described in
Laemmli. Immunoblotting was performed according to the specifications of
the manufacturer (Bio-Rad).
Procedure for isolation of modified protein
The modified protein can be isolated by any standard procedure known
to those skilled in the art. Representative of such standard procedures is the
following:
Cells are harvested and ruptured by standard mechanical or chemical
procedures. Cells are then suspended in buffer, homogenized and centrifuged
3s and the supernatant is discarded. The resulting insoluble pellet is resuspended
and the supernatant is discarded. This results in a washed insoluble pellet that
,
CA 022138~7 1997-08-26
W O 96/27017 PCT~US96102G23
14
is suspended in 50 mM Tris and 6M Urea at pH 8.2 and homogenized. ,B-
casein supernatant I is removed resulting in an insoluble extract that is again
suspended in 50 mM Tris and 6M Urea at pH 8.2 and homogenized. ,(~-casein
supernatant II is removed and supernatants I and II are pooled. The rem~ining
5 insoluble extract is discarded. The pooled supernatants are diluted 1:1 with 50
mM Tris and pH 8.2 and treated with 3M Urea to extract ~-casein. The final
,I~-casein solution is obtained by dialyzing the Urea extract of ,13-casein against
50 mM ethanolamine and 100 mM NaCl at pH 9.5, centrifuging, and diluting
in 50 mM ethanolamine, 100 mM NaCI at pH 9.5 to a protein concentration of
o 5 mg/ml. The pellet is discarded.
EXAMPLES
The experiments described in Examples 1 and 2 show that production
of recombinant ,B-casein is not adversely affected when bacteria are co-
transformed with two vectors cont~ining respectively a nucleotide sequence
5 encoding ,13-casein and a nucleotide sequence encoding a casein kinase. They
also demonstrate that recombinant phosphorylated ~-casein can be produced
using these two vectors in a bacterial system.
Example 4 describes a system in which a single construct, cont~ining a
promoter and both the nucleotide sequence coding for the protein to be
20 transcribed and phosphorylated and the nucleotide sequence coding for the
kinase, was used to transform a bacterial strain. In Example 4, production of
recombinant phosphorylated ,13-casein using a single plasmid was
demonstrated. A single construct system for expression of extracellularly
localized recomhin~nt phosphorylated ,B-casein that is identical to human native25 ,B-casein is described in Example 5.
Example 1: Production of ~a-casein in E.coli B: Phosphorylation of
intracellularly localized recombinant Met-~-casein: BL21 (DE3) strains.
To analyze the ability of recombinant human CKII ~rhCKII) to phosphorylate
30 reco=mbinant ,B-casein in vivo in a bacterial expression system, experiments
were performed in E. coli using two inducible expression vectors. The
expression vector pS750 was transformed alone or in combination with
expression vector pET-l ld-CKII ,Boc into the T7 host strains BL21(DE3),
BL21(DE3)pLysS, andBL21(DE3)pLysE. DE3 is aDNAfragmentderived
3s from a lambda phage contz~ining a lacl repressor, a lacUV5 promoter which is
inducible by isopropyl ~-D-thiogalactopyranoside (IPTG), and a gene for T7
CA 022138~7 1997-08-26
WO 96/27017 PCTrUS96/02623
RNA polymerase. In the presence of the inducer, T7 RNA polymerase is
produced resulting in transcription of the exogenous genes. Plasmid pLysS
confers resistance to chlor~mphtonicol and has little effect on growth rate and
production of foreign protein. It contains a T7 lysozyme that increases
stability of plasmids in E. coli and permits the cells to be lysed by freezing and
thawing.
Results as seen in Figure 5 indicate that high levels of recombinant
human Met~ casein were produced in E. coli and that the amount produced
was not influenced by co-production of recombinant human CKII ,Ba. After
10 electrophoretic separation of the proteins and phosphate staining, CKII ,~a is
seen to have phosphorylated recombinant human Met-,13-casein in vivo. This
is shown in Figure 6 and demonstrates the ability to produce phosphorylated
~-casein in a bacterial system using two vectors.
15 Example 2: Production of ,B-casein in E.coli K-12: Phosphorylation of
intracellularly localized recombinant Met-~-casein: HMS I 74(DE3)strains
E. coli K-12 strains HMS174(DE3), HMS174(DE3)pLysS, and HMS
174(DE3)pLysE were evaluated as hosts for production of recombinant human
Met-,~-casein and were transformed with pS750. The most efficient
20 production was achieved with HMS174(DE3)pLysS. Co-expression
experiments using pS750 and pET-l ld-CKII ~a showed strong induction of
recombinant human Met-13-casein production, which was independent of the
presence of pET-l ld-CKII ~a. Phosphate staining (Figure 7) showed
efficient phosphorylation of Met-~-casein when co-produced in vivo with
2s recombinant human CKII. A two plasmid system is inherently less desirable
than the single plasmid system of the present invention as each of the plasmids
must contain an antibiotic marker so that its presence in the host cells can be
monitored during the fermentation process. This nec~ssit~tçs the use of two
antibiotics in the growth medium and retards bacterial growth.
Example 3: Production of human ,B-casein E. coli K-12: Construct pRJB-7
containing both a ~-casein encoding sequence and CKII ~a encoding
sequences: T7 promoter in front of ,B-casein encoding sequence: T7 promoter
in front of CKII ~a encodin~ sequences
3s The construct pRJB-7, containing the ~-casein and the CKII ~a genes
each preceded by a T7 promoter, was transformed into E. coli K-12 host
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
16
HMS 1 74(DE3)LysS. The transformation and induction procedures followed
were those of the Novagen pET system manual as described in Example 4.
Western Blot Analysis
s Separation and transfer, blocking and antibody procedures are
described in Example 4. Figure 8 shows an immunoblot in which production
of 13-casein by E. coli HMS174(DE3)LysS cells cont~ining four dirr~ t
constructs is compared. Lysates from both incln- ed and uninduced cell
cultures are analyzed. Cells contain pET-l ld-CKII ~a (plasmid with CKII ,B
and ~ encoding sequences), pRJB-9 (hybrid construct with both ,13-casein and
CKII ,~a encoding sequences and T7 promoter in front of ,B-casein encoding
sequence only), or pRJB-7 (hybrid construct with both ,13-casein and CKII ,~a
encoding sequences and T7 promoters in front of both ~-casein and CKII ~a
encoding sequences). Transformation of the bacteria with pRJB-7 resulted in
severe reduction of bacterial growth. E. coli HMS 174(DE3)LysS had
approximately twice the doubling time as did the same strain transformed with
pRJB-9, the construct with only one T7 promoter. The Western blot shown in
Figure 8 shows reduced production of recombinant ,13-casein by induced cells
cont~ining pRJB-7 when compared with cells containing pRJB-9. This is seen
by comparing lane 4 (incl~lc e~l pRJB-7) with lane 8 (induced pRJB-9).
Although both pRJB-7 and pRJB-9 are derived from pS637, only pRJB-9
produced amounts of ~-casein equivalent to the parent construct. The presence
of an additional T7 promoter before the CKII genes in the hybrid construct had
the effect of both reducing cell growth and consequently reducing recombinant
2s protein production.
Figure 9 shows a Western blot analysis in which the lysates were
developed with phosphoserine antibody to detect phosphorylated protein.
Induced E. coli HMS174(DE3)LysS cells cont~ining pET-l ld-CKII ,~a,
pRJB-9 (hybrid construct with one T7 promoter), pRJB-7 (hybrid construct
with two T7 promoters), or pS637 (contains ¦3-casein encoding sequence but
not CKII ,~a encoding sequence) were compared for production of
phosphorylated recombinant ~-casein. Phosphorylated ~-casein was produced F
only in cells cont~ining pRJB-9 (lane 6). No phosphorylated protein was
detected in lane 7, which contains the lysate of cells cont~ining pRJB-7.
Failure to detect phosphorylated protein in the construct with two T7
promoters indicates that both inventiveness and experimentation were required
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
17
in order to develop the single construct system disclosed herein for expressing
an ~pl~liately modified recombinant protein in microorg~ni~m~. Although
the experiment with two T7 promoters in a single construct cO~ g the
nucleotide sequence encoding a protein and the nucleotide sequence encoding a
kinase gave a negative result, under different experimental conditions the use
of more than one promoter sequence should not be excluded. Situations where
it would be favorable to use two dirrtlellt promoters remain within the scope ofthe present invention.
lo Example 4: Production of human ~-casein in E. coli K-12: Construct pRJB-9
containing both ,13-casein encoding sequence and CKII ~a encoding sequences
The present invention uses a single construct expressing both the
information for transferring functional groups to specific sites and the proteinto be modified. In a specific embodiment of this invention the transferred
functional group is phosphate. The transfer is accomplished by a kinase that is
demonstrated to m~ te phosphorylation of specific sites on recomhin~nt
human ¦3-casein in vivo. This invention demonstrates that not only can human
,13-casein be specifically phosphorylated in vivo by E. coli, but that a single-construct with a promoter located before the sequence encoding ,~-casein and
having the advantages of a single-construct system can successfully m~
this function.
Transformation into E. coli K-12 HMS174(DE3)pLysS
The construct pRJB-9, cont~ining the ,13-casein and CKII ~a genes,
was transformed into E. coli K-12 host HMS174(DE3)LysS. The
transformation procedure followed was that of the Novagen pET system
manual (4th ed., TB No.55, June, 1994).
Induction of Expression
E. coli HMS 174(DE3)LysS host cells containing plasmids pRJB-9
(Figure 2), pS637 (Figure 1), or pET-1 ld-CKII 13cc (Shi et al, 1994) were
grown at 30,BC to a density of OD6oo=0.5-0.6. Culture samples were taken
before and 6 hours after adding 1 mM of the inducer IPTG. Cells from two 1
ml aliquots were pelleted by centrifugation in a microcentrifuge. Cells were
resuspended in sample loading buffer for gel electrophoresis after which 500 ,131
of the supernatants from each aliquot were collected. The spent culture medium
CA 022l3857 l997-08-26
W O96/27017 PCT~US96/02623
18
was concentrated in a Microcon 10 spin filter (Amicon) for 35 min~ltec at
10,000 x G. The retentate was collected after spinning for 3 minutes at 1,000 x
G and an equal amount of sample buffer at double concentration was added.
s Western Blot Analysis
Cell lysates were separated on SDS-Polyacrylamide pre-cast Gel
(Integrated Separations System) with a 10-20% gradient and transferred to an
Immobilon-P membrane (Millipore, Bedford, MA) with a semi-dry blotter.
Gels were electroblotted at a constant current (0.8 mA/cm2) for 45 minutes
10 onto Immobilon PVDF filters (Millipore) using a Trans-Blot SD Transfer Cell
(Bio-Rad) The transfer buffer contained 48 mM Tris, 39 mM glycine, 1.3 mM
SDS (sodium dodecyl sulfate) and 20% methanol. Prior to transfer, the filter
was soaked first in methanol and then in transfer buffer. For Western blot
analysis, the membrane was blocked in 3% bovine serum albumin and 0.2%
Tween in TBS (25 mM Tris, 0.154 M NaCl, pH 7.4). Primary antibody to ~-
casein and ~lk~line phosphatase goat anti-rabbit antibody, the secondary
antibody, were diluted 1 :8000 in the blocking buffer. An additional antibody
was used to detect phosphoserines. Blocking and antibody reactions were
done at 25-26,1~C in 2% gelatin co.,~ .i..g amplification grade porcine skin
20 (U.S. Biochemicals) in TBS for 2 hours. The blot was then rinsed with TBS
for 30 minllt~s Primary antibody, mouse monoclonal anti-phosphoserine
(Sigma) was diluted 1:200 or 1:100 in the 2% gelatin blocker and incubated for
two hours. The blot was rinsed twice in TBS for 5 minutes. The secondary
antibody, goat anti-mouse zllk~lin~ phosphatase (Sigma), was diluted 1 :4,000
2s in the gelatin blocker, incubated for one hour, and rinsed as before in TBS.
Nitro blue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate were used as
substrate for color development.
Figure 10 shows an immunoblot in which production of ~-casein by E.
coli K-12 HMS174(DE3)LysS cells containing three different constructs is
30 compared. Cells contain pS637 (plasmid with ~-casein encoding sequence),
pET-1 ld-CKII ~a (plasmid with CKII ~ and ~ encoding sequences), or
pRJB-9 (hybrid construct with both 13-casein and CKII ~a encoding
sequences). Comparison of lanes 3 and 4 shows that the hybrid construct,
pRJB-9, is producing equivalent amounts of ,B-casein to pS637, from which it
35 was derived and which does not contain the CKII ~a encoding sequences.
Both pRJB-9 and pS637 produced between 400-500 mg/L of ~-casein in this
-
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
19
host cell. This experiment shows that placing the ,13-casein encoding sequence
in tandem with the encoding sequence for CKII ~o~ does not significantly
change production of ~13-casein.
Figure 11 shows a Western blot analysis in which the Iysates were
5 developed with phosphoserine antibody to detect phosphorylated protein.
Increased qu~ntiti~s of native human ,13-casein and non-phosphorylated
recombinant ,B-casein were tested in addition to the Iysates of Figure 8. No
phosphorylation of bacterial proteins is seen in lane 6, which contains the lysate
from the CKII ~a plasmid, showing that phosphorylation is specific. The cell
lo lysate in lane 4, containing pRJB-9 with the ,~-casein and CKII ,Ba encoding
sequences in tandem, shows a strong band cross-reacting with the antibody.
The band of lane 4 has the same molecular weight as native human milk ,B-
casein by electrophoretic analysis as seen in lanes 2 and 3. There was no
cross-reactivity to recombinant, non-phosphorylated human ,B-casein, either
purified as in lanes 7 and 8 or as expressed in vivo by pS637 in lane 5. This
experiment demonstrates specific, high-level phosphorylation of intact,
recombinant human ~-casein in E. coli K-12 in a bacterial system using a single
construct.
20 Example 5: Production of ~-casein in E.coli K-12: Phosphorylation of
extracellularly localized recombinant ,B-casein: Construct containing E. coli
leader sequence. promoter. ,B-casein encodin~ sequence. pET- 1 1 d-CKII 130
In this example, the construction of a single plasmid that is used to
transform E~. coli K- 12 and m~ te production of extracellularly localized
25 phosphorylated 13-casein is disclosed. To create a single construct designed for
secretion of phosphorylated protein to the periplasmic space of a bacterial cell,
the ,B-casein encoding sequence is put into an expression vector containing a
leader sequence that directs protein transport to the periplasm. A polymerase
chain reaction (PCR) is performed using the clone resulting from these
30 procedures as the target DNA. The following primers synthesized at Midland
Certi~led Reagent Co. (Midland, TX). can be used in the PCR, RO-4: 5'-TGT
AAA ACG GCC ACT-3' (Seq.ID No: 3) and RO-29: 5'-GGG GAT CCG
TAC GCG TGA AAC-3' (Seq.ID No: 4) The base underlined in RO-29
incorporates a single base change to create an Mlul site at the end of the ,13-
3s casein encoding sequence in order to elimin~te the bacterial initiation codon,methionine, for protein synthesis. This is done so that the resulting protein will
'
CA 022138~7 1997-08-26
W O96t27017 PCTtUS96/02623
have an amino acid sequence identical to that of human ~-casein. The PCR
fragment is then purified. The 3' end of the encoding sequence, which is not
modified, is cut with BamH I. This fragment, cont~ining a S' blunt end and 3'
BamH I end, is cloned in the expression vector pET-26b (Novagen, Madison,
WI), which contains a T7 promoter, and cut at the blunt end with MscI and
with BamH I. The construct described here contains the T7 promoter, but
other promoter sequences could be used. The CKII F~a encoding sequence is
inserted as described above for pRJB-9. Expression is induced and Western
blot analysis is performed according to the procedures described in Example 4.
o A Western blot is performed to identify a protein, isolated from the
periplasmic space of the bacterial cells, that cross-reacts with antibody to
phosphoserine and migrates similarly to native ,B-casein. This experiment
demonstrates phosphorylation of recombinant human ,B-casein encoded by a
sequence fused to a heterologous translational start and signal sequence, this
15 sequence being preceded by a promoter sequence, and the sequence to be
phosphorylated being located in a plasmid co~ illg a kinase encoding
sequence such as CKII ~a. Production of extracellularly localized
phosphorylated protein has not been previously disclosed either in a one-vector
or a two-vector system.
The advantage of extracellular over intracellular localization of the
produced phosphorylated protein lies in the ease of its purification. The
periplasmic space of bacterial cells contains less extraneous matter than the
interior of the cell so that isolation of the purified protein is expedited. This is
particularly advantageous during co~ cial production.
2s This invention will allow commercial-scale production of
phosphorylated, recombinant m~rnm~ n proteins in microorg~nism.s The
method of the invention can be used to produce recombinant exogenous
proteins, including but not limited to, recombinant human ~-casein, in large
quantities. Phosphorylation of ~-casein in a bioreactor makes possible large-
30 scale synthesis in a fermentor of recombinant ,13-casein that is equivalent to
native human ~-casein. This will facilitate the production of infant formula
containing human ,13-casein in its native phosphorylated state. The method of
the invention can also be used for phosphorylation of cell proteins, including
receptors which are regulated by phosphorylation and dephosphorylation and
35 thereby act as signals in cell metabolism. The invention provides a cost-
CA 022138~7 1997-08-26
W O96/27017 PCTrUS96/02623
21
effective method of phosphorylating peptide receptors and will be useful in the
manufacture of pharmaceutical drugs.
l'he single plasmid system is pl~;reldble to a two-plasmid system for
industrial production of fermented proteins such as recombinant,
5 phosphorylated human ,~-casein. Large-scale production of recombinant
protein without the selective pressure provided by antibiotics in the growth
medium results in plasmid loss during the fermentation process since the cells
cont~ining the plasmids would have no selective advantage over those that
contained only one or no plasmids, but would be burdened by the presence of
o the plasmids resulting in slower growth. However, use of multiple
antibiotics to provide the selective pressure nf~cess~ry to m~int~in both
plasmids in the bacteria during fermentation frequently retards bacterial growthand results in lower yield of the desired recombinant product. Therefore, for
industrial purposes, the single-plasmid system disclosed herein is greatly
15 preferable to previously disclosed two-plasmid systems.
The discovery disclosed herein of a novel method for producing
recombinant, phosphorylated human ,13-casein, with characteristics similar or
identical to that of native human ~-casein, makes feasible the addition of this
protein to infant formula so as to render it more similar to human milk with
20 consequential benefits to developing infants. The disclosure of a method for
producing recombinant, modified human proteins in a bacterial system also
makes feasible the addition of the human proteins to other food and
pharm~elltic~l products.
~Ithough specific pl~r~ d embodiments of the invention have been
25 described above with reference to the accompanying experiments and
drawings, it will be ~a~c;lll that the invention is not limited to those preciseembodiments and that many modifications and variations could be effected by
one skilled in the art without departing from the spirit or scope of the invention
dS defined in the appended claims.
CA 022l38~7 l997-08-26
W O 96/27017
PCTrUS96/02623
22
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Mukerji, P.
Thurmond, J.
Hansson, L.
(ii) TITLE OF lNv~NllON: METHOD FOR EXPRESSING MODIFIED
RECOMBINANT PROTEINS IN A BACTERIAL SYSTEM
(iii) NUMBER OF SEQUENCES: 4
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Abbott Laboratories D377/AP6D
(B) STREET: 100 Ab~ott Park Road
(C) CITY: Abbott Park
(D) STATE: Illinois
(E) COUNTRY: USA
(F) ZIP: 60064-3500
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC Compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION N~MBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) AllO~N~Y/AGENT INFORMATION:
(A) NAME: Becker, Cheryl L.
(B) REGISTRATION N~MBER: 35,441
(C) DOCKET NUMBER: 5650.PC.01
(ix) TELECOMMUNICATION INFORMATION:
(A) TE~EPHONE: 708/935-1729
(B) TELEFAX: 708/938-2623
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CGCTGCAGCA TATGCGTGAA ACCATCGAAT C 31
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
CA 022l38~7 l997-08-26
WO 96/27017 PCT/US96/02623
23
(A) LENGTH: 61 base pai~s
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
~ (ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
CGGGATCCTG GTCCTCGTGT TTAACTTTTT CAACTTTCTG TTTGTATTCG GTGATCGATT 60
C 61
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
TGTAAAACGA CGGCCAGT 18
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: genomic DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GGGGATCCGT ACGCGTGA~A C 21
