Note: Descriptions are shown in the official language in which they were submitted.
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
}~AN G-PROTEIN K ~;-cr . OK ~IBEF51
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use o~ such polynucleotides and
polypeptides, as well as the produc~ion of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is a human 7-
tr~n~memhrane receptor. The tr~ncm~mhrane receptor is a G-
protein coupled receptor. The invention also relates to
; nh; h;ting the action of such polypeptides.
It is well established that many medically significant
biological processes are mediated by proteins participating
in signal transduction pathways that involve G-proteins
and/or ~econd messengers, e.g., cAMP (Lefkowitz, Nature,
351:353-354 (1991)). Herein these proteins are referred to
as protein~ participating in pathways with G-protein~ or PPG
proteins. Some examples of these proteins include the GPC
receptors, such as those for adrenergic agents and ~or~m;ne
(~h;lka, B.g., et al., PN~S, 84:46-50 (1987); Xobilka, B.K.,
et al., Science, 238:650-656 (1987); Bunzow, J.R., et al.,
Nature, 336:783-787 (1988)), G-proteins themselves, ef~ector
proteins, e.g., phospholipase C, adenyl cyclase, and
phosphodiesterase, and actuator proteins, e.g., protein
CA 02221616 1997-11-19
W096/39441 PCT~S95/07Z25
kinase A and protein kinase C (Simon, M.I., et al., Science,
252:802-8 (l99l)).
For example, in one form of signal transduction, the
effect of hormone binding is activation of an enzyme,
adenylate cyclase, inside the cell. Enzyme activation by
hormones is dependent on the presence of the nucleotide GTP,
and GTP also influences hormone b;n~ing. A G-protein
connects the hormone receptors to adenylate cyclase. G-
protein was shown to ~ch~nge GTP for bound GDP when
activated by hormone receptors. The GTP-carrying form then
binds to an activated adenylate cyclase. Hydrolysis of GTP
to GDP, catalyzed by the G-protein itself, returns the G-
protein to its basal, inactive form. Thus, the G-protein
serves a dual role, as an intermediate that relays the signal
from receptor to effector, and as a clock that controls the
duration of the signal.
The me.,~lane protein gene superfamily of G-protein
coupled receptors has been characterized as having seven
putative tr~ns~~~hrane ~nm~;n~, The ~m~lnC are believed to
represent tr~n~ hrane ~-helices connected by extracellular
or cytoplasmic loops. G-protein coupled receptors include a
wide range of biologically active receptors, such as hormone,
viral, growth factor and neuroreceptors.
G-protein coupled receptors have been characterized as
including these seven conserved hydrophobic stretches of
about 20 to 30 amino acids, connecting at least eight
divergent hydrophilic loops. The G-protein family of coupled
receptors includes dop~m;ne receptors which bind to
neuroleptic drugs used for treating psychotic and
neurological disorders. Other examples of members of this
family include calcitonin, adrenergic, endothel;n, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, hist ~m; ne,
thrombin, kinin, follicle stimulating hormone, opsins and
rhodopsins, odorant, cytomegalovirus receptors, etc.
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07Z25
Most GPRs have single conserved cysteine residues in
each of the ~irst two extracellular loops which form
disulfide bonds that are believed to stabilize functional
protein structure. The 7 tr~n~mhrane regions are
designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 is
also implicated in signal transduction.
Phosphorylation and lipidation (palmitylation or
~arnesylation) o~ cysteine residues can influence signal
transduction of some GPRs. Most GPRs contain potential
phosphorylation sites within the third cytoplasmic loop
and/or the c~ho~y terminus. For se~eral GPRs, such as the
~-adrenoreceptor, phosphorylation by protein kinase A and/or
specific receptor ~inases mediates receptor desensitization.
The ligand binding sites of GPRs are believed to
comprise a hydrophilic socket formed by several GPR
tr~n~mPmhrane ~m~;n~, which socket is surrounded by
hydrophobic residues of the GPRs. The hydrophilic side of
each GPR tr~n~m~mhrane helix is postulated to face inward and
form the polar ligand bt n~; ng site. TM3 has been implicated
in several GPRs as having a ligand binding site, such as
including the TM3 aspartate residue. Additionally, TM5
serines, a TM6 asparagine and TM6 or TM7 phenyl~l ~n; ne~ or
tyrosines are also implicated in ligand hi n~ ng,
GPRs can be intracellularly coupled by heterotrimeric G-
prcteins to various intracellular enzymes, ion ch~nn~ls and
transporters (see, John on et al ., Endoc., Rev., 10:317-331
(lg89)). Different G-protein ~-su~units preferentially
8~ te particular effectors to modulate various biological
fu~ctions in a cell. Phosphorylation of cytoplasmic
residues of GPRs has been identified as an important
merh~n~ ~m for the regulation of G-protein coupling of some
GP~s.
G-protein coupled receptors are ~ound in numerous sites
within a ~ lian host, for example, dor~m~ne i~ a critical
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
neurotransmitter in the central nervous system and is a G-
protein coupled receptor ligand.
In accordance with one aspect of the present invention,
there are provided novel mature receptor polypeptides as well
as biologically active and diagnostically or therapeutically
useful fragments, analogs and derivatives thereof. The
receptor polypeptides of the present invention are of human
origin.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
encoding the receptor polypeptides of the present invention,
including mRNAs, DNAs, cDNAs, genomic DNA as well as
antisense analogs thereof and biologically active and
diagnostically or therapeutically useful fragments thereof.
In accordance with a further aspect of the present
invention, there are provided processes for producing such
receptor polypeptides by recomh;n~nt techniques comprising
culturing recom~inant prokaryotic and/or eukaryotic host
cells, cont~;n;ng nucleic acid sequences encoding the
receptor polypeptides of the present invention, under
conditions promoting expression of said polypeptides and
subsequent recovery of said polypeptides.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
receptor polypeptides.
In accordance with another aspect of the present
invention there are provided methods of screening for
compounds which bind to and activate or inhibit activation of
the receptor polypeptides of the present invention.
In accordance with still another embodiment of the
present invention there are provided processes of
~mi n; stering compounds to a host which bind to and activate
the receptor polypeptide of the present invention which are
useful in the prevention and/or treatment of upper
respiratory conditions, for example, allergic rhinitis, hay
CA 02221616 1997-11-19
WO 96139441 PCT/US95/0722~;
fever, acute coryza and sinusitus, to promote uterine
inhibition, to stimulate platelet aggregation, regulate lipid
metabolism, and inhibit glucose-stimulated insulin release
~ from the pancreas.
In accordance with another aspect of the present
invention there is pro~ided a method o~ ~m;n; stering the
receptor polypeptides of the present invention via gene
therapy to treat conditions related to underexpression of the
polypeptides or underexpression o~ a ligand to the receptor
polypeptide.
In accordance with still another e~odiment of the
present invention there are provided processes o~
~mi n; stering compounds to a ho~t which bind to and inhibit
activation of the receptor polypeptides of the present
invention which are useful in the prevention and/or treatment
of hyperten~ion and other myocardial di~ease and other
diseases relating from vasoconstriction.
In accordance with yet another aspect of the present
invention, there are provided nucleic acid probes compri~ing
nucleic acid molecules of sufficient length to specifically
hy~ridize to the polynucleotide sequences of the present
inv~ention.
In accordance with still another aspect of the present
in~ention, there are provided diagnostic assays for detecting
diseases related to mutations in the nucleic acid sequences
encoding such polypeptides and for detecting an altered level
of the soluble fonm of the receptor polypeptide~.
In accordance with yet a further aspect of the present
invention, there are provided processes for utilizing such
receptor polypeptides, or polynucleotides encoding such
polypeptides, for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should
be apparent to those skilled in the art from the te~chings
herein.
CA 02221616 1997-11-19
WO 96139441 PCT/US95/0722~;
The following drawings are illustrative of embodiments
of the invention and are not meant to limit the scope of the
invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and the corresponding
deduced amino acid sequence of the G-protein coupled receptor
of the present invention. The st~n~Ard one-letter
abbreviation for amino acids is used. Sequencing was
performed using a 373 Automated DNA sequencer (Applied
Biosystems, Inc.).
Figure 2 illustrates an amino acid alignment of the G-
protein coupled receptor of the present invention and the
human adrenergic a,A receptor.
In accordance with an aspect of the present invention,
there is provided an isolated nucleic acid (polynucleotide)
which encodes for the mature polypeptide having the deduced
amino acid sequence of Figure 1 or for the mature polypeptide
encoded by the cDNA of the clone deposited as ATCC Deposit
No. on June 1, 1995.
A polynucleotide encoding a polypeptide of the present
invention may be found in skeletal muscle, heart and brain.
The polynucleotide of this invention was discovered in a cDNA
library derived from a human infant brain. It is
structurally related to the G protein-coupled receptor
family. It contains an open reading frame encoding a protein
of 349 amino acid residues. The protein exhibits the highest
degree of homology to a human a A adrenergic receptor with
25.387~ identity and 51.084% similarity over a 331 amino acid
stretch.
The polynucleotide of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which encodes the mature polypeptide may be
identical to the coding sequence shown in Figure 1 (SEQ ID
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
NO:1) or that of the deposited clone or may be a different
cod- ~ sequence which coding sequence, as a result of the
r~ n~ncy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:1)
or the deposited cDNA.
The polynucleotide which encodes ~or the mature
polypeptide of Figure 1 (SEQ ID NO:2) or for the mature
polypeptide encoded by the deposited cDNA may include: only
the coding sequence ~or the mature polypeptide; the coding
sequence for the mature polypeptide and additional co~i n~
sequence such as a leader or secretory sequence or a
proprotein sequence; the coding sequence for the mature
polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence
5~ and/or 3 o~ the coding sequence ~or the mature
polypeptide.
Thus, the tenm "polynucleotide PnroA~ng a polypeptide"
Pnco~r?sses a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which includes additional r~A;n~ and/or non-coding sequence.
The present invention ~urther relates to variants o~ the
hereinabove described polynucleotides which encode for
fragments, analog~ and derivatives of the polypeptide having
the deduced amino acid equence of Figure 1 (S~Q ID NO: 2 ) or
the polypeptide Pnco~e~ by the cDNA o~ the deposited clone.
The variant of the polynucleotide may be a naturally
occurring allelic variant of the polynucleotide or a non-
naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in Figure 1 or
the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides
whi.c.A variants encode ~or a ~ragment, derivative or analog o~
the polypeptide of Figure 1 (S~Q ID NO: 2 ) or the polypeptide
encoded by the cDNA of the deposited clone. Such nucleotide
CA 02221616 1997-11-19
W096/39441 PCT~S95/07225
variants include deletion variants, substitution variants and
addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic
variant of the coding sequence shown in Figure 1 (SFQ ID
N0:1) or of the coding sequence of the deposited clone. As
known in the art, an allelic variant is an alternate form o~
a polynucleotide sequence which may have a substitution,
deletion or addition of one or more nucleotides, which does
not substantially alter the function of the encoded
polypeptide.
The polynucleotides may also encode for a soluble form
of the receptor polypeptide which is the extracellular
portion of the polypeptide which has been cleaved from the TM
and intracellular ~om~in of the full-length polypeptide of
the present invention.
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for puri$ication of the polypeptide o~ the
present invention. The marker sequence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide ~or
purification of the mature polypeptide fused to the marker in
the case of a bacterial host, or, for example, the marker
sequence may be a hemagglutinin (HA) tag when a mAmm~lian
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene n means the segment of DNA involved in
proAncing a polypeptide chain; it includes regions preceding
and following the coding region (leader and trailer) as well
as intervening sequences (introns) between individual coding
segments (exons).
Fragments of the full length receptor gene may be used
as a hybridization probe ~or a cDNA library to isolate the
full length gene and to isolate other genes which have a high
CA 02221616 1997-11-19
W096/39441 PCT~S95/07225
sequence similarity to the gene or similar biological
activity. Probes of this type preferably have at least 30
bases and may contain, for example, 50 or more bases. The
probe may also be used to identify a cDNA clone corresponding
to a full length transcript and a genomlc clone or clones
th~t contain the complete receptor gene including regulatory
ancl promotor regions, exons, and introns. An example of a
screen comprises isolating the coding region of the gene by
using the known DNA sequence to synthesize an oligonucleotide
probe. Labeled oligonucleotides having a sequence
con~l~m~nt~ry to that of the gene of the present invention
are used to screen a library of human cDNA, genomic DNA or
mRNA to determine which members of the library the pro~e
hybridizes to.
The present invention further relates to
polynucleotides which hybridize to the here~n~hove-described
sequences if there is a~ lea~t 70%, preferably at least 90%,
an~l more preferably at least 95~ identity between the
se~nc~s. The present invention particularly relates to
polynucleotides which hybridize under stringent conditions to
the herP;n~hove-described polynucleotides. A~ herein used,
the term "stringent conditions~ means hybridization will
occur only if there is at least 95% and preferably at least
97~ identity between ~he sequences. The polynucleotides
which hybridize to the here;n~hove described polynucleotides
in a preferred ~mho~;m~nt encode polypeptides which either
retain subst~nt;~lly the same biological function or activity
as the mature polypeptide ~nco~ed by the cDNAs o~ Figure 1
(SBQ ID NO:1) or the depo~ited cDNA(s).
Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50
bases which hybridize to a polynucleotide of the present
invention and which has an identity thereto, as herp~n~hove
described, and which may or may not retain activity. For
example, such polynucleotides may be employed as probes for
CA 0222l6l6 lgg7-ll-l9
WO96/39441 PCT~S95/072Z5
the polynucleotide of SEQ ID NO:l, for example, for recovery
of the polynucleotide or as a diagnostic probe or as a PCR
primer.
Thus, the present invention is directed to
polynucleotides having at least a 70% identity, preferably at
least 90~ and more preferably at least a 95% identity to a
polynucleotide which encodes the polypeptide of SEQ ID NO:2
as well as fragments thereof, which fragments have at least
30 bases and preferably at least 50 bases and to polypeptides
encoded by such polynucleotides.
The deposit(s) referred to herein will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-organisms for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides cont~ine~ in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein by
reference and are controlling in the event of any conflict
with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to a receptor
polypeptide which has the deduced amino acid sequence of
Figure 1 (SEQ ID NO:2) or which has the amino acid sequence
encoded by the deposited cDNA, as well as fragments, analogs
and derivatives of such polypeptide.
The terms "fragment, n ~derivative" and ~analog~ when
referring to the polypeptide of Figure 1 (SEQ ID NO:2) or
that Pnro~ed by the deposited cDNA, means a polypeptide which
either retains substantially the same biological function or
activity as such polypeptide, i.e. functions as a receptor,
or retains the ability to bind the ligand or the receptor
even though the polypeptide does not function as an receptor,
--10--
CA 02221616 1997-ll-lg
096/39441 PCT~S95/07225
~or example, a soluble ~orm o~ the receptor. An analog
includes an extracellular portion which can be cleaved from
the tr~ncm~mhrane ~om~n and intracellular portion to produce
a solu~l~ active peptide.
The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, pre~erably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide
of Figure 1 (SEQ ID N0:2) or that encoded by ~he deposited
cDN~ may be (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid
residue) and ~uch substituted amino acid residue may or may
not be one encoded by the genetic code, or (ii) one in which
one or more of the amino acid residues includes a substituent
grollp, or (iii) one in which the mature polypeptide is fused
wit~ another compound, such as a c~ ~o~d to increase the
halE-life of the polypeptide (for example, polyethylene
gly~ol), or (iv) one in which the additional amino acids are
fused to the ma~ure polypeptide which is employed for
purification of the mature polypeptide, or (v) one in which
a fragment of the polypeptide is soluble, i.e. not .,.~..~Ldne
bound, yet still bind6 ligands to the ...~..~L~ne bound
rec~eptor. Such fragments, derivatives and analogs are deemed
to be within the scope of those skilled in the art from the
teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated fonm, and
preferably are purified to ho...oye.~eity.
The polypeptides of the present invention include the
polypeptide of SEQ ID N0:2 (in particular the mature
polypeptide) as well as polypeptides which have at least 70%
similarity (preferably at least a 70% identity) to the
polypeptide of S~Q ID N0:2 and more preferably at least a 90~
similarity (more preferably at least a 90% identity) to the
CA 02221616 1997-11-19
WO96/39441 PCT~S95/07225
polypeptide of SEQ ID NO:2 and still more preferably at least
a 9S~ similarity (still more preferably at least a 95%
identity) to the polypeptide of SEQ ID NO:2 and also include
portions of such polypeptides with such portion of the
polypeptide generally cont~n~ng at least 30 amino acids and
more preferably at least 50 amino acids.
As known in the art "similarity" between two
polypeptides ifi determined by comparing the amino acid
sequence and its conserved amino acid substitutes of one
polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis, therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to
synthesize ~ull-length polynucleotides of the present
invention.
The term "gene" mean~ the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding
and following the coding region "leader and trailer" as well
as intervening sequences (introns) between individual coding
segments (exons).
The term "isolated" means that the material is removed
from its original environment (e.g., the natural environment
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a living
~n~-l iS not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environm~nt~
-12-
CA 02221616 1997-11-19
WO 96139441 PCT/US95/07225
The polypeptides of the present invention include the
polypeptide of SBQ ID NO:2 (in particular the mature
polypeptide) as well as polypeptides which have at least 70~
- similarity (preferably a 70% identity) to the polypeptide of
S~Q ID NO:2 and more preferably a 90% s~m;l~rity (more
preferably a 90~ identity) ~o the polypeptide of SEQ ID NO:2
and still more prefera~ly a 95% similarity (still more
preferably a 90~ identity) ~o the polypeptide o~ SBQ ID NO:2
and also include portions of such polypeptides with such
portion of the polypeptide general~y cont~in;ng at least 30
amino acids and more preferably at least 50 amino acids.
As known in the art "similarity" between two
polypeptides is determlned by comparing the amino acid
sequence and its conser~red amino acid substitutes of one
polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present
in~ention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fra~onts or portions of the
polynucleotides of the present invention may be used to
sy~thesize full-length polynucleotides of the present
in~ention.
The present inven~ion also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the
invention and the production o~ polypeptides of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
tran~for~ed or transfected) with the vectors of this
in~rention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
fo~n of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as a~l~riate for activating
-13-
CA 02221616 1997-11-19
WO 96/39441 PCT/US9JI~ / ~2~
promoters, selecting transformants or amplifying the genes of
the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with
the host cell selected for expression, and will be apparent
to the ordinarily ~killed artisan.
The polynucleotides of the present invention may be
employed for producing polypeptides by recombinant
techniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonrh~omosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from
combinations of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
~n~QnllClease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the ~. coli. lac or tr~, the phage lambda PL
promoter and other promoters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site
for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for
amplifying expression.
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
In addition, the expression vectors preferably contain
one or more selectable marker genes to provide a phenotypic
trait for selection of trans~ormed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampicillin
resi~tance in E. coli.
The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to trans~orm an appropriate
ho~t to permit the host to express the protein.
As representative examples of appropriate hosts, there
may be mentioned: bacterial cells, such as B. coli,
strePtomyces~ Salmonella t~~himurium; fungal cells, such as
yeast; insect cells such as Droso~hila and S~odoptera Sf9;
~n;m~l cells such as CHO, COS or Bowes melanoma; adenovirus;
plant cells, etc. The selection of an appropriate host is
deemed to be within the scope of those skilled in the art
~r~m the teachings herein.
More particularly, the present invention also includes
recombinant constructs co~prising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of this
embo~im~nt, the construc~ further comprises regulatory
sequences, including, for example, a promoter, operably
lir~ed to the sequence. Large n-lmh~rs of suitable vectors
and promoters are known to those of skill in the art, and are
co~mercially aV~;lAhle~ The following vectors are provided
by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen),
pbs" pD10, phagescript, psiX174, pbluescript SK, pbsks,
pN~8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO,
pSVZCAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG,
pS~TL (Pharmacia). However, any other plasmid or vector may
CA 02221616 1997-11-19
WO96139441 PCT~S95/07225
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
using CAT (chloramphenicol trans~erase) vectors or other
vectors with selectable markers. Two appropriate vectors are
PKK232-8 and PCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp.
Eukaryotic promoters include CMV imm~t~te early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection o~ the appropriate
vector and promoter is well within the level of ordinary
skill in the art.
In a further embo~;m~nt, the present invention relates
to host cells containing the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
m~tnm~ lian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, D~AB-
Dextran mediated transfection, or electroporation. (Davis,
L., Dibner, M., Battey, I., Basic Methods in Molecular
Biology, (1986)).
The constructs in host cells can be used in a
conventional m~nner to produce the gene product encoded by
the recomh~n~n~ sequence. Alternatively, the polypeptides of
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in m~mmAlian cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sa-m-brook~
et al., Molecular Cloning: A Laboratory ~;tnn~l, Second
-16-
CA 02221616 1997-ll-l9
WO 96/39441 PCT/US95/07225
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure o~
which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of
- the present invention by higher eukaryotes is increased by
inserting an ~nh~ncer sequence into the vector. Rnh~ncer~
~ are cis-acting elements of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
~xamples including the Sv40 ~nh~ncer on the late side o~ the
replication origin bp 100 to 270, a cytomegalovirus early
pr~moter ~nh~ncer, the polyoma ~nh~ncer on the late side of
the replication origin, and adenovirus ~nh~ncers.
Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation o~ the host cell, e.g., the ampicillin
recistance gene of E. coli and S. cerevisiae TRPl gene, and
a promoter derived from a highly-expressed gene to direct
tra~scription of a downstream structural sequence. Such
promoters can be derived from operons encoding glycolytic
enz:y~es such as 3-phosphoglycerate kinase (PGR), ~-~actor,
aci.d pho~phatase, or heat shock proteins, among others. The
heterologous structural sequence is asfiembled in appropriate
phase with translation initiation and termination sequences,
and pre~erably, a leader ~equence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can ~ncoAe a fusion protein including an N-terminal
identification peptide imparting desired charac~eristics,
e.c~., stabilization or simplified purification of expressed
reromh;n~nt product.
Use~ul expression ~ector~ for bacterial use are
constructed by inserting a structural DNA sequence ~nro~;ng
a desired protein together with suitable translation
in:Ltiation and termination signals in operable reading phase
wi~h a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin o~
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, Salmonella t~phimurium and various species
within the genera Pse~l~o~onAs~ Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice.
As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived
from comm~cially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example,
pKK223-3 ~Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are co~h~ne~ with an appropriate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and
growth of the host strain to an appropriate -ell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the re~ulting
crude extract retained for further purification.
Microbial cells employed in expression of proteins can
be disrupted by any con~enient method, including freeze-thaw
cycling, sonication, mechanical di~ruption, or use of cell
lysing agents, such methods are well ~now to those skilled in
the art.
Various ~mm~lian cell culture systems can also be
employed to express recombinant protein. Examples of
m~ lian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines capable of expressing a
-18-
CA 02221616 1997-ll-lg
WO96/39441 PCT~S95/07225
compatible vector, for example, the C127, 3T3, CHO, HeLa and
BH~ cell lines. ~mm~lian expression ~ectors will comprise
an origin of replication, a suitable promoter and ~nh~ncer,
- and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination ~ecuences, and 5/ flanking
nontranscribed sequences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
The receptor polypeptides can be recovered and purified
from recomhin~nt cell cultures by methods including ~mmonium
su].fate or ethanol precipi~ation, acid ex~raction, anion or
cat;ion exchange chromatography, phosphocellulo~e
chxomatography, hydrophobic interaction chromatography,
a~inity chromatography, hydroxylapatite chromatography and
lectin chromatography. Protein refolding step~ can be used,
as necessary, in completing configuration of the mature
prc~tein. Finally, high performance liquid chromatography
(HPLC) can be employed for final puri~ication steps.
The polypeptides of the present invention may be a
nat:urally purified product, or a product of chemical
synthetic procedures, or produced by recomh;n~nt techniques
~rom a prokaryotic or eukaryotic host (~or example, by
bacterial, yeast, higher plant, insect and m~ l ian cells in
culture). Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present
in~ention may be glycosylated or may be non-glycosylated.
Polypeptides of the i~ven~ion may also include an initial
me~hionine amino acid residue.
The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials
for discovery of treatments and diagnostics to human disease.
The receptor of the present invention may be employed in
a process for screening ~or compounds which bind to and
activate (agonists) or bind to and ~nh;h~ t activation
--lg -
CA 0222l6l6 lgg7-ll-l9
WO96/39441 PCT~S95/07225
(antagonists) of the receptor polypeptide of the present
invention.
In yeneral, such screening procedures involve providing
appropriate cells which express the receptor on the surface
thereof. In particular, a polynucleotide encoding the
receptor of the present invention is employed to transfect
cells to thereby express the receptor. Such transfection may
be accomplished by procedures as hereinabove described.
One such screening procedure involves the use of the
m~1~nophores which are transfected to express the receptor of
the present invention. Such a screening technique is
described in PCT WO 92/01810 published February 6, 1992.
Thus, for example, such assay may be employed for
screening for a receptor antagonist by contacting the
m~l ~nophore cells which encode the receptor with both the
receptor ligand and a compound to be screened. Inhibition of
the signal generated by the ligand indicates that a compound
is a potential antagonist for the receptor, i.e., inhibits
activation of the receptor.
The screen may be employed for determining an agonist by
contacting such cells with compounds to be screened and
determ;n~ng whether such compound generates a signal, i.e.,
activates the receptor.
Other screening technigues include the use of cells
which express the receptor (for example, transfected CHO
cells) in a system which measures extracellular pH changes
caused by receptor activation, for example, as described in
Science, volume 246, pages 181-296 (~ctober 1989). For
example, potential agonists or antagonists may be contacted
with a cell which expresses the receptor and a second
messenger response, e.g. signal transduction or pH changes,
may be measured to determine whether the potential agonist or
antagonist is effective.
Another such screening technigue involves introducing
RNA PnCo~;ng the receptor into xenopus oocytes to transiently
-20-
CA 02221616 1997-11-19
WO96/39441 PCT~S95/07225
e~ress the receptor. The receptor oocytes may then be
contacted in the case of antagonist screening with the
receptor ligand and a compound to be screened, followed by
detection of inhibition of a calcium signal.
Another screening technique involves expressing the
~ receptor in which the receptor is linked to a phospholipase
C or D. As representative examples of such cells, there may
be mentioned endothelial cells, smooth muscle cells,
embryonic kidney cells, etc. The screening for an antagonist
or agonist may be accomplished as here~n~hove described by
detecting activation of the receptor or inhibition of
activation o~ the receptor from the phospholipase second
signal.
Another method involves screening for compounds which
inhibit activation of the receptor polypeptide of the present
invention by determining ;nhth;tion of htn~tng of labeled
ligand to cells which have the receptor on the surface
thereof. Such a method involves transfecting a eukaryotic
cell with DNA ~ncoAtng the receptor such that the cell
expresses the receptor on its surface and contacting the cell
with a potential antagonist in the presence of a labeled form
of a known ligand. The ligand can be labeled, e.g., by
radioactivity. The a~ount of labeled ligand bound to the
receptor~ is measured, e.g., by measuring radioactivity of
the receptors. If the potential antagonist binds to the
receptor as determined by a reduction of labeled ligand which
binds to the receptors, the binding of labeled ligand to the
receptor is inhibited.
In general, antagonists for G-protein coupled receptors
which are determined by screening procedures may be employed
for a variety of therapeutic purposes. For example, such
antagonists have been employed for treatment of hypertension,
angina pectoris, myocardial infarction, ulcers, asthma,
allergies, psychoses, depression, migraine, vomiting, stroke,
CA 0222l6l6 lgg7-ll-l9
W096/39441 PCT~S95/07225
eating disorders, migraine headaches, cancer and benign
prostatic hypertrophy.
Agonists for G-protein coupled receptors are also useful
for therapeutic purposes, such as the treatment of asthma,
Parkinson's disease, acute heart failure, hypotension,
urinary retention, and osteoporosis.
Examples o~ G-protein coupled receptor antagonists
include an antibody, or in some cases an oligonucleotide,
which binds to the G-protein coupled receptor but does not
elicit a second messenger response such that the activity of
the G-protein coupled receptor is prevented. Antibodies
include anti-idiotypic antibodies which recognize unique
determinants generally associated with the antigen-binding
site of an antibody. Potential antagonists also include
proteins which are closely related to the ligand of the G-
protein coupled receptor, i.e. a fr~gmPnt of the ligand,
which have lost biological function and when hinAing to the
G-protein coupled receptor, elicit no response.
A potential antagonist also includes an antisense
construct prepared through the use of antisense technology.
Antisense technology can be used to control gene expression
through triple-helix formation or antisense DNA or RNA, both
of which methods are based on hinA;ng of a polynucleotide to
DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complPm~nt~y to a region of the gene involved in
transcription (triple helix -see Lee et al., Nucl. Acids
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby
preventing transcription and the production of G-protein
coupled receptor. The antisense RNA oligonucleotide
hybridizes to the mRNA in vi~o and blocks translation of the
-22-
CA 02221616 1997-11-19
WO 9~/39441 PCT/US95/07225
mRNA molecule into the G-protein coupled receptor (antisense
- O~ano, ~. Neurochem., 56:560 (1991); Oligodeoxynucleotides
as Antisense Tnh; hl tors of Gene ~xpression, CRC Press, Boca
Raton, FL (1988)). The oligonucleotides described above can
also be delivered to cells ~uch that the antisense RNA or DNA
may be expressed in vivo to inhibit production of G-protein
coupled receptor.
Another potential antagonist is a small molecule which
binds ~o the G-protein coupled receptor, making it
inaccessible to ligands such that normal biological activity
is prevented. Bxamples o~ small molecules include but are
not limited to small peptides or peptide-like molecules.
Potential antagonists also include a soluble form of a
G-protein coupled receptor, e.g. a fragment of the receptor,
which binds to the ligand and prevents the ligand from
interacting with ...e..~Lane bound G-protein coupled receptor~.
The G-protein coupled receptor and antagonists or
agonists may be employed in comh;n~tion with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the polypeptide, and a
pharmaceutically acceptable carrier or excipient. Such a
carrier includes but i8 not limited to ~l;nP, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
~; n; ~tration.
The invention also provides a pharmaceutical pack or kit
comprising one or more cont~;ners filled with one or more of
the ingredient~ of the pharmaceutical composition~ of the
in~ention. Associated with such contAiner(s) carl be a notice
in the form prescribed by a govern~~nt~l agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects approval by the agency o~
m~lufacture, use or sale for human ~m; n;stration. In
addition, the pharmaceutical compositions may be employed in
conjunction with other therapeutic compound~.
CA 02221616 1997-11-19
WO96139441 PCT~S95/072Z5
The pharmaceutical compositions may be ~mi nl stered in
a convenient m~nn~r such as by the topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
A~m; n~ stered in an amount which is ef~ective for treating
and/or prophylaxis of the specific indication. In general,
the pharmaceutical compositions will be ~m; n; stered in an
amount of at least about lO ~g/kg body weight and in most
cases they will be ~mjn; stered in an amount not in excess of
about 8 mg/Kg body weight per day. In most cases, the dosage
is from about lO ~g/kg to about l mg/kg body weight daily,
taking into account the routes of ~m; n; stration, symptoms,
etc.
The G-protein coupled receptor polypeptides and
antagonists or agonists which are polypeptides, may be
employed in accordance with the present invention by
expression of such polypeptides iR vivo, which is often
referred to as "gene therapy."
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use of a
retroviral particle cont~;n;ng RNA encoding a polypeptide of
the present invention.
S;m; 1 ~rly, cells may be engineered in vivo for
expression of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle cont~; n; ng RNA
encoding the polypeptide of the present invention may be
~m; n; stered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
methods ~or ~m; n; stering a polypeptide of the present
invention by such method should be apparent to those skilled
-24-
CA 02221616 1997-ll-l9
WO 96/39441 PCT/US9~/07225
in ~he art ~rom the teachings o~ the present invention. For
exal~ple, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
be used to engineer cells in vivo a~ter combination with a
suitable delivery vehicle.
~ Retroviruses ~rom which the retroviral plasmid vectors
herein~hove mentioned may be derived include, but are not
limited to, Moloney Murine ~eukemia Virus, spleen necro~i~
virus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia
virus, human ;mmnno~eficiene~ viru8, adenovirus,
Myeloproli~erative Sarcoma Virus, and m~ ry tumor virus.
In one embodiment, the retroviral plasmid vector is derived
~rom Moloney Murine Leul~emia Virus.
The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited
to, the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Bictechnic~ues, Vol. 7, No. 9, 980-990 (1989), or any other
promoter (e.g., cellular promoters such as eukaryotic
cellular promoters including, but not limited to, the
hiEtone, pol III, and ~-actin promoters). Other viral
promoter~ which may be employed include, but are not limited
to, ade~ovirus promoters, thymidine kinase (TK) promoters,
ancl B19 parvovirus promoters. The selection o~ a suitable
prc~moter will be apparent to those skilled in the art from
the teachings ront~;nP~ herein.
The nucleic acid secluence encoding the polypeptide of
the present invention is under the control of a suitable
promoter. Suitable promoters which may be employed include,
but: are no~ limited to, adenoviral promoters, such as the
adenoviral major late promoter; or hetorologou~ promoters,
such as the cytomegalo~irus (CMV) promoter; the respiratory
syncytial virus (RSV) promoter; ~n~r~hle promoters, such as
the ~MT promoter, the metallothionein promoter; heat ~hock
-25-
CA 0222l6l6 lgg7-ll-l9
096/39441 PCT~S9S/07225
promoters; the albumin promoter; the ApoAI promoter; human
globin promoters; viral thymidine kinase promoters, such a~
the Herpes Simplex thymidine kinase promoter; retroviral LTRs
(including the modified retroviral LT~s her~in~hove
described); the ~-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter
which controls the gene encoding the polypeptide.
The retroviral plasmid vector i8 employed to transduce
packaging cell lines to form producer cell lines. Examples
of packaging cells which may be transfected include, but are
not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X,
VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell
lines as described in Miller, Human Gene Thera~y, Vol. 1,
pgs. 5-14 (1990), which is incorporated herein by reference
in its entirety. The vector may transduce the packaging
cells through any means known in the art. Such means
include, but are not limited to, electroporation, the use of
liposomes, and CaP04 precipitation. In one alternative, the
retroviral plasmid vector may be ~ncArsulated into a
liposome, or coupled to a lipid, and then ~mi n~ stered to a
host.
The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vitro or in vivo. The transduced eukaryotic cells will
expres~ the nucleic acid sequence(s) encoding the
polypeptide. ~ukaryotic cells which may be transduced
include, but are not limited to, embryonic stem cells,
embryonic carr~ n9,m~ cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronrh~ Al epithelial cells.
G-protein coupled receptors are ubiquitous in the
m~mm~lian host and are responsible for many biological
functions, including many pathologies. Accordingly, it is
-26-
CA 02221616 1997-11-19
W096/39441 PCT~S95/07225
desirous to find compounds which stimulate a G-protein
coupled receptor and compounds which antagonize a G-protein
coupled receptor.
This invention further provides a method of identifying
compounds which specifically interact with, and bind to, the
human G-protein coupled receptors on the surface of a cell
which comprises contacting a m~mm~l ian cell comprising an
isolated DNA molecule ~nCo~;ng the G-protein coupled receptor
with a plurality of compounds, determining those which bind
to the m~mm~ lian cell, and thereby identifying compounds
which specifically interact with and bind to a human G-
protein coupled receptor of the present invention.
This invention also provides a method of detecting
expression o~ the G-protein coupled receptor on the sur~ace
of a cell by detecting ~he presence of mRNA coding for a G-
protein coupled receptor which comprises obt~;n-ng total mRNA
from the cell and contacting the mRNA so obtA~ne~ with a
nucleic acid probe compri8ing a nucleic acid molecule of at
least 15 nucleotides capable of specifically hybridizing with
a F,equence included within the sequence of a nucleic acid
molecule ~nro~;ng a human G-protein coupled receptor under
hybridizing conditions, de~ecting the presence of mRNA
hybridized to the probe, and thereby detecting the expression
of the G-protein coupled receptor by the cell.
This invention is also related to the use of the G-
protein coupled receptor gene as part of a diagnostic assay
for detecting diseases or su~ceptibility to diseases related
to the presence of mutated G-protein coupled receptor genes.
Such diseases are related to cell trans~ormation, such as
tumors and cancers.
Indiv~ ~n~l s carrying mutations in the human G-protein
co~1pled receptor gene may be detected at the DNA level by a
variety of techniques. Nucleic acids for diagnosis may be
obt~n~ from a patient' 8 cells, such as from blood, urine,
saliva, tissue biopsy and autopsy material. The genomic DNA
CA 0222l6l6 Isg7-ll-ls
WO96/39441 PCT~S95/07225
may be used directly for detection or may be amplified
enzymatically by using PCR (Saiki et al., Nature, 324:163-166
(1986)) prior to analysis. RNA or cDNA may also be used for
the same purpose. As an example, PCR primers complementary
to the nucleic acid encoding the G-protein coupled receptor
protein can be used to identify and analyze G-protein coupled
receptor mutations. For example, deletions and insertions
can be detected by a change in size of the amplified product
in comparison to the normal genotype. Point mutations can be
identified by hybridizing amplified DNA to radiolabeled G-
protein coupled receptor RNA or alternatively, radiolabeled
G-protein coupled receptor antisense DNA sequences.
Perfectly matched sequences can be distinguished from
mismatched duplexes by RWase A digestion or by differences in
melting temperatures.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresi~. DNA
fra~n~s of different sequences may be distinguished on
denaturing formamide gradient gels in which the mobilities of
different DNA fragments are retarded in the gel at different
positions according to their specific melting or partial
melting temperatures (see, e.g., Myers et al ., Science,
230:1242 (1985)).
Sequence changes at specific locations may also be
revealed by nuclease protection assays, such as RNase and Sl
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of
restriction enzymes, (e.g., Restriction Fragment Length
Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
-28-
CA 02221616 1997-11-19
WO 96t39441 PCT/US95/0i225
In addition to more conventional gel-electrophoresis and
DNA se~uencing, mutations can al80 be detected by in si tu
analysis.
~ The present invention also relates to a diagnostic assay
for detecting altered levels of ~oluble ~orms of the receptor
po]ypep~ides of the present invention in various tissues.
Assays used to detect levels of the soluhle receptor
polypeptides in a sample derived from a host are well known
to those of skill in the art and include radioimmnnoassays,
co~petitive-h; n~ ng assays, Western blot analysis and
preferably as ELISA assay.
An ELISA assay initially comprises preparing an antibody
specific to antigens of the G-protein coupled receptor
polypeptides, pre~erably a mono~'onal antibody. In addition
a reporter antibody is prepared against the monoclonal
antibody. To the reporter antibody is attached a detectable
reagent such as radioa.ctivity, fluorescence or in this
example a horseradish peroxidase enzyme. A sample is now
removed from a host and incuhated on a solid support, e.g. a
pol~ el.e dish, that binds the proteins in the sample. Any
free protein b1 n~; n~ sites on the dish are then covered by
;ncllh~ting with a non-speci~ic protein such as bovine serum
m~ n . Next, the monoclonal ~nt; ho~y iS incubated in the
di,sh during which time the monoclonal antibodies attach to
any G-protein coupled receptor proteins attached to the
polystyrene dish. All nnhound monoclonal antibody is washed
out with buffer. The reporter ~nt;ho~y linked to horseradish
peroxidase is now placed in the dish resulting in h;nd;ng of
the reporter antibody to a~y monoclonal antibody bound to G-
protein receptor proteins. Unatt~rhe~ reporter ~nt; ho~y is
then washed out. Peroxidase su-hstrates are then added to the
dish and the amount of color developed in a given time period
is a measurement of the amount of G-protein coupled receptor
proteins present in a gi~en volume of patient sample when
c~..,~ared against a st~n~rd curve.
-29-
CA 02221616 1997-ll-l9
WO96/39441 pcT~s9s/o722s
The present invention also provides a method for
determining whether a ligand not known to be capable o~
binding to a receptor can bind to such receptor which
comprises contacting a m~mm~l ian cell which expresses a
recepto~ with the ligand under conditions permitting binding
of ligands to the receptor, detecting the presence of a
ligand which binds to the receptor and thereby determining
whether the ligand binds to the receptor. The systems
herein~hove described for deter~i ni ng agonists and/or
antagonists may also be employed for deter~i n; ng ligands
which bind to the receptor.
This invention also provides a method of detecting
expression of a receptor polypeptide of the present invention
on the surface of a cell by detecting the presence of mRNA
coding for the receptor which comprises obt~ining total mRNA
from the cell and contacting the mRNA ~o obt~i n~ with a
nucleic acid probe comprising a nucleic acid molecule of at
least 10 nucleotides capable of specifically hybridizing with
a sequence included within the sequence of a nucleic acid
molecule encoding the receptor under hybridizing conditions,
detecting the presence of mRNA hybridized to the probe, and
thereby detecting the expression of the receptor by the cell.
The present invention also provides a method for
identifying receptors related to the receptor polypeptides of
the present invention. The~e related receptors may be
identified by homology to an receptor polypeptide of the
present invention, by low stringency cross hybridization, or
by identifying receptor~ that interact with related natural
or synthetic ligands and or elicit similar behaviors after
genetic or pharmacological blockade of the receptor
polypeptides of the present invention.
The sequences of the present invention are al~o valuable
for chromosome identification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
-30-
CA 02221616 1997-11-19
W096/39441 PCT~S95/07225
need ~or identi~ying particular sites on the chromosome. Few
chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
~ chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with genes associated with
difiease .
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA.
Co~puter analysis of the cDNA is used to rapidly select
primers that do not sp~n more than one exon in the genomic
DNA, thus complicating the amplification process. These
primers are then used ~or PCR screening of somatic cell
hybrids cont~intng individual human chromosomes. Only those
hybrids cont~in~ng the human gene corresponding to the primer
will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
U~ing the present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels of
fragments from specific chromosomes or pools of large genomic
clones in an analogous ~nne~. Other mapping strategies that
can ~imilarly be used ~o map to its chromosome include in
sit:u hybridization, prescreening with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
clo~e to a met~ph~e chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., Human
Chromosomes: a ~nll~ 1 of Basic Techniques, PeL~dlllO~l Press,
New York (1988).
Once a sequence ha~ been mapped to a preci~e chromosomal
location, the physical position of the sequence on the
CA 02221616 1997-11-19
096/39441 PCT~S95/07225
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusick, Mendelian
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
of between 50 and 500 potential causative genes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expres~ing them can be used as
an ;mmllnogen to produce antibodies thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chim~ric~ single chain,
and h~ n;zed antibodies, as well as Fab fragments, or the
product of an Fab expression library. Various procedures
known in the art may be used for the production of such
ant; ho~; es and fragments.
~ nt; ho~; es generated against the polypeptides
COrre8pQn~; ng to a sequence of the present invention can be
obtained by direct injection of the polypeptides into an
~n;m~l or by ~ n~ ~tering the polypeptides to an ~n;m~l,
preferably a nonhllm~n The antibody 80 obtained will then
bind the polypeptides itself. In this m~nn~r, even a
sequence encoding only a fragment of the polypeptides can be
CA 02221616 1997-11-19
WO 96~39441 PCT/US95/07225
used to generate antibodies ~nAtn~ the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line
cultures can be used. ~xamples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
~Kozbor et al., 1983, T~llnology Today 4:72), and the EBV-
hybridoma technique to produce human monoclonal ~nt~hodies
(Cole, et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
ant:ibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to im~l~nogenic polypeptide products
o~ this invention. Also, transgenic mice may be used to
express hl~mAnized antibodies to ;m~llnogenic polypeptide
products of this invention.
The present invention will be further described with
reiEerence to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate underst~n~; n~ of the following
examples certain frequently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or $ollowed by capital letters and/or nllmh~rs~ The
starting plasmids herein are either co~~rcially available,
publicly aV~ hl e on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addi~ion, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
--33 -
-
CA 02221616 1997-11-19
WO96/39441 PCT~S95/07225
"Digestion" of DNA re~ers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are commercially available and their reaction
conditions, co~actors and other requirements were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically l ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~l
of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 units of enzyme in a larger
volume. Appropriate buffers and substrate amounts for
particular restriction enzymes are specified by the
manufacturer. Incubation times of about l hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier's instructions. A~ter digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation of the cleaved fragments is performed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" re~ers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without AAA~ng a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
"Ligation" refers to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using known
buf~ers and conditions with lO units to T4 DNA ligase
CA 02221616 1997-11-19
WO 96/39441 PCT/US9~,J~ 25
("ligase") per 0.5 ~g of approximately equimolar amounts o~
the DNA fra~nents to be ligated.
Unless otherwise stated, trans~ormation was perfonmed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
Exam~le 1
Bacterial Ex~ression and Purification of G-protein Coupled
Rece~tor
The DNA sequence encoding the receptor, ATCC # _ is
initially amplified using PCR oligonucleotide primers
corresponding to the S~ and sequences of the processed
receptor pro~ein (minus the ~ignal peptide sequence) and the
vec:tor sequences 3' to ~he receptor gene. Additional
nucleotides correspon~i n~ to receptor were added to the ~'
and 3~ sequences respectively. The 5~ oligonucleotide primer
ha~ the sequence 5'-CGGAA~ ~ATGAACTCCACCTTGGAT contains
a Eco RI restriction enzyme site followed by 18 nucleotides
of receptor coding sequence starting from the presumed
te~inal amino acid of the processed protein codon. The 3'
sequence 5'-CGGAAGGTTCGTCAGATATGACATCCATT contains
co~plementary sequences to HindIII site and is followed by 18
nucleotides of receptor. The restriction enzyme sites
correspond to the restriction enzyme sites on the bacterial
expression vector pQ~-9. ~Qiagen, Inc. 9259 Eton Avenue,
Chatsworth, CA, 91311). pQE-9 encodes antibiotic resistance
(~npr), a bacterial origin of replication (ori), an IPT&-
regulatable ~-~...oLer operator (P/0), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. pQ~-9 was
then digested with Eco RI and HindIII. The amplified
sequences were ligated into pQE-9 and were inserted in frame
with the ~equence encoding for the histidine tag and the
RB'3. The ligation mixture was then used to transform E. coli
strain available from Qiagen under the trA~mArk M15/rep 4 by
the procedure de cribed in Sambrook, J. et al., Molecular
-35-
CA 0222l6l6 lgg7-ll-l9
096/39441 PCT~S95/07225
Cloning: A Laboratory Manual, Cold Spring Laboratory Press,
(1989). M15/rep4 contains multiple copies of the plasmid
pRBP4, which expresses the la~I repressor and also confers
kanamycin resistance (Kanr). Trans~ormants are identi~ied by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies were selected. Plasmid DNA was isolated
and confirmed by restriction analysis.
Clones cont~ nt ng the desired constructs were grown
overnight (0/N) in li~uid culture in LB media supplemented
with both Amp (100 ug/ml) and Kan (25 ug/ml). The 0/N
culture is used to inoculate a large culture at a ratio of
1:100 to 1:250. The cells were grown to an optical density
600 (O.D.~) of between 0.4 and 0.6. IPTG (nIsopropyl-B-D-
thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/0 leA~;ng to increased gene
expression. Cells were grown an extra 3 to 4 hours. Cells
were then harvested by centrifugation. The cell pellet was
solubilized in the chaotropic agent 6 Molar Guanidine HCl.
After clarification, solubilized receptor was purified from
this solution by chromatography on a Nickel-Chelate column
under conditions that allow for tight h; n~; ng by proteins
~ontA;ntng the 6-His tag. Hochuli, ~. et al., J.
Chromatography 411:177-184 (1984). The receptor protein was
eluted from the column in 6 molar guanidine HCl pH 5.0 and
for the purpose of renaturation adjusted to 3 molar guanidine
HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced)
and 2 mmolar glutathione (oxidized). After incubation in
this solution for 12 hours the protein was dialyzed to 10
mmolar sodium phosphate.
Exam~le 2
Bx~ression of Recomhinant Receptor in COS cells
The expression of plasmid, G-protein coupled receptor HA
is derived from a vector pcDNAI/Amp (Invitrogen) contAtntng
CA 02221616 1997-11-19
WO96t39441 PCT~S95/07225
1) Sv40 origin of replication, 2) ampicillin resistance gene,
3) E.coli replication origin, 4) CMV promoter followed by a
polylinker region, a SV40 intron and polyadenylation site.
~ A DNA fragment encoding the entire receptor precursor and a
HA tag fused in frame to its 3' end was cloned into the
polylinker region of the vector, therefore, the recombinant
protein expression is directed under the CMV promoter. The
HA tag correspond to an epitope derived from the influenza
hem~gglutinin protein as previously described (I. Wilson, H.
Nim~n, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
198g, Cell 37, 767). The infusion of HA tag to our target
protein allows easy detection of the recomhin~nt protein with
an antibody that recognizes the ~A epitope.
The plasmid construction strategy is described as
follows:
The DNA se~uence encoding for the receptor, ATCC #
was constructed by PCR on the original EST cloned using two
p r i m e r s : t h e 5 ' p r i m e r ( 5 ' -
GTCCAAGCTTGCCACCATGAACTCCA~ w AT-3~) - (SEQ ID NO:5)
contains a HindIII site followed by 18 nucleotides of
receptor coding sequence starting from the initiation codoni
t h e 3 ' 8 e q u e n c e
5~-CTAGCTCGAGTCAAGCGTA~l~-l~A~L~lAl~ w lAGCAGATATGACATCCA
TTA~AG-3' (SEQ ID NO:6) cont~n~ complPmPnt~ry sequences to
Xho I site, translatio~ stop codon, HA tag and the last 18
nucleotides of the receptor coding sequence (not including
the stop codon). Therefore, the PCR product cont~nc a
HindIII site, receptor co~ng sequence followed by HA tag
~u~ed in ~rame, a translation termination stop codon next to
the HA tag, and an Xho I site. The PCR amplified DNA
fragment and the ~ector, pcDNAI/Amp, were digested with
HindIII and Xho I restriction enzyme and ligated. The
ligation mixture wa~ tran~formed into E. coli strain SURE
(a~ailable from Stratagene Cloning Systems, 11099 North
Torrey Pines Road, La Jolla, CA 92037) the trans~ormed
-37-
CA 02221616 1997-11-19
WO96/39441 PCT~S95/07225
culture was plated on ampicillin media plates and resistant
colonies were selected. Plasmid DNA was isolated from
transformants and e~mined by restriction analysis for the
presence of the correct fragment. For expression of the
recombinant receptor, COS cells were transfected with the
expression vector by D~AE-D~XTRAN method. (J. Sambrook, E.
Fritsch, T. Maniatis, Molecular Cloning: A Laboratory M~n~
Cold Spring Laboratory Press, (1989)). The expression of the
receptor HA protein was detected by radiolabelling and
;~m-lnQprecipitation method. (~. Harlow, D. Lane, Antibodies:
Laboratory ~nll~l, Cold Spring Harbor Laboratory Press,
(1988)). Cells were labelled for 8 hours with 35S-cysteine
two days post transfection. Culture media were then
collected and cells were ly~ed with detergent (RIPA buffer
(150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both
cell lysate and culture media were precipitated with a HA
specific monoclonal antibody. Proteins precipitated were
analyzed on 15% SDS-PAG~ gels.
E~am~le 3
Cloninq and expression of G-protein Coupled receptor usinq
the baculovirus ex~ression svstem
The DNA sequence ~nCo~ing the full length receptor
protein, ATCC # , was amplified using PCR
oligonucleotide primers corresponding to the 5~ and 3'
se~l~nceC of the gene:
~ he 5' primer has the sequence 5'-
CG&GAl~C~ ~ATGAACTCCAC~ AT (SEQ ID NO:7) and cont~in~ a
Bam HI restriction enzyme site ~in bold) followed by 4
nucleotides resembling an efficient signal for the initiation
of translation in eukaryotic cells (J. Mol. Biol. 1987, 196,
947-950, Xozak, M.), and just behind the first 18 nucleotides
of the receptor gene (the initiation codon for translation
"ATG" is underlined).
-38-
-
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
The 3~ primer has the sequence 5'-
CGG~TCCCGCTCAGATATGAGATCCATT-3' (SEQ ID NO:8) and contains
the cleavage site for the restriction en~o~llclease Bam HI and
18 nucleotides complementary to the 3I non-translated
se~lence o~ the receptor gene. The ampli~ied sequences were
isolated from a 1~ agarose gel using a commercially available
kit ("Geneclean," BI0 101 Inc., La Jolla, Ca.). The fragment
was then dige~ed with the ~n~o~-lcleases Bam HI and then
purified as described in Example 1. This fragment is
deslgnated F2.
The vector pRG1 (modi~ication o~ pVL941 vector,
discussed below) is used for the expression of the receptor
pro~ein using the baculovirus expression system (for review
see: Summers, M.D. and Smith, G.E. 1987, A m~nll~l o~ method~
for baculovirus vectors and insect cell culture procedures,
Texas Agricultural Experimental Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
virus (AcMNPV) followed by the recognition sites for the
resl_riction Pn~sn~lcleases Bam HI. The polyadenylation site
of the simian virus (SV)40 is used for efficient
polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene ~rom ~.coli is inserted
in ~he same orientation as the polyhedrin promoter followed
by the polyadenylation signal of the polyhedrin gene. The
pol~lledrin seguences are ~lanked at both sides by viral
seq~ences for the cell-media~ed homologous recombination of
co-transfected wild-type viral DNA. Many other baculovirus
vectors could be used in place of pRG1 such as pAc373, pVL941
and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology, 170:31-
39).
The plasmid was digested with the restriction enzyme Bam
HI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was then
-39-
CA 0222l6l6 Isg7-ll-ls
096/39441 pcT~s9s/o7225
isolated from a 1~ agarose gel as described in ~xample 1.
This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were
ligated with T4 DNA ligase. E.coli B 101 cells were then
transformed and bacteria identified that contA; n~ the
plasmid (pBac receptor) with the receptor gene using the
enzymes Bam HI. The sequence of the cloned fragment was
confirmed by DNA sequencing.
5 ~g of the plasmid pBac receptor were co-transfected
with 1.0 ~g of a c~m~ercially available linearized
baculovirus ("BaculoGold~ baculovirus DNA", Pharmingen, San
Diego, CA.) using the lipofection method (Felgner et al.
Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid
pBac receptor were mixed in a sterile well of a microtiter
plate contA;n;ng 50 ~l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l
Lipofectin plus 90 ~l Grace~s medium were added, mixed and
incubated for 15 minutes at room temperature. Then the
transfection mixture was added drop wise to the Sf9 insect
cells (ATCC CRL 1711) ~eeded in a 35 mm tissue culture plate
with 1 ml Grace' medium without serum. The plate was rocked
back and ~orth to mix the newly added solution. The plate
was then incubated for 5 hours at 27~C. After 5 hours the
transfection solution was removed from the plate and 1 ml of
Grace' 8 insect medium supplemented with 10% fetal calf serum
was added. The plate was put back into an incubator and
cultivation continued at 27~C for four days.
A~ter ~our days the supernatant was collected and a
plaque assay performed s;m;lA~ as described by Summers and
Smith (supra). As a modification an agarose gel with nBlue
Gal" (Life Technologies Inc., Gaithersburg) was used which
allows an easy isolation o~ blue s~A; n~ plaques. (A
detailed description of a "plaque assay" can al80 be found in
the user's guide for insect cell culture and baculovirology
-40-
-
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution of the viruses was
~ added to the cells, blue stained plaques were picked with the
tip of an Eppendorf pipette. The agar cont~ ni ng the
recombinant viruses was then resuspended in an Eppendorf tube
cont~;n~ng 200 ~1 o~ Grace~s medium. The agar was removed by
a brie~ centri~ugation and the supernatant cQnta;n~ng the
recombinant baculoviru~es was used to infect Sf9 cells seeded
in 35 mm dishes. Four days later the supernatants o~ these
culture dishes were har~ested and then stored at 4~C.
Sf9 cells were grown in Gracels medium supplemented with
10~ heat-inacti~ated FBS. The cells were infected with the
recombinant baculovirus V-receptor at a multiplicity of
infection (MOI) of 2. Six hours later the medium was removed
and replaced with SF900 II medium minus methionine and
cysteine (Li~e Technologies Inc., Gaither~burg). 42 hours
later 5 ~Ci of 3~S-methionine and 5 ~Ci 35S cysteine (Amersham)
were added. The cells were further ~nc~hAted for 16 hours
be~ore they were har~ested by centri~ugation and the labelled
proteins ~isualized by SDS-PAGE and autoradiography.
~xam~le 4
~xDression pattern o~ G-~rotein Cou~led rece~tor in human
tissue
Northern blot analysis was carried out to ~Y~m;ne the
levels of expression of receptor in human tissues. Total
cellular RNA samples were isolated with RNAzol~ B system
(Biotecx Laboratories, Inc. 6023 South Loop ~ast, Houston, TX
77033). About 10~g o~ total RNA isolated from each human
tissue speci~ied was separated on 1% agarose gel and blotted
onto a nylon ~ilter. (Sa..~ ook, Fritsch, and Maniatis,
Molecular Cloning, Cold Spring Harbor Pre~s, (1989)). The
labeling reaction was done according to the Stratagene Prime-
It kit with 50ng DNA ~ragment. The labeled DNA was purified
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603
Arapahoe Road, Boulder, CO 80303). The filter was then
hybridized with radioactive labeled $ull length receptor gene
at 1,000,000 cpm/ml in 0.5 M NaPO4, pH 7.4 and 7% SDS
overnight at 65 C. After wash twice at room temperature and
twice at 60 C with 0.5 x SSC, 0.1% SDS, the filter was then
expo~ed at -70 C overnight with an intensifying screen. The
message RNA for the receptor is abundant in skeletal muscle.
Example 5
~xDression via Gene Therapy
Fibroblasts are obt~nP~ from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and
separated into small pieces. Small chunks of the tissue are
placed on a wet surface of a tissue culture flask,
approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room
temperature over night. After 24 hours at room temperature,
the flask is inverted and the chunks of tissue remain fixed
to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added.
Thi~ is then incubated at 37~C for approximately one week.
At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in
culture, a monolayer of fibroblasts emerge. The monolayer is
trypsinized and scaled into larger fla~ks.
pMV-7 (Rirschmeier, P.T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with calf intestinal phosphatase. The
1 ;n~r vector is fractionated on agarose gel and purified,
using glass beads.
The cDNA encoding a polypeptide of the present invention
is amplified u~ing PCR primer~ which correspond to the 5' and
-42-
- CA 02221616 1997-11-19
WO 96/39441 PCT/US95/07225
3' end sequences respectively. The 5~ primer contains an
EcoRI site and the 3' primer further includes a HindIII site.
Equal quantities of the Moloney murine sarcoma virus linear
backbone and the amplified EcoRI and HindIII ~ragment are
added together, in the presence of T4 DNA ligase. The
resulting mixture is maintained under conditions appropriate
for ligation of the two fragments. The ligation mixture is
used to transform bacteria HB101, which are then plated onto
agar-cont~;n;ng kanamycin for the purpose of confirming that
the vector had the gene of interest properly in~erted.
The amphotropic pA317 or GP+aml2 packaging cells are
grown in tissue culture to confluent density in Dulbecco's
Modified Eagles Medium (DMEM) with 10% calf serum (CS),
penicillin and streptomycin. The MSV vector cont~ining the
gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
in~ectious viral particles cont~lnin~ the gene (the packaging
ce].ls are now referred to as producer cells).
Fresh media is added to the transduced pro~lc~r cells,
ancl ~ubsequently, the media is harvested from a 10 cm plate
of confluent producer cells. The spent media, cont~in;ng the
infectious viral particles, is filtered through a millipore
fi]ter to remove detached producer cells and this media i8
then used to infect fibroblast cells. Media is removed from
a sub-confluent plate of fibroblasts and quickly replaced
with the media from the producer cells. This media is
removed and replaced with fresh media. If the titer of virus
is high, then virtually all fibroblasts will be infected and
no selection is required. If the titer is very low, then it
is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injected into the
ho;t, either alone or after having been grown to confluence
on cytodex 3 microcarrier beads. The fibroblasts now produce
the protein product.
CA 02221616 1997-11-19
WO 96/39441 PCT/US95/0i225
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the
invention may be practiced otherwise than as particularly
described.
CA 02221616 1997-11-19
WO96/39441 PCT~S95/07Z25
SEQUENCE LISTING
(1) GENERAL INFORMATION:
~i) APPLICANT: Li, Y.
~ (ii) TITLE OF INVENTION: Human G-protein Coupled
Receptor
(iii) NUMBER OF SEQUENCES:
(iv) CO~R~-SPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BEC~ R FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) ~UUN-l-KY: USA
(F) ZIP: 0706~
(v) COM~ul~ READABLE FORM:
(A) M~DIUM TYPE: 3.5 INCH DIS ~ TTE
(B) COM~U-1~K: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D' SOFTWARE: WORD PERFBCT 5.1
(vi) ~U~RNT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Su~mitted Herewith
(C) CLASSIFICATIO~:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBBR: None
(B) FILING DATB: None
-45-
CA 02221616 1997-11-19
WO96/39441 PCT~S95/07225
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCXET NUMBER: 325800-365
(viii) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) lN~-OKMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2764 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~h~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
AATTACAGGT AACATTCTGA AATTGAACTA AACAGTAAAT ~ L~AAA ~ lCAAA 60
GAGGCAAAAT ATTATATTGG AATCAATGAA GAAAGTAAAT TATCTTGGCT AATTTTATTA 120
GTGGTAATTG TAGTGAAAGG ~-~-L-lC~-lAAA TATTATAAGC AAAl-~--l-l-l l~-lCCCCC~l 180
CTCAAATGAA AGGAAATGGG GGTAAATTAA TCTGACTGTG Al-~l-l-l-l~ TTTTAATGCTG 240
ATCTTGAAAG CTTGATGTTG CTGCTGCTCC Tr~T~r~r~TA CAGATCAGTT ~l~l~GG~lG 300
CTATTGAGGG TAGCCGTGAA TAGTGGTGCC AGTAGGGGTG GAGCGGGAGG GATGATGCCA 360
GCCTGAGCTA GCCAGGTTCT TTGATTAGGG CATTGGATGT GAAATGTAAA ATG~-l~-l~-lC 420
~-1-~-~-1~-1-1~-1 ATCAGCTGTT CAaAGaAaAC TCATTACAAC TCCTGCTGAA GCTCCTAATC 480
~l-~.--lCC~-~ ~-lACC ~-l~~-lCCCC~-l ACCCTCACTT GGC~-l~AAGA ~l-l~-lCCCC 540
AGAGTTTACC TTG~-lCCC~-l GGTGCTATGT GTATGGTGAA CCTGGCACTA TGGCCGCGTC 600
TGGGACTGGC r~r~ACTG CTGCTGGCTC TCCTTATTCC A~&AAGGATT TAAPr~G~A 660
TTGCACTGCA GGCAATGCAC CAGAGCAGCA GCATCAGGAG ~-l-l~GGGAGT AAGGCTCCTC 720
TGGCATTATT ACACACATGC AAAGCTGACC GCAATGACAG CAG--LG~-l~C TTTGAACTGT 780
TGGCAGCAGC CAAGCGGCAG CATGAAGTGA CAGATCACTC CTGAGCTCAA G ATG AAC 837
Met Asn
TCC ACC TTG GAT GGT AAT CAG AGC AGC CAC CCT TTT TGC CTC TTG GCA 885
-46-
CA 0222l6l6 l997-ll-l9
W O 96/39441 PCT~US95/07225
Ser Thr Leu Asp Gly Aqn Gln Ser Ser His Pro Phe Cys Leu Leu Ala
TTT GGC TAT TTG GAA ACT GTC AAT TTT TGC CTT TTG GAA GTA TTG ATT 933
Phe Gly Tyr Leu Glu Thr Val Asn Phe Cys Leu Leu Glu Val ~eu Ile
ATT GTC TTT CTA ACT GTA TTG ATT ATT TCT GGC AAC ATC ATT GTG ATT 981
Ile Val Phe Leu Thr Val Leu Ile Ile Ser Gly Asn Ile Ile Val Ile
TTT GTA TTT CAC TGT GCA CCT TTG TTG AAC CAT CAC ACT ACA AGT TAT 1029
Phe Val Phe His Cys Ala Pro ~eu Leu Asn His Hiq Thr Thr Ser Tyr
TTT ATC CAG ACT ATG GCA TAT GCT GAC CTT TTT GTT GGG GTG AGC TGC 1077
Phe Ile Gln Thr Met Ala Tyr Ala ~sp Leu Phe Val Gly Val Ser Cys
GTG GTC CCT TCT TTA TCA CTC CTC CAT CAC CCC CTT CCA GTA GAG GAG 1125
Val Val Pro Ser Leu Ser Leu Leu His His Pro Leu Pro Val Glu Glu
TCC TTG ACT TGC CAG ATA TTT GGT TTT GTA GTA TCA GTT CTG AAG AGC 1173
Ser Leu The Cys Gln Ile Phe Gly Phe Val Val Ser Val Leu Lys Ser
GTC TCC ATG GCT TCT CTG GCC TGT ATC AGC ATT GAT AGA TAC ATT GCC 1221
Val ser Met Ala Ser Leu Ala Cys Ile Ser Ile Asp Arg Tyr Ile Ala
ATT ACT AAA CCT TTA ACC TAT AAT ACT CTG GTT ACA CCC TGG AGA CTA 1269
Ile Thr Lys Pro Leu Thr Tyr Asn Thr Leu Val Thr Pro Trp Arg Leu
CGC CTG TGT ATT TTC CTG ATT TGG CTA TAC TCG ACC CTG GTC TTC CTG 1317
Arg Leu Cys Ile Phe Leu Ile Trp ~eu Tyr Ser Thr Leu Val Phe Leu
CCT TCC TTT TTC CAC TGG GGC AAA CCT GGA TAT CAT GGA GAT GTG TTT 1365
Pro Ser Phe Phe His Trp Gly ~ys Pro Gly Tyr His Gly Asp Val Phe
CAG TGG TGT GCG GAG TCC TGG CAC ACC GAC TCC TAC TTC ACC CTG TTC 1413
Gln Trp Cys Ala Glu Ser Trp Hi8 Thr Asp Ser Tyr Phe Thr Leu Phe
ATC GTG ATG ATG TTA TAT GCC CCA GCA GCC CTT ATT GTC TGC TTC ACC 1461
Ile Val Met Met Leu Tyr Ala Pro Ala Ala Leu Ile Val Cys Phe Thr
TAT TTC AAC ATC TTC CGC ATC TGC CAA CAG CAC ACA AAG GAT ATC ~GC 1509
Tyr Phe Asn Ile Phe Arg Ile Cy8 Gln Gln His Thr Lys Asp Ile Ser
GAA AGG CAA GCC CGC TTC AGC AGC CAG AGT GGG GAG ACT GGG GAA GTG 1557
Glu Arg Gln Ala Arg Phe Ser Ser Gln Ser Gly Glu Thr Gly Glu Val
-47-
CA 0222l6l6 l997-ll-l9
W O 96/39441 PCTrUS95/07225
CAG GCC TGT CCT GAT AAG CGC TAT GCC ATG GTC CTG TTT CGA ATC ACT 1605Gln Ala Cys Pro Asp Lys Arg Tyr Ala Met Val Leu Phe Arg Thr Thr
AGT GTA TTT TAC ATC CTC TGG TTG CCA TAT ATC ATC TAC TTC TTG TTG 1653Ser Val Phe Tyr Ile Leu Trp Leu Pro Tyr Ile Ile Tyr Phe Leu Leu
GAA AGC TCC ACT GGC CAC AGC AAC CGC TTC GCA TCC TTC TTG ACC ACC 1701Glu Ser Ser Thr Gly His Ser Asn Arg Phe Ala Ser Phe Leu Thr Thr
TGG CTT GCT ATT AGT AAC AGT TTC TGC AAC TGT GTA ATT TAT AGT CTC 1749Trp Leu Ala Ile Ser Asn Ser Phe Cys Asn Cys Val Ile Tyr Ser Leu
TCC AAC AGT GTA TTC CAA AGA GGA CTA AAG CGC CTC TCA GGG GCT ATG 1797Ser Asn Ser Val Phe Gln Arg Gly Leu Lys Arg Leu Ser Gly Ala Met
TGT ACT TCT TGT GCA AGT CAG ACT ACA GCC AAC GAC CCT TAC ACA GTT 1845Cy5 Thr Ser Cy~ Ala Ser Gln Thr Thr Ala Asn Asp Pro Tyr Thr Val
AGA AGC AAA GGC CCT CTT AAT GGA TGT CAT ATC TGAAGTGGCT 1888Arg Ser LYB Gly Pro Leu Asn Gly Cys His Ile
CAGTTACGGG ~l-lCCC~L~ ~L~l~L~lG~l ~l'~'~'~'l~'l' ~l~L~L~L~l ATTTTATCTC 1948
TAAGTATTCC TAATTCACTA GGAAATCTGG GACAGAATAC TTTGACTCTA AACAATAGCA 2008
TACAAATTAT TCGTATGGAT AC~-l-l~-lAAG TTTGTAGAAA ~ -LL-lCCC AAGTGCTTGT 2068
GAATTAGAAG ACTCAAGATC ATGAAGACAA ATTGCTCTTG CTCTCAATTT TTGAAATGTC 2128
TTGGAAATGA CTACAGTTCT CAGATTTAAA ATGAATAAAG CCATATCTAA CAC~-l~-l-l-lC 2188
CAGcTGGcAT GACTGAACCT GAGTGTGAAA AGCGTCAGCA TTTTAAAAAG TCATCACTTT 2248
~-l-l~L~ACTT TCTGGGCTCT TTCCAGCTAT TTGGGCGTCA TATGCAATTG AL-l-l~-iu--lA 2308
ACGGAATAGT AAAATATAAA TGAAAAGGTT TTAGAAATTA ~-lL-l-~-lATGT ATGCCAAAGC 2368
ATAACTACAC TGCAAGTTTC AACACT~TCA TTTAGAAAGC CAAATGTTCT ~l~L-l-l-lATT 2428
~-l'~L-~AGAG AATTCTCAGT AGGGTGAATA ATGTGAACAC ATAAACATTA ATTTTAGAAT 2488
TTTACAGTGA ACCATGAAGC AAAAGTGCAA TCAAATTATA CAATTTATGA AAAACTGAGC 2548
TA~-lL-ll-L~l GCCATGCTTC ACAGAGATCT AAAGATATGT ~L~LAGAA GTAATCGTGT 2608
AGTACTTTTG CCCATGCCTT i~L~i-lATGT CTATATTTAG AATATCTGAA TTGTTAGATT 2668
l~L~LlLLAC AGCAAAATGT GCTTAAGCTA AAAAGTAATT CAGGGAATTC GATATCAAGC 2728
TTATCGATAC CGTCGACCTC GAr~GGGGr~GC CCGGTA 2764
-48-
CA 02221616 1997-ll-l9
WO96/39441 PCT~S95/07225
(2) INFORMATION FOR SEQ ID NO:2:
(i) S~QUENCE CHARACT~RISTICS
(A) LENGTH: 349 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(i.i) MOLECULE TYPE: PROTEIN
(xi) SE~u~ DESCRIPTION: SEQ ID NO:2:
Met Asn Ser Thr Leu Asp Gly Asn Gln Ser Ser Hi8 Pro Phe Cys Leu
Leu Ala Phe Gly Tyr Leu Glu Thr Val Asn Phe Cys Leu Leu Glu Val
Leu Ile Ile Val Phe Leu Thr Val Leu Ile Ile Ser Gly Asn Ile Ile
Val Ile Phe Val Phe His Cys Ala Pro Leu Leu Asn Hil3 His Thr Thr
Ser Tyr Phe Ile Gln Thr Met Ala Iyr Ala Asp Leu Phe Val Gly Val
Ser C~ys Val Val Pro Ser Leu Ser Leu Leu HiS HiS Pro Leu Pro Val
Glu Glu Ser Leu The Cys Gln Ile Phe G~y Phe Val Val Ser Val Leu
100 105 110
Lys Ser Val Ser Met Ala Ser Leu Ala Cys Ile Ser Ile Asp Arg Tyr
115 120 125
Ile Ala Ile Thr Ly~ Pro Leu Thr Tyr Asn Thr Leu Val Thr Pro Trp
130 135 140
Arg Leu Arg Leu Cy5 Ile Phe Leu Ile Trp Leu Tyr Ser Thr Leu Val
145 150 155 160
Phe Leu Pro Ser Phe Phe Hi3 Trp Gly Lys Pro Gly Tyr HiS Gly Asp
165 170 175
Val Phe Gln Trp Cys Ala Glu Ser Trp His Thr Asp Ser Tyr Phe Thr
180 185 190
Leu Phe Ile Val Met Met Leu Tyr Ala Pro Ala Ala Leu Ile Val Cys
195 200 205
Phe Thr Tyr Phe Asn Ile Phe Arg Ile Cy9 Gln Gln His Thr Lys Asp
210 215 220
Ile Ser Glu Arg Gln Ala Arg Phe Ser Ser Gln Ser Gly Glu Thr Gly
--49--
CA 0222l6l6 l997-ll-l9
WO 96/39441 PCT/US95/07225
225 230 235 240
Glu Val Gln Ala Cys Pro Asp Lys Arg Tyr Ala Met Val Leu Phe Arg
245 250 255
Thr Thr Ser Val Phe Tyr Ile Leu Trp Leu Pro Tyr I' e Ile Tyr Phe
260 265 270
Leu Leu Glu Ser Ser Thr Gly His Ser Asn Arg Phe Ala Ser Phe Leu
275 280 285
Thr Thr Trp Leu Ala Ile Ser Asn Ser Phe Cys Asn Cys Val Ile Tyr
290 295 300
Ser Leu Ser Asn Ser Val Phe Gln Arg Gly Leu Lys Arg Leu Ser Gly
305 310 315 320
Ala Met Cy5 Thr Ser Cys Ala Ser Gln Thr Thr Ala Asn Asp Pro Tyr
325 330 335
Thr Val Arg Ser Lys Gly Pro Leu Asn Gly Cys His Ile
340 345
(2) INFORMATION FOR SEQ ID NO:3:
(i) SE~u~N~ CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:3:
GCTAAGGATC ~-L~CTC AAGGTT 26
(2) lN~Okl ~TION FOR SEQ ID NO:4:
(i) SEQu~ CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
-50-
CA 0222l6l6 l997-ll-l9
WO 96/39441 PCT/US95/07225
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GCI'A~TCTAG ATC~CATCTT GGGGAA 2 6
.
--51--
