Note: Descriptions are shown in the official language in which they were submitted.
CA 0222l602 1997-l2-o~
Wo96/40868 PCT~S96/09517
Essential Oliqonucleotides of Vertebrate Telomerase
Related Ap~lications
This application is a continuation-in-part of
copending United States patent application Serial No.
5 08/478,352, filed on June 7, 1995. The teachings of this
application are expressly incorporated herein by reference.
Backqround of the Invention
Telomerase is an enzyme essential for telomere length
maintenance. Conventional DNA polymerases cannot complete
~o the replication of chromosome ends and, without a mechanism
to overcome this problem, chromosomes are predicted to
shorten with each round of cell division. Watson, J.D.
(1972) Nature New Biol. 239:197-201. Telomerase is a
specialized telomere specific polymerase comprised of RNA
and protein components, which elongate chromosomes through
de novo nucleotide sequence addition.
A steady state equilibrium of telomere length is
established in immortal single cell eukaryotes and is
regulated by a number o~ dif~erent genes. Greider ( 1994)
20 Current Opinion in Genetics and Dev. 4:203-211.
Strikingly, length maintenance does not occur in primary
human somatic cells and when they are passaged in culture,
telomere length decreases in these cells. Primary human
cells have a limited lifespan in culture and telomere
chortening correlates well with loss of replicative
capacity. Harley, et al. (1990) Nature 345:458-460;
Allsopp, et al. (1992) Proc. Natl. Acad. Sci. USA, USA
89: 10114-10118. Telomere shortening in tissues in vivo has
been demonstrated for fibroblasts, leukocytes, and
endothelial cells. Germ cell telomeres do not shorten with
age, suggesting the germline is protected from telomere
CA 0222l602 l997-l2-0~
W 096/40868 PCT~US96/09517
--2--
loss.
Recent evidence suggests that the telomerase enzyme
may be a new target for cancer therapy. Short telomeres
are also found in cancer tissues. Telomere shortening may
be due to the inability of conventional polymerase to
replicate chromosome ends. Kim, et al . (1994) Science
266:2011-2015, were not able to detect telomerase in a
large number of primary cell lines and primary human
tissues. In contrast to normal human cells, cancer cells
from tissue culture and those taken directly from tumors
contain detectable telomerase activity. Counter, e t al .
(1994) Proc. Natl. Acad. Sci. USA 91:2900-2904; Kim, et
al., supra. These findings suggest that targeting
telomerase may be an effective cancer treatment. Harley,
15 et al. (1994) Cold Spring Harbor Lab Symposium on
Quantitative Biology, 59:307-31S. However, to understand
the regulation of telomerase in human diseases and
- disorders, it is essential to understand how telomerase
functions.
Summar~ of the Invention
Described herein are truncated vertebrate ( e . g.,
mAmm~lian and particularly human) telomerase and DNA
oligonucleotides comprising truncated segments of the gene
encoding telomerase RNA component, such as human telomerase
RNA component, which are essential for telomerase activity
(e.g., human telomerase activity) in cells and tissues.
Also disclosed are DNA and RNA oligonucleotides sharing the
biochemical and biological function of these essential
oligonucleotides and differing only in alteration,
substitution and/or deletion of one or more nucleotides
(nt) which do not affect the activity of the enzyme. These
oligonucleotides can be derived from other vertebrates,
especially mammals. Oligonucleotides which hybridize to
the above-described DNA or RNA sequences are also included
CA 0222l602 1997-12-0~
W 096/40868 PCTAJS96/09517 --3--
within the scope of this invention.
The truncated vertebrate telomerase of this invention
is an essential oligonucleotide (RNA) and telomerase
protein. The protein component can be comprised of more
than one subunit. Preferably the RNA is encoded by DNA
selected from nucleotides 44-204 of hTR as shown in Figure
6 (SEQ ID NO:l). Other essential oligonucleotides include
sequences encompassing nucleotides 1-203, 1-273, 1-418, or
DNA encompassing nucleotides 44-204 and sequential
deoxyribonucleotides but shorter than nucleotides 1-445
(SEQ ID NO:2) of hTR as shown in Figure 6. Further
provided is a 30 nucleotide sequence (nucleotides 170-199
of SEQ ID NO:1) which is required for functional RNA
component activity.
Both the complete RNA and protein components of
telomerase were thought to be necessary for telomerase
activity and, thus, for maintenance of telomeric length in
chromosomes. However, as described herein, truncated
telomerase, in which the RNA component is shorter than the
complete RNA component of human telomerase has been
produced and shown to have enzymatic activity. The
truncated human telomerase described herein can be produced
by combining telomerase protein components with
oligonucleotides prepared by recombinant methods,
oligonucleotides which are isolated from sources in which
they occur in nature or oligonucleotides which are
synthetically produced. Similar types of truncated
telomerases can be constructed by combining truncated
oligonucleotides from other vertebrate telomerase RNA
components with telomerase protein.
This invention also provides recombinant vertebrate
telomerase in which the components are telomerase protein
and the entire RNA component or a truncated RNA component,
such as those encoded by nucleotides 44-204 of hTR as shown
in Figure 6 (SEQ ID NO:l) or other essential
CA 0222l602 l997-l2-0~
W096/40868 PCTAUS96/09517
--4--
oligonucleotides including sequences encompassing
nucleotides 1-203, 1-273, 1-418, or DNA encompassing
nucleotides 44-204 and sequential deoxyribonucleotides but
less than 1-445 of hTR as shown in Figure 6, or the 30
nucleotide sequence (nucleotides 170-199 of SEQ ID NO:l)
which is re~uired for functional RNA component activity.
The telomerase protein can be synthesized, produced
recombinantly or obtained from sources in which it occurs
in nature.
The oligonucleotides of this invention can be used by
themselves or combined with the protein of vertebrate
telomerase for use in diagnostic or therapeutic methods and
in assays for telomerase. Oligonucleotides that encompass
the essential region of vertebrate telomerase are
especially useful to block the function of telomerase by,
for example, forming triple helices with DNA encoding RNA
components, preventing transcription.
In another aspect of this invention, essential
oligonucleotides may serve as probes or primers to detect
the presence of telomerase in cells and tissues. Such
probes or primers can be used diagnostically to determine
the presence and amount o~ telomerase in cell, tissue or
fluid samples obtained ~rom an individual.
The oligonucleotides of this invention as well as the
vertebrate telomerases described above can be used to treat
disorders arising from the presence of normal or abnormal
telomerase or to provide telomerase wherever it could be
beneficial. Oligonucleotides in a sense or antisense
orientation can prevent or inhibit telomerase activity by
binding to essential regions of the RNA component or to
telomerase protein. Sense or antisense sequences can be
delivered with or without telomerase protein by methods of
gene therapy (such as infection or trans~ection), as can
plasmid or expression vectors encompassing recombinant DNA
encoding vertebrate telomerase.
CA 02221602 lss7-12-o~
wo ~6l408~ PCT/US96/09517
--5--
Pharmaceutical compounds consisting of
oligonucleotides, telomerase, or truncated telomerase,
alone or combined with a suitable carrier, diluent or salt
are also included in this invention. These compounds can
be therapeutically applied to stimulate or modify the
effects of telomerase in order to treat conditions,
disorders or diseases arising from the lack of or abnormal
telomerase activity. Examples of such uses include
initiation or restoration of telomerase activity to
counteract senescence or to prevent immortalization, and
prevention or inhibition o~ telomerase activity in
immortalized cells such as tumor cells or parasites.
Another important feature of this invention is the use
of the truncated or recombinant telomerase to screen for
telomerase inhibitors which can be used to prevent
telomerase expression or activity in cells and tissues.
Telomerase activity of invading eukaryotic parasites or
tumors can also be detected and quantified. Therefore, the
present invention provides a diagnostic tool through which
inhibitors of telomerase activity can be tested and
developed, and by which diseases such as cancer, or
infections, such as yeast or protozoan diseases, can be
diagnosed
Brief Descri~tion of the Drawinqs
Figure 1 shows that the reconstitution of human
telomerase activity after MNase treatment is specific to
hTR.
Figure 2 shows the activity of telomerase
reconstituted with telomerase RNA mutations and assayed in
the absence or presence of dATP.
Figure 3 represents a functional analysis of 5l and/or
3~ terminal deletions of hTR.
Figure 4 represents a mutational analysis of hTR
residues 170-199.
,
CA 02221602 1997-12-0~
W O 96/40868 PCT~US96/09517
--6--
Figure 5 is a linear representation of full length hTR
which includes the template region (white box) and
positions of several restriction sites present in the gene
encoding hTR.
Figure 6 is the nucleotide sequence (SEQ ID NO:1) of
the gene encoding the human RNA component of telomerase
with the template boxed. The cleavage sites for several
restriction endonucleases are marked.
Figure 7 is the hTR sequence used for several hTR
reconstitution experiments with the template and cleavage
sites for restriction en~o~l~cleases marked.
Detailed DescriPtion of the Invention
This invention provides isolated DNA encoding portions
of the RNA component of human telomerase (hTR) that are
essential to produce a biologically active human telomerase
enzyme. The term "hTR" is used interchangeably for the RNA
component or the gene encoding the RNA component. Those of
skill in the art will recognize which type of nucleic acid
is intended where appropriate in this description. This
invention also provides truncated human telomerase RNA
which, in combination with telomerase protein, produces
biologically active human telomerase (i.e., one which
catalyzes the addition of deoxyribonucleotides to the
telomeres of chromosomes, thereby elongating the telomeres
of these chromosomes). The essential oligonucleotides
described herein are substantially shorter (comprise fewer
nucleotides) than the endogenous human RNA component. As
used herein, the term "essential" oligonucleotides refers
to oligonucleotides which, when coupled with the human
telomerase protein, form biologically active telomerase and
without which biologically active telomerase is not
produced. Both RNA that is essential to functional
telomerase and DNA encoding RNA that is essential are
referred to as ~essential oligonucleotides" (essential DNA,
CA 02221602 1997-12-0~
O 96/40868 PCTAUS96/09517
--7--
essential RNA). Essential DNA of this invention includes
isolated DNA sequences of hTR selected from the group
consisting of:
a) nucleotides 44-204 of hTR; b) nucleotides 1-203, 1-273,
or 1-418 of hTR; and c) DNA encompassing nucleotides 44-204
and sequential deoxyribonucleotides but shorter than 1-445
of hTR. It further includes nucleotides 170-199 of hTR
which are essential for telomerase activity although
additional nucleotides are re~uired to provide a
biologically active RNA component.
This invention encompasses isolated DNAs whose
sequences are provided (Figures 5 and 6) and other DNAs
which encode the same RNA sequences. This invention
further provides DNA which hybridizes to the essential DNA
described above, especially under stringent conditions such
as those described in Ausubel, et al. (1995) Curre~t
Protocols in Molecular Biology - A Laboratory ~;~n~J~ 7,
Chapter 6, John Wiley & Sons, NY, and DNA sequences which,
but for the degeneracy of the genetic code, would hybridize
to the essential DNA described above.
Applicants have discovered that the entire RNA
sequence of the RNA component of human telomerase as shown
in Figure 6 is not required for telomerase activity. In
fact, only certain portions of the RNA component are
essential to produce an active telomerase (e.g., by
combining with human telomerase protein). These encompass
the template of the RNA component and a minimum number
(160) of additional ribonucleotides upstream and downstream
along the molecule (See encoding DNA molecule in Figure 6,
nucleotides 44-204).
This invention also provides, for the first time,
functional vertebrate telomerase, produced with the
complete nucleotide sequence of the RNA component or with
the essential oligonucleotides of the RNA component
(sequences ranging from 160 to 445 nucleotides in length)
CA 0222l602 l997-l2-o~
WO ~G/~ B~ PCT/US96/09517
--8--
which have been delineated by the Applicants.
It should be noted that truncated vertebrate
telomerases (constructed with an RNA component comprising
fewer ribonucleotides than the endogenous RNA component of
the same species), for the first time, provide telomerases
modified by deletion of nonessential ribonucleotides and
permit the production of telomerase variants which retain
telomerase b; n~l; ng activity. These variants are useful in
the treatment of conditions such as cell senescence
(ageing) and in diseases as anti-tumor drugs.
The following generally describes the reconstitution
of recombinant human telomerase and the discovery of the
essential oligonucleotides for telomerase activity. More
specific methodology can be found in the examples.
R~con~titution o~ human telomerase acti~rity after ~ase
treatment
To determine whether human telomerase activity could
be reconstituted from isolated protein and RNA components,
partially purified human telomerase extracts were treated
with MNase to remove endogenous telomerase RNA. Telomerase
activity was followed by a modification of the TRAP assay
(Kim et al., supra) (see Exemplification). After nuclease
digestion, which abolished endogenous telomerase activity,
activity was restored by incubating MNase-treated
telomerase with EDTA and an in vitro transcribed hTR
transcript (hTRl-557), followed by the addition of Mg
(Figure 1). The hTRl-557 was transcribed from plasmid
pGEM33 digested with EcoRV. The hTRl-557 contains the
entire hTR (445 nucleotides (nt)) plus downstream sequences
(112 nt). Vector sequences 5' and 3~ to hTR genomic
sequence were also transcribed so that the total length of
the transcript is 630 nt. When no RNA was added, no
telomerase activity was restored. To test for linearity in
the telomerase reaction, two different concentrations of
CA 0222l602 l997-l2-0~
WO 96/40868 PCT/US96/09517
_g _
extract (6 ~Ll and 12~l) were used and to test for linearity
in the reconstitution, two different concentrations of RNA
were added (O.4 ~g and O.8 ~Lg). The amount of
reconstituted activity increased with the increased level
5 of both the extract and hTR indicating that reconstitution
~ was dependent on the added RNA (Figure 1).
Reconstitution is specific to human telomerase RNA
To determine whether reconstituted activity was
specific to hTR, several nonspecific RNAs were tested in
place of hTR in the reconstitution assay. The RNAs tested
were E. coli 5S, E. coli 16S and 23S RNAs, and Tetrahymena
telomerase RNA (Figure 1). No activity was seen when these
RNAs were added instead of hTR in the reconstitution assay.
Also, no T2G~ repeats were generated by adding Tetrahymena
telomerase RNA to MNase-treated human extract, using the
C-strand primer C,,A2 to detect the presence of amplified
elongation products (see below and Exemplification).
Activity was also not reconstituted using the mouse RNase P
RNA, the antisense strand of hTR and the mouse telomerase
RNA (mTR) (Blasco et al., (1995) Science 269:1267-1270).
To determine whether the signal in the TRAP assay was
dependent on human telomerase extract and not due to a
reaction involving amplification of the added hTR alone,
reconstitution was performed in the absence of human
telomerase extract. No amplified products were detected
under these conditions indicating reconstitution is
dependent on protein components. To further test the
specificity of the reconstituted telomerase activity,
experiments were performed using telomerase RNAs with
mutations in the template region. Both in vivo and in
vitro experiments with Tetrahymena telomerase showed that
altering the template region of the telomerase RNA results
in reprogramming the sequence that telomerase synthesizes
(Yu et al. (199O) Nature 344:126-132; Autexier and Greider
CA 02221602 1997-12-0~
W O ~614086~ PCT~US96/09S17
--10--
(1994) Genes & Dev. 8:563-575). Similarly when the genes
encoding the hllm~n or mouse telomerase RNAs were mutated in
the template region and the genes transfected into cultured
cells, telomerase activity was isolated which synthesized
the expected mutant telomere repeats (Blasco et al., 1995
Science 269:1267-1270; Feng, et al. (1995) Science
269:1236-1241.
Analogous hTR mutants were used in the in vi tro
reconstitution experiments. In the plasmid pGEM34, the
sequence encoding the template region of hTR was changed
from CTAACCCTA to CAAACCCAA (encoding hTR-C3A3) and in
pGEM36 to CCAACCCCA (encoding hTR-C4A2), which should
specify TTGGGG and TTTGGG repeats, respectively. The RNA
transcribed from these plasmids, hTR-C3A3 and hTR-C4A2, like
hTRl-557, contain sequences downstream of hTR and vector
sequences (see Exemplification). To assay the products of
the mutant telomerases, a two step amplification protocol
was used as described (Feng, et al. (1995) Science
269:1236-1241). In the first step, dATP was omitted from
the initial telomerase reaction. Under these conditions
wild type (naturally-occurring) telomerase will not
generate elongation products, however if the mutant RNAs
(hTR-C3A3 and hTR-C4A2) are functional, they should generate
telomerase products. For the PCR amplification step, dATP
was added and the C-strand primer corresponding to the
appropriate mutant was used for PCR amplification (see
Exemplification).
Amplified elongation products were detectable in the
absence of dATP for the mutants but not for the wild type
RNA added in reconstitution, indicating the requirement and
specificity of hTR in the in vitro reconstitution of human
telomerase activity (Figure 2). No long elongation
products are generated with the addition of hTR-C4A2, as
was seen in vivo (Feng, et al., supra ) . Telomerase
reconstitution was also assayed with hTRl-557 containing a
CA 02221602 1997-12-0~
W O 96/40868 PCTAUS96/09517
--11--
17 base insertion at residue 176 (hTR+17) (Feng, et al.,
supra). Only very weak elongation products were detectable
with this mutant. In other experiments this RNA ~ailed to
give signi~icant levels o~ reconstitution. These results
are corsistent with results from the in vivo reconstitution
of mutant RNAs in human cells, where this RNA was also not
functional (Feng, et al., supra). The presence of the 17
base insertion at nucleotide position 176 appears to
inhibit the ~unction of the human telomerase RNA.
Identification of a 160 nucleotide ~;n; 1 functional
region of hTR between re3idues 44-204
The 450 nucleotide human telomerase RNA is much larger
than the Tetrahymena (160 nt) and other ciliate telomerase
RNAs (147-209 nt), however it is signi~icantly smaller than
the yeast telomerase RNA (1300 nt) (Greider and Blackburn
(1989) Nature 337:331-337; Lingner et al. (1994) Genes &
Dev. 8:1984-1998; Singer and Gottschling (1994) Science
266:404-409; Feng, et al., supra; McEachern and Blackburn
(1995) Nature 376:403-409; McCormick-Graham and Romero
(1996) Mol. Cell. Biol. 16:1871-1879; Zaug et al. (1996)
Nucleic Acids Res. 24:532-533). To determine the essential
functional regions o~ the hTR and whether the entire RNA
sequence is required, telomerase activity was reconstituted
with RNAs deleted at the 5' and/or 3' ends (Figures 3 and
5). For a more accurate analysis of hTR, a plasmid
encoding only hTR was constructed that will generate an RNA
without downstream genomic sequences or vector sequences
(upstream or downstream) (phTR+1; see Exempli~ication). To
generate deletions in the 3' end of hTR, RNA was
transcribed from phTR+1 that had been cut with speci~ic
restriction endonucleases at various positions within the
coding region of hTR. Full length wild-type hTR is denoted
as hTR1-445. The numbers re~er to the position o~ residues
within the ~ull length hTR. Each RNA, with the enzyme used
CA 02221602 1997-12-0~
W O 96/40868 PCT~US96/09517
-12-
to cut the plasmid (in brackets) is denoted as hTR1-445
(FspI), hTR1-418 (ApaLI), hTR1-273(BspE1), hTR1-203 (SmaI),
hTR1-182 (PvuII), hTR1-169 ( BbvI ) and hTRl-159 (XbaI). To
generate the RNAs deleted at both the 5' and 3' ends
(hTR44-l7o~ hTR44-184 and hTR44-204), RNA was transcribed
using PCR fragments generated using primers that anneal at
the respective positions of the gene encoding hTR (see
Exemplification). Di~ferent amounts (1.25, 2.5 and 5 pmol)
of each hTR deleted at the 3' end were added in the
reconstitution reaction. Activity increased with
increasing amounts of RNA.
Significant levels of activity were restored with 2.5
pmol of hTRs beginning at postion +1 and extending 445,
418, 273 and 203 nt in length. Quantitation of the
amplified elongation products (see Exemplification)
indicated that the addition of hTR1-182 and hTR1-169
restored little activity (1-3~ compared to the addition of
full length hTR1-445) and activity was undetectable with a
hTR 159 nt in length (hTR1-159). The relative activities
of the 3' deletions of hTR are summarized in Figure 5.
This deletion analysis showed that 242 residues at the 3'
end are not essential for telomerase activity. These
results also suggest that a region of hTR, approximately 44
residues in length, between positions 159 and 203 is
important for hTR function. RNAs were then tested which
were truncated at both the 5' and 3' ends that contained
residue 44 through to either residue 184 or 204. Both of
these RNAs were active in reconstitution, although they had
reduced activity compared to the addition of full length
hTR. An hTR truncation starting at position 44 and ending
at residue 170 (hTR44-170) was not active in
reconstitution, indicating that a region of hTR,
approximately 33 residues in length, between 170 and 203 is
important for hTR function. The ability of RNAs containing
only residues 44-184 and 44-204 to reconstitute activity
CA 02221602 1997-12-0~
WO 96/40868 PCT/US96/09517
-13-
suggest that the 44 residues preceding the template are not
essential for activity.
~ A 30 nucleotide region of hTR s~Ann;n~ residues 170-199 is
essential for activity
To more clearly define the role of residues 170 to 203
of hTR in telomerase function, substitutions were made
spanning residues 170 to 179 (hTR170*), 180 to 189
(hTRl8o*) and 190 to 199 (hTR190*). Sequences in phTR+1 at
positions 170-179 (5'-CAAAAAATGT-3') were replaced by
5'-~'l"l"l"l"l"l'ACA-3', at positions 180-189 (5'-CAGCTGCTGG-3')
by 5'-GTCGACGACC-3' and at positions 190-199
(5'-CCCGTTCGCC-3') by 5'-GGGCAAGCGG-3'. Different amounts
of these hTRs (1.25, 2.5 and 5 pmol) were tested in
reconstitution and there was an increase in activity with
increasing amounts of RNA added. Levels of telomerase
activity reconstituted with 2.5 pmol of these RNAs were
compared to that reconstituted with three 3' deletions
(hTRl-l59~ hTR1-169 and hTR1-182) or hTRl-445 (Figures 4
and 5). Reconstitution with either hTR170*, hTRl8o*~
hTR190* restored little activity, comparable to the
activity restored by hTR1-169 and hTRl-182 (less than 8~ of
activity restored by hTRl-445). These results suggest that
either the sequences or potential secondary structures in
the 30 nucleotide region between 170 and 199 are essential
for activity. In addition this region contains the site of
the 17 nucleotide insertion that disrupted the ability of
hTR to function in vitro and in vivo. Thus these mutants
define an essential functional region of the hTR.
Thus, this invention delineates the essential
oligonucleotides necessary to reconstitute a functional
human RNA component. The findings described herein are
summarized as follows. Human telomerase activity was
restored to MNase-treated partially purified human
telomerase by the addition of EDTA and in vitro transcribed
CA 0222l602 l997-l2-0~
W O 96/40868 PCT~US96/09517
-14-
human telomerase RNA, as previously described for
Tetrahymena telomerase (Autexier and Greider (1994) Genes &
Dev. 8:563-575). The levels o~ reconstituted activity
compared to native activity varied, but were always lower
(less than 10~), as was the case for levels of
reconstituted Tetrahymena telomerase, suggesting that the
added hTR may not be completely functional compared to
endogenous telomerase RNA. The transcribed RNA may lack
some modifications or assume incorrect conformations which
prevent it from forming a functional RNP (Autexier and
Greider (1994) Genes & Dev. 8:563-575). The extra
sequences downstream of hTR and the transcribed vector
sequences did not inhibit the ability of hTR1-557 to
reconstitute telomerase activity, compared to full length
hTR1-445.
The inability to restore human telomerase activity
with the mouse telomerase RNA (mTR), even though human and
mouse telomerase both catalyze the addition of T2AG3
repeats, indicates a requirement for species-specific
telomerase protein-RNA interactions. In Tetrahymena, the
telomerase enzyme is about 250 kDa and consists of two
proteins, of 80 and 95 kDa (Collins et al. (1995) Cell
81:677-686). The predicted sizes of the human (750 kDa)
and mouse telomerase (~1000 kDa) enzymes differ ~rom each
other, and are larger than the Tetrahymena telomerase
enzyme (Greider et al. (1996) In: M. DePamphlis, ed., DNA
replication in eukaryotic cells, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., in press). The
mouse telomerase enzyme may consist of more or larger
protein components than the human enzyme and consequently,
at least in vitro, mTR may be unable to form a functional
complex with the human telomerase proteins.
Altering the template region of hTR changed the
sequence of the elongation products generated by
reconstituted telomerase, as seen with Tetrahymena ,in vivo
CA 02221602 1997-12-0~
WO 96/40868 PCT/US96/09517
-15-
and in vitro, (Yu et al. (1990) Nature 344:126-132;
Autexier and Greider (1994) Genes ~ Dev. 8:563-575) and
human and mouse (Blasco et al., 1995, supra; Feng, et al.
- (1995) Science 269:1236-1241, in vivo, confirming the
requirement and specificity of hTR in the in vi tro
reconstitution of human telomerase activity. The
specificity and fidelity of reconstituted activity suggests
that the reconstitution assay will be a useful biochemical
tool for dissecting native human telomerase function, as it
has been for Tetrahymena (Autexier and Greider, (1995)
Genes & Dev. 15:2227-2239).
Greater than half of the 445 nt hTR is not absolutely
required for telomerase activity in vi tro, including
residues 5' to the template. These studies define a
minimal functional region of hTR, approximately 159-203 nt
length. This minimal function region is similar in size to
the full length telomerase RNAs from ciliates, which range
in size from 147-208 nt (Greider, et al. (1996);
McCormick-Graham and Romero, supra). However, reduced
activity of telomerase reconstituted with the deleted hTRs
which are still functional, compared to activity
reconstituted with full length hTR, suggests that the
deleted regions may contain sequences or potential
secondary structures important for binding of telomerase
protein components, for assembly and for overall structure
and function of the telomerase complex. It is also
possible that the remainder of the RNA plays some role in
vivo, perhaps by binding proteins important in the
regulation of telomerase. This deletional analysis of hTR,
and the size of the telomerase RNAs in S. cerevisiae and K.
lactis ( 1300 nt) suggest that the entire telomerase RNA in
these organisms may not be needed for function. In yeast,
the U2 snRNA is 1175 nt long compared to in most other
organisms where it is about 190 nt long (Ares, (1986) Cell
47:49-59). Internal deletions which reduce the length of
CA 02221602 1997-12-o~
Wo96/40868 ~ PCT~S96/09517
-16-
the yeast U2 snRNA to that of other U2 snRNAs are still
active in splicing and yeast with the deleted U2 snRNA have
normal growth rates (Igel and Ares (1988) Nature 334:450-
453; Shuster and Guthrie (1988) Cell 55:41-48). The yeast
5 Ul snRNA is also larger (568 nt) than in metazoans where it
is 165 nt. Yeast cells carrying a deletion of 316 internal
residues allows wild-type growth (Siliciano et al. (1991)
Nucleic Acids Res. 19:6367-6372). Deletional analysis of
hTR (in vivo) and yeast telomerase RNA will be required to
further elucidate the role of the extra residues in these
longer telomerase RNAs. It is not clear, for hTR, mTR, or
the yeast telomerase RNAs, if there is a m; n; m~ 1 core
conserved secondary structure for all of these RNAs which
is essential, like with RNase P (Waugh et al. (1989)
15 Science 244: 1569-1571) .
Since deleted forms of hTR were active in
reconstitution, theoretically, small pieces of endogenous
hTR could remain following MNase digestion which could
intermolecularly complement the synthetic hTR forms.
20 Northern analysis of MNase-treated extract, however,
indicate that hTR is digested into pieces smaller than 50
nt. Further, titrations of the synthetic hTR deletions
showed that the amount of reconstituted activity increased
with increasing amounts of hTR, demonstrating that
25 reconstitution was dependent on the added RNA and not
endogenous RNA. Since the amount of RNA added was
approximately lO00 fold over that orginally present in the
extract, it is clear that the reconstituted activity was
due to the addition of synthetic RNA and not to the
complementation of synthetic RNA by the un-degraded
portions of the RNA.
In Tetrahymena and other ciliate telomerase RNAs,
there is a conserved region upstream of the template, which
plays a role in determining the 5' boundary of the
template, and the sequence synthesized by telomerase in
CA 0222l602 l997-l2-0~
W O ~ 368 PCT~US96/09517
-17-
vitro (Romero and Blackburn (1991) Cell 67:343-353;
Autexier and Greider, 1995, supra). This sequence is
absent in hTR, mTR and yeast telomerase RNAs (Singer and
- Gottschling (1994) Science 266:404-409; Blasco et al.,
1995, supra; Feng, et al., supra; McEachern and Blackburn
- (1995) Nature 376:403-409. The absence of this seauence
and the ability of hTR44-204, which lacks sequences 5' to
the template, to reconstitute telomerase activity, suggest
that human, mouse and yeast may use a di~ferent mech~n;cm
to regulate the 5' template boundary. Most of the
telomerase RNAs contain templates which are located
approximately 50 nt from the 5' end, except for yeast where
the template is more centrally located (Singer and
Gottschling, supra; McEachern and Blackburn, supra). In
the Tetrahymena telomerase RNA, which is only 159 nt in
length, deletions of as little as 19 residues from the 5'
end abolish activity indicating that residues 5' to the
template are essential. In hTR, residues 5' to the
template are not essential in vitro. However, the 5' end
may play some role, in vivo, perhaps by maintaining a
correct RNA structure for proteins to interact with other
sequences or structures of hTR.
Mutagenesis of sequences spanning residues 170-179,
180-189 or 190-199 of hTR almost completely abolished the
ability of hTR to function in reconstitution, suggesting
that these sequences are functionally and/or structurally
important, perhaps by binding telomerase or other proteins.
Low levels of activity were detectable when telomerase is
reconstituted with hTR170*, hTR180* or hTRlgo*, suggesting
that proteins may still bind weakly to the other 20 nt
which are not mutated in each case. Similarly, insertion
of 17 nt at position 176 also dramatically decreased
activity, providing further evidence that the structure or
sequence of this 30 nt region is important.
The ability to reconstitute human telomerase activity
CA 0222l602 l997-l2-0~
W O 96/40868 PCT~US96/095l7
-18-
using inactive protein and mutant hTR has allowed a
functional dissection of telomerase. With the definition of
a m;n;m~l functional region of hTR, the role of specific
sequences in this region and their importance for function
can now be tested directly using the reconstitution assay.
With the identification of human telomerase protein
components a thorough underst~n~;ng of human telomerase
protein-interactions and of the mechanism of human
telomerase action will be possible.
In one aspect, this invention provides nucleic acid
hybridization probes or primers which hybridize to a sample
nucleotide sequence, its complement or to a fragment of
either of these. Thus a method of determining the presence
of telomerase in a cellular sample obtained from an
individual is available. Methods of detecting telomerase
with an essential oligonucleotide (DNA or RNA) in a cell,
tissue, or fluid sample include the steps of: preparing
the sample so that the essential oligonucleotide will
hybridize to telomerase in the sample; combining or
contacting the sample with the DNA or RNA under conditions
under which hybridization of complementary nucleic acids
occurs; and detecting hybridization wherein if
hybridization occurs, telomerase is present in the sample.
Further assays can be carried out to confirm whether
telomerase is active. An additional step can also be taken
to measure the amount of hybridization to determine the
amount of telomerase in the sample. These essential
oligonucleotide probes can be detectably labeled (for
example with radioactive or fluorescent materials, or with
biotin or avidin) by methods known to those of skill in the
art.
In the same manner, primers which are all or a portion
of essential oligonucleotides can be used to initiate DNA
synthesis for amplification or diagnostic procedures. If a
primer is a portion of an essential oligonucleotide, it
CA 02221602 1997-12-0~
W O 96/40868 PCT~US96/09517
--19--
must be of sufficient length to hybridize to DNA and remain
hybridized under the conditions used, although the
nucleotides may not be identical in sequence. In general,
a primer will be at least 12 nucleotides and can be up to
100 nucleotides in length. Preferably primers will be 18
to 30 in length. The primers may be labeled before
hybridization so ~hat detection of labeled hybr~di~ed
material correlates with the presence and/or amount
telomerase in a sample taken from an individual. These
methods can be carried out following amplification of the
RNA component for early detection of diseases, such as
cancers or parasites, where only a few cells may be present
in the sample. They also relate to procedures wherein
recombinant telomerase is synthesized (with a whole or
truncated RNA component) and an active telomerase enzyme
produced.
Knowing what sequences are essential for activity
could also make it possible to determine whether alteration
of the endogenous RNA component has occurred in a portion
of the molecule necessary for activity. Alterations,
substitutions, or deletions of nucleotides, or other
abnormalities in essential regions may inhihit or
inactivate the enzyme so that telomeres of chromosomes are
not lengthened.
Another aspect of this invention relates to the use of
the isolated DNA sequences in antisense therapy to block
telomerase activity. Antisense therapy refers to
administration of or in si tu generation of oligonucleotides
or their derivatives which specifically hybridize with the
endogenous telomerase RNA component and/or which hybridize
with genomic DNA encoding the RNA component so as to
inhibit expression of that enzyme, e.g., by inhibiting
transcription and/or translation.
- This invention also relates to antisense constructs
that can be delivered, for example, in an expression vector
~ -- = = =
CA 02221602 1997-12-0~
W O 96/40868 PCT~US96/09517
-20-
that, when transcribed in the cell, produces RNA which is
complementary to at least the essential portions of the
telomerase RNA component. Bxpression vectors, such as
plasmids, are capable of directing the expression of genes
to which they are operatively linked. Alternatively, the
antisense construct is an oligonucleotide which is
generated ex vivo and which, when introduced into the cell,
causes inhibition of expression by hybridizing with the
telomerase RNA component or by hybridizing with genomic
sequences encoding the RNA component, thus preventing
telomerase from serving as a template for telomeric DNA
synthesis. Such oligonucleotides are preferably modified
oligonucleotides which are resistant to endogenous
nucleases and therefore stable in vivo. General approaches
to constructing oligomers useful in antisense therapy have
been described, for example, in Inouye, U.S. Patent No.
5,272,065, incorporated herein by reference, and reviewed
by Stein, et al. (1988) Cancer Res. 48: 2659-2668.
There are other methods by which the endogenous
telomerase can be inactivated. For example, insertion of
gene sequences into target tissues in a sense orientation
can be used to produce RNAs that bind to essential
telomerase protein, thereby inactivating the enzyme. For
example, a DNA construct encoding an RNA essential
oligonucleotide can be linked to a strong promoter to
express excess sense strands at a high level which
competitively inhibit the specific binding of an essential
protein. Other sense sequences may be constructed that
will bind to the DNA essential oligonucleotides to form a
triple helix and prevent transcription. Knowledge of the
essential portions of the RNA component increases the
likelihood of success ~or these endeavors because these
constructs contain nucleic acid sequences that will bind.
Oligonucleotides that blnd to the RNA component of
telomerase may also be combined with ribozyme sequences to
,
CA 0222l602 l997-l2-o~
Wo ~'40868 PCT/US96/09517
-21--
produce molecules that not only bind but specifically
cleave the RNA component, thus inactivating telomerase.
Both RNA and protein components are involved in
telomeric primer recognition and binding by telomerase
(Collins and Greider (1993) Genes & Dev. 7:1364-1376). The
ability to reconstitute human telomerase activity from
partial RNA component sequences and the telomerase protein
not only facilitates the structural and f~mctional
dissection of this ribonucleoprotein, it allows the
production of flln~mental synthesized enzymes with multiple
applications.
Truncated or recombinant human telomerase in all of
the disclosed forms can be used to design drugs or produce
pharmaceutical compositions for treating disorders in which
telomerase activity would be beneficial. Functional
telomerase molecules can be delivered to cells to stimulate
telomerase activity in cells normally lacking detectable
telomerase or in cells which are abnormal because
telomerase activity is present. Telomerase can be used to
extend replicative cell life span and deter cell senescence
and possible subsequent immortalization of cells.
Accordingly, the modified oligomers and telomerase
enzymes of the invention are usefu~ in therapeutic,
diagnostic and research contexts. Recombinant telomerase
can be especially useful in therapy where it is important
to slow the loss of telomere sequences (i.e., preventing
senescence of cells).
Pharmaceutical compositions containing the telomerases
of this invention can be used to treat conditions such as
those described above. Additionally, the telomerase
molecules can be used in screening other agents, for
example, in binding assays, to identify compounds which
nhibit or stimulate the activity of telomerase in vi tro or
ln Vi VO .
Pharmaceutical compositions containing the telomerases
CA 02221602 1997-12-0~
W O9'/~0~6~ PCTrUS96/09517
-22-
or essential oligonucleotides of this invention may also
contain pharmaceutically acceptable carriers, diluents,
fillers, salts, buffers, stabilizers and/or other materials
well known in the art. The term "pharmaceutically
acceptable~ means a non-toxic material that does not
interfere with the effectiveness of the biological activity
of the active ingredients(s). The characteristics of the
carrier or other material will depend on the route of
administration which can be carried out in a variety of
conventional ways. The amount of the active ingredient(s)
in the pharmaceutical composition of this invention will
depend upon the nature and severity of the condition being
treated, and may depend on the nature of any prior
treatments which the individual has undergone. In any
event, such methods require the administration of a
therapeutically effective amount of the active
ingredient(s) which is at least the minimum amount
necessary to effect a beneficial change in the condition
being treated.
It will be appreciated that the actual preferred
amounts of active compound in a specific case will vary
according to the specific compound being utilized, the
particular compositions formulated, the mode of
application, the particular situs of appIication, and the
individual being treated. Dosages for a given recipient
will be determined on the basis of individual
characteristics, such as body size, weight, age and the
type and severity of the condition being treated.
It should be noted that the formulations described
herein may be used for veterinary as well as human
applications and that the term "individua]" or "host"
should not be construed in a limiting m~nner,
Primary cells express little or no telomerase
activity, but following immortalization, cancer cells
reactivate telomerase and maintain telomere length. In
-
CA 02221602 1997-12-o~
Wo96/40868 ~~ PCT~S96/09517
-23-
fact, telomerase activity has been demon~trated in human
ovarian carcinoma cells, but not in normal cervical
endothelial cells. Counter, et al. (1994) Proc. Natl.
Acad . Sci . USA 91: 2900-2904. Telomere shortening before
crisis may be lethal, but those cells that can reactivate
telomerase maintain telomere length and survive crisis.
This model suggests that if telomerase is required for the
growth of immortalized cells, telomerase inhibitors may be
excellent anti-cancer drugs.
This invention provides a method by which cancers may
be diagnosed prior to or during clinical manifestation of
symptoms by means of detecting telomerase activity in
somatic cells that normally do not express telomerase.
Telomerase RNA expression in a sample of somatic cells or
tissue can be detected using the DNA or RNA probes
described herein; this is indicative of expression of
telomerase which, in turn, is an indication of immortal
cancer cells since most somatic cells do not normally
produce telomerase. Detection of hybridization in tissues
that normally lack telomerase is an indication of a
predisposition to cellular immortalization or cancer, or to
the presence of cancer or immortal cells.
By example, such methods of detecting the presence of
immortal cells or a predispositio~ to immortalization in a
2S eukaryotic cell, tissue or fluid sample can include:
obtaining a cell, tissue or fluid sample; and using the
essential oligonucleotides to determine the presence of
telomerase in the sample (for example, by hybridization
with a labeled probe), wherein if the sample demonstrates
the presence of telomerase, immortal cells or the
predisposition to immortalization is present. The same
method may be used to detect a predisposition to cancer or
the presence of cancer cells or tissue.
Alternatively, the recombinant telomerase can be used
to produce polyclonal or monoclonal antibodies to the
CA 02221602 1997-12-0~
W O ~6M0868 PCTAJS96/09517
-24 -
telomerase protein. These antibodies allow detection of
telomerase in vivo or in vitro at minute levels and c~n
serve to indicate the presence of abnormal telomerase
activity due to tumor cell growth or other conditions such
as parasitism by foreign eukaryotic organisms (i.e.,
yeasts, protozoa), and the like. Because antibodies can
accurately detect small amounts of antigen, early diagnosis
of these disorders is possible.
The present invention also provides a means for
developing drugs and pharmaceutical compounds that destroy
or otherwise inactivate or interfere with the activity of
telomerase. Thus, the truncated or recombinant telomerase,
or the essential oligonucleotides of this invention can be
used to screen for potential new drugs and pharmaceutical
compounds effective as anti-cancer and anti-microbial
agents, as described below. Further, since additional
telomerase activity may have an anti-aging effect and
result in restoration of cells by stabilizing telomere
length, compounds which stimulate or trigger telomerase
activity can be identified.
For example a method for screening agents which
inhibit, prevent, or stimulate telomerase activity can
comprise the steps of: contacting the potential agent with
truncated or recombinant telomerase under conditions
wherein telomerase is active; and determining whether the
activity of telomerase is decreased or increased; whereby
if the telomerase activity is decreased, the agent is
identified as a telomerase inhibitor and, if the telomerase
activity is increased, the agent is identified as a
telomerase stimulator.
The telomerase protein can also be combined with the
RNA component of telomerase to produce a functional
recombinant telomerase molecule which can be delivered to
cells by conventional methods. Alternatively, DNA encoding
a telomerase molecule can be introduced into target cells
CA 0222l602 l997-l2-0~
W O 96/40868 PCTrUS96/09S17 -25-
by recombinant DNA methods and transformation technology.
The incorporation of extra copies of functional telomerase
molecules may extend the replicative life span of the host
cell by stabilizing telomere length. Thus, this invention
includes methods for targeted gene therapy in individuals.
Another application of this invention is the
detection of eukaryotic disease-causing org~n;s~ in
somatic cells and tissues of vertebrates and treatment of
the resulting disease. There are many fungi, protozoa, and
even algae that invade the cellc and tissues of vertehrates
and are the cause of various diseases. Examples of such
diseases include, but are not limited to, aspergillosis,
histoplasmosis, candidiasis, paracoccidioidomycosis,
malaria, trichinosis, filariasis, trypanosomiasis
(sleeping sickness), schistosomiasis, toxoplasmosis, and
leishmaniasis. These org~n;s~ probably require telomerase
and express this enzyme as they multiply inside host cells
which do not normally produce telomerase. The above-
described methods to detect telomerase can be used to
develop early detection and diagnosis procedures for these
eukaryotic microbial parasites.
An example of such a method to detect a disease caused
by a eukaryotic microbial organism in a sample of cells
from an individual may comprise the steps of: obtaining a
sample of cells from the individuali and determinir,g f
microbial telomerase is present in the sample; wherein if
the sample demonstrates telomerase of a eukaryotic microbe,
a disease caused by a eukaryotic microbial organism is
present. If telomerase is normally present in the cells of
the individual, e.g., germline cells, the microbial
telomerase can be distinguished by determining if
hybridization occurs with a probe specific for non-human
telomerase.
Furthermore, since most m~mm~l ian somatic cells do not
require telomerase, the use of inhibitors of and
CA 02221602 1997-12-0~
W O 96/40868 PCTrUS96/09517
-26-
antibiotics against telomerase will provide a method of
treatment for such diseases that is nontoxic or exhibits
little toxicity to the host. For example, most of the
drugs used to treat diseases caused by Trypanosoma species
can cause serious side effects and even death. Use of
antisense RNA to the RNA of Trypanosoma sp. telomerase or
drugs against t~lo~ase may inhibit telomerase and thus
prevent the multiplication of species of this parasite in
an individual without affecting the host's somatic cells
and tissues. Included among these pharmaceuticals are
nucleic acids complementary to essential oligonucleotides
(antisense) that inhibit the expression of telomerase.
In a further aspect, the present invention provides a
process for producing a recombinant product comprising:
producing an expression vector which includes DNA which
encodes a telomerase molecule; transfecting or infecting a
host cell with the vector; and culturing the transfected or
infected cell line to produce the encoded telomera-~e
molecule (recombinant telomerase). The standard techniques
of molecular biology can be used to prepare DNA sequences
coding for the RNA and protein components of telomerase,
and for construction of vectors with appropriate promoters
for enzyme expression in a host cell. Suitable host
cell/vector systems, transfection or infection methods and
culture methods are well known in the art. These systems
may also be used to produce antibodies to telomerase.
It will also be appreciated that the methods described
above may be used to produce transgenic cells, tissues, and
organisms for use in investigating the role o~ telomerase
in eukaryotic organisms, and for therapeutic purposes.
The present invention will now be illustrated by the
following examples, which are not intended to be limiting
in any way.
EXEMPLIFICATION
CA 02221602 1997-12-0~
WO ~6/40~68 PCT/US96/09517
-27-
Example 1
Pre~aration of human telomerase extracts
Fractions used for reconstitution were prepared in the
following manner: S100 cytoplasmic extract was prepared
from 293 cells as previously described (Counter et al.
(1992) EM~O ~. 11:1921-1929). A zero to 40~ ~mmon;um
sulfate cut was made from this fraction, dialyzed to remove
the ammonium sulfate and applied to a Toyopearl Q column
equilibrated with buffer A cont~;n;ng 0.1 NaCl (A+0.1 NaCl
buffer: 20 mM HEPES pH 7.9, lmM DTT, 1 mM EGTA, 1 mM MgCl2,
10~ glycerol, 0.1 M NaCl). The column was wasned with
buffer A contA;n;ng 0.18 M NaCl, and telomerase activity
was eluted with buffer A cont~; n; ng 0.3 M NaCl. The active
fractions were pooled and concentrated with 50~ ammonium
sulfate and applied to a Toyopearl HW-65F column
equilibrated in buffer A cont~;n;ng 0.1 M NaCl and eluted
with the same buffer. Active fractions (1.7 mg/ml total
protein) were pooled and used in reconstitution.
Example 2
Telomerase elonqation activity assa~
Activity was assayed using a combination of the
conventional telomerase assay (Counter et al. (1992) EM~O
~. 11:1921-1929) and the TRAP assay (Kim, et al., supra) .
The conventional conditions were: one hour incubation at
30 C in 1 X t~lomerase buffer (50 Ir~ Tris-HCl pH 8.3, 1 mM
DTT, 1 mM spermidine, lmM MgCl2), 2mM dATP, 2mM dTTP, 10 ~M
dGTP and 40 pmol M2 oligo (5'-AATCCGTCGAGCAGAGTT-3').
Different volumes of extract were assayed as indicated in
the figures. Unless otherwise indicated, 12 ~l was used
(final 20 ~l) and mixed 1:1 with the reaction mixture. 10
~l of the 40 ~l telomerase reaction was then added to a 50
~l final volume PCR reaction: 1 X TRAP buffer (20 mM
Tris-HCl pH 8.3, 1.5 mM MgCl2, 63 mM KCl, lmM EGTA, 0.005
Tween-20, 0.1 mg/ml BSA), 50 ~M dNTPs, 20 pmol M2 primer,
CA 02221602 1997-12-0~
W O~G/IC368 PCT~US96/09517
-28-
20 pmol of the appropriate C-strand primer, 0.13 ~M
[~-32P]dGTP (0.5 ~l of 800 Ci/mmole; NEN) and 2U Taq
polymerase (Perkin-Elmer). The C-strand primers, C3TA2
pri.mer, C3P.3primer, or C~A2 primer were used to detect the
corresponding G-rich telomerase elongation products T2AG3,
T3A3 and T2G~. These primers are modified versions of the
Cx primer (Kim et al., supra) and contain three repeats of
the appropriate telomeric sequence plus some additional
sequences at the 5' end (Trap-eze~ kit, Oncor, Inc., 209
Perry Parkway, Gaithersberg, MD 20877,
www.oncorinc.com/home). After amplification for 18 cycles
at 30 sec 94-C, 30 sec 60-C and 30 sec 72 C, 7.5 ~l of the
reaction was mixed 50/50 with formamide containing xylene
cyanol and bromophenol blue. Products were resolved on a
12~, 7M urea denaturing gel in 0.6 X TBE electrophoresed at
35 W until xylene cyanol was 5 cm from the bottom. Gels
were dried and then exposed to Fuji PhosphorImager screens
overnight and then to film (XAR5) for the times indicated
in the figures. Products were quantitated by comparing the
signal intensity in each lane using a BAS2000
PhosphorImager.
Example 3
MNase treatment and reconstitution conditions
Reconstitution conditions were modified frorn those for
reconstitution of Tetrahymena telomerase (Autexier and
Greider (1994) Genes & Dev. 8:563-575). Twelfe ~l of human
telomerase fractions (in 1 mM EGTA) were treated for 10-15
min at 30'C with 1. 9-2 .1 mM CaCl2 and 1.0-1.15 Unit of
micrococcal nuclease (MNase) (Pharmacia) per ~l of extract.
The MNase was inactivated by the addition of 1.5 mM EGTA.
The extract was then incubated with in vi tro transcribed
RNA and 5 mM EDTA for 5 min at 37 C. 8mM MgCl2 was added
prior to assayin~ ~or telomerase activity. Mock-treated
telomerase consists of telomerase treated as described
CA 02221602 1997-12-0~
W O ~61408~8 PCTAUS96/09517
-29-
above, with the addition of EGTA prior to MNase.
In Figure 1, telomerase assays were performed with
- telomerase pretreated as indicated. In lanes 1-12,
- MNase-treated telomerase was reconstituted: without
addition of RNA (lanes 1 and 2); with 0.4 ~g hTR1-557
(lanes 3 and 4); or, with 0.8 ~g hTRl-557 (lanes 5 and 6);
with 8 ~g E. coli 5S rRNA (lanes 7 and 8); with 1.1 ~g 16
and 23S rRNA (lanes 9 and 10); or with 0.8 ~g Tetrahymena
telomerase RNA (lanes 11 and 12). Either 6 or 12 ~l of
extract was used in the elongation assay, prior to
amplification of elongation products, as indicated. 0.4
and 0.~ ~g of hTR is equivalent to approximately 2 and 4
pmoles, respectively. The gel was exposed 18 hours on
film.
Exam~le 4
Construction of phTR+1, phTR170, phTR180 and phTR190
A 480 bp fragment containing the T7 promoter and
positions +1 to 445 of the gene encoding hTR was generated
by PCR from the cloned hTR gene (Feng, et al., supra),
digested with HindIII and BamEI, and cloned into pUC119
digested with the same enzymes. The template used in PCR
was a 794 bp EcoRI-FspI fragment from pGRN33, which
contains a 2.5 kb genomic fragment including the hTR coding
region (Feng, et al., supra) . The sequences of primers
hTR+1 and hTR+445 used in PCR were
5'-GGGGAAGCTTTAATACGACTCACTA'rAGGGTTGCGGAGGGTGGGCCTG-3' and
5'-CCCCGGATCCTGCGCATGTGTGAGCCGAGTCCTGGG-3', respectively.
hTR+1 contains the T7 promoter and a HindIII site at the 5'
end. hTR+445 contains a BamHI site and an engineered FspI
site at +44S at the 5' end. PCR conditions were the
following: 1 X Taq extender buffer (Stratagene), 0.5 uM
primers, 1 ng template, 200 uM dNTPs (Pharmacia), 5U Taq
extender (Stratagene), 5U Taq polymerase (Perkin-Elmer), 5
~g T4 gene 32 product (Boehringer Mannheim), 30 cycles at
CA 0222l602 l997-l2-0~
WO ~G/l~ PCT/US96/09517
--30--
94-C for 40 sec, 58-C ~or 20 sec and 72-C for 60 sec. The
resulting clone, phTR+1, contained hTR downstream of the T7
promoter as confirmed by sequencing both strands of the
inserted DNA by the dideoxy-mediated chain termination
method as per the manufacturer's instructions (U.S.
Biochemical).
phTR170, phTR180 and phTR190 were constructed by
replacing a 114 bp XbaI-BspEl fragment in phTR+1 by the
same fragments (generated by PCR) cont~;n;ng 10 base pair
mutations spanning positions 170-179, 180-189 or 190-199 of
hTR respectively. phTR+1 digested with HindIII and BamHI
was used as a template in PCR. The 177 bp PCR fragment was
digested with XbaI and BspEl and the resulting 114 bp
fragment cloned into the phTR+l XbaI and BspEl restriction
sites. PCR conditions were as described for phTR+1 except
10 ng of the template fragment was used and the cycling
conditions were the ~ollowing: 5 cycles at 94-C 40 sec,
54-C 20 sec, 72-C 60 sec, followed by 25 cycles 94-C 40
sec, 60-C 20 sec, 72 C 60 sec. Primers hTR170 and TRC31
were used in PCR for constructing phTR170. The sequences
of hTR170 and TRC31 are
5'-GGGGTCTAGAGCAAA~~ ACACAGCTGCTGGCCCGTTC-3' and
5'-CCGAGAGACCCGCGGCTGACAGAG-3', respectively. phTR180 and
phTRlso were constructed in a manner similar to phTR170,
using primers hTR180 and hTR190, respectively, instead of
hTR170. The sequences of hTR180 and hTR190 are
5'-GGGGTCTAGAGCAAACAAAAAATGTGTCGACGACCCCCGTTCGCCTCCCGG-3'
and
5'-GGGGTCTAGAGCAAACAAAAAATGTCAGCTGCTGGGGGCAAGCGGTCCCGGGGACC
TGCG-3', respectively. The resulting clones, phTR170,
phTRlso and phTR190, contained the expected substitutions
within the inserted XbaI/BspEI fragment, as confirmed by
sequencing the inserted DNA.
In Figure 2, reconstituted telomerase was re-
~og-rammed to synthesize mutant telomere repeats and the
CA 02221602 1997-12-0~
W O 96/40868 PCT~US96/09517
-3 1-
activity o~ the reconstituted telomerase with telmerase RNA
mutations was assayed in the absence or presence o~ ATP as
indicated: no RNA, lane l; hTRl-557, lanes 2 and 3;
hTR1-557 with a 17 base insertion at position 176 (hTR~17),
lanes 4 and 5; hTR1-557 with a modi~ied template (C3A3)
encoding T3G3 repeats (hTR-C3A3), lanes 6 and 7; hTR1-557
with a modi~ied template (C4Az) encoding T2G4 repeats
(hTR-C4A2), lanes 8 and 9. As indicated, di~erent
C-strand oligonucleotides were used in the PCR assay to
detect the appropriate telomerase elongation products, and
3 pmoles o~ RNA were added to each reaction. The gel was
exposed to ~ilm for 4 days.
In Figure 3, telomerase was reconstituted with hTR o~
various sizes as indicated: no RNA, lane 1; hTRl-l59 ~159
nt), lane 2; hTR1-169 (169 nt), lane 3; hTRl-182 (182 nt),
lane 4; hTR1-203 (203 nt), lane 5; hTR1-273 (273 nt), lane
6; hTR1-445 (445 nt), lane 7; hTR 44-184 (140 nt), lane 8;
hTR 44-204 (160 nt), lane 9; hTR1-445 (445 nt), lane 10.
Each reaction in lanes 2-7 included 2.5 pmoles o~ RNA, and
3 pmoles of RNA were added to reactions shown in lanes
8-10. Lanes 1-7 were exposed ~or 2 days and lanes 8-10 ~or
5 days.
ExamPle 5
Pre~aration of RNAs
RNAs used in reconstitution were in vi tro transcribed
with SP6 or T7~ RNA polymerase (Stratagene) using pGEM33
~encoding wild-type hTR plus downstream sequences-total
length 557 nt-hTR1-557) digested with EcoRV, pGEM34
(encoding hTR1-557 with a C3A3-containing template), pGEM36
30 (encoding hTR1-557 with a C4A2-containing template) or
pGEM38 (encoding hTR1-557 with a 17 bp insertion at residue
176) digested with EcoRV (Figures 1 and 2) The RNAs used
~ in reconstitution contained 5' (34 nt) and 3' (41nt)
~lanking RNA ~rom the pGEM vector which does not encode the
CA 02221602 1997-12-0~
W O~6/108~8 ' PCT~US96/09517
-32-
telomerase RNA. The RNAs made ~rom phTR+1, phTRl7o~
phTR180 and phTR190 contained only hTR sequences. The
hTR44-170, hTR44-184 and hTR44-204 hTRs were made using DNA
~ragments generated by PCR. For all three, the 5' primer
was T7hs48
(~'-TTCTAATACGACTCACTATAGGTCTAACCCTAACTGAGAAGG-3'). For
hTR44-170, the 3' primer was R3C
(5'-GTTTGCTCTAGAATGAACGGTGGAAG-3'). For hTR44-184, the 3'
primer was hal88 (5'-AGCTGACAllllll~lllGCTC-3'). For
hTR44-204, the 3' primer was R7
(5'-GGAGGGGCGAACGGGCCAGCA-3'). Standard in vi tro
transcription reaction conditions recommended by the RNA
polymerase manu~acturer were used. The RNAs were either
gel puri~ied or the transcription reactions treated with 3U
RNase-~ree DNase (Pharmacia) per ~g of DNA for 10 min. The
RNA concentrations were determined by speci~ic activity
determination o~ RNA synthesized with radionucleotides.
The integrity and size of the RNAs were determined by
Northern analysis or staining with ethidium bromide. Size
of the RNAs are the ~ollowing, with the actual number of
residues or nTR and the enzyme used in parentheses:
hTRl-557~ 630 nt (EcoRV 557) for all hTRs made from pGEM
based vectors (+17 nt ~or hTR+17). Sizes of the RNAs made
~rom pUCll9 based plasmids (phTR+l, phTR170, phTR180,
phTR190) were the ~ollowing: hTR1-159 (XbaI 159), hTR1-169
(BbvI 169), hTRl-182 (PvuII 182), hTR1-203 (SmaI 203),
hTRl-273 (BspEl 273) and hTR1-445 (FspI 445). The FspI
site at position 445 was created by site-directed
mutagenesis. The TGCAGT spanning nucleotides 443 to 448
was altered to TGCGCA which is cut by FspI . This construct
was cloned into the plasmid pUC119. Tetrahymena telomerase
RNA used as a control was in vi tro transcribed as
previously described (Autexier and Greider (1994) Genes &
Dev. ~:563-575). The 5S and 16S, 23S E. coli rRNAs were
from Boehringer Mannheim and Sigma, respectively. Mouse
CA 02221602 1997-12-0~
WO 96/40868 PCT~US96/09517 - 33 -
RNase P RNA and mouse telomerase RNA were a gift of Maria
Blasco.
In Figure 4, telomerase was reconstituted with hTR o~
various sizes and sequence as indicated: mock-treated
telomerase, lane 1; no RNA, lane 2; hTRl-159 (159 nt), lane
3 ; hTRl-169 (169 nt), lane 4; hTR1-182 (182 nt), lane 5;
hTR170* (445 nt), lane 6; hTR180* (445 nt), lane 7; hTR190*
(445nt), lane 8; hTRl-445 (445 nt), lane 9. The reactions
shown in lanes 3 -9 had 2.5 pmoles of ~NA added to them.
The gel was exposed to X-ray film for 2 days, except for
lane 1, which was exposed for 18 hours.
Figure 5 is a linear representation of full-length
hTR. The schematic includes the template region (white
box) and positions of several restriction $ites present in
the gene encoding hTR. The FspI site was engineered into
the gene. The 5' and 3 ' deletions and substitutions in hTR
are indicated (stippled boxes), along with the relative
activities these RNAs restore when added back to
MNase-treated extract. The size of the transcribed RNAs
are also indicated. For comparison, activity of hTR+17,
which has a 17 nucleotide insertion at position 176 in
hTRl-557 is included. The transcribed RNA in this case
includes sequences downstream of hTR, plus vector sequences
5' and 3' to hTR.
Originally, the hTR sequence shown in Figure 7 was
used to generate some of the reagents for the hTR
reconstitution assays. The actual hTR sequence, discovered
at Cold Spring Harbor Laboratory, is shown in Figure 6.
E~uivalents
Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention
described specifically herein. Such equivalents are
intended to be encompassed in the scope of the following
3 5 claims.
