Note: Descriptions are shown in the official language in which they were submitted.
CA 02220670 1997-11-10
W 096135703 PCTnUS95/05922
H~ N I~nHIBITOR OF APOPTOSIS GENE 1
Thi invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is human inhibitor of
apoptosis gene 1, sometimes hereinafter referred to as
"hIAP-l". The invention also relates to inhibiting the
action of such polypeptides.
PrOYL~ cell death (apoptosis) is a process through
.which organisms get rid of unwanted cells. Proyr~r ~ cell
death can be considered as a specific type of terminal cell
differentiation. During apoptosis, the cells of an organism
round up and they have active blebbing at the cell surface,
forming apoptotic bodies, the nuclear membranes and some
internal structures break down, the nuclear DNA is fragmented
by enzymes, and finally the cell breaks into pieces.
The early studies of apoptosis provided that drugs that
block protein synthesis prevent apoptosis, suggesting that
progr~mm~ cell death requires specific proteins. A key aid
in finding the gene encoding the protein which is responsible
for apoptosis was the emergence in the 1980's of the tiny,
transparent round worm Caenorhabditis elegans as a valuable
--1--
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
resource for identifying genes active in embryonic
development. This microscopic worm has only 1,090 cells, and
development biologists, therefore, were able to trace the
lineage of each cell as the worm matures, and found that 131
of the embryonic cells undergo programmed cell death. Among
the genes identified in C.elegans where the death genes ced-3
and ced-4, as well as ced-9, an "anti-death" gene which
protects cells from apoptosis.
The search for m~mm~l ian analogs to these genes had a
breakthrough with the discovery that the gene bc1-2, which
had been identified as a cancer-causing oncogene, protects
;mm--ne cells call lymphocytes from suicide and protects
neurons as well. The worm protection gene, ced-9, was found
to be 23~ homologous to bc1-2, and the bc1-2 gene could
substitute for ced-9 in C. elegans, rescuing ced-9 mutants
from cell death.
Further, a match was found between the ced-3 and a new
m~mm-lian gene which coded for interleukin- ~-converting
enzyme (ICE). The two proteins share 28~ identity at the
amino acid level, and ced-3 is identical to ICE protein in a
five amino acid stretch thought to be the active site
responsible for ICE's protease activity.
Apoptosis may be induced by a variety of different
extracellular and intracellular stimuli, some of which are
still unknown, which can differ dep~n~; ng on cell type.
However, the numerous receptors and associated signal
transduction pathways that respond to each different
induction stimulus may converge on one or more of a limited
number of pathways that actually "trigger" the p-o~ d~ll for
apoptotic cell death. Among the stimuli which can induce
apoptosis, there is extracellular ATP, actinomycin and oxygen
radicals. Actinomycin inhibits the synthesis of RNA and
induces apoptosis in some m~mm~lian cell types, including
human primary uterine epithelial cells and HL60 leukemic
cells (Gerschenson, L.~. and Rotello, R.J., Cold Spring
CA 02220670 1997-11-10
W 096/35703 PCTnUS95/05922
Harbor, Laboratory Press, Cold Spring Harbor, New York, page
175, (1991) and Martin, S.J., et al., Immunol., 145:1859
( 1990 ) ) .
The baculovirus, Cydia pomonella granulosis virus
o (CpGV), was able to inhibit apoptosis in SF-21 cells (derived
from the fall army worm Spodoptera frugiperda) from a mutated
baculovirus AcMNPV which causes apoptosis in SF-21 cells in
the absence of CpGV. The CpGV gene was sequenced (Crook,
N.E. et al., J. Virol., 67:2168 (1993)) and found to have a
characteristic zinc finger-like moti~. The gene was named
iap for inhibitor of apoptosis, and the CpGV gene was called
the Cp- IAP.
The zinc finger-like motif ~ound in the Cp-IAP
polypeptide belongs to a specific class of zinc finger-like
motifs (Freemont, P.S. et al., Cell, 64:483 (1991)) usually
~ound at the amino terminus of polypeptides, but it can occur
elsewhere, as in the case of the IAP polypeptide, where it is
found at the carboxyl terminus. The IAP motif also contains
an additional CX2C repeat in the amino-terminal portion of the
motif, as well as an extra amino acid residue in the central
region (CXHX3C instead of CXHX2C). There are approximately 27
known proteins co~t~;n;ng this type of zinc finger-like
motif, four are found in baculoviruses. The zinc finger-like
motif in also present in several proteins encoded by
vertebrate viruses. The presence of the motif in several
regulatory proteins supports the hypothesis that many of the
proteins cont~;n;ng this motif may be transcriptional
regulatory factors, although DNA b; n~; ng has been
~mon~trated thus far for only one particular member of this
group (Tagawa, et al., J. Biol. Chem., 265:20021 (1990)).
The zinc finger-like motif found in Cp-IAP is also
present in a number of cellular polypeptides that may have a
role in regulating apoptosis. Several of these are encoded
by hllm~n proto-oncogenes such as PM~, bmi-l, c-cbl, rfp and
mel -18 .
--3--
CA 02220670 1997-11-10
W 096/3S703 PCTrUS95/05922
These proteins are involved in either positive or
negative apoptotic control. Thus, Cp-IAP may belong to a
class of cellular proteins which control apoptosis and
contain this distinctive zinc finger-like motif. The
polypeptide of the present invention contains the conserved
zinc finger-like motifs and has been putatively identified as
a member of this class of proteins.
Apoptosis has been shown to play a significant role in
cell development, antiviral responses, tissue
differentiation, development, tissue homeostasis, Al~h~; m~' S
disease, rheumatoid arthritis, septic shock, Parkinson's
disease and may be a mech~n;sm by which cells die during
strokes, trauma and degenerative diseases. Improper
apoptosis, i.e., when cells fail to die when they should, may
result in tumors, oncogenesis and viral infection.
In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide as well as
biologically active and diagnostically or therapeutically
useful fragments, analogs and derivatives thereof. The
polypeptide of the present invention is of human origin.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
encoding a polypeptide of the present invention including
mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and
biologically active and dia~nostically or therapeutically
useful fragments and derivatives thereof.
In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells,
cont~;n;ng a nucleic acid sequence, under conditions
promoting expression of said protein and subsequent recovery
of said protein.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
CA 02220670 1997-11-10
W 096/35703 PCTrUS95105922
polypeptide, or polynucleotide encoding such polypeptide ~or
therapeutic purposes, for example, for preventing
oncogenesis, to treat Al7he;m~'s disease, Parkinson's
disease, rheumatoid arthritis, septic shock and to prevent
the death of cells during strokes, trauma and degenerative
diseases.
In accordance with yet a further aspect of the present
invention, there is also provided nucleic acid probes
comprising nucleic acid molecules of sufficient length to
specifically hybridize to nucleic acid sequences of the
present invention.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptide8.
In accordance with yet another aspect of the present
invention, there are provided compounds which bind to and
inhibit such polypeptides, which may be used, for example, as
an anti-viral defense mech~n;~, to allow cell development,
tissue differentiation, tissue homeostasis and normal
devel~,l,e"L .
In accordance with still another aspect of the present
invention, there are provided processes for employing the
disclosed polynucleotides and polypeptides for research
purposes.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
The following drawings are illustrative of embo~;m~ntR
of the invention and are not meant to limit the scope of the
invention as encompassed by the claims.
Figure 1 illustrates the cDNA sequence and correspo~;ng
deduced amino acid sequence of the polypeptide of the present
invention. The s~n~d abbreviations for nucleotides and
amino acids are used. Sequencing was performed using a 373
automated DNA sequencer (Applied Biosystems, Inc.). .
CA 02220670 1997-11-10
WO 96/35703 PCTrUS95/05922
Figure 2 is an amino acid sequence alignm~nt of hIAP-1
with Cp-IAP (Cydia po-mnnella granulosis virus inhibitor of
apoptosis) and Op-IAP (Orgyia pseudotsugata nuclear
polyhedrosis virus inhibitor of apoptosis).
In accordance with an aspect of the present invention,
there is provided an isolated nucleic acid (polynucleotide)
which ~nco~c for the mature polypeptide having the deduced
amino acid sequence of Figure 1 (SEQ ID NO:2) or for the
mature polypeptide encoded by the cDNA of the clone deposited
as ATCC Deposit No. - on May 11, 1995.
A polynucleotide encoding a polypeptide of the present
invention may be obt~in~ from human jurket cell lines and
human osteoclastoma stromal cells. It is structurally
related to the ;nh; h; tor of apoptosis gene family. It
cont~;n~ an open reading frame encoding a protein of 438
amino acid residues. The protein ~h;h;ts the highest degree
of homology to Op-IAP with 44 ~ identity and 64 % simil~rity
over the entire amino acid stretch. As stated previously,
the conserved motifs found in genes of this type are
preserved in the gene of the present invention.
The polynucleotide of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which encodes the mature polypeptide may be
identical to the coding sequence shown in Figure 1 (SEQ ID
NO:1) or that of the deposited clone or may be a different
coding sequence which coding sequence, as a result of the
r~nn~ncy or degeneracy of the genetic code, ~nco~s the
same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1)
or the deposited cDNA.
The polynucleotide which Pnco~c for the mature
pol~eptide of Figure 1 (SEQ ID NO:2) or for the mature
polypeptide encoded by the deposited cDNA may include, but is
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
not limited to: only the coding ~equence for the mature
polypeptide; the coding sequence for the mature polypeptide
and additional coding sequence; the coding sequence for the
mature polypeptide (and optionally additional coding
~ sequence) and non-coding sequence, such as introns or non-
coding sequence 5' and/or 3' of the coding sequence for the
mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequence of Figure 1 ( SEQ ID NO:2) or
the polypeptide encoded by the cDNA of the deposited clone.
The variant of the polynucleotide may be a naturally
occurring allelic variant of the polynucleotide or a non-
naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in Figure 1
(SEQ ID NO:2) or the same mature polypeptide ~ncnA~A by the
cDNA of the deposited clone as well as variants of such
polynucleotides which variants ~.ncgA~ for a fragment,
derivative or analog of the polypeptide of Figure 1 (SEQ ID
NO:2) or the polypeptide encoded by the cDNA of the deposited
clone. Such nucleotide variants include deletion variants,
substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a
c~;ng sequence which is a naturally occurring allelic
variant of the coding sequence shown in Figure 1 (SEQ ID
NO:l) or of the coding sequence of the deposited clone. As
known in the art, an allelic variant is an alternate form of
a polynucleotide sequence which may have a substitution,
deletion or addition of one or more nucleotides, which does
-7-
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
not substantially alter the ~unction of the encoded
polypeptide.
The polynucleotides of the present invention may also
have the coding sequence fused in ~rame to a marker sequence
which allows for purification of the polypeptide of the
present invention. The marker sequence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide for
purification of the mature polypeptide fused to the marker in
the case of a bacterial host, or, for example, the marker
sequence may be a hem~gglutinin (HA) tag when a ~-mm~ n
host, e.g. COS-7 cell~, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates to
polynucleotides which hybridize to the her~;n~hove-described
se~lencPs if there is at least 70~, preferably at least 90~,
and more preferably at least 95~ identity between the
sequences. The present invention particularly relates to
polynucleotides which hybridize under stringent conditions to
the hereinabove-described polynucleotides. As herein used,
the term "stringent conditions" means hybridization will
occur only if there is at least 95% and preferably at least
97% identity between the se~-ences. The polynucleotides
which hybridi~e to the herein~hove described polynucleotides
in a preferred ~mho~m~nt ~nco~P polypeptides which either
retain subst~nt~Ally the same biological function or activity
as the mature polypeptide encoded by the cDNAs o~ Figure 1
(SEQ ID NO:l) or the deposited cDNA(s).
Alternatively, the polynucleotides may have at least 20
bases, preferably 30 bases and more preferably at least 50
bases which hybridize to a polynucleotide of the present
invention and which have an identity thereto, as her~n~h~ve
described, which may or may not retain activity. Such
polynucleotides may be employed as probes for the
polynucleotide of SEQ ID NO: 1, or for variants thereof, for
CA 02220670 1997-11-10
W 096135703 PCTrUS95/05922
example, for recovery of the polynucleotide or as a
diagnostic probe or as a PCR primer.
Thus, the present invention is directed to
polynucleotides having at least a 70~ identity, preferably at
least 90% and more preferably at least a 95% identity to a
polynucleotide which ~ncoA~s the polypeptide of SEQ ID NO:2
as well as fragments thereo~, which ~ragments have at least
30 bases and preferably at least 50 bases and to polypeptides
encoded by such polynucleotides.
The deposit(s) referred to herein will be ~-,ntA,nPA
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-org~n~ cmc for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides cont~ n~A in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein by
reference and are controlling in the event of any conflict
with any description of se~l~nc~s herein. A license may be
required to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to a polypeptide
which has the deduced amino acid sequence of Figure 1 (SEQ ID
NO:2) or which has the amino acid seguence ~ncoA~A by the
deposited cDNA, as well as fragments, analogs and derivatives
of such polypeptide.
The terms ~Ifragment,~ derivative~ and ~analog" when
referring to the polypeptide of Figure 1 (SEQ ID NO:2) or
that encoded by the deposited cDNA, means a polypeptide which
retains esspnt~lly the same biological function or activity
as such polypeptide. Thus, an analog includes a ~L~rotein
which can be activated by cleavage of the proprotein portion
to produce an active mature polypeptide.
CA 02220670 1997-11-10
W O 96/35703 PCTrUS95/05922
The polypeptide of the present invention may be a
recomh;n~nt polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide
of Figure 1 (SEQ ID NO:2) nor that encoded by the deposited
cDNA may be ~i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may
not be one encoded by the genetic code, or (ii) one in which
one or more of the amino acid residues includes a substituent
group, or (iii) one in which the mature polypeptide is fused
with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene
glycol), or (iv) one in which the additional amino acids are
fused to the mature polypeptide which are employed for
purification of the mature polypeptide or a ~l~rotein
sequence. Such fragments, derivatives and analogs are deemed
to be within the scope of those skilled in the art from the
teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
The polypeptides of the present invention include the
polypeptide of SEQ ID NO.2 (in particular the mature
polypeptide) as well as polypeptides which have at least 70%
s~m; l~rity (preferably a 7096 identity) to the polypeptide of
SEQ ID NO:2 and more preferably a 90% sim~l~rity (more
preferably a 90~ identity) to the polypeptide of SEQ ID NO:2
and still more preferably a 95% s~m~l~rity (still more
preferably a 95~ identity) to the polypeptide of SEQ ID NO:2
and to portions of such polypeptide with such portion of the
polypeptide generally cont~ n~ at least 30 amino acids and
more preferably at least 50 amino acids.
--10--
CA 02220670 1997-11-10
WO 96/35703 PCTAUS9510S922
As known in the art l~si m;l~rityll between two
polypeptides is determined by co~r~ing the amino acid
sequence and conserved amino acid substitutes thereto of the
polypeptide to the sequence of a ~econd polypeptide.
Fragments or portions of the polypeptides of the present
invention may be employed for producing the correspo~; n~
full-length polypeptide by peptide synthesis, therefore, the
~ragments may be employed as intenmediates for pro~nc~ ng the
full-length polypeptides. Fra~ments or portions of the
polynucleotides of the present invention may be used to
synthesize ~ull-length polynucleotides of the present
invention.
The term "isolated" means that the material is ~ ~ved
from its original envil~ -nt (e.g., the natural envilu~ t
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a living
~n;~-l iS not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
r~ro~ition is not part o~ its natural envi~
The term "gene" means the segment o$ DNA involved in
pro~llr;ng a polypeptide chain; it includes regions pr~r~ing
and ~ollowing the coding region "leader and trailer~ as well
as intervening sequences (introns) between individual ro~;ng
se_ nt~ (exons).
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the
invention and the production of polypeptides of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the hIAP-l
genes. The culture conditions, such as temperature, pH and
the like, are those previously used with the host cell
selected for expression, and will be apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be
employed ~or pro~llr, n~ polypeptides by recomh~n~nt
techniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g., derivatives
of SV40; bacterial plasmids; phage DNA; baculovirus; yeast
plasmids; vectors derived from ccmh; n~tions of plasmids and
phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
The d~lo~.iate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an d~lv~Liate restriction
Pn~nnll~lease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an d~v~liate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the E. coli. lac or trp, the phage 1~h~ PL
promoter and other promoters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also cnnt~n~ a ribosome bin~;ng site
CA 02220670 1997-11-10
W O 96/35703 PCTrUS95/05922
for translation initiation and a transcription terminator.
The vector m~y also include appropriate sequences ~or
amplifying expression.
In addition, the expression vectors preferably contain
one or more selectable m~rke~ genes to provide a phenotypic
trait ~or selection of transformed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampic;ll; n
resistance in E. coli.
The vector c~nt~;n;ng the appropriate DNA sequence as
herP~n~hove described, as well as an appropriate promoter or
control sequence, may be employed to transform an d~ro~iate
host to permit the host to express the protein.
As representative examples of a~Lu~Liate hosts, there
may be mentioned: bacterial cells, such as E. coli,
strePtom~ces~ Salmonella tY~h~mll~ium; fungal cells, such as
yeast; insect cells such as DrosoPhila S2 and SPodoptera S~9;
~n i m~ 1 cells such as CHO, COS or Bowes mel ~nom~;
adenoviruses; plant cells, etc. The selection of an
appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
More particularly, the present invention also includes
re~srh;n~nt constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect o~ this
Pmbo~;mPnt~ the construct further comprises regulatory
sequences, including, for example, a ~Lc..l~Ler, operably
linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
ro~m~cially available. The following vectors are provided
by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen),
pBS, pD10, phagescript, psiX17g, pbluescript SK, pbsks,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-
CA 02220670 1997-11-10
W096/35703 PCTrUS95tOS922
3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
using CAT (chloramphenicol transferase) vectors or other
vectors with selectable markers. Two appropriate vectors are
pKK232-8 and pCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, l~mhr~ PR~ PL and trp.
Eukaryotic promoters include CMV ;mm~ te early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriate
vector and promoter is well within the level of ordinary
skill in the art.
In a ~urther embo~m~nt, the present invention relates
to host cells contA~n;ng the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
m~ lian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEA~-
Dextran mediated transfection, or electroporation (Davis, L.,
Dibner, M., Battey, I., Basic Methods in Molecular Biology,
(1986)).
The constructs in host cells can be used in a
conventional m-nne~ to produce the gene product ~nco~ by
the recombinant sequence. Alternatively, the polypeptides of
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in m~mm~ n cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
-14-
CA 02220670 1997-11-10
W 096/35703 PCTrUS9~105~2Z
Appropriate cloning and expression vectors ~or use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory ~nll~l, Second
Edition, Cold Spring ~hor, N.Y., (1989), the disclosure o~
which is hereby incorporated by reference.
Transcription o~ the DNA encoding the polypeptides of
- the present invention by higher eukaryotes is increased by
inserting an Pnh~ncer sequence into the vector. Rnh~n~erS
are cis-acting elPm~nts of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
~xamples including the SV40 Pnh~n~r on the late side of the
replication origin bp 100 to 270, a cyt~ ovirus early
promoter Pnh~ncer~ the polyoma enh~cer on the late side o~
the replication origin, and adenovirus ~nh~ncers.
Generally, rero~b~n~nt expression vectors will include
origins of replication and selectable m~rke~s permitting
transformation of the host cell, e.g., the ampi~ ; n
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
promoters can be derived ~rom operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase ~PGK), ~-~actor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assem~led in d~' ~' iate
phase with translation initiation and termination sequences.
Optionally, the heterologous sequence can Pn~o~P a fusion
protein including an N-terminal i~Pnt;fication peptide
imparting desired characteristics, e.g., st~h;l~zation or
simplified puri~ication of expressed re~omh;n~nt product.
U~eful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable r~; ng phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
CA 02220670 l997~ll~lO
W 096/35703 PCTrUS95/05922
replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, S~lmnn~lla tYn~;ml-rium and various species
within the genera Psel-A~On~, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice.
As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived
from commPrcially available pl ~c,m;Ac comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, WI, USA). These pBR322 "backh~n~'l
sections are com.bined with an a~lu~riate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and
growth of the host strain to an ~lu~Liate cell density, the
selected promoter is induced by a~u~Liate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the resulting
crude extract re~inPA for further purification.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysing agents, such methods are well know to those skilled in
the art.
Various m~r~l;An cell culture systems can also be
employed to express recom.~inant protein. Examples of
m:~mm~l ian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
(1g81), and other cell lines c~p~hle of expressing a
-16-
CA 02220670 1997-11-10
W 096135703 PCTAUS95/05922
compatible vector, for example, the C127, 3T3, CHO, HeLa and
BHK cell lines. ~mm~ n expression vectors will comprise
an origin of replication, a suitable promoter and ~nh~ncer,
and also any necessary ribosome h; n~; ng sites,
~ polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5~ ~lanking
nontranscribed se~l~n~. DNA sequences derived from the
Sv40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic el~m~nts.
The polypeptide can be recovered and purified from
recombinant cell cultures by methods including Amm~;um
sulfate or ethanol precipitation, acid extraction, anion or
cation exchange chromatography, phosphocellulose
chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and
lectin chrom tography. Protein refolding steps can be used,
as necessary, in com.pleting configuration of the mature
protein. Finally, high perfon~ance liquid chromatography
(HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a
naturally purified product, or a product of chemical
synthetic procedures, or produced by recnmh; n~nt techniques
from a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and m~mm~ n cells in
culture). Depending upon thç host employed in a recn~h;n~nt
production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial
methionine amino acid residue.
The hIAP-1 polypeptides and ;nh; h; tory compounds,
described below, which are polypeptides may also be employed
in accordance with the present invention by expression of
such polypeptides in vivo, which is referred to as "gene
therapy.ll
CA 02220670 1997-11-10
W 096/35703 PCTnUS95/05922
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art and are apparent ~rom
the teachings herein. For example, cells may be engineered
by the use of a retroviral plasmid vector cont~n;ng RNA
encoding a polypeptide of the present invention.
S;m; 1 ~rly, cells may be engineered in vivo for
expression of a polypeptide in vivo by, for example,
procedures known in the art. For example, a packaginy cell
is transduced with a retroviral plasmid vector cont~;ning RNA
encoding a polypeptide of the present invention such that the
packaging cell now produces in~ectious viral particles
cont~;n~ng the gene of interest. These producer cells may be
~m;n; stered to a patient ~or engineering cells in vi~o and
expression of the polypeptide in vivo. These and other
methods for ~m; n; stering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the teachings of the pre~ent invention.
Retroviruses from which the retroviral plasmid vectors
her~;n~hove mentioned may be derived include, but are not
limited to, Moloney Murine Leukemia Virus, spleen necrosis
virus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia
virus, human ;mmllnodeficiency virus, adenovirus,
Myeloproli~erative Sarcoma Virus, and mammary tumor virus.
In one ~mhoA; m~nt, the retroviral plasmid vector is derived
from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited
to, the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechni~ues, Vol. 7, N0:9, 980-990 (1989), or any other
promoter (e.g., cellular promoters such as eukaryotic
-18-
CA 02220670 1997-11-10
WO 9613571~3 PCT/US95~05922
cellular promoters including, but not limited to, the
histone, pol III, and ~-actin promoters). Other viral
promoters which may be employed include, but are not limited
to, adenovirus promoters, thymidine kinase (TK) promoters,
and B19 parvovirus promoters. The selection of a suitable
promoter will be apparent to those skilled in the art from
~ the teachings contained herein.
The nucleic acid sequence encodiny the polypeptide of
the present invention is under the control of a suitable
promoter. Suitable promoters which may be employed include,
but are not limited to, adenoviral ~LG-I,oLers, such as the
adenoviral major late promoter; or heterologous promoters,
such as the cytomegalovirus (CMV) promoter; the respiratory
syncytial virus (RSV) promoter; ~ n~llr; hle promoters, such as
the MMT promoter, the metallothionein promoter; heat shock
promoters; the ~lhllm~ n promoter; the ApoAI promoter; human
globin promoters; viral thymidine kinase promoters, such as
the Herpes Simplex thymidine kinase ~l~.,.oLer; retroviral LTRs
(including the modified retroviral LTRs her~in~hnve
described); the ~-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter
which controls the gene ~ncoA; ng the polypeptide.
The retroviral plasmid vector is employed to transduce
packaging cell lines to form pro~llc~ cell lines. Examples
of packaging cells which may be transfected include, but are
not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X,
VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell
lines as described in Miller, Human Gene Thera~y, Vol. 1,
pgs. 5-14 (1990), which is incorporated herein by reference
in its entirety. The vector may transduce the packaging
cells through any means known in the art. Such means
include, but are not limited to, elect~ol~tion, the use of
liposomes, and CaPO4 precipitation. In one alternative, the
retroviral plasmid vector may be encapsulated into a
-19-
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
liposome, or coupled to a lipid, and then A~m~n~stered to a
host.
The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vi tro or in vivo . The transduced eukaryotic cells will
express the nucleic acid sequence(s) encoding the
polypeptide. Eukaryotic cells which may be transduced
include, but are not limited to, embryonic stem cells,
embryonic carc; n~ cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothel~Al cells, and bronrh;Al epithPl;Al cells.
Once the hIAP-1 polypeptide is being expressed intra-
cellularly via gene therapy, it may be employed to treat
neurodegenerative diseases caused by abnormal apoptosis of
neurons, for example, Al~hP~mP~'s disease and Parkinson's
disease.
hIAP-1 may also be employed to prevent cells from dying
during trauma such as head injury and strokes.
The hIAP-1 protein of the present invention may also be
employed to prevent abnormal apoptosis which leads to
rheumatoid arthritis.
hIAP-1 polypeptide may also be employed to prevent
oncogenesis which results frDm abnormal apoptosis.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides,
for in vitro purposes related to scientific research,
synthesis of DNA and manufacture of DNA vectors. For
example, the gene and gene product may be employed as a
research tool for discovering diagnostic and therapeutic
treatments for human disease and to shed light on the process
of apoptosis in hnm~n~
-20-
CA 02220670 1997-11-10
W O 96/3~703 PcTnuS95/05922
Fragments o~ the ~ull length hIAP-1 gene may be used as
a hybridization probe $or a cDNA library to isolate the ~ull
length hIAP-1 gene and to isolate other yenes which have a
high sequence s~m;l~3nity to the hIAP-1 gene or similar
biological activity. The probes are at least 20 bases in
length, preferably at least 30 and most preferably at least
50. The probe may also be used to identify a cDNA clone
corresponding to a full length transcript and a genomic clone
or clones that cont~; n the complete hIAP-1 gene including
regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of
the hIAP-1 gene ~y using the known DNA sequence to synthesize
an oligonucleotide probe. Labeled oligonucleotides having a
sequence complementary to that of the gene of the present
invention are used to screen a library of human cDNA, genomic
DNA or mRNA to determine which me~bPrs of the library the
probe hybridizes to.
This invention is also related to the use of the hIAP-1
gene as a ~ nostic. Detection of a mutated ~orm o~ hIAP-1
will allow a diagnosis of a disea~e or a susceptibility to a
disease which results from underexpression of hIAP-1.
Individuals carrying mutations in the human hIAP-1 gene
may be detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obt~;n~ from a patient's
cells, such as from blood, urine, sali~a, tissue biopsy and
autopsy material. The genomic DNA may be used directly for
detection or may be ampli~ied enzymatically by using PCR
(Saiki et al., Nature, 324:163-166 (1986)) prior to analy~is.
RNA or cDNA may also be used for the same purpose. As an
example, PCR primers complementary to the nucleic acid
encoding hIAP-l can be used to i-lPnt;fy and analyze hIAP-1
mutations. For example, deletions and insertions can be
detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be
identified by hybridizing amplified DNA to radiolabeled hIAP-
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
1 RNA or alternatively, radiolabeled hIAP-1 antisense DNA
se~l~nc~s. Perfectly matched sequences can be distinguished
from mismatched duplexes by RNase A digestion or by
differences in melting temperatures.
Sequence differences between the re~erence gene and
genes having mutations may be revealed by the direct DNA
se~l~nc;ng method. In addition, cloned DNA segments may be
employed as probes to detect specific DNA segments. The
sensitivity of this method is greatly ~nh~nc~d when co~h;n~
with PCR. For example, a se~l~nc;ng primer is used with
double-stranded PCR product or a single-stranded template
molecule generated by a modified PCR. The sequence
determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic se~l~nc;ng procedures
with fluorescent-tags.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be disting~ h~f~ on
denaturing foL,.~,~,ide gradient gels in which the mobilities of
different DNA fragments are retarded in the gel at different
positions according to their specific melting or partial
melting temperatures (see, e.g., Myers et al ., Science,
230:1242 (1985)).
Sequence changes at specific locations may also be
revealed by nuclease protection assays, such as RNase and S1
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA se~l~n~;ng or the use of
restriction enzymes, (e.g., Restriction Fragment Length
Polymorph;~ (RFLP)) and Sollth~r~ blotting of genomic DNA.
-22-
CA 02220670 1997-11-10
W 096135703 PCTrUS9510592Z
In addition to more conventional gel-electrophoresis and
DNA se~uencing, mutations can also be detected by in situ
analysis.
The present in~ention also relates to a diagnostic assay
~or detecting altered levels of hIAP-1 protein in various
tissues since an over-expression of the proteins compared to
normal control tissue samples can detect the presence of
conditions related to abnormally high apoptosis. Assays used
to detect levels of hIAP-1 protein in a sample derived from
a host are well-known to those of skill in the art and
include radio; ~lno~says, competitive -h; n~;ng assays,
Western Blot analysis and preferably an ELISA assay. An
ELISA assay initially comprises preparing an antibody
speci~ic to the hIAP-1 antigen, preferably a monoclonal
~nt, hody. In addition a reporter ~nt; ho~y is prepared
against the monoclonal antibody. To the reporter antibody is
attached a detectable reagent such as radioactivity,
fluorescence or in this example a horseradish peroxidase
enzyme. A sample is now lt,..o~ed from a host and incubated on
a solid support, e.g. a polystyrene dish, that binds the
proteins in the sample. Any free protein h; n~; ng sites on
the dish are then covered by incubating~with a non-specific
protein like BSA. Next, the monoclonal antibody is incubated
in the dish during which time the monoclonal antibodies
attach to any hIAP-1 proteins att~ ch~ tO the polystyrene
dish. All unbound monoclonal ~nt; hody iS ~ h~ out with
buffer. The ~e~olLer antibody linked to horser~i ch
peroxidase is now placed in the dish resulting in h; n~; ng of
the reporter antibody to any monoclonal antibody bound to
hIAP-1. Unattached reporter antibody is then w~ch~ out.
Peroxidase substrates-are then added to the dish and the
amount o~ color developed in a given time period is a
measurement of the amount of hIAP-1 protein present in a
given volume of patient sample when ~compared against a
stAn~rd curve.
-23-
CA 02220670 1997-11-10
W 096/35703 PCT/U~J'~5922
A competition assay may be employed wherein antibodies
specific to hIAP-1 is attached to a solid support and labeled
hIAP-1 and a sample derived from the host are passed over the
solid support and the amount of label detected attached to
the solid support can be correlated to a quantity of hIAP-l
in the sample.
This invention provides a method of screening compounds
to identify those which block the ;nh; h; tion of apoptosis by
hIAP-1. For example, SF-21 cells are trans~ected with a
known gene which causes apoptosis, for example, ~nn;h;l~tor
mutant DNA from vAcAnh or vP35Z. The compound to be tested
and hIAP are then r~nt~cted with the cell, either
intracellularly or extracellularly. A survey is then done of
the cells under a light microscope three to four days after
co-transfection, and the usual characteristics of an
apoptotic cell is checked and the ability of the compound to
prevent the action of hIAP is analyzed.
~ l1m~n IAP-1 is produced and functions intra-cellularly,
therefore, any ;nh; h; tory compounds must function intra-
cellularly. These c~"l~o~ds include antibodies which are
produced intracellularly. For example, an antibody
identified as ;nh; h; ting hIAP-l may be produced
intracellularly as a single chain antibody by procedures
known in the art, such as transforming the d~ u~liate cells
with DNA ~nco~;ng the single chain ~nt;hoAy to ~LeveL~t the
function of hIAP-l.
Another example is an antisense construct prepared using
antisense technology used to control gene expression through
triple-h~ formation or antisense DNA or RNA, both of which
methods are based on h; nrl;ng of a polynucleotide to DNA or
RNA. For example, the 5~ coding portion of the
polynucleotide sequence, which ~nco~s for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
-24-
CA 02220670 1997-11-10
W O ~6/35703 PCTAUS~5~'~5922
Complem-~nt~ry to a region o~ the gene involved in
transcription (triple helix -see hee et al., NUCl. Acids
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby
preventing transcription and the production o~ hIAP-1. The
antisense RNA oligonucleotide hybridizes to the mRNA in ~ivo
~ and blocks translation of the mRNA molecule into hIAP-1
polypeptide (Antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Tnh; h~ tors of Gene
Expression, CRC Press, Boca Raton, FL (1988)). The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed in
vivo to i nhi hi t production of hIAP-1.
Another example includes a mutated fonm, or mutein, of
hIAP-1 which recognizes hIAP-1 substrates but has ;mrA; red
function so as not to prevent apoptosis.
Another example i~ a small molecule which is able to
pass through the cell membrane and bind to hIAP-1 and prevent
its bioloyical activity. Examples of small molecules include
but are not limited to small peptides or peptide-like
molecules.
These compounds may be employed to inh;h;t the action of
hIAP-1 and prevent tumors since oncogenesis results when
cells ~ail to undergo apoptosis at the d~' ~liate time.
The action of hIAP-1 may also be ; nh; h;ted by these
c~...~o~lds for the promotion of cell development to allow
apoptosis to kill viral infected cells, and to stim~llAte
tissue differentiation and development. The compounds may
also be employed to ~-int~;n tissue homeostasis.
The cc...~o~lds may be employed in cQmh;n~tion with a
suitable pharmaceutical carrier. Such compositions comprise
a therapeutically effective amount of the co-l-~o~d, and a
pharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to ~Al ;ne, buffered
saline, dextrose, water, glycerol, ethanol, and ro~h;nAtions
-25-
CA 02220670 1997-11-10
W 096/3S703 PCTrUS95/05922
thereo~. The $onmulation should suit the mode of
A~m;n;StratiOn.
The invention also provides a pharmaceutical pack or kit
comprising one or more cont~;ners filled with one or more of
the ingredients of the pharmaceutical compositions of the
invention. Associated with such contA;n~r(s) can be a notice
in the form prescribed by a gover~m~nt~l agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects d~' ~val by the agency of
manufacture, use or sale for human A~m;n; ~tration. In
addition, the compounds may be employed in conjunction with
other therapeutic compounds.
The pharmaceutical composition~ may be A~; n;stered in
a convenient mAnn~r such as by the oral, topical,
intravenous, intraperitoneal, intramuscular, subclltAneous,
intrAnA~Al or intradermal routes. The pharmaceutical
compositions are A~m;n;stered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In general, they are A~; n;stered in an amount of at least
about 10 ~g/kg body weight and in most cases they will be
A~m;n;~tered in an amount not in excess of about 8 mg/Kg body
weight per day. In most cases, the dosage is from about 10
~g/kg to about 1 mg/kg body weight daily, taking into account
the routes of ~m;n;stration, symptoms, etc.
The se~lenc~fi of the present invention are also valuable
for chromosome identification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
need for i~nt;fying particular sites on the chromosome. Few
chromosome marking reagents based on actual se~uence data
(repeat polymorph;smc) are presently avA;l~hle for mArk;ng
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with genes associated with
disease.
CA 02220670 1997-11-10
W 096135703 PCTlUbgS~'v~922
Brie~ly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA.
Computer analysis of the 3' untranslated region o~ the gene
is used to rapidly select primers that do not span more than
one exon in the genomic DNA, thus complicating the
àmplification process. These primers are then used $or PCR
screening of somatic cell hybrids con~n~n~ individual human
chromosomes. Only those hybrids cont~;n~ng the human gene
corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublor~l~7~tion can be achieved with r~n~ls of
fra~ent~ ~rom speci~ic chromosomes or pools of large genomic
clones in an analogous ~nn~r Other mapping strategies that
can s~m~l~ly be used to map to its chromosome include in
situ hybridization, prescreening with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
clone to a met~ph~se chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., ~n~-n
a~o..~osomes: a M~nll~l of Basic Techniques, Pe~y~ l Press,
New York ~1988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are ~ound, for example, in V. McKusick, M~n~eli~n
Inheritance in Man (available on line tl~ouyll Johns Hopkins
University Welch Medical Library). The relatio~ch~r between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
-27-
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between a~ected and una~fected
individuals. If a mutation is observed in some,or all of the
affected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
of between 50 and 500 pot~nt;;7l causative genes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb).
The polypeptides, their frar3mpnt~ or other derivatives,
or analogs thereof, or cells expressing them can be used as
an ;mmnnogen to produce ;7nt;ho~7;es thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes çh;m-ric, single chain,
and hllm-7n;zed ;7n~;ho~7;es, as well as Fab frA~r~nt.c, or the
product of an Fab expression library. Various procedures
known in the art m.ay be used for the production of such
;7nt;hodies and fragments.
~ nt;ho~;es generated against the polypeptides
corresponding to a sequence o~ the present invention can be
obtA; n~7 by direct injection of the polypeptides into an
~7n;m~-l or by r7r7m~n~tering ,the polypeptides to an ,7n;m-7l,
preferably a n9nhllm7n. The Ant;ho~7y so obt;7;n~7 will then
bind the polypeptides itself. In this m;7nn~r, even a
sequence encoding only a fragment of the polypeptides can,be
used to generate ~nt;hodies h; n~7.;ng the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal ~nt;ho~7;es, any technique
which provides ;7nt;hodies produced by cont~nl70us cell line
cultures can be used. Examples include the hybridoma
technique (~ohler and Milstein, 1975, Nature, 256:495-497),
-28-
CA 02220670 1997-11-10
W 096J35703 PCTAUS95/05922
the trioma technique, the human B-cell hybridoma technique
(Kozbor et al., 1983, Tmmllnology Today 4:72), and the EBV-
hybridoma technique to produce human monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and ~Anc~r
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
t antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to ;~m~ln~enic polypeptide products
o~ this invention. Also, transgenic An;mAls may be used to
express hllm~n~zed Ant;hodies to ;mmllnogenic polypeptide
products of this invention.
The present invention will be further de8cribed with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate understAn~i ng of the following
examples certain frequently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or n~lmh~rs The
starting plasmids herein are either c~ e~cially av~;l Ahl e,
publicly aVAilAhle on an unrestricted basis, or can be
constructed $rom avA;lAhle plasmids in accord with pllhl;~h~
procedures. In addition, equivalent pl~s; ~ to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are c~Qrcially aVA;lAhle and their reaction
conditions, cofactors and other requirements were used as
would be known to the ordinarily skilled artisan. For the
purpose of isolating DNA $ragments for plasmid construction,
typically S to 50 ~g of DNA are digested with 20 to 250 units
-29-
CA 02220670 1997-11-10
WO 96/35703 PCTrUS95/05922
of enzyme in a larger volume. A~o~iate buffers and
substrate amounts for particular restriction enzymes are
specified by the manufacturer. Incubation times of about 1
hour at 37 C are ordinarily used, but may vary in accordance
with the supplier~s instructions. A~ter digestion the
reaction is electrophoresed directly on a polyacrylamide gel
to isolate the desired fragment.
Size separation of the cleaved fra~m~nt~ is per~ormed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complPm~nt~ry polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without ~ ng a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
"Ligationn refer~ to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accompl~shl~ u~ing known
buffers and conditions with 10 units of T4 DNA ligase
("ligase") per 0.5 ~g of approximately equimolar amounts of
the DNA fra_ - ts to be ligated.
Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
ExamPle 1
Bacterial Ex~ression and Purification of hIAP-1
The DNA sequence encoding hIAP-1, ATCC # , is
initially amplified using PCR oligonucleotide primers
correspon~ng to the 5' and 3' end ~equences of the processed
hIAP-1 gene (minus the signal peptide sequence) and the
vector sequences 3' to the hIAP-1 gene. Additional
-30-
CA 02220670 1997-11-10
W 096135703 PCT~US95/05922
nucleotides corresponding to hIAP-1 are added to the 5~ and
3' sequences respectively. The 5' oligonucleotide primer has
the sequence 5~ GATCGGATCCATGAGTACTGA~GAAGCC~G 3~ (SEQ ID
NO:3) co~t~;n~ a BamHI restriction enzyme site ~ollowed by 20
nucleotides of hIAP-1 ro~; ng sequence starting from the
presumed terminal amino acid o~ the processed protein. The
3~ sequence 5~ GACTGGAl~-l~-l-l-lA~G~G~ATGTACG 3~ (SEQ ID
NO:4) contains complen-nt~ry sequences to a BamHI site. The
restriction enzyme sites correspond to the restriction enzyme
sites on the bacterial expression vector pQE-9 (Qiagen, Inc.
Chatsworth, CA). pQE-9 Pnco~Pc ~nt;h~otic resistance ~Ampr),
a bacterial origin of replication (ori), an IPTG-regulatable
promoter operator (P/O), a ribosome h;n~;ng site (R8S), a 6-
His tag and restriction enzyme sites. pQE-9 is then digested
with BamHI and dephosphorylated. The ampli~ied se~l~n~s are
ligated into pQE-9 and are inserted in frame with the
sequence ~nro~ng for the hist~ne tag and the RBS. The
ligation mixture is then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in
Sambrook, J. et al., Molecular Cloning: A Laboratory ~n
Cold Spring Laboratory Press, (1989). M15/rep4 cont~;n~
multiple copies of the plasmid pREP4, which expresses the
lacI repressor and also con~ers kanamycin resistance (Kan').
Transformants are identified by their ability to grow on L8
plates and ampicillin/kanamycin resistant colonies are
selected. Plasmid DNA is isolated and confirmed by
restriction analysis. Clones con~;n;ng the desired
constructs are grown overnight (O/N) in liquid culture in LB
media supplemented with both Amp (100 ug/ml) and Xan (25
ug/ml). The O/N culture is used to inoculate a large culture
at a ratio of 1:100 to 1:250. The cells are grown to an
optical density 600 (O.D.~) o~ between 0.4 and 0.6. IPTG
(''Is~lo~yl-B-D-thiogalacto pyranoside") is th~n ~ to a
final conc~ntration of 1 mM. IPTG induces by inactivating
the lacI repressor, clearing the P/O l~;ng to increased
CA 02220670 1997-11-10
W 096135703 PCTrUS95/05922
gene e~pression. Cells are grown an extra 3 to 4 hours.
Cells are then harvested by centrifugation. The cell pellet
is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
A$ter clari~ication, solubilized hIAP-1 protein is purified
from this solution by chromatography on a Nickel-Chelate
column under conditions that allow for tight h; ncl;ng by
proteins cont~n;ng the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). hIAP-1 (50~ pure) is
eluted from the column in 6 molar guanidine HCl pH 5.0 and
for the purpose of renaturation adjusted to 3 molar guanidine
HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced)
and 2 mmolar glutathione (oxidized). After incubation in
this solution $or 12 hours the protein i~ dialyzed to 10
mmolar sodium phosphate.
Example 2
Cloninq and exPression of hIAP-1 usinq the baculovirus
exPression system
The DNA sequence encoding the full length hIAP-1
protein, ATCC # , is amplified using PCR oligonucleotide
primers correspon~ng to the 5' and 3' end se~l~nc~C of the
gene:
The 5' primer has the sequence 5' GCA6A~ AGATCTGG
TCACCATGAGTACTG 3' (SEQ ID NO:5) and cont~inc a BglII
restriction enzyme site (in bold) followed by 25 nucleotides
res~mhl~ng an efficient signal for the initiation of
translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950 (1987) which is just behind the hIAP-1 gene (the
initiation codon for translation "ATG" is underlined).
The 3~ primer has the sequence 5' GCAGA~ l-lAAGAGAGAAA
TGTACG 3' (SEQ ID NO:6) and contains the cleavage site for
the restriction ~n~nnl~clease BglII and 19 nucleotides
complem~nt~y to the 3' non-translated sequence of the hIAP-1
gene. The amplified sequence~ are isolated from a 1~ agarose
gel using a commercially available kit ("Geneclean," BIO 101
Inc., La Jolla, Ca.). The ~ragment is then digested with the
-32-
CA 02220670 1997-11-10
W 096/35703 PCTnUS95/05922
~n~nnrlease BglII and then puri~ied again on a 1~ agaro~e
gel. This ~ragment is designated F2.
The vector pRG1 (modi~ication o~ pVL941 vector,
discussed below) is used for the expression o~ the hIAP-1
- protein using the baculovirus expression system (for review
see: Summers, M.D. and Smith, G.E. 1987, A ~-n~ l o~ methods
for baculovirus vectors and insect cell culture procedures,
Texas Agricultural Exper;~n~l Station Bulletin NO:1555).
This expression vector cont~;nc the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
virus ~AcMNPV) ~ollowed by the recognition sites for the
restriction ~n~nnllclea~e BamHI. The polyadenylation site of
the simian virus (SV)40 is used for efficient
polyadenylation. For an easy selection of reromh;n~nt virus
the beta-galactosidase gene from E.coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal o$ the polyhedrin gene. The
polyhedrin sequences are flanked at both sides by viral
se~l~nce for the cell-mediated homologous reC~mh;n~tion of
cotransfected wild-type viral DNA. Many other baculovirus
vectors could be used in place of pRG1 such as pAc373, pVL941
and pAcIM1 ~Luckow, V.A. and Summers, M.D., Virology, 170:31-
39)-
The pl~cm;~ is digested with the restriction enzyme
BamHI and dephosphorylated using calf intestinal phosphatase
by procedures known in the art. The DNA is then isolated
from a 1% agarose gel using the co~cially available kit
(~Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA
is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are
ligated with T4 DNA ligase. E.coli B 101 cells are then
transformed and bacteria identified that cont~;ne~ the
plasmid (pBac hIAP-1) with the hIAP-l gene in the correct
orientation using PCR. The se~uence of the cloned fragment
is confirmed by DNA se~l~nC~ n~ .
CA 02220670 1997-11-10
W 096/35703 PCTrUS9~/05922
5 ~g of the plasmid pBac hIAP-1 is cotransfected with
1.0 ~g of a commercially av~ hl e l~np~rized baculovirus
("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.)
using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g o~ BaculoGold~ virus DNA and 5 ~g of the plasmid
pBac hIAP-1 are m~eA in a sterile well of a microtiter plate
~ont~n~ng 50 ~l of serum free Grace~s medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l
Lipofectin plus 90 ~l Grace's medium are added, mixed and
incubated ~or 15 minutes at room temperature. Then the
transfection mixture is added drop-wise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with 1 ml Grace's medium without serum. The plate is rocked
back and forth to mix the newly added solution. The plate is
then incubated for 5 hours at 27~C. After 5 hours the
transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum
iS A AA~A, The plate is put back into an incubator and
cultivation cont~nlleA at 27~C for four days.
After four days the supernatant is collected and a
plaque assay performed s~m;l~r as described by Summers and
Smith (supra). AS a modification an agarose gel with ~Blue
Gal" (Life Technologies Inc., Gaithersburg) is used which
allows an easy isolation of blue st~n~A plaques. (A
detailed de~cription of a "plaque assay" can also be ~ound in
the user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution, the virus is ~AAeA
to the cells and blue st~n~ plaques are picked with the tip
of an Eppendorf pipette. The agar cont~;n~ng the recomh;n~nt
viruses is then resuspended in an Eppendorf tube c~nt~t n~ ng
200 ~l of Grace's medium. The agar is removed by a brief
centrifugation and the supernatant cont~n~ng the recorhtn~nt
-34-
CA 02220670 1997-11-10
W 096/35703 PCT/U~gS~5922
baculovirus is used to in~ect S~9 cells seeded in 35 mm
dishes. Four days later the supernatant~ of these culture
dishes are harvested and then stored at 4~C.
S~9 cells are grown in Grace's medium supplemented with
10~ heat-inactivated FBS. The cells are infected with the
recomh;n~nt baculovirus V-hIAP-1 at a multiplicity of
infection (MOI) of 2. Six hours later the medium is removed
and replaced with SF900 II medium minus methionine and
cysteine (Life Technologies Inc., Gaithersburg, MD). 42
hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine
(Amersham) are added. The cells are further incubated for 16
hours be~ore they are harvested by centrifugation and the
labelled proteins visualized by SDS-PAGE and autoradiography.
ExamPle 3
ExPression of Recomh;n~nt hIAP-1 in COS cells
The expression of plasmid, hIAP-1 HA is derived from a
vector pcDNAI/Amp (Invitrogen) cont~;n;ng: 1) SV40 origin of
replication, 2) ampic;ll ;n resistance gene, 3) E.coli
replication origin, 4) CMV promoter followed by a polyl;nk~
region, an SV40 intron and polyadenylation site. A DNA
fragment encoding the entire hIAP-1 precursor and a HA tag
fused in frame to its 3' end is cloned into the polyl; nker
region of the vector, therefore, the recombinant protein
expression is directed under the CMV promoter. The HA tag
corresponds to an epitope derived from the influenza
hemagglllt~n;n protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Tern~,
1984, Cell 37:767, (1984)). The infusion of HA tag to the
target protein allows easy detection of the recomh;n~nt
protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as
~ollows:
The DNA sequence encoding hIAP-1, ATCC # , is
constructed by PCR using two primers: the 5' primer 5'
GCAGATCTGCAATGAGTACTGAAGAAGCC 3~ (SEQ ID NO:7) ~ont~;n~ a
-35-
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
BglII site followed by 21 nucleotides o~ hIAP-1 coding
seguence starting from the initiation codon; the 3' sequence
5~ GCAGAl~-l-l~AAGCGTA~l~-l~GGA~l~lATGGGTAAGAGAGA~ATGT
ACGAACAGT 3' (SEQ ID NO:8) cont~;ns compl~ment~ry se~l~nce~
to a BglII site, translation stop codon, HA tag and the last
21 nucleotides of the hIAP-1 coding sequence (not including
the stop codon). Therefore, the PCR product cont~;n~ a BglII
site, hIAP-1 co~;ng sequence followed by HA tag fused in
frame, a translation termination stop codon next to the HA
tag, and a BglII site. The PCR amplified DNA fragment is
digested with BglII and the vector, pcDNA1/Amp digested with
BamHI restriction enzyme are ligated. The ligation mixture is
transformed into E. coli strain XL-1-Blue (Stratagene Cloning
Systems, La Jolla, CA) the transformed culture is plated on
ampi~ n media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and ~min~d by
restriction analysis for the presence of the correct
fragment. For expression of the reco~h;n~n~ hIAP-1, COS
cells are transfected with the expression vector by DEAE-
DEXTRAN method (J. Sa~ ook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory ~nll~l, Cold Spring
Lahoratory Press, (1989)). The expression of the hIAP-1 HA
protein is detected by radiolah~ll;ng and ~ noprecipitation
method (E. Harlow, D. Lane, Antibodies: A Laboratory ~nn~l,
Cold Spring ~rhor Laboratory Press, (1988)). Cells are
l~helled for 8 hours with 35S-cysteine two days post
trans~ection. Culture media is then collected and cells are
lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40,
0.1~ SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I.
et al., Id. 37:767 (1984)). Both cell lysate and culture
media are precipitated with an HA specific monoclonal
~n~;ho~y. Proteins precipitated are analyzed on 15% SDS-PAGE
gels.
Exa~ le 6
Ex~ression o~ hIAP-1 ~ia Gene Therapy
-36-
CA 02220670 1997-11-10
W O 96/35703 PCTAUS95/05922
Fibroblasts are obtA~nP~ ~rom a subject by skin
biopsy. The resulting tissue is placed in tissue-culture
medium and separated into small pieces. Small chunks of the
tissue are placed on a wet surface of a tis~ue culture flask,
approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room
~ temperature over night. After 24 hours at room temperature,
the flask is inverted and the chunks of tissue rem.ain fixed
to the bottom of the flask and fresh media (e.g., Ham~s F12
me~; ~A, with 10% FBS, penic;ll; n and streptomycin, is a~e~.
This is then incubated at 37~C for a~roximately one week.
At this time, ~resh ~ is added and subsequently changed
every several days. After an additional two weeks in
culture, a monolayer of fibroblasts emerge. The monolayer is
trypsinized and scaled into laryer flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with calf intestinal phosphatase. The
l;nPA~ vector is fractionated on agarose gel and purified,
using glass beads.
The cDNA Pnro~;ng a polypeptide of the present invPnt;on
is amplified using PCR primers which correspond to the 5' and
3' end se~lpnrp~c respectively. The 5~ primer contA;n;ng an
EcoRI site and the 3' primer having ront~A;nC a HindIII site.
Equal quantities of the Moloney murine sarcoma virus l; neA~
hAckhonP and the EcoRI and HindIII ~ragment are A~P~
together, in the presence of T4 DNA ligase. The resulting
mixture is m~;ntA;ne~ under conditions a~Liate for
ligation of the two fra~mPntc. The ligation mixture is used
to transform bacteria B 101, which are then plated onto agar-
c~ntA;n;ng kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+am.12 packaging cells are
yLo~ n in tissue culture to confluent density in Dulbecco's
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
Modi~ied Eagles Medium (DMEM) with 1096 cal~ ~;erum (CS),
penicillin and streptomycin. The MSV vector cont~;ning the
gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
infectious viral particles cont~;n~ng the gene (the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells,
and subsequently, the media is harvested from a 10 cm plate
o~ confluent producer cells. The spent media, cont~;n~ng the
infectious viral particles, is fil~ered through a millipore
~ilter to remove detached producer cells and this media is
then used to infect fibroblast cells. Media is removed from
a sub-confluent plate of fibroblasts and quickly replaced
with the media from the producer cells. This media is
,oved and replaced with ~resh media. If the titer of virus
is high, then virtually all fibroblasts will be infected and
no selection is required. If the titer is very low, then it
is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injected into the
host, either alone or a~ter having been grown to confluence
on cytodex 3 microcarrier beads. The fibroblasts now produce
the protein product.
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the
invention may be practiced otherwise than as particularly
described.
-38-
CA 02220670 1997-11-10
W 096135703 PCT~US95/05922
~U~N~ LISTING
(1) ~N~R ~L INFORMATION:
(i) APPLICANT: HE, ET AL.
(ii) TITLE OF lNv~NllON: Human Inhibitor of Apoptosi~
Gene 1
(iii) N ~3ER OF SEQU~S: 8
(iv) CORRESPONDBNCE ~nn~ s:
(A) ~nnR~SEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART ~ OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) ~O~ : USA
(F) ZIP: 07068
(v) CO~U1~K READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DIS
(B) COM~ul~K: IBM PS/2
(C) OPERATING ~;y~ : MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(vi) CURR~NT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Concurrently
(C) CLASSIFICATION:
~vii) PRIOR APPLICATION DATA
(A) APPLICATION N~MBER:
(B) FILING DATE:
(viii) AllO~N~:Y/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET N~MBER: 325800-292
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQU~N~ CHARACTERISTICS
(A) LENGTH: 1435 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
-39-
CA 02220670 1997-11-10
W 096/35703 PCTrUS95/05922
(ii) MOLECULE TYPE: cDNA
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:1:
AGTTATGCAA TGAGTACTGA AGAAGCCAGA ~Ll l~l 1ACCT ACCATATGTG GCCATTAACC 60
'llLll~l~AC CATCAGAATT GGr~Ar.~r.CT ~lll-L-lATT AT~T~r~rArC TGGAGATAGG 120
GTAGCCTGCT TTGCCTGTGG TGGGAAGCTC AGTAACTGGG AArrAA~GGA TGATGCTATG 180
TrAr-AArArC GGAGGCATTT TCCCAACTGT CCA11111GG AAAATTCTCT ArAA~rTCTG 240
AGGTTTAGCA TTTCAAATCT GAGCATGCAG ACACATG QG CTCGAATGAG AACATTTATG 300
TA~1GGC~AT CTAGTGTTCC AGTTCAGCCT GAGCAGCTTG CAA~1G~1GG TTTTTATTAT 360
~1GG~1CG~A ATGATGATGT CAAATGCTTT 1 ~L ~ ~ ~ ~ATG GTGGCTTGAG ~1~11GG~AA 420
TCTGGAGATG ATCCATGGGT Ar.~Ar~TGCC AA~1~111C CAAG~l~l~A ~l~ll~ATA 480
CGAATGA~AG GCCAAGAGTT TGTTGATGAG ATTCAAGGTA GATATCCTCA L~ . l'~L-l~AA 540
QG~1~11~1 CAACTTCAGA TACCACTGGA rAAr.AA~ATG CTr.ArCrArC AATTATTCAT 600
TTTGGACCTG r~ArAAAr~TTC TTrAr-AArAT G~ ATGA TrAATArArC l~lG~;llA~A 660
TCTGCCTTGG AAATGGGCTT T~ATAr.Ar.Ar ~1G~1~AAAC A~ACAGTTCA AAGTA~AATC 720
CTGACAACTG GAGAGAACTA TAAA~rAr.TT AATGATATTG TGTCAGCACT TCTTAATGCT 780
GAAGATGAAA AAAr.Ar~rA Gr.ArA~r.AA AAArAArCTG AAGAAATGGC ATCAGATGAT 840
TTGTCATTAA TTCGr.~ArA~ CAGAATGGCT ~1~111~AAC AATTGACATG ~L~1~1~C~1 900
A1C~ ATA A1~L111A~A GGCCAATGTA ATTAATAA~r Arr.AArATGA TATTATTAAA 960
CAAAAAACAC AGATACCTTT ACAAGCGAGA GAACTGATTG AT~CrATTTT GGTTAAArrA 1020
AATGCTGCGG CCAACATCTT r~AAAArTGT CTAAAArAAA TTGACTCTAC ATTGTATAAG 1080
AACTTATTTG Tr,r~ATA~rAA TATGAAGTAT ATTCCAACAG AAGATGTTTC AG~1~1~1~A 1140
CTGGAAGAAC AATTGAGGAG GTTGCAAGAA rAACr~AArTT GTA~AGTGTG TATGr-ArAA~ 1200
GAA~111~1G TTGTATTTAT lC~ll~l~l CAl~lG~lAG TATGCCAGGA A1~1GCCC~1 1260
TCTCTAAGAA AATGCCCTAT TTGCAGGGGT ATAATCAAGG GTA~L~11CG TACATTTCTC 1320
TCTTAAAGAA AAATAGTCTA TATTTTAACC Tr,rATAAAA~ llA~A ATA11~11~A 1380
ACACTTGAAG CCATCTAAAG TA~AAGGr.A ATTATGAGTT TTTCAATTAG TAACA 1435
(2) INFORMATION FOR SEQ ID NO:2:
(i) SE~u~N~ CHARACTERISTICS
(A) LENGTH: 438 AMINO ACIDS(B) TYPE: AMINO ACID
(C) STRAND~n~.~.~
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) ~QU~l~ DESCRIPTION: SEQ ID NO:2:
Met Ser Thr Glu Glu Ala Arg Phe Leu Thr Tyr His Met Trp Pro
- 10 15
Leu Thr Phe Leu Ser Pro Ser Glu Leu Ala Arg Ala Gly Phe Tyr
Tyr Ile Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly
Lys Leu Ser Asn Trp Glu Pro Lys Asp Asp Ala Met Ser Glu His
Arg Arg His Phe Pro Asn Cys Pro Phe Leu Glu Asn Ser Leu Glu
Thr Leu Arg Phe Ser Ile Ser Asn Leu Ser Met Gln Thr His Ala
Ala Arg Met Arg Thr Phe Met Tyr Trp Pro Ser Ser Val Pro Val
100 105
Gln Pro Glu Gln Leu Ala Ser Ala Gly Phe Tyr Tyr Val Gly Arg-
110 115 120
Asn Asp Asp Val Lys Cys Phe Cys Cys Asp Gly Gly Leu Arg Cys
125 130 135
-40-
CA 02220670 1997-11-10
W 096135703 PCT~US95/~59ZZ
Trp Glu Ser Gly Asp Asp Pro Trp Val Glu His Ala Lys Trp Phe
140 145 150
Pro Arg Cys Glu Phe Leu Ile Arg Met Lys Gly Gln Glu Phe Val
155 160 165
Asp Glu Ile Gln Gly Arg Tyr Pro His Leu Leu Glu Gln Leu Leu
170 175 180
-Ser Thr Ser Asp Thr Thr Gly Glu Glu Asn Ala Asp Pro Pro Ile
185 190 195
Ile His Phe Gly Pro Gly Glu Ser Ser Ser Glu Asp Ala Val Met
~200 205 210
Met Asn Thr Pro Val Val Lys Ser Ala Leu Glu Met Gly Phe Asn
215 220 225
Arg Asp Leu Val Lys Gln Thr Val Gln Ser Lys Ile Leu Thr Thr
230 235 240
Gly Glu Asn Tyr Lys Thr Val Asn Asp Ile Val Ser Ala Leu Leu
245 250 255
A~n Ala Glu Asp Glu Lys Arg Glu Glu Glu Lys Glu Lys Gln Ala
260 265 270
Glu Glu Met Ala Ser Asp Asp Leu Ser Leu Ile Arg Lys Asn Arg
275 280 285
Met Ala Leu Phe Gln Gln Leu Thr CYB Val ~eu Pro Ile Leu Asp
290 295 300
Asn Leu Leu Lys Ala A~n Val Ile Asn Lys Gln Glu His Asp Ile
305 310 315
Ile Lys Gln Lys Thr Gln Ile Pro Leu Gln Ala Arg Glu Leu Ile
320 325 330
Asp Thr Ile Leu Val Lys Gly Asn Ala Ala Ala Asn Ile Phe Lys
335 340 345
Asn Cys Leu Lys Glu Ile Asp Ser Thr Leu Tyr Lys Asn Leu Phe
350 355 360
Val Asp Lys Asn Met Lys Tyr Ile Pro Thr Glu Asp Val Ser Gly
365 370 375
Leu Ser Leu Glu Glu Gln Leu Arg Arg Leu Gln Glu Glu Arg Thr
380 385 390
Cys Lys Val Cys Met Asp Lys Glu Val Ser Val Val Phe Ile Pro
395 400 405
Cys Gly His Leu Val Val Cys Gln Glu Cys Ala Pro Ser Leu Arg
410 415 420
Lys Cys Pro Ile Cys Arg Gly Ile Ile Lys Gly Thr Val Arg Thr
425 430 435
Phe Leu Ser
(2) INFORMATION FOR SEQ ID NO:3:
(i) S~:QU~N~ CH~RACTERISTICS
(A) L~l~: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) sTRAND~n~s SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SE~u~N~ DESCRIPTION: SEQ ID NO:3:
-41-
CA 02220670 1997-11-10
W 096135703 PCTrUS95/05922
GATCGGATCC ATGAGTACTG AAGAAGCCAG 30
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQu~N~ CHARACTERISTICS
(A) LENGTH: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAND~n~: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:4:
GACTGGATCC TCTTTA~GAG AGAAATGTAC G 31
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: 32 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAND~n~!~: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) S~Q~N~ DESCRIPTION: SEQ ID NO:5:
GCAGATCTGT AGAT~Lw L~A CCATGAGTAC TG 32
(2) INFORMATION FOR SEQ ID NO:6:
(i) ~Qu~N-CE CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAND~n~-~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:6:
GCAGATCTTT AAGAGAGAAA TGTACG 26
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 29 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
-42-
CA 02220670 1997-11-10
W 096/35703 PCT/US95/05922
(xi) ~Qu~N~ DESCRIPTION: SEQ ID NO:7:
GCAGATCTGC AATGAGTACT GAAGAAGCC 29
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: 59 BASE PAIRS
(B) TYPE: NUCLEIC ACID
~ (C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
~ (ii) MOLECULE TYPE: Oligonucleotide
(xi) ~Qu~ DESCRIPTION: SEQ ID NO:8:
GCAGATCTTC AAGCGTAGTC TGGGACGTCG TATGGGTAAG ArAr~AA~TGT ACGAACAGT 59
-43-
