Note: Descriptions are shown in the official language in which they were submitted.
CA 02216827 2005-12-22
TITLE OF THE INVENTION
SYNTHETIC HPV6/11 HYBRID Ll DNA ENCODING HUMAN
PAPILLOMAVIRUS TYPE 11 L1 PROTEIN
10 FIELD OF THE INVENTION
The present invention is directed to a synthetic DNA
molecule encoding purified human papillomavirus type 11 L 1 protein
and derivatives thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic of the construction of the HPV6/11
hybrid L 1 gene using synthetic oligonucleotides.
Figure 2 shows the nucleotide sequence of the HPV6/11
hybrid, published HPV6a and published HPV11 L1 genes.
Figure 3 shows the bidirectional yeast expression vector
pGAL 1-10 used to express papillomavirus L 1 capsid proteins.
Figure 4 is a Northem analysis of HPV 11 L 1 mRNA from
yeast.
Figure 5 shows expression of HPV 11 L 1 protein in yeast by
Westem analysis (immunoblot).
Figure 6 shows ELISA reactivities of HPV11 L1 VLPs
expressed from wild-type (wt) HPV11 compared to HPV6/11 hybrid
DNA.
Figure 7 is an electron micrograph of HPV 11 L1 VLPs
expressed in yeast.
Figure 8 shows the nucleotide sequence of the HPV6/11
hybrid gene.
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-2-
BACKGROUND OF THE INVENTION Papillomavirus (PV) infections occur in a variety
of animals,
including humans, sheep, dogs, cats, rabbits, monkeys, snakes and cows.
Papillomaviruses infect epithelial cells, generally inducing benign
epithelial or fibroepithelial tumors at the site of infection. PV are species
specific infective agents; a human papillomavirus cannot infect a
nonhuman animal.
Papillomaviruses may be classified into distinct groups
based on the host that they infect. Human papillomaviruses (HPV) are
further classified into more than 70 types based on DNA sequence
homology. PV types appear to be type-specific immunogens in that a
neutralizing immunity to infection by one type of papillomavirus does not
confer immunity against another type of papillomavirus.
In humans, different HPV types cause distinct diseases.
HPV types 1, 2, 3, 4, 7, 10 and 26-29 cause benign warts in both normal
and immunocompromised individuals. HPV types 5, A, 9, 12, 14, 15, 17,
19-25, 36 and 46-50 cause flat lesions in immunocompromised
individuals. HPV types 6, 11, 34, 39, 41-44 and 51-55 cause
nonmalignant condylomata of the genital or respiratory mucosa. HPV
types 16, 18, 31, 33, 35, 45, and 58 cause epithelial dysplasia of the
genital mucosa and are associated with the majority of in situ and
invasive carcinomas of the cervix, vagina, vulva and anal canal.
Papillomaviruses are small (50-60 nm), nonenveloped,
icosahedral DNA viruses that encode for up to eight early and two late
genes. The open reading frames (ORFs) of the virus genomes are
designated El to E8 and L 1 and L2, where "E" denotes early and "L"
denotes late. L1 and L2 code for virus capsid proteins. The early (E)
genes are associated with functions such as viral replication,
transcriptional regulation and cellular transformation.
The L 1 protein is the major capsid protein and has a
molecular weight of 55-60 kDa. L2 protein is a minor capsid protein
which has a predicted molecular weight of 55-60 kDa and an apparent
molecular weight of 75-100 kDa as determined by polyacrylamide gel
electrophoresis. Immunological data suggest that most of the L2 protein
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/0,1117
-3-
' is internal to the L1 protein within the viral capsomere. The L1 O-RF is
highly conserved among different papillomaviruses. The L2 proteins are
' less conserved among different papillomaviruses.
The L 1 and L2 genes have been identified as good targets for
immunoprophylaxis. Some of the early genes have also been
demonstrated to be potential targets of vaccine development. Studies in
the cottontail rabbit papillomavirus (CRPV) and bovine papillomavirus
(BPV) systems have shown that immunizations with recombinant Ll
and/or L2 proteins (produced in bacteria or by using vaccinia vectors)
protected animals from viral infection. Expression of papillomavnrus L i
genes in baculovirus expression systems or using vaccinia vectors
resulted in the assembly of virus-like particles (VLP) which have been
used to induce high-titer virus-neutralizing antibody responses that
correlate with protection from viral challenge. Furthermore, the L 1 and
L2 genes have been used to generate vaccines for the prevention and
treatment of papillomavirus infections in animals.
The development and commercialization of prophylactic and.
therapeutic vaccines for PV infection and disease containing Li protein,
L 1+ L2 proteins, or modified L 1 or L 1+ L2 proteins has been hindered
by the lack of large quantities of purified virus and purified protein.
Because PV is not readily cultivated in vitro, it is difficult to produce the
required amounts of Ll and L2 protein by in vitro propagation of PV.
The resultant supply problems make it difficult to characterize PV and
PV proteins. Accordingly, it would be useful to develop a readily
renewable source of crude PV proteins, especially PV L1 and L2 proteins
or modified L1 and L2 proteins. It would also be useful to develop
methods of purifying large quantities of the crude papillomavirus proteins
to levels of purity suitable for immunological studies and vaccine
development. It would also be useful to produce large quantities of
papillomavirus proteins having the immunity-conferring properties of the
native proteins, such as the conformation of the native protein. In
addition, it would be useful to develop methods of analyzing the PV
proteins and methods of determining the relative purity of the proteins as
well as compositions containing the proteins. Such highly purified
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-4-
proteins would also be useful in the preparation of a variety of reagents
useful in the study of PV infection; such reagents include but are not
limited to polyclonal antibodies, monoclonal antibodies, and analytical
standards.
HPV6 and 11 are causative agents for -90% of benign
genital warts and are only rarely associated with malignancies (Gissmann
et al., 1983, PNAS 80, 560-563). HPV6a is considered to be the most
abundant HPV6 subtype in condyloma accuminata (Brown, D. B., et al.,
J. Clin. Microbiol. 31:1667-1673). Office visits for genital warts
(condyloma accuminatum or planum) have been on the rise in recent
years. It is estimated that - 10% of the general population (ages 15-49)
have genital-tract HPV infections (Koutsky et al. 1988, Epidemiol. Rev.
10, 122-163). While the majority of condylomata is associated with
HPV6, in the case of laryngeal papillomatosis, HPV 11 is the dominant
type. HPV 11 replication in the epithelial cells of the respiratory tract
stimulates the proliferation of these cells which can lead to isolated
lesions of minor clinical relevance or to multiple spreading lesions and
recurring disease. Recurrent respiratory papillomatosis, a disease which
more often afflicts the juvenile population, can be a life-threatening
disease by causing obstructions in the respiratory tract. Recently, an
animal model which allows the replication of infectious HPV 11, has been
developed (Kreider et al. 1985, Nature 317, 639-640; Kreider et al. 1987,
J. Virol. 61, 590-593). The model enabled the identification of
conformational neutralizing epitopes on native virions and baculovirus-
expressed VLPs using monoclonal antibodies (Christensen et al 1990, J.
Virol. 64, 5678-56$1; Christensen and Kreider 1991, Vii-us Res. 21, 169-
179; Christensen and Kreider 1993, Virus Res. 28, 195-202; Christensen
et al. 1994, 75, 2271-2276).
Virus-like particles containing HPV 11 L1 protein have been
expressed in both insect and mammalian cell systems. Expression of
VLPs in yeast cells offers the advantages of being cost-effective and
easily adapted to large-scale growth in fermenters. However, the HPV 11
L 1 protein is expressed at low levels in yeast cells. This was observed to
be a result of truncation of the HPV 11 L1 mRNA. In contrast, the HPV6
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-5-
L1 gene is transcribed as full-length mRNA and is expressed to high
levels. By modifying the HPV6 L1 DNA to encode the HPV 11 L1
protein, it is possible to facilitate the transcription of full-length mRNA
resulting in increased HPV11 L1 protein expression. The present
invention provides an HPV6/11 hybrid L 1 gene sequence as well as a
method for the construction of the HPV6/11 hybrid L1 gene using
synthetic oligonucleotides. The hybrid gene was designed using the
HPV6a L1 sequence (Hofmann, K. J., et al., 1995, Virology, accepted for
publication) but contains the minimal number of base changes necessary
to encode the HPV 11 L 1 protein. Unlike the wild-type HPV 11 L 1 gene,
the HPV6/11 hybrid gene does not contain yeast-recognized internal
transcription termination signals; as a result full-length HPV6/11 mRNA
is produced and expression of HPV 11 L1 protein is increased.
The present invention is directed to highly purified PV L1
protein. The invention also comprises methods by which recombinant
papillomavirus proteins having the immunity-conferring properties of the
native papillomavirus proteins are produced and purified. The present
invention is directed to the production of prophylactic and therapeutic
vaccines for papillomavirus infection. Electron microscopy and binding
to conformational antibodies demonstrate that the recombinant proteins of
the present invention are capable of forming virus-like particles.
SUMMARY OF THE INVENTION
The present invention is directed to a synthetic DNA
molecule encoding purified human papillomavirus type 11 L 1 protein
and derivatives thereof.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to a synthetic DNA
molecule encoding purified human papillomavirus type 11 L 1 protein
and derivatives thereof. Various embodiments of the invention include
but are not limited to recombinant HPV DNA molecules, RNA
complementary to the recombinant HPV DNA molecules, proteins
encoded by the recombinant DNA molecules, antibodies to the
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-6-
recombinant DNA molecules and related proteins, compositions
comprising the DNA, RNA, proteins orantibodies, methods of using the
DNA, RNA, proteins or antibodies as well as derivatives thereof. Such
derivatives include but are not limited to peptides and proteins encoded
by the DNA, antibodies to the DNA or antibodies to the proteins encoded
by the DNA, vaccines comprising the DNA or vaccines comprising
proteins encoded by the DNA, immunological compositions comprising
the DNA or the proteins encoded by the DNA, kits containing the DNA
or RNA derived from the DNA or proteins encoded by the DNA.
HPV6 and 11 are causative agents for -90% of benign genital
warts and are only rarely associated with malignancies (Gissmann et al.,
1983, PNAS 80, 560-563). Office visits for genital warts (condyloma
accuminatum or planum) have been on the rise in the last years and it is
estimated that - 10% of the general population (ages 15-49) have genital-
tract HPV infections (Koutsky et al. 198$, Epidemiol. Rev. 10, 122-163).
While the majority of condylomata is associated with HPV6, in the case
of laryngeal papillomatosis, HPV 11 is the dominant type. HPV 11
replication in the epithelial cells of the respiratory tract stimulates the
proliferation of these cells which can lead to isolated lesions of minor
clinical relevance or to multiple spreading lesions and recurring disease.
Recurrent respiratory papillomatosis, a disease which more often afflicts
the juvenile population, can be a life-threatening disease by causing
obstructions in the respiratory tract. Recently, an animal model which
allows the replication of infectious HPV 11, has been developed (Kreider
et al. 1985, Nature 317, 639-640; Kreider et al. 1987, J. Virol. 61, 590-
593). The model enabled the identification of conformational
neutralizing epitopes on native virions and baculovirus-expressed VLPs
using monoclonal antibodies (Christensen et al. 1990, J. Virol 64, 5678-
56$1; Christensen and Kreider 1991, Virus-Res. 21, 169-179; Christensen
and Kreider 1993, Virus Res. 28, 195-202; Christensen et al. 1994, 75,
2271-2276).
The development and commercialization of prophylactic and
therapeutic vaccines for PV infection and disease containing L1 protein,
L 1+ L2 proteins, or modified L 1 or L 1+ L2 proteins has been hindered
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/0-4117
-7-
by the lack of large quantities of purified virus and purified protein.
Because PV is not readily cultivated in vitro, it is difficult to produce the
required amounts of L1 and L2 protein by in vitro propagation of PV.
The difficulties associated with in vitro cultivation of PV also result in
difficulties in chemical, immunological and biological characterization of
PV and PV proteins. Accordingly, it would be useful to develop a readily
renewable source of crude PV proteins, especially PV L1 and L2 proteins
or modified L 1 and L2 proteins. It would also be useful to develop
methods of purifying large quantities of the crude papillomavirus proteins
to levels of purity suitable for immunological studies and vaccine
development. It would also be useful to produce large quantities of
papillomavirus proteins having the immunity-conferring properties of the
native proteins, such as the conformation of the native protein. In.
addition, it would be useful to develop methods of analyzing the PV
proteins and methods of determining the relative purity of the proteins as
well as compositions containing the proteins. Such highly purified
proteins would also be useful in the preparation of a variety of reagents
useful in the study of PV infection; such reagents include but are not
limited to polyclonal antibodies, monoclonal antibodies, and analytical
standards.
Virus-like particles containing HPV 11 L1 protein have been
expressed in both insect and mammalian cell systems. Expression of
VLPs in yeast cells offers the advantages of being cost-effective and
easily adapted to large-scale growth in fermenters. However, the HPV 11
L 1 protein is expressed at low levels in yeast cells. This was observed to
be a result of truncation of the HPV 11 L 1 mRNA. In contrast, the HPV6
L1 gene is transcribed as full-length mRNA and is expressed to high
levels. By modifying the HPV6 L1 DNA to encode the HPV 11 L l
protein, it is possible to facilitate the transcription of full-length mRNA
resulting in increased HPV11 L1 protein expression. The present
invention provides an HPV6/11 hybrid L1 gene as well as a method for
the construction of the HPV6/11 hybrid L1 gene using synthetic
oligonucleotides. The hybrid gene was designed using the HPV6a L1
sequence but contains the minimal number of base changes necessary to
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-~-
encode the HPV11 L1 protein. Unlike the wild-type HPV11 L1 gene, the
HPV6/11 hybrid gene does not contain yeast-recognized internal
transcription termination signals, resulting in higher levels of mRNA and
consequently increased HPV 11 L1 protein expression.
Pharmaceutically useful compositions comprising the DNA
or proteins encoded by the DNA may be formulated according to known
methods such as by the admixture of a pharmaceutically acceptable
carrier. Examples of such carriers and methods of formulation may be
found in Remington's Pharmaceutical Sciences. To form a
pharmaceutically acceptable composition suitable for effective
administration, such compositions will contain an effective amount of the
protein or VLP. Such compositions may contain proteins or VLP derived
from more than one type of HPV.
Therapeutic or diagnostic compositions of the invention are
administered to an individual in amounts sufficient to treat or diagnose
PV infections. The effective amount may vary according to a variety of
factors such as the individual's condition, weight, sex and age. Other
factors include the mode of administration. Generally, the compositions
will be administered in dosages ranging from about 1 mcg to about 1 mg.
The pharmaceutical compositions may be provided to the
individual by a variety of routes such as subcutaneous, topical, oral,
mucosal, intravenous and intramuscular.
The vaccines of the invention comprise DNA, RNA or
proteins encoded by the DNA that contain the antigenic determinants
necessary to induce the formation of neutralizing antibodies in the host.
Such vaccines are also safe enough to be administered without danger of
clinical infection; do not have toxic side effects; can be administered by
an effective route; are stable; and are compatible with vaccine carriers.
The vaccines may be administered by a variety of routes,
such as orally, parenterally, subcutaneously, mucosally, intravenously or
intramuscularly. The dosage administered may vary with the condition,
sex, weight, and age of the individual; the route of administration; and the
type PV of the vaccine. The vaccine may be used in dosage forms such
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-9-
as capsules, suspensions, elixirs, or liquid solutions. The vaccine may be
formulated with an inmmunologically acceptable carrier.
The vaccines are administered in therapeutically effective
amounts, that is, in amounts sufficient to generate a immunologically
protective response. The therapeutically effective amount may vary
according to the type of PV. The vaccine may be administered in single
or multiple doses.
The purified proteins of the present invention may be used in
the formulation of immunogenic compositions. Such compositions, when
introduced into a suitable host, are capable of inducing an iminune
response in the host.
The purified proteins of the invention or derivatives thereof
may be used to generate antibodies. The term "antibody" as used herein
includes both polyclonal and monoclonal antibodies, as well as fragments
thereof, such as, Fv, Fab and F(ab)2 fragments that are capable of binding
antigen or hapten.
The proteins and protein derivatives of the present invention
may be used to serotype HPV infection and HPV screening. The purified
proteins, VLP and antibodies lend themselves to the formulation of kits
suitable for the detection and serotyping of HPV. Such a kit would
comprise a compartmentalized carrier suitable to hold in close
confinement at least one container. The carrier may further comprise
reagents such as L1 or L2 proteins or VLPs derived from recombinant
HPV6/11 or other recombinant HPV type DNA molecules or antibodies
directed against these proteins. The carrier may also contain means for
detection such as labeled antigen or enzyme substrates or the like.
The purified proteins are also useful as immunological
standards, molecular weight markers and molecular size markers..
It is known that there is a substantial amount of redundancy
in the various codons which code for specific amino acids. Therefore,
this invention is also directed to those DNA sequences which contain
alternative codons which code for the eventual translation of the identical
amino acid. For purposes of this specification, a sequence bearing one or
more replaced codons will be defined as a degenerate variation. Also
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-10-
included within the scope of this invention are mutations either in the DNA
sequence or the translated protein which do not substantially alter
the ultimate physical properties of the expressed protein. For example,
substitution of valine for leucine, arginine for lysine, or asparagine for
glutamine may not cause a change in functionality of the polypeptide.
It is known that DNA sequences coding for a peptide may be
altered so as to code for a peptide having properties that are different than
those of the naturally-occurring peptide. Methods of altering the DNA
sequences include, but are not limited to site directed mutagenesis.
As used herein, a "functional derivative" of the HPV6/11
hybrid gene is a compound that possesses a biological activity (either
functional or structural) that is substantially similar to the biological
activity of HPV6/1 1. The term "functional derivatives" is intended to
include the "fragments," "variants," "degenerate variants," "analogs" and
"homologues" or to "chemical derivatives" of HPV6/1 1.
The term "analog" refers to a molecule substantially similar
in function to either the entire HPV6/11 molecule or to a fragment
thereof.
The cloned HPV6/11 DNA or fragments thereof obtained
through the methods described herein may be recombinantly expressed
by molecular cloning into an expression vector containing a suitable
promoter and other appropriate transcription regulatory elements, and
transferred into prokaryotic or eukaryotic host cells to produce
recombinant HPV 11. Techniques for such manipulations are fully
described in Sambrook, J., et al., supra, and are known in the art.
Expression vectors are defined herein as DNA sequences
that are required for the transcription of cloned copies of genes and the
translation of their mRNAs in an appropriate host. Such vectors can be
used to express eukaryotic genes in a variety of hosts such as bacteria,
bluegreen algae, plant cells, insect cells, fungal cells and animal cells.
Specifically designed vectors allow the shuttling of DNA between hosts
such as bacteria-yeast or bacteria-animal cells or bacteria-fungal cells or
bacteria-invertebrate cells. An appropriately constructed expression
vector should contain: an origin of replication for autonomous replication
CA 02216827 1997-09-29
WO 96/30520 PCT/1TS96/04117
-11-
in host cells, selectable markers, a limited number of useful restriction
enzyme sites, a potential for high copy number, and active promoters. A
promoter is defined as a DNA sequence that directs RNA polymerase to
bind to DNA and initiate RNA synthesis. A strong promoter is one which
causes mRNAs to be initiated at high frequency. Expression vectors may
include, but are not limited to, cloning vectors, modified cloning vectors,
specifically designed plasmids or viruses.
A variety of mammalian expression vectors may be used to
express HPV6/11 DNA or fragments thereof in mammalian cells.
Commercially available mammalian expression vectors which may be
suitable for recombinant HPV6/11 DNA expression, include but are not
limited to, pcDNA3 (Invitrogen), pMC 1 neo (Stratagene), pXT 1
(Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593) pBPV-
1(R-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224),
pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dhfr (ATCC
37146), pUCTag (ATCC 37460), and a,ZD35 (ATCC 37565).
A variety of bacterial expression vectors may be used to
express HPV6/11 DNA or fragments thereof in bacterial cells.
Commercially available bacterial expression vectors which may be
suitable for recombinant HPV6/11 DNA expression include, but are not
limited to pETI la (Novagen), lambda gt11 (Invitrogen), pcDNAi[I
(Invitrogen), pKK223-3 (Pharmacia).
A variety of fungal cell expression vectors may be used to
express HPV6/11 or fragments thereof in fungal cells. Commercially
available fungal cell expression vectors which may be suitable for
recombinant HPV6/11 DNA expression include but are not limited to
pYES2 (Invitrogen), Pichia expression vector (Invitrogen) and
Hansenula expression (Rhein Biotech, Dusseldorf, Germany).
A variety of insect cell expression vectors may be used to
express HPV6/11 DNA or fragments thereof in insect cells.
Commercially available insect cell expression vectors which may be
suitable for recombinant expression of HPV6/11 DNA include but are not
limited to pBlue Bac III (Invitrogen).
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-12-
An expression vector containing HPV 6/11 DNA or fragments thereof may be used
for expression of HPV 11 proteins or
fragments of HPV 11 proteins in a cell, tissue, organ, or animal. Animal,
as used herein, includes humans. Host cells may be prokaryotic or
eukaryotic, including but not limited to bacteria such as E. coli, fungal
cells such as yeast, mammalian cells including but not limited to cell lines
of human, bovine, porcine, monkey and rodent origin, and insect cells
including but not limited to Drosophila and silkworm derived cell lines.
Cell lines derived from mammalian species which may be suitable and
which are commercially available, include but are not limited to, L cells
L-M(TK-) (ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2), 293 (ATCC
CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1
(ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K 1(ATCC CCL
61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC
CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26) and MRC-5
(ATCC CCL 171).
The expression vector may be introduced into host cells via
any one of a number of techniques including but not limited to
transformation, transfection, lipofection, protoplast fusion, and
electroporation. The expression vector-containing cells are clonally
propagated and individually analyzed to determine whether they produce
HPV 11 protein. Identification of HPV 11 expressing host cell clones may
be done by several means, including but not limited to immunological
reactivity with anti-HPV 11 antibodies.
Expression of HPV DNA fragments may also be performed
using in vitro produced synthetic mRNA or native mRNA. Synthetic
mRNA or mRNA isolated from cells expressing HPV6/l 1 hybrid DNA
can be efficiently translated in various cell-free systems, including but not
limited to wheat germ extracts and reticulocyte extracts, as well as
efficiently translated in cell based systems, including but not limited to
microinjection into frog oocytes, with microinjection into frog oocytes
being preferred.
Following expression of HPV 11 protein in a host cell,
HPV 11 protein may be recovered to provide HPV 11 protein in purified
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-13-
form. Several HPV 11 purification procedures are available and suitable
for use. As described herein, recombinant HPV 11 protein may be
purified from cell lysates and extracts by various combinations of, or
individual application of salt fractionation, ion exchange
chromatography, size exclusion chromatography, hydroxylapatite
adsorption chromatography and hydrophobic interaction chromatography.
In addition, recombinant HPV 11 protein may be separated
from other cellular proteins by use of an immunoaffinity column made
with monoclonal or polyclonal antibodies specific for full length nascent
HPV 11, or polypeptide fragments of HPV 11. Monoclonal and polyclonal
antibodies may be prepared according to a variety of methods known in
the art. Monoclonal or monospecific antibody as used herein is defined
as a single antibody species or multiple antibody species with
homogenous binding characteristics for HPV 11. Homogenous binding as
used herein refers to the ability of the antibody species to bind to a
specific antigen or epitope.
It is apparent to those skilled in the art that the methods for
producing monospecific antibodies may be utilized to produce antibodies
specific for HPV polypeptide fragments, or full-length nascent HPV
polypeptides. Specifically, it is apparent to those skilled in the art that
monospecific antibodies may be generated which are specific for the fully
functional HPV proteins or fragments thereof.
The present invention is also directed to methods for
screening for compounds which modulate the expression of DNA or
RNA encoding HPV as well as the function(s) of HPV 11 protein in vivo.
Compounds which modulate these activities may be DNA, RNA,
peptides, proteins, or non-proteinaceous organic molecules. Compounds
may modulate by increasing or attenuating the expression of DNA or
= RNA encoding HPV 11, or the function of HPV 11 protein. Compounds
that modulate the expression of DNA or RNA encoding HPV 11 or the
function of HPV 11 protein may be detected by a variety of assays. The
assay may be a simple "yes/no" assay to determine whether there is a
change in expression or function. The assay may be made quantitative by
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-14-
comparing the expression or function of a test sample with the levels of
expression or function in a standard sample.
Kits containing HPV6/11 hybrid DNA, fragments of
HPV6/11 hybrid DNA, antibodies to HPV6/11 DNA or HPV 11 protein,
HPV6/11 hybrid RNA or HPV 11 protein may be prepared. Such kits are
used to detect DNA which hybridizes to HPV6/I 1 DNA or to detect the
presence of HPV 11 protein or peptide fragments in a sample. Such
characterization is useful for a variety of purposes including but not
limited to forensic analyses and epidemiological studies.
Nucleotide sequences that are complementary to the
HPV6/11 DNA sequence may be synthesized for antisense therapy.
These antisense molecules may be DNA, stable derivatives of DNA such
as phosphorothioates or methylphosphonates, RNA, stable derivatives of
RNA such as 2'-O-alkylRNA, or other HPV6/11 antisense
oligonucleotide mimetics. HPV6/11 antisense molecules may be
introduced into cells by microinjection, liposome encapsulation or by
expression from vectors harboring the antisense sequence. HPV6/11
antisense therapy may be particularly useful for the treatment of diseases
where it is beneficial to reduce HPV 11 activity.
The term "chemical derivative" describes a molecule that
contains additional chemical moieties which are not normally a part of
the base molecule. Such moieties may improve the solubility, half-life,
absorption, etc. of the base molecule. Alternatively the moieties may
attenuate undesirable side effects of the base molecule or decrease the
toxicity of the base molecule. Examples of such moieties are described in
a variety of texts, such as Remington's Pharmaceutical Sciences.
Compounds identified according to the methods disclosed
herein may be used alone at appropriate dosages defined by routine
testing in order to obtain optimal inhibition of the HPV 11 or its activity =
while minimizing any potential toxicity. In addition, co-administration or
sequential administration of other agents may be desirable.
Advantageously, compounds of the present invention may be
administered in a single dose, or the total dosage may be administered in
several divided doses. Furthermore, compounds for the present invention
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-15-
may be administered via a variety of routes including but not limited to
intranasally, transdermally, by suppository, orally, and the like.
For combination treatment with more than one active agent,
where the active agents are in separate dosage formulations, the active
agents can be administered concurrently, or they each can be
administered at separately staggered times.
The dosage regimen utilizing the compounds of the present
invention is selected in accordance with a variety of factors including
type, species, age, weight, sex and medical condition of the patient; the
severity of the condition to be treated; the route of administration; the
renal and hepatic function of the patient; and the particular compound
thereof employed. A physician of ordinary skill can readily determine
and prescribe the effective amount of the drug required to prevent,
counter or arrest the progress of the condition. Optimal precision in
achieving concentrations of drug within the range that yields efficacy
without toxicity requires a regimen based on the kinetics of the dr-ug's
availability to target sites. This involves a consideration of the
distribution, equilibrium, and elimination of a drug.
In the methods of the present invention, the compounds
herein described in detail can form the active ingredient, and may be
administered in admixture with suitable pharmaceutical diluents,
excipients or carriers (collectively referred to herein as "carrier"
materials) suitably selected with respect to the intended form of
administration, that is, oral tablets, capsules, elixirs, syrup,
suppositories,
gels and the like, and consistent with conventional pharmaceutical
practices.
For instance, for oral administration in the form of a tablet or
capsule, the active drug component can be combined with an oral, non-
toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol,
water and the like. Moreover, when desired or necessary, suitable
binders, lubricants, disintegrating agents and coloring agents can also be
incorporated into the mixture. Suitable binders include without
limitation, starch, gelatin, natural sugars such as glucose or beta-lactose,
com sweeteners, natural and synthetic gums such as acacia, tragacanth,
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-16-
sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes and
the like. Lubricants used in these dosage forms include, without
limitation, sodium oleate, sodium stearate, magnesium stearate, sodium
benzoate, sodium acetate, sodium chloride and the like. Disintegrators
include, without limitation, starch, methyl cellulose, agar, bentonite,
xanthan gum and the like.
For liquid forms the active drug component can be combined
in suitably flavored suspending or dispersing agents such as the synthetic
and natural gums, for example, tragacanth, acacia, methyl-cellulose and
the like. Other dispersing agents which may be employed include
glycerin and the like. For parenteral administration, sterile suspensions
and solutions are desired. Isotonic preparations which generally contain
suitable preservatives are employed when intravenous administration is
desired.
Topical preparations containing the active drug component
can be admixed with a variety of carrier materials well known in the art,
such as, e.g., alcohols, aloe vera gel, allantoin, glycerine, vitamin A and E
oils, mineral oil, PPG2 myristyl propionate, and the like, to form, e.g.,
alcoholic solutions, topical cleansers, cleansing creams, skin gels, skin
lotions, and shampoos in cream or gel formulations.
The compounds of the present invention can also be
administered in the form of liposome delivery systems, such as small
unilamellar vesicles, large unilamellar vesicles and multilamellar
vesicles. Liposomes can be formed from a variety of phospholipids, such
as cholesterol, stearylamine or phosphatidylcholines.
Compounds of the present invention may also be delivered
by the use of monoclonal antibodies as individual carriers to which the
compound molecules are coupled. The compounds of the present
invention may also be coupled with soluble polymers as targetable drug
carriers. Such polymers can include polyvinyl-pyrrolidone, pyran
copolymer, polyhydroxypropylmethacryl-amidephenol, polyhydroxy-
ethylaspartamidephenol, or polyethyl-eneoxidepolylysine substituted with
palmitoyl residues. Furthermore, the compounds of the present invention
may be coupled to a class of biodegradable polymers useful in achieving
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-17-
controlled release of a drug, for example, polylactic acid, polyeps.ilon
caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacet:als,
polydihydro-pyrans, polycyanoacrylates and cross-linked or amphipathic
block copolymers of hydrogels.
The following examples illustrate the present invention
without, however, limiting the same thereto.
EXAMPLE 1
Construction of the Synthetic L 1 Gene
The 1.5 kbp open reading frame of HPV 11 L1 was
constructed using synthetic DNA oligomers ordered from Midland
Reagent Company. These oligomers were supplied containing 5' terminal
phosphates. A total of 24 oligomers were required and are listed below:
#241-1
5'GAAGATCTCACAAAACAAAATGTGGCGGCCTAGCGACAGCA
CAGTATATGTGCCTCCTCCTAACCCTGTATCCAAAGTTGTTGCC
ACGGATGCTTATGTTAAACGCACCAACATATTTTATCATGCCA
GCAGTTCTAGACTTCTTGCAGTGGGTCATCCTTATT 3' (SEQ ID
NO:1)
#2412
5'ATTCCATAAAAAAGGTTAACAAAACTGTTGTGCCAAAGGTGT
CAGGATATCAATACAGAGTATTTAAGGTGGTGTTACCAGATCC
TAACAAATTTGCATTGCCTGACTCGTCTCTTTTTGATCCCACAA
CACAACGTTTGGTATGGGCATGCATGT 3' (SEQ ID NO:2)
#241-3
5'ACATGCATGCACAGGCCTAGAGGTGGGCCGGGGACAGCCAT
TAGGTGTGGGTGTAAGTGGACATCCTTTACTAAATAAATATGA
TGATGTTGAAAATTCAGGGGGTTACGGTGGTAACCCTGGACAG
GATAACAGG 3' (SEQ ID NO:3)
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-18-
#241-4
5'GTTAATGTAGGTATGGATTATAAACAAACACAATTATGCATG
GTTGGATGTGCCCCCCCTTTGGGCGAGCATTGGGGTAAAGGTA
CACAGTGTAGTAATACATCTGTACAGAATGGTGACTGCCCGC3'
(SEQ ID NO:4)
#241-5
5'CCTTAGAACTTATTACCAGTGTTATACAGGATGGCGATATGG
TTGACACAGGCTTTGGTGCTATGAATTTTGCTGATTTGCAGACC
AATAAATCAGATGTTCCTCTTGACATATGTGGCACTGTA 3'
(SEQ ID NO:5)
#241-6
5'TGTAAATATCCAGATTATTTACAAATGGCTGCAGACCCATAT
GGTGATAGATTATTTTTTTATCTACGGAAGGAACAAATGTTTGC
CAGACATTTTTTTAACAGGGCTGGTACCCC 3'(SEQ ID NO:6)
#241-7
5'GGGGTACCGTGGGGGAACCTGTGCCTGATGATCTTTTAGTTA
AGGGTGGTAACAATCGCTCGTCTGTAGCGAGTAGTATATATGT
TCACACCCCAAGCGGCTCTTTGGTGTCCTCTGAGGCACA 3'
(SEQ ID NO:7)
#241-8
5'ATTGTTTAATAAGCCATATTGGCTACAAAAAGCCCAGGGACA
TAACAATGGTATTTGTTGGGGTAATCATCTGTTTGTTACTGTGG
TAGATACCACACGCAGTACCAACATGA 3'(SEQ ID NO:R)
#241-9 =
5'CATTATGTGCATCCGTATCTAAATCTGCCACATACACCAATTC
TGATTATAAAGAGTACATGCGTCATGTGGAAGAGTTTGATTTA
CAATTTATTTTTCAATTATGTAGCATT 3'(SEQ ID NO:9)
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/0,4117
-19-
#241-10
5'ACATTGTCTGCTGAAGTAATGGCCTATATTCACACAATGAAT
CCCTCTGTTCTCGAGGACTGGAACTTTGGGTTATCGCCTCCCCC
AAATGGTACACTCGAGCGG 3'(SEQ ID NO:10)
#241-11
5'CCGCTCGAGGATACCTATAGGTATGTGCAGTCACAGGCCATT
ACCTGTCAAAAGCCCACTCCTGAAAAGGAAAAGCAAGATCCCT
ATAAGGACATGAGTTTTTGGGAGGTTAATTTAAAAGAAAAGTT
TTCTAGTGAATTGGATCAGTTTCCTTT 3' (SEQ ID NO:11)
#241-12
5'GGGACGCAAGTTT'TTGTTACAAAGTGGATATAGGGGACGGAC
CTCTGCTCGTACCGGTATTAAGCGCCCTGCTGTTTCCAAACCCT
CTACTGCCCCTAAACGTAAGCGCACCAAAACTAAAAAG'TAAG
ATCTTC 3' (SEQ ID NO:12)
#241-13
5'GAAGATCTTACTTTTTAGTTTTGGTGCGCTTACGTTTAGGGGC
AGTAGAGGGTTTGGAAACAGCAGGGCGCTTAATACCGGTACG
AGCAGAGGTCCGTCCCCTATATCCACTTTGTAACAAAAACTTG
CGTCCCAAAGGAAACTGATCCAATTC 3' (SEQ ID NO:13)
#241-14
5'ACTAGAAAACTTTTCTTTTAAATTAACCTCCCAAAAACTCATG
TCCTTATAGGGATCTTGCTTTTCCTTTTCAGGAGTGGGC,TTTG
ACAGGTAATGGCCTGTGACTGCACATACCTATAGGTATCCTCG
AGCGG 3' (SEQ ID NO:14)
#241-15
5'CCGCTCGAGTGTACCATTTGGGGGAGGCGATAACCCAAAGTT
CCAGTCCTCGAGAACAGAGGGATTCATTGTGTGAATATAGGCC
ATTACTTCAGCAGACAATGTAATGCTACATAATTGAAAAA 3'
(SEQ ID NO:15)
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-20-
#241-16
5'TAAATTGTAAATCAAACTCTTCCACATGACGCATGTACTCTTT
ATAATCAGAATTGGTGTATGTGGCAGATTTAGATACGGATGCA
CATAATGTCATGTTGGTACTGCGTGTG 3' (SEQ ID NO:16)
#241-17
5'GTATCrACCACAGTAACAAACAGATGATTACCCCAACAAATA
CCATTGTTATGTCCCTGGGCTTTTTGTAGCCAATATGGCTTATT
AAACAATTGTGCCTCAGAGGACACCAA 3' (SEQ ID NO:17)
#241-18
5'AGAGCCGCTTGGGGTGTGAACATATATACTACTCGCTACAGA
CGAGCGATTGTTACCACCCTTAACTAAAAGATCATCAGGCACA
GGTTCCCCCACGGTACCCC 3' (SEQ ID NO:18)
#241-19
5'GGGGTACCAGCCCTGTTAAAAAAATGTCTGGCAAACATTTGT
TCCTTCCGTAGATAAAAAAATAATCTATCACCATATGGGTCTG
CAGCCATTTGTAAATAATCTGGATATTTACATACAGTGCCACA
TATGTCAA 3' (SEQ ID NO:19)
#241-20
5'GAGGAACATCTGATTTATTGGTCTGCAAATCAGCAAAATTCA
TAGCACCAAAGCCTGTGTCAACCATATCGCCATCCTGTATAAC
ACTGGTAATAAGTTCTAAGGGCGGGCAGTCACCATTCTGT 3'
(SEQ ID NO:20)
#241-21
5'ACAGATGTATTACTACACTGTGTACCTTTACCCCAATGCTCGC
CCAAAGGGGGGGCACATCCAACCATGCATAATTGTGTTTGTTT
ATAATCCATACCTACATTAACCCTGTTATCCTGTCCAGGGT 3'
(SEQ ID NO:21)
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-21-
#241-22
5'TACCACCGTAACCCCCTGAATTTTCAACATCATCATATTTATT
TAGTAAAGGATGTCCACTTACACCCACACCTAATGGCTGTCCC
CGGCCCACCTCTAGGCCTGTGCATGCATGT 3'(SEQ ID NO:22)
#241-23
5'ACATG CATGCCCATACCAAACGTTGTGTTGTGGGATCAAAAA
GAGACGAGTCAGGCAATGCAAATTTGTTAGGATCTGGTAACAC
CACCTTAAATACTCTGTATTGATATCCTGACACCTTTGGCACAA
CAGTTTTGTTAACCTTTTTTATGGAATAATAAGGATGACCC 3'
(SEQ ID NO:23)
#241-24
5'ACTGCAAGAAGTCTAGAACTGCTGGCATGATAAAATATGTTG
GTGCGTTTAACATAAGCATCCGTGGCAACAACTTTGGATACAG
GGTTAGGAGGAGGCACATATACTGTGCTGTCGCTAGGCCGCCA
CATTTTGTTTTGTGAGATCTTC 3' (SEQ ID NO:24)
Oligomers forming complementary pairs (#241-1 and #241-
24, #241-2 and #241-23, #241-3 and #241-22, #241-4 and #241-21, #241-
5 and #241-20, #241-6 and #241-19, #241-7 and #241-1 A, #241-8 and
#241-17, #241-9 and #241-16, #241-10 and #241-15, #241-11 and #241-
14, #241-12 and #241-13- Figure 1) were annealed in separate tubes
containing 2.5 mM Tris, pH 7.5, 0.25 mM EDTA. Tubes were heated to
9$ C for 4 min and then placed in 200 ml of 98 C water in a 250 ml
beaker to cool slowly. When the water cooled to room temperature, the
annealed pairs were added to tubes as designated: fragment A (oligomer
pairs #241-1 & 24, and -2 & 23); fragment B (#241-3 & 22, -4 & 21, -5 &
. 20, and -6 & 19); fragment C (#241-7 & 1 A, -8 & 17, -9 & 16 and -.t 0& 15)
and fragment D(#241-11 & 14 and -12 & 13). These oligomer pair mixes
were heated to 62 C for 2 min and then cooled slowly as before. The
contents of each tube were ligated overnight at 23 C using T4 DNA
ligase (Boehringer Mannheim, Inc.) and the reagents supplied by the
manufacturer.
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-22-
After ligation, fragment B required PCR amplification to
increase the amount of full-length product. This required ten cycles of
94 C, 1 min; 4$ C, 1 min; 72 C, 1 min followed by 10 min at 72 C in an
Applied Biosystems thermocycler using Boehringer Mannheim Taq
polymerase and the oligomer primers:
5'GGAATTCACATGCATGCACAGGCCTAG 3' (SEQ ID NO:25) and
5' GGAA'~TCGGGGTACCAGCCCTGTTAA 3' (SEQ ID NO:26).
The ligated products and the fragment B PCR product were
digested with restriction enzymes (Boehringer Mannheim, Inc.) as
follows: fragment A was digested with Bgl II and Sph I; fragment B, Sph
I and Kpn I; fragment C, Kpn I and Xho I; and fragment D, Xho I and
Bgl B. The digested fragments were separated on low melting point
agarose (FMC BioProducts) gels and correctly sized fragments isolated
by excision of the band and digestion of the agarose using AgaraseTM
(Boehringer Mannheim, Inc.) as recommended by the supplier. The
fragments A, B and D were recovered by ethanol precipitation and then
separately ligated into the vector pSP72 (Promega, Inc.) that had been
similarly digested with restriction enzymes to match each fragment being
ligated.
The Kpn I Xho I digested fragment C was first ligated to the
annealed oligomers
5'TCGAAGACTGGAACTTTGGGTTATCGCCTCCCCCAAATGGTA
CAC 3'; (SEQ ID NO:27) and
5'TCGAGTGTACCATTTGGGGGAGGCGATAACCCAAAGTTCCAG
TCT3' (SEQ ID NO:28).
Fragment C was then recleaved with Xho I and the 450 bp
Kpnl Xhol fragment was ligated with the Kpn I, Xho I-digested pSP72
vector. The ligation mixes were used to transform Escherichia coli strain
DH5 competent cells (Gibco BRL, Gaithersburg, MD). Transformants
were screened for insert-containing clones by colony hybridization (J.
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition,
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-23-
Cold Spring Harbor Laboratory Press, 1989). Plasmid DNA was isolated
from the positive clones using a Wizard miniprep kit (Promega Corp.)
and then sequenced using an Applied Biosystems 373A DNA Sequencer..
Clones containing the correct DNA sequence for each of the four
fragments were digested as before to release the fragments from t;he
pSP72 vector. The Kpn I, Xho I-digested fragment C was ligated with
the Xho I, Bgl H-digested fragment D and Kpn I, Bgl II-cut pSP72 in a
three-way ligation. The ligation products were then used to transform E.
coli. Resulting transformants were sequenced and a clone of correct
sequence obtained (designated CD). The 750 bp Bgl II Kpn I insert of
CD was recleaved from the pSP72 vector and ligated with Bgl II, Sph I
-digested fragment A and Sph I, Kpn I-digested fragment B in a three-
way ligation as before except Bgl II was added to decrease undesired
ligation products. The ligation products were separated on agarose gels,
the 1.5 kbp fragment was isolated, and was designated D361-1.
EXAMPLE 2
Comparison of Sequences
A comparison of the nucleotide sequence for the HPV6/11
hybrid, HPV6a and HPV11 L1 DNA sequences is shown in Figure 2.
There are a total of 55 nucleotide substitutions made to the HPV .6
backbone sequence to convert it to a HPV 11-encoding translation frame.
In addition, three base pair insertions were added at #411-413 bp to
encode the additional amino acid (tyrosine 132) found in HPV 11 but not
HPV6. Together, these changes allow the type 11-specific,
conformation-dependent, neutralizing monoclonal antibody (Chemicon
8740 MAb) to bind the L1 protein of the HPV6/11 L1 DNA expressed in
yeast. This suggests that the protein from the HPV6/11 hybrid gene
appears to be indistinguishable inununologically from native HPV 11.
Comparison of the HPV6/11 hybrid DNA sequence to the
published HPV 11 L i sequence shows 194 base pair substitutions. There
are a considerable number of substitutions relative to the wild type 11 L1
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-24-
sequence, any combination of which or all changes in total may be what
is responsible for the increased type 11 L 1 protein expression in yeast.
EXAMPLE 3
DNA Sequencing of the L1 gene
The HPV6/11 Ll gene was sequenced using an Applied
Biosystems DNA Sequencer #373A with dye terminator sequencing
reactions (PRIZMTM Sequencing Kit) as specified by the manufacturer
(ABI, Inc., Foster City, CA).
EXAMPLE 4
Construction of HPV6/11 L1, HPV 11 L1 and HPV6 L1 Yeast Expression
Vectors
The pGALI -10 yeast expression vector was constructed by
isolating a 1.4 kbp SphJ fragment from a pUC1$/bidirectional GAL
promoter plasmid which contains the Saccharomyces cerevisiae divergent
GALI -GALI O promoters from the plasmid pBM272 (provided by Mark
Johnston, Washington University, St. Louis, MO). The divergent
promoters are flanked on each side by a copy of the yeast ADHl
transcriptional terminator (Bennetzen, J.L. and Hall, B.D., 1982, J. Biol.
Chenz. 257: 3018-3025), a BamHI cloning site located between the GALI
promoter and the first copy of the ADHI transcriptional terminator and a
Smal cloning site located between the GALIO promoter and the second
copy of the ADHI transcriptional terminator. A yeast shuttle vector
consisting of pBR322, the yeast LEU2d gene (Erhart, E. and Hollenberg,
C.P., 1983, J. Bacteriol. 156: 625-635) and the yeast 2u plasmid (gift of
Benjamin Hall, University of Washington, Seattle, WA) (Broach, J.R.
and Volkert, F.C., 1991, Circular DNA Plasmids of Yeasts, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, New York) was digested
with Sphl and ligated with the 1.4 kbp Sphl divergent GAL promoter
fragment resulting in pGAL 1-10 (Figure 3).
The HPV6/11 hybrid L1 DNA encoding the HPV11 L1
protein (sample D361-1 from Example 1) contains a yeast non-translated
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-25-
leader sequence (Kniskern, P.J. et al., 1986, Gene 46: 135-14 1)
immediately upstream to the HPV6/11 L1 initiating methionine codon.
The pGALI-10 plasmid was linearized with B amHl which cuts between
the GALI promoter and the ADHI transcription terminator and ligated
with the 1.5 kbp, HPV6/11 L1 gene fragment (sample D361-1). E. coli
DH5 (Gibco BRL, Inc.) transformants were screened and a pGAL 1-10
plasmid containing the HPV6/11 L1 gene was isolated and designated as
D362-1.
The wild-type HPV 11 (wt-HPV 11) DNA was cloned from a
condyloma acuminatum lesion (kind gift of Dr. Darron Brown). Total
human genomic DNA was extracted and digested with restriction
endonucleases. The fraction containing wt-HPV 11 DNA was ligated into
an E. coli cloning vector to be used as a template for PCR. The Nwt-
HPV11 L1 gene was amplified by PCR using Vent polymerase (New
England Biolabs, Inc.), 10 cycles of amplification (94 C 1 min, 48 C 1
min, 72 C 1 min 45 sec), and the following oligonucleotide primers
which contain flanking Bgl II sites (underlined):
sense primer: 5'-CTC AGA TCT CAC AAA ACA AAA TGT GGC
GGC CTA GCG ACA GCA CAG-3' (SEQ ID NO:29)
antisense primer: 5'-GAG AGA TCT TAC TTT TTG GTT TTG GTA
CGT TTT CG-3' (SEQ ID NO:30)
The sense primer introduces a yeast non-translated leader
sequence (Kniskem, P.J. et al., 1986, Gene 46: 135-141) immediately
upstream to the wt-HPV 11 L1 initiating methionine codon (highlighted in
bold print). The 1.5 kbp wt-HPV 11 L1 PCR product was digested with
BgIII, gel purified and ligated with the BamHI digested pGALl -10
plasmid to yield plasmid, p329-1.
Total genomic DNA was extracted from an HPV6a-positive,
condyloma acuminatum lesion (kind gift of Dr. Darron Brown). The
HPV6a L1 gene was amplified by PCR using the biopsy sample ]DNA as
a template, Vent polymerase (New England Biolabs, Inc.), 35 cycles of
amplification (94 C 1 min, 48 C 1 min, 72 C 1 min 45 sec), the sense
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-26-
primer listed above for PCR of wt-HPV 11 L1 and an antisense primer
with the sequence,
5'-GAG AGA TCT TAC CTT TTA GTT TTG GCG CGC TTA C-3'
(SEQ ID NO:31).
The 1.5 kbp HPV6a Ll PCR product was digested with BglII, gel
purified and ligated with the BamHI digested pGAL1-10 plasmid to yield
plasmid D 128.
EXAMPLE 5
Preparation of Strain 1558
Step a: Preparation of Yeast Strain U9
Saccharomyces cerevisiae strain 2150-2-3 (MATalpha, leu2-
04, adel, cir ) was obtained from Dr. Leland Hartwell (University of
Washington, Seattle, WA). Cells of strain 2150-2-3 were propagated
overnight at 30 C in 5 mL of YEHD medium (Carty et al., J. Ind Micro 2
(1987) 117-121). The cells were washed 3 times in sterile, distilled
water, resuspended in 2 mL of sterile distilled water, and 0.1 mL of cell
suspension was plated onto each of six 5-fluoro-orotic acid (FOA) plates
in order to select for ura3 mutants (Cold SpringHarbor Laboratory
Manual for Yeast Genetics). The plates were incubated at 30 C. The
medium contained per 250 mL distilled water: 3.5 g, Difco Yeast
Nitrogen Base without amino acids and ammonium sulfate; 0.5 g 5-
Fluoro-orotic acid; 25 mg Uracil; and 10.0 g Dextrose.
The medium was sterilized by filtration through 0.2 m
membranes and then mixed with 250 mL of 4% Bacto-Agar (Difco)
maintained at 50 C, 10 mL of a 1.2 mg/mL solution of adenine, and 5 mL
of L-leucine solution (190 mg/ 50 mL). The resulting medium was
dispensed at 20 mL per petri dish.
After 5 days of incubation, numerous colonies had appeared.
Single colonies were isolated by restreaking colonies from the initial
FOA plates onto fresh FOA plates which were then incubated at 30 C. A
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/0-4117
-27-
number of colonies from the second set of FOA plates were tested for the
presence of the ura3 mutation by replica-plating onto both YEHD plates
and uracil-minus plates. The desired result was good growth on YEHD
and no growth on uracil-minus medium. One isolate (U9) was obtained
which showed these properties. It was stored as a frozen glycerol stock
(strain #325) at -70 C for later use.
Step b: Preparation of a Vector for disruption of the Yeast MNN9
grene
In order to prepare a vector for disruption of the MNN9 gene,
it was necessary to first clone the MNN9 gene from S. cerevisiae genomic
DNA. This was accomplished by standard Polymerase Chain Reaction
(PCR) technology. A 5' sense primer and 3' antisense primer for PCR of
the full-length MNN9 coding sequence were designed based on the
published sequence for the yeast MNN9 gene (Zymogenetics: EPO Patent
Application No. 88117834.7, Publication No. 0-314-096-A2). The
following oligodeoxynucleotide primers containing flanking HindIIl sites
(underlined) were used:
sense primer: 5'-CTT AAA GCT TAT GTC ACT TTC TCT TGT ATC
G-3' (SEQ ID NO:32)
antisense primer: 5'-TGA TAA GCT TGC TCA ATG GTT CTC TTC
CTC-3'. (SEQ ID NO:33)
The initiating methionine codon for the MNN9 gene is
highlighted in bold print. The PCR was conducted using genomic DNA
from S. cerevisiae strain JRY 188 as template, Taq DNA polymerase
(Perkin Elmer) and 25 cycles of amplification (94 C 1 min., 37 C 2 min.,
72 C 3 min.). The resulting 1.2 kbp PCR fragment was digested with
HindIII, gel-purified, and ligated with HindIII-digested, alkaline-
phosphatase treated pUC13 (Pharmacia). The resulting plasmid vvas
designated p 1183.
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-28-
In order to disrupt the MNN9 gene with the yeast URA3
gene, the plasmid pBR322-URA3 (which contains the 1.1 Kbp HindIII
fragment encoding the S. cerevisiae URA3 gene subcloned into the
HindIII site of pBR322) was digested with HindIII and the 1.1 kbp DNA
fragment bearing the functional URA3 gene was gel-purified, made blunt-
ended with T4 DNA polymerase, and then ligated with Pm1I-digeste&
plasmid p:183 (Pm1I cuts within the MNN9 coding sequence). The
resulting plasmid p 1199 contains a disruption of the MNN9 gene by the
functional URA3 gene.
Step c: Construction of U9-derivative strain 1372 containing
disruption of MNN9 gene
For disruption of the MNN9 gene in strain U9 (#325), 30 g
of plasmid p 1199 were digested with HindIII to create a linear
mnn9: : URA3 disruption cassette. Cells of strain 325 were transformed
with the HindIIl-digested p 1199 DNA by the spheroplast method (Hinnen
et al., 1978, Proc. Natl. Acad. Sci. USA 75:1929-1933) and transformants
were selected on a synthetic agar medium lacking uracil and containing
1.0 M sorbitol. The synthetic medium contained, per liter of distilled
water: Agar, 20 g; Yeast nitrogen base w/o amino acids, 6.7 g; Adenine,
0.04 g; L-tyrosine, 0.05 g; Sorbitol, 182 g; Glucose, 20 g; and Leucine
Minus Solution #2, 10 ml. Leucine Minus Solution #2 contains per liter
of distilled water: L-arginine, 2 g; L-histidine, 1 g; L-Leucine, 6 g; L-
Isoleucine, 6 g; L-lysine, 4 g; L-methionine, 1 g; L-phenylalanine, 6 g; L-
threonine, 6 g; L-tryptophan, 4 g.
The plates were incubated at 30 C for five days at which
time numerous colonies had appeared. Chromosomal DNA preparations
were made from 10 colonies and then digested with EcoRl plus HindIII.
The DNA digests were then evaluated by Southern blots (J. Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring
Harbor Laboratory Press, 1989) using the 1.2 kbp HindIII fragment
bearing the MNN9 gene (isolated from plasmid p 1199) as a probe. An
isolate was identified (strain #1372) which showed the expected DNA
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-29-
band shifts on the Southem blot as well as the extreme clumpiness
typically shown by mnn9 mutants.
Step d: Construction of a Vector for Disruption of Yeast HIS3 Gene
In order to construct a disruption cassette in which the S.
cerevisiae HIS3 gene is disrupted by the URA3 gene, the plasmid YEp6
(K. Struhl et al., 1979, Proc. Natl. Acad. Sci., USA 76:1035) was digested
with BamHI and the 1.7 kbp BamHI fragment bearing the HIS3 gene was
gel-purified, made blunt-ended with T4 DNA polymerase, and ligated
with pUC18 which had been previously digested with BamHI and treated
with T4 DNA polymerase. The resulting plasmid (designated p 1501 or
pUC 1 9-HIS3) was digested with Nhel (which cuts in the HIS3 coding
sequence), and the vector fragment was gel-purified, made blunt-ended
with T4 DNA polymerase, and then treated with calf intestine alkaline
phosphatase. The URA3 gene was isolated from the plasmid pBR322-
URA3 by digestion with HindIII and the 1.1 kbp fragment bearing the
URA3 gene was gel-purified, made blunt-ended with T4 DNA
polymerase, and ligated with the above pUC18-HIS3 Nhel fragment. The
resulting plasmid (designated pUC 1$-his3::URA3 or p 1505) contains a
disl-uption cassette in which the yeast HIS3 gene is disrupted by the
functional URA3 gene.
Step e: Construction of Vector for Disruption of Yeast PRB1 Gene
by the HIS3 Gene
Plasmid FP80H bearing the S. cerevisiae PRBI gene was
provided by Dr. E. Jones of Camegie-Mellon Univ. (C. M. Moehle et al.,
1987, Genetics115:255-263). It was digested with HindIII plus XhoI and
the 3.2 kbp DNA fragment bearing the PRBI gene was gel-purified and
made blunt-ended by treatment with T4 DNA polymerase. The plasmid
pUC 18 was digested with BamHI, gel-purified and made blunt-ended by
treatment with T4 DNA polymerase. The resulting vector fragment was
ligated with the above PRB1 gene fragment to yield the plasmid pUCI 8-
PRB 1. Plasmid YEp6, which contains the HIS3 gene, was digested with
BamHI. The resulting 1.7 kbp BamHI fragment bearing the functional
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-30-
HIS3 gene was gel-purified and then made blunt-ended by treatment with
T4 DNA polymerase. Plasmid pUC18-PRB 1 was digested with EcoRV
plus NcoI which cut within the PRB1 coding sequence and removes the
protease B active site and flanking sequence. The 5.7 kbp EcoRV-Ncol
fragment bearing the residual 5' and 3'-portions of the PRBI coding
sequence in pUC 18 was gel-purified, made blunt-ended by treatment with
T4 DNA polymerase, dephosphorylated with calf intestine alkaline
phosphatase, and ligated with the blunt-ended HIS3 fragment described
above. The resulting plasmid (designated pUC 18-prb 1::HIS3, stock
#1245) contains the functional HIS3 gene in place of the portion of the
PRBI gene which had been deleted above.
Step f: Construction of a U9-related Yeast Strain containing
disruptions of both the MNN9 and PRBI Genes
The U9-related strain 1372 which contains a MNN9 gene
disruption was described in Example 5c. Clonal isolates of strain 1372
were passaged on FOA plates (as described in Example 5a) to select ura3
mutants. A number of ura3 isolates of strain 1372 were obtained and one
particular isolate (strain 12930-190-S 1-1) was selected for subsequent
disruption of the HIS3 gene. The pUC 18-his3::URA3 gene disruption
vector (p 1505) was digested with Xbal plus EcoRI to generate a linear
his3: : URA3 disruption cassette and used for transformation of strain
12930-190-S 1-1 by the lithium acetate method (Methods in Enzymology,
194:290 (1991). Ura+ transformants were selected on synthetic agar
medium lacking uracil, restreaked for clonal isolates on the same
medium, and then replica-plated onto medium lacking either uracil or
histidine to screen for those isolates that were both Ura+ and His-. One
isolate (strain 12930-230-1) was selected for subsequent disruption of the
PRB1 gene. The PRB1 gene disruption vector (pUC1R-prb1::HIS3, stock
#1245) was digested with SacI plus Xbal to generate a linear prb1::HIS3
disruption cassette and used for transformation of strain 12930-230-1 by
the lithium acetate method. His+ transformants were selected on agar
medium lacking histidine and restreaked on the same medium for clonal
isolates. Genomic DNA was prepared from a number of the resulting
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-31-
His+ isolates, digested with EcoRI, and then electrophoresed on 0.8%
agarose gels. Southeln blot analyses were then performed using a radio-
labeled 617 bp probe for the PRBI gene which had been prepared by
PCR using the following oligodeoxynucleotide primers:
5' TGG TCA TCC CAA ATC TTG AAA 3' (SEQ ID NO:34); and
5' CAC CGT AGT GTT TGG AAG CGA 3' (SEQ ID NO:35)
.10 Eleven isolates were obtained which showed the expected
hybridization of the probe with a 2.44 kbp prb1::HIS3 DNA fraginent.
This was in contrast to hybridization of the probe with the 1.59 kbp
fragment for the wild-type PRB1 gene. One of these isolates containing
the desired prbl :: HIS3 disruption was selected for further use anci was
designated strain #1558.
EXAMPLE 6
Expression of HPV 11 L1 and HPV6 L1 in Yeast
Plasmids D362-1 (pGALI-10 + HPV6/11 L1), p329--1
(pGAL1-10 + wt-HPV 11 L1), D12A (pGALI-10 + HPV6 L1) and
pGAL 1-10 were used to transform S. cerevisiae strain #1559 (MATa,
leu2-04, prh1::HIS3, mnn9: : URA3, adel, cirO) by the spheroplast method
(Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75, 1929-1933). The
#1558 yeast strain transformed with plasmid D362-1 was designated as
strain #1782. For RNA studies, yeast clonal isolates were grown at 30 C
in YEH complex medium (Carty et al., 1987, J. Ind. Micro. 2, 117-121)
containing 0.1 M sorbitol and either 2% glucose or galactose for 26
hours. After harvesting the cells, yeast RNA was extracted using the hot
acidic phenol method as described (Current Protocols in Molecular
Biology, vol. 2, Current Protocols, 1993). For protein analysis, the
identical isolates were grown at 30 C in YEH complex medium
containing 0.1 M sorbitol, 2% glucose and 2% galactose for 70 hours.
After harvesting the cells, the cell pellets were broken with glass beads
CA 02216827 1997-09-29
WO 96/30520 PCT/1JS96/04117
-32-
and cell lysates analyzed for the expression of HPV11 L1 or HPV6 Ll
protein by immunoblot analysis.
EXAMPLE 7
Northern Blot Analvsis of Yeast Expressed HPV L1 RNAs
Samples containing 10 g of total RNA were denatured by
treatment with glyoxal and DMSO (Current Protocols in Molecular
Biology, vol. 1, Current Protocols, 1993) and electrophoresed through a
phosphate-buffered, 1.2% agarose gel. The RNA was transferred onto a
nylon membrane and detected with a 32P-labeled oligonucleotide that is
complementary to both the HPV 11 and HPV6 L1 DNA sequences.
The Northern blot is shown in Figure 4. No bands that
correspond to the expected size for full-length HPV L 1 RNA were
detected in the samples grown on glucose medium (lanes 1,3 and 5). This
is expected since glucose represses transcription from the yeast GAL I
promoter. In contrast, samples grown in galactose medium which
induces transcription from the GAL 1 promoter, show strong HPV L 1
RNA signals. The HPV6 L1 was transcribed as a full-length RNA
species (lane 2) while the majority of the wild-type (wt)-HPV 11 L 1 was
transcribed as a truncated form (lane 4). This result suggested that a yeast
transcription termination signal is located within the wt-HPV 11 L 1 ORF
but is not present in the HPV6 L1 sequence. The RNA transcribed from
the HPV6/11 hybrid gene appears to be full-length (lane 6). No HPV
specific RNA is detected in the pGAL 1-10 control yeast sample (lane 7).
EXAMPLE 8
Western Analysis of Yeast Expressed HPV L 1 Proteins
Samples containing 20 g of total cellular protein were
electrophoresed through 10% Tris-Glycine gels (Novex, Inc.) under
denaturing conditions and electroblotted onto nitrocellulose filters. L i
protein was immunodetected using rabbit antiserum raised against a tr-pE-
HPV11 L1 fusion protein as primary antibody (Brown, D.R. et al., 1994,
Virology 201:46-54) and horseradish peroxidase (HRP)-linked donkey
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-33-
anti-rabbit IgG (Amersham, Inc.) as secondary antibody. The filters were
processed using the chemiluminescent ECLTM Detection Kit
(Amersham, Inc.). A 50-55 kDa L1 protein band was detected in all
samples except the pGALI-10 negative control (lane 4) (Figure 5).
Furthermore, the amount of HPV 11 L1 protein expressed by the
HPV6/11 hybrid gene (lane 3) appears to be -10-fold greater than the
amount of L1 protein expressed by either the wt-HPV 11 gene (lane 2) or
the HPV6 Ll gene (lane 1).
EXAMPLE 9
ELISA of Yeast Expressed HPVI 1 L1 VLPs
An ELISA was used to determine relative amounts of VLPs
produced from yeast clones expressing either wt-HPV 11 or the HPV6/11
hybrid. The ELISA was also used to demonstrate that a conformational
epitope giving rise to strongly neutralizing antibody responses was
retained on the VLPs derived from the HPV6/11 hybrid DNA. This
conformational epitope has been defined by monoclonal antibody H 11.B2
(Christensen et al 1990, J. Virol. 64, 5678-568 1) which is available from
Chemicon International (Temecula, CA) as Chemicon MabR740. Briefly,
wells of ELISA plates (Maxisorb, Nunc Inc., Naperville, IL) were coated
with decreasing amounts of total yeast protein containing the HPV6/ 11
(hybrid) or wt-HPV 11 VLPs in 100 L PBS. CsCI-purified wt-HPV 11
virions (a generous gift of Dr. D. Brown) and control yeast protein were
used as controls. The plates were incubated overnight at 4 C before
aspirating and blocking the plates with 250 mcl 10% dried milk
(Carnation) in TTBS (50 mM Tris, pH 7.6, 150 mM NaC1, 0.1 %
Tween20) for 2 hrs at room termperature. The plates were washed once
with PBS/0.1 %Tween 20 before incubating the wells with 100 mc,l of a
1:1000 dilution of the anti-HPV 11 virion monoclonal antibody Chemicori
MAB 8740 in 1% dried milk in TTBS for 1 hr at room temperature.
Plates were washed 3 times with PBS/Tween 20 and then incubated with
100 mcl of anti-mouse IgG coupled to alkaline phosphatase (Kierkegard
&Perry, Gaithersburg, MD) at a dilution of 1:1000 in 1% milk + TTBS
for 1 hr at room temperature. Plates were again washed 3 times vvith
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-34-
PBS/Tween 20 before adding 100 mcl of phosphatase substrate (p-
nitrophenyl phosphate in diethanolamine buffer). Plates were incubated
30 min at room temperature. The reaction was stopped by addition of 50
mcl of 3N NaOH. Plates were read at 405 nm in an ELISA plate reader.
The average OD405 nm readings of 2 wells corrected against
the background readings obtained from control yeast proteins were
plotted against the total yeast protein in the wells and are shown in Figure
6. The HPV6/11 hybrid yeast clone produced more than 10 times the
amount of native VLPs compared to the wt clone. In addition, the
strongly neutralizing epitope recognized by Chemicon Mab 8740 is
displayed on these VLPs.
EXAMPLE 10
Electron Microscopic Studies
For EM analysis (Structure Probe, West Chester, PA), an
aliquot of each sample (crude clarified lysate or purified VLPs) was
placed on 200-mesh carbon-coated copper grids. A drop of 2%
phosphotungstic acid (PTA), pH 7.0 was placed on the grid for 20
seconds. The grids were allowed to air dry prior to transmission EM
examination. All microscopy was done using a JEOL 100CX
transmission electron microscope (JEOL USA, Inc.) at an accelerating
voltage of 100 kV. The micrographs generated have a final magnification
of 100,000x. As shown in Figure 7, VLPs were observed in the 45-55 nm
diameter size range in all HPV 11 samples but not in yeast control
samples.
EXAMPLE 11
Fermentation of HPV6/11 L1 (Strain #17R2)
Surface growth of a plate culture of strain 1782 was
aseptically transferred to a leucine-free liquid medium containing (per L):
8.5 g Difco yeast nitrogen base without amino acids and ammonium
sulfate; 0.2 g adenine; 0.2 g uracil; 10 g succinic acid; 5 g aminonium
sulfate; and 0.25 g L tyrosine; this medium was adjusted to pH 5.0-5.3
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-35-
with NaOH prior to sterilization. After growth for 25 hr at 28 C, 250 rpm
on a rotary shaker, frozen culture vials were prepared by adding sterile
glycerol to a final concentration of 17% (w/v) prior to storage at -- 70 C (1
mL per cryovial). Inoculum for fermentation of strain 1782 was
developed in the same medium (750 mL per 2-L flask) and was sta.rted by
transferring the thawed contents of two frozen culture vials to the 2-L.
flasks and incubating at 28 C, 250 rpm on a rotary shaker for 25 hr.
Fermentation of strain 1782 used a Chemap 23 L fermenter with a
working volume of 18 L after inoculation. The production medium used
contained (per L): 20 g Difco yeast extract; 10 g Sheffield HySoy
peptone; 20 g glucose; 20 g galactose; the medium was adjusted to pH
5.3 prior to sterilization. The entire contents (500 mL) of the 2-L
inoculum flask was transferred to the fermenter which was incubated at
28 C, 9 L air per min, 500 rpm, 3.5 psi pressure. Agitation was increased
as needed to maintain dissolved oxygen levels of greater than 40% of
saturation. Progress of the fetmentation was monitored by offline
glucose measurements (Beckman Glucose 2 Analyzer) and online mass
spectrometry (Perkin-Elmer 1200). After 66 hr incubation, a cell density
of 9.32 g dry cell weight per L was reached. The contents of two such
fermentations (total 17.5 L broth) were pooled before cell recoveiry. The
culture was concentrated by hollow fiber filtration (Amicon H5MP01-43
cartridge in an Amicon DC- 10 filtration system) to ca. 2 L, diafiltered
with 2 L phosphate-buffered saline, and concentrated further (to ca. 1 L)
before dispensing into 500 mL centrifuge bottles. Cell pellets were
collected by centrifugation at 8,000 rpm (Sorval GS3 rotor) for 20 min at
4 C. After decanting the supematant, the pellets (total 358 g wet cells)
were stored at - 70 C until use.
EXAMPLE 12
Purification of Recombinant HPV Type 11 L1 Capsid Proteins
All steps were performed at 4 C unless noted.
Cells were stored frozen at -70 C. Frozen cells (wet weight
= 190 g) were thawed at 20-23 C and resuspended in 900 mL "Bireaking
Buffer" (50 mM MOPS, pH 7.2, 500 mM NaCI, 1 mM CaC12). The
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-36-
protease inhibitors AEBSF and pepstatin A were added to final
concentrations of 1 mM and 1.7 M, respectively. The cell slurry was
broken at a pressure of approximately 16,000 psi by 4 passes in a M 110-
Y Microfluidizer (Microfluidics Corp., Newton, MA). A sufficient
volume of 10% Triton X 100 detergent (Pierce, Rockford, IL) was
added to the broken cell slurry to bring the concentration of TX 100 to
0.5%. The sluny was stirred for 20 hours. The Triton X 100-treated
lysate was centrifuged at 12,000 x g for 40 min to remove cellular debris.
The supernatant liquid containing L 1 protein was recovered.
The supernatant liquid was diafiltered against five volumes
of 20 mM sodium phosphate, pH 7.2, 0.5 M NaCI using a 300K
tangential flow membrane cassette (Filtron, Northborough, MA). The
material retained by the membrane was shown by radioimmunoassay and
western blotting to contain the L 1 protein.
The retentate was applied to a high resolution affinity
column (11.0 cm ID x 5.3 cm) of SP Spherodex (M) resin (IBF,
Villeneuve-la-Garenne, France) equilibrated in 20 mM sodium
phosphate, pH 7.2, 0.5 M NaC1. Following a wash with equilibration
buffer and a step wash with 20 mM sodium phosphate, pH 7.2, 1.0 M
NaCI, the L1 protein was eluted with a step wash of 20 mM sodium
phosphate, pH 7.2, 2.5 M NaC1. Fractions were collected during the
washes and elution. Colunm fractions were assayed for total protein by
the Bradford method. Fractions were then analyzed by western blotting
and SDS-PAGE with colloidal Coomassie detection. Fractions were also
analyzed by radioimmunoassay.
SP Spherodex fractions showing comparable purity and
enrichment of L 1 protein were pooled.
Final product was analyzed by western blotting and SDS-
PAGE with colloidal Coomassie detection. The L1 protein was estimated
to be > 90% homogeneous. The identity of L1 protein was confirmed by
western blotting. The final product was filtered aseptically through a 0.22
m membrane and stored at 4 C. This process resulted in a total of 100
mg protein.
CA 02216827 1997-09-29
WO 96/30520 PCT/US96/04117
-37-
Electron microscopy analysis is performed by Struc-ture
Probe (West Chester, PA). An aliquot of sample is placed on a 200 mesli
carbon-coated copper grid. A drop of 2% phosphotungstic acid, pH 7.0 is
placed on the grid for 20 seconds. The grid is allowed to air dry prior to
TEM examination. All microscopy is performed using a JEOL 100 CX
transmission electron microscope (JEOL USA, Inc.) at an accelerating
voltage of 100 W. The micrographs generated have a final magnification
of 100,000 X.
Bradford Assay for Total Protein
Total protein was assayed using a commercially available
Coomassie Plus kit (Pierce, Rockford, IL). Samples were diluted to
appropriate levels in Milli-Q-H20. Volumes required were 0.1 mL and
1.0 mL for the standard and microassay protocols, respectively. For both
protocols, BSA (Pierce, Rockford, IL) was used to generate the standard
curve. Assay was performed according to manufacturer's
recommendations. Standard curves were plotted using CricketGraph
software on a Macintosh Hci computer.
SDS-PAGE and Western Blot Assays
All gels, buffers, and electrophoretic apparatus were
obtained from Novex (San Diego, CA) and were run according to
manufacturer's recommendations. Briefly, samples were diluted to equal
protein concentrations in Milli-Q-H20 and mixed 1:1 with sample
incubation buffer containing 200 mM DTT. Samples were incubated 15
min at 100 C and loaded onto pre-cast 12% Tris-glycine gels. The
samples were electrophoresed at 125V for 1 hr 45 min. Gels were
developed by colloidal Coomassie staining using a commercially
obtained kit (Integrated Separation Systems, Natick, MA).
For western blots, proteins were transferred to PVDF
membranes at 25V for 40 min. Membranes were washed with M:illi-Q-
H20 and air-dried. Primary antibody was polyclonal rabbit antiserum
raised against a TrpE-HPV 11 L1 fusion protein (gift of Dr. D. Brown).
The antibody solution was prepared by dilution of antiserum in blotting
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-38-
buffer (5% non-fat milk in 6.25 mM Na phosphate, pH 7.2, 150 mM
NaCI, 0.02% NaN3). Incubation was for at least 1 hour at 20-23 C. The
blot was washed for 1 min each in three changes of PBS (6.25 mM Na
phosphate, pH 7.2, 150 mM NaCI). Secondary antibody solution was
prepared by diluting goat anti-rabbit IgG alkaline phosphatase-linked
conjugate antiserum (Pierce, Rockford, II.) in blotting buffer. Incubation
proceeded under the same conditions for at least 1 hour. Blots were
washed as before and detected using a 1 step NBT/BCIP substrate
(Pierce, Rockford, IL).
EXAMPLE 13
Preparation of Immunogenic Compositions
Purified VLP's are formulated according to known methods,
such as by the admixture of pharmaceutically acceptable carriers,
stabilizers, or a vaccine adjuvant. The immunogenic VLP's of the present
invention may be prepared for vaccine use by combining with a
physiologically acceptable composition such as, e.g. PBS, saline or
distilled water. The immunogenic VLP's are administered in a dosage
range of about 0.1 to 100 mcg, preferably about 1 to about 20 mcg, in
order to obtain the desired immunogenic effect. The amount of VLP per
formulation may vary according to a variety of factors, including but not
limited to the individual's condition, weight, age and sex. Administration
of the VLP formulation may be by a variety of routes, including but not
limited to oral, subcutaneous, topical, mucosal and intramuscular. Such
VLP formulations may be comprised of a single type of VLP (i.e., VLP
from HPV 11) or a mixture of VLP's (i.e, VLP's from HPV6, HPV 11,
HPV 16 and HPV 18).
An antimicrobial preservative, e.g. thimerosal, optionally
may be present. The immunogenic antigens of the present invention may
be employed, if desired, in combination with vaccine stabilizers and
vaccine adjuvants. Typical stabilizers are specific compounds, e.g.
polyanions such as heparin, inositol hexasulfate, sulfated beta-
cyclodextrin, less specific excipients, e.g. amino acids, sorbitol, mannitol,
xylitol, glycerol, sucrose, dextrose, trehalose, and variations in solution
CA 02216827 1997-09-29
WO 96/30520 PCTIUS96/04117
-39-
conditions, e.g. neutral pH, high ionic strength (ca. 0.5-2.0 M salts),
divalent cations (Ca2+, Mg2+). Examples of adjuvants are Al(OH)3 and
Al(P04). The vaccine of the present invention may be stored under
refrigeration or in lyophilized form.
EXAMPLE 14
Preparation of Antibodies to VLP
Purified VLP are used to generate antibodies. The term
"antibody" as used herein includes both polyclonal and monoclonal
antibodies as well as fragments thereof, such as Fv, Fab and F(ab)2
fragments that are capable of binding antigen or hapten. The antibodies
are used in a variety of ways, including but not limited to the purification
of recombinant VLP, the purification of native L1 or L2 proteins, and
kits. Kits would comprise a comparkmentalized carrier suitable to hold in
close confinement at least one container. The carrier would further
comprise reagents such as the anti-VLP antibody or the VLP suitable for
detecting HPV or fragments of HPV or antibodies to HPV. The carrier
may also contain means for detection such as labeled antigen or enzyme
substrates or the like. The antibodies or VLP or kits are useful for a
variety of purposes, including but not limited to forensic analyses and
epidemiological studies.
