Note: Descriptions are shown in the official language in which they were submitted.
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
XUMAN G-PROTEIN COUPLED RECEPTOR (HETGQ23)
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention are human 7-
transmembrane receptors. The invention also relates to
inhibiting the action of such polypeptides.
It is well established that many medically significant
biological processes are mediated by proteins participating
in signal transduction pathways that involve G-proteins
and/or second mes~engers, e.g., cAMP (Lefkowitz, Nature,
351:353-354 (1991)). Herein these proteins are referred to
a~ proteins participating in pathways with G-proteins or PPG
proteins. Some examples of these proteins include the GPC
receptors, such as those for adrenergic agents and dopamine
(Kobilka, B.K., et al., PNAS, 84:46-50 (1987); Kobilka, B.K.,
et al., Science, 238:650-656 (1987); Bunzow, J.R., et al.,
Nature, 336:783-787 (1988)), G-proteins themselves, effector
proteins, e.g., phospholipase C, adenyl cyclase, and
phosphodiesterase, and actuator proteins, e.g., protein
~ kinase A and protein k nase C (Simon, M.I., et al., Science,
252:802-8 (1991)).
.
--1--
CA 02220978 1997-11-13
W O 96/39436 PCT~US95107137
For example, in one ~orm o~ signal transduction, the
e~ect o~ hormone binding is activation o~ an enzyme,
adenylate cyclase, inside the cell. Enzyme activation by
hormones is dependent on the presence o~ the nucleotide GTP,
and GTP also in~luences hormone binding. A G-protein
connects the hormone receptors to adenylate cyclase. G-
protein was shown to exchange GTP ~or bound GDP when
activated by hormone receptors. The GTP-carrying ~orm then
binds to an activated adenylate cyclase. Hydrolysis o~ GTP
to GDP, catalyzed by the G-protein itsel~, returns the G-
protein to its basal, inactive ~orm. Thus, the G-protein
serves a dual role, as an intermediate that relays the signal
~rom receptor to e~ector, and as a clock that controls the
duration o~ the signal.
The membrane protein gene super~amily o~ G-protein
coupled receptors has been characterized as having seven
putative transmembrane domains. The domains are believed to
represent transmembrane ~-helices connected by extracellular
or cytoplasmic loops. G-protein coupled receptors include a
wide range of biologically active receptors, such as hormone,
viral, growth ~actor and neuroreceptors.
G-protein coupled receptors have been characterized as
including these seven conserved hydrophobic stretches o~
about 20 to 30 amino acids, connecting at least eight
divergent hydrophilic loops. The G-protein ~amily o~ coupled
receptors includes dopamine receptors which bind to
neuroleptic drugs used ~or treating psychotic and
neurological disorders. Other examples o~ members o~ this
~amily include calcitonin, adrenergic, endothelin, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, histamine,
thrombin, kinin, ~ollicle stimulating hormone, opsins,
endothelial di~erentiation gene-1 receptor, rhodopsins,
odorant, cytomegalovirus receptors, etc.
Most G-protein coupled receptors have single conserved
cysteine residues in each o~ the ~irst two extracellular
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
loops which ~orm disul~ide bonds that are believed to
stabilize ~unctional protein structure. The 7 transmembrane
regions are designated as TMl, TM2, TM3, TM4, TM5, TM6, and
TM7. TM3 has been implicated in signal transduction.
Phosphorylation and lipidation (palmitylation or
~arnesylation) of cysteine residues can in~luence signal
transduction o~ some G-protein coupled receptors. Most G-
protein coupled receptors contain potential phosphorylation
sites within the third cytoplasmic loop and/or the carboxy
terminus. For several G-protein coupled receptors, such as
the ~-adrenoreceptor, phosphorylation by protein kinase A
and/or specific receptor kinases mediates receptor
desensitization.
For some receptors, the ligand binding sites o~ G-
protein coupled receptors are believed to comprise a
hydrophilic socket formed by several G-protein coupled
receptors transmembrane domains, which socket is surrounded
by hydrophobic residues of the G-protein coupled receptors.
The hydrophilic side o~ each G-protein coupled receptor
transmembrane helix is postulated to ~ace inward and ~orm the
polar ligand binding site. TM3 has been implicated in
several G-protein coupled receptors as having a ligand
binding site, such as including the TM3 aspartate residue.
Additionally, TM5 serines, a TM6 asparagine and TM6 or TM7
phenylalanines or tyrosines are also implicated in ligand
binding.
G-protein coupled receptors can be intracellularly
coupled by heterotrimeric G-proteins to various intracellular
enzymes, ion channels and transporters (see, Johnson et al.,
Endoc., Rev., 10:317-331 (1989)). Di~erent G-protein ~-
subunits pre~erentially stimulate particular ef~ectors to
modulate various biological ~unctions in a cell.
Phosphorylation o~ cytoplasmic residues of G-protein coupled
receptors have been identi~ied as an important mechanism ~or
the regulation of G-protein coupling o~ some G-protein
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
coupled receptors. G-protein coupled receptors are found in
numerous sites within a m~m~l ian host.
In accordance with one aspect of the present invention,
there are provided novel polypeptides as well as biologically
active and diagnostically or therapeutically useful fragments
and derivatives thereof. The polypeptides of the present
invention are of human origin.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
encoding the polypeptide of the present invention including
mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs
thereof and biologically active and diagnostically or
therapeutically useful fragments thereof.
In accordance with a further aspect of the present
invention, there is provided a process for producing such
polypeptides by recombinant techniques which comprises
culturing recombinant prokaryotic and/or eukaryotic host
cells, containing a nucleic acid sequence encoding a
polypeptide of the present invention , under conditions
promoting expression of said polypeptide and subsequent
recovery of said polypeptide.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
In accordance with another aspect of the present
invention there are provided methods of screening for
compounds which bind to and activate or inhibit activation of
the receptor polypeptides of the present invention and for
receptor ligands.
In accordance with still another embodiment of the
present invention there is provided a process of using such
activating compounds to stimulate the receptor polypeptide of
the present invention for the treatment of conditions related
to the under-expression of the G-protein coupled receptors.
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
In accordance with another aspect of the present
invention there is provided a process of using such
inhibiting compounds for treating conditions associated with
over-expression of the G-protein coupled receptors.
In accordance with yet another aspect of the present
invention there is provided non-naturally occurring
~ synthetic, isolated and/or recombinant G-protein coupled
receptor polypeptides which are fragments, consensus
fragments and/or sequences having conservative amino acid
substitutions, of at least one transmembrane ~o~; n of the G-
protein coupled receptor of the present invention, such that
the receptor may bind G-protein coupled receptor ligands, or
which may also modulate, quantitatively or qualitatively, G-
protein coupled receptor ligand binding.
In accordance with still another aspect of the present
invention there are provided synthetic or recombinant G-
protein coupled receptor polypeptides, conservative
substitution and derivatives thereof, antibodies, anti-
idiotype antibodies, compositions and methods that can be
useful as potential modulators of G-protein coupled receptor
function, by binding to ligands or modulating ligand binding,
due to their expected biological properties, which may be
used in diagnostic, therapeutic and/or research applications.
It is still another object of the present invention to
provide synthetic, isolated or recombinant polypeptides which
are designed to inhibit or mimic various G-protein coupled
receptors or ~ragments thereof, as receptor types and
subtypes.
In accordance with yet a further aspect of the present
invention, there is also provided diagnostic probes
comprising nucleic acid molecules of sufficient length to
speci~ically hybridize to the nucleic acid sequences o~ the
present invention.
In accordance with yet another object of the present
invention, there is provided a diagnostic assay for detecting
CA 02220978 1997-11-13
O 96/39436 PCT~US95/07137
a disease or susceptibility to a disease related to
mutation in a nucleic acid sequence o~ the present invention
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
The ~ollowing drawings are illustrative of embodiments
o~ the invention and are not meant to limit the scope o~ the
invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and the corresponding
deduced amino acid sequence of the G-protein coupled receptor
of the present invention. The standard one-letter
abbreviation for amino acids are used. Sequencing was
performed using a 373 Automated DNA sequencer (Applied
Biosystems, Inc.).
Figure 2 is an illustration o~ the amino acid homology
between the polypeptide o~ the present invention (top line)
and hllm~n endothelial dif~erentiation protein (edg-1) gene
mRNA (bottom line).
Figure 3 is an illustration o~ the secondary structural
~eatures of the G-protein coupled receptor. The ~irst 7
illustrations set forth the regions of the amino acid
sequence which are alpha helices,-beta sheets, turn regions
or coiled regions. The boxed areas are the areas which
correspond to the region indicated. The second set of
figures illustrate areas of the amino acid sequence which are
exposed to intracellular, cytoplasmic or are membrane-
spanning. The hydrophilicity part illustrates areas of the
protein sequence which are in the lipid bilayer o~ the
membrane and are, therefore, hydrophobic, and areas outside
the lipid bilayer membrane which are hydrophilic. The
antigenic index corresponds to the hydrophilicity plot, since
antigenic areas are areas outside the lipid bilayer membrane
and are capable o~ binding antigens. The sur~ace probability
plot ~urther corresponds to the antigenic index and the
hydrophilicity plot. The amphipathic plots show those
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
regions of the 13 se~uences which are polar and non-polar.
The flexible regions correspond to the second set of
illustrations in the sense that flexible regions are those
which are outside the membrane and inflexible regions are
transmembrane regions.
In accordance with an aspect of the present invention,
there are provided isolated nucleic acids (polynucleotides)
which encode for the mature polypeptide having the deduced
amino acid sequence of Figure 1 (SEQ ID NO:2) or for the
mature polypeptide encoded by the cDNA of the clone deposited
as ATCC Deposit No. 97,130 on 4-28-95.
A polynucleotide encoding the polypeptide of the present
invention was isolated from a cDNA library derived from hllm~n
endometrial tumor tissue. It is structurally related to the
G protein-coupled receptor family. It contains an open
reading frame encoding a protein of 364 amino acid residues.
The protein exhibits the highest degree of homology to a
hl~m~n EDG-l protein with 36 ~ identity and 61 ~ simila~ity
over a 364 amino acid stretch. Potential ligands to the
receptor polypeptide of the present invention include but are
not limited to ~n~n~m; de, serotonin, adrenalin and
noradrenalin, platelet activating factor, thrombin, C5a and
bradykinin, chemokine, and platelet activating factor.
The polynucleotides of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which encodes the mature polypeptide may be
identical to the coding sequence shown in Figure 1 (SEQ ID
NO:1) or that of the deposited clone or may be a different
coding sequence which coding se~uence, as a result of the
redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1)
or the deposited cDNA.
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
The polynucleotides which encode ~or the mature
polypeptides o~ Figure 1 (SEQ ID NO:2) or ~or the mature
polypeptide encoded by the deposited cDNA may include: only
the coding sequence for the mature polypeptide; the coding
sequence ~or the mature polypeptide (and optionally
additional coding sequence) and non-coding sequence, such as
introns or non-coding sequence 5' and/or 3' o~ the coding
sequence ~or the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding'
sequence ~or the polypeptide as well as a polynucleotide
which includes additional coding and/or non-coding sequence.
The present invention ~urther relates to variants o~ the
hereinabove described polynucleotides which encode ~or
~ragments, analogs and derivatives o~ the polypeptide having
the deduced amino acid sequence o~ Figure 1 (SEQ ID NO:2) or
the polypeptide encoded by the cDNA o~ the deposited clone.
The variants of the polynucleotides may be a naturally
occurring allelic variant of the polynucleotides or a non-
naturally occurring variant o~ the polynucleotides.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in Figure 1
(SEQ ID NO:2) or the same mature polypeptide encoded by the
cDNA of the deposited clone as well as variants o~ such
polynucleotides which variants encode ~or a ~ragment,
derivative or analog o~ the polypeptide o~ Figure 1 (SEQ ID
NO:2) or the polypeptide encoded by the cDNA of the deposited
clone. Such nucleotide variants include deletion variar-s,
substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotides may have
a coding sequence which is a naturally occurring allelic
variant o~ the coding sequence shown in Figure 1 (SEQ ID
NO:1) or o~ the coding sequence o~ the deposited clone. As
known in the art, an allelic variant is an alternate ~orm o~
a polynucleotide sequence which may have a substitution,
CA 02220978 1997-11-13
W096/39436 PCT~S95/07137
deletion or addition of one or more nucleotides, which does
not substantially alter the function of the encoded
polypeptides.
The polynucleotides may also encode for a soluble form
of the receptor polypeptide of the present invention which is
the extracellular portion of the polypeptide which has been
cleaved from the TM and intracellular domain of the full-
length polypeptide of the present invention.
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for purification of the polypeptides of the
present invention.- The marker sequence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide for
purification of the mature polypeptide fused to the marker in
the case of a bacterial host, or, for example, the marker
sequence may be a hemagglutinin (HA) tag when a m~mm~l ian
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding
and following the coding region (leader and trailer) as well
as intervening sequences (introns) between individual coding
segments (exons).
Fragments of the full length gene of the present
invention may be used as a hybridization probe ~or a cDNA
library to isolate the full length gene and to isolate other
genes which have a high sequence similarity to the gene or
similar biological activity. Probes of this type preferably
have at least 20 or 30 bases and may contain, for example, 50
or more bases. The probe may also be used to identify a cDNA
clone corresponding to a full length transcript and a genomic
clone or clones that contain the complete gene of the present
invention including regulatory and promotor regions, exons,
and introns. An example of a screen comprises isolating the
_ g _
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
coding region o~ the gene by using the known DNA sequence to
synthesize an oligonucleotide probe. Labeled
oligonucleotides having a sequence complementary to that of
the gene o~ the present invention are used to screen a
library o~ human cDNA, genomic DNA or mRNA to determine which
members o~ the library the probe hybridizes to.
The present invention ~urther relates to
polynucleotides which hybridize to the hereinabove-described
sequences i~ there is at least 70~, pre~erably at least 90~,
and more pre~erably at least 95~ identity between the
sequences. The present invention particularly relates to
polynucleotides which hybridize under stringent conditions to
the hereinabove-described polynucleotides. As herein used,
the term "stringent conditions" means hybridization will
occur only if there is at least 95~ and pre~erably at least
97~ identity between the sequences. The polynucleotides
which hybridize to the hereinabove described polynucleotides
in a pre~erred embodiment encode polypeptides which either
retain substantially the same biological ~unction or activity
as the mature polypeptide encoded by the cDNAs o~ Figure 1
(SEQ ID N0:1) or the deposited cDNA(s).
Alternatively, the polynucleotide may have at least 20
bases, pre~erably at least 30 bases, and more preferably at
least 50 bases which hybridize to a polynucleotide o~ the
present invention and which has an identity thereto, as
hereinabove described, and which may or may not retain
activity. For example, such polynucleotides may be employed
as probes ~or the polynucleotide of SEQ ID NO:1, ~or example,
~or recovery o~ the polynucleotide or as a diagnostic probe
or as a PCR primer.
Thus, the present invention is directed to
polynucleotides having at least a 70~ identity, preferably at
least 90~ and more pre~erably at least a 95~ identity to a
polynucleotide which encodes the polypeptide o~ SEQ ID N0:2
as well as ~ragments thereo~, which ~ragments have at least
--10--
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
20 or 30 bases and preferably at least 50 bases and to
polypeptides encoded by such polynucleotides.
The deposit(s) referred to herein will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-organisms for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides contained in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein by
reference and are controlling in the event of any conflict
with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to a G-protein
coupled receptor polypeptide which has the deduced amino acid
sequence of Figure 1 (SEQ ID NO:2) or which has the amino
acid sequence encoded by the deposited cDNA, as well as
fragments, analogs and derivatives of such polypeptide.
The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of Figure 1 (SEQ ID NO:2) or
that encoded by the deposited cDNA, means a polypeptide which
either retains substantially the same biological function or
activity as such polypeptide, i.e. ~unctions as a G-protein
coupled receptor, or retains the ability to bind the ligand
or the receptor even though the polypeptide does not function
as a G-protein coupled receptor, for example, a soluble form
of the receptor. An analog includes a proprotein which can
be activated by cleavage of the proprotein portion to produce
an active mature polypeptide.
The polypeptides of the present invention may be
recombinant polypeptides, a natural polypeptides or synthetic
polypeptides, preferably recombinant polypeptides.
--11--
CA 02220978 1997-11-13
O 96/39436 PCTrUS95/07137
The fragment, derivative or analog of the polypeptide of
Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA
may be (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may
not be one encoded by the genetic code, or (ii) one in which
one or more o~ the amino acid residues includes a substituent
group, or (iii) one in which the mature polypeptide is fused
with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene
glycol), or (iv) one in which the additional amino acids are
fused to the mature polypeptide which is employed for
purification of the mature polypeptide or (v) one in which a
~ragment of the polypeptide is soluble, i.e. not membrane
bound, yet still binds ligands to the membrane bound
receptor. Such fragments, derivatives and analogs are deemed
to be within the scope of those skilled in the art from the
teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
The term "isolated" means that the material is removed
from its original environment (e.g., the natural environment
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a living
~n;m~l iS not isolated, but the same polynucleotide or
polypeptide, separated ~rom some or all o~ the coexisting
materials in the natural system, i8 isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
The polypeptides o~ the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature
-12-
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
polypeptide) as well as polypeptides which have at least 70~
similarity (preferably at least a 70~ identity) to the
polypeptide of SEQ ID NO:2 and more preferably at least a 90~
similarity (more preferably at least a 90~ identity) to the
polypeptide of SEQ ID NO:2 and still more preferably at least
a 95~ similarity (still more preferably at least a 95~
identity) to the polypeptide of SEQ ID NO:2 and also include
portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and
more preferably at least 50 amino acids.
As known in the art "similarity" between two
polypeptides is determined by comparing the amino acid
sequence and its conserved amino acid substitutes of one
polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to
synthesize full-length polynucleotides of the present
invention.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the
invention and the production of polypeptides of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the G-
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
protein coupled receptor genes. The culture conditions, such
as temperature, pH and the like, are those previously used
with the host cell selected for expression, and will be
apparent to the ordinarily skilled artisan.
The polynucleotides o~ the present invention may be
employed for producing polypeptides by recombinant
techniques. Thus, ~or example, the polynucleotide may be
included in any one o~ a variety o~ expression vectors ~or
expressing a polypeptide. Such vectors include chromosomal,
nonch~omosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived ~rom
combinations of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, ~owl pox virus, and pseudorabies.
However, any other vector may be used as long as it is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
endonuclease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples o~ such promoters, there may be mentioned: LTR or
SV40 promoter, the E. coli. lac or tr~, the phage lambda P~
promoter and other promoters known to control expression o~
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site
~or translation initiation and a transcription terminator.
The vector may also include appropriate se~uences ~or
amplifying expression.
In addition, the expression vectors pre~erably contain
one or more selectable marker genes to provide a phenotypic
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
trait ~or selection o~ trans~ormed host cells such as
dihydrofolate reductase or neomycin resistance ~or eukaryotic
cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to trans~orm an appropriate
host to permit the host to express the protein.
As representative examples o~ appropriate hosts, there
may be mentioned: bacterial cells, such as E. coli,
Streptomyces, Salmonella ty~himurium; ~ungal cells, such as
yeast; insect cells such as Droso~hila S2 and S~odo~tera S~9;
~n; m~ 1 cells such as CHO, COS or Bowes melanoma;
adenoviruses; plant cells, etc. The selection o~ an
approp__ate host is deemed to be within the scope o~ those
skilled in the art from the teachings herein.
More particularly, the present invention also includes
recombinant constructs comprising one or more o~ the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence o~ the invention has been inserted, in a
~orward or reverse orientation. In a pre~erred aspect o~ this
embodiment, the construct ~urther comprises regulatory
sequences, including, ~or example, a promoter, operably
linked to the sequence. Large numbers o~ suitable vectors
and promoters are known to those o~ skill in the art, and are
commercially available. The ~ollowing vectors are provided
by way o~ example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen),
pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
-15-
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
Promoter regions can be selected from any desired gene
using CAT (chloramphenicol transferase) vectors or other
vectors with selectable markers. Two appropriate vectors are
pKK232-8 and pCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda P~, PL and trp.
Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriate
vector and promoter is well within the level of ordinary
skill in the art.
In a further embodiment, the present invention relates
to host cells containing the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
m~mm~lian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEAE-
Dextran mediated transfection, or electroporation (Davis, L.,
Dibner, M., Battey, I., Basic Methods in Molecular Biology,
(1986)).
The constructs in host cells can be used in a
conventional manner to produce the gene product encoded by
the reco~mbinant sequence. Alternatively, the polypeptides of
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in mammalian cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is hereby incorporated by reference.
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
Transcription of the DNA encoding the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an enhancer sequence into the vector. ~nh~ncers
are cis-acting elements of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
Examples including the SV40 enhancer on the late side of the
replication origin bp 100 to 270, a cytomegalovirus early
promoter enhancer, the polyoma ~nh~ncer on the late side of
the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
promoters can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assembled in appropriate
phase with translation initiation and termination sequences.
Optionally, the heterologous sequence can encode a fusion
protein including an N-terminal identification peptide
imparting desired characteristics, e.g., stabilization or
simplified puri~ication of expressed recombinant product.
Useful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable reading phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, Salmonella typhimurium and various species
within the genera Pseudomonas, Streptomyces, and
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
Staphylococcus, although others may also be employed as a
matter o~ choice.
As a representative but nonlimiting example, use~ul
expression vectors for bacterial use can comprise a
selectable marker and bacterial origin o~ replication derived
~rom commercially available plasmids comprising genetic
elements o~ the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, ~or example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the
structural sequence to be expressed.
Following trans~ormation o~ a suitable host strain and
growth o~ the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are
cultured ~or an additional period.
Cells are typically harvested by centri~ugation,
disrupted by physical or chemical means, and the resulting
crude extract retained for ~urther puri~ication.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including ~reeze-thaw
cycling, sonication, mechanical disruption, or use o~ cell
lysing agents, such methods are well know to those skilled in
the art.
Various m~mm~l ian cell culture systems can also be
employed to express recombinant protein. Examples of
m~mm~l ian expression systems include the COS-7 lines o~
monkey kidney ~ibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines capable o~ expressing a
compatible vector, ~or example, the C127, 3T3, CHOHS293, HeLa
and BHK cell lines. M~mm~lian expression vectors will
comprise an origin o~ replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
-18-
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95107137
transcriptional termination sequences, and 5' ~ianking
nontranscribed sequences.- DNA sequences derived ~rom the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
~ The G-protein coupled receptor polypeptide o~ the
present invention can be recovered and puri~ied ~rom
recombinant cell cultures by methods including ammonium
sul~ate or ethanol precipitation, acid extraction, anion or
cation exchange chromatography, phosphocellulose
chromatography, hydrophobic interaction chromatography,
af~inity chromatography, hydroxylapatite chromatography and
lectin chromatography. Protein re~olding steps can be used,
as necessary, in completing con~iguration of the mature
protein. Finally, high per~ormance liquid chromatography
(HPLC) can be employed ~or ~inal puri~ication steps.
The polypeptides of the present invention may be a
naturally puri~ied product, or a product o~ chemical
synthetic procedures, or produced by recombinant techniques
~rom a prokaryotic or eukaryotic host (~or example, by
bacterial, yeast, higher plant, insect and m~mm~lian cells in
culture). Depending upon the host employed in a recombinant
production procedure, the polypeptides o~ the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial
methionine amino acid residue.
The G-protein coupled receptors of the present invention
may be employed in a process ~or screening ~or compounds
which activate (agonists) or inhibit activation (antagonists)
o~ the receptor polypeptide of the present invention .
In general, such screening procedures involve providing
appropriate cells which express the receptor polypeptide o~
the present invention on the sur~ace thereo~. Such cells
include cells ~rom m~mm~l S, yeast, drosophila or E. Coli . In
particular, a polynucleotide encoding the receptor o~ the
present invention is employed to trans~ect cells to thereby
-19-
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
express the G-protein coupled receptor. The expressed
receptor is then contacted with a test compound to observe
binding, stimulation or inhibition of a functional response.
One such screening procedure involves the use of
melanophores which are transfected to express the G-protein
coupled receptor of the present invention. Such a screening
technique is described in PCT WO 92/01810 published February
6, 1992.
Thus, for example, such assay may be employed for
screening for a compound which inhibits activation of the
receptor polypeptide of the present invention by contacting
the melanophore cells which encode the receptor with both the
receptor ligand and a compound to be screened. Inhibition of
the signal generated by the ligand indicates that a compound
is a potential antagonist for the receptor, i.e., inhibits
activation of the receptor.
The screen may be employed for determ; n; ng a compound
which activates the receptor by contacting such cells with
compounds to be screened and determining whether such
compound generates a signal, i.e., activates the receptor.
Other screening techniques include the use of cells
which express the G-protein coupled receptor (~or example,
transfected CHO cells) in a system which measures
extracellular pH changes caused by receptor activation, for
example, as described in Science, volume 246, pages 181-296
(October 1989). For example, compounds may be contacted with
a cell which expresses the receptor polypeptide of the
present invention and a second messenger response, e.g.
signal transduction or pH changes, may be measured to
determine whether the potential compound activates or
inhibits the receptor.
Another such screening technique involves introducing
RNA encoding the G-protein coupled receptor into Xenopus
oocytes to transiently express the receptor. The receptor
oocytes may then be contacted with the receptor ligand and a
-20-
CA 02220978 l997-ll-l3
W O 96139436 PCT~US95tO7137
compound to be screened, followed by detection of inhibition
or activation of a calcium signal in the case of screening
for compounds which are thought to inhibit activation of the
receptor.
Another screening technique involves expressing the G-
protein coupled receptor in which the receptor is linked to
a phospholipase C or D. As representative examples of such
cells, there may be mentioned endothelial cells, smooth
muscle cells, embryonic kidney cells, etc. The screening may
be accomplished as hereinabove described by detecting
activation of the receptor or inhibition of activa~ion of the
receptor from the phospholipase second signal.
Another method involves screening for compounds which
inhibit activation of the receptor polypeptide of the present
invention antagonists by determining inhibition of binding o~
labeled ligand to cells which have the receptor on the
surface thereof. Such a method involves transfecting a
eukaryotic cell with DNA encoding the G-protein coupled
receptor such that the cell expresses the receptor on its
surface and contacting the cell with a compound in the
presence of a labeled form of a known ligand. The ligand can
be labeled, e.g., by radioactivity. The amount of labeled
ligand bound to the receptors is measured, e.g., by measuring
radioactivity of the receptors. I~ the compound binds to the
receptor as determined by a reduction of labeled ligand which
binds to the receptors, the binding of labeled ligand to the
receptor is inhibited.
G-protein coupled receptors are ubiquitous in the
m~mm~l ian host and are responsible for many biological
functions, including many pathologies. Accordingly, it is
desirous to ~ind compounds and drugs which stimulate the G-
protein coupled receptor on the one hand and which can
inhibit the ~unction o~ a G-protein coupled receptor on the
other hand.
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
For example, compounds which activate the G-protein
coupled receptor may be employed for therapeutic purposes,
such as the treatment of asthma, Parkinson's disease, acute
heart failure, hypotension, urinary retention, and
osteoporosis.
In general, compounds which inhibit activation of the G-
protein coupled receptor may be employed for a variety of
therapeutic purposes, for example, for the treatment of
hypertension, angina pectoris, myocardial infarction, ulcers,
asthma, allergies, benign prostatic hypertrophy and psychotic
and neurological disorders, including schizophrenia, manic
excitement, depression, delirium, dementia or severe mental
retardation, dyskinesias, such as Huntington's disease or
Gilles dela Tourett's syndrome, among others. Compounds
which inhibit G-protein coupled receptors have also been
useful in reversing endogenous anorexia and in the control of
bulimia.
An antibody may antagonize a G-protein coupled receptor
of the present invention, or in some cases an oligopeptide,
which bind to the G-protein coupled receptor but does not
elicit a second messenger response such that the activity of
the G-protein coupled receptors is prevented. Antibodies
include anti-idiotypic antibodies which recognize unique
determ;n~nts generally associated with the antigen-binding
site of an antibody. Potential antagonist compounds also
include proteins which are closely related to the ligand of
the G-protein coupled receptors, i.e. a fragment of the
ligand, which have lost biological function and when binding
to the G-protein coupled receptor, elicit no response.
An antisense construct prepared through the use of
antisense technology, may be used to control gene expression
through triple-helix formation or antisense DNA or RNA, both
of which methods are based on binding of a polynucleotide to
DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes for the mature
-22-
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
polypeptides o~ the present invention, is used to design an
antisense RNA oligonucleotide o~ ~rom about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region o~ the gene involved in
transcription (triple helix -see Lee et al., Nucl. Acids
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby
preventing transcription and the production o~ G-protein
coupled receptor. The antisense RNA oligonucleotide
hybridizes to the mRNA in vivo and blocks translation o~ mRNA
molecules into G-protein coupled receptor (antisense - Okano,
J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as
Antisense Inhibitors o~ Gene Expression, CRC Press, Boca
Raton, FL (1988)). The oligonucleotides described above can
also be delivered to cells such that the antisense RNA or DNA
may be expressed in vivo to inhibit production o~ G-protein
coupled receptor.
A small molecule which binds to the G-protein coupled
receptor, making it inaccessible to ligands such that normal
biological activity is prevented, ~or example small peptides
or peptide-like molecules, may also be used to inhibit
activation of the receptor polypeptide o~ the present
invention.
A soluble ~orm of the G-protein coupled receptor, e.g.
a ~ragment o~ the receptors, may be used to inhibit
activation o~ the receptor by binding to the ligand to a
polypeptide o~ the present invention and preventing the
ligand ~rom interacting with membrane bound G-protein coupled
receptors.
This invention additionally provides a method o~
treating an abnormal condition related to an excess o~ G-
protein coupled receptor activity which comprises
administering to a subject the inhibitor compounds as
hereinabove described along with a pharmaceutically
acceptable carrier in an amount e~ective to inhibit
-23-
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
activation by blocking binding o~ ligands to the G-protein
coupled receptors, or by inhibiting a second signal, and
thereby alleviating the abnormal conditions.
The invention also provides a method o~ treating
abnormal conditions related to an under-expression o~ G-
protein coupled receptor activity which comprises
administering to a subject a therapeutically ef~ective amount
of a compound which activates the receptor polypeptide of the
present invention as described above in combination with a
pharmaceutically acceptable carrier, to thereby alleviate the
abnormal conditions.
The soluble form of the G-protein coupled receptor, and
compounds which activate or inhibit such receptor, may be
employed in combination with a suitable pharmaceutical
carrier. Such compositions comprise a therapeutically
e~ective amount of the polypeptide or compound, and a
pharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
administration.
The invention also provides a pharmaceutical pack or kit
comprising one or more containers ~illed with one or more o~
the ingredients of the pharmaceutical compositions of the
invention. Associated with such container(s) can be a notice
in the ~orm prescribed by a governmental agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects approval by the agency o~
manufacture, use or sale for human administration. In
addition, the pharmaceutical compositions may be employed in
conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in
a convenient manner such as by the topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
-24-
CA 02220978 l997-ll-l3
W O 96/39436 PCTAJS95/07137
administered in an amount which is effective for treating
and/or propnylaxis of the specific indication. In general,
the pharmaceutical compositions will be administered in an
amount of at least about 10 ~g/kg body weight and in most
cases they will be administered in an amount not in excess of
about 8 mg/Kg body weight per day. In most cases, the dosage
is from about 10 ~g/kg to about 1 mg/kg body weight daily,
taking into account the routes of administration, symptoms,
etc.
The G-protein coupled receptor polypeptides, and
compounds which activate or inhibit which are also compounds
may be employed in accordance with the present invention by
expression of such polypeptides in vivo, which is often
referred to as "gene therapy."
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use of a
retroviral particle containing RNA encoding a polypeptide of
the present invention.
Similarly, cells may be engineered in vivo ~or
expression of a polypeptide in vivo by, ~or example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle containing RNA
encoding the polypeptide o~ the present invention may be
administered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the teachings o~ the present invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
CA 02220978 1997-11-13
W O 96/39436 PCTnJS95/07137
be used to engineer cells in vivo a~ter combination with a
suitable delivery vehicle.
Retroviruses ~rom which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not
limited to, Moloney Murine Leukemia Virus, spleen necrosis
virus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia
virus, human ;mml~node~iciency virus, adenovirus,
Myeloproli~erative Sarcoma Virus, and m~mm~ry tumor virus.
In one embodiment, the retroviral plasmid vector is derived
~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited
to, the retroviral LTR; the SV40 promoter; and the hllm~n
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other
promoter (e.g., cellular promoters such as eukaryotic
cellular promoters including, but not limited to, the
histone, pol III, and ~-actin promoters). Other viral
promoters which may be employed include, but are not limited
to, adenovirus promoters, thymidine kinase (TK) promoters,
and B19 parvovirus promoters. The selection of a suitable
promoter will be apparent to those skilled in the art ~rom
the teachings contained herein.
The nucleic acid sequence encoding the polypeptide o~
the present invention is under the control o~ a suitable
promoter. Suitable promoters which may be employed include,
but are not limited to, adenoviral promoters, such as the
adenoviral major late promoter; or hetorologous promoters,
such as the cytomegalovirus (CMV) promoter; the respiratory
syncytial virus (RSV) promoter; inducible promoters, such as
the MMT promoter, the metallothionein promoter; heat shock
promoters; the albumin promoter; the ApoAI promoter; human
globin promoters; viral thymidine kinase promoters, such as
the Herpes Simplex thymidine kinase promoter; retroviral LTRs
-26-
-
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
(including the modi~ied retroviral LTKs hereinabove
described); the ~-actin promoter; and hllm~n growth hormone
promoters. The promoter also may be the native promoter
which controls the genes encoding the polypeptides.
The retroviral plasmid vector is employed to transduce
packaging cell lines to ~orm producer cell lines. Examples
o~ packaging cells which may be transfected include, but are
not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X,
VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pg.
5-14 (1990), which is incorporated herein by re~erence in its
entirety. The vector may transduce the packaging cells
through any means known in the art. Such means include, but
are not limited to, electroporation, the use o~ liposomes,
and CaPO4 precipitation. In one alternative, the retroviral
plasmid vector may be encapsulated into a liposome, or
coupled to a lipid, and then administered to a host.
The producer cell line generates in~ectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vitro or in vivo. The transduced eukaryotic cells will
express the nucleic acid sequence(s) encoding the
polypeptide. Eukaryotic cells which may be transduced
include, but are not limited to, embryonic stem cells,
embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, ~ibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
The present invention also provides a method ~or
determining whether a ligand not known to be capable o~
binding to a G-protein coupled receptor o~ the present
invention can bind to such receptor which comprises
contacting a mammalian cell which expresses a G-protein
coupled receptor with the ligand under conditions permitting
binding o~ ligands to the G-protein coupled receptor,
CA 02220978 l997-ll-l3
W O 96/39436 PCT~US95/07137
detecting the presence of a ligand which binds to the
receptor and thereby determining whether the ligand binds to
the G-protein coupled receptor.
This invention further provides a method of screening
drugs to identify drugs which specifically interact with, and
bind to, the hl~m~n G-protein coupled receptors on the surface
of a cell which comprises contacting a m~mm~l ian cell
comprising an isolated DNA molecule encoding the G-protein
coupled receptor with a plurality of drugs, determining those
drugs which bind to the m~m~1 ian cell, and thereby
identifying drugs which specifically interact with and bind
to a hllm~n G-protein coupled receptor of the present
invention. Such drugs may then be used therapeutically to
either activate or inhibit activation of the receptors of the
present invention.
This invention also provides a method of detecting
expression of the G-protein coupled receptor on the surface
of a cell by detecting the presence of mRNA coding for a G-
protein coupled receptor which comprises obtaining total mRNA
from the cell and contacting the mRNA so obtained with a
nucleic acid probe of the present invention capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human G-
protein coupled receptor under hybridizing conditions,
detecting the presence of mRNA hybridized to the probe, and
thereby detecting the expression of the G-protein coupled
receptor by the cell.
This invention is also related to the use of the G-
protein coupled receptor genes as part of a diagnostic assay
for detecting diseases or susceptibility to diseases related
to the presence of mutations in the nucleic acid sequences
with encode the receptor polypeptides of the present
invention. Such diseases, by way of example, are related to
cell transformation, such as tumors and cancers.
-28-
CA 02220978 l997-ll-l3
W O 96/39436 PCT~US95/07137
Individuals carrying mutations in the human G-protein
coupled receptor gene may be detected at the DNA level by a
variety of techniques. Nucleic acids for diagnosis may be
obtained from a patient's cells, such as from blood, urine,
saliva, tissue biopsy and autopsy material. The genomic DNA
may be used directly for detection or may be amplified
~ enzymatically by using PCR (Saiki et al., Nature, 324:163-166
(1986)) prior to analysis. RNA or cDNA may also be used ~or
the same purpose. As an example, PCR primers complementary
to the nucleic acid encoding the G-protein coupled receptor
proteins can be used to identify and analyze G-protein
coupled receptor mutations. For example, deletions and
insertions can be detected by a change in size of the
amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified
DNA to radiolabeled G-protein coupled receptor RNA or
alternatively, radiolabeled G-protein coupled receptor
antisense DNA sequences. Perfectly matched sequences can be
distinguished from mismatched duplexes by RNase A digestion
or by differences in melting temperatures.
Sequence differences between the re~erence gene and gene
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as
probes to detect specific DNA segments. The sensitivity of
this method is greatly enhanced when combined with PCR. For
example, a sequencing primer is used with double-stranded PCR
product or a single-stranded template molecule generated by
a modi~ied PCR. The sequence determination is per~ormed by
conventional procedures with radiolabeled nucleotide or by
automatic sequencing procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA
-29-
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
~ragments o~ di~erent sequences may be distinguished on
denaturing ~ormamide gradient gels in which the mobilities o~
di~erent DNA ~ragments are retarded in the gel at di~erent
positions according to their speci~ic melting or partial
melting temperatures (see, e.g., Myers et al., Science,
230:1242 (1985)).
Sequence changes at speci~ic locations may also be
revealed by nuclease protection assays, such as RNase and S1
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection o~ a speci~ic DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use o~
restriction enzymes, (e.g., Restriction Fragment Length
Polymorphisms (RFLP)) and Southern blotting o~ genomic DNA.
In addition to more conventional gel-electrophoresis and
DNA sequencing, mutations can also be detected by in si tu
analysis.
The present invention also relates to a diagnostic assay
~or detecting altered levels o~ soluble ~orms o~ the receptor
polypeptides of the present invention in various tissues.
Assays used to detect levels o~ the soluble receptor
polypeptides in a sample derived ~rom a host are well known
to those o~ skill in the art and include radioimmunoassays,
competitive-binding assays, Western blot analysis and
pre~erably as ELISA assay.
An ELISA assay initially comprises preparing an antibody
speci~ic to antigens o~ the receptor polypeptide, pre~erably
a monoclonal antibody. In addition a reporter antibody i8
prepared against the monoclonal antibody. To the reporter
antibody is attached a detectable reagent such as
radioactivity, ~luorescence or in this example a horseradish
peroxidase enzyme. A sample is now removed ~rom a host and
incubated on a solid support, e.g. a polystyrene dish, that
binds the proteins in the sample. Any f ree protein binding
-30-
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
sites on the dish are then covered by incubating with a non-
specific protein such as bovine serum albumin. Next, the
monoclonal antibody is incubated in the dish during which
time the monoclonal antibodies a~-:ach to any receptor
polypeptides of the present invention attached to the
polystyrene dish. All unbound monoclonal antibody is washed
out with buffer. The reporter antibody linked to horseradish
peroxidase is now placed in the dish resulting in binding of
the reporter antibody to any monoclonal antibody bound to
receptor proteins. Unattached reporter antibody is then
washed out. Peroxidase substrates are then added to the dish
and the amount of color developed in a given time period is
a measurement of the amount of receptor proteins present in
a given volume of patient sample when compared against a
standard curve.
The se~uences of the present invention are also valuable
for chromosome identification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual hllm~n chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome. Few
chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presen~ly available for marking
chromosomal location. The mapping o~ DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with gene associated with
disease.
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (pre~erably 15-25 bp) ~rom the cDNA.
Computer analysis of the 3' untranslated region is used to
rapidly select primers that do not span more than one exon in
the genomic DNA, thus complicating the amplification process.
These primers are then used for PCR screening of somatic cell
hybrids containing individual human chromosomes. Only those
hybrids containing the hllm~n gene corresponding to the primer
will yield an amplified fragment.
=
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels o~
fragments from specific chromosomes or pools of large genomic
clones in an analogous m~nner. Other mapping strategies that
can similarly be used to map to its chromosome include in
situ hybridization, prescreening with labeled ~low-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) o~ a cDNA
clone to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., Human
Chromosomes: A ~nll~ 1 of Basic Techniques, Pergamon Press,
New York (1988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusic , Mendelian
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between a~fected and unaf~ected
individuals. I~ a mutation is observed in some or all of the
a~ected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
-32-
CA 02220978 1997-11-13
WO 96/39436 PCT~US95/07137
of between 50 and 500 potential causative genes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an immunogen to produce antibodies thereto. These antibodies
~ can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain,
and hllm~n;zed antibodies, as well as Fab fragments, or the
product of an Fab expression library. Various procedures
known in the art may be used for the production of such
antibodies and fragments.
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obtained by direct injection of the polypeptides into an
~n; m~ 1 or by administering the polypeptides to an animal,
preferably a nonhllm~n. The antibody so obtained will then
bind the polypeptides itself. In this manner, even a
sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line
cultures can be used. Examples nclude the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
(Kozbor et al., 1983, Immunology Today 4:72), and the EBV-
hybridoma technique to produce human monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products
of this invention. Also, transgenic mice may be used to
-33-
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
express hllm~n;zed antibodies to immunogenic polypeptide
products of this invention.
The present invention will be ~urther described with
re~erence to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise speci~ied,
are by weight.
In order to ~acilitate understanding o~ the following
examples certain ~requently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
starting plasmids herein are either commercially available,
publicly available on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are commercially available and their reaction
conditions, co~actors and other require-~nts were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units o~ enzyme in about 20 ~1
o~ buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 units o~ enzyme in a larger
volume. Appropriate buffers and substrate amounts for
particular restriction enzymes are specified by the
manufacturer. Incubation times of about 1 hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier's instructions. After digestion the reaction is
-34-
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
electrophoresed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation of the cleaved fragments is performed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without adding a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
"Ligation" refers to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with 10 units to T4 DNA ligase
("ligase") per 0.5 ~g of approximately equimolar amounts of
the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as
described in the method of Graham; F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
Example 1
Bacterial Expression and Purification of the G-Protein
Coupled Receptor (GPRC) polypeptide
The DNA sequence encoding GPRC, ATCC # 97,130, is
initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences o~ the processed
GPRC nucleotide sequence. Additional nucleotides
corresponding to the GPRC nucleotide sequence are added to
the 5' and 3' sequences respectively. The 5' oligonucleotide
primer has the sequence 5' CACAGG~TCCCGTGGCTGCCATCTCTACTTC 3'
(SEQ ID NO:3) contains a BamHT restriction enzyme site
CA 02220978 1997-11-13
W 096/39436 PCT~US95/07137
followed by 17 nucleotides of GPRC coding sequence starting
from the presumed second amino acid o~ the processed protein.
The 3' sequence; 5' TCTCAGGTACCGTTCTCTAAACCACAGAGTGGTCA (SEQ
ID NO:4 ) contains complementary sequences to an ASP718 site
and is followed by 19 nucleotides of GPRC coding sequence.
The restriction enzyme sites corre~pond to the restriction
enzyme sites on the bacterial expression vector pQE-31
(Qiagen, Inc. Chatsworth, CA). pQE-31 encodes antibiotic
resistance (Ampr), a bacterial origin of replication (ori),
an IPTG-regulatable promoter operator (P/O), a ribosome
binding site (RBS), a 6-His tag and restriction enzyme sites.
pQE-31 is then digested with BamHT and ASP718. The ampli~ied
sequences are ligated into pQE-31 and are inserted in frame
with the sequence encoding for the histidine tag and the RBS.
The ligation mixture is then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in
Sambrook, J. et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Laboratory Press, (1989). M15/rep4 contains
multiple copies of the plasmid pREE-, which expresses the
lacI repressor and also confers kanamycin resistance (Kanr).
Transformants are identified by their ability to grow on LB
plates and ampicillin/kanamycin resistant colonies are
selected. Plasmid DNA is isolated and confirmed by
restriction analysis.
Clones containing the desired constructs are grown
overnight (O/N) in liquid culture in LB media supplemented
with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N
culture is used to inoculate a large culture at a ratio of
1:100 to 1:250. The cells are grown to an optical density
600 (o.D.600) o~ between 0.4 and 0.6. IPTG ("Isopropyl-B-D-
thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene
expression. Cells are grown an extra 3 to 4 hours. Cells
are then harvested by centrifugation. The cell pellet is
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
solubilized in the chaotropic agent 6 Molar Guanidine HCl.
After clarification, solubilized GPRC is purified from this
solution by chromatography on a Nickel-Chelate column under
conditions that allow for tight binding by proteins
containing the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). GPRC is eluted from the
column in 6 molar guanidine HCl pH 5.0 and for the purpo~e of
renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium
phosphate, 10 mmolar glutathione (reduced) and 2 mmolar
glutathione (oxidized). After incubation in this solution
for 12 hours the protein is dialyzed to 10 mmolar sodium
phosphate.
Example 2
ExPression of Recombinant GPCR in COS7 cells
The expression of plasmid, GPRC HA was derived from a
vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E.coli
replication origin, 4) CMV promoter followed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire GPRC precursor and a HA tag
fused in frame to its 3' end was cloned into the polylinker
region of the vector, therefore, the recombinant protein
expression was directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
1984, Cell 37, 767). The infusion of HA tag to the target
protein allows easy detection of the recombinant protein with
an antibody that recognizes the HA epitope.
The plasmid construction strategy was desc: ~ed as
follows:
The DNA sequence encoding GPRC, ATCC # 97,130, was
constructed by PCR using two primers: the 5' primer 5'
CAACCACAGGGATCCCATGGCTGCCATCTCTACTTCCATCCCTGTA 3' (SEQ ID
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
NO:5) contains a BamHI site (bold) ~ollowed by 27 nucleotides
o~ GPRC coding sequence starting ~rom the initiation codon;
the 3' sequence 5' CCCCTCGAGCTAAACCACAGAGTGGTCATTGCT
GTGAACTCCAGCC 3' (SEQ ID NO:6) contains complementary
sequences to an XhoI site, translation stop codon, HA tag and
the last 24 nucleotides o~ the GPRC coding sequence (not
including the stop codon). There~ore, the PCR product
contains a HindIII site, GPRC coding sequence ~ollowed by HA
tag ~used in ~rame, a translation termination stop codon next
to the HA tag, and an XhoI site. The PCR ampli~ied DNA
~ragment and the vector, pcDNA3/Amp, were digested with
HindIII and XhoI restriction enzymes and ligated. The
ligation mixture was trans~ormed into E. coli strain DH5~,
the trans~ormed cultur was plated on ampicillin media plates
and resistant colonies were selected. Plasmid DNA was
isolated ~rom trans~ormants and ~m; ned by restriction
analysis ~or the presence o~ the correct ~ragment. For
expression o~ the recombinant GPRC, COS7 cells were
trans~ected with the expression vector by DEAE-DEXTRAN method
(J. Sam~rook, E. Fritsch, T. Maniatis, Molecular Cloning: A
Laboratory M~nll~l, Cold Spring Laboratory Press, (1989)).
The expression of the GPRC HA protein was detected by
radiolabeling and ;mmllnoprecipitation method (E. Harlow, D.
Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, (1988)). Cells were labelled ~or 8 hours
with 35S-cysteine two days post trans~ection. Culture media
were then collected and cells were lysed with detergent (RIPA
bu~er (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5~ DOC,
50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media were precipitated with a
HA speci~ic monoclonal antibody. Proteins precipitated were
analyzed on 15~ SDS-PAGE gels.
Example 3
-38-
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
Cloninq and exPression of GPRC usinq the baculovirus
expression system
The DNA sequence encoding the full length GPRC protein,
ATCC # 97,130, was amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' TTCACCACCTACCTGGATCC
ACAGAGCTGTCATGGCTGCC 3' (SEQ ID NO:7) and contains a BamHI
restriction enzyme site (in bold) followed by 11 nucleotides
resembling an efficient signal for the initiation of
translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950 (1987) which was just behind the first 9
nucleotides of the GPRC gene (the initiation codon for
translation "ATG" is underlined).
The 3' primer has the sequence 5' CCTCATCTCAGGTACCGTT
CTAAACCACAGAGTGG 3' (SEQ ID NO:8) and contains the cleavage
site for the ASP718 restriction ~n~onllclease and 10
nucleotides complementary to the 3' non-translated sequence
of the GPRC gene. The amplified sequences were isolated from
a 1~ agarose gel using a commercially available kit
("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was
then digested with the endonuclease BamHI and then purified
again on a 1~ agarose gel. This fragment was designated F2.
The vector pA2 (modi~ication o~ pVL941 vector, discussed
below) was used ~or the expression of the GPRC protein using
the baculovirus expression system ~for review see: Summers,
M.D. and Smith, G.E. 1987, A m~nll~l of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin No. 1555). This
expression vector contains the strong polyhedrin promoter o~
the Autographa californica nuclear polyhedrosis virus
(AcMNPV) followed by the recognition sites for the
restriction endonuclease BamHI. The polyadenylation site of
the simian virus (SV)40 was used for e~icient
polyadenylation. For an easy selection of recombinant virus
the beta-galactosidase gene from E.coli was inserted in the
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
same orientation as the polyhedrin promoter ~ollowed by the
polyadenylation signal of the polyhedrin gene. The
polyhedrin sequences were ~lanked at both sides by viral
sequences ~or the cell-mediated homologous recombination o~
cotrans~ected wild-type viral DNA. Many other baculovirus
vectors could be used in place o~ pA2 such as pAc373, pVL941,
PRGl and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology,
170:31-39).
The plasmid was digested with the restriction enzymes
ASP718 and BamHT then dephos~norylated using cal~ intestinal
phosphatase by procedures known in the art. The DNA was then
isolated ~rom a 1~ agarose gel using the commercially
available kit ("Geneclean" BI0 101 Inc., La Jolla, Ca.).
This vector DNA was designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were
ligated with T4 DNA ligase. E.coli DH5~ cells were then
trans~ormed and bacteria identi~ied that contained the
plasmid (pBacGPRC) with the GPRC gene using the enzymes
BamHI. The sequence o~ the cloned ~ragment was con~irmed by
DNA sequencIng.
5 ~g o~ the plasmid pBacGPRC was cotrans~ected with 1.0
~g o~ a commercially available linearized baculovirus
("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.)
using the lipo~ection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g o~ BaculoGoldTM virus DNA and 5 ~g o~ the plasmid
pBacGPRC were mixed in a sterile well o~ a microtiter plate
cont~;n;ng 50 ~1 o~ serum free Grace's medium (Li~e
Technologies Inc., Gaithersburg, MD). A~terwards 10 ~1
Lipo~ectin plus 90 ~1 Grace's medium were added, mixed and
incubated ~or 15 minutes at room temperature. Then the
trans~ection mixture was added dropwise to the S~9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with 1 ml Grace's medium without serum. The plate was rocked
back and ~orth to mix the newly added solution. The plate
-40-
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
was then incubated for 5 hours at 27~C. A~ter 5 hours the
trans~ection solution was removed ~rom the plate and 1 ml o~
Grace's insect medium supplemented with 10~ ~etal cal~ serum
was added. The plate was put back into an incubator and
cultivation continued at 27~C ~or ~our days.
A~ter four days the supernatant was collected ,and a
plaque assay per~ormed similar as described by Summers and
Smith (supra). As a modi~ication an agarose gel with "Blue
Gal" (Li~e Technologies Inc., Gaithersburg) was used which
allows an easy isolation o~ blue stained plaques. (A
detailed description o~ a "plaque assay" can also be ~ound in
the user's guide for insect cell culture and baculovirology
distributed by Li~e Technologies Inc., Gaithersburg, page 9-
10) .
Four days a~ter the serial dilution, the virus were
added to the cells and blue stained plaques were picked with
the tip o~ an Eppendor~ pipette. The agar containing the
recombinant viruses was then resuspended in an Eppendor~ tube
containing 200 ~l o~ Grace's medium. The agar was removed by
a brie~ centrifugation and the supernatant containing the
recombinant baculovirus was used to in~ect S~9 cells seeded
in 35 mm dishes. Four days later the supernatants o~ these
culture dishes were harvested and then stored at 4~C.
S~9 cells were grown in Grace's medium supplemented with
10~ heat-inactivated FBS. The cells were in~ected with the
recombinant baculovirus V-GPRC at a multiplicity o~ infection
(MOI) o~ 2. Six hours later the medium was removed and
replaced with SF900 II medium minus methionine and cysteine
(Li~e Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci
o~ 35S-methionine and 5 ~Ci 35S cysteine (Amersham) were added.
The cells were ~urther incubated for 72 hours be~ore they
were harvested by cell lysis in hypotonic phosphate bu~er
and centri~uged to collect the cell membranes and the
labelled proteins visualized by SDS-PAGE and autoradiography.
-41-
CA 02220978 1997-11-13
W O 96/39436 PCTAUS95/07137
Exam~le 4
ExPression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture me~ium and
separated into small pieces. Small chunks of the tissue are
placed on a wet surface of a tissue culture flask,
approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room
temperature over night. After 24 hours at room temperature,
the flask is inverted and the chunks of tissue remain fixed
to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C ~or approximately one week.
At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in
culture, a monolayer o~ ~ibroblasts emerge. The monolayer is
trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine
sarcoma virus, is di~sted with EcoRI and HindIII and
subsequently treated with calf intestinal phosphatase. The
linear vector is fractionated on agarose gel and purified,
using glass beads.
The cDNA encoding a polypeptide of the present invention
is amplified using PCR primers which correspond to the 5' and
3' end sequences respectively. The 5' primer contains an
EcoRI site and the 3' primer ~urther includes a HindIII site.
Equal quantities of the Moloney murine sarcoma virus linear
backbone and the ampli~ied EcoRI and HindIII ~ragment are
added together, in the presence of T4 DNA ligase. The
resulting mixture is maintained under conditions appropriate
for ligation of the two fragments. The ligation mixture is
used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin ~or the purpose of con~irming that
the vector had the gene o~ interest properly inserted.
-42-
CA 02220978 1997-11-13
W O 96/39436 . PCTAUS95/07137
The amphotropic pA317 or GP+aml2 packaging cells are
grown in tissue culture to confluent density in Dulbecco's
Modified Eagles Medium (DMEM) with 10~ calf serum (CS),
penicillin and streptomycin. The MSV vector containing the
~ gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
infectious viral particles containing the gene (the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells,
and subsequently, the media is harvested ~rom a 10 cm plate
of confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore
filter to ~e-llove detached producer cells and this media is
then used to infect fibroblast cells. Media i8 ~e.lloved ~rom
a sub-confluent plate of fibroblasts and quickly replaced
with the media from the producer cells. This media is
removed and replaced with fresh media. If the titer of virus
is high, then virtually all fibroblasts will be infected and
no selection is required. If the titer is very low, then it
is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injected into the
host, either alone or a~ter having been grown to con~luence
on cytodex 3 microcarrier beads. The fibroblasts now produce
the protein product.
Numerous modifications and variations o~ the present
invention were possible in light o~ the above teachings and,
there~ore, within the scope o~ the appended claims, the
invention may be practiced otherwise than as particularly
described.
-43-
CA 02220978 1997-11-13
W O 96/39436 PCT~US95/07137
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: LI, ET AL.
(ii) TITLE OF INVENTION: Human G Protein Coupled
Receptor
(iii) NUMBER OF SEQUENCES: 8
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068
(V) COM~U'l'h'~ READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COM~u l~h~: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-358
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2456 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
-44-
CA 02220978 l997-ll-l3
WO 96/39436 PCTrUS9~/07137
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
WAACCGCCC CACC~1 W~1~ GCGGCCGCCC AGAACTAGTG GA'1'CCCCC W GCTGCAGGAA 60
TTCGGCACGA GCAGACACAC TTG~'1-1-1'W'1' TTACAGATCC AGTGAAGTGA AAAATCAGAA 120
CTAGAAACGT ATGCACCTTC CTAGCAGCAA AGCCGCTTCT GC~11~1-1CG CAGCCTCCAG 180
TGCA WWC W CGCT WWAGA AACTTTGCGC CTTCTGGAAA GTTTAGAAAG TGAGCCACGA 240
AAGAGAGGCC ACA111CCGG GGTTTTGCGG GCCCCGC'~AT ~11-1-1C-AGA G~'1-1''1''1'C~AG 300
TGGGAAGAGG AGAGCGACAA CGTGAAAATG CCCC~1~CCG GGGCGTCCAC CGGAGTCCTG 360
CCAGCTGTCC GGCGCTGGGG TGGACGTCTG ATTTATGAAG CTCCCCATCC ACCTATCTGA 420
GTACCTGACT TCTCAGGACT GACACCTACA GCATCAGGTA CACAGCTTCT CCTAGCATGA 480
CTTCGATCTG ATCAGCAAAC AAGAAAATTT ~L~1~CCC~LA ~ GG W C ~L~11~ACCA 540
CCTACAACCA CAGAGCTGTC AT WCTGCCA TCTCTACTTC CATCCCTGTA ATTTCACAGC 600
CCCAGTTCAC AGCCATGAAT GAACCACAGT GCTTCTACAA CGAGTCCATT GC~'1-1'~'1-1-11' 660
ATAACCGAAG TGGAAAGCAT CTTGCCACAG AATGGAACAC AGTCAGCAAG ~1 W1~ATGG 720
GACTTGGAAT CA~L~'11-1'~'1' ATCTTCATCA TGTTGGCCAA CCTATTGGTC ATGGTGGCAA 780
TCTATGTCAA CCGCCG~'11'C CA~1111~C~1~A TTTATTACCT AATGGCTAAT CTGGCTGCTG 840
CAGACTTCTT TG~'1'~&~'1-1'~ GCCTACTTCT ATCTCATGTT CAACACAGGA CCCAATACTC 9OO
GGAGACTGAC TGTTAGCACA TGG~'1'C~'1-1'C GTCAGGGCCT CATTGACACC AGCCTGACGG 9 60
CATCTGTGGC CAACTTACTG GCTATTGCAA TCGAGAGGCA CATTACGGTT TTCCGCATGC 10 20
AGCTCCACAC ACGGATGAGC AACCGGCGGG TA~'1'W'1'W'1' CA'1_L~'LW'LC ATCTGGACTA 10 80
TGGCCATCGT TATGGGTGCT ATACCCAGTG TGW CTGGAA CTGTATCTGT GATATTGAAA 1140
A'1-L~'1-1'C~AA CATGGCACCC CTCTACAGTG ACT~TTACTT A~ 1-L~L~G GCCATTTTCA 1200
A~ W~L~AC ~''1"1-1'~'1'G~'1'A A'LW'1'W'L'LC TCTATGCTCA CATCTTTGGC TA'1'~'1-1'CGCC 1260
AGAGGACTAT GAGAATGTCT CGGCATAGTT CTGGACCCCG GCGGAATCGG GATACCATGA 1320
TGA~'L~'1_L~L GAAGACTGTG GTCATTGTGC TTGGGGCCTT TATCATCTGC TGGACTCCTG 1380
GATTGGTTTT GTTACTTCTA GACGTGTGCT GTCCACAGTG CGAC~L~LG GCCTATGAGA 1440
AATTCTTCCT 'L~'1'C~'1-1'GCT GAATTCAACT CTGCCATGAA CCCCATCATT TACTCCTACC 1500
GCGACAAAGA AATGAGCGCC ACCTTTAGGC AGALC~L~LG CTGCCAGCGC AGTGAGAACC 1560
CCACCGGCCC CACAGAA W C TCAGACCGCT CGG~1-1'C~'1'C CCTCAACCAC ACCATCTTGG 1620
CTGGAGTTCA CAGCAATGAC CA~-1~L~1~G TTTAGAACGG AAACTGAGAT GA WAACCAG 1680
C~'~'L~'L~'LC TTGTAGGATA AACAGCCTCC CCCTACCCAA TTGCCAGGGC AAW'L~W'l' 1740
GTGAGAGAGG AGAAAAGTCA ACTCATGTAC TTAAACACTA ACCAATGACA GTA'1-1-1~'1-LC 1800
CTGGACCCCA CAAGACTTGA TATATATTGA AAATTAGCTT ATGTGACAAC C ~CATCTTG 1860
ATCCCCATCC ~'1-1'~'1'~AAAG TA WAAGTTG GAGCTCTTGC AATGGAATTC AAGAACAGAC 1920
TCTGGAGTGT CCATTTAGAC TACACTAACT AGACTTTTAA AAGATTGTGT ~'LG~'1-1-1'W L 19 80
GCAAGTCAGA ATAAATTCTG GCTAGTTGAA TCCACAACTT CATTTATATA CAGGCTTCCC 2040
'1-1-1-1-1-1'ATTT TTAAAGGATA C~'1-11'~'ACTT AATAAACACG TTTATGCCTA TCAGCATGTT 2100
TGTGATGGAT GAGACTATGG ACTGCTTTTA AACTACCATA ATTCCATTTT '1-1'CC~'1-1'ACA 2160
TAGGAAAACT GTAAGTTGGA ATTATCTTTT GGTTAGAAAG CATGCATGTA ATGTATGTAT 2220
GCAGCATGCC TTACTTAAAA AGATTAAAAG GATACTAATG TTAAATCTTC TAGGAAATAG 2280
AACCTAGACT TCAAAGCCAG TA'1_1_L~'1_1_1'A GGTCATGAAG CAAACAATGC TCTAATCACA 2340
ATATTAACTG TTTAATTAAA A'1'~'1_L~'1'AAC AAGTATAAAA CAGGGAATGT AAGTTTATTA 2400
CCAAAGTGAT ATGTATTCCA AAAAAGGTCA TAGAAGATGA AGCAACTATA ATATTG 2456
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 364 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
~et Ala Ala Ile Ser Thr Ser Ile Pro Val Ile Ser Gln Pro Gln
Phe Thr Ala Met Asn Glu Pro Gln Cys Phe Tyr Asn Glu Ser Ile
Ala Phe Phe Tyr Asn Arg Ser Gly Lys His Leu Ala Thr Glu Trp
CA 02220978 1997-11-13
W O 96/39436 PCTAJS95/07137
Asn Thr Val Ser Lys Leu Val Met Gly Leu Gly Ile Thr Val Cys
60~le Phe Ile Met Leu Ala Asn Leu Leu Val Met Val Ala Ile Tyr
75~al Asn Arg Arg Phe His Phe Pro Ile Tyr Tyr Leu Met Ala Asn
90~eu Ala Ala Ala Asp Phe Phe Ala Gly Leu Ala Tyr Phe Tyr Leu
100 105~et Phe Asn Thr Gly Pro Asn Thr Arg Arg Leu Thr Val Ser Thr
110 115 120~rp Leu Leu Arg Gln Gly Leu Ile Asp Thr Ser Leu Thr Ala Ser
125 130 135~al Ala Asn Leu Leu Ala Ile Ala Ile Glu Arg His Ile Thr Val
140 145 150~he Arg Met Gln Leu His Thr Arg Met Ser Asn Arg Arg Val Val
155 160 165~al Val Ile Val Val Ile Trp Thr Met Ala Ile Val Met Gly Ala
170 175 180~le Pro Ser Val Gly Trp Asn Cys Ile Cys Asp Ile Glu Asn Cys
185 190 195~er Asn Met Ala Pro Leu Tyr Ser Asp Ser Tyr Leu Val Phe Trp
200 205 210~la Ile Phe Asn Leu Val Thr Phe Val Val Met Val Val Leu Tyr
215 220 225~la His Ile Phe Gly Tyr Val Arg Gln Arg Thr Met Arg Met Ser
230 235 240~rg His Ser Ser Gly Pro Arg Arg Asn Arg Asp Thr Met Met Ser
245 250 255~eu Leu Lys Thr Val Val I le Val Leu Gly Ala Phe I le I le Cys
260 265 270~rp Thr Pro Gly Leu Val Leu Leu Leu Leu Asp Val Cys Cys Pro
275 280 285~ln Cys Asp Val Leu Ala Tyr Glu Lys Phe Phe Leu Leu Leu Ala
290 295 300~lu Phe Asn Ser Ala Met Asn Pro Ile Ile Tyr Ser Tyr Arg Asp
305 310 315~ys Glu Met Ser Ala Thr Phe Arg Gln Ile Leu Cys Cys Gln Arg
320 325 330~er Glu Asn Pro Thr Gly Pro Thr Glu Gly Ser Asp Arg Ser Ala
335 340 345~er Ser Leu Asn His Thr Ile Leu Ala Gly Val His Ser Asn Asp
350 355 360~is Ser Val Val
(2) INFORMATION FOR SEQ ID NO: 3:
( i ) SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
( B ) TYPE: NUCLE I C ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
( ii ) MOLECULE TYPE: Oligonucleotide
--46--
CA 02220978 1997-11-13
W O 96/39436 PCTrUS95/07137
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOhOGY: LINEAR
(ii) MOLECULE TYPE. Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS
(A) L~N~l~: 46 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CAACCACAGG GATCCCATGG CTGCCATCTC TACTTCCATC CCTGTA 46
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 46 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: ~ligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CCCCTCGAGC TAAACCACAG AGTGGTCATT GCTGTGAACT CCAGCC 46
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 40 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
-47-
CA 02220978 1997-11-13
W O 96139436 PCTAJS95/07137
TTCACCACCT ACCTGGATCC ACAGAGCTGT CATGGCTGCC40
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CCTCATCTCA GGTACCGTTC TAAACCACAG AGTGG 35
-48-
